Powered by Deep Web Technologies
Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ESC TN Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

60% 80% 100% US ESC TN OtherNone Propane Electricity Natural Gas MAIN HEATING FUEL USED COOLING EQUIPMENT USED DIVISION: East South Central (ESC) STATES INCLUDED: Alabama,...


US ESC TN Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

ESC TN ESC TN Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ESC TN Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US ESC TN Site Consumption kilowatthours $0 $400 $800 $1,200 $1,600 US ESC TN Expenditures dollars ELECTRICITY ONLY average per household * Tennessee households consume an average of 79 million Btu per year, about 12% less than the U.S. average. * Average electricity consumption for Tennessee households is 33% higher than the national average and among the highest in the nation, but spending for electricity is closer to average due to relatively low electricity prices. * Tennessee homes are typically newer, yet smaller in size, than homes in other parts of the country.


Category:Memphis, TN | Open Energy Information  

Open Energy Info (EERE)

Memphis, TN Memphis, TN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Memphis, TN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Memphis TN City of Memphis Tennessee (Utility Company).png SVFullServiceRestauran... 66 KB SVHospital Memphis TN City of Memphis Tennessee (Utility Company).png SVHospital Memphis TN ... 69 KB SVLargeHotel Memphis TN City of Memphis Tennessee (Utility Company).png SVLargeHotel Memphis T... 67 KB SVLargeOffice Memphis TN City of Memphis Tennessee (Utility Company).png SVLargeOffice Memphis ... 70 KB SVMediumOffice Memphis TN City of Memphis Tennessee (Utility Company).png SVMediumOffice Memphis... 65 KB SVMidriseApartment Memphis TN City of Memphis Tennessee (Utility Company).png


Category:Nashville, TN | Open Energy Information  

Open Energy Info (EERE)

Nashville, TN Nashville, TN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Nashville, TN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Nashville TN City of Memphis Tennessee (Utility Company).png SVFullServiceRestauran... 67 KB SVHospital Nashville TN City of Memphis Tennessee (Utility Company).png SVHospital Nashville T... 71 KB SVLargeHotel Nashville TN City of Memphis Tennessee (Utility Company).png SVLargeHotel Nashville... 68 KB SVLargeOffice Nashville TN City of Memphis Tennessee (Utility Company).png SVLargeOffice Nashvill... 71 KB SVMediumOffice Nashville TN City of Memphis Tennessee (Utility Company).png SVMediumOffice Nashvil... 67 KB SVMidriseApartment Nashville TN City of Memphis Tennessee (Utility Company).png


Murdock Road Knoxville.TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

702 702 Murdock Road Knoxville.TN 37932 Tel: (609) 921-1456 Fax: (609) 92 1-8703 AA\W.nell-one.com March 25,2009 Office of the Assistant General Counsel for Technology Transfer and Intellectual Property U.S. Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Attn: Technology Transfer Questions Subject: Questions Concerning Technology Transfer Practices at DOE Laboratories (Federal RegisterNol. 73, No. 229/ November 26,2008 /Notices) Dear Mr. Gottlieb, Thank you for the opportunity to respond to the questions published in the Federal Register. As Chief Executive Officer of Nell One Therapeutics, a spin-out company which is in the process of licensing technology from Oak Ridge National Laboratory (ORNL), I found the questions to be highly relevant to our experiences. While many great technologies and capabilities reside in the National Laboratories



NLE Websites -- All DOE Office Websites (Extended Search)

2005 Hurricanes on the Natural Gas Industry in the Gulf of Mexico Region Mexico FL GA SC AL MS LA TX AR TN TN Katrina - Cumulative wind > 39 mph Katrina - Cumulative wind > 73 mph...


DOE - Office of Legacy Management -- Springdale PA - PA 11  

Office of Legacy Management (LM)

Springdale PA - PA 11 Springdale PA - PA 11 FUSRAP Considered Sites Springdale, PA Alternate Name(s): C.H. Schnoor - Misspelling of Schnorr from historical documents Conviber, Inc. Premier Manufacturing Company Unity Railway Supply Company PA.11-1 PA.11-2 PA.11-4 PA.11-9 Location: 644 Garfield Street, Springdale, Pennsylvania PA.11-2 Historical Operations: Machined extruded uranium for the Hanford Pile Project to produce an alternate charge for the Hanford reactor and machined uranium slugs for MED contractors. PA.11-9 Eligibility Determination: Eligible PA.11-4 PA.11-5 Radiological Survey(s): Assessment Surveys, Verification Surveys PA.11-4 PA.11-6 PA.11-7 PA.11-8 Site Status: Certified - Cleanup completed - Certification Basis, Federal Register Notice Included PA.11-9


DOE - Office of Legacy Management -- Springdale PA - PA 11  

NLE Websites -- All DOE Office Websites (Extended Search)

Springdale PA - PA 11 Springdale PA - PA 11 FUSRAP Considered Sites Springdale, PA Alternate Name(s): C.H. Schnoor - Misspelling of Schnorr from historical documents Conviber, Inc. Premier Manufacturing Company Unity Railway Supply Company PA.11-1 PA.11-2 PA.11-4 PA.11-9 Location: 644 Garfield Street, Springdale, Pennsylvania PA.11-2 Historical Operations: Machined extruded uranium for the Hanford Pile Project to produce an alternate charge for the Hanford reactor and machined uranium slugs for MED contractors. PA.11-9 Eligibility Determination: Eligible PA.11-4 PA.11-5 Radiological Survey(s): Assessment Surveys, Verification Surveys PA.11-4 PA.11-6 PA.11-7 PA.11-8 Site Status: Certified - Cleanup completed - Certification Basis, Federal Register Notice Included PA.11-9


Invenergy TN LLC | Open Energy Information  

Open Energy Info (EERE)

Tennessee Sector Wind energy Product Wholly-owned subsidiary of Invenergy Wind developing wind farms in Tenessee. References Invenergy TN LLC1 LinkedIn Connections CrunchBase...


AOCS Official Method Tn 2a-86  

Science Conference Proceedings (OSTI)

Flash Point of Fatty Quaternary Ammonium Chloride, Closed Cup Method (Modified Closed Cup Method, ASTM Designation D 93-80) AOCS Official Method Tn 2a-86 Methods Downloads Methods Downloads DEFINITION This method


AOCS Official Method Tn 1a-64  

Science Conference Proceedings (OSTI)

Flash and Fire Points, Cleveland Open Cup Method AOCS Official Method Tn 1a-64 Methods Downloads Methods Downloads DEFINITION This method determines the temperature at which the test sample will flash and burn....


DOE - Office of Legacy Management -- Knoxville Iron Co - TN 07  

Office of Legacy Management (LM)

Knoxville Iron Co - TN 07 Knoxville Iron Co - TN 07 FUSRAP Considered Sites Site: KNOXVILLE IRON CO. (TN.07 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Knoxville , Tennessee TN.07-1 Evaluation Year: 1994 TN.07-2 TN.07-3 Site Operations: Melted uranium contaminated scrap metal in order to test industrial hygiene procedures in the mid-1950s. TN.07-1 Site Disposition: Eliminated - AEC license TN.07-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Limited Quantities of Uranium Contained in Slag Material TN.07-4 Radiological Survey(s): Yes - health and safety monitoring during operations only TN.07-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to KNOXVILLE IRON CO.



NLE Websites -- All DOE Office Websites (Extended Search)

8 8 SLAC-TN-04-051 Sep. 2004 (Jan. 2005) Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Electron Conditioning of Technical Aluminum Surfaces ¤ F. Le Pimpec, F. King, and R. E. Kirby


AT-TN: Mr. R. L. Rudolph  

Office of Legacy Management (LM)

MAR 1 ? 7982 MAR 1 ? 7982 3echW tiational, Inc. AT-TN: Mr. R. L. Rudolph PO Box 350 Oak Ridge, TFi 37830 Gentlemen: CRITERIA FOR REMEDIAL ACTION AT ACID/PUEBLO AND BAY0 CANYONS; REQUEST FOR COST/BENEFIT ANALYSES OF REMEDIAL ACTION OPTIONS AT THE CANYONS Enclosed are several pieces of cqrespondence related to AcldjPueblo * and Bayo Canyons. . . . . . . . . . . . . . First, EP has concurred with the remedial action DATE criteria for the New Mexico sftes that were proposed to them on August 20, 1987 (wfth the addition of a criterion for Pu-239 added RTG SYMBO, October 20, 7981). In summary, the cri terla will be: . . . . . . . IUITI*LSSIG. f ---- Radionuclfdt Sr-90 cs-137 Th-228 Th-230 Th-232 u-234 U-238 Pu-239 Pu-240 Pu-241 Am-241 Sofl Limft (pCi/g) 100 80


East North Central Pa  

Gasoline and Diesel Fuel Update (EIA)

East East North Central Pa cif ic Contiguous Mountain West North Central West South Central Pacific Noncontiguous East South Central Sout h At lant ic Middle Atlantic New England 35. Average Price of Natural Gas Delivered to Consumers by Census Division, 1995-1996 (Dollars per Thousand Cubic Feet) Table Census Division Residential Commercial 1995 1996 1995 1996 New England ........................................................... 9.06 9.03 6.78 6.96 Middle Atlantic ......................................................... 7.75 8.00 6.04 6.57 East North Central ................................................... 5.05 5.44 4.57 4.94 West North Central .................................................. 4.97 5.54 4.08 4.71 South Atlantic........................................................... 6.89 7.50 5.33 6.14 East South Central...................................................


DOE - Office of Legacy Management -- Oak Ridge TN Warehouse Site...  

Office of Legacy Management (LM)

Warehouses Site. This site is managed by the U.S. Department of Energy Office of Legacy Management. Aerial photograph of the Oak Ridge, Tennessee, Site TN.09-1 - DOE...


DOE - Office of Legacy Management -- Vitro Corp of America - TN 04  

Office of Legacy Management (LM)

TN 04 TN 04 FUSRAP Considered Sites Site: Vitro Corp. of America (TN.04) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Heavy Minerals Company Vitro Chemical Company TN.04-4 TN.04-5 Location: 4000 North Hawthorne Street , Chattanooga , Tennessee TN.04-5 Evaluation Year: 1990 TN.04-1 Site Operations: Processed mineral monazite to produce a thorium-uranium hydroxide and a series of rare earth products. TN.04-4 Site Disposition: Eliminated - Site licensed by AEC and State of Tennessee - No Authority to perform remedial action under FUSRAP TN.04-2 TN.04-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium Metal, ThF4, Thorium Oxide TN.04-1 Radiological Survey(s): None Indicated


Category:Pittsburgh, PA | Open Energy Information  

Open Energy Info (EERE)

Pittsburgh, PA Pittsburgh, PA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Pittsburgh, PA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Pittsburgh PA PECO Energy Co.png SVFullServiceRestauran... 65 KB SVHospital Pittsburgh PA PECO Energy Co.png SVHospital Pittsburgh ... 60 KB SVLargeHotel Pittsburgh PA PECO Energy Co.png SVLargeHotel Pittsburg... 60 KB SVLargeOffice Pittsburgh PA PECO Energy Co.png SVLargeOffice Pittsbur... 61 KB SVMediumOffice Pittsburgh PA PECO Energy Co.png SVMediumOffice Pittsbu... 63 KB SVMidriseApartment Pittsburgh PA PECO Energy Co.png SVMidriseApartment Pit... 64 KB SVOutPatient Pittsburgh PA PECO Energy Co.png SVOutPatient Pittsburg... 62 KB SVPrimarySchool Pittsburgh PA PECO Energy Co.png


Category:Philadelphia, PA | Open Energy Information  

Open Energy Info (EERE)

PA PA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Philadelphia, PA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Philadelphia PA PECO Energy Co.png SVFullServiceRestauran... 65 KB SVHospital Philadelphia PA PECO Energy Co.png SVHospital Philadelphi... 59 KB SVLargeHotel Philadelphia PA PECO Energy Co.png SVLargeHotel Philadelp... 60 KB SVLargeOffice Philadelphia PA PECO Energy Co.png SVLargeOffice Philadel... 61 KB SVMediumOffice Philadelphia PA PECO Energy Co.png SVMediumOffice Philade... 63 KB SVMidriseApartment Philadelphia PA PECO Energy Co.png SVMidriseApartment Phi... 64 KB SVOutPatient Philadelphia PA PECO Energy Co.png SVOutPatient Philadelp... 62 KB SVPrimarySchool Philadelphia PA PECO Energy Co.png


DOE - Office of Legacy Management -- Carpenter Steel Co - PA...  

Office of Legacy Management (LM)

included uranium hot rolling tests. PA.12-3 PA.12-4 Site Disposition: Eliminated - Radiation levels below criteria PA.12-1 PA.12-3 PA.12-5 Radioactive Materials Handled: Yes...

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.



Office of Legacy Management (LM)

e e D"E(:pa . EFG (0744 United States Government .;,~&ljy gb' /fq Department of Eneigy memorandum JUN 4 1992 DATE: REPLY TO ATTN OF: EM-421 (W. A. Williams, 903-8149) SUBJECT: Authority Determination -- Springdale, Pennsylvania Former C. H. Schnoor & Company facility, TO: The File The attached review documents the basis for determining whether DOE has authority for taking remedial action at the former C. H. Schnoor & Company facility in Springdale, Pennsylvania, under the Formerly Utilized Sites Remedial Action Program (FUSRAP). The facility was used for the shaping of uranium by the Manhattan Engineer District (MED) during the Second World War. The following factors are significant in reaching a decision and are discussed in more detail in the attached authority review:


DOE - Office of Legacy Management -- Aliquippa - PA 07  

Office of Legacy Management (LM)

Aliquippa - PA 07 Aliquippa - PA 07 FUSRAP Considered Sites Aliquippa, PA Alternate Name(s): Cyclops Corporation, Titusville Plant Univesal Cyclops, Inc Aliquippa Forge Site Vulcan Crucible Site PA.07-2 PA.07-4 Location: 100 First Street, Aliquippa, Pennsylvania PA.07-4 Historical Operations: During the late 1940s, performed metal fabrication services under contracct with the AEC that included rolling natural uranium metal into rods. PA.07-3 PA.07-5 PA.07-6 PA.07-7 Eligibility Determination: Eligible PA.07-1 Radiological Survey(s): Assessment Surveys, Verification Surveys PA.07-8 PA.07-9 PA.07-10 PA.07-11 PA.07-12 Site Status: Certified- Certification Basis, Federal Register Notice included PA.07-4 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


BatPaC - Battery Performance and Cost model - Home  

NLE Websites -- All DOE Office Websites (Extended Search)

> BatPaC Home About BatPaC Download BatPaC Contact Us BatPaC: A Lithium-Ion Battery Performance and Cost Model for Electric-Drive Vehicles The recent penetration of...



Office of Legacy Management (LM)

;;;;!r;; c"/ I%- , 2.1 + 2- ;;;;!r;; c"/ I%- , 2.1 + 2- llnited States Government Department of Energy memorandum Fw?fw --&a Gt3 .I\ DATE: Af'R 8 1991 REPLY TO Al-TN OF: EM-421 SUBJECT: Elimination of the Magnus Brass Manufacturing Company from FUSRAP TO: The File The Magnus Brass Manufacturing Company Sites are hereby eliminated from consideration in the Department of Energy's Formerly Utilized Sites Remedial Action Program (FUSRAP). The Department of Energy does not have the authority under the Atomic Energy Act to further investigate the sites, which are located at 533 Reading Road and 1029 West Seventh Street in Cincinnati, Ohio. The lack of authority is more fully explained in the attached Authority Review. The Department of Energy does not have any further information concerning the radiological status of the sites;


Y-12 and East TN Public Broadcasting System ? A Nuclear Family...  

NLE Websites -- All DOE Office Websites (Extended Search)

East TN Public Broadcasting System - A Nuclear Family Video Miniseries The fourth and final episode of A Nuclear Family: Y-12 National Security Complex documentary film miniseries...


DOE - Office of Legacy Management -- Frankford Arsenal - PA 21  

Office of Legacy Management (LM)

Frankford Arsenal - PA 21 Frankford Arsenal - PA 21 FUSRAP Considered Sites Site: Frankford Arsenal (PA.21 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Pitman -Dunn Laboratories Dept. , Philadelphia , Pennsylvania PA.21-1 Evaluation Year: 1987 PA.21-2 Site Operations: Conducted research involving the use of uranium tetrachloride and metal fabrication operations with uranium metal. PA.21-2 PA.21-4 PA.21-5 Site Disposition: Eliminated - Referred to DOD PA.21-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.21-2 PA.21-3 PA.21-4 PA.21-5 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD PA.21-2


Palmco Power PA, LLC | Open Energy Information  

Open Energy Info (EERE)

PA, LLC Place New York Utility Id 56573 Utility Location Yes Ownership R Operates Generating Plant Yes References EIA Form EIA-861 Final Data File for 2010 - File1a1 LinkedIn...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NllPA DETERMINATION NllPA DETERMINATION REClPI[NT:General Molors LlC Page I 0[2 STATE: MI PROJECf TITLE: Investigation of Micra.andMacro-scale Transport Processes for Improved Fuel Cell Performance Funding Opportunity Announcement Number Proc:urement Instrument Number NEPA Control Number CID Number DE·PS36-08G098OO9 EE0000470 GF0-10-353 EE470 Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA},1 have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: B3.6 Siting, construction (or modification). operation, and decommissioning of facilities for indoor bench-scale research projects and conventional laboratory operations (fOf example, preparation of chemical standards and sample analYSIS);


Cell, Vol. 29, 551-559, June 1982, Copyright 0 1982 by MIT Directed Transposon Tn5 Mutagenesis and  

E-Print Network (OSTI)

(nif) was cloned from the genome of the symbiotic nitrogen-fixing species Rhizobium meliloti. A total of 31 Tn5 insertions in the nif region were constructed and assayed for their effect on symbiotic between genomic nif: :TnS insertions and nif: :Tn5 insertions on mo- bilizable cloning vectors

Ausubel, Frederick M.


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


US MidAtl PA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MidAtl PA MidAtl PA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl PA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl PA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl PA Expenditures dollars ELECTRICITY ONLY average per household * Pennsylvania households consume an average of 96 million Btu per year, 8% more than the U.S. average. Pennsylvania residents also spend 16% more than the average U.S. households for energy consumed in their homes. * Average electricity consumption in Pennsylvania homes is 10,402 kWh per year, which is lower than the national average, but 58% more than New York households and 17% more than New Jersey residents.


US MidAtl PA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MidAtl PA MidAtl PA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl PA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl PA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl PA Expenditures dollars ELECTRICITY ONLY average per household * Pennsylvania households consume an average of 96 million Btu per year, 8% more than the U.S. average. Pennsylvania residents also spend 16% more than the average U.S. households for energy consumed in their homes. * Average electricity consumption in Pennsylvania homes is 10,402 kWh per year, which is lower than the national average, but 58% more than New York households and 17% more than New Jersey residents.


PA Sangli Bundled Wind Project | Open Energy Information  

Open Energy Info (EERE)

PA Sangli Bundled Wind Project Jump to: navigation, search Name PA Sangli Bundled Wind Project Place Maharashtra, India Zip 416115 Sector Wind energy Product Ichalkaranji-based SPV...


NETL: Science Bowl Information - Southwestern PA  

NLE Websites -- All DOE Office Websites (Extended Search)

Science Bowl Information > Science Bowl Information - South West PA Science Bowl Information > Science Bowl Information - South West PA Educational Initiatives Science Bowl Information - Southwestern PA Facebook Visit us on Facebook CLICK ON IMAGE TO SEE LARGER VIEW SWPA SWPA SWPA 2012 SWPA Science Bowl Results Congratulations! North Allegheny High School and Ingomar Middle School The finals for the SWPA Science Bowl were held on March 7th. The winner of the SWPA High School Science Bowl is North Allegheny High School. The winner of the SWPA Middle School Science Bowl is Ingomar Middle School Team 2 from the North Allegheny School District. The final team results are High School: 1st - North Allegheny HS 2nd - Mt. Lebanon HS 3rd - Baldwin HS 4th - Pine-Richland HS Middle School: 1st - Ingomar MS Team 2 (North Allegheny School District)


Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area (Redirected from New York Area - NY NJ CT PA) Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Jessop Steel Co - PA 17  

Office of Legacy Management (LM)

Jessop Steel Co - PA 17 Jessop Steel Co - PA 17 FUSRAP Considered Sites Site: JESSOP STEEL CO. (PA.17 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 500 Green Street , Washington , Pennsylvania PA.17-3 Evaluation Year: 1991 PA.17-1 Site Operations: Metal fabrication for the AEC in the early 1950s. PA.17-1 Site Disposition: Eliminated - Limited quantities of radioactive material handled on site - Potential for residual radioactive contamination is considered remote - Confirmed by radiological survey PA.17-1 PA.17-2 PA.17-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.17-1 Radiological Survey(s): Yes PA.17-3 Site Status: Eliminated from further consideration under FUSRAP


De l'utilite de l'hermeneutique des Tantra bouddhiques a propos d'un expose de l'appareit des Sept Ornements par un doxologue erudit dge lugs pa dBal mang dKon mchog rgyal mtshan (1764-1863)  

E-Print Network (OSTI)

) et son interprtation, v. P. Arnes (2002-a) : pp. 23-25 et n. 77-79. 31 Sa skya Pandita Kun dga rgyal mtshan (1182-1251), mKhas pa rnamsjug pai sgo zhes bya bai bstan bcos, (dornavant mKhas pa rnamsjug pai sgo), Mi rigs dpe skrun khang, 1981... don gsal ba sgron me, dans The Collected Works of Gu?-tha? dKon-mchog bstan- pai sgron-me, vol.1., 1971, p. 707 : sbas don ni bla mai man ngag gis ma bstan par rang dbang du dpyad pas rtogs mi nus pa zhig yin / ; pour le sens cach, v. ltude qui...

Arenes, Pierre




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Bettis Atomic Power Laboratories - PA  

Office of Legacy Management (LM)

Bettis Atomic Power Laboratories - Bettis Atomic Power Laboratories - PA 44 FUSRAP Considered Sites Site: Bettis Atomic Power Laboratories (PA.44 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Allegheny County , West Mifflin , Pennsylvania PA.44-1 Evaluation Year: Circa 1987 PA.44-2 Site Operations: Conducted activities directed toward the design, development, testing, and operational follow of nuclear reactor propulsion plants for Naval surface and submarine vessels. PA.44-1 Site Disposition: Eliminated - Active DOE facility PA.44-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Radioactive Materials Associated with Reactor Operation PA.44-3 Radiological Survey(s): None Indicated


Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026


DOE - Office of Legacy Management -- Foote Mineral Co - PA 27  

NLE Websites -- All DOE Office Websites (Extended Search)

Foote Mineral Co - PA 27 Foote Mineral Co - PA 27 FUSRAP Considered Sites Site: Foote Mineral Co. (PA.27 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Exton , Pennsylvania PA.27-1 Evaluation Year: 1987 PA.27-1 Site Operations: Processed rare earth, principally zirconium and monazite sand was processed on a pilot-plant scale. PA.27-2 Site Disposition: Eliminated - Limited quantity of material handled - Potential for contamination considered remote PA.27-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Zirconium, Possibly Uranium PA.27-1 PA.27-2 PA.27-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Foote Mineral Co.


DOE - Office of Legacy Management -- Sharples Corp - PA 29  

NLE Websites -- All DOE Office Websites (Extended Search)

Sharples Corp - PA 29 Sharples Corp - PA 29 FUSRAP Considered Sites Site: SHARPLES CORP. (PA.29 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 201 Spring Garden Street , Philadelphia , Pennsylvania & Philadelphia , Pennsylvania PA.29-2 PA.29-1 Evaluation Year: 1986 PA.29-1 Site Operations: Producer/broker of special chemicals - major MED supplier. PA.29-2 PA.29-3 Site Disposition: Eliminated - No indication that radioactive materials were used on the site PA.29-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to SHARPLES CORP. PA.29-1 - Memorandum/Checklist; D. Levine to the File; Subject:


DOE - Office of Legacy Management -- Heppanstall Co - PA 19  

Office of Legacy Management (LM)

Heppanstall Co - PA 19 Heppanstall Co - PA 19 FUSRAP Considered Sites Site: Heppanstall Co. (PA.19 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Tippens Inc. PA.19-1 Location: 4620 Hatfield Street , Pittsburgh , Pennsylvania PA.19-4 Evaluation Year: 1987 PA.19-2 Site Operations: Forged approximately 100,000 pounds of uranium during a six month period in 1955. PA.19-1 Site Disposition: Eliminated - Potential for contamination remote. Radiological screening survey results indicate radiation levels well below DOE guidelines. Conditions at site meet applicable requirements - No further investigation of site necessary. PA.19-1 PA.19-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.19-3


DOE - Office of Legacy Management -- Beryllium Corp - PA 39  

NLE Websites -- All DOE Office Websites (Extended Search)

Beryllium Corp - PA 39 Beryllium Corp - PA 39 FUSRAP Considered Sites Site: BERYLLIUM CORP. (PA.39 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Brush Beryllium PA.39-1 Location: Reading , Pennsylvania PA.39-1 Evaluation Year: 1987 PA.39-1 Site Operations: Production of Beryllium circa late 1940s - 50s. PA.39-1 Site Disposition: Eliminated - No radioactive material handled at this site, only Beryllium PA.39-1 Radioactive Materials Handled: No PA.39-1 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to BERYLLIUM CORP. PA.39-1 - Memorandum/Checklist; D. Levine to the File; Subject:


Technical Insights for Saltstone PA Maintenance  

Science Conference Proceedings (OSTI)

The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure & Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and compatibility with existing CBP expertise and already-planned activities. Based on these criteria, the five original topics were down-selected to two: external sulfate attack and mechanistic geochemical prediction. For each of the selected topics, the CBP communicated with the PA analysts and subject matter experts at Savannah River to acquire input data specific to the Saltstone facility and related laboratory experiments. Simulations and analyses were performed for both topics using STADIUM (SIMCO 2008), LeachXS/ORCHESTRA (ECN 2007, Meeussen 2003), and other software tools. These supplemental CBP analyses produced valuable technical insights that can be used to strengthen the Saltstone PA using the ongoing PA maintenance process. This report in part summarizes key information gleaned from more comprehensive documents prepared by Sarkar et al. (2010), Samson (2010), and Sarkar (2010).

Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.




Office of Legacy Management (LM)

PA.03 PA.03 ? A' EROSPACE~CORPORATI' ON / A. Plato, S. W., Washington, D. C. ZOOZJ. Telephone: (20.2) 488.6000 7117-Oli85.cdy.X 30'Septemberl985 Mr. Arthur Whitman, NE-24 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Whitman: AUTHORITY ,REVIEW. - THE FORMER SUPERIOR,STEEL CORPORATION SITE - AECCONTRACT NO. AT(30-l)- 1412 Aer0spac.e has completed.assembly and analysis.of, available documentation,, and'.prepared the,subject review for'your consideration and. determination ifthere.is authority for. remedial action. under FUSRAP' at the former Superior SteellCorporation facility in-Carnegie, Pennsylvania. As indica,ted,in the attached~review, the Superior Steel Corporation was one of three principal contractors involved in AEC's initial fuel element


DOE - Office of Legacy Management -- Philadelphia Navy Yard - PA 08  

NLE Websites -- All DOE Office Websites (Extended Search)

Philadelphia Navy Yard - PA 08 Philadelphia Navy Yard - PA 08 FUSRAP Considered Sites Site: PHILADELPHIA NAVY YARD (PA.08) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Philadelphia , Pennsylvania PA.08-1 Evaluation Year: 1987 PA.08-1 Site Operations: Abelson's S-50 thermal diffusion pilot plant was built and operated on this facility in 1944 and large quantities of uranium hexafluoride were processed in 1945. PA.08-1 Site Disposition: Eliminated - Referred to DOD PA.08-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium oxide (hexaflouride) PA.08-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD PA.08-1


Summary - Mitigation and Remediation of Mercury Contamination at the Y-12 Plant, Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oak Ridge, TN Oak Ridge, TN EM Project: Mitigation/Remediation of Hg ETR Report Date: April 2008 ETR-13 United States Department of Energy Office of Environmental Management (DOE-EM) External Technical Review of the Mitigation and Remediation of Mercury Contamination at the Y-12 Plant, Oak Ridge, TN Why DOE-EM Did This Review From 1953 to 1983, ~240,000 pounds of mercury (Hg) were released to the East Fork Popular Creek during the operation of the Y-12 Plant. In 1963, direct systematic releases of mercury stopped; however, mercury continues to be released into the creek from various sources of contamination in the Y-12 complex. Remediation completed up to 1992 resulted in an overall reduction of Hg loading from 150 g/day in 1983 to 15 g/day in 1992, with a


Summary - Environmental Management Waste Management Facility (EMWMF) at Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oak Ridge, TN Oak Ridge, TN EM Project: EM Waste Management Facility ETR Report Date: February 2008 ETR-11 United States Department of Energy Office of Environmental Management (DOE-EM) External Technical Review of Environmental Management Waste Management Facility (EMWMF) at Oak Ridge, TN Why DOE-EM Did This Review The Environmental Management Waste Management Facility (EMWMF) is a land disposal facility for wastes generated by environmental restoration activities being conducted at the US Department of Energy's (DOE) Oak Ridge Reservation. Low-level radioactive wastes, hazardous wastes (Subtitle C of the Resource Conservation and Recovery Act), and wastes defined by the Toxic Substances Control Act are approved for disposal in the EMWMF. All of the cells are lined with a


DOE - Office of Legacy Management -- W R Grace - Erwin - TN 05  

Office of Legacy Management (LM)

- Erwin - TN 05 - Erwin - TN 05 FUSRAP Considered Sites Site: W R Grace - Erwin (TN.05) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 5 FUSRAP considered sites for which records are available that provide a reasonably complete historical account of their operations and relationship, if any, with MED/AEC operations. However, additional analyses of these historical records, and more recent documentation of decisions concerning the authority and other considerations related to the elimination of these sites from further consideration under FUSRAP is warranted. These analyses will provide the


DOE - Office of Legacy Management -- Union Carbide and Carbon Co - TN 10  

Office of Legacy Management (LM)

Carbide and Carbon Co - TN 10 Carbide and Carbon Co - TN 10 FUSRAP Considered Sites Site: Union Carbide and Carbon Co (TN.10) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 5 FUSRAP considered sites for which records are available that provide a reasonably complete historical account of their operations and relationship, if any, with MED/AEC operations. However, additional analyses of these historical records, and more recent documentation of decisions concerning the authority and other considerations related to the elimination of these sites from further consideration under FUSRAP is warranted. These analyses will provide the


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Catalytic Co - PA 40  

NLE Websites -- All DOE Office Websites (Extended Search)

Catalytic Co - PA 40 Catalytic Co - PA 40 FUSRAP Considered Sites Site: Catalytic Co. (PA.40 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Philadelphia , Pennsylvania PA.40-1 Evaluation Year: 1991 PA.40-1 Site Operations: Prime contractor for construction of the Fernald facility. Records indicate one time shipment of a very small quantity (4 lbs) of uranium metal to this site. PA.40-1 Site Disposition: Eliminated - Construction contractor - Potential for residual contamination from the very small quantity of uranium shipped to this site is considered remote PA.40-2 Radioactive Materials Handled: None - as a construction contractor Primary Radioactive Materials Handled: Uranium Metal - Believed to be a Souvenier. PA.40-1


DOE - Office of Legacy Management -- Summerville Tube Co - PA 24  

NLE Websites -- All DOE Office Websites (Extended Search)

Summerville Tube Co - PA 24 Summerville Tube Co - PA 24 FUSRAP Considered Sites Site: SUMMERVILLE TUBE CO. (PA.24) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Bridgeport , Pennsylvania PA.24-1 Evaluation Year: 1987 PA.24-1 Site Operations: Metal fabrication research and development on uranium metal in the early 1940s - Cold drawing of tuballoy aluminum sheathing. PA.24-1 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote due to limited scope of operations and quantity of radioactive material handled PA.24-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.24-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either



E-Print Network (OSTI)


Hughes, Bruce


EA-1514: Proposed Conveyance of Parcel ED-6 to the City of Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE))

This Environmental Assessment was prepared for the conveyance of approximately 336 acres of excess property (i.e., property not needed to fulfill DOE current or foreseeable future requirements) known as Parcel ED-6 to the city of Oak Ridge, TN.


DOE - Office of Legacy Management -- Shippingport Atomic Power Plant - PA  

Office of Legacy Management (LM)

Shippingport Atomic Power Plant - Shippingport Atomic Power Plant - PA 13 FUSRAP Considered Sites Site: SHIPPINGPORT ATOMIC POWER PLANT (PA.13 ) Eliminated from further consideration under FUSRAP. Designated Name: Not Designated Alternate Name: Duquesne Light Company PA.13-1 Location: 25 miles west of Pittsburgh in Beaver County , Shippingport , Pennsylvania PA.13-2 Evaluation Year: circa 1987 PA.13-3 Site Operations: First commercially operated nuclear power reactor. Joint project (Federal Government an Duquesne Light Company) to demonstrate pressurized water reactor technology and to generate electricity. Plant operated by Duquesne Light Company under supervision of the Office of the DOE Deputy Assistant Secretary for Naval Reactors -- 1957 to October 1982. PA.13-2 Site Disposition: Eliminated - No Authority. DOE chartered Major Project #118, Shippingport Station Decommissioning Project completed cleanup in 1989. PA.13-1


NETL: Science Bowl Information - Southwestern PA  

NLE Websites -- All DOE Office Websites (Extended Search)

2011 SWPA Science Bowl 2011 SWPA Science Bowl CLICK ON IMAGE TO SEE LARGER VIEW SWPA West Chester East Team 1 SWPA Hempfield Team 1 SWPA State College Team 1 and SWPA Winner SWPA Norwin Team 1 Lilas Soukup,SB Coordinator NETL, The Honorable Tim Murphy, U.S. House, Dr. Charlene Newkirk, Dr. Anthony Cugini, Director, NETL Click here to watch the archived webcast of the Southwestern PA Science Bowl Finals High School Congratulations to our four division winners: View full results here Division Einstein - West Chester East Team 1 - Frances Poodry, Coach - Jon C, Captain - Ashish B - Alex C - Dan D Division Carson - Hempfield Team 1 - Thomas Harden, Coach - Jake K, Captain - Chase L - Rob R - Mike T - Priya B Division Tesla - State College Team 1 and SWPA Winner - Christoph S, Captain - Joe L - Monica M


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


File:USDA-CE-Production-GIFmaps-TN.pdf | Open Energy Information  

Open Energy Info (EERE)

TN.pdf TN.pdf Jump to: navigation, search File File history File usage Tennessee Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 332 KB, MIME type: application/pdf) Description Tennessee Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Tennessee External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:21, 27 December 2010 Thumbnail for version as of 16:21, 27 December 2010 1,650 × 1,275 (332 KB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Appalach7-TN-KY-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach7-TN-KY-LIQ.pdf Appalach7-TN-KY-LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 19.31 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



NETL: 2010 SW PA Middle School Science Bowl  

NLE Websites -- All DOE Office Websites (Extended Search)

is open to middle school students (school, scouts, home school) from Southwestern Pennsylvania (SW PA). Complete eligibility requirements are located at the National...


Microsoft PowerPoint - NETL Pittsburgh, PA to Washington, DC...  

NLE Websites -- All DOE Office Websites (Extended Search)

PA. 2. Merge RIGHT via Exit 161 onto I-70 EAST toward BREEZEWOODUS-30 BALTIMOREWASHINGTON, DC (follow US-30 through Breezewood). , ( g ) 3. At FREDERICKSBURG, merge...


Privacy Act (PA) of 1974 | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

(PA) of 1974 | National Nuclear Security Administration (PA) of 1974 | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Privacy Act (PA) of 1974 Home > About Us > Our Operations > NNSA Office of General Counsel > Privacy Act (PA) of 1974 Privacy Act (PA) of 1974 The purpose of the Privacy Act of 1974 (Act), Title 5, United States Code,


Building Energy Software Tools Directory: Power Calc PaK  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Calc PaK Power Calc PaK Power Calc PaK logo Power Calc PaK is smart electrical engineering software with a proprietary database. With just 3 inputs (load kVA, load type, and number of poles), it automatically calculates, and recalculates for changes (upstream and downstream), the entire power distribution system in a building providing more than 300 outputs that are compliant with the National Electrical Code (NEC). Power Calc PaK is a patent-protected innovation (covered by U.S. Patent No. 7,636,650). One bundled calculation integrates all the outputs across all the panelboards and equipment worksheets required for the power distribution system from the branch circuit to the electrical service. A few highlights are: 3 inputs for 300 NEC-compliant outputs; ends tedious and repetitive


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BatPaC - Battery Performance and Cost model - About BatPaC  

NLE Websites -- All DOE Office Websites (Extended Search)

About BatPaC About BatPaC The starting point for this work is based on the decades of battery design work headed by Paul Nelson at Argonne National Laboratory. These design models were based in Microsoft Office Excel® resulting in a flexible and straightforward format. The current effort builds on this previous experience by adding a manufacturing cost calculation as well as increasing the fidelity of the performance calculations all while maintaining efficient calculations (e.g. fractions of a second). The cost of a battery will change depending upon the materials chemistry, battery design, and manufacturing process. Therefore, it is necessary to account for all three areas with a bottom-up cost model. Other bottom-up cost models exist but are not generally available and have not been explicitly detailed in a public document. The motivation for our approach is based on a need for a battery performance and cost model that meets the following requirements:


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Martin-Lf Random and PA-complete Sets  

E-Print Network (OSTI)

A set A is Martin-Lof random iff the class fAg does not have \\Sigma 1 -measure 0. A set A is PA-complete if one can compute relative to A a consistent and complete extension of Peano Arithmetic. It is shown that every Martin-Lof random set either permits to solve the halting problem K or is not PA-complete. This result implies a negative answer to the question of Ambos-Spies and Kucera whether there is a Martin-Lof random set not above K which is also PA-complete.

Frank Stephan



The Sugar Creek zinc deposit, Jackson Co. TN -- Exploration history, geology and mineralization  

SciTech Connect

During the 60's and 70's zinc exploration of central TN and KY was active. The Sugar Creek Project was one of several investigated by Exxon. The discovery hole, Cu 15, was drilled in early 1973. The Sugar Creek Zinc Deposit was acquired by Independence Mining Co. in 1986 and I.M.C. has subsequently completed additional drilling, both stepout and confirmation holes. A total of 137 holes for 300,833 ft have been drilled. The Sugar Creek deposit is a typical Tennessee zinc deposit (Mississippi Valley Type) which occurs in solution collapse breccias in the Lower Ordovician, Knox Dolomite. The Knox consists of fine grained dolomite with interlayered limestones and crystalline dolomite. Only scattered residual limestone is found in the Sugar Creek area. Collapse breccias have formed which control zinc deposition and are similar to other TN Zn. deposits. At Sugar Creek the types of breccias include: a vertically exaggerated glory hole breakthrough breccia which extends to within 137 ft. of the Knox unconformity, has 500 ft. of zinc mineralization with 8 significant zinc intervals; holes with stacked zinc intervals interpreted to be sides of breakthrough breccia; and single zinc intervals in laterally positioned bedded mineral zones. A total of 99 holes were drilled in the more intense mineralized areas. The ratio of ore to non ore holes is nearly 1 to 1. The mineralization is typical M.V.T. with predominantly sphalerite and only minor occurrences of galena, fluorite, pyrite, etc.

Reinbold, G.; Moran, A.V.; Stevens, D.L. (Independence Mining Co. Inc., Reno, NV (United States))



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


PaTu Wind Farm | Open Energy Information  

Open Energy Info (EERE)

PaTu Wind Farm PaTu Wind Farm Jump to: navigation, search Name PaTu Wind Farm Facility PaTu Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Developer Oregon Trail Wind Farm Location Sherman County OR Coordinates 45.603734°, -120.618621° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.603734,"lon":-120.618621,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Palmetto Clean Energy (PaCE) Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Palmetto Clean Energy (PaCE) Program Palmetto Clean Energy (PaCE) Program Palmetto Clean Energy (PaCE) Program < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools State Government Savings Category Bioenergy Biofuels Alternative Fuel Vehicles Buying & Making Electricity Solar Home Weatherization Water Wind Program Info State South Carolina Program Type Performance-Based Incentive Rebate Amount Varies by technology and customer demand for Palmetto Clean Energy (PaCE) Provider South Carolina Energy Office '''''Note: For a limited time, generators of 6 kilowatts or less of renewable energy can now take advantage of a premium $0.10 per kilowatt hour. This premium is available on a first-come-first-serve basis to generators of solar, wind, hydro or biomass-based electricity.'''''



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SBOT 17-May-11 MINING PENNSYLVANIA NATIONAL ENERGY TECHNOLOGY LAB - PA POC Larry Sullivan Telephone (412) 386-6115 Email larry.sullivan@netl.doe.gov Support Activities for Oil and...


Microsoft PowerPoint - NETL Pittsburgh, PA to Washington, DC...  

NLE Websites -- All DOE Office Websites (Extended Search)

Washington, DC Headquarters 1. COCHRANS MILL RD. becomes BROWNSVILLE RD. 2. Stay STRAIGHT to go onto CURRY HOLLOW RDYELLOW BELT. 3 T k th PA 51 SOUTH t d CLAIRTON 3. Take the...


PA -Alternative 2009 FINAL mark revisions 91709green FINAL use...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the insulation , shall inspect the air barrier and insulation. PA304.3 Fireplaces. New wood-burning fireplaces shall have gasketed doors and outdoor combustion air. Exception:...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Vito Cedro III Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7406 vito.cedro@netl.doe.gov Jason S....


DOE - Office of Legacy Management -- Superior Steel Co - PA 03  

Office of Legacy Management (LM)

site; January 27, 1995 PA.03-4 - ORNLDOE Preliminary Survey; T.E. Myrick and C. Clark; Preliminary Site Survey Report for the Former Superior Steel Mill at Carnegie,...


PaSol Italia SpA | Open Energy Information  

Open Energy Info (EERE)

investors in order to initiate local PV module manufacturing to address the growing solar market in Italy and other parts of Europe References PaSol Italia SpA1 LinkedIn...


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


DOE - Office of Legacy Management -- Shallow Land Disposal Area - PA 45  

Office of Legacy Management (LM)

Shallow Land Disposal Area - PA 45 Shallow Land Disposal Area - PA 45 FUSRAP Considered Sites Shallow Land Disposal Area, PA Alternate Name(s): Parks Township Shallow Land Disposal Area Nuclear Materials and Equipment Corporation (NUMEC) Babcox and Wilcox Parks Facilities PA.45-1 PA.45-5 PA.45-6 Location: PA Route 66 and Kissimere Road, Parks Township, Apollo, Pennsylvania PA.45-1 Historical Operations: Fabricated nulcear fuel under an NRC license as an extension of NUMEC Apollo production facilities. PA.45-1 PA.45-5 Eligibility Determination: Eligible PA.45-6 Radiological Survey(s): None Site Status: Cleanup in progress by U.S. Army Corps of Engineers. PA.45-6 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Shallow Land Disposal Area, PA


Linear Collider Collaboration Tech Notes LCC-0141 SLAC-TN-04-040  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 SLAC-TN-04-040 May 2004 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Availability and Failure Effects of NLC Main Linac Mechanical Movers T. M. Himel, C. Spencer, Peter Tenenbaum


REPLY TO AlTN OF: W-421 (W. A. W  

Office of Legacy Management (LM)

QOEF 13254 QOEF 13254 i.3891 EFG iO7W United- states Government bemoranduin DATE: f-!uG 3, 9 19g4 REPLY TO AlTN OF: W-421 (W. A. W illiams, 427-1719) SUBJECT: Elimination of the Sites from Program the Formerly Utilized Sites Remedial Action To' The File In 1990, with the assistance of Mr. reviewed a number of sites that had services to the Fernald facility as . _ Doug Tonkay and Us. Michelle Landis, I formerly provided goods and/or subcontractors. For 24 of .these B. . sites, recoaaaendations were made to ellrlnate them from further consideration under Fomerly Utilized Sites Remedial Action Program (FUSRAP). In each case, I made or reviewed the evaluation, and, in each case, a handwritten evaluation was prepared. This is to provide a more formal record of the decision on these sites and to ratify and confirm the


Linear Collider Collaboration Tech Notes LCC-0140 SLAC-TN-04-041  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 SLAC-TN-04-041 June 2004 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Sensitivity to Nano-Tesla Scale Stray Magnetic Fields J. Frisch, T.O. Raubenheimer, P. Tenenbaum

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Linear Collider Collaboration Tech Notes LCC-0139 SLAC-TN-04-042  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 SLAC-TN-04-042 May 2004 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Alternative Main Linac BNS Configurations for Reduced Energy Spread Andrei Seryi and Peter Tenenbaum


DOE - Office of Legacy Management -- Aluminum Co of America - PA 23  

Office of Legacy Management (LM)

PA 23 PA 23 FUSRAP Considered Sites Site: Aluminum Company of America (ALCOA) ( PA.23 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: ALCOA Research Laboratory ALCOA New Kensington Works PA.23-3 PA.23-4 Location: 600 Freeport Road and Pine and Ninth Streets , New Kensington , Pennsylvania PA.23-1 PA.23-4 Evaluation Year: Circa 1993 PA.23-1 Site Operations: Research/Development and Production activities in support of the MED uranium slug canning and other programs, 1943-1945. PA.23-5 Site Disposition: Eliminated - Based upon results of radiological surveys of the properties, potential for residual radioactive contamination is considered remote PA.23-1 PA.23-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.23-1


TN-68 Spent Fuel Transport Cask Analytical Evaluation for Drop Events  

SciTech Connect

The U.S. Nuclear Regulatory Commission (NRC) is responsible for licensing commercial spent nuclear fuel transported in casks certified by NRC under the Code of Federal Regulations (10 CFR), Title 10, Part 71 [1]. Both the International Atomic Energy Agency regulations for transporting radioactive materials [2, paragraph 727], and 10 CFR 71.73 require casks to be evaluated for hypothetical accident conditions, which includes a 9-meter (m) (30-ft) drop-impact event onto a flat, essentially unyielding, horizontal surface, in the most damaging orientation. This paper examines the behavior of one of the NRC certified transportation casks, the TN-68 [3], for drop-impact events. The specific area examined is the behavior of the bolted connections in the cask body and the closure lid, which are significantly loaded during the hypothetical drop-impact event. Analytical work to evaluate the NRC-certified TN-68 spent fuel transport cask [3] for a 9-m (30-ft) drop-impact event on a flat, unyielding, horizontal surface, was performed using the ANSYS [4] and LS DYNA [5] finite-element analysis codes. The models were sufficiently detailed, in the areas of bolt closure interfaces and containment boundaries, to evaluate the structural integrity of the bolted connections under 9-m (30-ft) free-drop hypothetical accident conditions, as specified in 10 CFR 71.73. Evaluation of the cask for puncture, caused by a free drop through a distance of 1-m (40-in.) onto a mild steel bar mounted on a flat, essentially unyielding, horizontal surface, required by 10 CFR 71.73, was not included in the current work, and will have to be addressed in the future. Based on the analyses performed to date, it is concluded that, even though brief separation of the flange and the lid surfaces may occur under some conditions, the seals would close at the end of the drop events, because the materials remain elastic during the duration of the event.

Shah, M. J.; Klymyshyn, Nicholas A.; Adkins, Harold E.; Koeppel, Brian J.



Microsoft PowerPoint - PA CoP.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Community of Practice Roger Seitz (Savannah River National Laboratory) David Kosson (CRESP/Vanderbilt University) Martin Letourneau (DOE EM-41) 10 March 2010 WM '10, Phoenix Arizona SRNL-MS-2010-00037-S 2 WM 10, March 10, 2010 Safety Case Concept IAEA, Nuclear Energy Agency and others Reflects use of PA as only one part of a package used to support decisions "The purpose of computing is insight, not numbers" - Richard Hamming PA PA Uncertainty/ Importance Analysis Uncertainty/ Importance Analysis Safety Case Design Design Stakeholder Stakeholder Demonstrations Demonstrations R&D R&D Monitoring Monitoring Documentation Documentation WAC WAC Uncertainties can be managed in many different ways in addition to modeling 3 WM 10, March 10, 2010 Allow Low-level Waste Disposal Facility Federal



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

County of Chester STATE: PA County of Chester STATE: PA PROJECT EECBG - Chester County (PA) Installation of Cool Roof at Coatesville District Court TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA0000013 EE0000932 GFO-O000932-003 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy. demonstrate potential energy conservation. and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


DOE - Office of Legacy Management -- Pennsylvania Ordnance Works - PA 32  

Office of Legacy Management (LM)

Ordnance Works - PA 32 Ordnance Works - PA 32 FUSRAP Considered Sites Site: Pennsylvania Ordnance Works (PA.32 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


P.A. Capdau Charter School | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

P.A. Capdau Charter School P.A. Capdau Charter School P.A. Capdau Charter School August 8, 2007 - 3:16pm Addthis Prepared Remarks for Secretary Bodman Thank you, Principal Mitchell, for your kind introduction. I am glad to be back here in New Orleans to witness the tremendous progress all of you have made after the devastating events of two years ago. I am here not only to commend your efforts but also to state my commitment and the Department of Energy's commitment to the continued rebuilding effort. With great challenges come great opportunities. While there are tangible losses to grieve over when such devastation occurs, the resilient American spirit also finds unique ways to maximize any positive impact. In this case, the chance to rebuild much of the physical infrastructure that has


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


DOE - Office of Legacy Management -- Palmerton Ore Buying Site - PA 33  

NLE Websites -- All DOE Office Websites (Extended Search)

Palmerton Ore Buying Site - PA 33 Palmerton Ore Buying Site - PA 33 FUSRAP Considered Sites Site: PALMERTON ORE BUYING SITE (PA.33) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: New Jersey Zinc Company PA.33-1 Location: Palmerton , Pennsylvania PA.33-2 Evaluation Year: 1994 PA.33-3 Site Operations: Mid-1950s - AEC leased the New Jersey Zinc Company property and established a uranium ore stockpile on the property in the vicinity of Palmerton, PA. PA.33-4 Site Disposition: Eliminated - Potential for residual contamination and resulting exposure beyond that associated with natural background radiation considered remote PA.33-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Ore PA.33-4 Radiological Survey(s): Yes PA.33-5


DOE - Office of Legacy Management -- Rohm and Hass Co - PA 02  

Office of Legacy Management (LM)

Rohm and Hass Co - PA 02 Rohm and Hass Co - PA 02 FUSRAP Considered Sites Site: ROHM & HASS CO. (PA.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 5000 Richmond Street , Philadelphia , Pennsylvania PA.02-1 Evaluation Year: 1985 PA.02-2 Site Operations: Research and development on uranium recovery from carbonate leach liquors in the mid-1950s. PA.02-3 Site Disposition: Eliminated - Radiation levels below criteria PA.02-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.02-3 Radiological Survey(s): Yes PA.02-4 Site Status: Eliminated from consideration under FUSRAP PA.02-5 Also see Documents Related to ROHM & HASS CO. PA.02-1 - DOE Letter; Thornton to Bjuvik; Subject: Radiological


Development of a new dynamic gas flow-control system in the pressure range of 1 Pa-133 Pa  

Science Conference Proceedings (OSTI)

A new flow-control system (FCS-705) has been developed at Korea Research Institute of Standards and Science. The system is intended for calibration of vacuum gauges in the pressure range of 1 Pa-133 Pa by comparison method. This paper describes some basic characteristics of the system including; (1) the design and construction of the system, (2) the generation of stable pressures in the chamber, (3) achieving high upstream pressure limit by installing a short duct in the by-pass pumping line, and (4) investigation of the gas flow regimes within the short duct.

Hong, S. S.; Chung, J. W. [Korea Research Institute of Standards and Science, Daejeon 305-340 (Korea, Republic of); Khan, Wakil [Pakistan Vacuum Society, street 17, Islamabad (Pakistan)




E-Print Network (OSTI)

knowledge of market conditions unavailable to its competitors. This informational trading advantage from EOL for allegations that Williams Energy Marketing & Trading Co. cornered the market for natural gas in California3-26-03 DOCKET NO. PA02-2-000 STAFF REPORT PRICE MANIPULATION IN WESTERN MARKETS FINDINGS

Laughlin, Robert B.


Microsoft Word - West TN Solar Farm_Final EA.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6 6 10-088(E)/010511 FINAL ENVIRONMENTAL ASSESSMENT WEST TENNESSEE SOLAR FARM PROJECT HAYWOOD COUNTY, TENNESSEE U.S. Department of Energy National Energy Technology Laboratory Pittsburgh, PA February 2011 DOE/EA-1706 10-088(E)/010511 FINAL ENVIRONMENTAL ASSESSMENT West Tennessee Solar Farm Project Haywood County, Tennessee February 2011 Environmental Assessment for the West Tennessee Solar Farm Project Table of Contents i Table of Contents 1 INTRODUCTION .............................................................................................................................. 1 1.1 VOLUNTEER STATE SOLAR INITIATIVE ....................................................................... 1 1.1.1 Tennessee Solar Institute ........................................................................................ 1


DOE - Office of Legacy Management -- U S Bureau of Mines - PA 36  

Office of Legacy Management (LM)

PA 36 PA 36 FUSRAP Considered Sites Site: U. S. BUREAU OF MINES (PA.36) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Bruceton , Pennsylvania PA.36-1 Evaluation Year: 1987 PA.36-2 Site Operations: Conducted studied on explosiveness of Uranium, Thorium and Beryllium. PA.36-1 PA.36-3 Site Disposition: Eliminated - Small amounts of radioactive materials used - Potential for residual radioactive contamination considered remote PA.36-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium and Thorium PA.36-2 Radiological Survey(s): Yes - health and safety monitoring during operations only PA.36-1 Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Landis Machine Tool Co - PA 34  

NLE Websites -- All DOE Office Websites (Extended Search)

Landis Machine Tool Co - PA 34 Landis Machine Tool Co - PA 34 FUSRAP Considered Sites Site: LANDIS MACHINE TOOL CO. (PA.34 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Teledyne Landis Machine PA.34-1 Location: Waynesboro , Pennsylvania PA.34-2 Evaluation Year: 1991 PA.34-1 Site Operations: Manufactured metal fabrication equipment for machining uranium metal slugs. PA.34-1 Site Disposition: Eliminated - Limited scope of activities performed quantities of radioactive materials involved suggest little or no potential for residual radioactive contamination PA.34-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.34-2 Radiological Survey(s): Yes - health and safety monitoring during operations PA.34-3


DOE - Office of Legacy Management -- Curtis-Wright Corp - PA 37  

NLE Websites -- All DOE Office Websites (Extended Search)

Curtis-Wright Corp - PA 37 Curtis-Wright Corp - PA 37 FUSRAP Considered Sites Site: Curtis-Wright Corp. ( PA.37 ) Eliminated from further consideration under FUSRAP - Referred to the Pennsylvania Department of Environmental Resources, Bureau of Radiation Protection Designated Name: Not Designated Alternate Name: Quehanna Site Quehanna Radioisotopes Pilot Plant Radiation Process Center PA.37-1 Location: Northwest Clearfield County , Quehanna , Pennsylvania PA.37-2 PA.37-3 Evaluation Year: Circa 1990 PA.37-1 Site Operations: 1955-1960 Conducted research in nucleonics, electronics, chemicals and plastics - work for AEC primarily isotope separation and heat sources for space application. Also work for U.S. Air Force. AEC licensed facility. PA.37-1 PA.37-3 Site Disposition: Eliminated - No Authority to perform remedial action. Commercial facility operated under AEC license. Cleanup by the Commonwealth of Pennsylvania under plan approved by NRC. PA.37-2


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Designation Survey - Palmerton, Pa. Ore Storage Site William Bibb  

Office of Legacy Management (LM)

Designation Survey - Palmerton, Pa. Ore Storage Site Designation Survey - Palmerton, Pa. Ore Storage Site William Bibb Oak Ridge Operations Office Based on the information furnished in Aerospace's Review of the.subject site (Attachment 1) and the ORKL/RASA (Attachment 2), it Is requested that designation survey of the Palmerton Ore Storage Pennsylvania. The survey should be detailed to and subsurface data to make up for the lack of the previous AEC surveys and in keeping with ORNL/RASA group should furnish a draft survey approval prior to conducting any survey activities. If there are any questions, please call Edward DeLaney 04 FTS 253-4716. Arthur J. Whitman / '/ Division of Facility and Site ' Deconrnissioning P,rojects Office of Nuclear Energy : 2 Attachments I bee: I E. Keller, OR, w/attachs:


Explosive Demolition of a Fire-Water Tower At East Tennessee Technology Park, Oak Ridge TN  

SciTech Connect

On June 17, 2006, the Department of Energy (DOE) successfully demolished a {approx}60 year old fire-water tower (K-1206-E), located at the East Tennessee Technology Park (ETTP) in Oak Ridge, TN, using strategically placed explosive charges. The subject demolition project was executed by MCM Management Corporation and Demolition Dynamics under the management of DoE's prime contractor Bechtel Jacobs Company LLC (BJC). The K-1206-E Fire Water Tower (Tower) supported the ETTP fire water protection system from the mid- 1950's until 1991. The 378,500-L (100,000-gallon) Tower, elevated 53-m (175-feet) above grade, was located in a grassy area within 152-m (500-feet) of several other occupied facilities. Electrical, control circuits and supply water servicing the Tower were deactivated in 2003. Free liquids and sludge were removed from the tank prior to demolition. Demolition of a facility employing explosive demolition at a federal site in the 'post-9/11 era' was a substantial challenge. The subject paper discusses: - the planning and coordination steps that were taken to successfully overcome the challenges prior to the demolition of the empty, deactivated Tower; - the method used for the engineered demolition of the Tower; and - the factors responsible for the successful execution of this demolition project. At least two previous attempts were made to demolish the Tower. In the first attempt, the execution of the project was deferred by the re-allocation of funds. In the subsequent attempt in 2004, the execution of this project was postponed due to concerns that an adjacent facility would have to shut down operations during the duration of mobilization and execution of the project and thereby incur potential financial losses. A total of 51 cubic meters (1,800 cubic feet) of demolition debris was generated, which was compliantly disposed of at a local landfill followed by site restoration.

Brooksbank, R.D.; Rood, M.S.; Amrit, S.K.; Harper, M.S.; Dypolt, D.J.; Brehse, Mike [Bechtel Jacobs Company LLC, P.O. Box 4699 Oak Ridge, TN 37931 (United States)


Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Demonstration Assessment of LED Roadway Lighting: Philadelphia, PA  

Science Conference Proceedings (OSTI)

For this demonstration assessment, 10 different groups of LED luminaires were installed at three sites in Philadelphia, PA. Each of the three sites represented a different set of conditions, most importantly with regard to the incumbent HPS luminaires, which were nominally 100 W, 150 W, and 250 W. The performance of each product was evaluated based on manufacturer data, illuminance calculations, field measurements of illuminance, and the subjective impressions of both regular and expert observers.

Royer, Michael P.; Tuenge, Jason R.; Poplawski, Michael E.



DOE - Office of Legacy Management -- Westinghouse Atomic Power Div - PA 16  

Office of Legacy Management (LM)

Power Div - PA Power Div - PA 16 FUSRAP Considered Sites Site: WESTINGHOUSE ATOMIC POWER DIV. (PA.16 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Route 30 (Forrest Hills) , Pittsburgh , Pennsylvania PA.16-1 Evaluation Year: 1985 PA.16-1 Site Operations: Processed uranium metal for research and development and pilot-scale production of uranium oxide fuel elements. Prepared uranium metal for Enrico Fermi's Stagg Field experiment. PA.16-1 Site Disposition: Eliminated - Radiation levels below criteria PA.16-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.16-1 Radiological Survey(s): Yes PA.16-3 Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Birdsboro Steel and Foundry Co - PA 31  

Office of Legacy Management (LM)

Birdsboro Steel and Foundry Co - PA Birdsboro Steel and Foundry Co - PA 31 FUSRAP Considered Sites Site: Birdsboro Steel and Foundry Co. (PA.31 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Birdsboro Steel Foundry & Machine Company PA.31-1 Location: Birdsboro , Pennsylvania PA.31-1 Evaluation Year: 1987 PA.31-2 Site Operations: Designed and developed metal fabrication facilities installed at the AEC Feed Materials Production Center at Fernald, Ohio; no information on metal fabrication at Birdsboro, although the site received small quantities of uranium metal - presumably for testing purposes. PA.31-2 PA.31-3 Site Disposition: Eliminated - Limited scope of activities and quantity of radioactive material used at the site suggest that the potential for residual radioactive material at the site is remote PA.31-2


DOE - Office of Legacy Management -- Bartol Research Foundation - PA 0-02  

NLE Websites -- All DOE Office Websites (Extended Search)

Bartol Research Foundation - PA Bartol Research Foundation - PA 0-02 FUSRAP Considered Sites Site: Bartol Research Foundation (PA 0-02) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: The Franklin Institute PA.0-02-1 Location: Swathmore , Pennsylvania PA.0-02-1 Evaluation Year: 1987 PA.0-02-1 Site Operations: Research organization. Possibly performed radiation monitoring and possibly supplied monitoring equipment to Monsanto Chemical Company. PA.0-02-1 Site Disposition: Eliminated - No indication that radioactive materials were used on this site PA.0-02-1 Radioactive Materials Handled: None Indicated PA.0-02-1 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Teledyne-Columbia-Summerville - PA 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Teledyne-Columbia-Summerville - PA Teledyne-Columbia-Summerville - PA 01 FUSRAP Considered Sites Site: TELEDYNE-COLUMBIA-SUMMERVILLE (PA.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Columbia Steel, Summerill Tube, Columbia-Summerill PA.01-1 Location: Pittsburgh , Pennsylvania PA.01-1 Evaluation Year: 1987 PA.01-1 Site Operations: Metal fabrication operations. No indication radioactive materials were involved. PA.01-1 Site Disposition: Eliminated - Site was not involved in the handling of radioactive materials PA.01-1 PA.01-2 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Babcock and Wilcox Co - PA 18  

Office of Legacy Management (LM)

Babcock and Wilcox Co - PA 18 Babcock and Wilcox Co - PA 18 FUSRAP Considered Sites Site: Babcock and Wilcox Co (PA 18) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Tubular Products Division PA.18-1 Location: Beaver Falls , Pennsylvania PA.18-1 Evaluation Year: 1990 PA.18-1 Site Operations: Performed development work to pierce uranium billets for extrusion to tubes. No indication that the piercing operation was conducted. PA.18-1 Site Disposition: Eliminated - No indication that the metal fabrication (piercing) operation was conducted on this site. Records indicate small radiation sources were used on the site. Potential for residual radioactive contamination considered remote due to the limited quantities of material handled on the site. PA.18-3


DOE - Office of Legacy Management -- University of Pennsylvania - PA 0-06  

Office of Legacy Management (LM)

Pennsylvania - PA Pennsylvania - PA 0-06 FUSRAP Considered Sites Site: UNIVERSITY OF PENNSYLVANIA (PA.0-06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Philadelphia , Pennsylvania PA.0-06-1 Evaluation Year: 1987 PA.0-06-1 Site Operations: Research activities involving small quantities of radioactive materials in a controlled environment. PA.0-06-1 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote PA.0-06-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Radium PA.0-06-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to UNIVERSITY OF PENNSYLVANIA


DOE - Office of Legacy Management -- Vanadium Corp of America - PA 15  

Office of Legacy Management (LM)

Vanadium Corp of America - PA 15 Vanadium Corp of America - PA 15 FUSRAP Considered Sites Site: Vanadium Corp. of America (PA.15) Eliminated from further consideration under FUSRAP. Designated Name: Not Designated Alternate Name: UMTRAP Vicinity Property No. CA-401 PA.15-5 Location: Mayer Street - Collier Township , Bridgeville , Pennsylvania PA.15-1 Evaluation Year: 1985 PA.15-2 Site Operations: Faclility used to grind pitchblende ore during the early 1940's for processing by Vitro at Canonsburg. Conducted research and developed processes for concentration of Colorado Plateau ores (uranium-vanadium) PA.15-3 Site Disposition: Eliminated - site cleaned up as a vicinity property of the Canonsburg Site in 1986 under the Uranium Mill Tailings Remedial Action Program (UMTRAP). PA.15-5


DOE - Office of Legacy Management -- University of Pittsburgh - PA 0-07  

Office of Legacy Management (LM)

Pittsburgh - PA 0-07 Pittsburgh - PA 0-07 FUSRAP Considered Sites Site: UNIVERSITY OF PITTSBURGH (PA.0-07) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Pittsburgh , Pennsylvania PA.0-07-1 Evaluation Year: 1987 PA.0-07-1 Site Operations: Research activities involving small quantities of radioactive materials in a controlled environment. PA.0-07-1 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote PA.0-07-1 Radioactive Materials Handled: Yes PA.0-07-1 Primary Radioactive Materials Handled: Not Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to UNIVERSITY OF PITTSBURGH



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PENNSYLVANIA PENNSYLVANIA NATIONAL ENERGY TECHNOLOGY LAB - PA POC Larry Sullivan Telephone (412) 386-6115 Email larry.sullivan@netl.doe.gov ADMINISTATIVE / WASTE / REMEDIATION Facilities Support Services 561210 Employment Placement Agencies 561311 Temporary Help Services 561320 Professional Employer Organizations 561330 Document Preparation Services 561410 Security Guards and Patrol Services 561612 Security Systems Services (except Locksmiths) 561621 Janitorial Services 561720 Landscaping Services 561730 Hazardous Waste Treatment and Disposal 562211 Remediation Services 562910 Materials Recovery Facilities 562920 All Other Miscellaneous Waste Management Services 562998 CONSTRUCTION Industrial Building Construction 236210 Commercial and Institutional Building Construction 236220 Power and Communication Line and Related Structures Construction


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


NETL: 2010 SW PA High School Science Bowl  

NLE Websites -- All DOE Office Websites (Extended Search)

High School Science Bowl High School Science Bowl The U.S. Department of Energy's National Energy Technology Laboratory (DOE/NETL), and the Community College of Allegheny County (CCAC), South Campus, would like to invite you to participate in one of the premier scientific events for high school students, the Southwestern Pennsylvania High School Science Bowl 2010 on February 20, 2010. This will be NETL's 19th year sponsoring the high school competition. There is a change this year in the registration process from past years, all teams who are registering to complete, must do so through the National Science Bowl website by January 7, 2010. For those who are not familiar with the Science Bowl here are some highlights: The competition is open to high school students (school, scouts, home school) from Southwestern Pennsylvania (SW PA). Complete eligibility requirements are located at the National Science Bowl website.


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Microsoft PowerPoint - DOE_PA_Derivation and Application of SCULs...  

NLE Websites -- All DOE Office Websites (Extended Search)

Derivation and Application of Soil Contaminant Levels Protective of Groundwater at the Hanford Site Presented to: PA Community of Practice Technical Exchange Presented by: - Jim...


Annual Performance Evaluation of a Pair of Energy Efficient Houses (WC3 and WC4) in Oak Ridge, TN  

SciTech Connect

Beginning in 2008, two pairs of energy-saver houses were built at Wolf Creek in Oak Ridge, TN. These houses were designed to maximize energy efficiency using new ultra-high-efficiency components emerging from ORNL s Cooperative Research and Development Agreement (CRADA) partners and others. The first two houses contained 3713 square feet of conditioned area and were designated as WC1 and WC2; the second pair consisted of 2721 square feet conditioned area with crawlspace foundation and they re called WC3 and WC4. This report is focused on the annual energy performance of WC3 and WC4, and how they compare against a previously benchmarked maximum energy efficient house of a similar footprint. WC3 and WC4 are both about 55-60% more efficient than traditional new construction. Each house showcases a different envelope system: WC3 is built with advanced framing featured cellulose insulation partially mixed with phase change materials (PCM); and WC4 house has cladding composed of an exterior insulation and finish system (EIFS). The previously benchmarked house was one of three built at the Campbell Creek subdivision in Knoxville, TN. This house (CC3) was designed as a transformation of a builder house (CC1) with the most advanced energy-efficiency features, including solar electricity and hot water, which market conditions are likely to permit within the 2012 2015 period. The builder house itself was representative of a standard, IECC 2006 code-certified, all-electric house built by the builder to sell around 2005 2008.

Biswas, Kaushik [ORNL; Christian, Jeffrey E [ORNL; Gehl, Anthony C [ORNL; Jackson, Roderick K [ORNL; Boudreaux, Philip R [ORNL



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


La premiere somme philosophique du bouddhisme tibetain. Origines litteraires, philosophiques et mythologiques des Neuf etatpes de la Voie (theg pa rim pa dgu)  

E-Print Network (OSTI)

/ 'dul ba dgongs pa gsang ba dang/ rang bzhin gsang ba'i donrnams ni/ zhes gsung te/ rtsal 'phang mtho dman gyi khyad par gyis/ so so'i blo'i rtogs tshod kyi don'di rnams kyang phyin ci ma log pa'i don rtogs pa'i man ngag gi gzhi yin pas/ de bas na man... 'en haut (tib. lha) et d'en bas (tib. klu). Cf. Stein, 1996 : 141. Les Neuf Etapes de la Voie 97 dorigine cleste et munis de capacits surhumaines, descendaient etremontaient au ciel par le moyen d'une chelle qui se trouvait sur le sommetd'une montagne...

Mestanza, Ferran



Microsoft PowerPoint - Freeze.NE PA Overview_052511.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Used Fuel Disposition Campaign Used Fuel Disposition Campaign Summary of DOE-NE PA Modeling for Storage and Disposal of Used Nuclear Fuel (UNF), High-Level Radioactive Waste (HLW), and Low-Level Waste (LLW) Geoff Freeze Sandia National Laboratories PA Community of Practice Technical Exchange May 25-26, 2011 Print Close Used Fuel Disposition 2 DOE-Nuclear Energy (NE) - PA Modeling Activities NE Advanced Modeling and Simulation (NEAMS) Waste Integrated Performance and Safety Codes (Waste IPSC) Used Fuel Disposition (UFD) Generic Performance Assessment Model (GPAM) *** Initial modeling focus in both campaigns in on UNF/HLW disposal Print Close Used Fuel Disposition 3  UFD GPAM  Short time horizon (2-3 yrs) - Simplified generic system models (i.e., PA-fidelity using GoldSim) - Current computing capabilities


Northern Hemisphere 500-hPa Trough Merger and Fracture: A Climatology and Case Study  

Science Conference Proceedings (OSTI)

The results of an objective climatology of 500hPa trough merger (defined as the amalgamation of two initially separate vorticity maxima) and trough fracture (defined as the splitting of a single vorticity center into two separate vorticity ...

Devin B. Dean; Lance F. Bosart


Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site




E-Print Network (OSTI)

a ( I V ) , N p ( I V ) , AND Pu(IV) BOROHYDRIDES Rodney H.borohydrides of Pa, Np, and Pu have been pre pared and someU(BH. ,)Pu(BHi<)ii are much more volatile

Banks, R.H.



TN1421 - References  

Science Conference Proceedings (OSTI)

... 1914; WW Coblentz, "Studies of Instruments for Measuring Radiant Energy in Absolute ... JE Martin, NP Fox and PJ Keys, "A cryogenic radiometer of ...



NLE Websites -- All DOE Office Websites (Extended Search)

taTechnologySpecificUnitedStatesWindHighResolutionTennesseeWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of...


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


State College Area High School From State College, PA Wins DOE's National  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

College Area High School From State College, PA Wins DOE's College Area High School From State College, PA Wins DOE's National Science Bowl® State College Area High School From State College, PA Wins DOE's National Science Bowl® May 1, 2006 - 10:34am Addthis WASHINGTON , DC - State College Area High School from State College, Pennsylvania, today won the Department of Energy's (DOE) National Science Bowl®. Teams representing 65 schools from across the United States competed in this "Science Jeopardy" competition, which concluded this afternoon. Members of the winning team include Jason Ma, Ylaine Gerardin, Barry Liu, Galen Lynch, Francois Greer and coach, Julie Gittings. This team won a research trip to France and $1,000 for their school's science department. The answer that clinched the championship was in response to an earth


Second Meeting, July 13, 1999 Crowne Plaza Center City Philadelphia, PA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Second Meeting, July 13, 1999 Crowne Plaza Center City Philadelphia, PA Second Meeting, July 13, 1999 Crowne Plaza Center City Philadelphia, PA The second meeting of the Transportation External Coordination Working Group (TEC/WG) DOE Transportation Protocols Topic Group took place on July 13, 1999 at the Crowne Plaza Center City in Philadelphia, PA. MORNING SESSION Ms. Williams began the meeting by stating this was the second face-to-face session of the group; several conference calls had also been held since the first meeting in Jacksonville, FL in January 1999. She indicated there were some materials available in addition to the draft protocols that had been promised; one was a comment response document containing written comments received from participants on the different protocols, and the other was a draft schedule for completion of the other protocols. She said the milestones in the schedule were


Obtaining pressures in the 10?5 Pa range with oil?sealed rotary vacuum pumps  

Science Conference Proceedings (OSTI)

Trapped oil?sealed rotary pumps are usually considered capable of ultimate pressures no lower than about 10?3 Pa. Experiments are described which confirm that most of this residual gas originates from air dissolved in the pump oil. Replacement of the air with a less soluble gas (helium) or an easily trapped gas (carbon dioxide) is shown to give a useful reduction in ultimate pressure and to reduce the oxygen partial pressure to essentially zero. Operation with completely degassed oil is shown to give ultimate pressures in the 10?5 Pa range. The design of pumps based on these principles is discussed.

B. R. F. Kendall



P-A logic: a compositional proof system for distributed programs  

Science Conference Proceedings (OSTI)

This paper describes a compositional proof system called P-A logic for establishing weak total correctness and weak divergence correctness of CSP-like distributed programs with synchronous and asynchronous communication. Each process in a network is ... Keywords: OCCAM, liveness, proof system, safety

Paritosh K. Pandya; Mathai Joseph



Improved Skill for the Anomaly Correlation of Geopotential Heights at 500 hPa  

Science Conference Proceedings (OSTI)

This paper addresses the anomaly correlation of the 500-hPa geopotential heights from a suite of global multimodels and from a model-weighted ensemble mean called the superensemble. This procedure follows a number of current studies on weather ...

T. N. Krishnamurti; K. Rajendran; T. S. V. Vijaya Kumar; Stephen Lord; Zoltan Toth; Xiaolei Zou; Steven Cocke; Jon E. Ahlquist; I. Michael Navon



SpaceTime Spectral Analysis of the Southern Hemisphere Daily 500-hPa Geopotential Height  

Science Conference Proceedings (OSTI)

In this paper the authors use the NCEPDepartment of Energy (DOE) Reanalysis 2 (NCEP2) data from 1979 to 2004 to expand the daily 500-hPa geopotential height in the Southern Hemisphere (SH, 9020S) into a double Fourier series, and analyze the ...

Cheng Sun; Jianping Li



Paper Number 15736-PA Title Reaction Kinetics of Fuel Formation for In-Situ Combustion  

E-Print Network (OSTI)

Paper Number 15736-PA Title Reaction Kinetics of Fuel Formation for In-Situ Combustion Authors Abu believed to cause fuel formation for in-situ combustion have been studied and modeled. A thin, packed bed the approach of a combustion front. Analysis of gases produced from the reaction cell revealed that pyrolysis

Abu-Khamsin, Sidqi


A generic network interface architecture for a networked processor array (NePA)  

Science Conference Proceedings (OSTI)

Recently Network-on-Chip (NoC) technique has been proposed as a promising solution for on-chip interconnection network. However, different interface specification of integrated components raises a considerable difficulty for adopting NoC techniques. ... Keywords: interconnection network, multiprocessor systemon-chip (MPSoC), network interface, network-on-chip (NoC), networked processor array (NePA)

Seung Eun Lee; Jun Ho Bahn; Yoon Seok Yang; Nader Bagherzadeh



Hugo van Dam and the dynamic adjoint function Imre Pa zsit*  

E-Print Network (OSTI)

adjoint theory in such cases does not play a role at all. 1762 I. Pa´zsit / Annals of Nuclear Energy 30 and practical and, accordingly, it dominates the applications in the theory of zero power reactor noise fluctuations in a steady subcritical reactor, i.e. the theory of zero power reactor noise, the dual possibility

Pázsit, Imre


Spectroscopic and magnetic studies of tetravalent Pa and trivalent Th compounds  

SciTech Connect

At the beginning of the actinide series, the 5f and 6d configurations are very close in energy. Consequently, both the 5f and 6d energy level splittings may be observed experimentally in Pa{sup 4+} and Th{sup 3+} compounds. The available magnetic and optical data on these systems are reviewed.

Edelstein, N.M.; Kot, W.K.


Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Project Plan 7930 Cell G PaR Remote Handling System Replacement  

Science Conference Proceedings (OSTI)

For over 40 years the US Department of Energy (DOE) and its predecessors have made Californium-252 ({sup 252}Cf) available for a wide range of industries including medical, nuclear fuels, mining, military and national security. The Radiochemical Engineering Development Center (REDC) located within the Oak Ridge National Laboratory (ORNL) processes irradiated production targets from the High Flux Isotope Reactor (HFIR). Operations in Building 7930, Cell G provide over 70% of the world's demand for {sup 252}Cf. Building 7930 was constructed and equipped in the mid-1960s. Current operations for {sup 252}Cf processing in Building 7930, Cell G require use of through-the-wall manipulators and the PaR Remote Handling System. Maintenance and repairs for the manipulators is readily accomplished by removal of the manipulator and relocation to a repair shop where hands-on work can be performed in glove boxes. Contamination inside cell G does not currently allow manned entry and no provisions were created for a maintenance area inside the cell. There has been no maintenance of the PaR system or upgrades, leaving operations vulnerable should the system have a catastrophic failure. The Cell G PaR system is currently being operated in a run to failure mode. As the manipulator is now 40+ years old there is significant risk in this method of operation. In 2006 an assessment was completed that resulted in recommendations for replacing the manipulator operator control and power centers which are used to control and power the PaR manipulator in Cell G. In mid-2008 the chain for the bridge drive failed and subsequent examinations indicated several damaged links (see Figure 1). To continue operations the PaR manipulator arm is being used to push and pull the bridge as a workaround. A retrieval tool was fabricated, tested and staged inside Cell G that will allow positioning of the bridge and manipulator arm for removal from the cell should the PaR system completely fail. A fully functioning and reliable Par manipulator arm is necessary for uninterrupted {sup 252}Cf operations; a fully-functioning bridge is needed for the system to function as intended.

Kinney, Kathryn A [ORNL




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


One-and two-photon photoactivation of a paGFP-fusion protein in live Drosophila embryos  

E-Print Network (OSTI)

constructed a photoactivatable Drosophila his- tone 2 A variant green fluorescent fusion protein (H2AvD- pa of multiple fluorescent loci. This report constitutes the first demon- stration of two-photon activation of pa Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Green fluorescent protein

Rieger, Bernd



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NJ1PA DETERMINATION NJ1PA DETERMINATION RECIPIENT:Abengoa Solar Inc. Page 1 of2 STATE: CO PROJECT TITLE: Reducing the Cost of Thermal Energy Storage for Parabolic Trough Power Plants Funding Opportunity Announcement Numbu Procurement Instrument Number NEPA Control Numbu ell) Number DE·PS36-08G098032 G018156 GFQ.G018156-003 G018156 Based on my review oflhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A),1 have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but nollimiled to, literature surveys. inventories. audits), data analysis (indudm9 computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply


File:USDA-CE-Production-GIFmaps-PA.pdf | Open Energy Information  

Open Energy Info (EERE)

PA.pdf PA.pdf Jump to: navigation, search File File history File usage Pennsylvania Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 419 KB, MIME type: application/pdf) Description Pennsylvania Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Pennsylvania External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:20, 27 December 2010 Thumbnail for version as of 16:20, 27 December 2010 1,650 × 1,275 (419 KB) MapBot (Talk | contribs) Automated bot upload


EIS-0357 - Gilberton Coal-to-Clean Fuels and Power Project in Giberton, PA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7 - Gilberton Coal-to-Clean Fuels and Power Project in 7 - Gilberton Coal-to-Clean Fuels and Power Project in Giberton, PA EIS-0357 - Gilberton Coal-to-Clean Fuels and Power Project in Giberton, PA Summary This Environmental Impact Statement (EIS) assesses the potential environmental impacts that would result from a proposed Department of Energy (DOE) action to provide cost-shared funding for construction and operation of facilities near Gilberton, Pennsylvania, which have been proposed by WMPI PTY, LLC, for producing electricity, steam, and liquid fuels from anthracite coal waste (culm). The project was selected by DOE under the Clean Coal Power Initiative (CCPI) to demonstrate the integration of coal waste gasification and Fischer-Tropsch (F-T) synthesis of liquid hydrocarbon fuels at commercial scale. PUBLIC COMMENT OPPORTUNITIES



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETERMINATION Nl!PA DETERMINATION RI':CIPIENT:Western Iowa Tech Community College PROJECT TITLE: Western Iowa Tech Community College Renewable Energy Economy Conidor Page 1 of2 STATE: IA Funding Opportunity Announcement Number Proeurement lnstrument Number NEPA Control Number CID Number CongressIOnally Directed DE-EEOOO3285 GF0-10-329 0 Based on my review orthe Inrormation concerning the proposed action, B5 NEPA Compliance Officer (authorb-.ed under DOE Order 451.IA), I have made the rollo wing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including. but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3M COMPANY FOR AN ADVANCE WAIVER OF PA ENT 3M COMPANY FOR AN ADVANCE WAIVER OF PA ENT RIGHTS UNDEF DOE COOPERATIVE AGREEMENT NO. DE-FC36- 01AL67621 ENTITLED "ADVANCED MEA'S FOR ENHANCED OPERATING CONDITIONS"; W(A)-04-038; CH-1205 As set out in the attached waiver petition and in subsequent discussions with DOE Patent Counsel, 3M Company (3M) has requested an advance waiver of domestic and foreign patent rights for all subject inventions made under the above-identified cooperative agreement by its employees and its subcontractors' employees, regardless of tier, except inventions made by subcontractors eligible to retain title pursuant to P.L. 96-517, as amended, and National Laboratories. Referring to item 2 of 3M's waiver petition, the purpose of this agreement encompasses the design, development and manufacturing of polymer electrolyte membrane fuel cells



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OF ENERGY OF ENERGY EERE PROJECT MANAGEMENT CENTER NJ1PA DETERMINATION Page 1 of2 RECIPIENT:ELECTRATHERM, Inc. STATE: NV PROJECT TITLE: ·Small Scale Electrical Power Generation from Heat Co-Produced in Geothermal Fluids: MiningOperation" Funding Opportunity Announcement Number PNK:urement Instrument Number N£PA Control Number em Number OE+FOAOOOO336 DE-EEOOO4435 GF0-0004435-002 G04435 Based on my review of the information c:oncerning tbe proposed action, 85 NEPA Compliance Officer (authorized under DOE Order 451.IA),1 have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Info rm ation gathering, analysis, and d issemination Information gathering (including , but not limited to, literature surveys, inventories, site visits, and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PA DEl1!RMINATION PA DEl1!RMINATION RECIPIENT:Snohomish County PUD PROJECT TITLE: Acoustic Effects of Hydrokinetic Tidal Turbines Page 1 00 STATE: WA funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA..()()()()()69 DE-EEOOO2654 GF0-10-171 0 Based on my review oflhe information concerning the proposed adion, as NEPA CompliaDce Officer (authorized under DOE Order451.1A), I have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 83.1 OnSlle and off site site characterizatIOn and environmental monitonng, Induding siting, construction (or modification). operatJon, and dismantlement or dosing (abandonment) of characterization and monitoring devices and siting, constructJon, and aSSOCIated operation of a small-scale laboratory building or renovation of a room in an existing building


File:EIA-Appalach2-OH-PA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach2-OH-PA-GAS.pdf Appalach2-OH-PA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Northern Ohio, Southwestern New York, and Western Pennsylvania By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 10.31 MB, MIME type: application/pdf) Description Appalachian Basin, Northern Ohio, Southwestern New York, and Western Pennsylvania By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Ohio, New York, Pennsylvania File history Click on a date/time to view the file as it appeared at that time.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETERMINATION Nl!PA DETERMINATION RECIPIENT :Ruby Mountain Inc for EI Paso County PROJECf TITLE : EI Paso County Geothermal Project at Fort Bliss - Phase 2-8 and Phase 3 Page 1 of2 STATE : TX Funding Opportunity Announcement Number Procuremenllnstrument Number NEPA Control Number CID Number DE-FOA-0000109 DE-EEOOO2827 GFO-O002827-OO4 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (autborlzed under DOE Order 45I.lA), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited la, literature surveys, inventories, audits). data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply


File:EIA-Appalach3-eastPA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach3-eastPA-BOE.pdf Appalach3-eastPA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Eastern Pennsylvania By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.04 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern Pennsylvania By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Pennsylvania File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Romanosky Romanosky Crosscutting Research Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4721 robert.romanosky@netl.doe.gov Richard Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Shizhong Yang Principal Investigator Southern University


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Recipient: County of Lancaster, PA ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Lancaster County Environmental Center Energy Efficiency Retrofits A9, All, B5.1 Waste Stream Clause Historic Preservation Clause Engineering Clause **This NEPA determination is limited to lighting upgrades, installation of a PV system; installation of a geothermal heat pump is conditioned pending further NEPA review. Lancaster County Environmental Center Renewable Energy System B5.1 Waste Stream clause Historic Preservation clause Engineering clause County Facility Energy Audits A9 None. This NEPA determination is limited to audits only.


Microsoft PowerPoint - PA CoP Status and plans.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

of Practice Status and Plans Performance Assessment Community of Practice Technical Exchange May 25, 2011 Martin J Letourneau DOE Office of Environmental Compliance 5/25/2011 Print Close 2 History and Background * Originally envisioned and established in 2008 under DOE HLW Corporate Board * Very DOE and EM oriented * Sponsored 2 technical exchange meetings (Salt Lake and Richland) * Went dormant when HLW Corporate Board was on hiatus * Corporate Board Shifted to Office of Environmental Compliance * Identified opportunity to make PA CoP broader and free- standing 5/25/2011 Print Close 3 Initial Steering Committee Meeting * Met Monday to develop path forward and work on charter - Alaa aly, Intera


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Patricia Rawls Patricia Rawls Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-5882 patricia.rawls@netl.doe.gov Sankaran Sundaresan Principal Investigator Princeton University Department of Chemical Engineering Princeton, NJ 08544 609-258-4583 sundar@princeton.edu PROJECT DURATION Start Date 10/01/2011 End Date 09/30/2014 COST Total Project Value $420,366 DOE/Non-DOE Share $300,000 / $120,366 Implementation and Refinement

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rick Dunst Rick Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 MS 922-273C Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Felicia Manciu Principal Investigator University of Texas at El Paso 500 West University Avenue El Paso, TX 79968-8900 915-747-5715 fsmanciu@utep.edu PROJECT DURATION Start Date 01/15/2009 End Date 12/15/2013 COST Total Project Value $249,546 DOE/Non-DOE Share $249,546 / $0


Mycenaean -pi and pa-ro in the light of TH Uq 434  

E-Print Network (OSTI)

for Mycenologists and specialists in the Aegean cultures, but also for scholars working on the history of the Greek language, Greek religion and institutions, and Indo-European. ISBN978-90-429-2909-8 (Peeters Leuven) ISBN978-2-7584-0186-5 (Peeters France... he demonstrates record standing flocks involved in the production of lambs and wool (KILLEN 1964); mutatis mutandis he argues for a similar function for these Pylian records. If so, the pa-ro formulae would record the herdsmen under whose care...

Thompson, Rupert John Ernest



Effects of Pressure on Collision, Coalescence, and Breakup of Raindrops. Part I: Experiments at 50 kPa  

Science Conference Proceedings (OSTI)

Previous breakup experiments have been carried out at laboratory pressures (100 kPa). However, raindrop interactions mainly take place higher up in the atmosphere, even in the supercooled part of a cloud where drops can be initiated by shedding ...

Roland List; C. Fung; R. Nissen




E-Print Network (OSTI)

Pa (BH4 ) 4' Np (BH ) 4' AND Pu (BH ) 4 R. H. Banks, N. M.Pa(BH4 )4' Np(BH 4 )4' and Pu(BH4)4t R. H. Banks, N. M.Pa(BH )4' Np(BH )4' and Pu(BH )4 have been synthesized. U(

Banks, R.H



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PROJEC PROJEC T FAC TS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Gordon Bierwagen Principal Investigator North Dakota State University P.O. Box 6050 Department 2760 Fargo, ND 58108-6050 701-231-8294 gordon.bierwagen@ndsu.edu PARTNERS None PROJECT DURATION Start Date 12/01/2009 End Date 11/30/2011 COST Total Project Value $298,949 DOE/Non-DOE Share $298,949 / $0 PROJECT NUMBER DE-FE0002054 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Jose Castillo Principal Investigator San Diego State University 5500 Campanile Drive San Diego, CA 92122 619-594-7205 castillo@myth.sdsu.edu PARTNERS Sienna Geodynamics and Consulting, Inc. PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,993 DOE/Non-DOE Share $299,993 / $0 PROJECT NUMBER DE-FE0002069 Government funding for this project is provided in whole or in part through the


2013 NETL CO2 Capture Technology Meeting Sheraton Station Square, Pittsburgh, PA  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL CO2 Capture Technology Meeting NETL CO2 Capture Technology Meeting Sheraton Station Square, Pittsburgh, PA July 8 - 11, 2013 ION Novel Solvent System for CO 2 Capture FE0005799 Nathan Brown ION Engineering Presentation Outline 2  ION Advanced Solvent Background  Project Overview  Technology Fundamentals  Progress & Current Status  Plans for Future Commercialization  Acknowledgements ION Engineering Background 3 Mission Statement: Develop new solvents and processes for economic removal of CO 2 from industrial emissions. Markets:  Coal-fired flue gas  NGCC-fired flue gas  Sour gas processing 1 st & 2 nd Generation CO 2 Capture 4 Aqueous MEA Commercial Use Existing Commercial Technology Lateral Transfer of Existing Technology Aqueous MEA


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACTS Joseph Stoffa Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-0285 joseph.stoffa@netl.doe.gov Xingbo Liu Principal Investigator Dept. MechanaWest Virginia University P.O. Box 6106 Morgantown, WV 26506-6106 304-293-3339 xingbo.liu@mail.wvu.edu Shailesh D. Vora Technology Manager, Fuel Cells National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7515 shailesh.vora@netl.doe.gov PARTNERS None PROJECT DURATION Start Date End Date 08/31/2012 09/30/2015 COST Total Project Value $634,839 DOE/Non-DOE Share $499,953 / $134,886 AWARD NUMBER FE0009675 Fundamental Understanding of Oxygen Reduction and Reaction Behavior and Developing High Performance and Stable



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARTIlIENT OFI!NERGY DFPARTIlIENT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!Tl!Rl\.lINAIION RECIPIENT:NH Office of Energy and Planning PROJECf TITLE : Fonnula Grant for State Energy Program· NH Page 1 of2 STATE: NH Funding Opportunity Announ~ement Number Procurement Instrument Number NEPA Control Number CID Number DE FDA 0000643 DE-FG26-06R130472 GF()'()130472-OO1 Based on my review orlbe information concerning the proposed action, as NEPA Compliance OffICer (authorized under DOE Order 4sl.tA), I have made the foUowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for detennination: Technical advice and planning assistance to international, national, state, and local organizatioos



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PARTh1l1NT OFI!NERGY PARTh1l1NT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!TFIU.nNATION Page I of2 RECIPIENT: City of SI. Petersburg STATE: FL PROJECT TITLE: SI. Petersburg Solar Pilol Project (FL) FUnding Opportunity Announcement Number Procunml'nt Instrument Numbu NEPA Control Number CID Number DE-EEOOOO284 GF().OQ()()284-003 G0284 Based on my review ortbe information concerning the proposed action, as NEPA Compliance Officer (authorized UDder DOE Order 451.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.16 Sola r photovoltaic systems The installation, modification, operation, and removal of commercially available solar photovoltaic systems located on a building or other structure (such as rooftop, parking lot or facility, and mounted to Signage,



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

~) ~) u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPI[NT :Dehlsen Associates. LlC (DA) Page 1 of2 STATE: CA PROJECT TITLE: High Energy Density Distributed Hydrostatic Direct Drive for large Wind Turbine and MHK Device Applications Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-0000439 DE-EEOOO5139 GFO-OOOS139-001 0 Based on my review ofthe information concerning tbe proposed acrion, as NEPA Compliance Officer (authorized under DOE Order451.IA), J have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (Including, but nollimited to, literature surveys, inventories, audits), data analysis (including



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARTlIIENT OFI!NERGY DFPARTlIIENT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!Tl!RMINATION Page 1 of2 RECIPIENT: Energent Corporation STATE: CA PROJECT TITLE: Scale Resistant Heat Exchangers for Low Temperature Geothermal Binary Cycle Power Plant Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOA-0000318 DE-EE0004423 GFO-OOO4423-OO2 G04423 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order4S1.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Inf ormation Information gathering (including, but not limited to, literature surveys, inventories, site visits, and gathering, analYSiS, and audits), data analysis (including, but not limited to, computer modeling), document preparation


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Karen Kluger Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6667 karen.kluger@netl.doe.gov Gary Mavko Principal Investigator Stanford University 397 Panama Mall Stanford, CA 94305-2215 650-723-9438 Fax: 650-723-1188 mavko@stanford.edu PROJECT DURATION Start Date 12/01/2009 End Date 06/30/2013 COST Total Project Value $385,276 DOE/Non-DOE Share $295,777/ $89,499 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Rock Physics of Geologic Carbon Sequestration/Storage



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARl'lIIENT OF ENERGY DEPARl'lIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT: Snohomish County PUD PROJECf TITLE: Acoustic Effects of Hydrokinetic Tidal Turbines Page 1 on STATE: WA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000069 DE-EEOOO2654 GFQ-0002654-OO2 0 Based on my review orlhe Information concerning the proposed action, as NEPA Compliance Officer (authori1.ed under DOE Order 4S1.1A), I have made the following determination: ex, EA, EIS APPENDIX ANO NUMBER: Description: B3.3 Field and laboratory research, inventory, and information collection activities that are directly related to the conservation of fish or wildlife resources and that involve only negligible habitat destruction or population reduction


Microsoft PowerPoint - Cheng-PA Presentation-v5.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Applications Applications of RESRAD-OFFSITE Presented At PA Community of Practice Technical Exchange Richland, WA April 14, 2010 Jing-Jy Cheng, Ph.D. Environmental Science Division Argonne National Laboratory RESRAD - A Regulatory Tool for Addressing Site Cleanup Issues 2 RESRAD, an internationally utilized model, successfully addresses the critical question "How clean is clean enough?" Supports government regulatory endeavors in cleanup * DOE (Designated by Order 5400.5) * NRC (License Termination Rule; 10 CFR 20 Subpart E; NUREG/1757) * EPA (CERCLA) * State agencies In use for about 30 years * Evaluation of more than 300 cleanup sites * Over 100 training workshops * International (e.g., IAEA) recognition RESRAD Development Philosophy : Bridging Science with Regulatory Compliance



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

... ... ~ . u.s DEPAR lENT OFl!NERG' EERE PROJECT MANAGEMENT CDITER Nl!PA Dl!Tl!Rl\llNATION Page 1 of2 RECIPIENT:Stanford University STATE: CA PROJECf TITLE: In·Situ X·Ray Analysis of Rapid Thermal Processing for Thin·FiI Solar Cells: Closing the Gap between Production and Laboratory Efficiency Funding Opportunity Announcement Number DE·FOA-0000654 Procurement Instrument Number DE·EE0005951 NEPA Control Number em Number GFQ-0005951·001 G05951 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the following determination: CX, EA, EIS APP~:NDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination 81.31 Installation or



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OFl!NERGY OFl!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!R}.JINATION RECIPIENT:State of Wisconsin * Office of Energy Independence PROJECf TITLE: WI Biodiesel Blending Program Page 1 of2 STATE: WI Funding Opportunity Announttmenf Number Proc:unment Instrument Numbu NEPA Control Number CID Number COP DE-EEOOO3117 GFO-l0-4t4 EE3117 Based on my nview oftbe information concerning the proposed action, as NEPA Compliance Officer (authori7.ed undu DOE Onter 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathenng (Including, but not limited to, literature surveys, inventories, audits). data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies. analytical energy supply

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Andrea Dunn Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Marte Gutierrez Principal Investigator Colorado School of Mines 1600 Illinois Street Golden, CO 80401 303-273-3468 Fax: 303-273-3602 mgutierr@mines.edu PROJECT DURATION Start Date 12/01/2009 End Date 5/31/2013 COST Total Project Value $297,505 DOE/Non-DOE Share $297,505 / $0 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Training and Research on Probabilistic Hydro-Thermo-Mechanical Modeling of Carbon Dioxide Geological Sequestration in Fractured Porous Rocks Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Il.II.': , Il.II.': , u.s. DEPARTMENT OFFNERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DFTFnIINATION RECIPIENT: FDC Enterprises, Inc. Page 1 of2 STATE: KS PROJECT TITLE: Design and Demonstration of an Advanced Agricultural Feedstock Supply System for lignocellulosic Bioenergy Production Funding Opportunity AonOUDCtment Number DE-FOA-0000060 Pnxunmtol Instrument Number EEOOO1033 NEPA Control Number em Number GF()..10-532 0 Based on my review oflbe information concerning the propostd action, 85 NEPA Compliance Officer (authorized under DOE Order 4Sl.IA). I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits). data analysis (including



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FNT OF ENERGY FNT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT:Oregon Department of Energy PROJECf TITLE: Farm Power Tillamook, LLC Page I of2 STATE: OR Funding Opportunity Announcement Number DE-FOA-0000052 Procurement Instrument Number NEPA Control Number ell> Number DE-EEOOOO140 GFO-OOO0140-OO5 EE140 Based on my review oftbe information concerning the proposed aetion, as NEPA Compliance Officer (autborized under DOE Order 451.1A), I have made the following determination: ex, EA, EI S APP~:NDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

FACTS FACTS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Joseph Labuz Principal Investigator University of Minnesota 500 Pillsbury Drive SE Room 122 CivE 0851 Minneapolis, MN 55455 612-625-9060 jlabuz@umn.edu PARTNERS None PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,568 DOE/Non-DOE Share $299,568 / $0 PROJECT NUMBER DE-FE0002020 Government funding for this project is provided in whole or in part through the



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

u~\ u~\ u.s. DEPAR TMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT:Hawaii Natural Energy Institute STATE : HI PROJECf TITLE: Hawaii Hydrogen Power Park - Technology Validation of a Hydrogen Fueling System Funding Opportunity Announcement Number n/a Procurement Instrument Number DE·FC51-02R021399 NEPA Control Number GFO-R021399-002 Page 1 of2 em Number 21399 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description; 85.1 Adions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Office of Legacy Management (LM)

8 MILES NORTH OF PHlLADEl.PHlA 8 MILES NORTH OF PHlLADEl.PHlA HATBORO, PA. August 27, 1948 ! ! Frank Giaccio' Commission / I This follows my letter of August ZOth, in which I promised to advise you of our thoughts concerning beryllium, after I had completed a series of con- tacts with both.Government and private,grou?s and had an opportunity to evaluate the possibilities of using our process from the point of view of industrial research. By this, I meanthe possibility of the research leading into substantial production of parts. I believe I mentioned some of the contacts to you when I was in your office, and that we still had more to make. It is my opinion now that as far as beryllium is concerned, I cannot visualize the possibility of large production runs of parts; because it is



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Recipient. County of Berks, PA ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Replacement of Steam and Condensation Lines at North Campus B5.1 Waste Stream, Engineering, and Historical Preservation clauses. The new boiler cannot result in a net increase in air emissions. Additional Comments: Based on my review of information conveyed to me and in my possession (or attached) concerning the proposed action, as NEPA Compliance Officer (as authorized under DOE Order 451.1B), I have determined that the proposed action fits within the specified class of actions, other applicable regulatory requirements are met, and the proposed action is hereby categorically excluded from further



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PARTMENT OF ENERGY PARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT:WA Dept of Commerce Page 1 of3 STATE: WA PROJECT TITLE: SEP ARRA · WSU Anaerobic Digester - Nutrient Recovery Technology - Vander Haak Dairy Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number EEOOOO139 GF0-0000139-040 0 Based on my review of the Information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visils, and audits), data analysis (including


Oxidation of zirconium alloys in 2.5 kPa water vapor for tritium readiness.  

DOE Green Energy (OSTI)

A more reactive liner material is needed for use as liner and cruciform material in tritium producing burnable absorber rods (TPBAR) in commercial light water nuclear reactors (CLWR). The function of these components is to convert any water that is released from the Li-6 enriched lithium aluminate breeder material to oxide and hydrogen that can be gettered, thus minimizing the permeation of tritium into the reactor coolant. Fourteen zirconium alloys were exposed to 2.5 kPa water vapor in a helium stream at 300 C over a period of up to 35 days. Experimental alloys with aluminum, yttrium, vanadium, titanium, and scandium, some of which also included ternaries with nickel, were included along with a high nitrogen impurity alloy and the commercial alloy Zircaloy-2. They displayed a reactivity range of almost 500, with Zircaloy-2 being the least reactive.

Mills, Bernice E.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N1!PA Dl!1'ElU.llNATION N1!PA Dl!1'ElU.llNATION RECIPIENT:City of Perth Amboy PROJECT TITLE : Municipal Complex Solar Power Project Page 1 of2 STATE: NJ Funding Opportunity Announl::ement Number Procurement Instrument Number NEPA Control Number elD Number Congressionally Directed Project DE· EEOOO3172 GF0-0003172..Q01 EE3172 Based on my review of the information concerning the proposed action, as N[PA Compliance Officer (authoro.ed under DOE Order451.1A),1 have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Adions to oonserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentratIOns of potentially harmful substances. These actions may involve financial and technical


Murdock Road Knoxville.TN  

NLE Websites -- All DOE Office Websites (Extended Search)

or licensing to companies and partners outside the United States). Given the size and financial strength of the U.S. marketplace, I believe the ultimate licensee of this...


BsTan gnyis gling pa (1480-1535) et la Revelation du Yang tig ye shes mthong grol  

E-Print Network (OSTI)

enseignements et de ri-chesses se trouve Gos sngon ! Si tu (veux) te rendre l-bas, je te guiderai !Cest une injonction de Guru Padma ! 10 4 Le personnage dont il est question dans cette stance est O rgyan m... certainement lui prfrer laleon du bKa thang gser phreng de Sangs rgyas gling pa qui propose la lecture (p.630) stag thab. On verra plus bas comment interprter isolment stag (pour stagshar) et thab (pour thab).6 O rgyan gling pa, op. cit., p. 571 : de...

Achard, Jean-Luc




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



A Diagnostic Study of an Explosively Developing Extratropical Cyclone and an Associated 500-hPa Trough Merger  

Science Conference Proceedings (OSTI)

This paper presents a diagnosis of an explosively developing cyclone (1.3 Ber) that occurred in conjunction with a 500-hPa synoptic-scale trough merger over the eastern United States in November 1999. The explosive development occurred in ...

Jennifer L. S. Strahl; Phillip J. Smith



Contributions to 2^nd TeV Particle Astrophysics Conference (TeV PA II) Madison Wisconsin - 28-31 August 2006  

E-Print Network (OSTI)

This collection of proceedings to the TeV PA II Conference presents some of the latest results of the IceCube Collaboration.

IceCube Collaboration; A. Achterberg



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Geochemical data package for the Hanford immobilized low-activity tank waste performance assessment (ILAW PA)  

Science Conference Proceedings (OSTI)

Lockheed Martin Hanford Company (LMHC) is designing and assessing the performance of disposal facilities to receive radioactive wastes that are stored in single- and double-shell tanks at the Hanford Site. The preferred method of disposing of the portion that is classified as low-activity waste is to vitrify the liquid/slurry and place the solid product in near-surface, shallow-land burial facilities. The LMHC project to assess the performance of these disposal facilities is the Hanford Immobilized Low-Activity Tank Waste (ILAW) Performance Assessment (PA) activity. The goal of this project is to provide a reasonable expectation that the disposal of the waste is protective of the general public, groundwater resources, air resources, surface-water resources, and inadvertent intruders. Achieving this goal will require prediction of contaminant migration from the facilities. This migration is expected to occur primarily via the movement of water through the facilities, and the consequent transport of dissolved contaminants in the porewater of the vadose zone. Pacific Northwest National Laboratory assists LMHC in their performance assessment activities. One of the PNNL tasks is to provide estimates of the geochemical properties of the materials comprising the disposal facility, the disturbed region around the facility, and the physically undisturbed sediments below the facility (including the vadose zone sediments and the aquifer sediments in the upper unconfined aquifer). The geochemical properties are expressed as parameters that quantify the adsorption of contaminants and the solubility constraints that might apply for those contaminants that may exceed solubility constraints. The common parameters used to quantify adsorption and solubility are the distribution coefficient (K{sub d}) and the thermodynamic solubility product (K{sub sp}), respectively. In this data package, the authors approximate the solubility of contaminants using a more simplified construct, called the solution concentration limit, a constant value. In future geochemical data packages, they will determine whether a more rigorous measure of solubility is necessary or warranted based on the dose predictions emanating from the ILAW 2001 PA and reviewers' comments. The K{sub d}s and solution concentration limits for each contaminant are direct inputs to subsurface flow and transport codes used to predict the performance of the ILAW system. In addition to the best-estimate K{sub d}s, a reasonable conservative value and a range are provided. They assume that K{sub d} values are log normally distributed over the cited ranges. Currently, they do not give estimates for the range in solubility limits or their uncertainty. However, they supply different values for both the K{sub d}s and solution concentration limits for different spatial zones in the ILAW system and supply time-varying K{sub d}s for the concrete zone, should the final repository design include concrete vaults or cement amendments to buffer the system pH.

DI Kaplan; RJ Serne



New Regimes of Stringy (Holographic) Pomeron and High Multiplicity pp and pA Collisions  

E-Print Network (OSTI)

Holographic AdS/QCD models of the Pomeron unite a string-based description of hadronic reactions of the pre-QCD era with the perturbative BFKL approach. The specific version we will use due to Stoffers and Zahed, is based on a semiclassical quantization of a "tube" (closed string exchange or open string virtual pair production) in its Euclidean formulation using the scalar Polyakov action. This model has a number of phenomenologically successful results. In this work we point out that the periodicity of a coordinate around the tube allows the introduction of a Matsubara time and therefore an effective temperature on the string. We observe that in the LHC setting this temperature is approaching the Hagedorn temperature of the QCD strings. We therefore conclude, based on studies of the stringy thermodynamics of pure gauge theories, that there should exist two new regimes of the Pomeron: the "near-critical" and the "post-critical" ones. In the former one, string excitations should create a high entropy "string ball" at mid-rapidity, with high energy and entropy but small pressure/free energy. Amusingly, we find that this ball is dual to a certain black hole. Furthermore, as the intrinsic temperature of the string narrows on the Hagedorn temperature or T/TH-1=O(1/Nc), or even higher ones, the stringy ball develops repulsive interactions, a pressure, and becomes a post-critical explosive "QGP ball". We speculate that the high multiplicity trigger in pp and pA selects events with such a "string ball" cluster. The hydrodynamical flow resulting from this scenario is discussed elsewhere.

Edward Shuryak; Ismail Zahed


Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DEl'ER}.fiNATION RECIPIENT:Cortiand County Business Development Corporation PROJE(.T TITLE : Energy Independent Agri-Business Outreach Page I of2 STATE: NY Funding Opportunity Announcement Number DE-EOOO3110 Procurement Instrument Number EEOOO3110 NEPA Control Number em Number GFO-10-573 0 Based on my review orlbe information concerning the proposed action, as N[PA Compliance Officer (autborized under DOE Order 4SI.IA),1 have made tbe follol'iing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul nollimiled 10, literature surveys. inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETlffiMINATION Nl!PA DETlffiMINATION R[CIPIENT:New York State Energy Research and Development Authority PROJECf TITLE: Program Year 2012 Formula Grants - State Energy Program Page 1 of3 STATE: NY Funding Opportunity Announcement Numbel" Procurement Instrument Number NEPA Control Number CID Number DE-FOA-Q000643 R130772 GF0-0130772-OO1 Based on my review orlbe information concerning the proposed action, as NEPA Compliance Omen (authorized under DOE Order 451.1A), I hne made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: All Technical advice and assistance to organization, A9 Information gathering, analysis, and dissemination Rational for determination: Technical advice and planning aSSistance to international, national, slate, and local organizations.


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Comparison of 700-hPa NCEP-R1 and AMIP-R2 Wind Patterns over the Continental United States Using Cluster Analysis  

Science Conference Proceedings (OSTI)

Clustering techniques are adapted to facilitate the comparison of gridded 700-hPa wind flow patterns spanning the continental United States. A recent decade (198594) of wind component data has been extracted from two widely used reanalysis ...

Ellen J. Cooter; Jenise Swall; Robert Gilliam



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DE1'l!RlInNATION DE1'l!RlInNATION Page I of2 RECIPIENT:West Chester University of Pennsylvania STATE: PA PROJECT TITLE: Design and Implementation of Geothermal Energy Systems at West Chester University Funding Opportunity Announcement Number 70.10 Procurement Instrument Number DE-EEOOO3217 NEPA Control Number GFO-1Q-484 cm Number o Based on my review oflhe informallon concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTII'IENT OF ENERGY DEPARTII'IENT OF ENERGY EERE PROJECT MA'PA DETEIU.fiNATION RECIPIENT:ldaho Office of Energy Resources PROJECT TITLE : Program Year 2012 State Energy Program Formula Grants Page 1 of2 STATE: fD Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CIO Number DE-FOA0000643 DE-EEOOO3681 GFD-0003681-OO3 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 1. IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination A11 Technical advice and assistance to organizations Rational for determination: Information gathering (induding, but not limited to, literature surveys, inventories, site visits, and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DI!PARTlIIENT OFI!NFRGY DI!PARTlIIENT OFI!NFRGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!TIIU.fiNATION REClPI[NT:The Regents of the University of Califomia; University of California Berkley Page I of2 STATE: CA PROJEcr TITLE: Advanced Manufacturing MedicaVBiosciences Pipeline for Economic Development {AM2PED)is a regional medical and biosciences manufacturing initiative targeting the 180/880 corridor in the SF East Bay. Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number JlAC2102AM DE-EE0006026 GF().()()()6()26-001 G06026 Based on my TCview ortbe information concerning the proposed aclion, as NEPA Compliance Officer (authoru.ed under DOE Order 451.1A), I have made tbe following detel"mination: ex, EA, [IS APPENDIX AND NUMBER:



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

.**.* : .**.* : , U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!Rl\lINATION RECIPIENT :DOE Solar Energy Technology Program PROJECf TITLE: Solar Energy Evolution and Diffusion Studies (SE EDS) Page 1 of2 STATE: DC Funding Opportunity Annouoc:emenf Number Procurement Instrument Number NEPA Control Number em Number OE-FOA-OOOO740 GFO-FOA0740-001 Based on my review orehe information concerning the proposed aetion, as NEPA Compliance Officer (authorized under DOE Order 4Sl.IA), I have made tbe following determination: ex, EA, EIS APPENDlX AND NUMBER: Description: A91nformation gatheri ng, analYSiS, and d isseminatio n Information gathering (including, but nollimiled 10, literature surveys, Inventories, site visits, and audits), data analysis (including, but not limited 10, computer modeling), document preparation



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARThIENT OFENYRGY DFPARThIENT OFENYRGY EERE PROJECT MANAGEMENT CENTER Nl'PA DETFlUllNATION RECIPIENT:State of louisiana-Louisiana Department of Natural Resources PROJECf TITLE: ARRA EECBG-Slale of louisiana Pointe Coupe Parish Page 1 of3 STATE : LA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Numbu DE-FOA-OOOOO13 DE-EEOOOO735 GF0-0000735-OO5 0 Based on my review of the informafion concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Adions to conserve energy. demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OFENl!RGY OFENl!RGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!lU.nNATION RECIPIENT:Atargis Energy Inc. PROJECT TITLE : Cycloidal Wave Energy Converter Page lof2 STATE: CO Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE·FOA-OOOO293 DE-EEOOO3635 GFQ-000363S-001 0 Based on my review of tbe information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA). I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies. analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Richland county Richland county U.S. DEPARTMENT OFI!NFRGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!TI!RMINATION PROJECT TITLE: Irmo Char1ing Cross Sidewalk Project Page 1 of2 STATE: SC Funding Opportunity AnnouDcement Num~r Procurement Instrument Number NEPA Control Number CID Number EEOOOO95O GF().()()()()95()3 0 Based on my review ofthe information concerning tbe proposed action, as NEPA Compliance Officer (authom.ed under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation , and promote energy-efficJency that do not increase the indoor ooncentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MANAGEMENT CENTER MANAGEMENT CENTER NJ!PA DETEJU,llNATION RECIPIENT :Ocean Renewable Power Company, LlC Page I of2 STATE: AK PROJECf TITLE: Acoustic Monitoring of Beluga Whale Interactions withCook Inlet Tidal Energy Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO69 DE-EE0002657 GFO-O002657-002 G02657 Based on my review oftbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B3.3 Research related to Field and laboratory research, inventory, and information collection activities that are directly conservation of fish, wildlife, related to the conservation of fish and wildlife resources or to the protection of cultural



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARThIFNT OF ENERGY DFPARThIFNT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DETFID.llNATION RECIPIENT:Mercedes·Benz Research & Development, North America PROJECT TITLE : Light· Duty Fuel Cell Electric Vehicle Validation Data Page I of2 STATE : CA Funding Opportunity Announcemcnt Number DE·FOA·0000625 Procurement Instrument Number DE-EEOOO5971 NEPA Control Number CID Number GFO"'()005971...{)()1 G05971 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI. IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Rational for detennination: Information gathering (including, but not limited to, literature surveys. inventories, site visits, and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DIiPARTMENT OF ENFR Y DIiPARTMENT OF ENFR Y EERE PROJECT MANAGEMENT C NTER NIiPA DETERMINATION RECIPIENT:Califomia Energy Commission PROJE('T TITLE: SEP Annual Formula Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procurement Instrument umber NEPA Control Number em Number DE-FOA-0000643 DE-EE-0003941 GFO-O003941-OO1 Based on my review of the information concerning the proposed action, as NEP Compliance Officer (authorized under DOE Order 451.lA), I have made the (ollowlng determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including , bul nol limiled 10, lite alure surveys, inventories, site visits, and audits), data analysis (including , but nol limiled 10. co puler modeling), document preparation


Exchanges of Energy, Water and Carbon Dioxide Xuhui Lee (Yale University) and Edward Pa:on (NCAR)  

NLE Websites -- All DOE Office Websites (Extended Search)

Influences of the Boundary Layer Flow on Vegeta8on-Air Influences of the Boundary Layer Flow on Vegeta8on-Air Exchanges of Energy, Water and Carbon Dioxide Xuhui Lee (Yale University) and Edward Pa:on (NCAR) * Summarize your projects and its scienFfic objecFves for the next 3-5 years The objecFve of this project is to establish a mechanisFc understanding of the interplay between flow heterogeneity in the atmospheric boundary layer (ABL), land surface heterogeneity, and vegetaFon-air exchange of energy, water and CO 2 . The project will invesFgate mechanisms by which mesoscale moFons in the ABL influence vegetaFon-air exchange. It will also quanFfy the influence of heterogeneity on predicFons by 1D column models used in regional and global scale climate models. It is hypothesized that two important ABL processes entrainment and flow



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

*** *** ~ , RECI P I [NT :Riverheath u.s. DEP.-\RTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!RMINATION Page 1 of2 STATE: WI PROJECT TITLE: RiverHeath: Neighborhood loop Geothermal Exchange System: Technology Demonstration Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOO116 DE-EEOOO3005 GFO-OO03005-OO2 G03005 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4Sl.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may Involve financial and technical

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Dictyostelium transcriptional responses to Pseudomonas aeruginosa: common and specific effects from PAO1 and PA14 strains  

E-Print Network (OSTI)

,15 DDB0167879 IWS1 C-terminus 0,70 0,69 DDB0205969 snd1, tudor domain-containing protein 0,66 0,79 DDB0188840 TFIIAL, "transcription_factor_IIA" -0,79 -0,55 DDB0167865 ddx52, DEAD/DEAH box helicase -0,55 -0,55 DDB0184074 ddx6, DEAD/DEAH box helicase 0... ,62 0,66 DDB0184228 DEAD/DEAH box helicase -0,63 -0,60 Table 2: Genes differentially expressed upon infection with PAO1 and PA14 versus Klebsiella (Continued)Page 9 of 15 (page number not for citation purposes) DDB0206136 myb domain-containing protein 0...

Carilla-Latorre, Sergio; Calvo-Garrido, Javier; Bloomfield, Gareth; Skelton, Jason; Kay, Robert R; Ivens, Alasdair; Martinez, Jose L; Escalante, Ricardo



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Exceptional Service in the National Interest SNL/WIPP Records Center File Code: WIPP:  

E-Print Network (OSTI)

Exceptional Service in the National Interest SNL/WIPP Records Center File Code: WIPP:'s) Waste Isolation Pilot Plant (WIPP). The DOE is emplacing MgO in the WIPP to serve as the engineered in the WIPP divided by the total amount required to consume all CO2 that would be produced by microbial


The Northern Wintertime Divergence Extrema at 200 hPa and MSLP Cyclones as Simulated in the AMIP Integration by the ECMWF General Circulation Model  

Science Conference Proceedings (OSTI)

Divergence and convergence centers at 200 hPa and mean sea level pressure (MSLP) cyclones are located every 6 hours for a 10-year GCM simulation for the boreal winters from 1980 to 1988. The simulation used the observed monthly mean SST for the ...

James S. Boyle



Interannual Variations of East Asian Trough Axis at 500 hPa and its Association with the East Asian Winter Monsoon Pathway  

Science Conference Proceedings (OSTI)

Interannual variations of the East Asian trough (EAT) axis at 500 hPa are studied with the European Centre for Medium-Range Weather Forecasts 40-yr reanalysis data. The associated circulation pattern and pathway of the East Asian winter monsoon (...

Lin Wang; Wen Chen; Wen Zhou; Ronghui Huang



By Terry Engelder and Gary G. Lash UNIVERSITY PARK, PA.The shale gas rush is on. Excitement over natural gas production from a  

E-Print Network (OSTI)

By Terry Engelder and Gary G. Lash UNIVERSITY PARK, PA.­The shale gas rush is on. Excitement over natural gas production from a number of Devonian-Mississippian black shales such as the Barnett by the Eastern Gas Shales Project (EGSP), a U.S. Department of Energy-sponsored investigation of gas potential

Engelder, Terry



NLE Websites -- All DOE Office Websites (Extended Search)

issue is that of energy deposition in the issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Abstract: The effects of electron conditioning on commercially prepared aluminum alloys 1100 and 6063 were investigated. Contrary to the assumption that electron conditioning, if performed long enough, can reduce and stabilize the SEY at approximately 1.1, the SEY of aluminum did not go lower than 1.8. In fact, it increases again with continued electron exposure dose.


TN 1421 - Chapter 2: Electrical Substitution Radiometry  

Science Conference Proceedings (OSTI)

... II. Electrical Substitution Radiometry. ... Figure 1. Schematic diagram of the essential components of an electrical substitution radiometer. ...


ORNL/TN--8524 DE83 005172  

E-Print Network (OSTI)

-kW Free-Piston Stirling Engine with a Dashpot Load DISCLAIMER This report was prepared as an account RESULTS AND DESCRIPTION OF A 1KW FREE-PISTON STIRLING ENGINE WITH A DASHPOT LOAD Jeffrey Schreiber.33 hp) single cylinder free-piston Stirling engine was installed in the test facilities at the Lewis

Oak Ridge National Laboratory


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETl!la.llNATION Nl!PA DETl!la.llNATION RECIPIENT:lmpact Technologies llC PROJECf TITLE : Deep Geothermal Drilling using Millimeter Wave Technology Page 1 of2 STATE: OK Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOS22 DE-EEOOO5504 GFO-OOO5504-OO1 G05504 Based on my review or lhe infonnation concerning the proposed action, as NEPA Compliance OtrlCCf (authorized unde r DOE OTdu451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (induding. but not limited to. literature surveys, inventories, site visits, and audits), data analysis (induding. but not limited 10, computer modeling), document preparation (induding. bul nollimited to, conceptual design,


Structure and Function of PA4872 from Pseudomonas aeruginosa, a Novel Class of Oxaloacetate Decarboxylase from the PEP Mutase/Isocitrate Lyase Superfamily  

SciTech Connect

Pseudomonas aeruginosa PA4872 was identified by sequence analysis as a structurally and functionally novel member of the PEP mutase/isocitrate lyase superfamily and therefore targeted for investigation. Substrate screens ruled out overlap with known catalytic functions of superfamily members. The crystal structure of PA4872 in complex with oxalate (a stable analogue of the shared family R-oxyanion carboxylate intermediate/transition state) and Mg{sup 2+} was determined at 1.9 {angstrom} resolution. As with other PEP mutase/isocitrate lyase superfamily members, the protein assembles into a dimer of dimers with each subunit adopting an {alpha}/{beta} barrel fold and two subunits swapping their barrel's C-terminal {alpha}-helices. Mg2+ and oxalate bind in the same manner as observed with other superfamily members. The active site gating loop, known to play a catalytic role in the PEP mutase and lyase branches of the superfamily, adopts an open conformation. The N{sup {epsilon}} of His235, an invariant residue in the PA4872 sequence family, is oriented toward a C(2) oxygen of oxalate analogous to the C(3) of a pyruvyl moiety. Deuterium exchange into {alpha}-oxocarboxylate-containing compounds was confirmed by {sup 1}H NMR spectroscopy. Having ruled out known activities, the involvement of a pyruvate enolate intermediate suggested a decarboxylase activity of an {alpha}-oxocarboxylate substrate. Enzymatic assays led to the discovery that PA4872 decarboxylates oxaloacetate (k{sub cat}) = 7500 s{sup -1} and K{sub m} = 2.2 mM) and 3-methyloxaloacetate (k{sub cat}) = 250 s{sup -1} and K{sub m} = 0.63 mM). Genome context of the fourteen sequence family members indicates that the enzyme is used by select group of Gram-negative bacteria to maintain cellular concentrations of bicarbonate and pyruvate; however the decarboxylation activity cannot be attributed to a pathway common to the various bacterial species.

Narayanan, Buvaneswari C.; Niu, Weiling; Han, Ying; Zou, Jiwen; Mariano, Patrick S.; Dunaway-Mariano, Debra; Herzberg, Osnat (UNM); (UMBI)



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.




Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



La Liste Des Tantras Du rNying Ma'i Rgyud 'bum Selon L'edition Et Ablie Par Kun Mkhyen 'Jigs Med Gling Pa  

E-Print Network (OSTI)

gro bai rgyud lnga) qui sontcommuns lAnuyoga24 et dont la liste concerne les nos. 229, 224, 169, 166 etun Ri bo brtsegs pai rgyud qui est non-identifi dans la liste de Jigs med glingpa),xvi. le Recueillement Concentr (Ting dzin rtse gcig, non... on pourrait leur en trouver une, ainsi quon la fait dans cette prsentation. Il faudrait galement appliquer ce schma celui des clas- sification complexes du Klong sde en Abme blanc (klong dkar po), noir (klong nag po), diapr (klong khra bo) et infini...

Achard, Jean-Luc



Offering Songs, Festive Songs, Processional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Ta po sam ten gyam pa, 'Dream about Tibet'  

E-Print Network (OSTI)

last updated on Monday, 4 April 2011 Accession Form for Individual Recordings: Collection / Collector Name mGar glu / Katey Blumenthal Tape No. / Track / Item No. 06_14_2010_Ta po sam ten gyam pa.WAV Length of track 00:03:53 Title of track Ta po... ) Date of recording 06/14/2010 Place of recording Lo Monthang, Mustang, Nepal Name(s), age, sex, place of birth of performer(s) Tashi Tsering, unknown age, Male, Lo Monthang, Mustang, Nepal. Language of recording Logay Performer(s)s first / native...

Blumenthal, Katey


Offering Songs, Festive Songs, Processional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Da lulo chig dag pa nai ki nai glu yakshung  

E-Print Network (OSTI)

last updated on Monday, 4 April 2011 Accession Form for Individual Recordings: Collection / Collector Name khro glu / Katey Blumenthal Tape No. / Track / Item No. 06_07_2010_Da lulo chig dag pa nai ki nai glu yakshung.MP3 Length of track 00... (festive song) Medium (i.e. reel to reel, web-based file, DVD) Digital Recording Related tracks (include description/relationship if appropriate) Name of recorder (if different from collector) Date of recording 06/07/2010 Place of recording Lo...

Blumenthal, Katey


Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Physical characteristics of LWRs and SCLWRs loaded by ({sup 233}U-Th-{sup 238}U) oxide fuel with small additions of {sup 231}Pa  

SciTech Connect

The paper investigates the possibility and attractiveness of using (U-Th) fuel in light-water reactors (LWRs) and in light-water reactors with super-critical coolant parameters (SCLWRs). It is proposed to dilute {sup 233}U with {sup 238}U to enhance the proliferation resistance of this fissionable isotope. If is noteworthy that she idea was put forward for the first time by she well known American physicist and participant of the Manhattan Project Dr. T. Taylor. Various fuel compositions are analyzed and compared on fuel breeding, achievable values of fuel burn-up and cross-sections of parasitic neutron absorption. It is also demonstrated that small {sup 231}Pa additions (several percent) into the fuel allows: to increase fuel burn-up, to achieve more negative temperature reactivity coefficient of coolant and to enhance nonproliferation of the fuel. (authors)

Kulikov, E.G.; Shmelev, A.N.; Apse, V.A. [Moscow Engineering Physics Institute - State University, Kashirskoe shosse, 31, Moscow (Russian Federation); Kulikov, G.G. [International Science and Technology Center, Krasnoproletarskaya ul., 32-34, P.0. Box 20, Moscow (Russian Federation)




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PARThlENT OF ENERGY PARThlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA Dl1TImfiNATION RECIPIENT: BeIi Geospace, Inc Page 1 of2 STATE: TX PROJECT TITLE: Geothermal Technology Advancement for Rapid Development of Resources in the U.S. Funding OpportunUy Announcement Number Procurement Instrument Number NEPA Control Number em Number DE·FQA'()()()()S22 OE-EEOOO5515 GF0-0005515-001 G05515 Bued on my review oftbe information concerning the proposro action, as NEPA Compliance Officer (authorized under DOE Ordtr 4SI.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : A9 Information gathering, analysis, and dissemination Information gathering (induding, but not limited to, literature surveys, inventories, site visits. and audits), data analysis

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EERE PROJECT MANAGEMENT CENTER N1!PA DEl'l!R1.llNAl'ION R[CIPIENT:State of Louisiana-louisiana Department of Natural Resources  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENTER CENTER N1!PA DEl'l!R1.llNAl'ION R[CIPIENT:State of Louisiana-louisiana Department of Natural Resources PROJECf TITLE: ARRA EECBG - State of Louisiana St. James Parish Page 1 of2 STATE: LA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO13 DE-EEOOOO735 GF0-0000735-004 0 Based on my review or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I bave made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potentia! energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENl!RGY ENl!RGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!R1.llNATION RECIPIENT: Magma Energy (U.S .) Corp. Page 1 of3 STATE: NV PROJECf TITLE: Recovery Act: A 3D·3C Reflection Seismic Survey and Data Integration to Identify the Seismic Response of Fractures and Permeable Zones over a Known Geothermal Resource: Soda lake , Churchill Co" NV Funding Opportunity Announcement Number PrO(u.-ement Instrument Number NEPA Control Number em Number 0000109 DE-EEOOO2832 GFO-OOO2832·003 0 Based on my review oftbe informatioD concerning the proposed action, as NEPA Compliance Officer (authori7.ed under DOE Order 451.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathenng (including , but nollimiled 10, literature surveys, inventories, audits), data analYSIS (including


ENVIRONMENTAL COALITION ON NUCLEAR POWER Phone/Fax: 814-237-3900 433 Orlando Avenue, State College, PA 16803 e-mail: johnsrud@csrlink  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COALITION ON NUCLEAR POWER Phone/Fax: 814-237-3900 433 COALITION ON NUCLEAR POWER Phone/Fax: 814-237-3900 433 Orlando Avenue, State College, PA 16803 e-mail: johnsrud@csrlink.net January 29, 1998 U.S. Department of Energy Office of General Counsel CC-52 RE: 62 FR 68272 1000 Independence Avenue SW Price-Anderson Act Washington, D.C. 20585 Dear Madam or Sir: We have just been notified of the December 31, 1997, Federal Register Notice of opportunity for public comment on the Price-Anderson Act (PAA). Please accept for the Department's record in this matter the following comments submitted by the Pennsylvania-based Environmental Coalition on Nuclear Power (ECNP), a not-for-profit public-interest citizens' organization that has been actively involved in a broad range of nuclear energy and radioactive waste issues since


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




Science Conference Proceedings (OSTI)

... Synovate provides services to many companies, including General Motors, Fidelity Investments, American Express, ExxonMobil, Proctor & Gamble ...




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Pour servir a la numerisation des manuscrits tibetains de Dunhuang conserves a la Bibliotheque Nationale : II. Un fichier de Marcelle Lalou  

E-Print Network (OSTI)

'i mdo. 129, INV. 116 (quinzimedes textes mentionns la suite du texte 5). = Otani 810 ? rnam par mi rtog par 'jug pa zhes bya ba'igzungs. ! Avikalpapravesha.- rnam par snang mdzad chos kyi rje. 257, INV. 2 (dbut du texte 2).- rnam spyan drang ba smon... texte 4).- mi rtog pa'i bsam gtan la 'jug pa dam pa'i chos kyi mdo sde (las). 068,INV. 829 (dbut du texte, qui donne "myi rtog pa" et non "mi rtog pa".- moksa'i bshas pa rdzogs sho //. 0618, INV. 910 (fin du f. 22, l'orthographede la fiche est...

Chayet, Anne




SciTech Connect

In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Pa{alpha} image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M{sub Sun} yr{sup -1}, was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are {approx}7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

Komugi, S. [Joint ALMA Observatory, Alonso de Cordova 3107, Vitacura, Santiago 763-0355 (Chile); Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabe, T.; Yoshii, Y. [Institute of Astronomy, University of Tokyo, Osawa 2-21-1, Mitaka, Tokyo 181-0015 (Japan); Takagi, T. [Institute of Space and Astronautical Science, JAXA, 3-31-1 Yoshinodai, Sagamihara, Kanagawa 229-8510 (Japan); Iono, D.; Kaneko, H.; Ueda, J. [Nobeyama Radio Observatory, National Astronomical Observatory, 462-2 Nobeyama, Minamimaki, Minamisaku, Nagano 384-1305 (Japan); Saitoh, T. R., E-mail: skomugi@alma.cl [Interactive Research Center of Science, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro 152-0033 (Japan)



Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Tibetan Texts: dMigs-pa-brtag-pa; dMigs-pa-brtag-pahi-hgrel-pa; dMigs-pa-brtag-pahi-hgrel-bshad  

E-Print Network (OSTI)

~~ .~~.:..\\t ~.~",.Q.,~", " 01~' -" ""' ~""' -.,.rtI' .!"oo~""" ...", q+j::"~' ~~ :J"..q~r'ra,,::'t:4"',"?f:a~'fl:::J':.\\l=-;Q~~"~ ~='~I:';C\\ ~~"~;:'S~'~~rs ::J'iJ'~'~5~':J'~='~="~1 ::" 1 ~ ~=:~;:':;;J... ~~ '~=" ~~'.:fs:,'..CJj "l'~ ~r:.J~'~''C!~'~ ~i'r;.:I-l J.t='~C!l~~t:'~~=l1~:P::~~~;'=-irC\\i"'~~1 i~ :r. e;-~ 'f,e:' ~ ~ "'" ...",.., ~ ~ . @l~ ~t:'tJ::~ ",,'~ "'. S ~'?l'~~~' c.rti ~ ;1 C:,~ .~ 1- .t; 6t 't: ,r. ''-i'll':: 1:' f:' ':r~'=~"1...

Namgyal Institute of Tibetology



A Handlist of the Bonpo Kangyur and Tengyur  

E-Print Network (OSTI)

??????????????????????????? Dus gsum mi nub bstan pa'i rgyal mtshan kun tu bzang po nam mkha' rgyal po thugs rje chen po 'khor ba kun grol gyi rgyud. Note: This is a gter ma of Bde-chen gling-pa. 117 28. ??????????????????????????????????????????????????????????? ??... ??????????????????????????? rDzogs chen bsgrags pa skor gsum las, sTeng lha yul du bsgrags pa'i skor. 324 175. ???????????????????????????????? ?????????????? ??????????????????????????????? rDzogs chen bsgrags pa skor gsum las, Bar mi yul dang, 'Og klu yul du bsgrags...

Keutzer, Kurt



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


ORAU Campus Visitor Map  

NLE Websites -- All DOE Office Websites (Extended Search)

+ Number Directions from Main Campus: Go back out to ORAU Way Turn left onto ORAU Way Turn left at S Illinois AveTN-62 (2.9 mi) Bear Slight right toward Bethel...



E-Print Network (OSTI)

System ARW Solver · Equations: Fully compressible, Euler nonhydrostatic with a run-time hydrostatic the compressible, nonhydrostatic Euler equations. The equations are cast in flux form using variables that have

Zhang, Yan


NIST TN 1297: Appen. C. NIST Tech. Communications Prog.  

Science Conference Proceedings (OSTI)

... E of the NIST Administrative Manual. ... of fundamental constants, fundamental metrological research ... Experimental Statistics, NBS Handbook 91 (US ...


P.O. Box 117, Oak Ridge, TN 37831  

NLE Websites -- All DOE Office Websites (Extended Search)

of climate stations that record real-time temperature, precipitation, wind speed, and solar radiation trends across the United States. Through the Atmospheric Turbulence and...


NIST TN 1297: Appen. D. Clarification and Additional ...  

Science Conference Proceedings (OSTI)

... t 1-? D.6 Uncertainty and units of the ... of this and other terms, has been replaced here and ... is equal to the negative of the estimated systematic error. ...



NLE Websites -- All DOE Office Websites (Extended Search)

chamber, one sample at a time is loaded, on its individual carrier plate, onto a manipulator arm (Vacuum Generators "Omniax"). The Omniax carrier plate holder design is shown...


Other Participants 1992 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

, Sparks , NV Gateway High School , Monroeville , PA Grant High School, Portland , OR Hanford High School , Richland , WA Harrison High School , Farmington Hills , MI Henry M....


Notice of Intent to Prepare an Environmental Impact Statement for the Gilberton Coal-to-Clean Fuels and Power Project, Gilberton, PA (DOE/EIS-0357) (April 10, 2003)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

08 08 Federal Register / Vol. 68, No. 69 / Thursday, April 10, 2003 / Notices DEPARTMENT OF ENERGY Notice of Intent To Prepare an Environmental Impact Statement for the Gilberton Coal-to-Clean Fuels and Power Project, Gilberton, PA AGENCY: Department of Energy. ACTION: Notice of intent. SUMMARY: The U.S. Department of Energy (DOE) announces its intent to prepare an Environmental Impact Statement (EIS) pursuant to the National Environmental Policy Act (NEPA), the Council on Environmental Quality (CEQ) NEPA regulations (40 CFR parts 1500-1508), and the DOE NEPA regulations (10 CFR part 1021), to assess the potential environmental impacts of a proposed project by WMPI PTY, LLC, to design, construct, and operate a demonstration plant near Gilberton, Schuylkill County, Pennsylvania. The


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...


Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...


Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...


Microsoft Word - figure_23.doc  

Annual Energy Outlook 2012 (EIA)

11.00+ Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...


Microsoft Word - figure_23.doc  

Gasoline and Diesel Fuel Update (EIA)

Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Blythe Solar Power Project PA/FEIS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BLYTHE SOLAR POWER PROJECT BLYTHE SOLAR POWER PROJECT Volume 1 of 2 August 2010 DOI Control #: FES 10-41 Publication Index #: BLM/CA/ES-2010-015+1793 NEPA Tracking # DOI-BLM-CA-060-0010-0013-EIS United States Department of the Interior Bureau of Land Management 120 1 Bird Center Drive Palm Springs, CA 92262 Phone (760) 833-7100 IFax (760) 833-7199 http://www.blm.gov/ca/palmsprings/ In reply refer to: CACA 048811 August 20, 20 I0 Dear Reader: Enclosed is the Proposed Resource Management Plan-AmendmentlFinal Environmental Impact Statement (PAlFEIS) for the California Desert Conservation Area (CDCA) Plan and Blythe Solar Power Project (BSPP). The Bureau of Land Management (BLM) prepared the PAIFEIS in consultation with cooperating agencies, taking into account public comments received during the National Environmental


Genesis Solar Energy Project PA/FEIS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GENESIS SOLAR ENERGY PROJECT GENESIS SOLAR ENERGY PROJECT Volume 1 of 3 August 2010 DOI Control #: FES 10-42 Publication Index #: BLM/CA/ES-2010-016+1793 NEPA Tracking # DOI-BLM-CA-060-0010-0015-EIS ,,..--......- _...._--- United States Department of the Interior Bureau of Land Management 1201 Bird Center Drive Palm Springs, CA 92262 Phone (760) 833·7100 IFax (760) 833-7199 http://www.blm.gov/calpalmsprings/ In reply refer to: CACA 048880 August 27, 20 I0 Dear Reader: Enclosed is the Proposed Resource Management Plan-Amendment/Final Environmental Impact Statement (PAIFEIS) for the California Desert Conservation Area (COCA) Plan and Genesis Solar Energy Project (GSEP). The Bureau of Land Management (BLM) prepared the PAiFEIS in consultation with cooperating agencies, taking into account public comments received during the National


Microsoft Word - PA Report 2013.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 1-December 30, 2012 October 1-December 30, 2012 February 12, 2013 Page 5 2.2 90-DAY LOOK AHEAD  Provide an annual assessment of the LM/LMS Environmental Management System in February. Three processes will be examined to evaluate implementation of the EMS elements.  Revise the Quality Assurance Manual, incorporating DOE Order 414.1D in March. A major change to the DOE directive is the requirements to choose a national standard as a basis of the QA Program. Stoller has chosen ISO 14001, Environmental Management System, because the standard focuses on environmental stewardship. 2.3 MAJOR CONCERNS The 2012 Health and Safety goal of more timely completion of corrective actions did not reach the 80 percent target for this quarter. A renewed focus on corrective action completion was


NETL: Science Bowl Information - South Western PA  

NLE Websites -- All DOE Office Websites (Extended Search)

CLICK ON IMAGE TO SEE LARGER VIEW SWPA Marshall Team 1 and SWPA Winner SWPA Wendover SWPA Carson Team 1 SWPA Suncrest Team 1 Lilas Soukup,SB Coordinator NETL, The Honorable Tim Murphy, U.S. House, Dr. Charlene Newkirk, Dr. Anthony Cugini, Director, NETL Middle School Congratulations to our four division winners: View full results here Division Einstein - Suncrest Team 1 - Christina Maloney, Coach - Aishwarya V, Captain - Bryce A - Luka B - David S - Roark S Division Carson - Wendover - Denise McGill, Coach - Adam G, Captain - Julia H - Kristina M - Josh M - Katrina P Division Tesla - Carson Team 1 - Cris Rufflol, Coach - Kevin D, Captain - Massil A - Pranav C - Rohan Y Division Westinghouse - Marshall Team 1 and SWPA Winner - Daniel Williams, Coach - Songela C, Captain - Marisa D


225 Shunk Hall University Park, PA 16802  

E-Print Network (OSTI)

of experience: Leadership of a contracted work crew consisting of 15 laborers Troubleshooting daily process

Demirel, Melik C.


NETL: Science Bowl Information - South Western PA  

NLE Websites -- All DOE Office Websites (Extended Search)

CLICK ON IMAGE TO SEE LARGER VIEW National Champs - State College - enjoying the Eiffel Tower in Paris. National Champs - State College - enjoying the Eiffel Tower in Paris....


NETL: 2009 SW PA Science Bowl Information  

NLE Websites -- All DOE Office Websites (Extended Search)

second in the National Competition and traveled to France to visit Europe's largest nuclear power plant. 2009 Southwestern Pennsylvania Science Bowl Information Center DATE:...


NETL: Science Bowl Information - Southwestern PA  

NLE Websites -- All DOE Office Websites (Extended Search)

SWPA Science Bowl-High School Preliminary Results Congratulations to the four high school divisional winners who competed Saturday February 25, 2012 in 12 competitive matches....


NETL: Science Bowl Information - South Western PA  

NLE Websites -- All DOE Office Websites (Extended Search)

SWPA Science Bowl-Middle School Preliminary Results Congratulations to the four middle school divisional winners who competed Saturday March 3, 2012 in 5 competitive rounds. These...


Arco chimie focuses on PA at FOS  

Science Conference Proceedings (OSTI)

Arco Chimie France (Fos-sur-Mer), at a recent meeting at its southern France manufacturing site, emphasized that future strategy is strongly focused on its propylene oxide (PO) and derivatives activities. The F2.5 billion ($466 million)-Fe billion/year operation manufactures 200,000 m.t./year of PO, about 70% for captive use and the balance for the merchant market; 550,000 m.t./year of methyl tert butyl ether (MTBE); 97,000 m.t./year of polyols; and 70,000 m.t./year of propylene glycols. There has been talk of Arco modifying its Fos MTBE plant to make it flexible for ethyl tert-butyl ether (ETBE) output; the parent company already operates an MTBE/ETBE pilot unit at Corpus Christi, TX. But Arco Chimie notes there is insufficient bioethanol feedstock availability to convert all production to ETBE. The company would also require investment in new storage capacity for ethanol and ETBE. However, France's biofuels program is not yet clearly defined, and it is politically sensitive because it depends heavily on government subsidies offered to farmers. That, says Arco, makes it impossible to have an accurate idea of how much ethanol will be available.

Jackson, D.



Pittsburgh, PA 15217 Members, County Council  

E-Print Network (OSTI)

Members, My name is Roger Dannenberg. I've lived in Pittsburgh since 1979, and I have been a member never be detected by testing. It might be detected by a complete inspection of the software programs, has recommended that electronic voting systems enable voters to inspect a paper record to verify

Eckhardt, Dave


2011 International Pittsburgh Coal Conference Pittsburgh, PA  

E-Print Network (OSTI)

injection line is equipped with a flow meter and pressure transducer as well as a pneumatic control valve to below the water table and hence are not directly connected with the vadose zone, while well W-3 has of the latter's well screen and shutting off its connectivity with soil vadose zone gas. Formal sampling

Mohaghegh, Shahab


La Roca Blanca de Lhang lhang - Un santuario en Nyag rong  

E-Print Network (OSTI)

de Rag dmar, debido a la progresiva influencia a lo largo de los siglos de la emigracin de poblacin mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag... mi nyag pa shar dang lho phyogs su phos mthus mi nyag log skad da ltaang lus yod pa de sa gnas dir rag dmar go zer ba ni brag dmar go zer ba yin/ La Roca Blanca de Lhang lhang 15 masculina(dbon brgyud) 9 . Muchos de estos centros religiosos...

Aguillar, Oriol



U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


The First Four Themes of Klong chen pa's Tshig don bcu gcig pa  

E-Print Network (OSTI)

as Buddha-Body, its nature as light, and its compassion as Awareness. 5. The way taken by Pristine Cognition gives an outline of the forma- tion of the body. It is argued that one has to learn first about the definite characteristics of the body... in order to understand the light-channels (od rtsa) which are based on the body and which constitute the way taken by Pristine Cognition (ye shes). 6. The doors by means of which Pristine Cognition arises explains the place where Pristine Cognition...

Scheidegger, Daniel



On the history and identification of two of the Thirteen Later Translations of the Dzogchen Mind Series  

E-Print Network (OSTI)

skad du/ byang chub kyi sems sgom pa don grub pa zhes bya ba/ dpal kun tu bzang po bde ba chen po la phyag 'tshal [lo]/ thug rje rgya mtsho (l. 5) sems can kun la khyab/ lha dang klu yang bden pa'i bka' nyan te/ dkon mchog gsum ni nam yang bskur mi... ni bstan du med/ sems dang chos ni ci yang ma yin pas/ sgom (l. 7) pa'i tshe na ci yang mi bsgom mo/ rnam par rtog pa'i mtshan ma ci byung yang/ rtog pa de nyid chos nyid yin shes na/ chos kyi dbyings ni gzhan du bsgom mi dgos/ de la gnyen pos bcos...

Liljenberg, Karen



SGang steng Catalogue  

E-Print Network (OSTI)

byaba/ 184-187 (274b-282a) Revue d'Etudes Tibtaines18 Colophon : // rgyud kyi rgyal po mi nub rgyal mtshan rje btsan dam pardo rje od phro bai rgyud rdzogs so//. 24. rDo rje sems dpa' nam mkha' che rgyas pa'i yi ge med pa'i rgyud/187-190 (282a-284b... cing theg pa mtha dag gi don bkod pa/ byang chubkyi sems bsam gtan nges pai rgyal po/ rje btsan dam pa rdzogs so//. 26. Mi 'gyur ba'i thig le tig / 189-191 (285a-287a)Colophon : /byang chub kyi sems mi gyur bai thig le tig rdzogs so//. 27. Srog gi...

Cathy Cantwell; Mayer, Rob; Kowalewski, Michael; Achard, Jean-Luc



Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


"Department of Energy Information Protection Task Force - SSN Reduction Project PA 09-Baseline Inventory",,,,,,,,,,,,,"1. Not Cost Effective","2. No Resources Available","3. Legally Required to Collect and/or Maintain","4. Other - Explain in Column ""R"""  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Energy Information Protection Task Force - SSN Reduction Project PA 09-Baseline Inventory",,,,,,,,,,,,,"1. Not Cost Effective","2. No Resources Available","3. Legally Required to Collect and/or Maintain","4. Other - Explain in Column ""R""" Department of Energy Information Protection Task Force - SSN Reduction Project PA 09-Baseline Inventory",,,,,,,,,,,,,"1. Not Cost Effective","2. No Resources Available","3. Legally Required to Collect and/or Maintain","4. Other - Explain in Column ""R""" "DOE Privacy Website: http://management.energy.gov/FOIA/privacy.htm",,,,,,,,,,,,,"Yes","No","N/A" ,"1. Departmental Element","2. System Name/ Major Application Name","3. Location","4. Name of System Owner/ Information or Data Owner","5. Contact Information","6. Does the system collect or maintain Social Security numbers?","7. Source of Legal Requirement/Authority to Collect or Maintain Social Security Numbers?","8. Does the system have a Privacy Impact Assessment (PIA)?","9. Does the system have a System of Records Notice (SORN)? If yes, provide the name of the System of Records Notice.","10. Does the system collect or maintain other forms of PII?","Comments"

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The sGang steng-b rNying ma'i rGyud manuscript from Bhutan  

E-Print Network (OSTI)

first folios, itsimply gives the volume identification and pagination in gold ink. 6 Volumes Ka, Pa, Ra, Ha to Ki, Gi, Ci, Chi, Nyi, Thi, Ni, Pi, Bi, and Mi 7 This is unlike the Rig 'dzin edition, where...

Cathy Cantwell; Mayer, Rob



The Buddhist princess and the woolly turban: non-Buddhist others in a 15th century biography  

E-Print Network (OSTI)

rnams la di ni bdag gis kun tu mi bzod kyis/ rdo ba dang phongs la rab tu bskrod cig ces bsgoo/khor rnams kyis kyang le lo ma yin par de bzhin du bgyis pa las/ bya gag gi phreng pa zhig pa bzhin du gyur nas rnga dang bshang la sogs pa rnams ni gzhi... dbus su ci nang bgyid par zhus nas/ de dang dei las la jug pa na rgyal bai dbang mos rang gi lhai de nyid dran par byes te blta stangs kyi gzir bas gshen rabs kyi rgyal mtshan chang ba yon mchod khor dang bcas pa thams cad la shing tu mi zad pa...

Diemberger, Hildegard




Office of Legacy Management (LM)

'??Kt fire ?726 reisccnsrcd nnd GxG.rL:* shed i.2 it3 csrUes tqyi by tn;hncd p?Q,cZt pr,l%WlMiL, TJi.th tl &Azy & fonAQinlff C,j-taen t&2 &if&g Sec%ir;n YG D...


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Linear Collider Collaboration Tech Notes LCC-0151 SLAC-TN-0-048  

NLE Websites -- All DOE Office Websites (Extended Search)

of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion...


File:EIA-Appalach7-TN-KY-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 BOE Reserve Class Kentucky and Tennessee By 2001 BOE Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.57 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:43, 20 December 2010 Thumbnail for version as of 17:43, 20 December 2010 5,100 × 6,600 (18.57 MB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Appalach7-TN-KY-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 Gas Reserve Class Kentucky and Tennessee By 2001 Gas Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.6 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:44, 20 December 2010 Thumbnail for version as of 17:44, 20 December 2010 5,100 × 6,600 (18.6 MB) MapBot (Talk | contribs) Automated bot upload


Data Sharing Report Characterization of Isotope Row Facilities Oak Ridge National Laboratory Oak Ridge TN  

SciTech Connect

The U.S. Department of Energy (DOE) Oak Ridge Office of Environmental Management (EM-OR) requested that Oak Ridge Associated Universities (ORAU), working under the Oak Ridge Institute for Science and Education (ORISE) contract, provide technical and independent waste management planning support using funds provided by the American Recovery and Reinvestment Act (ARRA). Specifically, DOE EM-OR requested ORAU to plan and implement a survey approach, focused on characterizing the Isotope Row Facilities located at the Oak Ridge National Laboratory (ORNL) for future determination of an appropriate disposition pathway for building debris and systems, should the buildings be demolished. The characterization effort was designed to identify and quantify radiological and chemical contamination associated with building structures and process systems. The Isotope Row Facilities discussed in this report include Bldgs. 3030, 3031, 3032, 3033, 3033A, 3034, 3036, 3093, and 3118, and are located in the northeast quadrant of the main ORNL campus area, between Hillside and Central Avenues. Construction of the isotope production facilities was initiated in the late 1940s, with the exception of Bldgs. 3033A and 3118, which were enclosed in the early 1960s. The Isotope Row facilities were intended for the purpose of light industrial use for the processing, assemblage, and storage of radionuclides used for a variety of applications (ORNL 1952 and ORAU 2013). The Isotope Row Facilities provided laboratory and support services as part of the Isotopes Production and Distribution Program until 1989 when DOE mandated their shutdown (ORNL 1990). These facilities performed diverse research and developmental experiments in support of isotopes production. As a result of the many years of operations, various projects, and final cessation of operations, production was followed by inclusion into the surveillance and maintenance (S&M) project for eventual decontamination and decommissioning (D&D). The process for D&D and final dismantlement of facilities requires that the known contaminants of concern (COCs) be evaluated and quantified and to identify and quantify any additional contaminants in order to satisfy the waste acceptance criteria requirements for the desired disposal pathway. Known facility contaminants include, but are not limited to, asbestos-containing material (ACM), radiological contaminants, and chemical contaminants including polychlorinated biphenyls (PCBs) and metals.

Weaver, Phyllis C



Approved for public release; distribution is unlimited. ERDC TN-DOER-E31  

E-Print Network (OSTI)

one of our most economically important pests in urban landscapes. Fire Ants cause extensive mounding (black dots show the location of each fire ant colony). Benefits · The ideal set of turf and landscape of landscape plants and turfgrasses can be identified that are repellent to Fire Ant foraging and mound

US Army Corps of Engineers


CASI 2011 Work Plan 1 ERDC/CERL TN-11-1 January 2011  

E-Print Network (OSTI)

by natural disasters, purposeful attack, or unusually high demand). When failures occur at various locations and thermal energy storage; n microgrids, ac and dc, including both self-contained, cellu- lar, and universal

US Army Corps of Engineers


Approved for public release; distribution is unlimited. ERDC/EL TN-11-4  

E-Print Network (OSTI)

the well was successfully capped (OSAT 2010). This is comparable in magnitude to previous oil spills in U.S due to releases of crude oil from tankers, offshore platforms, drilling rigs and wells. Spills was one of four large oil spills occurring along U.S. coastlines from 1976 to 2010. Depending

US Army Corps of Engineers


II United States Government DATE: REPLY TO Al-TN OF: SUBJECT...  

Office of Legacy Management (LM)

for Remedial Action at the Former Baker Brothers Inc. Site, Toledo, Ohio Manager, DOE Oak Ridge Field Office This is to notify you that the Former Baker Brothers, Inc. site...


ERDC/CERL TN-13-1 February 2013 Approved for public release; distribution is unlimited.  

E-Print Network (OSTI)

.sirsi.net/client/search/asset:asset?t:ac=$N/1006361 #12;CASI 2013 Work Plan 17 Operational Energy Base Camp Studies: Literature Review of Findings #12;CASI 2013 Work Plan 10 Energy and Water Conservation Assessments: A Field Guide outlines common: IMCOM POC: James Westervelt, CERL #12;CASI 2013 Work Plan 16 Sustainable Energy Solutions Lead: Franklin

US Army Corps of Engineers


TN-Gebhren fr Externe 2013/2014 Wir an der Uni  

E-Print Network (OSTI)

Garten: Sind sie noch zu retten? Bedrohte Pflanzen im Botanischen Garten 24.09.2013, von 12:00-13:30 Uhr Dr. Ute Becker kostenfrei 20140090 Besuch im Botanischen Garten: Die sinnliche Seite der Gewürze 09

van Straten, Duco

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analysts Grammar or Japanese tn the Nu-ProJect -A Procedural Approach to Analysts Grammar -  

E-Print Network (OSTI)

.Ten|gucht (Kyosera Co.). Hr. A.Kosaka (~EC Co.). Mr. H.Sakamoto (Ok1 Electr|c Co.), MtSS H.Kume (JCS). Hr. N


NIST TN 1297: Appen. D6. Uncert. units of the SI  

Science Conference Proceedings (OSTI)

... methods; simple calibration D.5 t p and the quantile t 1-? D.6 Uncertainty and units of the SI; proper use of the SI and quantity and unit symbols D.7 ...


The T.N. Thiele Centre for Mathematics in Natural Science,  

E-Print Network (OSTI)

We propose a new measure of risk, based entirely on downwards moves measured using high frequency data. Realised semivariances are shown to have important predictive qualities for future market volatility. The theory of these new measures is spelt out, drawing on some new results from probability theory. Keywords: Market frictions; Quadratic variation; Realised variance; Semimartingale; Semivariance. 1 It was understood that risk relates to an unfortunate event occurring, so for an investment this corresponds to a low, or even negative, return. Thus getting returns in the lower tail of the return distribution constitutes this downside risk. However, it is not easy to get a simple measure of this risk. Quoted from Granger (2008). 1

Ole E. Barndorff-nielsen; Silja Kinnebrock; Neil Shephard



Microsoft PowerPoint - Camper, ORNL-TN CAB-04-2010-final, via...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chairs of the Environmental Management Site- Specific Advisory Board Specific Advisory Board Larry W. Camper, Director Division of Waste Management and Environmental Protection Off...


Approved for public release; distribution is unlimited. ERDC TN-DOER-E32  

E-Print Network (OSTI)

Report 262. Washington, DC: National Academy Press. Reine K. J., D. D. Dickerson, and D. G. Clarke. 1998EWsintendedtoprotecttheselectedspecies. BACKGROUND AND PROBLEM: Environmental windows (EWs) associated with dredging operations can be controversial, and monitoring environmental windows for dredging projects. Marine Board, Transportation Research Board. Special

US Army Corps of Engineers


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

. Moscou : Nauka. Zhang Yisun 1993. Bod rgya tshig mdzod chen mo, Pkin : Mi rigs dpe skrun khang LA ROCA BLANCA DE LHANG LHANG Un santuario en Nyag rong Oriol Aguilar En Tbet, el Pas de las Nieves, en el centro de... mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag dmar, en Rag dmar8. Tambin facilita los nombres de los diversos centros religiosos desde tiempos...

Achard, Jean-Luc



gkp940 401..407  

NLE Websites -- All DOE Office Websites (Extended Search)

MiST2 MiST2 database: a comprehensive genomics resource on microbial signal transduction Luke E. Ulrich 1,2, * and Igor B. Zhulin 2,3 1 Agile Genomics LLC, Mount Pleasant, SC 29466, 2 Department of Microbiology, University of Tennessee, Knoxville, TN 37996 and 3 BioEnergy Science Center and Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37886, USA Received September 15, 2009; Revised October 8, 2009; Accepted October 9, 2009 ABSTRACT The MiST2 database (http://mistdb.com) identifies and catalogs the repertoire of signal transduction proteins in microbial genomes. Signal transduction systems regulate the majority of cellular activities including the metabolism, development, host- recognition, biofilm production, virulence, and antibiotic resistance of human pathogens. Thus, knowledge of the proteins and interactions that comprise



E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.



Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Engine Technology Background The mission of the U.S. Department of Energy's National Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Testing of Rapid PSA for CO 2 Capture Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Research &...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

including lignite and sub-bituminous coal, make up about half of U.S. coal production and reserves. They have lower energy and sulfur contents than bituminous coal, but higher...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Institute Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...


Microsoft Word - CX_PA-Sappho-LLIP-L0254.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 30, 2009 November 30, 2009 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Curtis Michael Electrical Engineer - TFOD-OLYMPIA Proposed Action: Port Angeles-Sappho #1 Line Tap Budget Information: Work Order # 00004866, Task # 04 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B4.6: "Additions or modifications to electric power transmission facilities that would not affect the environment beyond the previously developed facility area..." Location: Port Angeles, Clallam County, Washington Proposed by: Bonneville Power Administration (BPA) and Clallam County Public Utility District (PUD) Description of the Proposed Action: BPA proposes to install a new tap and associated disconnect structures on BPA's Port Angeles-Sappho #1 115-kV transmission line to provide a


OpenPA: Open Portable Atomics | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

(Open Portable Atomics) is an open source library intended to provide a consistent C API for performing atomic operations on a variety of platforms. The main goal of the...


DMigs-pa-brtag-pahi-hgrel-bshad (Alambana Pariksha Tika)  

E-Print Network (OSTI)

. ," -- -' ..... ~", ~~ Q~'~ ~'Q'qF' F;" l::::'::J' '~'::1'1:\\ 'Y~~ .~~.:..\\t ~.~",.Q.,~", " 01~' -" ""' ~""' -.,.rtI' .!"oo~""" ...", q+j::"~' ~~ :J"..q~r'ra,,::'t:4"',"?f:a~'fl:::J':.\\l=-;Q~~"~ ~='~I:';C\\ ~~"~;:'S~'~~rs ::J'iJ'~'~5~':J'~='~="~1 ::" 1... ~' )"~.:: ~~:.;.II ~~ :'C:'~5~l"r~s.:'fI~ '.r~.J.t.~~.~ I ~~ '~=" ~~'.:fs:,'..CJj "l'~ ~r:.J~'~''C!~'~ ~i'r;.:I-l J.t='~C!l~~t:'~~=l1~:P::~~~;'=-irC\\i"'~~1 i~ :r. e;-~ 'f,e:' ~ ~ "'" ...",.., ~ ~ . @l~ ~t:'tJ::~ ",,'~ "'. S ~'?l'~~~' c.rti ~ ;1 C...

Namgyal Institute of Tibetology



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of filter elements to remove ash from the syngas prior to it being utilized in a gas turbine or fuel cell. The elements are arranged in columns called "candles" and contained...



NLE Websites -- All DOE Office Websites (Extended Search)

improvements in generator efficiency and appliance efficiency ratings, development of energy-efficient manufacturing or industrial practices, and small-scale conservation and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Facilities Description Scientists at NETL's laboratories use the Geoscience Analysis, Interpretation, and Assessments (GAIA) Computational Facilities for...



E-Print Network (OSTI)

. ENVIRONMENT Paper is from the ultimate renewable resource: trees; and sustainably managed forests are carbon commodity. The biggest market for exports of wastepaper from New Zealand is China closely followed production is 99% from sustainable and renewable plantations. The wood used for newsprint is either low value

Hickman, Mark

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Pyroelectric Ceramic Temperature Sensors for Energy System Applications Background There is an increasing need to monitor processing parameters such as...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

CO 2 -Binding Organic Liquids Gas Capture with Polarity-Swing-Assisted Regeneration Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and are also stringent in order to avoid poisoning catalysts utilized in making liquids from fuel gas, electrodes in fuel cells, and selective catalytic reduction...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

The TMS Foundation. The TMS Foundation was established in 1993, to develop and fund programs that will fully prepare future generations of professionals for...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

TMS Foundation Activities. Through the generous support of TMS members, friends, and corporate contributors, The TMS Foundation is currently funding these...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

The TMS Foundation Bylaws. The TMS Foundation was established in 1993, to develop and fund programs that will fully prepare future generations of...


P.A. Capdau Charter School | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and, of course, our school buildings, like the one we are in today. DOE's "EnergySmart Schools" Program helps reduce schools' energy use and expenses, and provides a better...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

TMS ENERGY INITIATIVES ... minorities, or project your green persona to make your corporate mark through customized events, scholarships and amenities.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

modeling, laboratory experiments, and industry input to develop physics-based methods, models, and tools to support the development and deployment of advanced...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of clean energy systems. Accomplishments The AVESTAR team successfully deployed 3-D virtual IGCC immersive training systems at NETL and West Virginia University that allow...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent...


NETL: Science Bowl Information - South Western PA - 2010 New...  

NLE Websites -- All DOE Office Websites (Extended Search)

CLICK ON IMAGE TO SEE LARGER VIEW National Champs - State College - enjoying the Eiffel Tower in Paris. National Champs - State College - enjoying the Eiffel Tower in Paris. 2010...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

volatilization from interconnect alloys using solution conductivity. Schematic of a SOFC highlighting potential degradation mechanisms. The GEGR project assists the SOFCs...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

project phases focused on cell and stack research and development with emphasis on SOFC performance enhancement (power density, fuel utilization, and degradation), cost...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

chemical state of pulse laser deposited thin-film cathodes were measured. * A symmetric SOFC cell for ultra-small angle X-ray scattering studies was designed and constructed. The...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

coatingscale durability through thermal cycling. * Drew the interest of a major SOFC manufacturer and specialty SOFC metals producer. Benefits nGimat's SBIR project...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

assists the SOFCs program in meeting its cost and performance targets by ensuring that SOFC seals can achieve reliable operation over an extended operating life. The program...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

methods developed in this ONR program can now be applied to the testing of a Delphi Gen 4 SOFC stack in the DOE research program. Benefits This NUWC project assists the SOFCs...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

region or matching oxygen vacancy concen- trations. * Demonstrated that periodic reverse SOFC operation serves to prolong SOFC lifetimes. * Demonstrated elemental surface valence...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Unique Low Thermal Conductivity Thermal Barrier Coating (TBC) Architectures-UES Background Gas turbine engines used in integrated gasification combined cycle power plants require...

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

a novel catalyzed wall heat exchanger, and a network of heat exchangers to support thermal self-sufficiency. * Completed test stand modifications at UTC Power to support...


Privacy Act (PA) of 1974 | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

unwarranted invasions of their privacy stemming from federal agencies' collection, maintenance, use, and disclosure of personal information about them. Therefore, unlike the...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

diverse number of systems and chemical processes ranging from catalysts developments for Fischer-Tropsch synthesis applications, nanoscience, development of dense membrane systems...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and unknown samples. Analyses are used to characterize the fundamental properties of unconventional natural gas and oil reservoirs, ultra-deepwater and frontier-region...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the plant. Calera's process reduces carbon dioxide and pollutant emissions by using waste streams to make useable products. In the Sub-phase 2a, Calera completed the detailed...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

WGS National Carbon Capture Center - Water-Gas Shift Tests to Reduce Steam Use Background In cooperation with Southern Company Services, the U.S. Department of Energy (DOE)...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

* Conduct bench-scale testing of the complete ICES incorporating the selected particle growth method with the optimized capture duct and diffuser systems to enable the...


Membranes Obtained from PA6/HDPE Blends Via Precipitation by ...  

Science Conference Proceedings (OSTI)

The results showed the characteristic pores for microfiltration process. .... of Transparent Conductive Films of Magnesium Hydroxide Based Compounds.


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

First Name:*. Middle Initial: Last Name:*. Title/Position: Employer: Address 1:*. Address 2: City:*. State/Province:*. Zip/Postal Code:*. Country: Telephone: Fax:.


Confirmatory Survey Report for the Quehanna Decommissioning Project, Karthaus, PA  

Science Conference Proceedings (OSTI)

The survey activities consisted of visual inspections and radiological surveys including beta and gamma surface scans and surface beta activity measurements.

W. C. Adams



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

can contribute to the reduction of overall greenhouse gas emissions from fossil power plants. One area of research is the development and characterization of multiple...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Archer Daniels Midland Company: CO 2 Capture from Biofuels Production and Storage into the Mt. Simon Sandstone Background Carbon dioxide (CO 2 ) emissions from industrial...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Transport Membrane (ITM) Oxygen Technology for Integration in IGCC and Other Advanced Power Generation Systems Background Oxygen is among the top five chemicals produced worldwide...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

materials requirements for all fossil energy systems, including materials for advanced power generation technologies, such as coal gasification, heat engines, such as turbines,...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Aerodynamics and Heat Transfer Studies of Parameters Specific to the IGCC- Requirements: High Mass Flow Endwall Contouring, Leading Edge Filleting and Blade Tip Ejection under...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Effects of Hot Streak and Phantom Cooling on Heat Transfer in a Cooled Turbine Stage Including Particulate Deposition-The Ohio State University Background Sophisticated...


BatPaC - Battery Performance and Cost model - Contacts  

NLE Websites -- All DOE Office Websites (Extended Search)

Argonne National Laboratory Chemical Sciences & Engineering DOE Logo CSE Home About CSE Research Facilities People Publications Awards News & Highlights Events Search Argonne ......


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

FutureGen 2.0 Background The combustion of fossil fuels for electricity generation is one of the largest contributors to carbon dioxide (CO 2 ) emissions in the United States and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

(3) improving efficiency of storage operations; and (4) developing Best Practices Manuals. Deploying these technologies in commercial-scale applications will require a...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

main bulk phases, the Nb solid solution, and Nb silicides will be developed. Formation energies of the undoped and doped Nb-Si-Cr will be calculated and compared. Interfacial...

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Technology (Georgia Tech) will obtain data and develop models of the turbulent burning rate of HHC fuels at realistic conditions and in inhomo- geneous conditions such as...


Recipient: County of Lancaster, PA ENERGY EFFICIENCY AND CONSERVATION...  

NLE Websites -- All DOE Office Websites (Extended Search)

Server Virtualization A9, B5.1 None. LED Traffic Signal Upgrades B5.1 Waste Stream Clause Energy Audit & Energy Master Planning for Public & Not-for- Profit Facilities A9, All,...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. After only eight years from the time of...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. Only eight years after construction and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

capture technologies developed by the DOE program may also be applied to natural gas power plants after addressing the R&D challenges associated with the relatively low...


Herausgeber: Paderborn Institute for Scientific Computation (PaSCo)  

E-Print Network (OSTI)

sources. One of related works is an energy-harvesting WSN for a railway monitoring system [6]. In [7.032mW (indoor) to 37mW (direct sunlight) when energy is harvested from solar or 5mW (piezoelectric

Noé, Reinhold


The Minerals, Metals and Materials Society, Warrendale, PA - TMS  

Science Conference Proceedings (OSTI)

TMS on LinkedIN LinkedIN TMS on Facebook Facebook TMS on Flickr Flickr TMS YouTube Channel YouTube Email Page...


P.O. Box 1002 Millersville, Pa. 17551-0302  

E-Print Network (OSTI)

Gramoxone Inteon® Syngenta 22 D 2L Firestorm® Chemtura 22 D 3L Paraquat Concentrate® Solera Source Dynamics

Hardy, Christopher R.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

correspond to reflected-shock temperature (1180 K) and pressure (13.06 atm) for a stoichiometric H 2 -O 2 mixture in argon. Comparison with chemical kinetics mechanisms is good...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

TMS ENERGY INITIATIVES KNOWLEDGE RESOURCE CENTER ... Corporate, Hydro Aluminium Rolled Products Wagstaff Inc. Foundation Founders


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

oil recovery (EOR) application. The industrial source of CO 2 will be a petroleum-coke-to-chemicals (methanol and other by-products) gasification plant being developed by...


Hybrid solar lighting systems and components - Energy ...  

... (Lenoir City, TN), Earl; Dennis D. (Knoxville, TN), Beshears; David L. (Knoxville, TN), Maxey; Lonnie C. (Powell, TN), Jordan; John K. (Oak Ridge, TN), ...



U.S. Energy Information Administration (EIA)

MO MT NE NV NH NJ NM NY NC ND OH OK OR PA RI SC SD TN TX UT VT VA WA WV WI WY U.S. Number of states in which marketer is licensed ... Service Tech & Research Corp


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Materials Solutions for Hydrogen Delivery in Pipelines  

NLE Websites -- All DOE Office Websites (Extended Search)

Solutions for Solutions for Hydrogen Delivery in Pipelines Dr. Subodh K. Das Secat, Inc. September 26, 2007 This presentation does not contain any proprietary, confidential, or otherwise restricted information Project Team SECAT (KY) Project Manager Oregon Steel Mills (OR) Steel Pipe Producer Columbia Gas of Kentucky (KY) NG transporter Schott North America (PA) Glass coatings supplier Chemical Composite Coatings (GA) Composites coatings Advanced Technology Corp. (TN) ABI technology provider ASME (NY) Codes and Standards DGS Metallurgical Solutions (OR) Steel consulting University of Illinois (IL) Basic embrittlement studies Oak Ridge National Laboratory (TN) Applied research Objective and Deliverables Objective: ∑ Develop materials technologies to minimize embrittlement of


Notice of Intent to Prepare an Environmental Impact Statement for a Transuranic Waste Treatment Facility at Oak Ridge, TN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

79 79 Federal Register / Vol. 64, No. 17 / Wednesday, January 27, 1999 / Notices format (e.g., Braille, large print, audiotape, or computer diskette) on request to the contact person listed in the preceding paragraph. Individuals with disabilities may obtain a copy of the application package in an alternate format, also, by contacting that person. However, the Department is not able to reproduce in an alternate format the standard forms included in the application package. Electronic Access to This Document You may view this document, as well as all other Department of Education documents published in the Federal Register, in text or portable document format (pdf) on the Internet at either of the following sites: http;//ocfo.ed.gov/fedreg.hmt http://www.ed.gov/news.html To use the pdf you must have the Adobe

Note: This page contains sample records for the topic "tn mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Assessing the Environmental Impacts of Cellulosic Bioethanol Production: An Ongoing Case Study of Switchgrass Production around Vonore, TN  

E-Print Network (OSTI)

for the Vonore area, we will relate these changes in water quality to changes in economic criteria (e.g., target of Tennessee Biofuels Initiative. Managed by Genera Energy LLC and operated by DuPont Danisco Cellulosic


International Composites Expo ICE-98 Nashville, TN, January 19-21, 1998. Title: Strength, Durability and Health Monitoring of Composites  

E-Print Network (OSTI)

and utilization of composite overlays on civil infrastructures is also addressed. INTRODUCTION According to the US. The perspective and benefits of the repair, upgrade, retrofit, and rehabilitation of US civil infrastructure using capacity of concrete bridges. FRP repair technology offers a practical way to rehabilitate aging concrete

Giurgiutiu, Victor


Agenda for Sept 10-11 workshop in Oak Ridge, TN Sustainability of Bioenergy Systems: Cradle to Grave  

E-Print Network (OSTI)

Smith (EPA) Design of Sustainable Biofuel Supply Chains · Ozge Kaplan (EPA) - Emerging Biomass Production § 3 in 5 · Chris Impellitteri (EPA) - Biofuels:Water Resources, Reuse and Energy · Virginia Dale Analysis of Ecological Effects of Biofuels Crops § Questions and discussion · 3:00 Break · 3:30 Reconvene o


J. DALTON YORK 110 Sheffield Ct., Cookeville, TN 38506 | 931-854-1068 | dyork@tntech.edu  

E-Print Network (OSTI)

channel of a solid-oxide fuel cell (SOFC). Butane conversion and product formation were monitored hydrocarbons in the anode channels of a SOFC. Additional efforts are required to account for catalytic. Solid-oxide fuel cells (SOFC), in particular, offers a very promising method for direct production

Firoozabadi, Abbas


Results for the Independent Sampling and Analysis of Used Oil Drums at the Impact Services Facility in Oak Ridge, TN  

SciTech Connect

The U.S. Department of Energy (DOE) requested that Oak Ridge Associated Universities (ORAU), via the Oak Ridge Institute for Science and Education (ORISE) contract, perform independent sampling and analysis of used oils contained within eight 55 gallon drums stored at the former IMPACT Services facility, located at the East Tennessee Technology Park in Oak Ridge, Tennessee. These drums were originally delivered by LATA Sharp Remediation Services (LSRS) to IMPACT Services on January 11, 2011 as part of the Bldg. K-33 demolition project, and the drums plus contents should have been processed as non-hazardous non-radiological waste by IMPACT Services. LSRS received a certificate of destruction on August 29, 2012 (LSRS 2012a). However, IMPACT Services declared bankruptcy and abandoned the site later in 2012, and eight of the original eleven K-33 drums are currently stored at the facility. The content of these drums is the subject of this investigation. The original drum contents were sampled by LSRS in 2010 and analyzed for gross alpha, gross beta, and polychlorinated biphenyls (PCBs), using both compositing and grab sampling techniques. The objective of this 2013 sample and analysis effort was to duplicate, to the extent possible, the 2010 sampling and analysis event to support final disposition decisions. Part of that decision process includes either verifying or refuting the assertion that oils that are currently stored in drums at the IMPACT Services facility originated from Bldg. K-33 equipment.




General Considerations in the Corrosion of Structures  

Science Conference Proceedings (OSTI)

Table 1   Corrosion rates of carbon steel calibrating specimens at various locations...Vancouver Island BC, Canada Rural marine 13 0.5 Detroit, MI Industrial 14.5 0.57 Fort Amidor Pier, Panama, CZ Marine 14.5 0.57 Morenci, MI Urban 19.5 0.77 Potter County, PA Rural 20 0.8 Waterbury, CT Industrial 22.8 0.89 State College, PA Rural 23 0.9 Montreal, Que. Canada Urban 23 0.9 Durham, NH Rural...


Carbon Steels  

Science Conference Proceedings (OSTI)

Table 1   Corrosion rates of carbon steel at various locations...Vancouver Island, BC, Canada Rural marine 13 0.5 Detroit, MI Industrial 14.5 0.57 Fort Amidor Pier, CZ Marine 14.5 0.57 Morenci, MI Urban 19.5 0.77 Potter County, PA Rural 20 0.8 Waterbury, CT Industrial 22.8 0.89 State College, PA Rural 23 0.9 Montreal, QC, Canada Urban 23 0.9 Durham, NH Rural 28 1.1...


A nineteenth-century Bonpo pilgrim in Western Tibet and Nepal: Episodes from the life of dKar ru grub dbang bsTan 'dzin rin chen  

E-Print Network (OSTI)

in the valley named Khra zhu, in the east of the savage borderland of Hor (in Khams).2 His father was She tsu wer ma of the B?iu ldong dmar clan, and his mother Dang ra g.yu mi of the rGyal rmog sog po clan. His actual birth took place at sunrise... held the title of head proctor (khrims chen), named Rad sla wer ma. The censure he received ostensibly 3 Kha ba che phyir nor yod gro mi thub / gzhon pa rgyab khur thub tshad gro dgos pai / nor...

Ramble, Charles



Tagore au Tibet  

E-Print Network (OSTI)

modernit loccidentale.50 Quoi quil en soit, 47 Tagore 2002b : 99.48 Gru gzings 2001 : 152 (Brtsams chos nang gi mi sna gtso bo Rgya gar chos lugs pa Kar la ni rgyalgces kyi snying stobs shugs drag... cing / rang gshis brtan zhing brling bai na gzhon zhig yin / Slobchen mthar phyin ma thag Rgya gar rgyal gces pai mthun tshogs kyi dbu bzhugs su bsdad pas / mirigs bcings grol gyi ched du dbyin jii mi ser spel mkhan mthar skrod gtong ba khur du...

Robin, Francoise



Lamps in the Leaping Over  

E-Print Network (OSTI)

dusgser gyi nya mo khor lo bskor bai rgyud chen po: /rang byung lhun grub bras bu n/ /gdod naslhun grub rang char bas/ /byung ba lnga la rag ma pas/ /sku gsung thugs la rten mi cha/ /gsalbyed rig pai sgron ma yi s/ /gter khyim phung po gsal byed... / /longs sku dang nisprul pai sku/ /chu shel sgron mai dpes mtshon kyang/da lta rang la byung ma srid/ /khyung sgoma chag phur mi nus/.14 See TTT 54, p. 504, eigthth chapter of the Byang chub kyi sems rin chen khor lo: /sems nyid rigpai sgron ma yis...

Scheidegger, Daniel



Le Corps d'Arc-en-ciel ('ja' lus) de Shardza Rinpoche illustrant la perfection de la Voie rDzogs chen  

E-Print Network (OSTI)

celui-ci in Bon chos kyi rnam par dbye ba mdor bsdus, p. 89-112. 28 sPrul sku Blo ldan snying po (1360-1385), Mi shig rdo rje (qui est, supposment, lincarnation immdiate de sPrul sku Blo ldan), Sangs rgyas gling pa (1705-1735), et Kun grol grags... . Rappelons cependant que, comme toutes choses, lenseignement du Buddha est considr comme un phno- mne impermanent (bon mi rtag pa) et donc vou la destruction. La prsence ou prnnit de lenseignement est lun des lments clefs entrant dans les...

Achard, Jean-Luc



Contribution aux nombrables de la tradition Bon po : l'Appendive de bsTan 'dzin Rin chen rgyal mtshan a la Sphere de Cristal des Dieux et des Demons de Shar rdza rin po che  

E-Print Network (OSTI)

lettre Ha) ; 2. lessence fminine manifeste sous la forme du a shad etlocalise lextrmit infrieure du canal central ; et 3. le thig le indestructi-ble (mi shig pai thig le) localise dans le cur et exprime en fonction duneEssence vide (ngo bo... familiarisation avec les principes de lapratique, lors de la fusion des essences conscutive au Brasier et lEcoulement (bar dzag)44, il entre alors dans des expriences contemplativesde Dlice (bde ba), de Clart (gsal ba) et de Non-discursivit (mi rtog pa...

Achard, Jean-Luc



Veil of Kashmir  

E-Print Network (OSTI)

is considerably strengthened when we see that Zhangzhungpas words opening verse 28, gang yang grang dang tsha ba dang // bkres dang skon pa mi sems shing, find a parallel (more in meaning and grammatical structure than in wording) in the Sad?prarudita story... (Tsong-kha-pa 2000: 1): gang yang lus dang srog la mi lta bai brtson grus... (Assiduity without any consideration whatsoever for body and life...). In the following verse, number 29, we find a still louder echo of a phrase from Tsongkhapas k?vya...

Martin, Dan



Tuvinian images of demons from Tibet  

E-Print Network (OSTI)

causing deseases see Tucci and Heissig (1970): 193, 195. As such demons the gdon are also briefly characterized by Tseng (2005): 51. For further general remarks on the gdon see Clifford (1984): 148-55. In a text composed by Mi pham rnam rgyal in 1908... . Ri dvags rgyal (Ri dvags rgyal po) deer (ri dvags) (Fig. 3) 3. sKem byed (sKem byed pa) young man (gzhon nu) (Fig. 2) 4. brJed byed (brJed byed pa) fox (wa) (Fig. 4) 5. Khu tshur can raven (bya rog) (Fig. 5) 6. Ma mo human being (mi...

Schwieger, Peter



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake