Powered by Deep Web Technologies
Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ESC TN Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

60% 80% 100% US ESC TN OtherNone Propane Electricity Natural Gas MAIN HEATING FUEL USED COOLING EQUIPMENT USED DIVISION: East South Central (ESC) STATES INCLUDED: Alabama,...


US ESC TN Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

ESC TN ESC TN Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ESC TN Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US ESC TN Site Consumption kilowatthours $0 $400 $800 $1,200 $1,600 US ESC TN Expenditures dollars ELECTRICITY ONLY average per household * Tennessee households consume an average of 79 million Btu per year, about 12% less than the U.S. average. * Average electricity consumption for Tennessee households is 33% higher than the national average and among the highest in the nation, but spending for electricity is closer to average due to relatively low electricity prices. * Tennessee homes are typically newer, yet smaller in size, than homes in other parts of the country.


Category:Memphis, TN | Open Energy Information  

Open Energy Info (EERE)

Memphis, TN Memphis, TN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Memphis, TN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Memphis TN City of Memphis Tennessee (Utility Company).png SVFullServiceRestauran... 66 KB SVHospital Memphis TN City of Memphis Tennessee (Utility Company).png SVHospital Memphis TN ... 69 KB SVLargeHotel Memphis TN City of Memphis Tennessee (Utility Company).png SVLargeHotel Memphis T... 67 KB SVLargeOffice Memphis TN City of Memphis Tennessee (Utility Company).png SVLargeOffice Memphis ... 70 KB SVMediumOffice Memphis TN City of Memphis Tennessee (Utility Company).png SVMediumOffice Memphis... 65 KB SVMidriseApartment Memphis TN City of Memphis Tennessee (Utility Company).png


Category:Nashville, TN | Open Energy Information  

Open Energy Info (EERE)

Nashville, TN Nashville, TN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Nashville, TN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Nashville TN City of Memphis Tennessee (Utility Company).png SVFullServiceRestauran... 67 KB SVHospital Nashville TN City of Memphis Tennessee (Utility Company).png SVHospital Nashville T... 71 KB SVLargeHotel Nashville TN City of Memphis Tennessee (Utility Company).png SVLargeHotel Nashville... 68 KB SVLargeOffice Nashville TN City of Memphis Tennessee (Utility Company).png SVLargeOffice Nashvill... 71 KB SVMediumOffice Nashville TN City of Memphis Tennessee (Utility Company).png SVMediumOffice Nashvil... 67 KB SVMidriseApartment Nashville TN City of Memphis Tennessee (Utility Company).png


Murdock Road Knoxville.TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

702 702 Murdock Road Knoxville.TN 37932 Tel: (609) 921-1456 Fax: (609) 92 1-8703 AA\W.nell-one.com March 25,2009 Office of the Assistant General Counsel for Technology Transfer and Intellectual Property U.S. Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Attn: Technology Transfer Questions Subject: Questions Concerning Technology Transfer Practices at DOE Laboratories (Federal RegisterNol. 73, No. 229/ November 26,2008 /Notices) Dear Mr. Gottlieb, Thank you for the opportunity to respond to the questions published in the Federal Register. As Chief Executive Officer of Nell One Therapeutics, a spin-out company which is in the process of licensing technology from Oak Ridge National Laboratory (ORNL), I found the questions to be highly relevant to our experiences. While many great technologies and capabilities reside in the National Laboratories



NLE Websites -- All DOE Office Websites (Extended Search)

2005 Hurricanes on the Natural Gas Industry in the Gulf of Mexico Region Mexico FL GA SC AL MS LA TX AR TN TN Katrina - Cumulative wind > 39 mph Katrina - Cumulative wind > 73 mph...


WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Eugenio Magistretti  

E-Print Network (OSTI)

WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Slots Eugenio Magistretti Rice University of WiFi has deteriorated from over 80% at 1 Mbps to under 10% at 1 Gbps. In this paper, we propose WiFi-Nano, thereby reducing ack overhead. We validate the effectiveness of WiFi-Nano through im- plementation

Mellor-Crummey, John


US ENC WI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC WI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


AOCS Official Method Tn 2a-86  

Science Conference Proceedings (OSTI)

Flash Point of Fatty Quaternary Ammonium Chloride, Closed Cup Method (Modified Closed Cup Method, ASTM Designation D 93-80) AOCS Official Method Tn 2a-86 Methods Downloads Methods Downloads DEFINITION This method


AOCS Official Method Tn 1a-64  

Science Conference Proceedings (OSTI)

Flash and Fire Points, Cleveland Open Cup Method AOCS Official Method Tn 1a-64 Methods Downloads Methods Downloads DEFINITION This method determines the temperature at which the test sample will flash and burn....


Invenergy TN LLC | Open Energy Information  

Open Energy Info (EERE)

Tennessee Sector Wind energy Product Wholly-owned subsidiary of Invenergy Wind developing wind farms in Tenessee. References Invenergy TN LLC1 LinkedIn Connections CrunchBase...


WI Windinvest | Open Energy Information  

Open Energy Info (EERE)

WI Windinvest WI Windinvest Jump to: navigation, search Name WI Windinvest Place Westfalen, Germany Zip 48727 Sector Wind energy Product Westfalen based wind project developer Coordinates 43.992484°, -117.711985° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.992484,"lon":-117.711985,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE - Office of Legacy Management -- Knoxville Iron Co - TN 07  

Office of Legacy Management (LM)

Knoxville Iron Co - TN 07 Knoxville Iron Co - TN 07 FUSRAP Considered Sites Site: KNOXVILLE IRON CO. (TN.07 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Knoxville , Tennessee TN.07-1 Evaluation Year: 1994 TN.07-2 TN.07-3 Site Operations: Melted uranium contaminated scrap metal in order to test industrial hygiene procedures in the mid-1950s. TN.07-1 Site Disposition: Eliminated - AEC license TN.07-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Limited Quantities of Uranium Contained in Slag Material TN.07-4 Radiological Survey(s): Yes - health and safety monitoring during operations only TN.07-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to KNOXVILLE IRON CO.


Evansville WI (WWTP) | Open Energy Information  

Open Energy Info (EERE)

Evansville WI (WWTP) Evansville WI (WWTP) Jump to: navigation, search Name Evansville WI (WWTP) Facility Evansville WI (WWTP) Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Evansville WI (WWTP) Energy Purchaser Evansville WI (WWTP) Location Evansville WI Coordinates 42.77765315°, -89.28004146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.77765315,"lon":-89.28004146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Scheduling in multihop WiMAX networks  

Science Conference Proceedings (OSTI)

IEEE 802.16, popularly known as WiMAX, is at the forefront of the technology drive because of the growing demand for high-speed wireless broadband networks. Multihop WiMAX networks are particularly useful as they increase the coverage area without the ...

Debalina Ghosh; Ashima Gupta; Prasant Mohapatra



AT-TN: Mr. R. L. Rudolph  

Office of Legacy Management (LM)

MAR 1 ? 7982 MAR 1 ? 7982 3echW tiational, Inc. AT-TN: Mr. R. L. Rudolph PO Box 350 Oak Ridge, TFi 37830 Gentlemen: CRITERIA FOR REMEDIAL ACTION AT ACID/PUEBLO AND BAY0 CANYONS; REQUEST FOR COST/BENEFIT ANALYSES OF REMEDIAL ACTION OPTIONS AT THE CANYONS Enclosed are several pieces of cqrespondence related to AcldjPueblo * and Bayo Canyons. . . . . . . . . . . . . . First, EP has concurred with the remedial action DATE criteria for the New Mexico sftes that were proposed to them on August 20, 1987 (wfth the addition of a criterion for Pu-239 added RTG SYMBO, October 20, 7981). In summary, the cri terla will be: . . . . . . . IUITI*LSSIG. f ---- Radionuclfdt Sr-90 cs-137 Th-228 Th-230 Th-232 u-234 U-238 Pu-239 Pu-240 Pu-241 Am-241 Sofl Limft (pCi/g) 100 80



NLE Websites -- All DOE Office Websites (Extended Search)

8 8 SLAC-TN-04-051 Sep. 2004 (Jan. 2005) Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Electron Conditioning of Technical Aluminum Surfaces ¤ F. Le Pimpec, F. King, and R. E. Kirby


Category:Green Bay, WI | Open Energy Information  

Open Energy Info (EERE)

WI WI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Green Bay, WI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVFullServiceRestauran... 79 KB SVQuickServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVQuickServiceRestaura... 79 KB SVHospital Green Bay WI Wisconsin Electric Power Co.png SVHospital Green Bay W... 79 KB SVLargeHotel Green Bay WI Wisconsin Electric Power Co.png SVLargeHotel Green Bay... 78 KB SVLargeOffice Green Bay WI Wisconsin Electric Power Co.png SVLargeOffice Green Ba... 90 KB SVMediumOffice Green Bay WI Wisconsin Electric Power Co.png SVMediumOffice Green B... 78 KB SVMidriseApartment Green Bay WI Wisconsin Electric Power Co.png


What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Oak Ridge TN Warehouse Site...  

Office of Legacy Management (LM)

Warehouses Site. This site is managed by the U.S. Department of Energy Office of Legacy Management. Aerial photograph of the Oak Ridge, Tennessee, Site TN.09-1 - DOE...


MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...


An efficient security framework for mobile WiMAX  

Science Conference Proceedings (OSTI)

WiMAX is a technology that provides continuous high data throughput with low delays for various user types and modes of operation. The security protocols proposed for WiMAX impose a heavy performance overhead, especially on mobile subscribers running ... Keywords: PKMv2, WiMAX, handover, hierarcical identity based cryptography, security

Mete Rodoper; Arati Baliga; Edward Jung; Wade Trappe



DOE - Office of Legacy Management -- Vitro Corp of America - TN 04  

Office of Legacy Management (LM)

TN 04 TN 04 FUSRAP Considered Sites Site: Vitro Corp. of America (TN.04) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Heavy Minerals Company Vitro Chemical Company TN.04-4 TN.04-5 Location: 4000 North Hawthorne Street , Chattanooga , Tennessee TN.04-5 Evaluation Year: 1990 TN.04-1 Site Operations: Processed mineral monazite to produce a thorium-uranium hydroxide and a series of rare earth products. TN.04-4 Site Disposition: Eliminated - Site licensed by AEC and State of Tennessee - No Authority to perform remedial action under FUSRAP TN.04-2 TN.04-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium Metal, ThF4, Thorium Oxide TN.04-1 Radiological Survey(s): None Indicated


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Utilizing WiMAX mesh mode for efficient IPTV transmission  

Science Conference Proceedings (OSTI)

Providing high bit-rates, WiMAX enables IPTV multicasting for several simultaneous broadcasting channels. WiMAX base stations can offer higher capacity to users with better signal quality values, and more robust but lower capacity modulations to users ... Keywords: iptv, mesh mode, multicasting, wimax

Murat Ozyurt; Seckin Ulug; Tuna Tugcu



Detecting transmission power misbehaviour in wi-fi networks  

Science Conference Proceedings (OSTI)

In Wi-Fi networks, transmission (TX) power levels are constrained by regulatory limits. However, the emergence of flexible MAC drivers allows the easy modification of PHY and MAC layer parameters. This has enabled users to attempt to violate these limits. ... Keywords: EIRP, Wi-Fi, detection, misbehaviour, transmission power

Szymon Szott, Marek Sikora, Marek Natkaniec, Krzysztof Loziak



DOE - Office of Legacy Management -- Besley-Wells - Wisconsin - WI 03  

Office of Legacy Management (LM)

Besley-Wells - Wisconsin - WI 03 Besley-Wells - Wisconsin - WI 03 FUSRAP Considered Sites Site: Besley-Wells - Wisconsin (WI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Besley Products Co. WI.03-3 Location: Beloit , Wisconsin WI.03-1 Evaluation Year: 1994 WI.03-1 Site Operations: 1953 proposal for a trial lot of 500 uranium slugs to be machined by Besley double spindle wet grinder in order to compare production rate with that of current process; no indication proposed activities were carried out. WI.03-2 WI.03-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the indication that proposed activities were not carried out WI.03-1 WI.03-3 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None WI.03-3


DOE - Office of Legacy Management -- Allis-Chalmers Co - WI 01  

Office of Legacy Management (LM)

Allis-Chalmers Co - WI 01 Allis-Chalmers Co - WI 01 FUSRAP Considered Sites Site: Allis-Chalmers Co (WI.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Hawley Plant WI.01-1 Location: Milwaukee , Wisconsin WI.01-1 Evaluation Year: 1987 WI.01-1 Site Operations: Manufactured electrical equipment - pumps, motors, and switchgears for K-25 and Y-12. WI.01-1 Site Disposition: Eliminated - Scope of testing activities were limited - Very small amounts of Uranium metal were used for testing - Potential for residual radioactive material on the site considered remote. WI.01-1 WI.01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium Metal WI.01-1 Radiological Survey(s): None Indicated


On the Construction of WiMax Mesh Tree  

E-Print Network (OSTI)

Abstract The IEEE 802.16 protocol, also known as WiMAX, has been designed to support long-range communications with high bitrates, using two operation modes: Point-to-Multi-Point (PMP) and Mesh. In the mesh mode, Subscriber Stations (SSs) can directly communicate with each other, thus forming a tree, and can be used to forward others data packets in a multihop fashion. On the contrary, in the PMP mode only one hop communication toward the Base Station (BS) is allowed. In this paper, we investigate the performance of the mesh mode by proposing an algorithm for constructing the WiMAX mesh tree. Our algorithm increases routes effective throughput by splitting long links into multiple shorter ones. We show through simulations that this approach leads to improving the throughput capacity of WiMAX-based wireless mesh networks. Index Terms WiMAX, wireless mesh networks. I.

Salim Nahle; Luigi Iannone; Benoit Donnet; Naceur Malouch




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS Location: Tribe WI-TRIBE- STOCKBRIDGE- MUNSEE BAND OF MOHICAN INDIANS WI American Recovery and Reinvestment Act: Proposed Action or Project Description The Stockbridge-Munsee Band of Mohican Indians proposes to conduct energy efficient audits of residential and commerical buildings. Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



Office of Legacy Management (LM)

;;;;!r;; c"/ I%- , 2.1 + 2- ;;;;!r;; c"/ I%- , 2.1 + 2- llnited States Government Department of Energy memorandum Fw?fw --&a Gt3 .I\ DATE: Af'R 8 1991 REPLY TO Al-TN OF: EM-421 SUBJECT: Elimination of the Magnus Brass Manufacturing Company from FUSRAP TO: The File The Magnus Brass Manufacturing Company Sites are hereby eliminated from consideration in the Department of Energy's Formerly Utilized Sites Remedial Action Program (FUSRAP). The Department of Energy does not have the authority under the Atomic Energy Act to further investigate the sites, which are located at 533 Reading Road and 1029 West Seventh Street in Cincinnati, Ohio. The lack of authority is more fully explained in the attached Authority Review. The Department of Energy does not have any further information concerning the radiological status of the sites;


Y-12 and East TN Public Broadcasting System ? A Nuclear Family...  

NLE Websites -- All DOE Office Websites (Extended Search)

East TN Public Broadcasting System - A Nuclear Family Video Miniseries The fourth and final episode of A Nuclear Family: Y-12 National Security Complex documentary film miniseries...


DOE - Office of Legacy Management -- Trane Co - WI 0-02  

Office of Legacy Management (LM)

Trane Co - WI 0-02 Trane Co - WI 0-02 FUSRAP Considered Sites Site: TRANE CO. (WI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: LaCross , Wisconsin WI.0-02-1 Evaluation Year: 1987 WI.0-02-1 Site Operations: Produced Aluminum cans for fuel rod experiments at Argonne Met Lab; Supplied construction materials to Oak Ridge. WI.0-02-1 Site Disposition: Eliminated - No radioactive materials used at this site WI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None WI.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TRANE CO. WI.0-02-1 - Memorandum/Checklist; A. Wallo to the File; (Elimination



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...


MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and


A survey of MAC based QoS implementations for WiMAX networks  

Science Conference Proceedings (OSTI)

We present a comprehensive survey of proposed Quality of Service (QoS) mechanisms in the Media Access Control (MAC) sublayer of WiMAX based wireless networks. QoS support in WiMAX is a fundamental design requirement, and is considerably more difficult ... Keywords: MAC, Media Access Control, QoS, Quality of Service, WiMAX, Wireless networks

Y. Ahmet ?ekercio?lu; Milosh Ivanovich; Alper Ye?in



QoS differentiation for IEEE 802.16 WiMAX mesh networking  

Science Conference Proceedings (OSTI)

Recently IEEE 802.16 WiMAX has attracted a lot of attention in wireless networking research and applications. To enable a flexible and cost-effective deployment, mesh networking mode is defined in WiMAX standard. In this paper, we introduce a system ... Keywords: IEEE 802.16, QoS, WiMAX mesh, interference-aware design, scheduling

Yan Zhang; Honglin Hu; Hsiao-Hwa Chen



A joint centralized scheduling and channel assignment scheme in WiMax mesh networks  

Science Conference Proceedings (OSTI)

The IEEE 802.16 standard, also known as Worldwide Interoperability for Microwave Access (WiMax), which provides a mechanism for deploying high-speed wireless mesh networks in metropolitan areas. Thus, Quality of Service (QoS) is very important for WiMax ... Keywords: MDFS algorithm, WiMax mesh networks, centralized scheduling, channel assignment

Yuliang Tang; Yan Yao; Xinrong Lin



DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


Fundamentals of WiMAX: Understanding Broadband Wireless Networking  

Science Conference Proceedings (OSTI)

This is the eBook version of the printed book. Praise for Fundamentals of WiMAX "This book is one of the most comprehensive books I have reviewed ... it is a must-read for engineers and students planning to remain current or who plan to pursue a career ...

Jeffrey Andrews; Arunabha Ghosh; Rias Muhamed



Cell, Vol. 29, 551-559, June 1982, Copyright 0 1982 by MIT Directed Transposon Tn5 Mutagenesis and  

E-Print Network (OSTI)

(nif) was cloned from the genome of the symbiotic nitrogen-fixing species Rhizobium meliloti. A total of 31 Tn5 insertions in the nif region were constructed and assayed for their effect on symbiotic between genomic nif: :TnS insertions and nif: :Tn5 insertions on mo- bilizable cloning vectors

Ausubel, Frederick M.


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



DOE - Office of Legacy Management -- Union Carbide and Carbon Co - TN 10  

Office of Legacy Management (LM)

Carbide and Carbon Co - TN 10 Carbide and Carbon Co - TN 10 FUSRAP Considered Sites Site: Union Carbide and Carbon Co (TN.10) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 5 FUSRAP considered sites for which records are available that provide a reasonably complete historical account of their operations and relationship, if any, with MED/AEC operations. However, additional analyses of these historical records, and more recent documentation of decisions concerning the authority and other considerations related to the elimination of these sites from further consideration under FUSRAP is warranted. These analyses will provide the

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Summary - Mitigation and Remediation of Mercury Contamination at the Y-12 Plant, Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oak Ridge, TN Oak Ridge, TN EM Project: Mitigation/Remediation of Hg ETR Report Date: April 2008 ETR-13 United States Department of Energy Office of Environmental Management (DOE-EM) External Technical Review of the Mitigation and Remediation of Mercury Contamination at the Y-12 Plant, Oak Ridge, TN Why DOE-EM Did This Review From 1953 to 1983, ~240,000 pounds of mercury (Hg) were released to the East Fork Popular Creek during the operation of the Y-12 Plant. In 1963, direct systematic releases of mercury stopped; however, mercury continues to be released into the creek from various sources of contamination in the Y-12 complex. Remediation completed up to 1992 resulted in an overall reduction of Hg loading from 150 g/day in 1983 to 15 g/day in 1992, with a


Summary - Environmental Management Waste Management Facility (EMWMF) at Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oak Ridge, TN Oak Ridge, TN EM Project: EM Waste Management Facility ETR Report Date: February 2008 ETR-11 United States Department of Energy Office of Environmental Management (DOE-EM) External Technical Review of Environmental Management Waste Management Facility (EMWMF) at Oak Ridge, TN Why DOE-EM Did This Review The Environmental Management Waste Management Facility (EMWMF) is a land disposal facility for wastes generated by environmental restoration activities being conducted at the US Department of Energy's (DOE) Oak Ridge Reservation. Low-level radioactive wastes, hazardous wastes (Subtitle C of the Resource Conservation and Recovery Act), and wastes defined by the Toxic Substances Control Act are approved for disposal in the EMWMF. All of the cells are lined with a


DOE - Office of Legacy Management -- W R Grace - Erwin - TN 05  

Office of Legacy Management (LM)

- Erwin - TN 05 - Erwin - TN 05 FUSRAP Considered Sites Site: W R Grace - Erwin (TN.05) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 5 FUSRAP considered sites for which records are available that provide a reasonably complete historical account of their operations and relationship, if any, with MED/AEC operations. However, additional analyses of these historical records, and more recent documentation of decisions concerning the authority and other considerations related to the elimination of these sites from further consideration under FUSRAP is warranted. These analyses will provide the


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



EA-1514: Proposed Conveyance of Parcel ED-6 to the City of Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE))

This Environmental Assessment was prepared for the conveyance of approximately 336 acres of excess property (i.e., property not needed to fulfill DOE current or foreseeable future requirements) known as Parcel ED-6 to the city of Oak Ridge, TN.



E-Print Network (OSTI)


Hughes, Bruce


Blue-Fi: enhancing Wi-Fi performance using bluetooth signals  

Science Conference Proceedings (OSTI)

Mobile devices are increasingly equipped with multiple network interfaces with complementary characteristics. In particular, the Wi-Fi interface has high throughput and transfer power efficiency, but its idle power consumption is prohibitive. In this ... Keywords: bluetooth, context-awareness, energy-efficiency, location, mobile device, wi-fi

Ganesh Ananthanarayanan; Ion Stoica



WiMAX Double Movable Boundary Scheme in the Vehicle to Infrastructure Communication Scenario  

Science Conference Proceedings (OSTI)

WiMAX is an interesting technology that will be applied in vehicular networks due to the provisioning of high mobility, wide coverage, and different classes of service. In this paper, we investigate the problem of vehicular applications mapping in the ... Keywords: Intelligent Transportation System, Quality of service, Scheduling, WiMAX

Rola Naja; Melhem El Helou; Samir Tohm



Beyond deployments and testbeds: experiences with public usage on vehicular WiFi hotspots  

Science Conference Proceedings (OSTI)

We describe our experiences with deploying a vehicular Internet access service on public transit buses. Our system, called WiRover, has been running on these buses since April 2010 for about 18 months till date providing a WiFi hotspot to which bus passengers ... Keywords: network diversity, vehicular connectivity, wireless, wirover

Joshua Hare; Lance Hartung; Suman Banerjee



Wireless wakeups revisited: energy management for voip over wi-fi smartphones  

Science Conference Proceedings (OSTI)

IP based telephony is rapidly gaining acceptance over traditional means of voice communication. Wireless LANs are also becoming ubiquitous due to their inherent ease of deployment and decreasing costs. In enterpriseWi-Fi environments, VoIP is a compelling ... Keywords: VoIP, Wi-Fi, cellular networks, power management, smartphones

Yuvraj Agarwal; Ranveer Chandra; Alec Wolman; Paramvir Bahl; Kevin Chin; Rajesh Gupta



Applications of WiMAX-based wireless mesh network in monitoring wind farms  

Science Conference Proceedings (OSTI)

This paper has studied the feasibility of applying World Interoperability for Microwave Access (WiMAX) based Wireless Mesh Networks (WMNs) in monitoring wind farms. WMNs provide a dynamic topology which meets the requirements of communications ... Keywords: WMNs, WiMAX, World Interoperability for Microwave Access, communications, renewable energy, simulation, wind energy, wind farm monitoring, wind farms, wind power, wireless mesh networks, wireless networks

Gang Zheng; Hongbing Xu; Xinheng Wang; Jianxiao Zou



Citywide mobile internet access using dense urban WiFi coverage  

Science Conference Proceedings (OSTI)

We investigate if it is feasible to use the WiFi coverage in urban areas for mobile Internet access and which type of applications can benefit from the Internet access provided by the already deployed WiFi Access Points (APs). Nowadays, most smartphones ... Keywords: mobile clients, mobile internet access, wifi, wireless networks

Maria Eugenia Berezin; Franck Rousseau; Andrzej Duda



Fast-converging scheduling and routing algorithms for WiMAX mesh networks  

Science Conference Proceedings (OSTI)

In this paper, we present fast converging algorithms that fit well WiMAX mesh networks. First, a centralized scheduling algorithm is presented. It calculates schedules by transforming the multi-hop tree into a single hop, and then repartitioning the ... Keywords: WiMAX, mesh networks, routing, scheduling

Salim Nahle; Naceur Malouch



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


A-GPS Assisted Wi-Fi Access Point Discovery on Mobile Devices for Energy Saving  

E-Print Network (OSTI)

Mobile devices have been shipped with multiple wireless network interfaces in order to meet their diverse communication and networking demands. In this paper, we propose an A-GPS assisted scheme that discovers the nearest Wi-Fi network access points (APs) by using user's location information. This allows the user to switch to the Wi-Fi interface in an intelligent manner when she/he arrives at the nearest Wi-Fi network AP. Therefore, it avoids the long periods in idle state and greatly reduces the number of unnecessary Wi-Fi scans on the mobile device. The experimental results demonstrate that our scheme effectively saves energy for mobile devices integrated with Wi-Fi and cellular interfaces.

Xia, Feng; Ding, Fangwei; Hao, Ruonan



Energy Management for the "WiFi of Things"  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Management for the "WiFi of Things" Energy Management for the "WiFi of Things" Speaker(s): Janet Peterson Date: May 6, 2010 - 12:00pm Location: 90-3122 This seminar will present an overview of the WiFi enabled energy management technologies pioneered by Our Home Spaces. Our Home Spaces provides consumer facing energy management solutions. These energy management solutions are based on using the existing consumer infrastructure and devices - this allows a lower cost of entry for both the utilities and less complexity in the home. Working with low cost low power WiFi chips from GainSpan and Marvell allow WiFi solutions to range from communicating thermostat, to energy monitoring and controlling smart plugs thru irrigation controllers. The system takes advantage of ubiquitous nature


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


File:EIA-Appalach7-TN-KY-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach7-TN-KY-LIQ.pdf Appalach7-TN-KY-LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 19.31 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time.


File:USDA-CE-Production-GIFmaps-TN.pdf | Open Energy Information  

Open Energy Info (EERE)

TN.pdf TN.pdf Jump to: navigation, search File File history File usage Tennessee Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 332 KB, MIME type: application/pdf) Description Tennessee Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Tennessee External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:21, 27 December 2010 Thumbnail for version as of 16:21, 27 December 2010 1,650 × 1,275 (332 KB) MapBot (Talk | contribs) Automated bot upload


Super Wi-Fi is Super for Energy Too | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too September 24, 2010 - 11:45am Addthis Super Wi-Fi is Super for Energy Too Nick Sinai Senior Advisor to the U.S. Chief Technology Officer, White House Office of Science and Technology Policy What does this mean for me? By integrating broadband into the emerging Smart Grid, consumers will have revolutionized communication with their utility -- they will have detailed information on their energy use that will help inform them how they can save on their electric bills. Editor's Note: Cross-posted from the National Broadband Plan blog, which deals with how broadband technology will integrate into the smart grid. We at the FCC are very excited about yesterday's order to free up the unused "white spaces" spectrum between television channels, intended to


Identified Patent Waiver W(I)2012-003 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 Identified Patent Waiver W(I)2012-003 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-004 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 Identified Patent Waiver W(I)2012-004 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-005 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 Identified Patent Waiver W(I)2012-005 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Using unlabeled Wi-Fi scan data to discover occupancy patterns of private households  

Science Conference Proceedings (OSTI)

This poster presents the homeset algorithm, a lightweight approach to estimate occupancy schedules of private households. The algorithm relies on the mobile phones of households' occupants to collect Wi-Fi scans. The scans are then used to determine ...

Wilhelm Kleiminger, Christian Beckel, Anind Dey, Silvia Santini



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...


The Sugar Creek zinc deposit, Jackson Co. TN -- Exploration history, geology and mineralization  

SciTech Connect

During the 60's and 70's zinc exploration of central TN and KY was active. The Sugar Creek Project was one of several investigated by Exxon. The discovery hole, Cu 15, was drilled in early 1973. The Sugar Creek Zinc Deposit was acquired by Independence Mining Co. in 1986 and I.M.C. has subsequently completed additional drilling, both stepout and confirmation holes. A total of 137 holes for 300,833 ft have been drilled. The Sugar Creek deposit is a typical Tennessee zinc deposit (Mississippi Valley Type) which occurs in solution collapse breccias in the Lower Ordovician, Knox Dolomite. The Knox consists of fine grained dolomite with interlayered limestones and crystalline dolomite. Only scattered residual limestone is found in the Sugar Creek area. Collapse breccias have formed which control zinc deposition and are similar to other TN Zn. deposits. At Sugar Creek the types of breccias include: a vertically exaggerated glory hole breakthrough breccia which extends to within 137 ft. of the Knox unconformity, has 500 ft. of zinc mineralization with 8 significant zinc intervals; holes with stacked zinc intervals interpreted to be sides of breakthrough breccia; and single zinc intervals in laterally positioned bedded mineral zones. A total of 99 holes were drilled in the more intense mineralized areas. The ratio of ore to non ore holes is nearly 1 to 1. The mineralization is typical M.V.T. with predominantly sphalerite and only minor occurrences of galena, fluorite, pyrite, etc.

Reinbold, G.; Moran, A.V.; Stevens, D.L. (Independence Mining Co. Inc., Reno, NV (United States))



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Linear Collider Collaboration Tech Notes LCC-0141 SLAC-TN-04-040  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 SLAC-TN-04-040 May 2004 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Availability and Failure Effects of NLC Main Linac Mechanical Movers T. M. Himel, C. Spencer, Peter Tenenbaum


REPLY TO AlTN OF: W-421 (W. A. W  

Office of Legacy Management (LM)

QOEF 13254 QOEF 13254 i.3891 EFG iO7W United- states Government bemoranduin DATE: f-!uG 3, 9 19g4 REPLY TO AlTN OF: W-421 (W. A. W illiams, 427-1719) SUBJECT: Elimination of the Sites from Program the Formerly Utilized Sites Remedial Action To' The File In 1990, with the assistance of Mr. reviewed a number of sites that had services to the Fernald facility as . _ Doug Tonkay and Us. Michelle Landis, I formerly provided goods and/or subcontractors. For 24 of .these B. . sites, recoaaaendations were made to ellrlnate them from further consideration under Fomerly Utilized Sites Remedial Action Program (FUSRAP). In each case, I made or reviewed the evaluation, and, in each case, a handwritten evaluation was prepared. This is to provide a more formal record of the decision on these sites and to ratify and confirm the

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Linear Collider Collaboration Tech Notes LCC-0140 SLAC-TN-04-041  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 SLAC-TN-04-041 June 2004 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Sensitivity to Nano-Tesla Scale Stray Magnetic Fields J. Frisch, T.O. Raubenheimer, P. Tenenbaum


Linear Collider Collaboration Tech Notes LCC-0139 SLAC-TN-04-042  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 SLAC-TN-04-042 May 2004 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Alternative Main Linac BNS Configurations for Reduced Energy Spread Andrei Seryi and Peter Tenenbaum


FI St Po Crypto IPS 140 tanley ortal Ga ograph 0-2 Sec Wi-Q ...  

Science Conference Proceedings (OSTI)

... Q Portal Gat ey Wi-Q Port a wireless ga Wi-Q Comm ry 802.15.4 on tested: 3. on tested: 12 tion ... he s the nts. Page 11. ... The PG d lf Test ower-Up ...



A Silence Duration Based Uplink Scheduling Algorithm for Multiple VoIP Users in M-WiMAX  

Science Conference Proceedings (OSTI)

This paper proposes an efficient uplink scheduling algorithm that can perfectly support various VoIP CODECs with VAD/DTX/CNG in M-WiMAX considering the variants of silence duration between different voice users, solving the problems of uplink resources ... Keywords: G.729B, VAD/DTX/CNG, VoIP CODECs, WiMAX, ertPS, scheduling algorithm

Farouk Y. M. Alkadhi; Zheng Liu; Min Yang; Qiuhong Wang; Jufeng Dai



Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7  

E-Print Network (OSTI)

Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7 1 the box is unchecked. #12;Quick GuideWindows 7 Wi-Fi set up 7. Successfully added postech -> Change Connection Setup Guide for Windows 7 Make sure this box is unchecked. #12;

Kim, Yong Jung


A study on the security, the performance and the penetration of Wi-Fi networks in a Greek urban area  

Science Conference Proceedings (OSTI)

This paper presents a study on the expansion of urbanWi-Fi networks and the degree of users' awareness about their characteristics. It involves an experiment contacted at the area of Serres, a Greek city of around 70,000 inhabitants. The findings revealed ... Keywords: Wi-Fi networks usage, urban networks, war driving, wireless security

Savvas Mousionis; Alex Vakaloudis; Constantinos Hilas



A cross-layer framework for video-on-demand service in multi-hop WiMax mesh networks  

Science Conference Proceedings (OSTI)

In this work, we introduce a cross-layer framework to favor the video-on-demand service in multi-hop WiMax mesh networks. We first propose a joint solution of admission control and channel scheduling for video streams. The proposed approach guarantees ... Keywords: Cross-layer design, Simulation, Video-on-demand, WiMax, Wireless mesh network

Fei Xie; Kien A. Hua; Ning Jiang



TN-68 Spent Fuel Transport Cask Analytical Evaluation for Drop Events  

SciTech Connect

The U.S. Nuclear Regulatory Commission (NRC) is responsible for licensing commercial spent nuclear fuel transported in casks certified by NRC under the Code of Federal Regulations (10 CFR), Title 10, Part 71 [1]. Both the International Atomic Energy Agency regulations for transporting radioactive materials [2, paragraph 727], and 10 CFR 71.73 require casks to be evaluated for hypothetical accident conditions, which includes a 9-meter (m) (30-ft) drop-impact event onto a flat, essentially unyielding, horizontal surface, in the most damaging orientation. This paper examines the behavior of one of the NRC certified transportation casks, the TN-68 [3], for drop-impact events. The specific area examined is the behavior of the bolted connections in the cask body and the closure lid, which are significantly loaded during the hypothetical drop-impact event. Analytical work to evaluate the NRC-certified TN-68 spent fuel transport cask [3] for a 9-m (30-ft) drop-impact event on a flat, unyielding, horizontal surface, was performed using the ANSYS [4] and LS DYNA [5] finite-element analysis codes. The models were sufficiently detailed, in the areas of bolt closure interfaces and containment boundaries, to evaluate the structural integrity of the bolted connections under 9-m (30-ft) free-drop hypothetical accident conditions, as specified in 10 CFR 71.73. Evaluation of the cask for puncture, caused by a free drop through a distance of 1-m (40-in.) onto a mild steel bar mounted on a flat, essentially unyielding, horizontal surface, required by 10 CFR 71.73, was not included in the current work, and will have to be addressed in the future. Based on the analyses performed to date, it is concluded that, even though brief separation of the flange and the lid surfaces may occur under some conditions, the seals would close at the end of the drop events, because the materials remain elastic during the duration of the event.

Shah, M. J.; Klymyshyn, Nicholas A.; Adkins, Harold E.; Koeppel, Brian J.



50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.




E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew


Improvement security for RuBee radio-WiMAX mesh networks  

Science Conference Proceedings (OSTI)

Next generation communication standard integrate various access networks technology to become mesh networks. One of air interface standard is metropolitan area wireless broadband service. IEEE 802.16 is the basis for Worldwide Interoperability for Microwave ... Keywords: AAA, RuBee (IEEE 1902.1), WiMAX, gateway access point, group identity key

Tin-Yu Wu; Jhong-Ci Wu; Wei-Fang Weng



Perspectives on quality of experience for video streaming over WiMAX  

Science Conference Proceedings (OSTI)

The advent of broadband wireless networks, such as WiMAX, is paving the way for the widespread deployment of high-bandwidth video streaming services for mobile users. To provide acceptable end-to-end performance in such a network, it is important to ...

Arun Vishwanath; Partha Dutta; Malolan Chetlu; Parul Gupta; Shivkumar Kalyanaraman; Amitabha Ghosh



Wi-Fi/ZigBee coexistence for fault-tolerant building automation system  

Science Conference Proceedings (OSTI)

The paper presents a case study where a building automation system is investigated using two wireless standards, ZigBee and Wi-Fi 802.11b. Since each standard has specific features and advantages, a network incorporating both manifests itself as an optimal ...

Tarek K. Refaat, Mohamed A. Saleh, Ramz M. Daoud, Hassanein H. Amer, Magdy S. El-Soudani, Magdi S. Moustafa



An experimental performance comparison of 3G and Wi-Fi  

Science Conference Proceedings (OSTI)

Mobile Internet users have two options for connectivity: pay premium fees to utilize 3G or wander around looking for open Wi-Fi access points. We perform an experimental evaluation of the amount of data that can be pushed to and pulled from the Internet ...

Richard Gass; Christophe Diot



Experiences, challenges and lessons from rolling out a rural WiFi mesh network  

Science Conference Proceedings (OSTI)

The computing for development community knows that technology interventions involve consideration of social, technical and environmental factors. Research into WiFi solutions has fallen off as ubiquitous mobile solutions penetrate even the deepest rural ... Keywords: VoIP, baseline study, community co-design, inverse infrastructure, participatory and ethnographic methods, telecommunications

Carlos Rey-Moreno; Zukile Roro; William D. Tucker; Masbulele Jay Siya; Nicola J. Bidwell; Javier Simo-Reigadas



WiMAX-RBDS-Sim: an OPNET simulation framework for IEEE 802.16 mesh networks  

Science Conference Proceedings (OSTI)

In this paper, a simulation model for IEEE 802.16 (WiMAX) wireless mesh networks with distributed scheduling is developed. It provides a framework for the evaluation of reservation-based distributed scheduling (RBDS) policies at the medium access control ... Keywords: IEEE 802.16, OPNET, distributed scheduling, simulation, wireless mesh networks

Gustavo Vejarano; Janise McNair



DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



File:USDA-CE-Production-GIFmaps-WI.pdf | Open Energy Information  

Open Energy Info (EERE)

WI.pdf WI.pdf Jump to: navigation, search File File history File usage Wisconsin Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 326 KB, MIME type: application/pdf) Description Wisconsin Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Wisconsin External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (326 KB) MapBot (Talk | contribs) Automated bot upload


Explosive Demolition of a Fire-Water Tower At East Tennessee Technology Park, Oak Ridge TN  

SciTech Connect

On June 17, 2006, the Department of Energy (DOE) successfully demolished a {approx}60 year old fire-water tower (K-1206-E), located at the East Tennessee Technology Park (ETTP) in Oak Ridge, TN, using strategically placed explosive charges. The subject demolition project was executed by MCM Management Corporation and Demolition Dynamics under the management of DoE's prime contractor Bechtel Jacobs Company LLC (BJC). The K-1206-E Fire Water Tower (Tower) supported the ETTP fire water protection system from the mid- 1950's until 1991. The 378,500-L (100,000-gallon) Tower, elevated 53-m (175-feet) above grade, was located in a grassy area within 152-m (500-feet) of several other occupied facilities. Electrical, control circuits and supply water servicing the Tower were deactivated in 2003. Free liquids and sludge were removed from the tank prior to demolition. Demolition of a facility employing explosive demolition at a federal site in the 'post-9/11 era' was a substantial challenge. The subject paper discusses: - the planning and coordination steps that were taken to successfully overcome the challenges prior to the demolition of the empty, deactivated Tower; - the method used for the engineered demolition of the Tower; and - the factors responsible for the successful execution of this demolition project. At least two previous attempts were made to demolish the Tower. In the first attempt, the execution of the project was deferred by the re-allocation of funds. In the subsequent attempt in 2004, the execution of this project was postponed due to concerns that an adjacent facility would have to shut down operations during the duration of mobilization and execution of the project and thereby incur potential financial losses. A total of 51 cubic meters (1,800 cubic feet) of demolition debris was generated, which was compliantly disposed of at a local landfill followed by site restoration.

Brooksbank, R.D.; Rood, M.S.; Amrit, S.K.; Harper, M.S.; Dypolt, D.J.; Brehse, Mike [Bechtel Jacobs Company LLC, P.O. Box 4699 Oak Ridge, TN 37931 (United States)



Multi-channel transmission with efficient delivery of routing information in maritime WiMAX mesh networks  

Science Conference Proceedings (OSTI)

There is a lack of broadband wireless network in sea to meet the increasing needs of modern maritime users and we have envisaged WiMAX mesh networks for high-speed and low-cost ship-to-ship/shore communications. In such a maritime WiMAX mesh network, ... Keywords: IEEE Std 802.16-2004, broadband wireless access, maritime communications, mesh network, multi-channel transmission

Ming-Tuo Zhou; Hiroshi Harada; Peng-Yong Kong; Chee-Wei Ang; Yu Ge; J. S. Pathmasuntharam



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-1  

E-Print Network (OSTI)

The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33 of WAPs Up to 125 1 WAP / 25 people #12;The University of Texas at Austin July 11, 2012 Data of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-3 5. Distance limitation

Texas at Austin, University of


Human activity recognition in indoor environments by means of fusing information extracted from intensity of WiFi signal and accelerations  

Science Conference Proceedings (OSTI)

In this work, we propose an activity recognition system based on the use of a topology-based WiFi localization system combined with accelerometers for body posture recognition. The WiFi localization system is developed using a fuzzy rule-based classifier ... Keywords: Fuzzy logic, Human activity recognition, Interpretability-accuracy trade-off

Alberto Alvarez-Alvarez; Jose M. Alonso; Gracian Trivino



Radiometric and Engineering Performance of the SeaWiFS Quality Monitor (SQM): A Portable Light Source for Field Radiometers  

Science Conference Proceedings (OSTI)

A portable and stable source of radiant flux, the Sea-viewing Wide Field-of-view Sensor (SeaWiFS) Quality Monitor (SQM), was developed as a field instrument for use in experiments away from the calibration laboratory such as those encountered ...

B. Carol Johnson; Ping-Shine Shaw; Stanford B. Hooker; Don Lynch



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Annual Performance Evaluation of a Pair of Energy Efficient Houses (WC3 and WC4) in Oak Ridge, TN  

SciTech Connect

Beginning in 2008, two pairs of energy-saver houses were built at Wolf Creek in Oak Ridge, TN. These houses were designed to maximize energy efficiency using new ultra-high-efficiency components emerging from ORNL s Cooperative Research and Development Agreement (CRADA) partners and others. The first two houses contained 3713 square feet of conditioned area and were designated as WC1 and WC2; the second pair consisted of 2721 square feet conditioned area with crawlspace foundation and they re called WC3 and WC4. This report is focused on the annual energy performance of WC3 and WC4, and how they compare against a previously benchmarked maximum energy efficient house of a similar footprint. WC3 and WC4 are both about 55-60% more efficient than traditional new construction. Each house showcases a different envelope system: WC3 is built with advanced framing featured cellulose insulation partially mixed with phase change materials (PCM); and WC4 house has cladding composed of an exterior insulation and finish system (EIFS). The previously benchmarked house was one of three built at the Campbell Creek subdivision in Knoxville, TN. This house (CC3) was designed as a transformation of a builder house (CC1) with the most advanced energy-efficiency features, including solar electricity and hot water, which market conditions are likely to permit within the 2012 2015 period. The builder house itself was representative of a standard, IECC 2006 code-certified, all-electric house built by the builder to sell around 2005 2008.

Biswas, Kaushik [ORNL; Christian, Jeffrey E [ORNL; Gehl, Anthony C [ORNL; Jackson, Roderick K [ORNL; Boudreaux, Philip R [ORNL



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma


Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook  

U.S. Energy Information Administration (EIA)

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook for Winter Fuels Outlook Conference National Association of State Energy Officials (NASEO)


Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.




NLE Websites -- All DOE Office Websites (Extended Search)

taTechnologySpecificUnitedStatesWindHighResolutionTennesseeWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of...


TN1421 - References  

Science Conference Proceedings (OSTI)

... 1914; WW Coblentz, "Studies of Instruments for Measuring Radiant Energy in Absolute ... JE Martin, NP Fox and PJ Keys, "A cryogenic radiometer of ...



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Cross-layer modeling of capacity in wireless networks: Application to UMTS/HSDPA, IEEE802.11 WLAN and IEEE802.16 WiMAX  

Science Conference Proceedings (OSTI)

We investigate in this work the cross-layer modeling of the capacity of wireless systems in the presence of two types of flows: streaming and elastic, under a dynamic configuration wherein users join the system and leave it after a finite duration. For ... Keywords: Capacity, Cross-layer design, Flow level, IEEE802.11 WLAN, IEEE802.16 WiMAX, Integrated services, MAC scheduling, UMTS/HSDPA

Mariana Dirani; Chadi Tarhini; Tijani Chahed


Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Better Buildings Neighborhood Program: Boulder, Garfield, and...  

NLE Websites -- All DOE Office Websites (Extended Search)

| SC TN | TX | VT | VI | VA WA | WI Boulder County, Colorado Customized Programs Help Energy Efficiency Rise in Three Colorado Counties Photo of buildings spread across a...


Murdock Road Knoxville.TN  

NLE Websites -- All DOE Office Websites (Extended Search)

or licensing to companies and partners outside the United States). Given the size and financial strength of the U.S. marketplace, I believe the ultimate licensee of this...



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential


WI Radiation Protection  

Energy.gov (U.S. Department of Energy (DOE))

This statute seeks to regulate radioactive materials, to encourage the constructive uses of radiation, and to prohibit and prevent exposure to radiation in amounts which are or may be detrimental...


Wi-Fi security  

Science Conference Proceedings (OSTI)

"ALL [wireless security] mechanisms are completely in-effective" was the conclusion of a study by the Department of Computer Science at the University of Maryland. This discussion will systematically shed light on the inherent insecurities involved with ...

Paul Williams



U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



Measurement of single and double glazing thermal performance under realistic conditions using the mobile window thermal test (MoWiTT) facility  

SciTech Connect

The thermal performance of single glazing, clear double glazing, and double glazing with a low-emissivity coating was measured in both south-facing and north-facing orientations under realistic field conditions using the new MoWiTT field test facility. The time-dependent net heat flow through each fenestration was found to be consistent with the predictions of the standard simplified heat transfer model, provided that an angle-dependent shading coefficient is used and diffuse solar gain is included in the calculation. Summer-condition average U-values were derived for each glazing type and were found to agree with the expected values for both types of double glazing. The measured U-value for single glazing was lower than predicted.

Klems, J.; Keller, H.



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah


Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



sqas wi9 final document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SQAS96-001 SQAS96-001 Quality Report SQAS96-001 Preparation for a Software Quality Audit June 1996 Software Quality Assurance Subcommittee of the Nuclear Weapons Complex Quality Managers United States Department of Energy Albuquerque Operations Office Abstract This document will enable a site to prepare for a software quality audit by providing specific guidance. It will also provide guidance to a site that would enable it to perform a software quality audit. Preparation for a Software Quality Audit SQAS96-001 ACKNOWLEDGMENT This document was prepared for the Department of Energy (DOE) by a Working Group of the Nuclear Weapons Complex (NWC) Quality Managers' Software Quality Assurance Subcommittee (SQAS). The following contributed towards the creation of this document:



NLE Websites -- All DOE Office Websites (Extended Search)

issue is that of energy deposition in the issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Abstract: The effects of electron conditioning on commercially prepared aluminum alloys 1100 and 6063 were investigated. Contrary to the assumption that electron conditioning, if performed long enough, can reduce and stabilize the SEY at approximately 1.1, the SEY of aluminum did not go lower than 1.8. In fact, it increases again with continued electron exposure dose.


TN 1421 - Chapter 2: Electrical Substitution Radiometry  

Science Conference Proceedings (OSTI)

... II. Electrical Substitution Radiometry. ... Figure 1. Schematic diagram of the essential components of an electrical substitution radiometer. ...


ORNL/TN--8524 DE83 005172  

E-Print Network (OSTI)

-kW Free-Piston Stirling Engine with a Dashpot Load DISCLAIMER This report was prepared as an account RESULTS AND DESCRIPTION OF A 1KW FREE-PISTON STIRLING ENGINE WITH A DASHPOT LOAD Jeffrey Schreiber.33 hp) single cylinder free-piston Stirling engine was installed in the test facilities at the Lewis

Oak Ridge National Laboratory


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Microsoft PowerPoint - Experimental and Computational_Liaw  

NLE Websites -- All DOE Office Websites (Extended Search)

of Tennessee (UT), Knoxville, TN 37996 Phone: (865) 974-6356; Fax: (865)974-4115 Fan Zhang (Co-Principal Investigator) CompuTherm, LLC (CTL), Madison, WI 53719 Phone: (608)...


Better Buildings Neighborhood Program: Connecticut  

NLE Websites -- All DOE Office Websites (Extended Search)

TN | TX | VT | VI | VA WA | WI Connecticut Volunteers Help Connecticut Homeowners Save Energy Photo of a variety of buildings in an urban area, with a river flowing in the...


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - topic_B_WI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Interconnection on Electric Resource Western Interconnection on Electric Resource Planning and Priorities The awardee must complete the following at a minimum: 1. Continued development of the Western Renewable Energy Zone (WREZ) analysis, currently performed by the Western Governors' Association (WGA) under DOE Cooperative Agreement (DE-FC26-08NT01788) in order to identify those areas in the West with vast renewable resources to expedite the development and delivery of renewable energy to where it is needed. Specifically, the awardee must complete the following tasks. a. Coordinating Energy Purchasing from the WREZs Aggregating demand for renewable energy can stimulate the development of commercial renewable generation and supporting transmission projects. Many public power, cooperative, state, federal and provincial electric systems have


WiH1950s poster  

Science Conference Proceedings (OSTI)

... definitive work on the thermochemical properties of ions: Gas-Phase Ion ... Despite working under a very tight deadline, she successfully designed a ...



a beneficial manner. The three projects wi  

NLE Websites -- All DOE Office Websites (Extended Search)

beneficial manner. The three projects will demonstrate technologies beneficial manner. The three projects will demonstrate technologies that: (1) make progress toward DOE's target CO 2 capture efficiency of 90 percent; (2) make progress toward DOE's capture and sequestration goal of less than 10 percent increase in the cost of electricity for gasification systems and less than 35 percent for combustion and oxy-combustion systems; and (3) capture and sequester, or put to


ORAU Campus Visitor Map  

NLE Websites -- All DOE Office Websites (Extended Search)

+ Number Directions from Main Campus: Go back out to ORAU Way Turn left onto ORAU Way Turn left at S Illinois AveTN-62 (2.9 mi) Bear Slight right toward Bethel...


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



NIST TN 1297: Appen. C. NIST Tech. Communications Prog.  

Science Conference Proceedings (OSTI)

... E of the NIST Administrative Manual. ... of fundamental constants, fundamental metrological research ... Experimental Statistics, NBS Handbook 91 (US ...


P.O. Box 117, Oak Ridge, TN 37831  

NLE Websites -- All DOE Office Websites (Extended Search)

of climate stations that record real-time temperature, precipitation, wind speed, and solar radiation trends across the United States. Through the Atmospheric Turbulence and...


NIST TN 1297: Appen. D. Clarification and Additional ...  

Science Conference Proceedings (OSTI)

... t 1-? D.6 Uncertainty and units of the ... of this and other terms, has been replaced here and ... is equal to the negative of the estimated systematic error. ...



E-Print Network (OSTI)

System ARW Solver · Equations: Fully compressible, Euler nonhydrostatic with a run-time hydrostatic the compressible, nonhydrostatic Euler equations. The equations are cast in flux form using variables that have

Zhang, Yan



NLE Websites -- All DOE Office Websites (Extended Search)

chamber, one sample at a time is loaded, on its individual carrier plate, onto a manipulator arm (Vacuum Generators "Omniax"). The Omniax carrier plate holder design is shown...



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.



U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp


Nation Weekly June 6, 2004, Volume 1, Number 7  

E-Print Network (OSTI)

ec ted c o- or din ate s yo u wi ll f ind u nli mi ted p os sib ilit y f or yo ur lim ite d bu dg et. Sp re ad y ou r n et at th e Te x-W or ld an d sp en d so me qu ite h ou rs fi sh ing th ro ug h ou r c oll ec tio n yo u wi ll...

Upadhyay, Akhilesh


Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

SciTech Connect

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.



Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

Science Conference Proceedings (OSTI)

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.



Identified Patent Waiver W(I)2012-002  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by BATTELLE MEMORIAL INSTITUTE for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC07-05ID14517.


Identified Patent Waiver W(I)2012-009  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by UNITED TECHNOLOGIES RESEARCH for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC02-05CH11231.



E-Print Network (OSTI)

December 3-5, 1979 THE MOBILE WINDOW THERMAL TEST FACILITY (Orlando, Florida. The Mobile Window Thermal Test Facility (Press, 197 . THE NOBILE WINDOW THERMAL TEST FACILITY (

Klems, J. H.



Why Wi-Fi wants to be free  

Science Conference Proceedings (OSTI)

As the telecommunications industry wavers, a global grassroots movement is building the next-generation wireless network.

Terry Schmidt; Anthony Townsend



Identified Patent Waiver W(I)2008-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ELTRON RESEARCH, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-05NT42469

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Patent Waiver W(I)2011-013  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2011-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2011-012  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Harnessing frequency diversity in wi-fi networks  

Science Conference Proceedings (OSTI)

Wireless multicarrier communication systems transmit data by spreading it over multiple subcarriers and are widely used today owing to their robustness to multipath fading, high spectrum efficiency, and ease of implementation. In this paper, we use real ... Keywords: IEEE 802.11, cross layer design, forward error correction (FEC), orthorgonal frequency division multiplexing (OFDM), rate adaptation

Apurv Bhartia; Yi-Chao Chen; Swati Rallapalli; Lili Qiu




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

INCINERATION AT THE INCINERATION AT THE IDAHO NATIONAL ENGINEERING AND ENVIRONMENTAL LABORATORY U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL OFFICE OF AUDIT SERVICES DECEMBER 1999 DOE/IG-0454 AUDIT REPORT December 15, 1999 MEMORANDUM FOR THE SECRETARY FROM: Gregory H. Friedman (Signed) Inspector General SUBJECT: INFORMATION : Audit Report on "Waste Incineration at the Idaho National Engineering and Environmental Laboratory" BACKGROUND The Waste Experimental Reduction Facility (WERF) Incinerator is located at the Idaho National Engineering and Environmental Laboratory (INEEL) in Idaho Falls, Idaho. The primary mission of the incinerator is to provide mixed waste treatment until a demonstrated, more cost-effective commercial facility is available.



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Biofuels Project Locations Biofuels Project Locations BlueFire Ethanol Biochemical Municipal Solid Waste (Mecca, CA) Poet Biochemical Corn Cob/Corn Fiber (Emmetsburg, IA) Lignol Biochemical Woody Biomass- Ag Residues (Grand Junction, CO) ICM Biochemical Switchgrass, Forage Sorghum, Stover (St. Joseph, MO) Abengoa Biochemica Agricultural Residue (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE Bioenergy Science Center (Oak Ridge, TN) NewPage Thermochemical Woody Biomass - Mill Residues (Wisconsin Rapids, WI) Range Fuels Thermochemical Woody Waste (Soperton, GA) DSM Innovation Center Biochemical Various (Parsippany, NJ) Novozymes Biochemical Various (Davis, CA) Genencor Biochemical Various (Palo Alto, CA) Verenium Corp Biochemical Various (San Diego, CA)


Phase Locked Loop Control of Inverters in a Microgrid  

E-Print Network (OSTI)

Phase Locked Loop Control of Inverters in a Microgrid Matthew Surprenant Dept of ECE University Venkataramanan Dept of ECE University of Wisconsin Madison, WI, USA Abstract--Microgrids are small for inverter-based microsources within a mi- crogrid. The general control philosophy within a microgrid

Hiskens, Ian A.


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Biofuels Biofuels Project Locations Pacific Ethanol (Boardman, OR) BlueFire Ethanol (Corona, CA) POET (Emmetsburg, IA) Lignol Innovations (Commerce City, CO) ICM (St. Joseph, MO) Abengoa (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE Bioenergy Science Center (Oak Ridge, TN) NewPage (Wisconsin Rapids, WI) Range Fuels (Soperton, GA) DSM Innovation Center (Parsippany, NJ) Novozymes (Davis, CA) Genencor (Palo Alto, CA) Verenium Corp (San Diego, CA) Dupont (Wilmington, DE) Mascoma (Lebanon, NH) Cargill Inc (Minneapolis, MN) Regional Partnerships South Dakota State University, Brookings, SD Cornell University, Ithaca, NY University of Tennessee, Knoxville, TN Oklahoma State University, Stillwater, OK Oregon State University, Corvallis, OR



Office of Legacy Management (LM)

'??Kt fire ?726 reisccnsrcd nnd GxG.rL:* shed i.2 it3 csrUes tqyi by tn;hncd p?Q,cZt pr,l%WlMiL, TJi.th tl &Azy & fonAQinlff C,j-taen t&2 &if&g Sec%ir;n YG D...


gkp940 401..407  

NLE Websites -- All DOE Office Websites (Extended Search)

MiST2 MiST2 database: a comprehensive genomics resource on microbial signal transduction Luke E. Ulrich 1,2, * and Igor B. Zhulin 2,3 1 Agile Genomics LLC, Mount Pleasant, SC 29466, 2 Department of Microbiology, University of Tennessee, Knoxville, TN 37996 and 3 BioEnergy Science Center and Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37886, USA Received September 15, 2009; Revised October 8, 2009; Accepted October 9, 2009 ABSTRACT The MiST2 database (http://mistdb.com) identifies and catalogs the repertoire of signal transduction proteins in microbial genomes. Signal transduction systems regulate the majority of cellular activities including the metabolism, development, host- recognition, biofilm production, virulence, and antibiotic resistance of human pathogens. Thus, knowledge of the proteins and interactions that comprise


File:EIA-Appalach7-TN-KY-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 BOE Reserve Class Kentucky and Tennessee By 2001 BOE Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.57 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:43, 20 December 2010 Thumbnail for version as of 17:43, 20 December 2010 5,100 × 6,600 (18.57 MB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Appalach7-TN-KY-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 Gas Reserve Class Kentucky and Tennessee By 2001 Gas Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.6 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:44, 20 December 2010 Thumbnail for version as of 17:44, 20 December 2010 5,100 × 6,600 (18.6 MB) MapBot (Talk | contribs) Automated bot upload

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Approved for public release; distribution is unlimited. ERDC TN-DOER-E31  

E-Print Network (OSTI)

one of our most economically important pests in urban landscapes. Fire Ants cause extensive mounding (black dots show the location of each fire ant colony). Benefits · The ideal set of turf and landscape of landscape plants and turfgrasses can be identified that are repellent to Fire Ant foraging and mound

US Army Corps of Engineers


CASI 2011 Work Plan 1 ERDC/CERL TN-11-1 January 2011  

E-Print Network (OSTI)

by natural disasters, purposeful attack, or unusually high demand). When failures occur at various locations and thermal energy storage; n microgrids, ac and dc, including both self-contained, cellu- lar, and universal

US Army Corps of Engineers


The T.N. Thiele Centre for Mathematics in Natural Science,  

E-Print Network (OSTI)

We propose a new measure of risk, based entirely on downwards moves measured using high frequency data. Realised semivariances are shown to have important predictive qualities for future market volatility. The theory of these new measures is spelt out, drawing on some new results from probability theory. Keywords: Market frictions; Quadratic variation; Realised variance; Semimartingale; Semivariance. 1 It was understood that risk relates to an unfortunate event occurring, so for an investment this corresponds to a low, or even negative, return. Thus getting returns in the lower tail of the return distribution constitutes this downside risk. However, it is not easy to get a simple measure of this risk. Quoted from Granger (2008). 1

Ole E. Barndorff-nielsen; Silja Kinnebrock; Neil Shephard



ERDC/CERL TN-13-1 February 2013 Approved for public release; distribution is unlimited.  

E-Print Network (OSTI)

.sirsi.net/client/search/asset:asset?t:ac=$N/1006361 #12;CASI 2013 Work Plan 17 Operational Energy Base Camp Studies: Literature Review of Findings #12;CASI 2013 Work Plan 10 Energy and Water Conservation Assessments: A Field Guide outlines common: IMCOM POC: James Westervelt, CERL #12;CASI 2013 Work Plan 16 Sustainable Energy Solutions Lead: Franklin

US Army Corps of Engineers


TN-Gebhren fr Externe 2013/2014 Wir an der Uni  

E-Print Network (OSTI)

Garten: Sind sie noch zu retten? Bedrohte Pflanzen im Botanischen Garten 24.09.2013, von 12:00-13:30 Uhr Dr. Ute Becker kostenfrei 20140090 Besuch im Botanischen Garten: Die sinnliche Seite der Gewürze 09

van Straten, Duco


Analysts Grammar or Japanese tn the Nu-ProJect -A Procedural Approach to Analysts Grammar -  

E-Print Network (OSTI)

.Ten|gucht (Kyosera Co.). Hr. A.Kosaka (~EC Co.). Mr. H.Sakamoto (Ok1 Electr|c Co.), MtSS H.Kume (JCS). Hr. N


Linear Collider Collaboration Tech Notes LCC-0151 SLAC-TN-0-048  

NLE Websites -- All DOE Office Websites (Extended Search)

of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion...


Approved for public release; distribution is unlimited. ERDC TN-DOER-E32  

E-Print Network (OSTI)

Report 262. Washington, DC: National Academy Press. Reine K. J., D. D. Dickerson, and D. G. Clarke. 1998EWsintendedtoprotecttheselectedspecies. BACKGROUND AND PROBLEM: Environmental windows (EWs) associated with dredging operations can be controversial, and monitoring environmental windows for dredging projects. Marine Board, Transportation Research Board. Special

US Army Corps of Engineers


Microsoft PowerPoint - Camper, ORNL-TN CAB-04-2010-final, via...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chairs of the Environmental Management Site- Specific Advisory Board Specific Advisory Board Larry W. Camper, Director Division of Waste Management and Environmental Protection Off...


NIST TN 1297: Appen. D6. Uncert. units of the SI  

Science Conference Proceedings (OSTI)

... methods; simple calibration D.5 t p and the quantile t 1-? D.6 Uncertainty and units of the SI; proper use of the SI and quantity and unit symbols D.7 ...


II United States Government DATE: REPLY TO Al-TN OF: SUBJECT...  

Office of Legacy Management (LM)

for Remedial Action at the Former Baker Brothers Inc. Site, Toledo, Ohio Manager, DOE Oak Ridge Field Office This is to notify you that the Former Baker Brothers, Inc. site...


Data Sharing Report Characterization of Isotope Row Facilities Oak Ridge National Laboratory Oak Ridge TN  

SciTech Connect

The U.S. Department of Energy (DOE) Oak Ridge Office of Environmental Management (EM-OR) requested that Oak Ridge Associated Universities (ORAU), working under the Oak Ridge Institute for Science and Education (ORISE) contract, provide technical and independent waste management planning support using funds provided by the American Recovery and Reinvestment Act (ARRA). Specifically, DOE EM-OR requested ORAU to plan and implement a survey approach, focused on characterizing the Isotope Row Facilities located at the Oak Ridge National Laboratory (ORNL) for future determination of an appropriate disposition pathway for building debris and systems, should the buildings be demolished. The characterization effort was designed to identify and quantify radiological and chemical contamination associated with building structures and process systems. The Isotope Row Facilities discussed in this report include Bldgs. 3030, 3031, 3032, 3033, 3033A, 3034, 3036, 3093, and 3118, and are located in the northeast quadrant of the main ORNL campus area, between Hillside and Central Avenues. Construction of the isotope production facilities was initiated in the late 1940s, with the exception of Bldgs. 3033A and 3118, which were enclosed in the early 1960s. The Isotope Row facilities were intended for the purpose of light industrial use for the processing, assemblage, and storage of radionuclides used for a variety of applications (ORNL 1952 and ORAU 2013). The Isotope Row Facilities provided laboratory and support services as part of the Isotopes Production and Distribution Program until 1989 when DOE mandated their shutdown (ORNL 1990). These facilities performed diverse research and developmental experiments in support of isotopes production. As a result of the many years of operations, various projects, and final cessation of operations, production was followed by inclusion into the surveillance and maintenance (S&M) project for eventual decontamination and decommissioning (D&D). The process for D&D and final dismantlement of facilities requires that the known contaminants of concern (COCs) be evaluated and quantified and to identify and quantify any additional contaminants in order to satisfy the waste acceptance criteria requirements for the desired disposal pathway. Known facility contaminants include, but are not limited to, asbestos-containing material (ACM), radiological contaminants, and chemical contaminants including polychlorinated biphenyls (PCBs) and metals.

Weaver, Phyllis C



Approved for public release; distribution is unlimited. ERDC/EL TN-11-4  

E-Print Network (OSTI)

the well was successfully capped (OSAT 2010). This is comparable in magnitude to previous oil spills in U.S due to releases of crude oil from tankers, offshore platforms, drilling rigs and wells. Spills was one of four large oil spills occurring along U.S. coastlines from 1976 to 2010. Depending

US Army Corps of Engineers


Microsoft Word - West TN Solar Farm_Final EA.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6 6 10-088(E)/010511 FINAL ENVIRONMENTAL ASSESSMENT WEST TENNESSEE SOLAR FARM PROJECT HAYWOOD COUNTY, TENNESSEE U.S. Department of Energy National Energy Technology Laboratory Pittsburgh, PA February 2011 DOE/EA-1706 10-088(E)/010511 FINAL ENVIRONMENTAL ASSESSMENT West Tennessee Solar Farm Project Haywood County, Tennessee February 2011 Environmental Assessment for the West Tennessee Solar Farm Project Table of Contents i Table of Contents 1 INTRODUCTION .............................................................................................................................. 1 1.1 VOLUNTEER STATE SOLAR INITIATIVE ....................................................................... 1 1.1.1 Tennessee Solar Institute ........................................................................................ 1


Hybrid solar lighting systems and components - Energy ...  

... (Lenoir City, TN), Earl; Dennis D. (Knoxville, TN), Beshears; David L. (Knoxville, TN), Maxey; Lonnie C. (Powell, TN), Jordan; John K. (Oak Ridge, TN), ...


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Feedstock, and Technology Diversity Feedstock, and Technology Diversity Pacific Ethanol Biochemical Wheat Straw/Corn Stover (Boardman, OR) Iogen Biochemical Wheat Straw (Shelly, ID) Blue Fire Biochemical Municipal Solid Waste (Corona, CA) Poet Biochemical Corn Stover (Emmetsburg, IA) Lignol Biochemical Wood Residues (Commerce City, CO) ICM Biochemical Switchgrass, Corn Stover (St. Joseph, MO) Abengoa Biochemical/ Thermo Ag Waste, Switchgrass (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE Bioenergy Science Center (Oak Ridge, TN) Stora Enso North America Thermochemical Wood Chips (Wisconsin Rapids, WI) Range Fuels Thermochemical Wood Chips (Soperton, GA) Alico Thermochemical/Bio Citrus Waste (LaBelle, FL) Six Commercial-Scale Biorefinergy


pnas201120992 1..6  

NLE Websites -- All DOE Office Websites (Extended Search)

polymer polymer of caffeyl alcohol in plant seeds Fang Chen a,b,1 , Yuki Tobimatsu c,1 , Daphna Havkin-Frenkel d , Richard A. Dixon a,b,2 , and John Ralph c,e,2 a Plant Biology Division, Samuel Roberts Noble Foundation, Ardmore, OK 73401; b Department of Energy, BioEnergy Science Center (BESC), Oak Ridge National Laboratory, Oak Ridge, TN 37831; c Department of Biochemistry, Enzyme Institute, University of Wisconsin, Madison, WI 53726; d Department of Plant Biology and Pathology, Rutgers, State University of New Jersey, New Brunswick, NJ 08901; and e Department of Energy, Great Lakes Bioenergy Research Center, and Wisconsin Bioenergy Initiative, Madison, WI 53706 Contributed by Richard A. Dixon, December 20, 2011 (sent for review November 2, 2011) Lignins are complex phenylpropanoid polymers mostly associated with plant secondary cell walls. Lignins arise primarily via oxidative


IL Wted States Government  

Office of Legacy Management (LM)

Tis&: p/WI-3 Tis&: p/WI-3 . IL Wted States Government ' 1, -1. \ k. 4 4L La. -iF 1 I ' __, 7, Department of Energy memorandum TN OF: EM-421 (W. A. Williams, 903-8149) rn. I \ SUBJECT: Authorization for Remedial Action at the Former C. H. Schnoor & Company Site, Springdale, Pennsylvania TO: Manager, DOE Oak Ridge Field Office This is to notify you that the former C. H. Schnoor & Company facility in Springdale, Pennsylvania, is designated for remedial action under the Formerly Utilized Sites Remedial Action Program (FUSRAP). This notification does not constitute a FUSRAP baseline change control approval. Approval of the baseline change will be accomplished through the normal baseline change control procedures.


Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity  

NLE Websites -- All DOE Office Websites (Extended Search)

12 12 © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd Received Date : 08-Jul-2012 Revised Date : 30-Aug-2012 Accepted Date : 03-Sep-2012 Article type : Original Article Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Fang Chen, 1,3* Yuki Tobimatsu, 2, Lisa Jackson, 1 John Ralph, 2,4 and Richard A. Dixon 1,3* 1 Plant Biology Division, Samuel Roberts Noble Foundation, 2510 Sam Noble Parkway, Ardmore, OK 73401, USA; 2 Department of Biochemistry, University of Wisconsin-Madison, Enzyme Institute, 1710 University Avenue, Madison, WI 53726, USA; 3 DOE Bioenergy Sciences Center, Oak Ridge, TN, USA; 4 DOE Great Lakes Bioenergy Research Center, Madison, WI, and Wisconsin Bioenergy

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael



Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


Nuclear Energy Enabling Technologies (NEET) Reactor Materials  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Enabling Technologies (NEET) Reactor Materials Enabling Technologies (NEET) Reactor Materials Award Recipient Estimated Award Amount* Award Location Supporting Organizations Project Description University of Nebraska $979,978 Lincoln, NE Massachusetts Institute of Technology (Cambridge, MA), Texas A&M (College Station, TX) Project will explore the development of advanced metal/ceramic composites. These improvements could lead to more efficient production of electricity in advanced reactors. Oak Ridge National Laboratory $849,000 Oak Ridge, TN University of Wisconsin-Madison (Madison, WI) Project will develop novel high-temperature high-strength steels with the help of computational modeling, which could lead to increased efficiency in advanced reactors. Pacific Northwest National Laboratory


Results for the Independent Sampling and Analysis of Used Oil Drums at the Impact Services Facility in Oak Ridge, TN  

SciTech Connect

The U.S. Department of Energy (DOE) requested that Oak Ridge Associated Universities (ORAU), via the Oak Ridge Institute for Science and Education (ORISE) contract, perform independent sampling and analysis of used oils contained within eight 55 gallon drums stored at the former IMPACT Services facility, located at the East Tennessee Technology Park in Oak Ridge, Tennessee. These drums were originally delivered by LATA Sharp Remediation Services (LSRS) to IMPACT Services on January 11, 2011 as part of the Bldg. K-33 demolition project, and the drums plus contents should have been processed as non-hazardous non-radiological waste by IMPACT Services. LSRS received a certificate of destruction on August 29, 2012 (LSRS 2012a). However, IMPACT Services declared bankruptcy and abandoned the site later in 2012, and eight of the original eleven K-33 drums are currently stored at the facility. The content of these drums is the subject of this investigation. The original drum contents were sampled by LSRS in 2010 and analyzed for gross alpha, gross beta, and polychlorinated biphenyls (PCBs), using both compositing and grab sampling techniques. The objective of this 2013 sample and analysis effort was to duplicate, to the extent possible, the 2010 sampling and analysis event to support final disposition decisions. Part of that decision process includes either verifying or refuting the assertion that oils that are currently stored in drums at the IMPACT Services facility originated from Bldg. K-33 equipment.




J. DALTON YORK 110 Sheffield Ct., Cookeville, TN 38506 | 931-854-1068 | dyork@tntech.edu  

E-Print Network (OSTI)

channel of a solid-oxide fuel cell (SOFC). Butane conversion and product formation were monitored hydrocarbons in the anode channels of a SOFC. Additional efforts are required to account for catalytic. Solid-oxide fuel cells (SOFC), in particular, offers a very promising method for direct production

Firoozabadi, Abbas


Agenda for Sept 10-11 workshop in Oak Ridge, TN Sustainability of Bioenergy Systems: Cradle to Grave  

E-Print Network (OSTI)

Smith (EPA) Design of Sustainable Biofuel Supply Chains · Ozge Kaplan (EPA) - Emerging Biomass Production § 3 in 5 · Chris Impellitteri (EPA) - Biofuels:Water Resources, Reuse and Energy · Virginia Dale Analysis of Ecological Effects of Biofuels Crops § Questions and discussion · 3:00 Break · 3:30 Reconvene o


International Composites Expo ICE-98 Nashville, TN, January 19-21, 1998. Title: Strength, Durability and Health Monitoring of Composites  

E-Print Network (OSTI)

and utilization of composite overlays on civil infrastructures is also addressed. INTRODUCTION According to the US. The perspective and benefits of the repair, upgrade, retrofit, and rehabilitation of US civil infrastructure using capacity of concrete bridges. FRP repair technology offers a practical way to rehabilitate aging concrete

Giurgiutiu, Victor


Assessing the Environmental Impacts of Cellulosic Bioethanol Production: An Ongoing Case Study of Switchgrass Production around Vonore, TN  

E-Print Network (OSTI)

for the Vonore area, we will relate these changes in water quality to changes in economic criteria (e.g., target of Tennessee Biofuels Initiative. Managed by Genera Energy LLC and operated by DuPont Danisco Cellulosic


Notice of Intent to Prepare an Environmental Impact Statement for a Transuranic Waste Treatment Facility at Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

79 79 Federal Register / Vol. 64, No. 17 / Wednesday, January 27, 1999 / Notices format (e.g., Braille, large print, audiotape, or computer diskette) on request to the contact person listed in the preceding paragraph. Individuals with disabilities may obtain a copy of the application package in an alternate format, also, by contacting that person. However, the Department is not able to reproduce in an alternate format the standard forms included in the application package. Electronic Access to This Document You may view this document, as well as all other Department of Education documents published in the Federal Register, in text or portable document format (pdf) on the Internet at either of the following sites: http;//ocfo.ed.gov/fedreg.hmt http://www.ed.gov/news.html To use the pdf you must have the Adobe


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


The Xirrus Wi-Fi Array XS4, XS8 Security Policy Xirrus, Inc.  

Science Conference Proceedings (OSTI)

... Production-grade components and production-grade opaque ... dirt, or oil. ... The security strap should be pulled tight to disallow turning of the mounting ...


Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Xirrus Wi-Fi Array XN4, XN8, XN12, XN16 Security Policy ...  

Science Conference Proceedings (OSTI)

... Production?grade components and production?grade opaque ... the surface area of any grease, dirt, or oil. ... strap should be pulled tight to disallow ...



WiFi Meet FuFi: Research Topics in SCM and DSS  

E-Print Network (OSTI)

Disruptive innovation catalysed by energy (carbon footprint) may reshape supply chain and logistics. The continents of Europe, Asia and Africa may evolve as a connected value network through railroad logistics.

Datta, Shoumen



North Brazil Current Ring Generation and Evolution Observed with SeaWiFS  

Science Conference Proceedings (OSTI)

The earth's largest oceanic rings are formed by the retroflecting North Brazil Current (NBC) near 8N in the western tropical Atlantic. The NBC flows northward across the equator and past the mouth of the Amazon River entraining river-influenced ...

David M. Fratantoni; Deborah A. Glickson



SCOTT T. SANDERS 1500 Engineering Dr., Madison, WI, 53706 | 608 262 3540 | stsanders@wisc.edu  

E-Print Network (OSTI)

, S.T., and Okura, Y., "Design of System for Rugged, Low-noise Fiber-optic Access to High Study: Two-Step Water Splitting Cycle Using the Fe3O4/FeO Redox System," Solar Energy 65, 43-53, 1999} Walewski, J.W., Filipa, J.A., and Sanders, S.T., "Optical beating of polychromatic light and its impact

Van Veen, Barry D.


Identified Patent Waiver W(I)2012-012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

has to inventions conceived or first actually reduced to practice by DR. F. JEFFREY MARTIN under agreement DE-AC52-06NA25396, as the DOE has determined that granting such a...


ARIEL: automatic wi-fi based room fingerprinting for indoor localization  

Science Conference Proceedings (OSTI)

People spend the majority of their time indoors, and human indoor activities are strongly correlated with the rooms they are in. Room localization, which identifies the room a person or mobile phone is in, provides a powerful tool for characterizing ...

Yifei Jiang; Xin Pan; Kun Li; Qin Lv; Robert P. Dick; Michael Hannigan; Li Shang



High School Visits (WI, IL, MN and other states) Arranged in alpha order  

E-Print Network (OSTI)

High School 10/5/12 8:15 a.m. Black River Falls High School 9/21/12 9:00 a.m. Bollingbrook High School High School 10/16/12 12:00 p.m. Crystal Lake Central High School 10/15/12 9:40 a.m. Cuba City High

Saldin, Dilano


WiGriMMA: A Wireless Grid Monitoring Model Using Agents  

Science Conference Proceedings (OSTI)

The complexity, heterogeneity, device mobility and the unpredictable user behavior demands proper automation of monitoring activity in the wireless Grid to enable the user needs. Since the wireless devices can dynamically join/leave the Grid, and its ... Keywords: Agent, Credit management, Device state control, Grid monitoring, Wireless Grid

Mahantesh N. Birje; Sunilkumar S. Manvi



Centr um voor Wi skunde en I nf or mati ca Modelling, AnalysisandSimulation  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . 31 iii #12;Contents CAFE Final Report Volume II III Protocols 33 6 Notation and De nitions 35 6.1 and Simulation CAFE project _ Final report volume II Secure protocols and architecture Edited by A. Bosselaers, R;CAFE Project - Final Report Volume II Secure Protocols and Architecture Edited by A. Bosselaers, R

Schoenmakers, Berry


Evaluating next-cell predictors with extensive Wi-Fi mobility data  

E-Print Network (OSTI)

cycles or more. If an external fault happens, breaker B1 will shut down the fuel cell immediately and separate it from the system. The breaker B2 will then operate to isolate the fault. As a result, the user factor 1HK (7) where


Achieving True Video-on-Demand Service in Multi-Hop WiMax Mesh Networks  

E-Print Network (OSTI)

Mesh Network Configuration (MSH-NCFG) messages. Each MSH-NCFG message contains a Network Descriptor by listening to MSH-NCFG messages. From all the possible neighboring nodes that advertise MSH-NCFG messages

Hua, Kien A.


,"Wisconsin Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050WI3","N3010WI3","N3020WI3","N3035WI3","N3045WI3" "Date","Natural Gas Citygate Price in Wisconsin (Dollars per Thousand Cubic Feet)","Wisconsin...


bersicht ber die Durchfhrung der Fachpraktika Master Gym Bachelor BEU / Master GH / R  

E-Print Network (OSTI)

) WiSe od. SoSe 2) WiSe 1) 4) WiSe od. SoSe 2) Chemie SoSe SoSe 5) ______ SoSe 5) _____ _____ _____ _____ Deutsch WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. So

Kallenrode, May-Britt


Fast Wave Power Flow Along SOL Field Lines in NSTX and the Associated Power Deposition Profile Across the SOL in Front of the Antenna *  

E-Print Network (OSTI)

Ridge National Laboratory, Oak Ridge, TN 3 XCEL Engineering Inc., Oak Ridge, TN 4 Columbia University

Princeton Plasma Physics Laboratory


,"Tennessee Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050TN3","N3010TN3","N3020TN3","N3035TN3","N3045TN3" "Date","Natural Gas Citygate Price in Tennessee (Dollars per Thousand Cubic Feet)","Tennessee Price...


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY


Microsoft Word - 2007hsn-infocom-paper-lehman-etal.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Control Plane Architecture and Design Considerations for Multi-Service, Multi-Layer, Multi- Domain Hybrid Networks Tom Lehman 1 , Xi Yang 1 , Chin P. Guok 2 , Nageswara S. V. Rao 3 , Andy Lake 4 , John Vollbrecht 4 , Nasir Ghani 5 1 Information Sciences Institute East, University of Southern California, Arlington, VA 22203, USA, Email: {tlehman,xyang}@isi.edu 2 Network Engineering Services Group, ESnet, Berkeley, CA 94720, USA, Email: chin@es.net 3 Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA, Email: raons@ornl.edu 4 University Corporation for Advanced Internet Development, Internet2, Ann Arbor, MI 48104, USA, Email: {jrv,alake}@internet2.edu 5 Department of Electrical and Computer Engineering, Tennessee Technological University, Cookville, TN 38505, USA,



National Nuclear Security Administration (NNSA)

I I l1. CONTRACT 10 CODE PAGE OF PAGES AMENDMENT OF SOLICITATIONIMODIFICATION OF CONTRACT 1 I 2. AMENDMENTIMODIFICATION NO. 3. EFFECTIVE DATE 4. REQUISITION/PURCHASE REQ. NO. IS. PROJECT NO. (If applicable) 218 See Block 16C 6 . ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) 05008 CODE 105008 NNSA/Oakridge Site Office NNSA/Oakridge Site Office U.S . Department of Energy U.S. Department of Energy NNSA/Y-12 Site Office NNSA/Y-12 Site Office P.O. Box 2050 P.O. Box 2050 301 Bear Creek Road 301 Bear Creek Road Building Building Oak Ridge TN 37831 Oak Ridge TN 37831 8. NAME AND ADDRESS OF CONTRACTOR (No., MI'H/. county. Stole /JIId ZIP Codo) 9A. AMENDMENT OF SOLICITATION NO. {xl f-- BABCOCK & WILCOX TECHNICAL SERVICES Y-12, LLC Attn: WILLIE J. WILSON


Development of Novel Non-PGM Electrocatalysts for Proton Exchange Membrane Fuel Cell Applications - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Sanjeev Mukerjee Department of Chemistry and Chemical Biology, Northeastern University (NEU) Boston, MA 02115 Phone: (617) 373-2382 Email: S.mukerjee@neu.edu DOE Managers HQ: Kathi Epping Martin Phone: (202) 586 7425 Email: Kathi.Epping@ee.doe.gov GO: David Peterson Phone: (720) 356-1747 Email: David.Peterson@go.doe.gov Contract Number: DE-EE0000459 Subcontractors: * University of New Mexico, Albuquerque, NM (UNM) (Prof. Plamen Atanassov) * Michigan State University, East Lansing, MI (MSU) (Prof. Scott Barton) * University of Tennessee, Knoxville, TN (UTK)

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Vessel Design and Fabrication Technology for Stationary High-Pressure Hydrogen Storage - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Zhili Feng (Primary Contact), Wei Zhang, John Wang and Fei Ren Oak Ridge National Laboratory (ORNL) 1 Bethel Valley Rd, PO Box 2008, MS 6095 Oak Ridge, TN 37831 Phone: (865) 576-3797 Email: fengz@ornl.gov DOE Manager HQ: Sara Dillich Phone: (202) 586-7925 Email: Sara.Dillich@ee.doe.gov Subcontractors: * Global Engineering and Technology LLC, Camas, WA * Ben C. Gerwick Inc., Oakland, CA * MegaStir Technologies LLC, Provo, UT * University of Michigan, Ann Arbor, MI Project Start Date: October 1, 2010 Project End Date: Project continuation and direction



E-Print Network (OSTI)

??The Medicaid Home and Community Based Services Waiver (HCBS) funds services for people with developmental disabilities in community based group homes. The purpose of the (more)

Cook, Craig



Calibration Evaluation and Radiometric Testing of Field Radiometers with the SeaWiFS Quality Monitor (SQM)  

Science Conference Proceedings (OSTI)

One of the goals of calibration and validation programs supporting ocean color satellites is to produce water-leaving radiances with an uncertainty of 5% in clear-water regions. This objective requires field instruments with a calibration and ...

Stanford B. Hooker; James Aiken



a h|^w[!"????????x?x?Wi8]4!xb0??*ܼ |uY ...  

Science Conference Proceedings (OSTI)

... sG?? w?A?????9???*vv*?_*?g*'??^? 8DXit7=5???*r?*L??*ATS????\\?2??*`*m ...



A Model Of Pedestal Structure J.D. Callen, University of Wisconsin, Madison, WI 53706-1609  

E-Print Network (OSTI)

paleoclassical ones, i.e., for Dan > Dpc eff fDD where fD ( 0.1 in 988892 ) is degree of diffusion reduction

Princeton Plasma Physics Laboratory


WiMsh: a simple and efficient tool for simulating IEEE 802.16 wireless mesh networks in ns-2  

Science Conference Proceedings (OSTI)

Wireless mesh networks (WMNs) are two-tier wireless multihop networks. The top tier is made of wireless routers, which provide access to the wireless clients in the bottom tier. One technology for enabling multi-hop communication in the top tier is IEEE ... Keywords: IEEE 802.16, network simulator 2, simulation, wireless mesh networks

Claudio Cicconetti; Ian F. Akyildiz; Luciano Lenzini



CYCLE-BY-CYCLE COMBUSTION VARIATIONS IN SPARK-IGNITED ENGINES Engineering Technology Division, Oak Ridge National Laboratory, Oak Ridge TN 37831-8088 USA  

E-Print Network (OSTI)

CYCLE-BY-CYCLE COMBUSTION VARIATIONS IN SPARK-IGNITED ENGINES C.S. DAW Engineering Technology-2053 USA ABSTRACT Under constant nominal operating conditions, internal combustion engines can exhibit sub- stantial variation in combustion efficiency from one cycle to the next. Previous researchers have attempted

Tennessee, University of


Data Sharing Report for the Quantification of Removable Activity in Various Surveillance and Maintenance Facilities at the Oak Ridge National Laboratory Oak Ridge TN  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Oak Ridge Office of Environmental Management (OR-EM) requested that Oak Ridge Associated Universities (ORAU), working under the Oak Ridge Institute for Science and Education (ORISE) contract, provide technical and independent waste management planning support using American Recovery and Reinvestment Act (ARRA) funds. Specifically, DOE OR-EM requested that ORAU plan and implement a sampling and analysis campaign targeting potential removable radiological contamination that may be transferrable to future personal protective equipment (PPE) and contamination control materialscollectively referred to as PPE throughout the remainder of this reportused in certain URS|CH2M Oak Ridge, LLC (UCOR) Surveillance and Maintenance (S&M) Project facilities at the Oak Ridge National Laboratory (ORNL). Routine surveys in Bldgs. 3001, 3005, 3010, 3028, 3029, 3038, 3042, 3517, 4507, and 7500 continuously generate PPE. The waste is comprised of Tyvek coveralls, gloves, booties, Herculite, and other materials used to prevent worker exposure or the spread of contamination during routine maintenance and monitoring activities. This report describes the effort to collect and quantify removable activity that may be used by the ORNL S&M Project team to develop radiation instrumentation screening criteria. Material potentially containing removable activity was collected on smears, including both masselin large-area wipes (LAWs) and standard paper smears, and analyzed for site-related constituents (SRCs) in an analytical laboratory. The screening criteria, if approved, may be used to expedite waste disposition of relatively clean PPE. The ultimate objectives of this effort were to: 1) determine whether screening criteria can be developed for these facilities, and 2) provide process knowledge information for future site planners. The screening criteria, if calculated, must be formally approved by Federal Facility Agreement parties prior to use for ORNL S&M Project PPE disposal at the Environmental Management Waste Management Facility (EMWMF). ORAU executed the approved sampling and analysis plan (SAP) (DOE 2013) while closely coordinating with ORNL S&M Project personnel and using guidelines outlined in the Waste Handling Plan for Surveillance and Maintenance Activities at the Oak Ridge National Laboratory, DOE/OR/01-2565&D2 (WHP) (DOE 2012). WHP guidelines were followed because the PPE waste targeted by this SAP is consistent with that addressed under the approved Waste Lot (WL) 108.1 profile for disposal at EMWMFthis PPE is a future waste stream as defined in the WHP. The SAP presents sampling strategy and methodology, sample selection guidelines, and analytical guidelines and requirements necessary for characterizing future ORNL S&M Project PPE waste. This report presents a review of the sample and analysis methods including data quality objectives (DQOs), required deviations from the original design, summary of field activities, radiation measurement data, analytical laboratory results, a brief presentation of results, and process knowledge summaries.

King, David A



InGaAS detectors for miniature infrared instruments T.N. Krabach, C. Staller, S. Dejewski, T. Cunningham, M. Herring, and E.R. Fossum  

E-Print Network (OSTI)

. The spacecraft and mission limitations of solar power also apply to these alternative power systems. Coolers of peak solar illumination. In this region, the primary phenomenology of interest is the reflectance imaging system, of which some variant has been flown on virtually every scientific space mission. Imaging

Fossum, Eric R.


ION GNSS+ 2013, Session F1, Nashville, TN, 16-20 September 2013 Page 1/10 Stereo-Vision Aided GNSS for Automotive  

E-Print Network (OSTI)

estimation of position, velocity and time of user equipment at a fairly low cost for most positioning-motion. In combination with a low-cost GNSS receiver, the system can provide more robust estimation while having good. His research ranges from precise positioning to GNSS signal processing. More information is available

Calgary, University of


K-1435 Wastewater Treatment System for the Toxic Substances Control Act Incinerator Wastewater at the East Tennessee Technology Park, Oak Ridge, TN  

Science Conference Proceedings (OSTI)

This paper will discuss the design and performance of a wastewater treatment system installed to support the operation of a hazardous waste incinerator. The Oak Ridge Toxic Substances Control Act Incinerator (TSCAI), located at the East Tennessee Technology Park (ETTP), is designed and permitted to treat Resource Conservation and Recovery Act (RCRA) wastes including characteristic and listed wastes and polychlorinated biphenyl (PCB)-contaminated mixed waste. The incinerator process generates acidic gases and particulates which consist of salts, metals, and radionuclides. These off-gases from the incinerator are treated with a wet off-gas scrubber system. The recirculated water is continuously purged (blow down), resulting in a wastewater to be treated. Additional water sources are also collected on the site for treatment, including storm water that infiltrates into diked areas and fire water from the incinerator's suppression system. To meet regulatory requirements for discharge, a wastewater treatment system (WWTS) was designed, constructed, and operated to treat these water sources. The WWTS was designed to provide for periodic fluctuation of contaminant concentrations due to various feed streams to the incinerator. Blow down consists of total suspended solids (TSS) and total dissolved solids (TDS), encompassing metals, radionuclide contamination and trace organics. The system design flow rate range is 7.95 to 17 cubic meters per hour (m3/hr) (35 to 75 gallons per minute; gpm). The system is designed with redundancy to minimize time off-line and to reduce impacts to the TSCAI operations. A novel treatment system uses several unit operations, including chemical feed systems, two-stage chemical reaction treatment, micro-filtration, sludge storage and dewatering, neutralization, granular activated carbon, effluent neutralization, and a complete programmable logic controller (PLC) and human-machine interface (HMI) control system. To meet the space requirements and to provide portability of the WWTS to other applications, the system was installed in three, over-the-road semi trailers, and interconnected with piping and power. Trailers were oriented on a small site footprint to facilitate ease of installation. A remote sump pump skid was provided to convey water from two holding sumps adjacent to the treatment process. An accumulation tank and pump were also provided to receive miscellaneous wastewaters for treatment if they meet the waste acceptance criteria. The paper will include details of the technology used in the design, the requirements for compliance, and the initial performance demonstration and jar testing results. The WWTS successfully allowed for highly efficient, high-volume treatment with compliant discharge to off-site surface water. (authors)

Beck, Ch.A. [Senior Project Manager, Golder Associates Inc. (United Kingdom); Tiepel, E.W. [Principal, Golder Associates Inc. (United Kingdom); Swientoniewski, M.D. [P.E. Senior Project Engineer, Bechtel Jacobs Company LLC (United States); Crow, K.R. [P.E., Project Manager, CDM (United States)



K-1435 Wastewater Treatment System for the Toxic Substances Control Act Incinerator Wastewater at the East Tennessee Technology Park, Oak Ridge, TN  

SciTech Connect

This paper discusses the design and performance of a wastewater treatment system installed to support the operation of a hazardous waste incinerator. The Oak Ridge Toxic Substances Control Act Incinerator (TSCAI), located at the East Tennessee Technology Park (ETTP), is designed and permitted to treat Resource ConservatioN and Recovery Act (RCRA) wastes including characteristic and listed wastes and polychlorinated biphenyl (PCB)-contaminated mixed waste. the incinerator process generates acidic gases and particulates which consist of salts, metals, and radionuclides. These off-gases from the incinerator are treated with a wet off-gas scrubber system. The recirculated water is continuously purged (below down), resulting in a wastewater to be treated. Additional water sources are also collected on the site for treatment, including storm water that infiltrates into diked areas and fire water from the incinerator's suppression system. To meet regulatory requirements for discharge, a wastewater treatment system (WWTS) was designed, constructed, and operated to treat these water sources. The WWTS was designed to provide for periodic fluctuation of contaminant concentrations due to various feed streams to the incinverator. Blow down consists of total suspended solids (TSS) and total dissolved solids (TDS), encompassing metals, radionuclide contamination and trace organics. The system design flow rate range is 35 to 75 gallons per minute (gpm). The system is designed with redundancy to minimize time off-line and to reduce impacts to the TSCAI operations. A novel treatment system uses several unit operations, including chemical feed systems, two-stage chemical reaction treatment, microfiltration, sludge storage and dewatering, neutralization, granular activated carbon, effluent neutralization, and a complete programmable logic controller (PLC) and human-machine interface (HMI) control system. To meet the space requirements and to provide portability of the WWTS to other applications, the system was installed in three, over-the-road semi trailers, and interconnected with piping and power. Trailers were oriented on a small site footprint to facilitate ease of installation. A remote sump pump skid was provided to convey water from two holding sumps adjacent to the treatment process. An accumulation tank and pump were also provided to receive miscellaneous wastewaters for treatment if they meet the waste acceptance criteria. The paper includes details of the technology used in the design, the requirements for compliance, and the initial performance demonstration and jar testing results. The WWTS successfully allowed for highly efficient, high-volume treatment with compliant discharge to off-site surface water.

Swientoniewski M.D.



Separation of Flip and Non-Flip parst of Charge Exchange np->pn at energies Tn = 0.5 - 2.0 GeV  

E-Print Network (OSTI)

The new Delta-Sigma experimental data on the ratio $R_{dp}$ allowed separating the Flip and Non-Flip parts of the differential cross section of $np\\to pn$ charge exchange process at the zero angle by the Dean formula. The PSA solutions for the $np\\to np$ elastic scattering are transformed to the $np\\to pn$ charge exchange representation using unitary transition, and good agreement is obtain.

R. A. Shindin; A. A. Morozov; E. V. Chernykh; D. K. Guriev; A. A. Nomofilov; V. Yu. Prytkov; V. I. Sharov; L. I. Strunov



Field-Scale Evaluation of Biostimulation for Remediation of Uranium-Contaminated Groundwater at a Proposed NABIR Field Research Center in Oak Ridge, TN  

DOE Green Energy (OSTI)

A hydrologic, geochemical and microbial characterization of the Area 3 field site has been completed. The formation is fairly impermeable, but there is a region of adequate flow approximately 50 feet bgs. The experiment will be undertaken within that depth interval. Groundwater from that depth is highly acidic (pH 3.2), and has high levels of nitrate, aluminum, uranium, and other heavy metals, as well as volatile chlorinated solvents (VOCs). Accordingly, an aboveground treatment train has been designed to remove these contaminants. The train consists of a vacuum stripper to remove VOCs, two chemical precipitation steps to adjust pH and remove metals, and a fluidized bed bioreactor to remove nitrate. The aboveground system will be coupled to a belowground recirculation system. The belowground system will contain an outer recirculation cell and a nested inner recirculation cell: the outer cells will be continuously flushed with nitrate-free treated groundwater. The inner cell will receive periodic inputs of uranium, tracer, and electron donor. Removal of uranium will be determined by comparing loss rates of conservative tracer and uranium within the inner recirculation cell. Over the past year, a detailed workplan was developed and submitted for regulatory approval. The workplan was presented to the Field Research Advisory Panel (FRAP), and after some extensive revision, the FRAP authorized implementation. Detailed design drawings and numerical simulations of proposed experiments have been prepared. System components are being prefabricated as skid-mounted units in Michigan and will be shipped to Oak Ridge for assembly. One manuscript has been submitted to a peer reviewed journal. This paper describes a novel technique for inferring subsurface hydraulic conductivity values. Two posters on this project were presented at the March 2002 NABIR PI meeting. One poster was presented at the Annual conference of the American Society for Microbiology in Salt Lake City, UT in May 2002.

Criddle, Craig S.



Microsoft PowerPoint - Camper, ORNL-TN CAB-04-2010-final, via Cate 4-19-10.ppt [Compatibility Mode]  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chairs of the Environmental Management Site- Chairs of the Environmental Management Site- Specific Advisory Board Specific Advisory Board Larry W. Camper, Director Division of Waste Management and Environmental Protection Off f S Office of Federal and State Materials and Environmental Management Programs April 28 2010 April 28, 2010 West Valley Demonstration Project * WVDP 1981 * WV Decommissioning Criteria * Interagency/Core Team Meetings * Review/Comment on Decommissioning Plan Review/Comment on Decommissioning Plan * Cooperating Agency on EIS Sit Vi it * Site Visits * Significant Progress/Cooperation 2 Waste Incidental to Reprocessing * Interagency Agreements * 2005 NDAA - Section 3116 * Review of Waste Determinations * Monitoring Role Monitoring Role * Current Status P * Progress 3 Depleted Uranium Disposal * Current Waste Stream Not Considered



Science Conference Proceedings (OSTI)

... TN. Oak Ridge Metrology Center, Oak Ridge, TN [105000- 0] Oak Ridge National Laboratory - Metrology, Oak Ridge, TN [200659- 0] Transcat ...



Electromagnetics - DC/Low Frequency  

Science Conference Proceedings (OSTI)

... TN. Oak Ridge Metrology Center, Oak Ridge, TN [105000- 0] Oak Ridge National Laboratory - Metrology, Oak Ridge, TN [200659- 0] Transcat ...



Microsoft PowerPoint - Experimental and Computational_Liaw  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental and Computational Experimental and Computational Investigation of High-Entropy Alloys (HEAs) for Elevated- Temperature Applications Peter K. Liaw (Principal Investigator) Department of Materials Science and Engineering The University of Tennessee (UT), Knoxville, TN 37996 Phone: (865) 974-6356; Fax: (865)974-4115 Fan Zhang (Co-Principal Investigator) CompuTherm, LLC (CTL), Madison, WI 53719 Phone: (608) 274-1414; Fax: (608) 274-6045 Haoyan Diao (Ph.D. student), UT Chuan Zhang (Researcher), CTL Acknowledgements We are very grateful to: (1) Vito Cedro (2) Richard Dunst (3) Patricia Rawls, (4) Robert Romanosky, and (5) Nicholas Anderson for their kind support (6) National Energy Technology Laboratory (NETL) for sponsoring this project (1) Potential Significance (2)


Distributed Surveillance and Control on Freeways  

E-Print Network (OSTI)

surveillance, Response time can be given as, RTd = Tw + Tc +T'n + Td + Tr Where, RTd = response time under distributeddecision processes. Hence, RTd - RTc = T'n - Tn T'n is the

Coifman, Benjamin



Time & Frequency  

Science Conference Proceedings (OSTI)

... Oak Ridge, TN [105000- 0] Oak Ridge National Laboratory - Metrology, Oak Ridge, TN [200659 ... of Virginia Metrology Lab, Richmond, VA ...


Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Oak Ridge National Laboratory (ORNL) Source List of Subcontractors  

E-Print Network (OSTI)

Middlesboro Road Lafollette TN 37766 423-201-0635 XCEL Engineering, Inc. 1066 Commerce Park Oak Ridge TN 37830

Pennycook, Steve


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan




co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


Categorical Exclusion Determination Form It Submit by E-_  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It Submit by E-_ It Submit by E-_ I'llail - ] Proposed Action Title: (0672- 1610) Eaton Corporation - Highly Efficient, Nea r-Isothermal Liquid-Piston Compressor fo r Low Cost At-Home Natural Gas Refueli ng Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Southfield, MI ; Eden Prairie, MN; Minneapolis, MN; and Milwaukee, WI Proposed Action Description: Funding will support efforts to develop a highly efficient, near isothermal liquid piston compressor for low cost, at-home natu ral gas refueling Proposed work will consist of: (1) develop and optimize a concept compressor design to achieve established performance and cost targets; (2) characterize and verify the expected performance for the compressor design; and (3) develop a compressor system prototype to test proof of


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6



Office of Legacy Management (LM)

~ *-,-' .r_~, ~ *-,-' .r_~, VERIFICATION SURVEY OF THE BAKER AND WILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by W. C. Adams Environmental Survey and Site Assessment Program Energy/Environment Systems Division Oak Ridge Institute for Science and Education Oak Ridge, Tennessee 37831-0117 Prepared for the Office of Environmental Restoration U.S. Department of Energy FINAL REPORT JUNE 1994 This report is based on work performed under contract number DE-AC05-760R00033 with the U.S. Department of Energy. Baker arId Wi,,iMI Wsrchouwl-Vcrification June 28, ,994 - ,I I_ ..I .- VERIFICATION SURVEY OF THE BAKER AND W ILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by: ' J .,,,~ ' . W . C. Adams, Project Leader Date: Environmental Survey and Site Assessment Program


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


EA-16-C TransAlta Energy Marketing (U.S) Inc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 Federal Register 1 Federal Register / Vol. 76, No. 14 / Friday, January 21, 2011 / Notices Houghton, MI. NPA: Goodwill Industries of Northern Wisconsin & Upper Michigan, Inc., Marinette, WI Contracting Activity: Dept of the Interior, National Park Service, Midwest Region, Omaha, NE. Deletions On 10/22/2010 (FR 65305) and 11/19/ 2010 (75 FR 70909-70910), the Committee for Purchase From People Who Are Blind or Severely Disabled published notices of proposed deletions from the Procurement List. After consideration of the relevant matter presented, the Committee has determined that the products listed below are no longer suitable for procurement by the Federal Government under 41 U.S.C. 46-48c and 41 CFR 51- 2.4. Regulatory Flexibility Act Certification I certify that the following action will


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5500 5500 Johnson Controls, Inc. EE Multiple PMC/PVT 2011/ 10/1/2011 to 1/31/2015 Chris Johnson Multiple sites, CA, MI, WI, OR Significant Cost Improvement of Li-Ion Cells (SUMMARY CX) Reduce manufactured cost of large format Li-ion cells by 50% through use of coated separators, dry coated electrodes, and fast formation technologies. Christopher Johnson Digitally signed by Christopher Johnson DN: cn=Christopher Johnson, o=PMC, ou=PVT, email=cjohnson@netl.doe.gov, c=US Date: 2011.12.19 13:35:19 -05'00' 12 19 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.12.20 11:06:33 -05'00' 12 20 2011 Comprehensive list of subcontractors and five locations covered under this Summary CX has been


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

As A As A Power Resource Steven Nadel, Executive Director American Council for an Energy-Efficient Economy October 2010 2 The American Council for an Energy- Efficient Economy (ACEEE) 30 year old, non-profit 501(c)(3) dedicated to advancing energy efficiency through research and education. 35+ staff in Washington DC, + field offices in DE, MI, WA and WI. Focus on End-Use Efficiency in Industry, Buildings, Utilities, and Transportation; Economic Analysis & Human Behavior; and State & National Policy Worked on utility-sector energy-efficiency programs and policies since 1980s Savings Potential from Jan. 2009 Electricity Advisory Committee Report Average Statewide Utility Cost of Saved Energy for Efficiency Programs 3.3 3.3 3.1 3.0 2.9 2.8 2.7 2.6 2.1 1.9 1.9 1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4


Mercury Measurements Characterizing the Impact of SCR on Mercury: Consol Test Site 5 - Eastern Bituminous Coal-Fired Power Plant wi th an SCR, ESP, and Wet FGD  

Science Conference Proceedings (OSTI)

CONSOL Energy Inc., Research & Development (CONSOL), with support from the U.S. Department of Energy, National Energy Technology Laboratory (DOE) and the Electric Power Research Institute (EPRI), is evaluating the effects of selective catalytic reduction (SCR) on mercury (Hg) capture in coal-fired plants equipped with an electrostatic precipitator (ESP) - wet flue gas desulfurization (FGD) combination or a spray dyer absorber 8212 fabric filter (SDA-FF) combination. In this program CONSOL is determining ...



Presented at the 16th ANS Topical Meeting on the Technology of Fusion Energy, Madison WI, Sept. 14-16, 2004.  

E-Print Network (OSTI)

Stanford University . . . . . . . . #12;13 Solar Energy Ordered Bulk Heterojunction Photovoltaic Cells Inorganic Nanocomposite Solar Cells by Atomic Layer Deposition Nanostructured Metal-Organic Composite Solar Cells Nanostructured Silicon-Based Tandem Solar Cells Photosynthetic Bioelectricity Biomass Energy

Ghoniem, Nasr M.


Matching renewal energy sources to rural development needs : a prototype design for a rural community development center for Jamaica, W.I.  

E-Print Network (OSTI)

The opportunities for utilizing Jamaica/s rich supply of renewable energy resources as a base for stead, environmentally sound rural development is tremendous. This thesis explores as way of tapping this potential. Jamaica's ...

Jackson, Michael Onaje



Anthropogenic impact on spring bloom dynamics in the Yangtze River Estuary based on SeaWiFS mission 19982010 and MODIS 20032010 observations  

Science Conference Proceedings (OSTI)

Nutrient output from the Yangtze River to the sea has increased dramatically since the 1960s, and over the past 50 years more than 50,000 reservoirs on the Yangtze River basin have had little impact on water discharge, but have drastically reduced the ...

Cheng Chen, Hong Jiang, Yu Zhang



~o,nnarrrs C/WI. Vol. 19.No. 2. no. 85-90. 1995I. Copyright f. 1995Els&er ScienceLrd  

E-Print Network (OSTI)

`A' to interpret it as a chemical element and searches its memory for the element that corresponds of the program can be secured by sending a disk to the author. Acknou,lrrlg~nle,lrs-The author would like

Campanario, Juan Miguel


Optimum Cycle Length and Discharge Burnup for Nuclear Fuel - A Comprehensive Study for BWRs and PWRs: Phase I: Results Achievable Wi thin the 5 Percent Enrichment Limit  

Science Conference Proceedings (OSTI)

Core reload design and economic analyses show that both pressurized water reactors (PWRs) and boiling water reactors (BWRs) can derive significant benefits by increasing the discharge burnup of their fuel above the currently licensed values. Optimum discharge burnup levels, however, may not be achievable without exceeding the current 5 wt percent limit on enrichment.



Thermal performance measurements of sealed insulating glass units with low-E coatings using the MoWiTT (Mobile Window Thermal Test) field-test facility  

SciTech Connect

Using data obtained in a mobile field-test facility, measured performance of clear and low-emissivity double-glazing units is presented for south-facing and north-facing orientations. The changes in U-value and shading coefficient resulting from addition of the low-E coating are found to agree with theoretical expectations for the cold spring test conditions. Accurate nighttime U-values were derived from the data and found to agree with calculations. Expected correlation between U-value and wind speed was not observed in the data; a plausible experimental reason for this is advanced.

Klems, J.; Keller, H.



Dept. of Sol Science, UW-Madison/UW-Extension, 1525 Observatory Dr., Madison, WI 53706/608-262-0485 November 2010 Issue #2 2010  

E-Print Network (OSTI)

plants burn low S coal and some have installed flue gas scrubbers to reduce sulfur emissions. Use is generated from burning coal. As a consequence of the 1990 Clean Air Act Amendment many coal-burning power power plants in the south- eastern part of the state producing FGD gypsum, with a third to come on

Balser, Teri C.

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 2. Final remedial investigation report  

SciTech Connect

Volume II of this report contains data tables and field notes of information gathered from the sampling of soils and ground water. Hydrocarbons and aromatic volatile organics are among the contaminants listed.

Not Available



Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 1. Final remedial investigation report  

SciTech Connect

Volume 1 of this report covers the Remedial Investigation conducted on Site 1, Fire Training Area at Volk Field Air National Guard Base. The remedial work is described and the testing conducted after remediation to insure all contamination has been removed. The study as conducted under the Air National Guard's Installation Restoration Program. Partial contents include: Meteorology; Hydrology; Soils; Water wells; Groundwater; Borings; Samplings; Chemical contamination; Migration; Decontamination.

Not Available



wyang98@stanford.edu; phone 1 650 723-6213; fax 1 650 725-9755; http://eil.stanford.edu/WiMMS/  

E-Print Network (OSTI)

In this study, a new wireless sensing unit for operation within an automated Structural Health Monitoring (SHM) system is proposed, designed and validated. The design of the wireless sensing unit emphasizes minimization of its power consumption characteristics to ensure it is suited for long-term field deployment in civil structures. The wireless modem integrated with the unit has a long communication range that permits wireless sensors to be spaced over 100m apart. A multi-channel high-resolution analog-to-digital converter is included within each sensing unit to provide flexibility for high-fidelity data collection. A key feature of the wireless sensing unit design is the inclusion of a sophisticated computing core that is capable of locally executing engineering algorithms in real-time. As part of the embedded software, a novel communication protocol is written that can accomplish low-latency communications for accurate time synchronization between spatially distributed wireless sensors. To illustrate the capabilities of the wireless monitoring platform, including the execution of extensive computational tasks, a prototype system is fabricated and tested in the laboratory and field. As part of validating the system performance in the field, the vertical acceleration response of the Geumdang Bridge under traffic loading is measured by 14 wireless sensing unit prototypes.

Design Of Low-Power; Wang Yang; Jerome P. Lynch; B Kincho H. Law



100000241,1,1,1,1,20050516,"AL",10610,"Albertville Municipal...  

U.S. Energy Information Administration (EIA) Indexed Site

,1,229279,"WI",8026,"Sheboygan Falls City of",99 5500018312,1,1,1,1,18004899,"WI",10610,"Sun Prairie Water & Light Comm",99 5500018312,1,2,1,1,1961803,"WI",10620,"Sun Prairie Water...


Business Engineering (M.Sc.) Summer Term 2013  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68 Automated Manufacturing Systems- WI4INGMBWBK1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Material Flow in Logistic Systems- WI4INGMB25 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Material Flow in networked Logistics Systems- WI4INGMB26

Stein, Oliver


The Tension in Solidarity: Race, Gender, and National Identity in Katherine Dunhams Southland  

E-Print Network (OSTI)

WI: The University of Wisconsin Press, 2005. 345-363.WI: The University of Wisconsin Press, 2005. 364-381. ---. WI: The University of Wisconsin Press, 2005. Cole, Johnnetta

Timmons, Michele



NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5653 5653 Filter Sensing Technologies, Inc. EE Multiple PMC/PVT 1/15/2012 - 1/14/2015 Walter G. Parker Multiple sites - MA, MI, NY & TN Development of Radio Frequency Diesel Particulate Filter Sensor and Controls (SUMMARY CX) Developing computer simulations to guide sensor design, developing sensor prototypes, and conducting engine, bench, and ash loading tests to develop calibrations and validate performance. Walter G. Parker Digitally signed by Walter G. Parker DN: cn=Walter G. Parker, o=DOE NETL, ou=PV&T, email=walter.parker@netl.doe.gov, c=US Date: 2011.11.16 14:30:31 -05'00' 11 16 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.12.06 11:22:29 -05'00'


Publications Alphabetically  

NLE Websites -- All DOE Office Websites (Extended Search)

Alphabetically Alphabetically Recently Posted Overview Report: Project to date through September 2013 Nissan Leaf Vehicle Summary Report: July - September 2013 Chevrolet Volt Vehicle Summary Report: July - September 2013 Electric Vehicle Charging Infrastructure Summary Report: July - September 2013 Blink Charging Units Map - Project to date through September 2013 Nissan Leafs and Chevrolet Volts Map - Project to date through September 2013 DOE U.S. Drive All Tech Teams Meeting (SLIDES) Troy, MI - December 2013 IWC - Testing Results: PLUGLESS Wireless Charging System by Evatran Group Inc. (SLIDES) Franklin, TN - December 2013 2011 Honda CRZ (2982) Fleet Testing Results to Date 2011 Honda CRZ (4466) Fleet Testing Results to Date 2011 Honda CRZ (2982) Fact Sheet 2011 Honda CRZ (4466) Fact Sheet


U.S. Department of Energy Categorical Exclusion Determination Form  

NLE Websites -- All DOE Office Websites (Extended Search)

Proiect Title: (0288-1583) Proiect Title: (0288-1583) Arkansas Power Electronics International, Inc. - Highly-Integrated Sic Multichip Power Modules Location: *- Multiple States - AK, TN, NC,MI Proposed Action or Project Description: American Recovery and Reinvestment Act: Funding will support laboratory and bench scale research and development on a Silicon Carbide (Sic) power module to be used in Plug-In Electric Hybrid Vehicles. The proposed work is consistent with the goals of ADEPT: fundamental advances in soft magnetics, high voltage switches, and reliable, high-density charge storage. Proposed work consists entirely of pilot scale RD&D work to be completed in laboratories and facilities controlled by the entities responsible for work under this project; Arkansas Power Electronics International, Inc. and the University of Arkansas in Fayetteville, Arkansas; Oak Ridge National


The family of terpene synthases in plants: a midsize family of genes for specialized metabolism that is highly diversified throughout the kingdom  

NLE Websites -- All DOE Office Websites (Extended Search)

PLANT PLANT GENOME: AN EVOLUTIONARY VIEW ON STRUCTURE AND FUNCTION The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom Feng Chen 1,* , Dorothea Tholl 2 , Jo ¨ rg Bohlmann 3 and Eran Pichersky 4 1 Department of Plant Sciences, University of Tennessee, Knoxville, TN 37996, USA, 2 Department of Biological Sciences, 408 Latham Hall, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA, 3 Michael Smith Laboratories, 2185 East Mall, University of British Columbia, Vancouver, BC V6T 1Z4, Canada, and 4 Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA Received 14 October 2010; revised 19 January 2011; accepted 31 January 2011. * For correspondence (fax +1 865 974 1947; e-mail fengc@utk.edu). SUMMARY Some plant


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA


Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti




E-Print Network (OSTI)

of noble gases in molten salts, which also provide a modeln Hexane B2 275C. Hydrogen-Molten Salt WI (dynes/em) WI PI

Joyce, Peter James



A Numerical Model for Combustion of Bubbling Thermoplastic ...  

Science Conference Proceedings (OSTI)

... where Wi = dri/dt and Wi+1 = dri+1/dt are velocities of inner and outer nodes respectively, the mass conservation equation can be rewritten as ...



Site Safety and Health Plan (Phase 3) for the treatability study for in situ vitrification at Seepage Pit 1 in Waste Area Grouping 7, Oak Ridge National Laboratory, Oak Ridge, TN  

SciTech Connect

This plan is to be implemented for Phase III ISV operations and post operations sampling. Two previous project phases involving site characterization have been completed and required their own site specific health and safety plans. Project activities will take place at Seepage Pit 1 in Waste Area Grouping 7 at ORNL, Oak Ridge, Tennessee. Purpose of this document is to establish standard health and safety procedures for ORNL project personnel and contractor employees in performance of this work. Site activities shall be performed in accordance with Energy Systems safety and health policies and procedures, DOE orders, Occupational Safety and Health Administration Standards 29 CFR Part 1910 and 1926; applicable United States Environmental Protection Agency requirements; and consensus standards. Where the word ``shall`` is used, the provisions of this plan are mandatory. Specific requirements of regulations and orders have been incorporated into this plan in accordance with applicability. Included from 29 CFR are 1910.120 Hazardous Waste Operations and Emergency Response; 1910.146, Permit Required - Confined Space; 1910.1200, Hazard Communication; DOE Orders requirements of 5480.4, Environmental Protection, Safety and Health Protection Standards; 5480.11, Radiation Protection; and N5480.6, Radiological Control Manual. In addition, guidance and policy will be followed as described in the Environmental Restoration Program Health and Safety Plan. The levels of personal protection and the procedures specified in this plan are based on the best information available from reference documents and site characterization data. Therefore, these recommendations represent the minimum health and safety requirements to be observed by all personnel engaged in this project.

Spalding, B.P.; Naney, M.T.



Ectoparasites reduce long-term survival of their avian C H A R L E S R. BROWN1, M A R Y B O M B E R C E R BROL4TN1  

E-Print Network (OSTI)

h;td no rft'ect oil the extent to wllicl~ ectop;~r;~sitesrctlucctl ;tdult clill' swallow srrrvivorsllip (figure 2). 7'11is is uillikr the 11;~ttcrnfnr 11rst-I);~srd cc:top;~r;~"tisrrl,primarily by SWEctoparasites reduce long-term survival of their avian host C H A R L E S R. BROWN1, M A R Y B O M


Resilience of Alaska's boreal forest to climatic F.S. Chapin III, A.D. McGuire, R.W. Ruess, T.N. Hollingsworth, M.C. Mack,  

E-Print Network (OSTI)

that are disproportionately important relative to their biomass) or dominant species, including white spruce, alder, Sphagnum biomass and palatability) (Kielland et al. 2006). These changes indirectly reduce recruitment of white spruce (Angell and Kielland 2009). Although the data record is too short and the connections to climate

McGuire, A. David


1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.



Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius



Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



Fast Faraday cup with high bandwidth - Energy Innovation ...  

Deibele; Craig E. (Knoxville, TN) Assignee: UT-Battelle, LLC (Oak Ridge, TN) Application Number: 10/ 810,088: Application Publication Number: ...


ORISE: Career Opportunities  

NLE Websites -- All DOE Office Websites (Extended Search)

Director Cytogenetics Oak Ridge, TN 12-098 Administrative Assistant Lorton, VA 12-018 Medical & Tech Dir Radiation Emergency Medicine Oak Ridge, TN Ready to Apply? To...



E-Print Network (OSTI)

, University of Wisconsin, Madison, WI 53706 (3) Department of Theoretical Physics and Plasma Research

Redi, Martha H.



E-Print Network (OSTI)

NJ, 07036. **Present address: ***Present address: Chemistry Department, Beloit College, Beloit, WI Solar Energy

Robbins, J.L.



Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard


Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...



Office of Legacy Management (LM)

, , . d Sepmber 20, 1976 . e E. K. Limp, Chfdf, Process Facilities Safety liranch, ~%&iCj kP3RT uF FlhimiiS : &TECH SPECSALlY S-EL Cuwr)wTIa:i On huyusf 19, 1976, Fred F, Ha_ytaod, DRdL, and I visttdd be A?j-TzcILi - planf in ' dardrvlltit, ;ic# YorX, to i3ake a orelir;linary assczimx~f of tile radIo?ocjical status of facilities ut47fzad durfnb3 lW-51 for X': contract mrk f WI 1 vi n.; urd a. GcLwter, Ham r4tina+r, ;iismssicms warz &id ' cliL1 :Ir. tionalj fir. Ted Ckx, mo Has fmf 1 iar tri tn t:~ ject wprk, ixsistzd in iGtntiPyiy involved blant arms. Foll~Anp SW- ¶s d szatment of fin4intjs: &arhtir;fts tijs toi4. Tne cmpqr, known as Al leyhany-ludlxa at ttw tin or' tse contract, rolled uranic oillets +to solId t-o&. Tile cf)cratiofh


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

239 239 Prime: GE Global Research EE DE-EE0005573 PMC/PVT 2011 Ron Harp 10/1/2011 - 1/31/2016 Multiple sites, NC, NY, OH, WI, TN, CO,IA Alternative High-Performance Motors with Non-Rare Earth Materials (SUMMARY CX) Synthesize and characterize magnetic materials, utilize to produce motor components. Formulate and test high temperature insulation materials. Design and test motors. 09 19 2011 Rondle E Harp Digitally signed by Rondle E Harp DN: cn=Rondle E Harp, o=PMC, ou=PVTD, email=rondle.harp@netl.doe.gov, c=US Date: 2011.09.19 09:19:42 -04'00' 9 28 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.09.28 15:23:44 -04'00' Comprehensive list of subcontractors and seven locations covered under this Summary CX has been



Office of Legacy Management (LM)




Office of Legacy Management (LM)

. .* . .* . *' 1, c. l ( JJmKS.,"T +2 - Sk--- LCi = ~CU---.-T?~~ - ' _ I -Got& &ysp f= ,$QTg-J%ej & *j, at r-s* p? the c;t S=iw ' e -4 -7 T&a* J %h~k smey to &?'LcrsL!! +,'-H a&xlt CE c~-siz4-"' (WL'&W b--"-R; d-x43 - "MS , cc- 22 lLW JP .-. 2-Q L.2, l=AF, !y515) SkQQ c3 t& e$QT'3r,y* +' -'a-- 'ZS cw..tn;i. .-- Z!o cezU2?siataa kjc~s AA3 ks*~sti lffti S *Ab *T*,& tmld kv ;ia-eGd aa t;v ryrs d t:* -ticIs;: e c3 eaizw2-L &4?ia, x,qZ-' y s +.!-w~ * & & A& b L*z&=- b l A m iE3 &an z U/L& ,c,- 223 *Pb ' Sd YfZ' , w%b!.R LiZhE O+ZIBr -wi' Qe e* if,= ca' ,c, me *e83ia ~hl3 GK m*GLFs. s&s-?qyi* w =.,m -y s:* & km, -k tei;2&+ 3, J. ' Ybc!zb, -a i. 2. iY,kq& ' . \ cus s. '



Office of Legacy Management (LM)

ANALYTICAL DEPT. - HEALTH AhD SAFETY DlVlSlDN I -. . Industrial Hygiene or Medical Dept. 1956 I. H.# 984 Sample Nos. l2 Date Collected- o/2g by&- Route to J" Location SSi4.X CUiTn! CXJitP. Type of Sample&-dust Analyzed for F Alpha x Remarks P~UXC~JGIi.' ON. 14lCI11~ U Beta - IIoll0Wi.n~ slucs - NO, Ra Oil PH Be Th Sample No. 7573p Hour Sample Description 1355 CZ Orxxator sets slul: into place, closes shield over machine S starts &ill. oil coolant flows through hollow drill ____ 3 is rebounded back through an openiq covers 1 cor.lp N9 8775 Analytical Chemistry Section: Date Received 7-2-66 by hb Date Reported 74X& bY IIR Method of Analysis Alpha sdntillation cam 2 % ' CJly Counting Data: BKGD .27 c/min GE0 4o% /min 1 I c- d/ill/M 3


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


NIST Fundamental Constants Data Center 1994 - FCDC  

Science Conference Proceedings (OSTI)

Fundamental Constants Data Center. Technical Highlights. Measurement Uncertainty - 1994 Edition of NIST TN 1297. In ...


Comparison of Agricultural Run-off between Biological Farming and  

E-Print Network (OSTI)

samples had lower NOx : TN ratios 78% of BASIC samples had lower PO4 : TP ratios 100% of Organic samples had lower NOx : TN ratios 50% of Organic samples had lower PO4 : TP ratios #12;Flow-weighed Nutrient Loads Generally Lower 21% TN load reduction 87% TP load reduction 24% TN load reduction 14% TP load


Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro



Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...


Intrusion detection and monitoring for wireless networks.  

SciTech Connect

Wireless computer networks are increasing exponentially around the world. They are being implemented in both the unlicensed radio frequency (RF) spectrum (IEEE 802.11a/b/g) and the licensed spectrum (e.g., Firetide [1] and Motorola Canopy [2]). Wireless networks operating in the unlicensed spectrum are by far the most popular wireless computer networks in existence. The open (i.e., proprietary) nature of the IEEE 802.11 protocols and the availability of ''free'' RF spectrum have encouraged many producers of enterprise and common off-the-shelf (COTS) computer networking equipment to jump into the wireless arena. Competition between these companies has driven down the price of 802.11 wireless networking equipment and has improved user experiences with such equipment. The end result has been an increased adoption of the equipment by businesses and consumers, the establishment of the Wi-Fi Alliance [3], and widespread use of the Alliance's ''Wi-Fi'' moniker to describe these networks. Consumers use 802.11 equipment at home to reduce the burden of running wires in existing construction, facilitate the sharing of broadband Internet services with roommates or neighbors, and increase their range of ''connectedness''. Private businesses and government entities (at all levels) are deploying wireless networks to reduce wiring costs, increase employee mobility, enable non-employees to access the Internet, and create an added revenue stream to their existing business models (coffee houses, airports, hotels, etc.). Municipalities (Philadelphia; San Francisco; Grand Haven, MI) are deploying wireless networks so they can bring broadband Internet access to places lacking such access; offer limited-speed broadband access to impoverished communities; offer broadband in places, such as marinas and state parks, that are passed over by traditional broadband providers; and provide themselves with higher quality, more complete network coverage for use by emergency responders and other municipal agencies. In short, these Wi-Fi networks are being deployed everywhere. Much thought has been and is being put into evaluating cost-benefit analyses of wired vs. wireless networks and issues such as how to effectively cover an office building or municipality, how to efficiently manage a large network of wireless access points (APs), and how to save money by replacing an Internet service provider (ISP) with 802.11 technology. In comparison, very little thought and money are being focused on wireless security and monitoring for security purposes.

Thomas, Eric D.; Van Randwyk, Jamie A.; Lee, Erik J.; Stephano, Amanda (Indiana University); Tabriz, Parisa (University of Illinois at Urbana-Champaign); Pelon, Kristen (Cedarville University); McCoy, Damon (University of Colorado, Boulder); Lodato, Mark (Lafayette College); Hemingway, Franklin (University of New Mexico); Custer, Ryan P.; Averin, Dimitry (Polytechnic University); Franklin, Jason (Carnegie Mellon University); Kilman, Dominique Marie



Michael L. Corradini Nuclear Engineering & Engineering Physics -Birthdate -8/6/52, US Citizen 1500 Engineering Drive, Madison WI -Phone: 608-263-1648 -Email: Corradini@engr.wisc.edu  

E-Print Network (OSTI)

's Award in Nuclear Reactor Safety -1984 * Member of the Wisconsin Radioactive Waste Review Board Technical and ACCOMPLISHMENTS * Awarded the NSF Presidential Young Investigator's Award, 1984 * American Nuclear Society Reactor.Budnitz, M.Pilch, "Perspectives on Advanced Simulation for Nuclear Reactor Safety Applications", Nuclear

Volpe, Francesco


1300 Linden Drive Madison, WI 53706-1524 (608) 262-4847 www.sohe.wisc.eduVol.11, No.1 Spring 2008 impactSchool of Human Ecology  

E-Print Network (OSTI)

. Carbone, K. Saarnio, S. Saarikoski, T. Makela, M. Kulmala, V.-M. Kerminen, D.R. Worsnop, and R. Hillamo

Sheridan, Jennifer


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 - 13230 of 28,905 results. 21 - 13230 of 28,905 results. Event Renewable Energy Market Update Webinar Attendees will learn about the latest developments of the five types of renewable energy technologies (biomass, geothermal, low-head hydro, solar, and wind). Attendees will also get comfortable... http://energy.gov/indianenergy/events/renewable-energy-market-update-webinar Event Local Event X-10- Oak Ridge, TN Local Event X-10 - Oak Ridge, TN http://energy.gov/hss/events/local-event-x-10-oak-ridge-tn-1 Event Local Event Y-12- Oak Ridge, TN Local Event Y-12 - Oak Ridge, TN http://energy.gov/hss/events/local-event-y-12-oak-ridge-tn-6 Event Local Event X-10- Oak Ridge, TN Local Event X-10 - Oak Ridge, TN http://energy.gov/hss/events/local-event-x-10-oak-ridge-tn-3 Download CX-011024: Categorical Exclusion Determination


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000239 FOA-0000239 Prime: Azure Dynamics, Subs: Multi. EE DE-EE0005408 PMC/PVT 2011 Ron Harp 10/1/2011 - 9/30/2014 Multiple sites - PA, MI, MA, VT,WI, CO Fully-Integrated Automotive Traction Inverter with Real-Time Switching Optimization (SUMMARY CX) The objective of this project is to conduct power inverter research, development, and demonstration capable of achieving inverter efficiency targets. 09 19 2011 Rondle E Harp Digitally signed by Rondle E Harp DN: cn=Rondle E Harp, o=PMC, ou=PVTD, email=rondle.harp@netl.doe.gov, c=US Date: 2011.09.19 12:57:41 -04'00' 9 26 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.09.26 15:23:43 -04'00' Comprehensive list of subcontractors and six locations covered by this Summary CX has been provided to


1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael

Note: This page contains sample records for the topic "tn wi mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...




Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan




SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass



Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL



SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan
