National Library of Energy BETA

Sample records for tn al eastern

  1. Johnston et al. 1 Preliminary U-Pb Geochronology of the Tugela Terrane, Natal Belt, eastern

    E-Print Network [OSTI]

    Johnston, Stephen T.

    Johnston et al. 1 Preliminary U-Pb Geochronology of the Tugela Terrane, Natal Belt, eastern South of the Mesoproterozoic Natal belt of eastern South Africa. The Tugela terrane consists of a west-plunging structural granitoid suite. Introduction Mesoproterozoic orogenic belts are common to most continental fragments

  2. Lithospheric petrology of the eastern Arabian Plate: Constraints from Al-Ashkhara (Oman) xenoliths

    E-Print Network [OSTI]

    Stern, Robert J.

    and basanite igneous activity. Nd model ages for the spinel peridotite xenoliths range between 0.59 and 0.65 Ga brought to the surface by volcanic eruptions (Griffin and O'Reilly, 1987; Rudnick et al., 1986; Zhou et al and isotopic composition and thermal state of the upper mantle (e.g. Eggins et al., 1998; Griffin and O

  3. REPLY TO Al-TN OF: EM-421 SUBJECT:

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TACe - .'pJ3u44x:Y"

  4. Invenergy TN LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgency (IRENA) Jump to: navigation, searchData atTN LLC Jump to:

  5. National Lab., TN (United States)] 54 ENVIRONMENTAL SCIENCES...

    Office of Scientific and Technical Information (OSTI)

    G.M. Oak Ridge National Lab., TN (United States) 54 ENVIRONMENTAL SCIENCES; GROUND WATER; REMEDIAL ACTION; TECHNETIUM 99; SORPTION; PERTECHNETATES Groundwater used for...

  6. DOE - Office of Legacy Management -- Oak Ridge TN Warehouse Site - TN 09

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont,Manufacturing -Nevada Test SiteNYOak Ridge TN

  7. ERDC/TN ANSRP-06-__ November 2006

    E-Print Network [OSTI]

    ). Their impact is not minor. In the UMR and Missouri River drainages, common carp typically contributes more breach the electric barrier constructed by the U.S. Army Corps of Engineers in the Chicago Sanitary of both species is occurring in the UMR and Missouri drainages (Burr et al. 1996, Koel et al. 2000

  8. PV SOLAR RESOURCE GUIDE FOR RURAL DISTRIBUTORS IN TN Introduction

    E-Print Network [OSTI]

    McCarthy, John F.

    April 2013 Asa Roy PV SOLAR RESOURCE GUIDE FOR RURAL DISTRIBUTORS IN TN #12;1 Introduction experience with solar power. Research and interviews with the Tennessee's Green Power Providers Program, Green Power Providers Coordinators at several urban distributors, and solar installers in Tennessee

  9. Transposable elements Updated March 29, 2012 4 (none) Tpm kan (Tn903) Tn903 pkan none none --K CDE Epicentre

    E-Print Network [OSTI]

    Borenstein, Elhanan

    - - L2 CDI [6] T14 mTn5*-lacZ1 -em pLG51 Tpm (P) erm ? lacZ TS none - - L2 CDI [6] T15 ISR6K-em 7 pLG52a, pLG53, pLG55a Tpm (P) erm ? none none - ori R6K E ACE [6] T16 ISR6K-kan 8 pLG56a Tpm (P) kan ? none

  10. Technical Note PR-TN-2004/00370 Issued: 05/2004

    E-Print Network [OSTI]

    de Vries, Arjen P.

    Technical Note PR-TN-2004/00370 Issued: 05/2004 Mass Customization in Ambient Narratives Mark van Science Amsterdam Unclassified Koninklijke Philips Electronics N.V. 2004 #12;PR-TN-2004/00370 Unclassified ii Koninklijke Philips Electronics N.V. 2004 Authors' address Mark van Doorn WY 21 mark

  11. A review of the T_N theory and its cousins

    E-Print Network [OSTI]

    Yuji Tachikawa

    2015-04-07

    The T_N theory is a four-dimensional N=2 superconformal field theory that has played a central role in the analysis of supersymmetric dualities in the last few years. The aim of this review is to collect known properties of the T_N theory and its cousins in one place as a quick reference.

  12. A review of the T_N theory and its cousins

    E-Print Network [OSTI]

    Tachikawa, Yuji

    2015-01-01

    The T_N theory is a four-dimensional N=2 superconformal field theory that has played a central role in the analysis of supersymmetric dualities in the last few years. The aim of this review is to collect known properties of the T_N theory and its cousins in one place as a quick reference.

  13. Methane oxidation in the eastern tropical North Pacific Ocean water column

    E-Print Network [OSTI]

    2015-01-01

    PACK ET AL. EASTERN PACIFIC METHANE OXIDATIONA method for measuring methane oxidation rates using low-levels of C-labeled methane and accelerator mass

  14. II United States Government DATE: REPLY TO Al-TN OF: SUBJECT:

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700, 1.Reports1E~ S·D3GraniteS T A/ I' Il7aa

  15. REPLY TO AlTN OF: W-421 (W. A. W

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TACe - .'pJ3u44x:Y"QOEF

  16. Eastern Frequency Response Study

    SciTech Connect (OSTI)

    Miller, N.W.; Shao, M.; Pajic, S.; D'Aquila, R.

    2013-05-01

    This study was specifically designed to investigate the frequency response of the Eastern Interconnection that results from large loss-of-generation events of the type targeted by the North American Electric Reliability Corp. Standard BAL-003 Frequency Response and Frequency Bias Setting (NERC 2012a), under possible future system conditions with high levels of wind generation.

  17. ERDC/TN APCRP-EA-24 Comparison of Three Biomass Sampling

    E-Print Network [OSTI]

    US Army Corps of Engineers

    ERDC/TN APCRP-EA-24 July 2010 Comparison of Three Biomass Sampling Techniques on Submersed Aquatic R. Spickard2 PURPOSE: Quantifying biomass to measure aquatic plant abundance can be costly and labor intensive. This technical note compares several alternate, less exhaustive techniques for biomass sampling

  18. ERDC/EL TN-11-1 Flood Risk Management: Insights from

    E-Print Network [OSTI]

    US Army Corps of Engineers

    ERDC/EL TN-11-1 March 2011 Flood Risk Management: Insights from an Expert Modeling Process by M. D preparedness planning that harmonizes efforts of implementing agencies and stakeholders. Risk management are essential for effective risk management policy. Formal (versus ad hoc) analyses of risk manager and stake

  19. EA-1514: Proposed Conveyance of Parcel ED-6 to the City of Oak Ridge, TN

    Broader source: Energy.gov [DOE]

    This Environmental Assessment was prepared for the conveyance of approximately 336 acres of excess property (i.e., property not needed to fulfill DOE current or foreseeable future requirements) known as Parcel ED-6 to the city of Oak Ridge, TN.

  20. THE LANTERNFISHES (PISCES: MYCfOPHIDAE) OF THE EASTERN GULF OF MEXICO

    E-Print Network [OSTI]

    THE LANTERNFISHES (PISCES: MYCfOPHIDAE) OF THE EASTERN GULF OF MEXICO JOHN V. GARTNER, JR.,l THOMAS of Myctophidae were taken in midwater trawl samples from the eastern Gulf of Mexico during March through October diverse (Backus et al. 1977). The Gulf of Mexico is one such regime. Backus et a1. (1977) noted

  1. JOURNAL OF GEOPHYSICAL RESEARCH, VOL. ???, XXXX, DOI:10.1029/, The 2011 Mw 7.1 Van (Eastern Turkey) Earthquake -1

    E-Print Network [OSTI]

    Cambridge, University of

    JOURNAL OF GEOPHYSICAL RESEARCH, VOL. ???, XXXX, DOI:10.1029/, The 2011 Mw 7.1 Van (Eastern Turkey, 2012, 5:45pm D R A F T #12;X - 2 ELLIOTT ET AL.: 2011 VAN EARTHQUAKE, EASTERN TURKEY moment and source.: 2011 VAN EARTHQUAKE, EASTERN TURKEY X - 3 Interferograms from the ENVISAT satellite were derived from

  2. Evolution of Tidal Amplitudes in the Eastern Pacific Ocean

    E-Print Network [OSTI]

    Hickey, Barbara

    amplitudes may impact ocean mixing, nutrient supply, primary production, fisher- ies, and coastal erosion [Flick et al., 2003]. To understand the causes of the evolution of coastal tides, it is necessary) and semidiurnal (M2) constituents in the Eastern Pacific from Chile to Alaska (33ºS to 60ºN latitude). The only

  3. FISHING PERMIT Eastern Shore Agricultural

    E-Print Network [OSTI]

    FISHING PERMIT Eastern Shore Agricultural Research and Extension Center If all fields are not filled out, you do NOT have permission to fish! Name: ____________________________________________ Fishing Permit is valid for ONE YEAR. In return for this privilege, I agree to: 1. ABSOLVE the Eastern

  4. ELECTR-6198; No of Pages 22 Please cite this article in press as: Sandiford, M.., et al., Five Years of Declining Annual Consumption of Grid-Supplied Electricity in Eastern Australia: Causes and Consequences. Electr. J. (2015), http://dx.doi.org/

    E-Print Network [OSTI]

    Sandiford, Mike

    2015-01-01

    Years of Declining Annual Consumption of Grid-Supplied Electricity in Eastern Australia: Causes Consumption of Grid-Supplied Electricity in Eastern Australia: Causes and Consequences For decades, consumption of grid-supplied electricity increased in line with a growing economy. In the five years since

  5. Y-12 and East TN Public Broadcasting System Â… A Nuclear Family Video Miniseries

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLos Alamos verifies largest single MicropulseXunOperationsEast TN

  6. Plains and Eastern Clean Line Transmission Line: Comment from...

    Office of Environmental Management (EM)

    from Block Plains and Eastern Clean Line: Arkansas and Oklahoma Plains and Eastern Clean Line Transmission Line: Comment from Block Plains and Eastern Clean Line: Arkansas and...

  7. ION GNSS12 Conference, Session F1, Nashville, TN (Sep 18-21, 2012) Investigating Indoor GPS Doppler and

    E-Print Network [OSTI]

    Calgary, University of

    1/10 ION GNSS12 Conference, Session F1, Nashville, TN (Sep 18-21, 2012) Investigating Indoor GPS School of Engineering Position, Location and Navigation (PLAN) Group University of Calgary BIOGRAPHY of the Department of Geomatics Engineering at the University of Calgary. He received his BSc from the Isfahan

  8. Topic A Awardee: Eastern Interconnection Planning Collaborative...

    Energy Savers [EERE]

    policy makers Consumer and environmental interests Transmission Planning Authorities Market participants generating, transmitting or consuming electricity within the Eastern...

  9. Eastern Renewable Generation Integration Study (Presentation)

    SciTech Connect (OSTI)

    Bloom, A.

    2014-05-01

    This presentation provides a high-level overview of the Eastern Renewable Generation Integration Study process, scenarios, tools, and goals.

  10. INV . January 2009 EASTERN HEMISPHERE

    E-Print Network [OSTI]

    /6500/1998 1:6,500,000 The Mediterranean basin (bc) - C.I.A. G/5672/M4 C55/13000/2004 1:13,000,000 Geodynamic (bc) - C.I.A. G/5700/4300/1994 1:4,300,000 Europe (bc) - C.I.A. G/5700/4500/1997 non-circ 1:4,500 copies) (bc) - National Geographic Society 5671/G1/-/1986 - Eastern hemisphere narcotics - C.I.A. G/5671

  11. Eastern Renewable Generation Integration Study (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2014-02-01

    This one-page, two-sided fact sheet provides an overview of the Eastern Renewable Generation and Integration Study process.

  12. Cko.efer f. (i.f\\~f':tn\\ltt E'~~CS'\\'~ A~\\ !f~ \\fb a... 'T":~4.r.-t..

    E-Print Network [OSTI]

    Li, Kin-Yin

    QC~-®! Cko.efer f. (i.f\\~f':tn\\ltt E'~~CS'\\'~ A~\\ !f~ \\fb a... 'T":~4.r.-t.. ~c-l.;~. ~e...CA weo

  13. Plains and Eastern Clean Line

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAandSummary Areas ofEnergy OnPeter B.EnergyInPilgrim6,and Eastern

  14. Internal and External Ethnic Assessments in Eastern Europe

    E-Print Network [OSTI]

    Ahmed, Patricia; Feliciano, Cynthia; Emigh, Rebecca Jean

    2006-01-01

    in The Gypsies of Eastern Europe, edited by David Crowe andin The Gypsies of Eastern Europe, edited by David Crowe andin The Gypsies of Eastern Europe, edited by David Crowe and

  15. Transmission Constraints and Congestion in the Western and Eastern...

    Office of Environmental Management (EM)

    Congestion in the Western and Eastern Interconnections, 2009-2012 (January 2014) Transmission Constraints and Congestion in the Western and Eastern Interconnections, 2009-2012...

  16. Plains and Eastern Clean Line Transmission Line: Comment from...

    Energy Savers [EERE]

    Plains and Eastern Clean Line Transmission Line: Comment from Marshall Hughes Plains and Eastern Clean Line Transmission Line: Comment from Marshall Hughes Comment submitted on...

  17. Advance Funding and Development Agreement: Plains & Eastern Clean...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advance Funding and Development Agreement: Plains & Eastern Clean Line Transmission Project (September 20, 2012) Advance Funding and Development Agreement: Plains & Eastern Clean...

  18. ALS Visitors

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 NewsUsers' Executive Committee ALS Users'ALS

  19. Importance of Doping and Frustration in Itinerant Fe-doped Cr2Al

    SciTech Connect (OSTI)

    Susner, Michael A; Parker, David S; Safa-Sefat, Athena

    2015-01-01

    We have performed an experimental and theoretical study comparing the effects of Fe-doping of Cr2Al, an antiferromagnet with a N el temperature of 670 K, with known results on Fe-doping of antiferromagnetic bcc Cr. (Cr1-xFex)2Al materials are found to exhibit a rapid suppression of antiferromagnetic order with the presence of Fe, decreasing TN to 170 K for x=0.10. Antiferromagnetic behavior disappears entirely at x 0.125 after which point increasing paramagnetic behavior is exhibited. This is unlike the effects of Fe doping of bcc antiferromagnetic Cr, in which TN gradually decreases followed by the appearance of a ferromagnetic state. Theoretical calculations explain that the Cr2Al-Fe suppression of magnetic order originates from two effects: the first is band narrowing caused by doping of additional electrons from Fe substitution that weakens itinerant magnetism; the second is magnetic frustration of the Cr itinerant moments in Fe-substituted Cr2Al. In pure-phase Cr2Al, the Cr moments have an antiparallel alignment; however, these are destroyed through Fe substitution and the preference of Fe for parallel alignment with Cr. This is unlike bulk Fe-doped Cr alloys in which the Fe anti-aligns with the Cr atoms, and speaks to the importance of the Al atoms in the magnetic structure of Cr2Al and Fe-doped Cr2Al.

  20. AL. I

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval Ordnance,:n5.5.8GE 1A L L'-AL.

  1. ALS Spectrum

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I TALSALSSpectroscopyALS

  2. ALS Visitors

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 NewsUsers' Executive Committee ALS Users'ALSQuick

  3. ALS Visitors

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 NewsUsers' Executive Committee ALS

  4. Industry @ ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat Pumps Heat Pumpsfacility doe logoInIndustry @ ALS

  5. Reviw Al

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979 1.988 1.996 2.003 1990-2016 East CoastReviw Al now ..

  6. Tiu Ch Chn La D n Khi Phc Sm Vo ngy 21 thng 4 nm 2011, cc y Vin nh Gi Tn Hi

    E-Print Network [OSTI]

    s tn hi cng là mt yu t quan trng trong quy trình la chn d án); Kh nng thành công ca tng gii pháp thay Tác ng ca mi gii pháp ti sc khe và s an toàn ca cng ng · óng góp vào vic bo v s toàn vn ca môi trng và nhiên i vi bên hoc các bên có trách nhim vi v tràn du iu này cng nhm tìm kim s n bù i vi tn hi gây ra

  7. A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexicoemi_2324 226..240

    E-Print Network [OSTI]

    A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexicoemi sinkholes (cenotes). These cenotes were explored, mapped, and geochemically and microbiologically sampled (Gary et al., 2006a) is host to several water-filled, limestone sinkholes (cenotes). This system is part

  8. Cell, Vol. 29, 551-559, June 1982, Copyright 0 1982 by MIT Directed Transposon Tn5 Mutagenesis and

    E-Print Network [OSTI]

    Ausubel, Frederick M.

    by the isolation of nodulation-defective (Nod-) and nitrogen-fixation-defective (Fix-) mutants (Buchanan-Wollaston et al., 1980; Meade et al., 1982; Scott et al., 1982). We define the Nod- phenotype as failure (nod genes) are located on plasmids (Johnston et al., 1978; Zurkowski and Lorkiewicz, 1979; Beynon et

  9. Annual Performance Evaluation of a Pair of Energy Efficient Houses (WC3 and WC4) in Oak Ridge, TN

    SciTech Connect (OSTI)

    Biswas, Kaushik; Christian, Jeffrey E; Gehl, Anthony C; Jackson, Roderick K; Boudreaux, Philip R

    2012-04-01

    Beginning in 2008, two pairs of energy-saver houses were built at Wolf Creek in Oak Ridge, TN. These houses were designed to maximize energy efficiency using new ultra-high-efficiency components emerging from ORNL s Cooperative Research and Development Agreement (CRADA) partners and others. The first two houses contained 3713 square feet of conditioned area and were designated as WC1 and WC2; the second pair consisted of 2721 square feet conditioned area with crawlspace foundation and they re called WC3 and WC4. This report is focused on the annual energy performance of WC3 and WC4, and how they compare against a previously benchmarked maximum energy efficient house of a similar footprint. WC3 and WC4 are both about 55-60% more efficient than traditional new construction. Each house showcases a different envelope system: WC3 is built with advanced framing featured cellulose insulation partially mixed with phase change materials (PCM); and WC4 house has cladding composed of an exterior insulation and finish system (EIFS). The previously benchmarked house was one of three built at the Campbell Creek subdivision in Knoxville, TN. This house (CC3) was designed as a transformation of a builder house (CC1) with the most advanced energy-efficiency features, including solar electricity and hot water, which market conditions are likely to permit within the 2012 2015 period. The builder house itself was representative of a standard, IECC 2006 code-certified, all-electric house built by the builder to sell around 2005 2008.

  10. Triboelectric charging of volcanic ash from the 2011 Gr\\'{i}msv\\"{o}tn eruption

    E-Print Network [OSTI]

    Houghton, Isobel M P; Nicoll, Keri A

    2013-01-01

    Triboelectric charging of different size fractions of a sample of volcanic ash is studied experimentally. Laboratory experiments demonstrate that the normalised span of the particle size distribution plays an important role in the magnitude of charging generated. Previous measurements of the volcanic plumes have shown that ash particles are electrically charged up to hundreds of km away from the vent, which indicates the the ash particles continue to be charged in the plume through the mechanism of triboelectrification [Harrison et al., Env. Res. Lett. 5 024004 (2010), Hatakeyama J. Met. Soc. Japan 27 372 (1949)]. The influence of the normalised span on plume charging suggests that all ash plumes are likely to be charged, with implications for remote sensing and plume lifetime.

  11. In: Proceedings of the 89th Annual Meeting (held June 23-28 in Nashville, TN), Air and Waste Management Association, Pittsburgh, Pennsylvania, June 1996 Paper No. 96-125.03 1996 H.C. Frey

    E-Print Network [OSTI]

    Frey, H. Christopher

    No. 96-125.03 Proceedings, 89th Annual Meeting June 23-28, 1996 Nashville, TN Air & Waste Management), Air and Waste Management Association, Pittsburgh, Pennsylvania, June 1996 Paper No. 96-125.03 © 1996 HIn: Proceedings of the 89th Annual Meeting (held June 23-28 in Nashville, TN), Air and Waste

  12. nh Gi Tn Hi Ti Nguyn Thin Nhin do Trn Du Deep Horizon D n nng cp ng mn vo Khu

    E-Print Network [OSTI]

    tht v dch v gii trí trong vùng t thuc B ni V nm bang vùng Vnh. Sau s c tràn du Deep Horizon, mt lng du và các hot ng i phó u ã làm tn tht các c hi gii trí và làm gim cht lng tri nghim ca du khách n khu

  13. Evolution of Middle Eastern Social Structures: a new model

    E-Print Network [OSTI]

    White, Douglas R.

    Evolution of Middle Eastern Social Structures: a new model Abstract The desert is small relative: evolution, endogamy, population, raiding, Bedouin,] #12;2 Evolution of Middle Eastern Social Structures

  14. Numerical Modeling of Eastern Connecticut's Visual Resources1

    E-Print Network [OSTI]

    Numerical Modeling of Eastern Connecticut's Visual Resources1 Daniel L. Civco 2/ l Submitted Conservation, The University of Connecticut, Storrs, Connecticut. / Abstract: A numerical model capable of accurately predicting the preference for landscape photographs of selected points in eastern Connecticut

  15. Eastern Renewable Generation Integration Study: Initial Results (Poster)

    SciTech Connect (OSTI)

    Bloom, A.; Townsend, A.; Hummon, M.; Weekley, A.; Clark, K.; King, J.

    2013-10-01

    This poster presents an overview of the Eastern Renewable Generation Integration Study, which aims to answer critical questions about the future of the Eastern Interconnection under high levels of solar and wind generation penetration.

  16. Cancer Prevention in Eastern North Carolina Task 3: Final Report

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    1 Cancer Prevention in Eastern North Carolina Task 3: Final Report A Cancer Profile of Eastern, MPA Interim Manager, NC Comprehensive Cancer Program North Carolina Department of Health and Human University Greenville, NC 27834 Contract # 02776-12 #12;2 Project Title: Cancer Prevention in Eastern North

  17. nh gi Tn hi Ti nguyn Thin nhin do Trn du Deep Horizon Khi phc loi chim ng bin ti vng b bin Alabama

    E-Print Network [OSTI]

    ánh giá Tn hi Tài nguyên Thiên nhiên do Tràn du Deep Horizon Khôi phc loài chim ng bin ti vùng b Alabama s hình thành 5 nn làm t ca chim ng dc theo vùng b bin Mobile và Baldwin, Alabama tng c hi làm có th c tìm thy quanh nm ti khu vc b bin Alabama. Chim ng bin òi hi nhng khu vc làm t rng rãi vi

  18. ABSTRACT.--We analyzed distribution of Hermit Thrushes (Catharus guttatus faxoni) wintering in the eastern United States and northeastern Mexico using data from 2,077 specimens collected in

    E-Print Network [OSTI]

    Stouffer, Phil

    in the eastern United States and northeastern Mexico using data from 2,077 specimens collected in winter más grandes, ni datos climáticos multianuales ni el clima del mes y año en que las aves fueron colecta Marzo, se enfrentaron a climas más fríos que las hembras sedentarias. Al invernar más al norte y migrar

  19. Power plant rehabilitation in Eastern Europe

    SciTech Connect (OSTI)

    Gaglia, B.N. [Pyropower Corp., San Diego, CA (United States); Lecesne, E. [ABB Power Generation Ltd., Baden (Switzerland)

    1995-12-31

    Beginning in 1989, political revolution in the former Eastern block countries precipitated a period of economic transformation from a centrally planned to a market-oriented economy. Because energy is a vital factor of any economic development, rehabilitation of the region`s aging and polluting energy sector is essential to achieving economic stability and growth. Today Eastern Europe is among the most polluted regions in the world. This is due to the absence of effective environmental responsibility over the last 40 years. The European Community and other Western countries have focused on Eastern Europe as a significant world environmental problem, particularly the Black Triangle area. To meet this challenge the governments of Poland, the Czech Republic, Germany and others have embarked on various programs to rehabilitate the key power stations in the region. This paper will present the various aspects of power plant rehabilitation including the installation of new efficient turbine generators, new digital control systems, renovated power cycle equipment and modern efficient clean coal circulating fluidized bed technology. The paper focuses on this issue by using the Turow 2 x 235 MW rehabilitation project in Bogatynia, Poland as a case study. Included in the paper will be a discussion of a broad range of issues affecting rehabilitation including technical considerations, financial and commercial limitations and political aspects.

  20. ALS User Meeting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS User Meeting Print web banner ALS User Meeting: October 5-7, 2015 Home Agenda Awards Exhibitors Lodging Posters Registration Transportation Workshops Contact Us User Meeting...

  1. lLLiad TN:

    E-Print Network [OSTI]

    The dissipated energy is expressed by tan 6, which is called the loss factor or the .... ing of drifted wind-packed snow on the lee side of the terminal moraine.

  2. lLLiad TN:

    E-Print Network [OSTI]

    and Yamaji (1954; 1956) have measured Young's modulus and viscosity of ... perpendicular to the plane of bending; k'2 = hz/lZ. for a rectangular bar. h is the .... Consolidated Engineering Corporation's Type 5-118 with paper speed of 3 in.

  3. Northerly surface wind events over the eastern North Pacific Ocean : spatial distribution, seasonality, atmospheric circulation, and forcing

    E-Print Network [OSTI]

    Taylor, Stephen V.

    2006-01-01

    atmosphere over the eastern Pacific Ocean in summer, volumeover the eastern North Pacific Ocean: Spatial distribution,winds over the eastern North Pacific Ocean in spring and

  4. Eastern Wind Integration and Transmission Study (EWITS) (Revised)

    SciTech Connect (OSTI)

    Not Available

    2011-02-01

    EWITS was designed to answer questions about technical issues related to a 20% wind energy scenario for electric demand in the Eastern Interconnection.

  5. A major lithospheric boundary in eastern California defined by...

    Open Energy Info (EERE)

    ratios of Miocene-Recent basalts in eastern California, when screened for crustal contamination, vary dramatically and indicate the presence of a major lithospheric boundary that...

  6. Eastern Wind Integration and Transmission Study -- Preliminary Findings: Preprint

    SciTech Connect (OSTI)

    Corbus, D.; Milligan, M.; Ela, E.; Schuerger, M.; Zavadil, B.

    2009-09-01

    This paper reviews the Eastern Wind Integration and Transmission Study, the development of wind datasets, the transmission analysis, and the results of wind integration analysis for four scenarios.

  7. Eastern Wind Integration and Transmission Study: Executive Summary...

    Energy Savers [EERE]

    Study: Executive Summary and Project Overview Eastern Wind Integration and Transmission Study: Executive Summary and Project Overview This study evaluates the future operational...

  8. Eastern Energy Zones Mapping Tool | Department of Energy

    Office of Environmental Management (EM)

    Planning Council (EISPC) has released the Energy Zones (EZ) Mapping Tool, a free, web-based interactive tool that will help states and other stakeholders in the Eastern...

  9. Simulation of the intraseasonal variability over the Eastern...

    Office of Scientific and Technical Information (OSTI)

    Simulation of the intraseasonal variability over the Eastern Pacific ITCZ in climate models Citation Details In-Document Search Title: Simulation of the intraseasonal variability...

  10. Proposed Project: Plains & Eastern Clean Line Transmission Line...

    Energy Savers [EERE]

    & Eastern Clean Line project (the proposed project) would include an overhead +- 600 kV direct current electric transmission system and associated facilities with the capacity to...

  11. Section 1222 Program - Proposed Plains & Eastern Clean Line Project...

    Energy Savers [EERE]

    Electricity Policy Coordination and Implementation Transmission Planning Section 1222 of the Energy Policy Act 2005 Proposed Project: Plains & Eastern Clean Line ...

  12. Environmental Regulation Impacts on Eastern Interconnection Performance

    SciTech Connect (OSTI)

    Markham, Penn N; Liu, Yilu; Young II, Marcus Aaron

    2013-07-01

    In the United States, recent environmental regulations will likely result in the removal of nearly 30 GW of oil and coal-fired generation from the power grid, mostly in the Eastern Interconnection (EI). The effects of this transition on voltage stability and transmission line flows have previously not been studied from a system-wide perspective. This report discusses the results of power flow studies designed to simulate the evolution of the EI over the next few years as traditional generation sources are replaced with environmentally friendlier ones such as natural gas and wind.

  13. CURRENT SKIPJACK OCEANOGRAPHY CRUISES IN EASTERN TROPICAL PACIFIC OCEAN

    E-Print Network [OSTI]

    CURRENT SKIPJACK OCEANOGRAPHY CRUISES IN EASTERN TROPICAL PACIFIC OCEAN F. Williams A series of skipjack oceanography cruises is planned for two offshore areas in the eastern tropical Pacific Ocean October 23 and arrived in Honolulu November 29; and the David Starr Jordan (Fishery-Oceanography C en t e

  14. Biological Oceanography of the Eastern Tropical Pacific: Summary

    E-Print Network [OSTI]

    540 Biological Oceanography of the Eastern Tropical Pacific: Summary of Existing Information Tuna Oceanography Research Program of the Institute of Marine Resources of the University of California Oceanography of the Eastern Tropical Pacific: Summary of Existing Information By MAURICE BLACKBURN tribution

  15. A New Species of Cryptotriton (Caudata: Plethodontidae) from Eastern Guatemala

    E-Print Network [OSTI]

    Wake, David B.

    A New Species of Cryptotriton (Caudata: Plethodontidae) from Eastern Guatemala Carlos R. Va (Plethodontidae) is described from the mountains of eastern Guatemala. The new species is distinguished from all~as del este de Guatemala. Cryptotriton sierraminensis se distingue de todos los otros miembros de su ge

  16. UNITED STATES DISTRICT COURT EASTERN DISTRICT OF CALIFORNIA -FRESNO

    E-Print Network [OSTI]

    Hansen, James E.

    UNITED STATES DISTRICT COURT EASTERN DISTRICT OF CALIFORNIA - FRESNO CENTRAL VALLEY CHRYSLER Report, Abridged Text with all 48 Figures was submitted to United States District Court, Eastern District, decreased snow-pack in certain mountain ranges, increased strength of storms driven by latent heat

  17. Ancient west Eurasian ancestry in southern and eastern Africa

    E-Print Network [OSTI]

    Reich, David

    Ancient west Eurasian ancestry in southern and eastern Africa Joseph K. Pickrella,1,2 , Nick, 2014 (received for review July 30, 2013) The history of southern Africa involved interactions between eastern Africa. In particular, we also find evidence for two admixture events in the history of Kenyan

  18. ORIGINAL PAPER Neoproterozoic diamictite in the Eastern Desert of Egypt

    E-Print Network [OSTI]

    Stern, Robert J.

    ORIGINAL PAPER Neoproterozoic diamictite in the Eastern Desert of Egypt and Northern Saudi Arabia in Wadi Kareim and Wadi Mobarak in the Eastern Desert of Egypt and the Nuwaybah formation in NW Saudi and extends from Egypt, Israel, and Jordan to Ethiopia and Yemen. The ANS (Fig. 1a) developed during

  19. Eastern Band of Cherokee Strategic Energy Plan

    SciTech Connect (OSTI)

    Souther Carolina Institute of energy Studies-Robert Leitner

    2009-01-30

    The Eastern Band of Cherokee Indians was awarded a grant under the U.S. Department of Energy Tribal Energy Program (TEP) to develop a Tribal Strategic Energy Plan (SEP). The grant, awarded under the “First Steps” phase of the TEP, supported the development of a SEP that integrates with the Tribe’s plans for economic development, preservation of natural resources and the environment, and perpetuation of Tribal heritage and culture. The Tribe formed an Energy Committee consisting of members from various departments within the Tribal government. This committee, together with its consultant, the South Carolina Institute for Energy Studies, performed the following activities: • Develop the Tribe’s energy goals and objectives • Establish the Tribe’s current energy usage • Identify available renewable energy and energy efficiency options • Assess the available options versus the goals and objectives • Create an action plan for the selected options

  20. 189Center for Arab and Middle Eastern Studies (CAMES) Graduate Catalogue 201415

    E-Print Network [OSTI]

    and Middle Eastern Studies (CAMES) Director: Hazbun, Waleed Assistant Director: Saidi, Aliya R. Professor

  1. Seismic retrofit of precast panel buildings in Eastern Europe

    E-Print Network [OSTI]

    Tzonev, Tzonu

    2013-01-01

    Many countries in Eastern Europe, particularly ones from the former Soviet Bloc, are facing a potential crisis regarding their deteriorating precast panel apartment buildings. These complexes were built using industrial ...

  2. A reservoir management strategy for multilayered reservoirs in eastern Venezuela 

    E-Print Network [OSTI]

    Espinel Diaz, Arnaldo Leopoldo

    1998-01-01

    A reservoir management strategy has been developed for a field located in eastern Venezuela. The field contains deep, high pressure, multilayer reservoirs. A thorough formation evaluation was accomplished using the log data, core data, PVT data...

  3. Eddy formation and propagation in the eastern tropical Pacific 

    E-Print Network [OSTI]

    Jhingran, Vikas Gopal

    1997-01-01

    Observations of eddies in the eastern tropical Pacific from TOPEX altimetry data show that there are seasonal and interannual variations in eddy activity. Comparisons between time of eddy formation and corresponding wind ...

  4. Land Snail Ecology and Biogeography of Eastern Maine

    E-Print Network [OSTI]

    Nekola, Jeffrey C.

    Land Snail Ecology and Biogeography of Eastern Maine Vertigo bollesiana Vertigo nylanderi Vertigo & Invertebrate Group Maine Department of Inland Fisheries & Wildlife and the Aroostook Hills and Lowlands ......................................................................................................... 75 Appendix I: Taxonomic Key for Maine Land Snails ............................................... 78

  5. Reading the Lontars: Endangered Literary Practices of Lombok, Eastern Indonesia

    E-Print Network [OSTI]

    Austin, Peter

    2009-12-16

    The Sasaks of Lombok island, eastern Indonesia, have a literary tradition of writing manuscripts on palm leaves (lontar) in a manner similar to that of the Balinese (Rubinstein 2000), and historically, the Javanese. Lombok today remains only one...

  6. Aeolian depositional landforms of the south eastern Mojave Desert, California 

    E-Print Network [OSTI]

    Alvis, William Thomas

    2000-01-01

    Remote sensing and photo interpretation techniques are used to describe and map aeolian deposits found along two sediment transport corridors in the south eastern Mojave Desert. The first pathway and associated sand deposits extend eastward from...

  7. Source apportionment of wet sulfate deposition in eastern North America

    E-Print Network [OSTI]

    Fay, James A.

    1985-01-01

    An analytical model of long distance transport of air pollutants (Fay and Rosenzweig, 1980) has been adapted for the estimation of long term (e.g. annual) wet sulfate deposition in eastern N. America. The model parameters ...

  8. Characterization of maize testing locations in eastern and southern Africa 

    E-Print Network [OSTI]

    Maideni, Francis W.

    2006-08-16

    The region of eastern and southern Africa is very diverse in environments and agronomic practices. The region has one of the highest per capita consumption of maize (Zea mays. L), which is predominantly produced by smallholder farmers. Some...

  9. Advanced Unit Commitment Strategies in the United States Eastern Interconnection

    SciTech Connect (OSTI)

    Meibom, P.; Larsen, H. V.; Barth, R.; Brand, H.; Tuohy, A.; Ela, E.

    2011-08-01

    This project sought to evaluate the impacts of high wind penetrations on the U.S. Eastern Interconnection and analyze how different unit commitment strategies may affect these impacts.

  10. Post-Formative Ceramics in the Eastern Grat Basin

    E-Print Network [OSTI]

    Forsyth, Donald W

    1986-01-01

    Great Salt Lake Fremont Ceramics. In: The Levee Site and the1986). Post-Formative Ceramics in the Eastern Great Basin: A1977 Prehistoric Ceramics of the Fremont. Museiun of

  11. Developing Generic Dynamic Models for the 2030 Eastern Interconnection Grid

    SciTech Connect (OSTI)

    Kou, Gefei; Hadley, Stanton W; Markham, Penn N; Liu, Yilu

    2013-12-01

    The Eastern Interconnection Planning Collaborative (EIPC) has built three major power flow cases for the 2030 Eastern Interconnection (EI) based on various levels of energy/environmental policy conditions, technology advances, and load growth. Using the power flow cases, this report documents the process of developing the generic 2030 dynamic models using typical dynamic parameters. The constructed model was validated indirectly using the synchronized phasor measurements by removing the wind generation temporarily.

  12. Impacts of Central America gap winds on the SST annual cycle in the eastern Pacific warm pool

    E-Print Network [OSTI]

    Sun, Fengpeng; Yu, Jin-Yi

    2006-01-01

    the eastern Pacific warm pool, gap winds, thermocline dome,in the eastern Pacific warm pool Fengpeng Sun 1 and Jin-Yiin the eastern Pacific warm pool and its relation to Central

  13. A retrospective study of ecosystem effects of the 1976/77 regime shift in the eastern Pacific warm pool

    E-Print Network [OSTI]

    Vilchis, L. Ignacio

    2010-01-01

    of the eastern Pacific warm pool: Can community structure bein the eastern Pacific warm pool A dissertation submitted inthe eastern Pacific warm pool (5-20°N, 90-110°W). Values are

  14. The Political Economy of Rule of Law in Middle-Income Countries: A Comparison of Eastern Europe and China

    E-Print Network [OSTI]

    Peerenboom, Randall

    2010-01-01

    A COMPARISON OF EASTERN EUROPE AND CHINA vides productive6. A COMPARISON OF EASTERN EUROPE AND CHINA eralization, andA COMPARISON OF EASTERN EUROPE AND CHINA fied versions of

  15. Renewable Energy in Central & Eastern Europe Vienna University of Technology I Energiepark Bruck/Leitha

    E-Print Network [OSTI]

    Arnold, Anton

    Renewable Energy in Central & Eastern Europe CONTINUING EDUCATION CENTER Vienna University is currently not sustainable. Renewable energy sources as well as more effiicient ways to use energy "Renewable Energy in Central & Eastern Europe" is, to contribute significantly to this process

  16. Submitted to Energy Policy, 16 November 2009 Eastern Canadian crude oil supply and its implications

    E-Print Network [OSTI]

    Hughes, Larry

    Submitted to Energy Policy, 16 November 2009 ERG/200911 Eastern Canadian crude oil supply and its;Eastern Canadian crude oil supply and its implications for regional energy security Larry Hughes Energy. One such example is crude oil, which is found primarily in western Canada. Eastern Canada, consisting

  17. Late Quaternary variability of sedimentary nitrogen isotopes in the eastern South Pacific Ocean

    E-Print Network [OSTI]

    Demouchy, Sylvie

    Late Quaternary variability of sedimentary nitrogen isotopes in the eastern South Pacific Ocean), Late Quaternary variability of sedimentary nitrogen isotopes in the eastern South Pacific Ocean) in the water columns of the Arabian Sea (AS) and the eastern North and South Pacific oceans (ENP; ESP) holds

  18. Intraseasonal Eastern Pacific Precipitation and SST Variations in a GCM Coupled to a Slab Ocean Model

    E-Print Network [OSTI]

    Maloney, Eric

    Intraseasonal Eastern Pacific Precipitation and SST Variations in a GCM Coupled to a Slab Ocean-Schubert convection to a slab ocean model (SOM) improves the simulation of eastern Pacific convection during and ocean make eastern Pacific low-level circulation anomalies more complex in the SOM simulation than

  19. HABITAT SELECTION AND USE BY BREEDING HEN PHEASANTS IN EASTERN SOUTH DAKOTA, 1999-2001

    E-Print Network [OSTI]

    HABITAT SELECTION AND USE BY BREEDING HEN PHEASANTS IN EASTERN SOUTH DAKOTA, 1999-2001 BY Rebecca D BY BREEDING HEN PHEASANTS IN EASTERN SOUTH DAKOTA, 1999-2001 This thesis is approved as a creditable HABITAT SELECTION AND USE BY BREEDING HEN PHESANTS IN EASTERN SOUTH DAKOTA, 1999-2001 Rebecca D

  20. Assessing Seasonal Transport and Deposition of Agricultural Emissions in Eastern North Carolina, U.S.A.

    E-Print Network [OSTI]

    Raman, Sethu

    Assessing Seasonal Transport and Deposition of Agricultural Emissions in Eastern North Carolina, U strategies. The eastern portion of North Carolina is used as a case example due to its high, localized eastern North Carolina. Diurnal and seasonal patterns were identified for dispersion and concentration

  1. Palaeomagnetic data from a Mesozoic Philippine Sea Plate ophiolite on Obi Island, Eastern Indonesia

    E-Print Network [OSTI]

    Royal Holloway, University of London

    Palaeomagnetic data from a Mesozoic Philippine Sea Plate ophiolite on Obi Island, Eastern Indonesia exposed on Obi Island, eastern Indonesia. Until the late Neogene, Obi formed part of the southern tectonic history of eastern Indonesia and northern New Guinea has been dominated by the punctuated

  2. Primary production in the eastern tropical Pacific: A review J. Timothy Pennington a

    E-Print Network [OSTI]

    Pennington, J. Timothy

    , Peru Abstract The eastern tropical Pacific includes 28 million km2 of ocean between 23.5°N phytoplankton growth (and nitrogen fixation) over large portions of the open-ocean eastern tropical Pacific Pacific. Seasonal cycles are weak over much of the open-ocean eastern tropical Pacific, although several

  3. Seismic stratigraphy of Lake Van, eastern Turkey Deniz Cukur a, *

    E-Print Network [OSTI]

    Gilli, Adrian

    Seismic stratigraphy of Lake Van, eastern Turkey Deniz Cukur a, * , Sebastian Krastel b , Hans, EMCOL and Department of Geological Engineering, 34469 Maslak, Istanbul, Turkey d Van Yüzüncü Yil University, Department of Geological Engineering, Van, Turkey e Eawag, Swiss Federal Institute of Aquatic

  4. Thermal and Kinematic Evolution of the Eastern Cordillera Fold and

    E-Print Network [OSTI]

    Toro, Jaime

    Thermal and Kinematic Evolution of the Eastern Cordillera Fold and Thrust Belt, Colombia Jaime Toro and then calculated the conductive thermal state of key steps of the kinematic history using ThrustpackR 4.0. The models were constrained by well, seismic, apatite fission-track, and thermal-maturity data. The main

  5. Diseases of plantation forestry trees in eastern and southern Africa

    E-Print Network [OSTI]

    Diseases of plantation forestry trees in eastern and southern Africa J. Roux a*, G. Meke b , B a Introduction Plantations of non-native trees have been grown in Africa for more than 100 years.1,2 The most especially for construction timber and fuel, while in southern Africa this timber also sustains a thriving

  6. The Eucalyptus canker pathogen Chrysoporthe cubensis discovered in eastern Australia

    E-Print Network [OSTI]

    The Eucalyptus canker pathogen Chrysoporthe cubensis discovered in eastern Australia Geoffrey S of commercially planted Eucalyptus species (Myrtaceae) in tropical and subtropical parts of the world where these trees are planted as non-natives. Although the majority of Eucalyptus spp. are native to Australia, Chr

  7. Eastern Renewable Generation Integration Study Solar Dataset (Presentation)

    SciTech Connect (OSTI)

    Hummon, M.

    2014-04-01

    The National Renewable Energy Laboratory produced solar power production data for the Eastern Renewable Generation Integration Study (ERGIS) including "real time" 5-minute interval data, "four hour ahead forecast" 60-minute interval data, and "day-ahead forecast" 60-minute interval data for the year 2006. This presentation provides a brief overview of the three solar power datasets.

  8. AN ECONOMIC EVALUATION OF THE ST. LAWRENCE RIVER-EASTERN

    E-Print Network [OSTI]

    AN ECONOMIC EVALUATION OF THE ST. LAWRENCE RIVER-EASTERN LAKE ONTARIO BASS FISHERY The St. Lawrence information on the economic importance of the bass fishery, considered by many to be one of the best smallmouth bass fisheries in the world. The economic value of this recreational fishery should be taken

  9. A retrospective study of ecosystem effects of the 1976/77 regime shift in the eastern Pacific warm pool

    E-Print Network [OSTI]

    Vilchis, L. Ignacio

    2010-01-01

    of skipjack tuna, Katsuwonus pelamis, in the eastern Pacificalbacares and Katsuwonus pelamis, respectively), to drive

  10. Al Ogletree & Bob Tankersley 

    E-Print Network [OSTI]

    Unknown

    2011-08-17

    the installation and proper utilization of an EMCS.5 The objective of this report is to determine how successful Energy Management Control Systems have been in reducing energy consumption. 1 Claridge, D.E., et al 1994. "Energy retrofits can cut use and costs...." Mechanical Engineering, August, pp. 64-67. 2 Editor, 1991. Buildings, December, p. 16. 3 Editor, 1992. Buildings, September, p. 34. 4Mumford, S., 1994. Buildings, February, pp. 38-41. 5 Editor, 1993. Buildings, May, p 38. 1 The LoanSTAR Program6 In 1988...

  11. ALS Activity Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I T E D S TALPES20thALS

  12. ALS Beamlines Directory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I T E D SALS BeamlinesALS

  13. ALS User Meeting Archives

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N ISpectrum Print BegunALS User

  14. ALS Users' Association Charter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N ISpectrum Print BegunALS

  15. ALS Beamlines Directory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News BelowAskedAIKEN TECHNICALArgonneALS Beamlines

  16. ALS Beamlines Directory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News BelowAskedAIKEN TECHNICALArgonneALS

  17. ALS Postdoctoral Fellowship Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News BelowAskedAIKENALSDoctoralALS

  18. ALS Users' Association Charter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 NewsUsers' Executive Committee ALS Users'

  19. ALS Beamlines Directory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of rare Kaonforsupernovae2 Publications6 SmartInformation A toBeamlinesALS

  20. ALS Communications Group

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of rare Kaonforsupernovae2 Publications6 SmartInformation A toBeamlinesALS

  1. ALS in the News

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of rare Kaonforsupernovae2 Publications6 SmartInformation Afeed-imageALS

  2. About the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of raregovAboutRecovery Act Recovery ActARM OverviewAbout GEDOEaboutUs |ALS

  3. Access to the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of raregovAboutRecovery Act Recovery ActARMAccelerators,Access to the ALS

  4. mp ILLiad TN: 427447 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

    E-Print Network [OSTI]

    Fractures and other nonwelded contacts are important mechanical and hydrological features of rock ... at di?erent effective stresses under dry and saturated conditions at room temperature. ... angle is commonly referred to as the quality factor Q and is .... data for fractured specimens E32, E30 and E35 as a function of stress.

  5. US ESC TN Site Consumption

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSales Type: Sales120 US ENC WIESC

  6. Advanced Unit Commitment Strategies for the US Eastern Interconnection

    SciTech Connect (OSTI)

    Ela, E.; Meibom, P.; Barth, R.; Tuohy, A.; Milligan, M.

    2010-01-01

    With increasing penetrations of wind power on the eastern interconnection of the United States, much research has been discussed on how the increased uncertainty may change how the system is operated. In particular, unit commitment programs which decide what units need to be started up in order to meet the changing demand at least cost may need to have modifications in order to reduce costs and improve reliability on a power system with increasing uncertain variables. This paper outlines a study undertaken for the U.S. Eastern Interconnection in which different advanced unit commitment strategies were simulated for three different years to evaluate the benefits that may occur from using these strategies as an operational tool.

  7. Guidelines for ground motion definition for the eastern United States

    SciTech Connect (OSTI)

    Gwaltney, R.C.; Aramayo, G.A.; Williams, R.T.

    1985-06-01

    Guidelines for the determination of earthquake ground motion definition for the eastern United States are established here. Both far-field and near-field guidelines are given. The guidelines were based on an extensive review of the current procedures for specifying ground motion in the United States. Both empirical and theoretical procedures were used in establishing the guidelines because of the low seismicity in the eastern United States. Only a few large- to great-sized earthquakes (M/sub s/ > 7.5) have occurred in this region, no evidence of tectonic surface ruptures related to historic or Holocene earthquakes has been found, and no currently active plate boundaries of any kind are known in this region. Very little instrumented data have been gathered in the East. Theoretical procedures are proposed so that in regions of almost no data, a reasonable level of seismic ground motion activity can be assumed. The guidelines are to be used to develop the safe shutdown earthquake (SSE). A new procedure for establishing the operating basis earthquake (OBE) is proposed, in particular for the eastern United States. The OBE would be developed using a probabilistic assessment of the geological conditions and the recurrence of seismic events at a site. These guidelines should be useful in development of seismic design requirements for future reactors. 17 refs., figs., tabs.

  8. Grenville foreland thrust belt hidden beneath the eastern US midcontinent

    SciTech Connect (OSTI)

    Hauser, E.C. (Cornell Univ., Ithaca, NY (United States))

    1993-01-01

    Grenville foreland thrust structures are observed beneath the eastern US midcontinent on COCORP (Consortium for Continental Reflection Profiling) line OH-1 and a short seismic line in southwest Ohio. These structures represent the first evidence for a significant Grenville foreland thrust belt preserved in eastern North America. On the COCORP lines, the structures include a thrust ramp anticline and an associated asymmetric syncline. The Grenville front tectonic zone appears to truncate these foreland structures, indicating a later, second phase expressed as a deeply penetrating, out-of-sequence thrust zone associated with the main uplift of the Grenville province on the east. A short, shallow seismic line in southwestern Ohio reveals an east-dipping sequence of prominently layered rocks that may lie above a footwall ramp to a deeper Grenville thrust fault. A drill hole into the less reflective top of this dipping sequence encountered unmetamorphosed sedimentary rocks like those increasingly reported from other drill holes in southwestern Ohio and adjacent states. Although possibly part of a late Precambrian (Keweenawan ) rift, these clastic sedimentary rocks may instead preserve evidence of a heretofore unrecognized Grenville foreland basin in eastern North America. Alternatively these Precambrian sedimentary rocks together with an underlying, but yet undrilled, strongly layered sequence may correlate with similarly layered rocks observed on COCORP and industrial seismic lines within the Middle Proterozoic granite-rhyolite province to the west in Indiana and Illinois and indicate that unmetamorphosed sedimentary material is an important constituent of the granite-rhyolite province. 25 refs., 6 figs.

  9. Trends of extreme precipitation in eastern China and their possible causes

    E-Print Network [OSTI]

    2015-01-01

    eastern China un- der global warming. Plateau Meteorology,PRECIPITATION, AEROSOLS, AND GLOBAL WARMING ence, 314, 1442–logical cycle to global warming. J. Climate, 19, 5686–5699,

  10. Behavioral context of call production by eastern North Pacific blue whales

    E-Print Network [OSTI]

    Oleson, Erin M; Calambokidis, J; Burgess, W C; McDonald, M A; LeDuc, C A; Hildebrand, J A

    2007-01-01

    by eastern North Pacific blue whales Erin M. Oleson 1, *,context of calls produced by blue whales Balaenoptera mus-North Pacific population of blue whales (Thompson 1965,

  11. Eastern Wind Integration and Transmission Study: Executive Summary and Project Overview (Revised)

    SciTech Connect (OSTI)

    EnerNex Corporation; The Midwest ISO; Ventyx

    2011-02-01

    EWITS was designed to answer questions about technical issues related to a 20% wind energy scenario for electric demand in the Eastern Interconnection.

  12. Data Collection and Analyses of the CHP System at Eastern Maine...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2008 report describes the Eastern Maine Medical Center's installation of a Centaur 50 gas turbine and performance data for one year from December 2006 to November 2007. The...

  13. Trends of extreme precipitation in eastern China and their possible causes

    E-Print Network [OSTI]

    2015-01-01

    in different-class precipitation over eastern China un- derwet and dry season precipitation. Nature Geoscience, 6, 263–to the orographic precipitation in the Qinling Mountains.

  14. Al Geist | ornl.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and research organizations. Al continues to work with researchers in DOE as well as industry to improve the capabilities of electronic notebook software. Among his numerous...

  15. ALS Scientific Advisory Committee Charter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Scientific Advisory Committee Charter Print This document was revised and approved December 18, 2008. I. FUNCTION AND REPORTING The ALS Scientific Advisory Committee (SAC) is...

  16. ALS Scientific Advisory Committee Charter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Committee Charter Print This document was revised and approved December 18, 2008. I. FUNCTION AND REPORTING The ALS Scientific Advisory Committee (SAC) is advisory to the...

  17. ALS Evidence Confirms Combustion Theory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Evidence Confirms Combustion Theory Print Researchers recently uncovered the first step in the process that transforms gas-phase molecules into solid particles like soot and...

  18. ALS Evidence Confirms Combustion Theory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Evidence Confirms Combustion Theory ALS Evidence Confirms Combustion Theory Print Wednesday, 22 October 2014 11:43 Researchers recently uncovered the first step in the process that...

  19. Eastern Interconnection Planning Collaborative News Release | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPL EnergyPlus,Department of EnergySessionEnergyEnergy Eastern

  20. Publications of the University of Eastern Finland Dissertations in Forestry and Natural Sciences

    E-Print Network [OSTI]

    Nyman, Tommi

    Publications of the University of Eastern Finland Dissertations in Forestry and Natural Sciences in internal-feeding sawflies Publications of the University of Eastern Finland Dissertations in Forestry Finland, Joensuu, on September, 19, 2014, at 12 o'clock. Department of Biology #12;Grano Joensuu, 2014

  1. Mycoscience 41: 595--606, 2000 New Leptographium species from Indonesia and Eastern

    E-Print Network [OSTI]

    Mycoscience 41: 595--606, 2000 595 New Leptographium species from Indonesia and Eastern North from pine infested with an Ips sp. in Indonesia. In addition, two unknown species have been collected that the isolates from Indonesia and those from Eastern North America represent three previously un described taxa

  2. Habitat suitability modeling for the eastern hog-nosed snake, Heterodon platirhinos, in Ontario

    E-Print Network [OSTI]

    Blouin-Demers, Gabriel

    Habitat suitability modeling for the eastern hog-nosed snake, Heterodon platirhinos, in Ontario, the eastern hog- nosed snake, Heterodon platirhinos, is found in a limited portion of southern Ontario Ontario, it is crucial to document what limits the snake's habitat to direct conservation efforts better

  3. Evolution of Quaternary Tholeiitic Basalt Eruptive Centers on the Eastern Snake

    E-Print Network [OSTI]

    Wetmore, Paul H.

    Evolution of Quaternary Tholeiitic Basalt Eruptive Centers on the Eastern Snake River Plain, Idaho tholeiitic basalt eruptive centers on the eastern Snake River Plain, Idaho, in Bill Bonnichsen, C.M. White, and Michael McCurry, eds., Tectonic and Magmatic Evolution of the Snake River Plain Volcanic Province: Idaho

  4. Distinctive upper mantle anisotropy beneath the High Lava Plains and Eastern Snake River Plain,

    E-Print Network [OSTI]

    Distinctive upper mantle anisotropy beneath the High Lava Plains and Eastern Snake River Plain and continuing with the still- ongoing volcanism in the High Lava Plains (HLP) and eastern Snake River Plain (SRP waves; shear wave splitting; high lava plains; Snake River Plain; Yellowstone. Index Terms: 8137

  5. Late Quaternary constructional development of the Axial Volcanic Zone, eastern Snake River Plain, Idaho

    E-Print Network [OSTI]

    Wetmore, Paul H.

    Late Quaternary constructional development of the Axial Volcanic Zone, eastern Snake River Plain volcanic ridge that trends northeast across the middle of the eastern Snake River Plain, and acts Snake River Plain: the AVZ, the Big Lost Trough to the north, and the Arco-Big Southern Butte (ABSB

  6. International Symposium on Eastern Mediterranean Geology Thessaloniki, Greece, 14-20 April 2004

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    5th International Symposium on Eastern Mediterranean Geology Thessaloniki, Greece, 14-20 April 2004 of Athens, Lofos Nymfon 1, 11810 Athens, Greece, esokos@gein.noa.gr 2 Charles University, Prague, KG MFF UK;5th International Symposium on Eastern Mediterranean Geology Thessaloniki, Greece, 14-20 April 2004

  7. Biogeography, ecoregions, and geomorphology affect fish species composition in streams of eastern Oklahoma, USA

    E-Print Network [OSTI]

    Marston, Richard A.

    Oklahoma, USA Daniel C. Dauwalter & Dale K. Splinter & William L. Fisher & Richard A. Marston Received: 8 and stream habitat, influenced fish species composition (presence­absence) in eastern Oklahoma, USA relative ecoregions in eastern Oklahoma. Partial canonical correspondence analyses (pCCAs) and variance partitioning

  8. Neoproterozoic tectonothermal evolution of the Central Eastern Desert, Egypt: a slow velocity tectonic process

    E-Print Network [OSTI]

    Fritz, Harald

    Neoproterozoic tectonothermal evolution of the Central Eastern Desert, Egypt: a slow velocity, University of Assiut, Egypt Received 10 January 2001; received in revised form 24 October 2001; accepted 25 in the Central Eastern Desert of Egypt is constraint by 40 Ar/39 Ar ages of hornblende and muscovite from Meatiq

  9. Renewable Energy in Central & Eastern Europe Vienna University of Technology I Energiepark Bruck/Leitha

    E-Print Network [OSTI]

    Szmolyan, Peter

    Renewable Energy in Central & Eastern Europe CONTINUING EDUCATION CENTER Vienna University on the consumption of energy. However, this system is currently not sustainable. Renewable energy sources as well. The objective of the postgraduate MSc Program "Renewable Energy in Central & Eastern Europe" is, to contribute

  10. Social & Economic Transformations Affecting Rural People and Communities in Central & Eastern Europe Since 1990

    E-Print Network [OSTI]

    Chen, Tsuhan

    Europe Since 1990 Social & Economic Transformations Affecting Rural People and Communities in Central & Eastern Europe Since 1990 EDITED BY Barbora Babjaková, Anna Bandlerová, David L. Brown, Andrzej Kaleta and Communities in Central & Eastern Europe Since 1990 Planning Committee Barbora Babjaková, Slovak University

  11. The Deep Currents in the Eastern Equatorial Atlantic Ocean

    E-Print Network [OSTI]

    /IRD/UPMC), IPSL, Paris, France. 3 IRD, B.P. A5, 98848 Nouméa cedex, New-Caledonia. 4 LEGOS (CNRS observed in the central and western equatorial basin. Here, we present three meridional velocity sections of the basin [Böning and Schott, 1993; Gouriou et al., 1999, 2001; Send et al., 2002] but no deep velocity

  12. Unthinkable Rebellion and the Praxis of the Possible: Ch'orti' Campesin@ Struggles in Guatemala's Eastern Highlands

    E-Print Network [OSTI]

    Casolo, Jennifer Jean

    2011-01-01

    Santiago de Guatemala to the sparsely populated eastern countryside, especially along the Motagua riverSantiago de Guatemala, to the sparsely populated eastern countryside, especially along the Motagua River.

  13. A retrospective study of ecosystem effects of the 1976/77 regime shift in the eastern Pacific warm pool

    E-Print Network [OSTI]

    Vilchis, L. Ignacio

    2010-01-01

    tuna in the eastern Pacific Ocean. Inter-Amer. Trop. Tunatuna in the eastern Pacific Ocean. Inter-Amer. Trop. TunaT.P. , 2001. On the Pacific Ocean regime shift. Geophysical

  14. A Review of the Systematics of Angel Sharks Emphasizing the Species of the Eastern Pacific Region with a Modified Set of Morphometrics for Order Squatiniformes

    E-Print Network [OSTI]

    Alioto, Dominic

    2012-01-01

    occurring in the eastern Pacific Ocean. Ayers compared hisoccurring in the eastern Pacific Ocean. It remains possibleof the Atlantic and Pacific Oceans. Squatiniformes are very

  15. Development of Eastern Regional Wind Resource and Wind Plant Output Datasets: March 3, 2008 -- March 31, 2010

    SciTech Connect (OSTI)

    Brower, M.

    2009-12-01

    The objective of this project was to provide wind resource inputs to the Eastern Wind Integration and Transmission Study.

  16. Fault Process and Broadband Ground-Motion Simulations of the 23 October 2011 Van (Eastern Turkey) Earthquake

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    Fault Process and Broadband Ground-Motion Simulations of the 23 October 2011 Van (Eastern Turkey Abstract On 23 October 2011 an Mw 7.1 earthquake occurred in eastern Turkey, close to the towns of Van.1 Van earthquake occurred on 23 October 2011 in eastern Turkey, close to the towns of Van and Erci

  17. The Khopik porphyry copper prospect, Lut Block, Eastern Iran: Geology, alteration and mineralization, fluid inclusion, and oxygen isotope studies

    E-Print Network [OSTI]

    Kraus, Mary

    The Khopik porphyry copper prospect, Lut Block, Eastern Iran: Geology, alteration.R. Stern b a Research Center for Ore Deposits of Eastern Iran, Ferdowsi University of Mashhad, Iran b and mineralization Microthermometry Stable isotope The Khopik porphyry copper (Au, Mo) prospect in Eastern Iran

  18. Eastern Seaboard Electric Grid Fragility Maps Supporting Persistent Availability

    SciTech Connect (OSTI)

    Walker, Kimberly A; Weigand, Gilbert G; Fernandez, Steven J

    2012-11-01

    Persistently available power transmission can be disrupted by weather causing power outages with economic and social consequences. This research investigated the effects on the national power grid from a specific weather event, Hurricane Irene, that caused approximately 5.7 million customer power outages along the Eastern Seaboard in August of 2011. The objective was to describe the geographic differences in the grid s vulnerability to these events. Individual factors, such as wind speed or precipitation, were correlated with the number of outages to determine the greatest mechanism of power failure in hopes of strengthening the future power grid. The resulting fragility maps not only depicted 18 counties that were less robust than the design-standard robustness model and three counties that were more robust, but also drew new damage contours with correlated wind speeds and county features.

  19. Microbial desulfurization of Eastern oil shale: Bioreactor studies

    SciTech Connect (OSTI)

    Maka, A.; Akin, C.; Punwani, D.V.; Lau, F.S.; Srivastava, V.J.

    1989-01-01

    The removal of sulfur from Eastern oil shale (40 microns particle size) slurries in bioreactors by mixed microbial cultures was examined. A mixed culture that is able to remove the organic sulfur from model sulfur compounds presenting coal as well as a mixed culture isolated from oil shale enrichments were evaluated. The cultures were grown in aerobic fed-batch bioreactors where the oil shale served as the source of all nutrients except organic carbon. Glucose was added as an auxiliary carbon source. Microbial growth was monitored by plate counts, the pH was checked periodically, and oil shale samples were analyzed for sulfur content. Results show a 24% reduction in the sulfur content of the oil shale after 14 days. The settling characteristics of the oil shale in the bioreactors were examined in the presence of the microbes. Also, the mixing characteristics of the oil shale in the bioreactors were examined. 10 refs., 6 figs., 5 tabs.

  20. Tennessee Valley and Eastern Kentucky Wind Working Group

    SciTech Connect (OSTI)

    Katie Stokes

    2012-05-03

    In December 2009, the Southern Alliance for Clean Energy (SACE), through a partnership with the Appalachian Regional Commission, EKPC, Kentucky's Department for Energy Development and Independence, SACE, Tennessee's Department of Environment and Conservation, and TVA, and through a contract with the Department of Energy, established the Tennessee Valley and Eastern Kentucky Wind Working Group (TVEKWWG). TVEKWWG consists of a strong network of people and organizations. Working together, they provide information to various organizations and stakeholders regarding the responsible development of wind power in the state. Members include representatives from utility interests, state and federal agencies, economic development organizations, non-government organizations, local decision makers, educational institutions, and wind industry representatives. The working group is facilitated by the Southern Alliance for Clean Energy. TVEKWWG supports the Department of Energy by helping educate and inform key stakeholders about wind energy in the state of Tennessee.

  1. Middle Eastern power systems; Present and future developments

    SciTech Connect (OSTI)

    Not Available

    1992-06-01

    Middle Eastern Power systems have evolved independently of each other over many decades. The region covers a wide geographical area of over 4 million square kilometers with an estimated population in 1990 of over 120 million people. This paper discusses the present status and future power system developments in the Middle East with emphasis on the Mashrequ Arab Countries (MAC). MAC consists of Egypt, Iraq, Jordan, Lebanon, Syria, Yemen, and the six Gulf Cooperation Council (GCC) countries, namely, Bahrain, Kuwait, Qatar, Saudi Arabia, Oman, and the United Arab Emirates (UAE). Interconnections within MAC and possible extensions to Turkey, Europe, and Central Africa are discussed. A common characteristic of the MAC power systems is that they are all operated by government or semi-government bodies. The energy resources in the region are varied. Countries such as Iraq, Egypt, and Syria have significant hydro power resources. On the other hand, the GCC countries and Iraq have abundant fossil fuel reserves.

  2. Proposals in for Czech firms; cooperation likely with eastern Germany

    SciTech Connect (OSTI)

    Alperowicz, N.

    1993-02-10

    Two Western groups - Shell and a consortium made up of Agip, Conoco, and Total - have offered to buy the refining operations of Chemopetrol Litvinov and Kaucuk Kralupy, both in the Czech republic. Meanwhile, Amoco, Neste, and PCD are looking at the possibility of acquiring some of the plastics plants at Litvinov. Amoco is interested in the polypropylene operations, Neste in polyethylene, and PCD in both. The two Czech firms are included in the second wave of privatization, which will begin in midyear. So far, there have been no offers for the 80,000-m.t./year polystyrene and 60,000-m.t./year styrene butadiene rubber operations belonging to Kralupy, although Atochem representatives recently visited the plants. Litvinov is carrying out revamping operations at its core unit, a 12-year-old, 450,000-m.t./year ethylene plant. The plant, currently running at 400,000 m.t./year, supplies downstream plants, Neratovice, and sells on the export markets. An existing ethylene pipeline between Litvinov and Bohlen in eastern Germany, which used to supply an average 100,000 m.t./year of ethylene to Bohen in exchange for naphtha, is virtually unused. One proposal involves reactivating this exchange to secure ethylene feedstock for plants in eastern Germany. According to some sources, a preliminary decision has been made to shut down the 100,000-m.t./year ethylene plant at Leuna and possibly to expand the Bohlen cracker by 100,000 m.t./year, to 400,000 m.t./year by the late 1990s.

  3. ORIGINAL PAPER From Tethys to Eastern Paratethys: Oligocene depositional

    E-Print Network [OSTI]

    Jiménez-Moreno, Gonzalo

    of New Mexico, Albuquerque 86011, USA S. Coric Geologische Bundesanstalt, Neulinggasse 38, 1031 Vienna anoxic bottom conditions (e.g. Schulz et al. 2005) and the deposition of black shales in large parts

  4. ALS IR News October 25, 2006

    E-Print Network [OSTI]

    ). And the reflection spectrum of an Al mirror clearly shows the strong AlOx absorptions from the very thin oxide layer

  5. Al

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News Publications Traditional KnowledgeAgenda Agenda NERSC UserAgustin Mihi andAiron the way to

  6. An evaluation of efforts to reestablish eastern wild turkeys into the Post Oak Savannah of Texas 

    E-Print Network [OSTI]

    Petty, Blake Douglas

    2000-01-01

    The overall objective of this study was to summarize the cumulative results of 5 studies focusing on efforts to reestablish eastern wild turkeys (Meleagris gallopavo silvestris) into the Post Oak Savannah of Texas and to evaluate the effectiveness...

  7. Population dynamics of eastern wild turkeys relocated into the post oak savannah of Texas 

    E-Print Network [OSTI]

    Lopez, Roel Roberto

    1996-01-01

    Objectives of this study were to provide information on the status of eastern wild turkeys (meleagris gallopavo silvestris) relocated into the Post Oak Savannah of Texas. Specifically, I evaluated and discussed (1) survival and reproduction, (2...

  8. FY 2005/06 Accomplishment Eastern Maine Medical Center (EMMC) Receives

    E-Print Network [OSTI]

    Pennycook, Steve

    FY 2005/06 Accomplishment Eastern Maine Medical Center (EMMC) Receives "Critical Power Reliability capability (natural gas or oil) to greatly improve its ability to operate under any condition. The following on medical equipment and f

  9. Classification of surficial sediments: North-Central and Eastern Gulf of Mexico 

    E-Print Network [OSTI]

    Cain, William

    2003-01-01

    The surface sediments in the North-Central and Eastern Gulf of Mexico can be appropriately characterized by physical property analysis, especially by comparison of wet-bulk density. Two hundred and eighty, 1-5 meter cores ...

  10. Website Provides Data for Key Oil Play in North Dakota, Eastern...

    Broader source: Energy.gov (indexed) [DOE]

    A new web-based geographic information system designed to improve oil production in North Dakota and eastern Montana has been launched with support from the U.S. Department of...

  11. Ground-based measurements of immersion freezing in the eastern Mediterranean

    E-Print Network [OSTI]

    Levin, Z.

    Ice nuclei were measured in immersion-freezing mode in the eastern Mediterranean region using the FRIDGE-TAU (FRankfurt Ice-nuclei Deposition freezinG Experiment, the Tel Aviv University version) chamber. Aerosol particles ...

  12. Building skills : a construction trades training facility for the eastern Canadian Arctic

    E-Print Network [OSTI]

    Roszler, Sarah Katherine, 1977-

    2005-01-01

    On April 1, 1999, the Inuit of the Eastern Canadian Arctic achieved sovereignty over a new territory, Nunavut, envisioning economic self-reliance, political self-determination, and renewal of confidence in Inuit community. ...

  13. EMBARGOED FOR 1 P.M. Eastern Standard Time Wed, Feb. 4, 2015

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    call for antibody 'bar code' system to follow Human Genome Project February 4, 2015 EMBARGOED FOR 1 P.M. Eastern Standard Time Wed, Feb. 4, 2015 LOS ALAMOS, N.M., Feb. 4, 2015-More...

  14. Modern Taurine Cattle Descended from Small Number of Near-Eastern Founders

    E-Print Network [OSTI]

    Modern Taurine Cattle Descended from Small Number of Near-Eastern Founders Ruth Bollongino,*,1 Holland Abstract Archaeozoological and genetic data indicate that taurine cattle were first domesticated be expected if cattle domestication was a technologically straightforward and unexacting region

  15. Deformation, erosion and sedimentation in collisional orogens : case studies from eastern Tibet and southwestern China

    E-Print Network [OSTI]

    Studnicki-Gizbert, Christopher Terrance

    2006-01-01

    This dissertation addresses aspects of the tectonics of regions adjacent to the eastern Himalayan syntaxis. The first chapter describes the Tertiary Gonjo basin, includes structural and sedimentologic observations, and ...

  16. Kinematically consistent, elastic block model for the eastern Mediterranean constrained by GPS measurements

    E-Print Network [OSTI]

    Lawrence, Shawn A. (Shawn Adam), 1975-

    2003-01-01

    I use a Global Positioning System (GPS) velocity field to constrain block models of the eastern Mediterranean and surrounding regions that account for the angular velocities of constituent blocks and elastic strain ...

  17. Impacts of feral hogs on reclaimed surface-mined lands in eastern Texas: a management perspective 

    E-Print Network [OSTI]

    Mersinger, Robert C.

    1999-01-01

    During the last decade, surface lignite mines in eastern Texas have experienced damage to reclaimed lands by feral hogs (Sus scrota). Specifically, feral hogs have caused damage to vegetative plantings used in the reclamation ...

  18. INTEGRITY OF SCHOOLS OF SKIPJACK TUNA, KATSUWONUS PELAMIS, IN THE EASTERN PACIFIC OCEAN,

    E-Print Network [OSTI]

    INTEGRITY OF SCHOOLS OF SKIPJACK TUNA, KATSUWONUS PELAMIS, IN THE EASTERN PACIFIC OCEAN Pacific yellowfin [(Thunnus albacares)] and the Pac.ific-wide skipjack [(KatS'Uwonus pelamis

  19. Sites with Holocene dung deposits in the Eastern Desert of Egypt: Visited by herders?

    E-Print Network [OSTI]

    Marinova, Elena

    Sites with Holocene dung deposits in the Eastern Desert of Egypt: Visited by herders? V. Linseele a by the Belgian Middle Egypt Prehistoric Project of Leuven University under the direction of P.M. Vermeersch

  20. Health Disparities in Eastern North Carolina 1 May 2011 Satomi Imai, Ph. D.

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    Health Disparities in Eastern North Carolina 1 May 2011 Satomi Imai, Ph. D. Center for Health Services Research and Development East Carolina University Disparities in Health Status and Health Risk .................................................................................................................. 4 Perceived Health Status

  1. Sub-surface dissolution of evaporites in the Eastern Mediterranean sea 

    E-Print Network [OSTI]

    Camerlenghi, Angelo Alessandro

    1988-01-01

    SUB-SURFACE DISSOLUTION OF EVAPORITES IN THE EASTERN MEDITERRANEAN SEA A Thesis by ANGELO ALESSANDRO CAMERLENGHI Submitted to the Office of Graduate Studies of Texas ASM University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE December 1988 Major Subject: Oceanography SUB-SURFACE DISSOLUTION OF EVAPORITES IN THE EASTERN MEDITERRANEAN SEA A Thesis by ANGELO ALESSANDRO CAMERLENGHI Approved as to style and content by: Pl&DWa~rg~~~ William R. Bryair...

  2. The potential for commercial use of wildlife in some North-Eastern Tuli Block farms 

    E-Print Network [OSTI]

    Nchunga, Mushanana Lawrence

    1978-01-01

    THE POTENTIAL FOR COMMERCIAL USE OF WILDLIFE IN SOME NORTH ? EASTERN TULI BLOCK FARMS A Thesis by Mushanana Lawrence Nchunga Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE December 1978 Major Subject: Wildlife and Fisheries Sciences THE POTENTIAL FOR COMMERCIAL USE OF WILDLIFE IN SOME NORTH-EASTERN TULI BLOCK FARMS A Thesis Mushanana Lawrence Nchunga A proved as to style and content by: ) (Chairman...

  3. Transformer Abdullah Al-Otaibi

    E-Print Network [OSTI]

    Masoudi, Husain M.

    Transformer Abdullah Al-Otaibi ID#242374 Section#2 Abstract- this is a brief description for transformer and how it works. I. DEFINITION A transformer is a device that transfers electrical energy from of the transformer in 1831. The transformer is used by Faraday only to demonstrate the principle of electromagnetic

  4. Anthropogenic emissions of highly reactive volatile organic compounds in eastern Texas

    E-Print Network [OSTI]

    Mickley, Loretta J.

    al 2003, Parrish et al 2012) and in an oil/gas field of northern Colorado (Gilman et al 2013 of VOCs, have been used to constrain AHRVOC emissions in East Asia (Fu et al 2007) and Nigeria (Marais et

  5. Geologic Controls of Hydrocarbon Occurrence in the Appalachian Basin in Eastern Tennessee, Southwestern Virginia, Eastern Kentucky, and Southern West Virginia

    SciTech Connect (OSTI)

    Hatcher, Robert D

    2005-11-30

    This report summarizes the accomplishments of a three-year program to investigate the geologic controls of hydrocarbon occurrence in the southern Appalachian basin in eastern Tennessee, southwestern Virginia, eastern Kentucky, and southern West Virginia. The project: (1) employed the petroleum system approach to understand the geologic controls of hydrocarbons; (2) attempted to characterize the P-T parameters driving petroleum evolution; (3) attempted to obtain more quantitative definitions of reservoir architecture and identify new traps; (4) is worked with USGS and industry partners to develop new play concepts and geophysical log standards for subsurface correlation; and (5) geochemically characterized the hydrocarbons (cooperatively with USGS). Third-year results include: All project milestones have been met and addressed. We also have disseminated this research and related information through presentations at professional meetings, convening a major workshop in August 2003, and the publication of results. Our work in geophysical log correlation in the Middle Ordovician units is bearing fruit in recognition that the criteria developed locally in Tennessee and southern Kentucky are more extendible than anticipated earlier. We have identified a major 60 mi-long structure in the western part of the Valley and Ridge thrust belt that has been successfully tested by a local independent and is now producing commercial amounts of hydrocarbons. If this structure is productive along strike, it will be one of the largest producing structures in the Appalachians. We are completing a more quantitative structural reconstruction of the Valley and Ridge and Cumberland Plateau than has been made before. This should yield major dividends in future exploration in the southern Appalachian basin. Our work in mapping, retrodeformation, and modeling of the Sevier basin is a major component of the understanding of the Ordovician petroleum system in this region. Prior to our undertaking this project, this system was the least understood in the Appalachian basin. This project, in contrast to many if not most programs undertaken in DOE laboratories, has a major educational component wherein three Ph.D. students have been partially supported by this grant, one M.S. student partially supported, and another M.S. student fully supported by the project. These students will be well prepared for professional careers in the oil and gas industry.

  6. Central and Eastern United States (CEUS) Seismic Source Characterization (SSC) for Nuclear Facilities Project

    SciTech Connect (OSTI)

    Kevin J. Coppersmith; Lawrence A. Salomone; Chris W. Fuller; Laura L. Glaser; Kathryn L. Hanson; Ross D. Hartleb; William R. Lettis; Scott C. Lindvall; Stephen M. McDuffie; Robin K. McGuire; Gerry L. Stirewalt; Gabriel R. Toro; Robert R. Youngs; David L. Slayter; Serkan B. Bozkurt; Randolph J. Cumbest; Valentina Montaldo Falero; Roseanne C. Perman' Allison M. Shumway; Frank H. Syms; Martitia P. Tuttle

    2012-01-31

    This report describes a new seismic source characterization (SSC) model for the Central and Eastern United States (CEUS). It will replace the Seismic Hazard Methodology for the Central and Eastern United States, EPRI Report NP-4726 (July 1986) and the Seismic Hazard Characterization of 69 Nuclear Plant Sites East of the Rocky Mountains, Lawrence Livermore National Laboratory Model, (Bernreuter et al., 1989). The objective of the CEUS SSC Project is to develop a new seismic source model for the CEUS using a Senior Seismic Hazard Analysis Committee (SSHAC) Level 3 assessment process. The goal of the SSHAC process is to represent the center, body, and range of technically defensible interpretations of the available data, models, and methods. Input to a probabilistic seismic hazard analysis (PSHA) consists of both seismic source characterization and ground motion characterization. These two components are used to calculate probabilistic hazard results (or seismic hazard curves) at a particular site. This report provides a new seismic source model. Results and Findings The product of this report is a regional CEUS SSC model. This model includes consideration of an updated database, full assessment and incorporation of uncertainties, and the range of diverse technical interpretations from the larger technical community. The SSC model will be widely applicable to the entire CEUS, so this project uses a ground motion model that includes generic variations to allow for a range of representative site conditions (deep soil, shallow soil, hard rock). Hazard and sensitivity calculations were conducted at seven test sites representative of different CEUS hazard environments. Challenges and Objectives The regional CEUS SSC model will be of value to readers who are involved in PSHA work, and who wish to use an updated SSC model. This model is based on a comprehensive and traceable process, in accordance with SSHAC guidelines in NUREG/CR-6372, Recommendations for Probabilistic Seismic Hazard Analysis: Guidance on Uncertainty and Use of Experts. The model will be used to assess the present-day composite distribution for seismic sources along with their characterization in the CEUS and uncertainty. In addition, this model is in a form suitable for use in PSHA evaluations for regulatory activities, such as Early Site Permit (ESPs) and Combined Operating License Applications (COLAs). Applications, Values, and Use Development of a regional CEUS seismic source model will provide value to those who (1) have submitted an ESP or COLA for Nuclear Regulatory Commission (NRC) review before 2011; (2) will submit an ESP or COLA for NRC review after 2011; (3) must respond to safety issues resulting from NRC Generic Issue 199 (GI-199) for existing plants and (4) will prepare PSHAs to meet design and periodic review requirements for current and future nuclear facilities. This work replaces a previous study performed approximately 25 years ago. Since that study was completed, substantial work has been done to improve the understanding of seismic sources and their characterization in the CEUS. Thus, a new regional SSC model provides a consistent, stable basis for computing PSHA for a future time span. Use of a new SSC model reduces the risk of delays in new plant licensing due to more conservative interpretations in the existing and future literature. Perspective The purpose of this study, jointly sponsored by EPRI, the U.S. Department of Energy (DOE), and the NRC was to develop a new CEUS SSC model. The team assembled to accomplish this purpose was composed of distinguished subject matter experts from industry, government, and academia. The resulting model is unique, and because this project has solicited input from the present-day larger technical community, it is not likely that there will be a need for significant revision for a number of years. See also Sponsors Perspective for more details. The goal of this project was to implement the CEUS SSC work plan for developing a regional CEUS SSC model. The work plan, formulated by the project manager and a

  7. Background Report on Eastern Democratic Republic of the Congo

    SciTech Connect (OSTI)

    Warren, Tracy A

    2011-05-01

    Each month, approximately 45,000 people die from violence, hunger, disease, and other effects of displacement as a result of war in the Democratic Republic of the Congo (DRC). The country is often said to be plagued by a 'resource curse.' During each period in history since its discovery by the West, the DRC has possessed the resources the world craves and the world has sought these without regard for the consequences to the Congolese people. The catastrophic consequences of Congo's history of natural resource exploitation are the direct and indirect death of millions of Congolese people. The current war in Congo is multi-causal in nature but explanations are often reduced to describing it as an ethic conflict based on objective grievance. Objective grievance such as inequality, ethnic tensions, land disputes, and lack of democracy do exist, but they are neither necessary nor sufficient to explain the cause of the violent conflict, and more importantly, they fall short in explaining why this conflict has continued for years. The reality is the conflict is an economic war in which the trade of conflict minerals, gold and the 3Ts (tin, tantalum, tungsten), is directly linked to the financial sustainability of the groups fighting each other in eastern DRC. Objective grievance is a by-product of the conflict, used to create a false but plausible moral justification to continue violence. This paper examines the history of conflict in the DRC and the socio-economic variables contributing to the current war fought over conflict minerals.

  8. Precipitation over eastern South America and the South AtlanticSea surface temperature during neutral ENSO periods

    E-Print Network [OSTI]

    Jones, Charles

    2015-01-01

    2003) GPCP pentad precipitation analyses: an experimentalconvec- tion and increase precipitation over eastern SouthAmerica. Keywords SST Precipitation South Atlantic Dipole

  9. Response to comments by Yuan Wang on “Trends of extreme precipitation in Eastern China and their possible causes”

    E-Print Network [OSTI]

    2015-01-01

    dependence of global precipitation extremes. Geo- phys. Res.2015: Trends of extreme precipitation in eastern China andon convective clouds and precipitation. Rev. Geophys. , 50,

  10. Synthesis of AlN/Al Polycrystals along with Al Nanoparticles Using Thermal Plasma Route

    SciTech Connect (OSTI)

    Kanhe, Nilesh S.; Nawale, A. B.; Kulkarni, N. V.; Bhoraskar, S. V.; Mathe, V. L.; Das, A. K.

    2011-07-15

    This paper for the first time reports the (200) oriented growth of hexagonal Aluminum nitride crystals during synthesis of aluminum nanoparticles in dc transferred arc thermal plasma reactor by gas phase condensation in nitrogen plasma. The structural and morphological study of as synthesized AlN crystal and aluminium nanoparticles was done by using the x-ray diffraction method, scanning electron microscopy and transmission electron microscopy.

  11. ALS 20th Anniversary Celebration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I T E D S TALPES20thALS 20th

  12. ALS Evidence Confirms Combustion Theory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I TALS Evidence ConfirmsALS

  13. 2012 ALS User Meeting Awards

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONe β+-DecayUpgrade P.July 31, 20122012 ALS

  14. 2015 ALS User Meeting Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril 30, 2013Program95 Calendar August2015 ALS

  15. 2012 ALS User Meeting Awards

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 2010 james-r.giusti@srs.govTuesday, February 1,2 ALS User

  16. ALS Evidence Confirms Combustion Theory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News BelowAskedAIKENALSDoctoral Fellowship inALS

  17. United States Patent [19] Church et al.

    E-Print Network [OSTI]

    Church, George M.

    United States Patent [19] Church et al. [54] CHARACTERIZATION OF INDIVIDUAL POLYMER MOLECULES BASED 1111111111111111111111111111111111111111111111111111111111111 US005795782A [11] Patent Number: [45] Date of Patent: 5,795,782 Aug. 18, 1998 Boulanger et al

  18. IBM Probes Material Capabilities at the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    IBM Probes Material Capabilities at the ALS IBM Probes Material Capabilities at the ALS Print Wednesday, 12 February 2014 11:05 Vanadium dioxide, one of the few known materials...

  19. ALS Beamline Design Requirements - Revision 1

    E-Print Network [OSTI]

    Heimann, Phil

    2010-01-01

    be protected by a ground fault circuit interrupter (GFCI).The ALS routinely installs GFCI at convenient locations

  20. Al+LiF Coated Focal Plane

    E-Print Network [OSTI]

    Al+LiF Coated Mirror #2 Focal Plane Assemblies (4) Detectors (2) Al+LiF Coated Mirror #1 SiC Coated Mirror #2 SiC Coated Mirror #1 Rowland Circles Al+LiF Coated Grating #2 Al+LiF Coated Grating #1 SiC Coated Grating #2 z y x Figure 1 A schematic view of the FUSE optical system. 1. INTRODUCTION The Far

  1. Advance Funding and Development Agreement: Plains & Eastern Clean Line

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment| DepartmentAL/FAL 99-01Energy Efficiency Grants |January 29,Transmission

  2. Session: Avian migration and implications for wind power development in the Eastern United States

    SciTech Connect (OSTI)

    Mabey, Sarah; Cooper, Brian

    2004-09-01

    This session at the Wind Energy and Birds/Bats workshop consisted of two presentations followed by a discussion/question and answer period. The session was arranged to convey what is known about avian migration, particularly in the eastern US. The first presentation ''Migration Ecology: Issues of Scale and Behavior'' by Sarah Mabey frames the issue of migratory bird interactions with wind energy facilities from an ecological perspective: when, where, and why are migrant bird species vulnerable to wind turbine collision. The second presentation ''Radar Studies of Nocturnal Migration at Wind Sites in the Eastern US'' by Brian Cooper reported on radar studies conducted at wind sites in the eastern US, including Mount Storm, Clipper Wind, and others.

  3. Wind/PV Generation for Frequency Regulation and Oscillation Damping in the Eastern Interconnection

    SciTech Connect (OSTI)

    Liu, Yong; Gracia, Jose R; Hadley, Stanton W; Liu, Yilu

    2013-12-01

    This report presents the control of renewable energy sources, including the variable-speed wind generators and solar photovoltaic (PV) generators, for frequency regulation and inter-area oscillation damping in the U.S. Eastern Interconnection (EI). In this report, based on the user-defined wind/PV generator electrical control model and the 16,000-bus Eastern Interconnection dynamic model, the additional controllers for frequency regulation and inter-area oscillation damping are developed and incorporated and the potential contributions of renewable energy sources to the EI system frequency regulation and inter-area oscillation damping are evaluated.

  4. Sources and fluxes of carbon in a large boreal hydroelectric reservoir of eastern Canada: an isotopic approach

    E-Print Network [OSTI]

    Long, Bernard

    Sources and fluxes of carbon in a large boreal hydroelectric reservoir of eastern Canada Hydroelectric reservoirs emit greenhouse gases (GHGs). Although a few hypothesis have been put forward at the surface of a large boreal hydroelectric reservoir of eastern Canada (Robert-Bourassa) as well

  5. Deep-Sea Research I 53 (2006) 17621771 Gouge marks on deep-sea mud volcanoes in the eastern

    E-Print Network [OSTI]

    Hooker, Sascha K.

    2006-01-01

    Deep-Sea Research I 53 (2006) 1762­1771 Gouge marks on deep-sea mud volcanoes in the eastern in the eastern Mediterranean Sea. The marks consist of a central groove (about 10 cm deep and 1­2 m long like the deep-diving whales. The characteristic high acoustic backscatter of the mud volcanoes would

  6. How plate tectonics is recorded in chalk deposits along the eastern English Channel in Normandy (France) and Sussex (UK)

    E-Print Network [OSTI]

    Boyer, Edmond

    fracture system, on each side of the eastern English Channel, using a set of 1600 meso-scale fractures data vary on each part of the eastern English Channel. The meso-scale fracture system is thus used to better define the type of relationship between meso-scale and large-scale brittle deformation in the Chalk

  7. Influence of temperature and body mass on standard metabolic rate of eastern red-backed salamanders (Plethodon cinereus)

    E-Print Network [OSTI]

    Hopkins, William A.

    Influence of temperature and body mass on standard metabolic rate of eastern red-backed salamanders 29 October 2009 Accepted 20 January 2010 Keywords: Eastern red-backed salamander Oxygen consumption be used to investigate questions of applied or basic ecological interest, such as quantifying energetic

  8. Fast Track Reservoir Modeling of Shale Formations in the Appalachian Basin. Application to Lower Huron Shale in Eastern Kentucky.

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    Huron Shale - Gas production from Devonian Shale in Eastern Kentucky goes all the way back to 1892, when of the reservoir, efficient gas production was established. The most prolific horizon of Devonian Shale in Eastern Kentucky is the Lower Huron Shale, which is Ohio Shale member. Over 80% of Devonian gas production comes

  9. A westward extension of the warm pool leads to a westward extension of the Walker circulation, drying eastern Africa

    E-Print Network [OSTI]

    Williams, Park

    , drying eastern Africa A. Park Williams · Chris Funk Received: 3 June 2010 / Accepted: 21 December 2010 Ó Africa. In recent decades (1980­2009), this response has suppressed convection over tropical eastern Africa, decreasing precipitation during the `long-rains' season of March­June. This trend toward drought

  10. Phanerozoic tectonothermal history of the ArabianNubian shield in the Eastern Desert of Egypt: evidence from fission track

    E-Print Network [OSTI]

    Fritz, Harald

    Phanerozoic tectonothermal history of the Arabian­Nubian shield in the Eastern Desert of Egypt were performed in the Eastern Desert of Egypt. The results provide insights into the processes driving reserved. Keywords: Phanerozoic; Fission track thermochronology; Palaeostress; Arabian­Nubien shield; Egypt

  11. JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 88, NO. B9, PAGES 7429-7448, SEPTEMBER 10,1983 --BACK ARC THRUSTING IN THE EASTERN SUNDA ARC, INDONESIA

    E-Print Network [OSTI]

    McCaffrey, Robert

    THRUSTING IN THE EASTERN SUNDA ARC, INDONESIA: A CONSEQUENCE OF ARC-CONTINENT COLLISION Eli A. Silver Center, Jalan Diponegoro 57, Bandung, Indonesia Abstract. The structure of the eastern Sunda convergence

  12. A new approach to obtaining a 3D shear wave velocity model of the crust and upper mantle: An application to eastern Turkey

    E-Print Network [OSTI]

    Holliday, Vance T.

    : An application to eastern Turkey Jonathan R. Delph , George Zandt, Susan L. Beck Department of Geosciences to their theoretical location. When applied to eastern Turkey, this approach leads to a higher resolution image of the subsurface and clearly delineates different tectonic features in eastern Turkey that were not apparent using

  13. JOURNAL OF GEOPHYSICAL RESEARCH: SOLID EARTH, VOL. 118, 16191637, doi:10.1002/jgrb.50117, 2013 The 2011 Mw 7.1 Van (Eastern Turkey) earthquake

    E-Print Network [OSTI]

    Cambridge, University of

    The 2011 Mw 7.1 Van (Eastern Turkey) earthquake J. R. Elliott,1 A. C. Copley,2 R. Holley,3 K. Scharer,4 imagery, and field observations to constrain the fault parameters of the Mw 7.1 2011 Van (Eastern Turkey (Eastern Turkey) earthquake, J. Geophys. Res. Solid Earth, 118, 1619­1637, doi:10.1002/jgrb.50117. 1

  14. Trends and Disparities in Mortality in Eastern North Carolina-29 Counties Report #2.201, August 2014 PageCenter for Health Systems Research and Development, ECU

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    Trends and Disparities in Mortality in Eastern North Carolina-29 Counties Report #2.201, August East Carolina University Trends and Disparities in Mortality in Eastern North Carolina Total Deaths in Eastern North Carolina-29 Counties Report #2.201, August 2014 PageCenter for Health Systems Research

  15. Trends and Disparities in Mortality in Eastern North Carolina-41 Counties Report #2.203, August 2014 PageCenter for Health Systems Research and Development, ECU

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    Trends and Disparities in Mortality in Eastern North Carolina-41 Counties Report #2.203, August East Carolina University Trends and Disparities in Mortality in Eastern North Carolina Total Deaths in Eastern North Carolina-41 Counties Report #2.203, August 2014 PageCenter for Health Systems Research

  16. Trends and Disparities in Specific Cancer Mortality in Eastern North Carolina Report #2.203, September 2009 PageCenter for Health Services Research and Development, ECU

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    Trends and Disparities in Specific Cancer Mortality in Eastern North Carolina Report #2 and Development East Carolina University Trends and Disparities in Specific Cancer Mortality in Eastern North and Disparities in Specific Cancer Mortality in Eastern North Carolina Report #2.203, September 2009 Page

  17. From the Bay of Naples to the River Don: the Campanian Ignimbrite eruption and the Middle to Upper Paleolithic transition in Eastern Europe

    E-Print Network [OSTI]

    Holliday, Vance T.

    Paleolithic transition in Eastern Europe John F. Hoffecker a,*, Vance T. Holliday b , M.V. Anikovich c , A Paleolithic transition Early Upper Paleolithic Eastern Europe Kostenki-Borshchevo Geochronology Climate across Southeastern and Eastern Europe. At the Kostenki-Borshchevo open-air sites on the Middle Don River

  18. Did melting glaciers cause volcanic eruptions in eastern California? Probing the mechanics of dike

    E-Print Network [OSTI]

    Manga, Michael

    Did melting glaciers cause volcanic eruptions in eastern California? Probing the mechanics of dike significant cross correlations between changes in eruption frequency and the first derivative of the glacial volume. Moreover, calculated time lags for the effects of glacial unloading on silicic and basaltic

  19. Environmental control on eastern broadleaf forest species' leaf wax distributions and D/H ratios

    E-Print Network [OSTI]

    Environmental control on eastern broadleaf forest species' leaf wax distributions and D/H ratios the degree to which an individual plant's leaf waxes D/H ratios are affected by these parameters remains- sitions of leaf wax n-alkanes, stem and surface waters were analyzed and compared against high

  20. Environmental control on eastern broadleaf forest species' leaf wax distributions and D/H ratios

    E-Print Network [OSTI]

    Tipple, Brett

    Environmental control on eastern broadleaf forest species' leaf wax distributions and D/H ratios plant's leaf waxes D/H ratios are affected by these parameters remains in question. Understanding Coast of the US, from Florida to Maine. Hydrogen isotopic compo- sitions of leaf wax n-alkanes, stem

  1. CONTRIBUTIONS TO LIFE HISTORIES OF SCIlENIDlE OF THE EASTERN UNITED STATES COAST.

    E-Print Network [OSTI]

    CONTRIBUTIONS TO LIFE HISTORIES OF SCIlENIDlE OF THE EASTERN UNITED STATES COAST. ~ By WILLIAMW of the commercial fisheries of the United States, excluding Alaska, rests entirely in the hands of the State-desired story of the migration and feeding and breeding habits of one or more species of fish. [Coker, 1920, p

  2. Forest Resources: Eastern Wild Turkey Management http://tfsweb.tamu.edu Page 1 of 1

    E-Print Network [OSTI]

    Forest Resources: Eastern Wild Turkey Management http://tfsweb.tamu.edu Page 1 of 1 Diet: Turkeys are opportunistic omnivores feeding on what is seasonably available. The wild turkey's diet is approxi- mately 75 grasshoppers, ants, beetles, spiders) and snails. Turkey poults are particular- ly dependent on insects during

  3. Physical and chemical signatures of a developing anticyclonic eddy in the Leeuwin Current, eastern Indian Ocean

    E-Print Network [OSTI]

    Feng, Ming

    Physical and chemical signatures of a developing anticyclonic eddy in the Leeuwin Current, eastern 2006 to sample a developing anticyclonic eddy of the Leeuwin Current off Western Australia. The eddy to that of the Leeuwin Current, indicating the water mass in the eddy is mainly derived from the Leeuwin Current

  4. Ground-Motion Suite Selection for Eastern North America E. M. Hines, M.ASCE1

    E-Print Network [OSTI]

    Hines, Eric

    prevention design for moderate seismic regions has become a serious concern. Whereas 10 years ago, Boston in the eastern United States to have adopted formal seismic design criteria (Nordenson and Bell 2000), it is now-thirds of the 2% in 50 year maximum considered earthquake (MCE) event as the primary seismic design intensity

  5. Precambrian Research xxx (2006) xxxxxx Anorthosites in the Eastern Granulites of Tanzania--New SIMS

    E-Print Network [OSTI]

    Fritz, Harald

    2006-01-01

    Precambrian Research xxx (2006) xxx­xxx Anorthosites in the Eastern Granulites of Tanzania, University of Dar es Salaam, Tanzania Received 12 May 2005; received in revised form 3 March 2006; accepted 7 in Tanzania. These are tectonically incorporated into a suite of enderbitic rocks and migmatitic orthogneisses

  6. Eastern Asian emissions of anthropogenic halocarbons deduced from aircraft concentration data

    E-Print Network [OSTI]

    Palmer, Paul

    Eastern Asian emissions of anthropogenic halocarbons deduced from aircraft concentration data Paul:CO enhancement ratios on regional to continental scales can be used to infer halocarbon emissions, providing of Asian outflow from the TRACE-P mission over the western Pacific (March­April 2001) and derive emissions

  7. Temperature Influence on Commercial Lake Whitefish Harvest in Eastern Lake Michigan

    E-Print Network [OSTI]

    the relationship between lake whitefish harvest, water temperature statistics, and fishing effort. Several vari in describing the fish harvest with surface water temperatures is most likely the consequence of warm surfaceTemperature Influence on Commercial Lake Whitefish Harvest in Eastern Lake Michigan Holly Price1

  8. Increase of wintertime fog in China: Potential impacts of weakening of the Eastern Asian monsoon circulation

    E-Print Network [OSTI]

    Zeng, Ning

    Increase of wintertime fog in China: Potential impacts of weakening of the Eastern Asian monsoon. [1] Fog is a severe weather hazard that greatly influences traffic and daily life with potentially heavy economic loss. An increasing number of traffic accidents caused by fog have been reported in China

  9. WEATHER-TYPE CLIMATOLOGY OF PRECIPITATION IN THE EASTERN Hanns Kerschner

    E-Print Network [OSTI]

    Kerschner, Hanns

    AND DATA SET The classification is based on a calendar of daily weather types for the Eastern Alps, set up.Kerschner@uibk.ac.at Abstract: A simple weather type classification based on 500 hPa airflow and the anomaly of the 500 h between anticyclonic, indifferent and cyclonic weather types (Schüepp, 1979). The precipitation data come

  10. Music in Middle Eastern Cinema Conference Tuesday 17th May and Wednesday 18th May

    E-Print Network [OSTI]

    Miranda, Eduardo Reck

    Music in Middle Eastern Cinema Conference Tuesday 17th May and Wednesday 18th May Programme Tuesday Cinema: From Zeki Muren to Orhan Gencebay 12.50pm ­ 2pm Lunch break Session 3: 2pm ­ 4.30pm Due Cinema: Bashu, Little Stranger' 4.30 Tea/coffee Session 4: 5pm -7pm Chair: Stephen Cottrell (City

  11. Soil CO2 production and surface flux at four climate observatories in eastern Canada

    E-Print Network [OSTI]

    Beltrami, Hugo

    Soil CO2 production and surface flux at four climate observatories in eastern Canada David Risk December 2002. [1] Soils constitute the largest terrestrial source of carbon dioxide to the atmosphere the climatic controls on soil respiration. We use subsurface CO2 concentrations, surface CO2 flux and detailed

  12. Advanced Unit Commitment Strategies for the U.S. Eastern Interconnection: Preprint

    SciTech Connect (OSTI)

    Ela, E.; Milligan, M.; Meibom, P.; Barth, R.; Tuohy, A.

    2010-10-01

    This paper outlines a study undertaken for the U.S. Eastern Interconnection in which different advanced unit commitment strategies were simulated for three different years to evaluate the benefits that may occur from using these strategies as an operational tool.

  13. Winter Eddy Genesis in the Eastern South China Sea due to Orographic Wind Jets GUIHUA WANG

    E-Print Network [OSTI]

    Chen, .Dake

    Winter Eddy Genesis in the Eastern South China Sea due to Orographic Wind Jets GUIHUA WANG State, China (Manuscript received 22 June 2007, in final form 10 August 2007) ABSTRACT Generation of mesoscale with a reduced-gravity model. It is found that the orographic wind jets associated with the northeast winter

  14. Respiratory and Reproductive Characteristics of Eastern Mosquitofish (Gambusia holbrooki) Inhabiting a Coal Ash Settling Basin

    E-Print Network [OSTI]

    Hopkins, William A.

    ) Inhabiting a Coal Ash Settling Basin B. P. Staub, W. A. Hopkins, J. Novak, J. D. Congdon Savannah River 2002/Accepted: 29 March 2002 Abstract. Coal fly ash and effluent from coal ash settling basins viable populations in areas contaminated by coal ash. While eastern mosquitofish are present

  15. Tree mortality in the eastern and central United States: patterns and drivers

    E-Print Network [OSTI]

    Moorcroft, Paul R.

    Tree mortality in the eastern and central United States: patterns and drivers M I C H A E L C . D I rate due to the small sample size of deaths within individual studies. Still, life cycle analyses have, such as the loss of >1.2 mil- lion ha of pinyon pine forest in the southwestern United States following the 2002

  16. ARTICLE BODY Across the wide open spaces of north eastern New Mexico roams an

    E-Print Network [OSTI]

    Rock, Chris

    ARTICLE BODY Across the wide open spaces of north eastern New Mexico roams an unlikely creature, the North American pronghorn antelope. Dr. Mark Wallace is working alongside New Mexico Fish and Game,000 individuals. In New Mexico, large herds can be seen grazing in agricultural fields, costing farmers

  17. Wave energy potential in the Eastern Mediterranean Levantine Basin. An integrated 10-year study

    E-Print Network [OSTI]

    Georgiou, Georgios

    that remains to be covered before wave energy science and technology reach the maturity level of its windData bank Wave energy potential in the Eastern Mediterranean Levantine Basin. An integrated 10-year Article history: Received 30 July 2013 Accepted 25 March 2014 Available online Keywords: Wave energy

  18. The Seytan Deresi wreck and the Minoan connection in the Eastern Aegean 

    E-Print Network [OSTI]

    Margariti, Roxani Eleni

    1998-01-01

    the tradition of colonization and intensive maritime activity by Minors in the region. Tile pottery from keyman Deresi may have been made in a Minoan settlement of the Eastern Aegean islands or a site on the Anatolian coast where Minors lived and/or traded....

  19. Genetic heterogeneity of Atlantic bluefin tuna caught in the eastern North Atlantic Ocean south of Iceland

    E-Print Network [OSTI]

    Newman, Michael C.

    of Iceland Jens Carlsson, Jan R. McDowell, Jeanette E. L. Carlsson, Droplaug O´ lafsdo´ttir, and John E. Genetic heterogeneity of Atlantic bluefin tuna caught in the eastern North Atlantic Ocean south of Iceland, more recent studies south of Iceland reported only small differences in size of tuna caught

  20. Mantle upwellings and convective instabilities revealed by seismic tomography and helium isotope geochemistry beneath eastern Africa

    E-Print Network [OSTI]

    Montagner, Jean-Paul

    geochemistry beneath eastern Africa Jean-Paul Montagner,1 Bernard Marty,2 Ele´onore Stutzmann,1 De for North and East Africa using a high resolution three-dimensional anisotropic tomographic model derived from seismic data of a French experiment ``Horn of Africa'' and existing broadband data. The joint

  1. A thermotectonic framework for the growth and stabilization of the eastern Kaapvaal craton, southern Africa

    E-Print Network [OSTI]

    Schoene, Robert Blair

    2006-01-01

    Continents are an amalgamation of crust and mantle lithosphere assembled over -4 Gyr and are therefore our best record of the early Earth. Exposures of rocks -3.0-3.7 Ga cover -20,000 km2 of eastern S. Africa and Swaziland, ...

  2. Precambrian Research 136 (2005) 2750 The Wadi Mubarak belt, Eastern Desert of Egypt

    E-Print Network [OSTI]

    Fritz, Harald

    2005-01-01

    Precambrian Research 136 (2005) 27­50 The Wadi Mubarak belt, Eastern Desert of Egypt, Graz, Austria b Mansoura University, Faculty of Science, Geology Department, El Mansoura, Egypt c February 2003; accepted 3 September 2004 Abstract The Wadi Mubarak belt in Egypt strikes west­east (and

  3. Perceived challenges to public health in Central and Eastern Europe: a qualitative analysis

    E-Print Network [OSTI]

    Müller-Nordhorn, Jacqueline; Holmberg, Christine; Dokova, Klara G.; Milevska-Kostova, Neda; Chicin, Gratiana; Ulrichs, Timo; Rechel, Bernd; Willich, Stefan N.; Powles, John; Tinnemann, Peter

    2012-04-26

    Open Access ublic health in Central litative analysis G Dokova3, Neda Milevska-Kostova4, Gratiana Chicin5, s8 and Peter Tinnemann1 between Central and Eastern Europe compared to tors are amenable to public health interventions. Thed Central Ltd...

  4. Pacific Ocean Contribution to the Asymmetry in Eastern Indian Ocean Variability CAROLINE C. UMMENHOFER*

    E-Print Network [OSTI]

    Ummenhofer, Caroline C.

    Pacific Ocean Contribution to the Asymmetry in Eastern Indian Ocean Variability CAROLINE C is restricted to the Indian or Pacific Ocean only, support the interpretation of forcing mechanisms for large Indian Ocean atmospheric forcing versus remote influences from Pacific wind forcing: low events develop

  5. Recent transfer of coastal sediments to the Laurentian Channel, Lower St. Lawrence Estuary (Eastern Canada),

    E-Print Network [OSTI]

    St-Ong, Guillaume

    of the Lower St. Lawrence Estuary (Eastern Canada). The multibeam data were used to generate a high that they were produced by a combination of erosive turbidity flows and retrogressive failures. The two box cores. Introduction Submarine canyons are initiated by failures on depositional oversteepenings of continental slopes

  6. FRAMEWORK GEOLOGY OF FORT UNION COAL IN THE EASTERN ROCK SPRINGS UPLIFT,

    E-Print Network [OSTI]

    Chapter GF FRAMEWORK GEOLOGY OF FORT UNION COAL IN THE EASTERN ROCK SPRINGS UPLIFT, GREATER GREEN RIVER BASIN, WYOMING By R.M. Flores,1 A.M. Ochs,2 and L.R. Bader1 in U.S. Geological Survey Professional Paper 1625-A 1 U.S. Geological Survey 2 Consultant, U.S. Geological Survey, Denver, Colorado 1999

  7. Geochemical and petrological evidence for subduction^ accretion processes in the Archean Eastern Indian Craton

    E-Print Network [OSTI]

    Garzione, Carmala N.

    ; received in revised form 5 December 2003; accepted 7 January 2004 Abstract The composition of sandstones^late Archean sandstones from the Eastern Indian Craton show that the sedimentary rocks were derived from-normalized rare earth element (REE) patterns of the sandstones show a light REE-enriched signature with (La

  8. The onset of the Messinian salinity crisis in the Eastern Mediterranean (Pissouri Basin, Cyprus)

    E-Print Network [OSTI]

    Utrecht, Universiteit

    The onset of the Messinian salinity crisis in the Eastern Mediterranean (Pissouri Basin, Cyprus) W'Histoire Naturelle, 43 rue Bu¡on, Paris, France c Department of Earth Sciences, University of Cambridge, Downing¡on, 75005 Paris, France g Universite¨ Paris-Sud (Orsay), De¨partement des Sciences de la Terre, Paris

  9. Wave energy potential in the Eastern Mediterranean Levantine Basin. An integrated 10-year study

    E-Print Network [OSTI]

    Georgiou, Georgios

    Data bank Wave energy potential in the Eastern Mediterranean Levantine Basin. An integrated 10-year Article history: Received 30 July 2013 Accepted 25 March 2014 Available online Keywords: Wave energy Numerical atmospheric Wave modeling a b s t r a c t The main characteristics of wave energy potential over

  10. ORNL/TN--8524 DE83 005172

    E-Print Network [OSTI]

    Oak Ridge National Laboratory

    NOT Engineering Technology Division IWO-PHASE, TWO-COMPONENT STIRLING ENGINE WITH CONTROLLED EVAPORATION C. D angular frequency of operation #12;TWO-PHASE, TWO-COMPONENT STIRLING ENGINE WITH CONTROLLED EVAPORATION C. D. West ABSTRACT In a Stirling-like engine, the specific power can be greatly increased by the use

  11. lLLiadTN:896411 llllllllllllllllllllllllllllllllllllllll

    E-Print Network [OSTI]

    Apr 9, 2010 ... British Petroleum Company and would like to express their ... element solution to static and dynamic problems of geomechanics', PhD. lhtiis.

  12. TN Energy Efficient Schools Initiative GSHP Program

    Broader source: Energy.gov [DOE]

    Project objectives: Develop methods to make GSHPs more affordable for Tennessee school districts, by innovative design techniques, reducing the up-front cost of the technology, and by providing an innovative method of financing construction. Three school districts have been chosen as test beds for the innovations.

  13. 601 Rockwell Farm Lane, Farragut, TN 37934

    E-Print Network [OSTI]

    . ATune: Compiler-Driven Adaptive Execution - Created a tuning system, which adaptively optimizes MPI-time/runtime performance optimization on emerging hardware architectures including multi-cores and hardware accelerators Research Experience OpenARC: Open Accelerator Research Compiler - Develop an open-sourced, high

  14. AT-TN: Mr. R. L. Rudolph

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the WeldonB10081278MaywoodWayne Site83WOMPOC:07MAR 1 ?

  15. Microsoft Word - al93-4.doc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    93-4 Acquisition Regulation Date April 7, 1993 ACQUISITION LETTER AUTHORITY This Acquisition Letter (AL) is issued by the Director, Office of Procurement, Assistance and Program...

  16. IBM Probes Material Capabilities at the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    more energy-efficient electronic devices. Researchers from IBM's forward-thinking Spintronic Science and Applications Center (SpinAps) recently used the ALS to gain greater...

  17. Suppe, 1981; Ho, 1986 Tsai, 1986; Rau et al.,

    E-Print Network [OSTI]

    Lee, Jian-Cheng

    -63. Hsu, T. L., 1962, Recent faulting in the Longitudinal Valley of eastern Taiwan: Mem. Geol. Soc. China. 4, p. 533-570. Lee, J. C., 1994, Structure et deformation active d'un orogene: Taiwan. Mem. Sc

  18. Microsoft Word - AL2008-05.doc | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Microsoft Word - AL2008-05.doc Microsoft Word - AL2008-05.doc Microsoft Word - AL2008-05.doc More Documents & Publications Microsoft Word - AL 2010-07 Acquistion Letters Remaining...

  19. Dissecting the eastern margin of the Tibetan plateau : a study of landslides, erosion and river incision in a transient landscape

    E-Print Network [OSTI]

    Ouimet, William Burke

    2007-01-01

    The eastern margin of the Tibetan plateau is characterized by large rivers dissecting regional topography that has been uplifted in association with the continued convergence of the Indian subcontinent and Eurasia. In this ...

  20. The Role of Energy Availability in Mammalian Hibernation: An Experimental Test in Free-Ranging Eastern Chipmunks

    E-Print Network [OSTI]

    Kramer, Donald L.

    -Ranging Eastern Chipmunks Murray M. Humphries1,2, * Donald L. Kramer1 Donald W. Thomas2 1 Department of Biology temper- ature has permitted endotherms to occupy a wide range of thermal niches (Bennett 1991; Davenport

  1. Fertilization success and zygote survival in the Galveston Bay population of Crassostrea virginica (Gmelin), the eastern oyster 

    E-Print Network [OSTI]

    Armstrong, Stephanie Celeste

    1997-01-01

    these interactions, resulting in gametic incompatibility. From an ecological perspective, gametic incompatibility maintains the genetic structure of existing species. Previous studies have demonstrated that closely related individuals of the Eastern oyster...

  2. Analysis of reservoir performance and forecasting for the eastern area of the C-2 Reservoir, Lake Maracaibo, Venezuela 

    E-Print Network [OSTI]

    Urdaneta Anez, Jackeline C

    2001-01-01

    for the entire reservoir that considers the new geological model developed during reservoir description. Furthermore, it provides PDVSA with a powerful tool for planning and reservoir management decisions, especially in the eastern area of the reservoir...

  3. Air-sea interaction at contrasting sites in the Eastern Tropical Pacific : mesoscale variability and atmospheric convection at 10°N

    E-Print Network [OSTI]

    Farrar, J. Thomas (John Thomas), 1976-

    2007-01-01

    The role of ocean dynamics in driving air-sea interaction is examined at two contrasting sites on 125°W in the eastern tropical Pacific Ocean using data from the Pan American Climate Study (PACS) field program. Analysis ...

  4. Karyotypic variation in populations of deer mice (Peromyscus maniculatus) from the northeastern United States and eastern Canada 

    E-Print Network [OSTI]

    Myers Unice, Stephanie Marie

    1996-01-01

    Karyotypic analyses are provided for five previously uncharacterized subspecies of deer mice (Peromyscus maniculatus) from the northeastern United States and eastern Canada. Nondifferentially-stained, G-banded and C-banded ...

  5. Reservoir characterization of the upper Merecure and lower Oficina Formations sands in the Leona Este Field, Eastern Venezuela Basin 

    E-Print Network [OSTI]

    Flores Millan, Maria Carolina

    2001-01-01

    Field, which is located in the southern portion of the Eastern Venezuela Basin. Two or more of these reservoir sands, which are interbedded with shales, have been simultaneously produced pursuing an increase in the oil production rate, but an unexpected...

  6. Oxygen isotope and sapropel stratigraphy in the Eastern Mediterranean during the last 3.2 million years 

    E-Print Network [OSTI]

    Kroon, Dick; Alexander, I; Little, M; Lourens, L J; Matthewson, A; Robertson, Alastair H F; Sakamoto, T

    1998-01-01

    Stable oxygen isotope data from four holes drilled at the Ocean Drilling Program Site 967, which is located on the lower northern slope of the Eratosthenes Seamount, provide a continuous record of Eastern Mediterranean ...

  7. Eastern Europe Research Reactor Initiative nuclear education and training courses - Current activities and future challenges

    SciTech Connect (OSTI)

    Snoj, L.; Sklenka, L.; Rataj, J.; Boeck, H.

    2012-07-01

    The Eastern Europe Research Reactor Initiative was established in January 2008 to enhance cooperation between the Research Reactors in Eastern Europe. It covers three areas of research reactor utilisation: irradiation of materials and fuel, radioisotope production, neutron beam experiments, education and training. In the field of education and training an EERRI training course was developed. The training programme has been elaborated with the purpose to assist IAEA Member States, which consider building a research reactor (RR) as a first step to develop nuclear competence and infrastructure in the Country. The major strength of the reactor is utilisation of three different research reactors and a lot of practical exercises. Due to high level of adaptability, the course can be tailored to specific needs of institutions with limited or no access to research reactors. (authors)

  8. Sequence Stratigraphy and Detrital Zircon Provenance of the Eureka Quartzite in South-Central Nevada and Eastern California 

    E-Print Network [OSTI]

    Workman, Benjamin David

    2012-07-16

    STRATIGRAPHY AND DETRITAL ZIRCON PROVENANCE OF THE EUREKA QUARTZITE IN SOUTH-CENTRAL NEVADA AND EASTERN CALIFORNIA A Thesis by BENJAMIN DAVID WORKMAN Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2012 Major Subject: Geology Sequence Stratigraphy and Detrital Zircon Provenance of the Eureka Quartzite in South- Central Nevada and Eastern California...

  9. Evolution of the Llanos Basin and the deformation of the Eastern Cordiller, Columbia

    SciTech Connect (OSTI)

    Addison, F.; Cooper, M.; Hayward, A.; Howe, S. O'Leary, J. (BP Exploration Co. Ltd., Santafe de Bogota (Colombia))

    1993-02-01

    The Llanos Basin is located on the flank of the Eastern Cordillera in northeast Colombia. Basin development commenced with the deposition of a synrift Triassic and Jurassic megasequence related to the separation of North and South America in the Caribbean. Basin development continued with the Cretaceous Back Arc Megasequence deposited in a back arc basin behind the Andean subduction zone. Three major sequences can be recognized corresponding to extensional pulses in the Tithonian, Albian, and the Santonian which control thickness and facies distributions. The primary reservoir in the basin is the Late Eocene Mirandor Formation which was deposited in a fluvial system which prograded from the Guyana Shield to the west-northwest. This was deposited as part of the Pre-Andean Foreland Basin Megasequence (Bartonian to Serravallian) which developed as a result of uplift onset and deformation in the Central Cordillera. This megasequence covered the Magdalena Valley the Eastern Cordillera ad the Llanos Basin. In the foothills of the Eastern Cordillera, the Mirador Formation begins to show evidence of marine influence and was probably deposited in a series of shoreface sands and offshore bar complexes in the Cordillera. The Pre-Andean Foreland Basin Megasequence includes the Eocene-Oligocene Carbonera Formation which was deposited in a low every fluvial system that was mud dominated. Within the Carbonera Formation, a series of major, grossly coarsening upward cycles can be seen which are separated by maximum flooding surfaces that approximate to time lines. These cycles correspond to the early phases of development of the Central Cordillera with each pulse being seen as an influx of coarser clastics to the basin. The deformation style in the Eastern Cordillera is a mixture of thin-skinned thrust structures and the inversion of the thick-skinned basement involved extension faults. The inversion structures include the Cuisana field, a giant oil and gas-condensate discovery.

  10. Post-Zhabdrung Era Migration of Kurmedkha Speaking People in Eastern Bhutan

    E-Print Network [OSTI]

    Gyeltshen, Tshering

    2006-01-01

    close attention to details of certain key words with same accents, phonetics, orthography, and structures in dialects spoken in the places of origin and where people had migrated. The study is primarily based two main assumptions: (a) dialects... not occurred in other parts of Eastern Bhutan. In pre-modern Bhutan, from the time of the first Zhabdrung until 1960, threpas were regarded as pillars of the country’s agrarian economy.22 Since complaints of heavy taxes that forced families to migrate...

  11. Effects of electricity rates and rate structures on pump irrigation: an eastern Colorado case study

    SciTech Connect (OSTI)

    Gardner, R.L.; Young, R.A.

    1984-11-01

    This article analyzes the effects of electricity rate policy on electricity demand (and the derived effect on irrigation water use) via a case study in eastern Colorado. Empirical demand curves for electricity for pump irrigation are estimated. Alternative rate structures are tested for their effect on electricity and water use patterns, farm income, and utility revenue. Particular attention is given to the problem of modeling a declining block structure. 11 references, 1 figure, 3 tables.

  12. A study of mid-latitude tropopause characteristics over eastern North America 

    E-Print Network [OSTI]

    Houston, Ben Howard

    1962-01-01

    ). This objective definition is described in considerable detail in Chapter TT of this thesis. The meteorological significance of such secondary tropopauses has not been determined. CHAPT SR II ANALYSIS PROCSDURE Source of Data Data from eight upper...A STUDY OF MID IATITUDE TROPOPAUSE CHARACTERISTICS OVER EASTERN NORTH AMERICA A Thesis By BEN HOHARD HOUSTON Captain, USAF Submitted to the Graduate School of the Agricultural and Mechanical College of Texas in partial fulfillment...

  13. Geothermal Energy and the Eastern US: Fifth technical information interchange meeting, Minutes

    SciTech Connect (OSTI)

    1980-12-01

    The technical interchange meeting documented here is the fifth meeting where people interested in geothermal energy in the Eastern US have met to interchange technical information. These meetings are intended to assist all in the difficult task of balancing time and effort in doing their assigned jobs and keeping track of what others are doing in similar or related tasks. All of the aforementioned meetings have served their intended purpose and further regional and national meetings are sure to follow.

  14. Messinian sea level fall in the Dacic Basin (Eastern Paratethys): palaeogeographical implications from seismic sequence

    E-Print Network [OSTI]

    Utrecht, Universiteit

    from seismic sequence stratigraphy Karen A. Leever,1,3 Liviu Matenco,1,3 Traian Rabagia,1,3 Sierd et al., 2005; Gillet et al., 2007). In this paper, we use seismic sequence stratigraphy supported

  15. Century Projections of Snowfall and Winter Severity1 Across Central-Eastern North America2

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    and Upper Midwest and Great Lakes LCC, daily snowfall62 events are projected to become less common),78 favor drought development (Mishra et al. 2010; Mahanama et al. 2011), and increase fire risk79

  16. Summary Slides of ALS Industry Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Print No. Slide Beamline Full Web Highlight ALSNews Volume 17 Takeda Advances Diabetes Research at ALS 5.0.2, 5.0.3 06.02.2015 Vol. 364 16 Metrology for Next-Generation...

  17. United States Patent [191 Kaplan et al.

    E-Print Network [OSTI]

    Kaplan, Alexander

    United States Patent [191 Kaplan et al. [54] NONLINEAR OPTICAL DEVICE USING SELF-TRAPPING OF LIGHT Inventors: Alexander E. Kaplan, Cambridge, Mass; John E. Bjorkholm, Holmdel, N.J.; Peter W. Smith, Colts

  18. Introduzione alle Proteine e al Protein Folding

    E-Print Network [OSTI]

    Giannozzi, Paolo

    Chapter 4 Introduzione alle Proteine e al Protein Folding 4.1 Proteine: propriet`a strutturali Le protein folding `e il cosiddetto modello HP, nel quale a ogni amino acido `e assegnata l'etichetta di

  19. Building Reconstruction from ALS: Integrating Shape knowledge

    E-Print Network [OSTI]

    Building Reconstruction from ALS: Integrating Shape knowledge and Manual Operation Biao Xiong George Vosselman #12;Introduction Primitive Buildings Constraint Least Square Fit Manual Operation Future work 2 #12;Introduction Primitive Buildings Building Knowledge Constraint Least Square Fit Manual

  20. Der Gebudebereich als Motor fr die Energiewende

    E-Print Network [OSTI]

    Verbrauch! #12;#12;Gebäude als Energiespeicher 1,09 TWh/K 1.090.000.000 kWh/K #12;Gebäude der Zukunft Energieerzeuger + Energiespeicher #12;Wärmebrücken ­ Thermografie #12;#12;,,Die Szenarien belegen, die

  1. Western Baldwin County, AL Grid Interconnection Project

    SciTech Connect (OSTI)

    Thomas DeBell

    2011-09-30

    The Objective of this Project was to provide an additional supply of electricity to the affected portions of Baldwin County, AL through the purchase, installation, and operation of certain substation equipment.

  2. 17th Annual ALS Users' Association Meeting

    SciTech Connect (OSTI)

    Robinson, Art; Tamura, Lori

    2004-11-29

    It's not exactly Russian roulette, but scheduling October events outdoors is not risk-free, even in usually sunny California. An overflow crowd of more than 400 registered users, ALS staff, and vendors enjoyed a full indoor program featuring science highlights and workshops spread over two and a half days from October 18 to October 20. However, a major storm, heralding the onset of the San Francisco Bay Area rainy season, posed a few weather challenges for the events on the ALS patio.

  3. Biogenic emission measurement and inventories determination of biogenic emissions in the eastern United States and Texas and comparison with biogenic emission inventories

    E-Print Network [OSTI]

    2010-01-01

    of bio- genic isoprene emission estimates for the state ofFull Article Biogenic emission measurement and inventoriesdetermination of biogenic emissions in the eastern United

  4. Making the Market Right for Environmentally Sound Energy-Efficient Technologies: U.S. Buildings Sector Successes that Might Work in Developing Countries and Eastern Europe

    E-Print Network [OSTI]

    Gadgil, A.J.

    2008-01-01

    developing and Eastern European countries, retail electricity60 developing countries found that electricity subsidiesReview of Electricity Tariffs in Developing Countries During

  5. Characterization of Ultrathin Films of -Al2O3 and the Chemistry of 1,3-Butadiene on NiAl(001) and -Al2O3

    E-Print Network [OSTI]

    Characterization of Ultrathin Films of -Al2O3 and the Chemistry of 1,3-Butadiene on NiAl(001 by warming above 210 K. Adsorption and reaction of 1,3-butadiene on NiAl(001), and thin films of -Al2O3, have (LID-FTMS), AES, and LEED. We find that at 170 K, the 1,3-butadiene is irreversibly -bonded to NiAl(001

  6. Lg excitation, attenuation, and source spectral scaling in central and eastern North America

    SciTech Connect (OSTI)

    Mitchell, B.J.; Xie, J.; Baqer, S.

    1997-10-01

    Seismic moments and corner frequencies were obtained for many earthquakes in the central and eastern United States, and for a few events in the western United States, using the Lg phase and a recently developed inversion algorithm. Additionally, Q values for the Lg phase along paths to individual stations were obtained simultaneously with the source parameters. Both corner frequencies and magnitudes were found to vary systematically with moment. For moments between 0.15 and 400 x 10{sup 15} N-m corner frequencies vary between about 4 and 0.2 Hz while body-wave magnitude varies between about 3.5 and 5.8. A map of Lg Q values displays a systematic decrease from east and west. Maximum and minimum values are 989 and 160, respectively. Lg coda Q values were obtained for the entire United States with excellent coverage in the eastern and western portions of the country and somewhat poorer coverage in the central portion. Lg coda Q is highest (700-750) in a region of the northeastern United States that includes portions of New York and Pennsylvania and lowest (>200) in California. Lg coda Q is lower (250-450) everywhere west of Rocky Mountains than in the rest of the country (450-750). Q determinations for both the direct Lg phase and Lg coda indicate that, for an earthquake of a given magnitude, Lg and its coda will propagate much more efficiently, and cause damage over a wider area, in the eastern and central United States than it will in the United States.

  7. Moore Foundation Funds ALS Researchers for Promising New Technique...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Moore Foundation Funds ALS Researchers for Promising New Technique for Studying Materials Moore Foundation Funds ALS Researchers for Promising New Technique for Studying Materials...

  8. New ALS Technique Guides IBM in Next-Generation Semiconductor...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New ALS Technique Guides IBM in Next-Generation Semiconductor Development New ALS Technique Guides IBM in Next-Generation Semiconductor Development Print Wednesday, 21 January 2015...

  9. ALS Gives Chevron Scientists New Insights into Corrosion Resistance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Gives Chevron Scientists New Insights into Corrosion Resistance ALS Gives Chevron Scientists New Insights into Corrosion Resistance Print Thursday, 25 July 2013 13:44 In the...

  10. Eutychius of Alexandria Sa d b. al-Ba rq (or al-Bi rq, although

    E-Print Network [OSTI]

    Wintner, Shuly

    in Egypt renounced their allegiance to the patriarch. Ibn Ab U aybi a (d. 668/1270) lists in his a manuscript was found in Aleppo (GAS 3:297); Kitb al-jadal bayn al-mukhlif wa-l- Na rn, "A treatise

  11. Security-Aware Resource Allocation in Clouds Saeed Al-Haj, Ehab Al-Shaer

    E-Print Network [OSTI]

    Wang, Yongge

    Security-Aware Resource Allocation in Clouds Saeed Al-Haj, Ehab Al-Shaer Department of Software enforcement of defense-in-depth for cloud VMs by determining (1) the grouping of VMs into security groups in reducing risk and improving manageability of security configurations for the cloud VMs. I. INTRODUCTION

  12. Electronic circuits having NiAl and Ni.sub.3 Al substrates

    DOE Patents [OSTI]

    Deevi, Seetharama C. (Midlothian, VA); Sikka, Vinod K. (Oak Ridge, TN)

    1999-01-01

    An electronic circuit component having improved mechanical properties and thermal conductivity comprises NiAl and/or Ni.sub.3 Al, upon which an alumina layer is formed prior to applying the conductive elements. Additional layers of copper-aluminum alloy or copper further improve mechanical strength and thermal conductivity.

  13. Identification of Central-Pacific and Eastern-Pacific types of ENSO in CMIP3 Models

    E-Print Network [OSTI]

    Yu, Jin-Yi; Kim, Seon T.

    2010-01-01

    1102.0.CO;2. Rayner, N. A. , D. E. Parker, E.Tem- perature data (HadISST) [Rayner et al. , 2003] over the

  14. (12) United States Patent Baker et al.

    E-Print Network [OSTI]

    Baker, R. Jacob

    (12) United States Patent Baker et al. US007271635B2 US 7,271,635 B2 Sep. 18,2007 (10) Patent N0.: (45) Date of Patent: (54) METHOD AND APPARATUS FOR REDUCING DUTY CYCLE DISTORTION OF AN OUTPUT SIGNAL: Micron Technology, Boise, ID (US) ( * ) Notice: Subject to any disclaimer, the term of this patent

  15. The Rail Gun Muad Al Khaldi

    E-Print Network [OSTI]

    Masoudi, Husain M.

    The Rail Gun Muad Al Khaldi Department of Electrical Engineering King Fahd University of Petroleum and Minerals Abstract- The rail gun is one of promising ways of launching projectiles. Recently, many. In this project, I am going to investigate the construction of electromagnetic rail guns, the way the function

  16. Kirke et al. 1 Computer Music Journal

    E-Print Network [OSTI]

    Miranda, Eduardo Reck

    of a #12;Kirke et al. 2 Computer Music Journal floating buoy. Types of water wave pattern, varying in shape) with the sonification of ocean buoy spectral data. Initially this had a scientific motivation, and the idea of creating a musical performance came later (Sturm 2005). The buoy sonifications were located in an 8 channel field

  17. (12) United States Patent Grier et al.

    E-Print Network [OSTI]

    Grier, David

    (12) United States Patent Grier et al. US008791985B2 US 8,791,985 B2 Jul. 29, 2014 (10) Patent N0.: (45) Date of Patent: (54) (75) (73) (21) (22) (86) (87) (65) (60) (51) (52) TRACKING to any disclaimer, the term ofthis patent is extended or adjusted under 35 U.S.C. 154(b) by 744 days. 12

  18. (12) United States Patent Vertes et al.

    E-Print Network [OSTI]

    Vertes, Akos

    (12) United States Patent Vertes et al. (54) THREE-DIMENSIONAL MOLECULAR IMAGING BY INFRARED LASER) ( *) Notice: Subject to any disclaimer, the term ofthis patent is extended or adjusted under 35 U.S.c. 154(b/282,287,288; 4361173 See application file for complete search history. (56) References Cited U.S. PATENT DOCUMENTS 6

  19. United States Patent [19] Payne et al.

    E-Print Network [OSTI]

    Shamos, Michael I.

    United States Patent [19] Payne et al. [54] NETWORK SALES SYSTEM [75] Inventors: Andrew C. Payne/10 2102606 2/1983 United Kingdom .............. G07F 7/10 IIIIII 1111~1111111~~111111~II Implementation"; An Internet Billing Server, pp. 1-19. no date. Payment Systems, "United States"; pp. 115

  20. Ternary Dy-Er-Al magnetic refrigerants

    DOE Patents [OSTI]

    Gschneidner, K.A. Jr.; Takeya, Hiroyuki

    1995-07-25

    A ternary magnetic refrigerant material comprising (Dy{sub 1{minus}x}Er{sub x})Al{sub 2} for a magnetic refrigerator using the Joule-Brayton thermodynamic cycle spanning a temperature range from about 60K to about 10K, which can be adjusted by changing the Dy to Er ratio of the refrigerant. 29 figs.

  1. Geologic Controls of Hydrocarbon Occurrence in the Southern Appalachian Basin in Eastern Tennessee, Southwestern Virginia, Eastern Kentucky, and Southern West Virginia

    SciTech Connect (OSTI)

    Robert D. Hatcher

    2003-05-31

    This report summarizes the first-year accomplishments of a three-year program to investigate the geologic controls of hydrocarbon occurrence in the southern Appalachian basin in eastern Tennessee, southwestern Virginia, eastern Kentucky, and southern West Virginia. The project: (1) employs the petroleum system approach to understand the geologic controls of hydrocarbons; (2) attempts to characterize the T-P parameters driving petroleum evolution; (3) attempts to obtain more quantitative definitions of reservoir architecture and identify new traps; (4) is working with USGS and industry partners to develop new play concepts and geophysical log standards for subsurface correlation; and (5) is geochemically characterizing the hydrocarbons (cooperatively with USGS). First-year results include: (1) meeting specific milestones (determination of thrust movement vectors, fracture analysis, and communicating results at professional meetings and through publication). All milestones were met. Movement vectors for Valley and Ridge thrusts were confirmed to be west-directed and derived from pushing by the Blue Ridge thrust sheet, and fan about the Tennessee salient. Fracture systems developed during Paleozoic, Mesozoic, and Cenozoic to Holocene compressional and extensional tectonic events, and are more intense near faults. Presentations of first-year results were made at the Tennessee Oil and Gas Association meeting (invited) in June, 2003, at a workshop in August 2003 on geophysical logs in Ordovician rocks, and at the Eastern Section AAPG meeting in September 2003. Papers on thrust tectonics and a major prospect discovered during the first year are in press in an AAPG Memoir and published in the July 28, 2003, issue of the Oil and Gas Journal. (2) collaboration with industry and USGS partners. Several Middle Ordovician black shale samples were sent to USGS for organic carbon analysis. Mississippian and Middle Ordovician rock samples were collected by John Repetski (USGS) and RDH for conodont alteration index determination to better define regional P-T conditions. Efforts are being made to calibrate and standardize geophysical log correlation, seismic reflection data, and Ordovician lithologic signatures to better resolve subsurface stratigraphy and structure beneath the poorly explored Plateau in Tennessee and southern Kentucky. We held a successful workshop on Ordovician rocks geophysical log correlation August 7, 2003 that was cosponsored by the Appalachian PTTC, the Kentucky and Tennessee geological surveys, the Tennessee Oil and Gas Association, and small independents. Detailed field structural and stratigraphic mapping of a transect across part of the Ordovician clastic wedge in Tennessee was begun in January 2003 to assist in 3-D reconstruction of part of the southern Appalachian basin and better assess the nature of a major potential source rock assemblage. (3) Laying the groundwork through (1) and (2) to understand reservoir architecture, the petroleum systems, ancient fluid migration, and conduct 3-D analysis of the southern Appalachian basin.

  2. Correlation between water-vapor transport from the Gulf of Mexico and precipitation in the eastern United States 

    E-Print Network [OSTI]

    Wright, John Vinson

    1973-01-01

    CORRELATION BETWEEN WATER-V'POR TRANSPORT FROM THE GULF OF MEXICO AND PR CIPITATION IN THE EASTERN UNITED STATES A Thesis John Vinson Wright, Jr. Subiaitted to the Gw. . duate College ot Texas A&M University in parti ' fulfillment... of the reourres, ent for the degre oi MASTER OF SCIENCE May 197B Ma]or Sub]ect: Meteorology CORRELATION BETWEEN WATER-VAPOR TRANSPORT FROM THE GULF OF MEXICO AND PRECIPITATION IN THE EASTERN UNITED STATFS A Thesis by John Vinson Wright, Jr. Approved ac...

  3. JOURNAL OF GEOPHYSICAL RESEARCH: SOLID EARTH, VOL. 118, 119, doi:10.1002/jgrb.50117, 2013 The 2011 Mw 7.1 Van (Eastern Turkey) earthquake

    E-Print Network [OSTI]

    Elliott, John

    Mw 7.1 Van (Eastern Turkey) earthquake J. R. Elliott,1 A. C. Copley,2 R. Holley,3 K. Scharer,4 and B to constrain the fault parameters of the Mw 7.1 2011 Van (Eastern Turkey) reverse-slip earthquake Turkey) earthquake, J. Geophys. Res. Solid Earth, 118, doi:10.1002/jgrb.50117. 1. Introduction [2

  4. Petrophysical properties of the root zone of sheeted dikes in the ocean crust: A case study from Hole ODP/IODP 1256D, Eastern Equatorial Pacific

    E-Print Network [OSTI]

    Demouchy, Sylvie

    Program) Site 1256 is located on the Cocos Plate in the Eastern Equatorial Pacific Ocean, in a 15 Ma oldPetrophysical properties of the root zone of sheeted dikes in the ocean crust: A case study from Hole ODP/IODP 1256D, Eastern Equatorial Pacific Marie Violay , Philippe A. Pezard, Benoît Ildefonse

  5. Influence of Ohio River valley emissions on fine particle sulfate measured from aircraft over large regions of the eastern United States

    E-Print Network [OSTI]

    Weber, Rodney

    valley emissions on fine particle sulfate measured from aircraft over large regions of the eastern UnitedInfluence of Ohio River valley emissions on fine particle sulfate measured from aircraft over large regions of the eastern United States and Canada during INTEX-NA Christopher J. Hennigan,1 Scott Sandholm,2

  6. Banded Iron Formations from the Eastern Desert of Egypt: A new type of Ore? KHALIL, Khalil Isaac1 and EL-SHAZLY, Aley K.2

    E-Print Network [OSTI]

    El-Shazly, Aley

    Banded Iron Formations from the Eastern Desert of Egypt: A new type of Ore? KHALIL, Khalil Isaac1 and EL-SHAZLY, Aley K.2 1 Department of Geology, University of Alexandria, Egypt 2 Geology Department localities in an area approximately 30,000 km2 within the eastern desert of Egypt. With the exception

  7. Application of Wavelet and Regression Analysis in Assessing Temporal and Geographic Climate Variability: Eastern Ontario,

    E-Print Network [OSTI]

    Patterson, Timothy

    to gradual increased winter heating in Ottawa (heat island effects) associated with population growth. We urban heat island effect as North American urban centres have grown in size (Karl et al., 1988), or natural processes such as changes in solar radiation (e.g., Carslaw et al., 2002). Urban heat islands

  8. UN TRAIT POLITIQUE DU IIE L'PTRE DE UBAYD ALLH B. AL-ASAN AL-ANBAR

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Ubayd Allh b. al-asan al-Anbar (m. 168/785) à lintention du calife abbside al-Mahd (158/775-169/785). À la littérature de « miroirs des princes », voir notamment C.E. Bosworth, « Naat al-mulk », EI, VII, p

  9. Al2O3 ADHERENCE ON CoCrAl ALLOYS

    E-Print Network [OSTI]

    Kingsley, L.M.

    2010-01-01

    oxidation, 1200°C *S00 22b. Oxide layers Aluminized 63 hrs,neath the thin initial oxide layer. ' The lowered Al contentalready estab- lished oxide layer; compositional changes of

  10. The evolution of Al-Azhar Street, Al-Qahira, Egypt

    E-Print Network [OSTI]

    Elkatsha, Markus Fawzy Fahmy

    2000-01-01

    The historic quarter of Cairo, al-Qahira, is going through a period intense transformation that is threatening the physical environment as well as the social and economic fabric of the city. The transformations taking place ...

  11. (12) United States Patent Miller et al.

    E-Print Network [OSTI]

    Asanoviæ, Krste

    (12) United States Patent Miller et al. US007925839B1 US 7,925,839 B1 Apr. 12, 2011 (10) Patent N0.: (45) Date of Patent: (54) (75) (73) (*) (21) (22) (63) (60) (51) (52) (58) SYSTEM AND METHOD disclaimer, the term ofthis patent is extended or adjusted under 35 U.S.C. 154(b) by 117 days. Appl. No.: 12

  12. Herman et al. 1 SUPPLEMENTAL EXPERIMENTAL PROCEDURES

    E-Print Network [OSTI]

    Rudner, David

    into the non-essential ycgO locus (K. Marquis and D.Z.R., unpublished). pJW110 [yhdG::RBMwt (ermI and HindIII. pBB279 [yhdG::erm] is an ectopic integration vector made for double crossover insertions into the nonessential yhdG locus (B. Burton and D.Z.R., unpublished). #12;Herman et al. 2 pJW111 [yhdG::RBMmut (erm

  13. United States Patent [19] Carlson et al.

    E-Print Network [OSTI]

    Adelson, Edward

    United States Patent [19] Carlson et al. [11] Patent Number: 4,523,230 [45] Date of Patent: Jun. 11 ............. 358/160, 163; 166; 167, 358/905, 21 R, 36; 382/49, 54 [56] References Cited U.S. PATENT DOCUMENTS 4 signals. 24 Claims, 8 Drawing Figures #12;U.S. Patent Jun. 11, 1985 Sheet 1 of 4 4,523,230 #12;U.S. Patent

  14. United States Patent [19] Burt et al.

    E-Print Network [OSTI]

    Adelson, Edward

    United States Patent [19] Burt et al. [11] Patent Number: 4 , 6 98, 84 3 [45] Date of Patent: Oct, 43, 49, 50, 54, 55 [56] References Cited U.S. PATENT DOCUMENTS 3,737,855 6/1973 Cutaia.S. Patent Oct. 6, 1987 Sheet 1 of 3 4,698,843 #12;U.S. Patent Oct. 6, 1987 Sheet 2 of 3 4,698,843 #12;U

  15. INTRODUCCION AL LENGUAJE PROLOG 1. Introduccion 2

    E-Print Network [OSTI]

    Camacho, David

    . Prolog y el paradigma de la Programaci´on L´ogica 6 3.1. Sintaxis´on En este documento se realiza una breve introducci´on al lenguaje de programaci´on Prolog, con el objetivo fundamental de mostrar c´omo se da el paso desde el concepto de programaci´on l´ogica "pura

  16. An ALS (Advanced Light Source) handbook

    SciTech Connect (OSTI)

    Not Available

    1988-11-01

    This booklet aims to provide the prospective user of the Advanced Light Source with a concise description of the radiation a researcher might expect at his or her experimental station. The focus is therefore on the characteristics of the light that emerges from insertion devices and bending magnets and on how components of the beam lines further alter the properties of the radiation. The specifications and operating parameters of the ALS injection system and storage ring are of only peripheral interest. To this end, Sections 3 and 5 and most of Section 4 are devoted to summary presentations, by means of performance plots and tabular compilations, of radiation characteristics at the ALS--spectral brightness, flux, coherent power, resolution, time structure, etc.--assuming a representative set of four undulators and one wiggler and a corresponding set of five beam lines. As a complement to these performance summaries, Section 1 is a general introductory discussion of synchrotron radiation and the ALS, and Section 2 provides a compendious introduction to the characteristics of synchrotron radiation from bending magnets, wigglers, and undulators. In addition, Section 4 briefly introduces the theory of diffraction grating and crystal monochromators. 15 refs., 28 figs., 5 tabs.

  17. Projected impacts of climate change on species distribution in the Acadian Forest region of eastern Nova Scotia

    E-Print Network [OSTI]

    .e., hydrological cycle and earth- sun geometry. Growing degree days and mean air temperature are basedProjected impacts of climate change on species distribution in the Acadian Forest region of eastern on processing remote sensing data, mean air temperatures serves as one of several inputs to model calculation

  18. OligoceneMiocene basin evolution in SE Anatolia, Turkey: constraints on the closure of the eastern Tethys gateway

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Oligocene­Miocene basin evolution in SE Anatolia, Turkey: constraints on the closure of the eastern, The Netherlands 3 Department of Geology, Firat University, Elazig, Turkey 4 Natural History Museum Vienna, Austria, we focus on the evolution of Oligocene and Miocene foreland basins in the southernmost part of Turkey

  19. Deep-Sea Research I 51 (2004) 12451274 Carbon fluxes through food webs of the eastern equatorial

    E-Print Network [OSTI]

    Jackson, George

    2004-01-01

    Deep-Sea Research I 51 (2004) 1245­1274 Carbon fluxes through food webs of the eastern equatorial inverse and network analyses to examine food web interactions at 0 , 140 W during EqPac time approach allowed us to trace the pathway of fixed carbon through a representative food web

  20. Dynamics of large wood in an eastern U.S. mountain stream Dana R. Warren *, Clifford E. Kraft

    E-Print Network [OSTI]

    Kraft, Clifford E.

    Dynamics of large wood in an eastern U.S. mountain stream Dana R. Warren *, Clifford E. Kraft recent studies have documented the importance of large woody debris (large wood) in streams of northeastern North America. Large wood retains sediment and organic matter (Thompson, 1995), promotes habitat

  1. Climatic forcing of eastern Mediterranean deep-water formation and benthic ecosystems during the past 22 000 years

    E-Print Network [OSTI]

    Gilli, Adrian

    Climatic forcing of eastern Mediterranean deep-water formation and benthic ecosystems during) suggest a high spatiotemporal variability of deep-water oxygenation and biogeochemical processes maximum, cool surface waters and high evaporation resulted in maximum convection and oxic deep-waters

  2. The Kelso dune field is located in the eastern Mojave Desert, California, at the terminus of a

    E-Print Network [OSTI]

    Ramsey, Michael

    ABSTRACT The Kelso dune field is located in the eastern Mojave Desert, California, at the terminus significant spectral variations that indicate potential mineralogic heterogeneities within the active dunes-member minerals that showed marked variations within the dunes. In addition, standard petrographic techniques re

  3. Hindcast of oil-spill pollution during the Lebanon crisis in the Eastern Mediterranean, JulyAugust 2006

    E-Print Network [OSTI]

    Georgiou, Georgios

    Hindcast of oil-spill pollution during the Lebanon crisis in the Eastern Mediterranean, July, Athens, Greece a r t i c l e i n f o Keywords: Lebanese oil-pollution event Oil-spill modeling Oceanography Network http://www.moon-oceanforecasting.eu) pro- vides near-real-time information on oil

  4. Ecosystem dynamics and export production in the central and eastern equatorial Pacific: A modeling study of impact of ENSO

    E-Print Network [OSTI]

    Wang, Wendy

    Ecosystem dynamics and export production in the central and eastern equatorial Pacific: A modeling biomass and low export production. Zooplankton and large phytoplankton are more depressed than small enhance export production by a factor of eight in the Nin~o3 area. Large phytoplankton are largely

  5. The Oyster Industry of Eastern Mexico CLYDE L. MacKENZIE, Jr. and ARMANDO T. WAKIDA-KUSUNOKI

    E-Print Network [OSTI]

    The Oyster Industry of Eastern Mexico CLYDE L. MacKENZIE, Jr. and ARMANDO T. WAKIDA-KUSUNOKI Introduction Mexico has an oyster industry of sub stantial size, ranking about sixth in the world. In 1993 of Mexico, while the Philippines, Aus tralia, Canada, and New Zealand trailed it (Fig. 1). On its east coast

  6. OE Issues Notice of Intent to Prepare an Environmental Impact Statement for the Plains & Eastern Clean Line Transmission Project

    Broader source: Energy.gov [DOE]

    On December 21, 2012, DOE’s Office of Electricity Delivery and Energy Reliability (OE) issued a Notice of Intent (NOI) to Prepare an Environmental Impact Statement (EIS) for the Plains & Eastern Clean Line Transmission Project on behalf of the Department and Southwestern Power Administration

  7. SOLAS Mid Term Strategy Initiative "Air-sea gas fluxes at Eastern boundary upwelling and Oxygen Minimum Zone (OMZ) systems"

    E-Print Network [OSTI]

    1 SOLAS Mid Term Strategy Initiative "Air-sea gas fluxes at Eastern boundary upwelling and Oxygen Lachkar, ETH Zurich, Suisse Parv Suntharalingam, UEA, UK Martin Hernandez Ayon, UABC, Mexico +of course of SOLAS and to the Workshop Véronique Garçon 09:50 Surface (energy and water) fluxes at the air

  8. Observations and transport theory analysis of low frequency, acoustic mode propagation in the Eastern North Pacific Ocean

    E-Print Network [OSTI]

    Frandsen, Jannette B.

    in the Eastern North Pacific Ocean Tarun K. Chandrayadulaa) and John A. Colosi Naval Postgraduate School order mode statistics as a function of range and source depth are presented from the Long Range Ocean of ocean acoustics research for decades. Fluctuation statistics are crucial to achieve more coherent sig

  9. Sequence Stratigraphy of the Dakota Sandstone, Eastern San Juan Basin, New Mexico, and its Relationship to Reservoir Compartmentalization

    SciTech Connect (OSTI)

    Varney, Peter J.

    2002-04-23

    This research established the Dakota-outcrop sequence stratigraphy in part of the eastern San Juan Basin, New Mexico, and relates reservoir quality lithologies in depositional sequences to structure and reservoir compartmentalization in the South Lindrith Field area. The result was a predictive tool that will help guide further exploration and development.

  10. Prokaryotic respiration and production in the meso-and bathypelagic realm of the eastern and western North Atlantic basin

    E-Print Network [OSTI]

    Reinthaler, Thomas

    and western North Atlantic basin Thomas Reinthaler1 Department of Biological Oceanography, Royal Netherlands'Oce´anologie Biologique de Banyuls, Universite´ Paris VI. CNRS UMR 7621, BP44, F-66651 Banyuls-sur-Mer, France Gerhard J abundance decreased exponentially with depth from 3 to 0.4 3 105 cells mL21 in the eastern basin and from 3

  11. Magnetic lineations constraints for the back-arc opening of the Late Neogene South Banda Basin (eastern Indonesia)

    E-Print Network [OSTI]

    Dyment, Jérôme

    Magnetic lineations constraints for the back-arc opening of the Late Neogene South Banda Basin Laboratoire de PeÃ?trologie, Tour 26-16, BoIÃ?te 110, UniversiteÃ? Paris VI, 4 place Jussieu, 75252 Paris Cedex The South Banda Basin is located within eastern Indonesia near the triple junction between the Eurasian

  12. Study of Reservoir Heterogencities and Structural Features Affecting Production in the Shallow Oil Zone, Eastern Elk Hills Area, California

    SciTech Connect (OSTI)

    Janice Gillespie

    2004-11-01

    Late Neogene (Plio-Pleistocene) shallow marine strata of the western Bakersfield Arch and Elk Hills produce hydrocarbons from several different reservoirs. This project focuses on the shallow marine deposits of the Gusher and Calitroleum reservoirs in the Lower Shallow Oil Zone (LSOZ). In the eastern part of the study area on the Bakersfield Arch at North and South Coles Levee field and in two wells in easternmost Elk Hills, the LSOZ reservoirs produce dry (predominantly methane) gas. In structurally higher locations in western Elk Hills, the LSOZ produces oil and associated gas. Gas analyses show that gas from the eastern LSOZ is bacterial and formed in place in the reservoirs, whereas gas associated with oil in the western part of the study area is thermogenic and migrated into the sands from deeper in the basin. Regional mapping shows that the gas-bearing LSOZ sands in the Coles Levee and easternmost Elk Hills area are sourced from the Sierra Nevada to the east whereas the oil-bearing sands in western Elk Hills appear to be sourced from the west. The eastern Elk Hills area occupied the basin depocenter, farthest from either source area. As a result, it collected mainly low-permeability offshore shale deposits. This sand-poor depocenter provides an effective barrier to the updip migration of gases from east to west. The role of small, listric normal faults as migration barriers is more ambiguous. Because our gas analyses show that the gas in the eastern LSOZ reservoirs is bacterial, it likely formed in-place near the reservoirs and did not have to migrate far. Therefore, the gas could have been generated after faulting and accumulated within the fault blocks as localized pools. However, bacterial gas is present in both the eastern AND western parts of Elk Hills in the Dry Gas Zone (DGZ) near the top of the stratigraphic section even though the measured fault displacement is greatest in this zone. Bacterial gas is not present in the west in the deeper LSOZ which has less measured fault displacement. The main difference between the DGZ and the LSOZ appears to be the presence of a sandpoor area in the LSOZ in eastern Elk Hills. The lack of permeable migration pathways in this area would not allow eastern bacterial gas to migrate farther updip into western Elk Hills. A similar sand-poor area does not appear to exist in the DGZ but future research may be necessary to verify this.

  13. Extension of the Yellowstone plateau, eastern Snake River Plain, and Owyhee plateau

    SciTech Connect (OSTI)

    Rodgers, D.W.; Hackett, W.R.; Ore, H.T. (Idaho State Univ., Pocatello (USA))

    1990-11-01

    Formation of the late Cenozoic volcanic province comprising the Owyhee plateau, eastern Snake River Plain, and Yellowstone plateau has been accompanied by east-northeast-directed crustal extension. A new vector of 45 mm/yr, N56{degree}E for the migration of silicic volcanism across the volcanic province is calculated. If migration of volcanism reflects west-southwest continental drift over a mantle plume, a zone of crustal extension must separate the volcanic province from the more slowly moving North American craton. Space-time relations of basin fill in the adjacent Basin and Range province provide evidence for a zone of extension, about 125 km wide, coincident with and east of coeval silicic volcanism. Since 16 Ma, the zone of extension has migrated along with silicic volcanism, maintaining its position between the province and the unextended craton.

  14. Updated Eastern Interconnect Wind Power Output and Forecasts for ERGIS: July 2012

    SciTech Connect (OSTI)

    Pennock, K.

    2012-10-01

    AWS Truepower, LLC (AWST) was retained by the National Renewable Energy Laboratory (NREL) to update wind resource, plant output, and wind power forecasts originally produced by the Eastern Wind Integration and Transmission Study (EWITS). The new data set was to incorporate AWST's updated 200-m wind speed map, additional tall towers that were not included in the original study, and new turbine power curves. Additionally, a primary objective of this new study was to employ new data synthesis techniques developed for the PJM Renewable Integration Study (PRIS) to eliminate diurnal discontinuities resulting from the assimilation of observations into mesoscale model runs. The updated data set covers the same geographic area, 10-minute time resolution, and 2004?2006 study period for the same onshore and offshore (Great Lakes and Atlantic coast) sites as the original EWITS data set.

  15. Examination of eastern oil shale disposal problems - the Hope Creek field study

    SciTech Connect (OSTI)

    Koppenaal, D.W.; Kruspe, R.R.; Robl, T.L.; Cisler, K.; Allen, D.L.

    1985-02-01

    A field-based study of problems associated with the disposal of processed Eastern oil shale was initiated in mid-1983 at a private research site in Montgomery County, Kentucky. The study (known as the Hope Creek Spent Oil Shale Disposal Project) is designed to provide information on the geotechnical, revegetation/reclamation, and leachate generation and composition characteristics of processed Kentucky oil shales. The study utilizes processed oil shale materials (retorted oil shale and reject raw oil shale fines) obtained from a pilot plant run of Kentucky oil shale using the travelling grate retort technology. Approximately 1000 tons of processed oil shale were returned to Kentucky for the purpose of the study. The study, composed of three components, is described. The effort to date has concentrated on site preparation and the construction and implementation of the field study research facilities. These endeavors are described and the project direction in the future years is defined.

  16. Tribal Wind Assessment by the Eastern Shoshone Tribe of the Wind River Reservation

    SciTech Connect (OSTI)

    Pete, Belvin; Perry, Jeremy W.; Stump, Raphaella Q.

    2009-08-28

    The Tribes, through its consultant and advisor, Distributed Generation Systems (Disgen) -Native American Program and Resources Division, of Lakewood CO, assessed and qualified, from a resource and economic perspective, a wind energy generation facility on tribal lands. The goal of this feasibility project is to provide wind monitoring and to engage in preproject planning activities designed to provide a preliminary evaluation of the technical, economic, social and environmental feasibility of developing a sustainable, integrated wind energy plan for the Eastern Shoshone and the Northern Arapahoe Tribes, who resides on the Wind River Indian Reservation. The specific deliverables of the feasibility study are: 1) Assessments of the wind resources on the Wind River Indian Reservation 2) Assessments of the potential environmental impacts of renewable development 3) Assessments of the transmission capacity and capability of a renewable energy project 4) Established an economic models for tribal considerations 5) Define economic, cultural and societal impacts on the Tribe

  17. Al-Ca and Al-Fe metal-metal composite strength, conductivity, and microstructure relationships

    SciTech Connect (OSTI)

    Kim, Hyong June

    2011-12-01

    Deformation processed metal-metal composites (DMMC’s) are composites formed by mechanical working (i.e., rolling, swaging, or wire drawing) of two-phase, ductile metal mixtures. Since both the matrix and reinforcing phase are ductile metals, the composites can be heavily deformed to reduce the thickness and spacing of the two phases. Recent studies have shown that heavily drawn DMMCs can achieve anomalously high strength and outstanding combinations of strength and conductivity. In this study, Al-Fe wire composite with 0.07, 0.1, and 0.2 volume fractions of Fe filaments and Al-Ca wire composite with 0.03, 0.06, and 0.09 volume fractions of Ca filaments were produced in situ, and their mechanical properties were measured as a function of deformation true strain. The Al-Fe composites displayed limited deformation of the Fe phase even at high true strains, resulting in little strengthening effect in those composites. Al-9vol%Ca wire was deformed to a deformation true strain of 13.76. The resulting Ca second-phase filaments were deformed to thicknesses on the order of one micrometer. The ultimate tensile strength increased exponentially with increasing deformation true strain, reaching a value of 197 MPa at a true strain of 13.76. This value is 2.5 times higher than the value predicted by the rule of mixtures. A quantitative relationship between UTS and deformation true strain was determined. X-ray diffraction data on transformation of Al + Ca microstructures to Al + various Al-Ca intermetallic compounds were obtained at the Advanced Photon Source at Argonne National Laboratory. Electrical conductivity was measured over a range of true strains and post-deformation heat treatment schedules.

  18. An examination of scale-dependent resource use by Eastern Hognose snakes in southcentral New Hampshire.

    SciTech Connect (OSTI)

    LaGory, K. E.; Walston, L. J.; Goulet, C; Van Lonkhuyzen, R. A.; Najjar, S.; Andrews, C.; Environmental Science Division; Univ. of New Hampshire; U.S. Air Force

    2009-11-01

    The decline of many snake populations is attributable to habitat loss, and knowledge of habitat use is critical to their conservation. Resource characteristics (e.g., relative availability of different habitat types, soils, and slopes) within a landscape are scale-dependent and may not be equal across multiple spatial scales. Thus, it is important to identify the relevant spatial scales at which resource selection occurs. We conducted a radiotelemetry study of eastern hognose snake (Heterodon platirhinos) home range size and resource use at different hierarchical spatial scales. We present the results for 8 snakes radiotracked during a 2-year study at New Boston Air Force Station (NBAFS) in southern New Hampshire, USA, where the species is listed by the state as endangered. Mean home range size (minimum convex polygon) at NBAFS (51.7 {+-} 14.7 ha) was similar to that reported in other parts of the species range. Radiotracked snakes exhibited different patterns of resource use at different spatial scales. At the landscape scale (selection of locations within the landscape), snakes overutilized old-field and forest edge habitats and underutilized forested habitats and wetlands relative to availability. At this scale, snakes also overutilized areas containing sandy loam soils and areas with lower slope (mean slope = 5.2% at snake locations vs. 6.7% at random locations). We failed to detect some of these patterns of resource use at the home range scale (i.e., within the home range). Our ability to detect resource selection by the snakes only at the landscape scale is likely the result of greater heterogeneity in macrohabitat features at the broader landscape scale. From a management perspective, future studies of habitat selection for rare species should include measurement of available habitat at spatial scales larger than the home range. We suggest that the maintenance of open early successional habitats as a component of forested landscapes will be critical for the persistence of eastern hognose snake populations in the northeastern United States.

  19. Intergrated study of the Devonian-age black shales in eastern Ohio. Final report

    SciTech Connect (OSTI)

    Gray, J.D.; Struble, R.A.; Carlton, R.W.; Hodges, D.A.; Honeycutt, F.M.; Kingsbury, R.H.; Knapp, N.F.; Majchszak, F.L.; Stith, D.A.

    1982-09-01

    This integrated study of the Devonian-age shales in eastern Ohio by the Ohio Department of Natural Resources, Division of Geological Survey is part of the Eastern Gas Shales Project sponsored by the US Department of Energy. The six areas of research included in the study are: (1) detailed stratigraphic mapping, (2) detailed structure mapping, (3) mineralogic and petrographic characterization, (4) geochemical characterization, (5) fracture trace and lineament analysis, and (6) a gas-show monitoring program. The data generated by the study provide a basis for assessing the most promising stratigraphic horizons for occurrences of natural gas within the Devonian shale sequence and the most favorable geographic areas of the state for natural gas exploration and should be useful in the planning and design of production-stimulation techniques. Four major radioactive units in the Devonian shale sequence are believed to be important source rocks and reservoir beds for natural gas. In order of potential for development as an unconventional gas resource, they are (1) lower and upper radioactive facies of the Huron Shale Member of the Ohio Shale, (2) upper Olentangy Shale (Rhinestreet facies equivalent), (3) Cleveland Shale Member of the Ohio Shale, and (4) lower Olentangy Shale (Marcellus facies equivalent). These primary exploration targets are recommended on the basis of areal distribution, net thickness of radioactive shale, shows of natural gas, and drilling depth to the radioactive unit. Fracture trends indicate prospective areas for Devonian shale reservoirs. Good geological prospects in the Devonian shales should be located where the fracture trends coincide with thick sequences of organic-rich highly radioactive shale.

  20. Heat flow and seismicity patterns in the vicinity of the eastern Snake River Plain, Idaho

    SciTech Connect (OSTI)

    Blackwell, D.D. Kelley, S.A.; Steele, J.L. (Southern Methodist Univ., Dallas, TX (United States). Dept. of Geological Sciences)

    1993-04-01

    New heat flow data and thermal modeling are used to calculate crustal temperatures in and adjacent to the eastern Snake River Plain (SRP). The estimated crustal temperature are then used to investigate the relationship between crustal strength and the observed parabolic pattern of seismicity around the SRP. Heat flow below the SRP aquifer in deep wells on the Idaho National Engineering Laboratory (INEL) site near the northern margin of the SRP is 107 [plus minus] 15 mWm[sup [minus]2]. Heat flow values from deep wells on both the northern and southern margins of the eastern SRP average 100 [plus minus] 15 mWm[sup [minus]2]. 2-D finite-difference thermal models were developed to fit seismic and heat flow data in the vicinity of the SRP. The models have a shallow silicic magma chamber that is as wide as the SRP. The silicic chamber is underlain by mafic heat sources in the middle to lower crust and in the upper mantle. The heat flow data are best fit by models with deep heat sources that are wider than the SRP. These results are consistent with the presence of young basaltic centers that have been observed outside the SRP. The temperature from the authors thermal models were used to calculate strength envelopes for the crust in the SRP/Basin and Range region. The weakest part of the crust is along the edge of the Basin and Range, where it is heated by the SRP; thus the boundary to the two provinces may be a zone of weak coupling. Their modeling indicates that it is difficult to explain the earthquake pattern in the vicinity of the SRP as a thermomechanical effect related to the passage of the Yellowstone hot spot.

  1. Geology and geophysics of Proterozoic basement rocks in the eastern midcontinent of the United States

    SciTech Connect (OSTI)

    Lidiak, E.G. )

    1992-01-01

    Upper crustal Proterozoic rocks of the eastern midcontinent of the U.S. are part of the transcontinental Proterozoic province, a 3,000 km-long belt of anorogenic igneous rocks that extends from western Ohio to southern California. Regional magnetic and gravity anomaly maps reveal a variety of prominent anomalies and gradients that reflect major basement or intrabasement structures. Widespread are pronounced (10--20 km diameter), high-amplitude (600--700 gamma) circular to elliptical positive magnetic anomalies that are associated with magnetite-series granites and coeval rhyolites. Also present (in Indiana) are a series of ring-shaped magnetic anomalies that have a diameter of about 50 km and form circular to elliptical patterns of narrow positive anomalies bordered by negative anomalies and ringing a central minimum. Modeling of the anomalies suggests that they may be ring dike complexes associated with calderas. Two prominent circular gravity lows associated with large granitic batholiths have also been identified. The larger of these, the Wisconsin gravity minimum, has a diameter of about 250 km and an amplitude of about [minus]65 mgals and is associated with the Wolf River batholith. The second gravity low has a diameter of about 75 km and an amplitude of about [minus]25 mgals and is in east-central Kentucky. Several major rift zones are present in the eastern midcontinent. The most prominent of these is the New Madrid rift complex, a failed-arm structure that extends into the craton beneath the Mississippi embayment. Also present are linear arrays of positive magnetic and gravity anomalies that are associated with basaltic rift zones. These include the mid-Michigan rift and the Ft. Wayne rift, as well as with possible rifts associated with the mid-Tennessee and Louisville positive anomalies.

  2. Pollution-enhanced reactive chlorine chemistry in the eastern tropical Atlantic boundary layer

    E-Print Network [OSTI]

    2009-01-01

    doi:10.1029/2008GL036666, 2009 Pollution-enhanced reactiveE. S. Saltzman (2009), Pollution-enhanced reactive chlorine5 L08810 LAWLER ET AL. : POLLUTION-ENHANCED CLX IN THE MBL

  3. P-wave tomography of eastern North America: Evidence for mantle evolution from Archean to Phanerozoic,

    E-Print Network [OSTI]

    estimated to be as early as 4.1 Ga [e.g., Hopkins et al., 2008], or as late as 1 Ga [e.g., Stern, 2005 largely invoke Archean processes, such as the extraction of koma- tiitic magmas [e.g., Griffin et al keels, despite their relatively low density [e.g., Jordan, 1988; King, 2005; O'Reilly and Griffin, 2006

  4. ALS Ceramics Materials Research Advances Engine Performance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I T E DALS CapabilitiesALS

  5. ALS Operating Schedule on Google Calendar

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I TALS EvidenceHistory: TheALS

  6. ALS Postdoc Recognized for Outstanding Thesis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I TALS EvidenceHistory:ALS

  7. ALS Reveals New State of Matter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve4AJ01) (See Energy Level79AJ01)19^ U N I TALSALS Reveals New StateALS

  8. A=17Al (1993TI07)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion1AJ01) (Not93TI07) (Not1959AJ76) (See the71AJ02)93TI07)Al

  9. Microsoft Word - AL2006-02.doc

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft Word - AL2006-01.doc More Documents &

  10. Microsoft Word - AL2006-03.doc

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoft Word - AL2006-01.doc More Documents

  11. ALS Ceramics Materials Research Advances Engine Performance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News BelowAskedAIKENALS Capabilities RevealALS

  12. ALS Operating Schedule on Google Calendar

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News BelowAskedAIKENALSDoctoralALS Operating

  13. Microsoft Word - AL2005-08.doc

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE Safetyof MethaneMillionMicrosoft Word - AL2005-05Revised.docNo.

  14. AL/FAL 99-01

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s iof1AGGIE SOL The UniversityAIRMaster+AL/FAL

  15. Toyota Collaborates with the ALS and Molecular Foundry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Toyota Collaborates with the ALS and Molecular Foundry Toyota Collaborates with the ALS and Molecular Foundry Print Friday, 18 July 2014 10:41 Toyota has been conducting research...

  16. Takeda Advances Diabetes Drug Development at the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Takeda Advances Diabetes Drug Development at the ALS Takeda Advances Diabetes Drug Development at the ALS Print Tuesday, 19 May 2015 12:25 Type 2 diabetes mellitus (T2DM),...

  17. ALS Technique Gives Novel View of Lithium Battery Dendrite Growth

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Technique Gives Novel View of Lithium Battery Dendrite Growth ALS Technique Gives Novel View of Lithium Battery Dendrite Growth Print Thursday, 24 April 2014 09:46 Lithium-ion...

  18. Data Transfer Considerations for ALS Scientists and Users

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Data Transfer Considerations for ALS Scientists and Users Print Introduction Working at the ALS generates huge amounts of data, and for many years this has caused users to have to...

  19. Microsoft Word - AL2005-08.doc | Department of Energy

    Office of Environmental Management (EM)

    8.doc Microsoft Word - AL2005-08.doc Microsoft Word - AL2005-08.doc More Documents & Publications OPAM Policy Acquisition Guides Attachment FY2011-28 OPAM Microsoft Word -...

  20. Growth and Oxidation of Thin Film Al(2)Cu

    SciTech Connect (OSTI)

    SON,KYUNG-AH; MISSERT,NANCY A.; BARBOUR,J. CHARLES; HREN,J.J.; COPELAND,ROBERT GUILD; MINOR,KENNETH G.

    2000-01-18

    Al{sub 2}Cu thin films ({approx} 382 nm) are fabricated by melting and resolidifying Al/Cu bilayers in the presence of a {micro} 3 nm Al{sub 2}O{sub 3} passivating layer. X-ray Photoelectron Spectroscopy (XPS) measures a 1.0 eV shift of the Cu2p{sub 3/2} peak and a 1.6 eV shift of the valence band relative to metallic Cu upon Al{sub 2}Cu formation. Scanning Electron microscopy (SEM) and Electron Back-Scattered Diffraction (EBSD) show that the Al{sub 2}Cu film is composed of 30-70 {micro}m wide and 10-25 mm long cellular grains with (110) orientation. The atomic composition of the film as estimated by Energy Dispersive Spectroscopy (EDS) is 67 {+-} 2% Al and 33 {+-} 2% Cu. XPS scans of Al{sub 2}O{sub 3}/Al{sub 2}Cu taken before and after air exposure indicate that the upper Al{sub 2}Cu layers undergo further oxidation to Al{sub 2}O{sub 3} even in the presence of {approx} 5 nm Al{sub 2}O{sub 3}. The majority of Cu produced from oxidation is believed to migrate below the Al{sub 2}O{sub 3} layers, based upon the lack of evidence for metallic Cu in the XPS scans. In contrast to Al/Cu passivated with Al{sub 2}O{sub 3}, melting/resolidifying the Al/Cu bilayer without Al{sub 2}O{sub 3} results in phase-segregated dendritic film growth.

  1. Ab initio molecular dynamics of Al irradiation-induced processes during Al{sub 2}O{sub 3} growth

    SciTech Connect (OSTI)

    Music, Denis; Nahif, Farwah; Friederichsen, Niklas; Schneider, Jochen M.; Sarakinos, Kostas

    2011-03-14

    Al bombardment induced structural changes in {alpha}-Al{sub 2}O{sub 3} (R-3c) and {gamma}-Al{sub 2}O{sub 3} (Fd-3m) were studied using ab initio molecular dynamics. Diffusion and irradiation damage occur for both polymorphs in the kinetic energy range from 3.5 to 40 eV. However, for {gamma}-Al{sub 2}O{sub 3}(001) subplantation of impinging Al causes significantly larger irradiation damage and hence larger mobility as compared to {alpha}-Al{sub 2}O{sub 3}. Consequently, fast diffusion along {gamma}-Al{sub 2}O{sub 3}(001) gives rise to preferential {alpha}-Al{sub 2}O{sub 3}(0001) growth, which is consistent with published structure evolution experiments.

  2. Magnetization anomaly of Nb3Al strands and instability of Nb3Al Rutherford cables

    SciTech Connect (OSTI)

    Yamada, Ryuji; /Fermilab; Kikuchi, Akihiro; /Tsukuba Magnet Lab; Wake, Masayoshi; /KEK, Tsukuba

    2006-08-01

    Using a Cu stabilized Nb{sub 3}Al strand with Nb matrix, a 30 meter long Nb{sub 3}Al Rutherford cable was made by a collaboration of Fermilab and NIMS. Recently the strand and cable were tested. In both cases instability was observed at around 1.5 Tesla. The magnetization of this Nb{sub 3}Al strand was measured first using a balanced coil magnetometer at 4.2 K. Strands showed an anomalously large magnetization behavior around at 1.6 T, which is much higher than the usual B{sub c2} {approx} 0.5 Tesla (4.2 K) of Nb matrix. This result is compared with the magnetization data of short strand samples using a SQUID magnetometer, in which a flux-jump signal was observed at 0.5 Tesla, but not at higher field. As a possible explanation for this magnetization anomaly, the interfilament coupling through the thin Nb films in the strands is suggested. The instability problem observed in low field tests of the Nb{sub 3}Al Rutherford cables is attributed to this effect.

  3. Oxidation of Al doped Au clusters: A first principles study

    SciTech Connect (OSTI)

    Rajesh, Chinagandham [RMC, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India)

    2009-06-21

    Using first principles method we report the oxidation of Al doped Au clusters. This work is divided into two parts: (i) the equilibrium structures and stability of Al doped Au{sub n-1} clusters (n=2-7,21) and (ii) the interaction of O{sub 2} with stable clusters. The calculations are performed using the plane wave pseudopotential approach under the density functional theory and generalized gradient approximation for the exchange and correlation functional. The optimized geometries of Au{sub n-1}Al clusters indicate that the substitution of Au by Al results an early onset of three-dimensional structures from tetramer onwards. This is different from the results of transition metal doped Au clusters, where the planar conformation of Au clusters retains up to heptamer. The stability of Au{sub n-1}Al clusters has been analyzed based on the binding energy, second difference in energy, and the energy gaps between the highest occupied molecular orbital and lowest unoccupied molecular orbital energy levels. Based on the energetics, the Au{sub 3}Al and Au{sub 5}Al clusters are found to have extraordinary stability. The oxidation mechanism of Al doped Au clusters have been studied by the interaction of O{sub 2} with Al, Au, AuAl, Au{sub 3}Al, and Au{sub 20}Al clusters. It is found that the oxidation of Au{sub n-1}Al clusters undergoes via dissociative mechanism, albeit significant charge transfer from Al to Au. Moreover, the O{sub 2} molecule prefers to attach at the Al site rather than at the Au site.

  4. High strain-rate deformation fabrics characterize a kilometers-thick Paleozoic fault zone in the Eastern Sierras Pampeanas, central Argentina

    E-Print Network [OSTI]

    Whitmeyer, Steven J.

    in the Eastern Sierras Pampeanas, central Argentina Steven J. Whitmeyer*, Carol Simpson Department of Earth´rdoba, central Argentina. The NNW-striking, east-dipping `Tres Arboles' fault zone extends for at least 250 km

  5. The challenges of a water system management handover in eastern Ethiopia : from the United Nations Refugee Agency to a local community

    E-Print Network [OSTI]

    Chung, Christophe (Christopher J.)

    2011-01-01

    During the height of a political crisis in the late 1980s, hundreds of thousands of Somali refugees crossed into eastern Ethiopia. A humanitarian crisis soon unfolded as water was in short supply in the arid region. In ...

  6. The nature of transition from adakitic to non-adakitic magmatism in a slab window setting: A synthesis from the eastern Pontides, NE Turkey

    E-Print Network [OSTI]

    Eyuboglu, Yener

    The eastern Pontides orogenic belt provides a window into continental arc magmatism in the Alpine–Himalayan belt. The late Mesozoic–Cenozoic geodynamic evolution of this belt remains controversial. Here we focus on the ...

  7. Forecasting Recovery Opportunities for the Red-cockaded Woodpecker on Private Lands in Eastern North Carolina Using a Spatial Model of Tree Age 

    E-Print Network [OSTI]

    Dube, Amanda M

    2014-11-21

    age model for pines on private lands in eastern North Carolina. Modeling provided a means to spatially and temporally identify recovery opportunities over the next 10 to 40 years, predict locations for potential recruitment clusters within the next 10...

  8. Effects of four chitin synthesis inhibitors on feeding and mortality of the Eastern subterranean termite, Reticulitermes flavipes Kollar (Isoptera:Rhinotermitidae) 

    E-Print Network [OSTI]

    Vahabzadeh, Rebecca D.

    2002-01-01

    This study measured changes in feeding and mortality of the Eastern subterranean termite, Reticulitermes flavipes when exposed to diets treated with one of four chitin synthesis inhibitors including; diflubenzuron, ...

  9. An Archaeological Survey for the Upper Leon River Municipal Water District Proposed Wastewater Treatment System Improvements Project in Eastern Comanche County, Texas 

    E-Print Network [OSTI]

    Moore, William

    2015-07-10

    An archaeological evaluation of approximately 4 miles of proposed sewer force main and a proposed wastewater treatment plant at a 20 acre tract in eastern Comanche County, Texas was performed by Brazos Valley Research Associates (BVRA) in October...

  10. Settlement patterns in the eastern coast of Maracaibo Lake, Venezuela : evaluation of existing settlements and model for a low income sector of El Menito new town

    E-Print Network [OSTI]

    Rodriguez Navas, Humberto José

    1983-01-01

    This thesis is divided in two parts; The First part is the physical analysis of residential settlements in the Eastern Coast of Maracaibo Lake, Venezuela. The work is based on surveys, evaluations and comparisons of four ...

  11. Weathering the cold of `94. A review of the January 1994 energy supply disruptions in the Eastern United States

    SciTech Connect (OSTI)

    1995-05-01

    This report examines the causes of and responses to the very low temperatures over a wide region of the Eastern US causing unprecedented sustained demand for energy during the week of January 16--22, 1994. The topics of the report include the vagaries of the weather, the North American power supply structure, a chronology of major events of January, natural gas industry operations during peak demand periods, and recommendations for fuel supply, load forecasting, and energy emergency response exercises.

  12. Character of the diatom assemblage spanning a depositional transition in the Eastern Equatorial Pacific Ocean at 6.6 Ma 

    E-Print Network [OSTI]

    Brookshire, Brian Neville, Jr.

    2005-02-17

    in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 2003 Major Subject: Oceanography CHARACTER OF THE DIATOM ASSEMBLAGE SPANNING A DEPOSITIONAL TRANSITION IN THE EASTERN EQUATORIAL PACIFIC OCEAN AT 6.6 Ma A Thesis... by BRIAN NEVILLE BROOKSHIRE JR. Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by...

  13. Exhumation of the ultrahigh-pressure Tso Morari unit in eastern Ladakh (NW Himalaya): A case study

    E-Print Network [OSTI]

    Nicolas, Chamot-Rooke

    of deformation compressed between two rigid blocks [Thompson et al., 1997a]. [3] Each exhumation model predicts to the Earth's surface often implies a rapid exhumation [e.g., Duche^ne et al., 1997]. However, as they display

  14. Multi-criteria assessment of socio-environmental aspects in shrinking cities. Experiences from eastern Germany

    SciTech Connect (OSTI)

    Schetke, Sophie Haase, Dagmar

    2008-10-15

    Demographic change and economic decline produce modified urban land use pattern and densities. Compared to the beginning of the 90s after the German reunification, nowadays massive housing and commercial vacancies followed by demolition and perforation come to pass in many cities of the former GDR. In consequence, a considerable surplus of urban brownfields has been created. Furthermore, the decline in the urban fabric affects social infrastructure and urban greenery of local neighbourhoods. Here, urban planning enters into 'uncharted territory' since it needs to assess the socio-environmental impact of shrinkage. In order to carry out such an evaluation quantitatively, a multi-criteria assessment scheme (MCA) was developed and applied. Firstly, we identified infrastructure and land use changes related to vacancy and demolition. Secondly, demolition scenarios for the coming 20 years were applied in order to give an idea for a long-term monitoring approach at the local district level. A multi-criteria indicator matrix quantifies the socio-environmental impact on both urban greenery and residents. Using it, we set demolition scenarios against urban 'quality of life' targets. Empirical evidence comes from Leipzig, in eastern Germany, a representative case study for urban shrinkage processes. The results show that shrinkage implies socio-environmental changes of residential livelihoods, however, does not simply increase or decrease the overall urban quality of life. The integrated assessment of all indicators identifies environmental and social opportunities, as well as the challenges a shrinking city is faced with.

  15. Depositional environments, lithofacies types, and reservoir development of the Permian Khuff Formation in Eastern Saudi Arabia

    SciTech Connect (OSTI)

    Al-Jallal, I.A. (Saudi Aramco, Dhahran (Saudi Arabia))

    1991-08-01

    The Later Permian carbonates and evaporites of the Khuff Formation contain considerable amounts of gas in Ghawar field, eastern Saudi Arabia. Sedimentary structures, textures, and grain types were used to interpret the depositional environments and to define the different lithofacies types which determine the original reservoir face is distribution within this 1,500-ft-thick formation. There are three major depositional environments: subtidal, intertidal, and sabkha. Locally, these include shoals, belts, bars, bays, lagoons, ponds, tidal channels, sabkha. Locally, these include shoals, belts, bars, bays, lagoons, ponds, tidal channels, sabkha islands, and sabkha pans. Tidal flooding and storms are represented. These environments represent four major transgressive-regressive cycles, which conform to four Khuff units: Khuff A, B, C and D (from youngest to oldest). Transgressive phases (subtidal), with lithofacies of grainstones and horizontally burrowed mudstones usually comprise the reservoir facies. The regressive phases (intertidal and sabkha) with lithofacies of anhydritic mudstones and anhydrites, usually seal the Khuff reservoirs. Later disappearance of reservoir facies are due to deposition or diagenesis. Depositionally, the lateral change in facies may occur, for example, from a non-reservoir anhydrite and mudstone facies to a reservoir grainstone facies, or from a non-reservoir anhydritic mudstones to a reservoir burrowed-mudstone facies. Diagenetically, ooid grainstones may be greatly cemented by anhydrite. A combination of dolomitization and leaching may create intercrystalline porosity in mudstone. Leaching creates poorly connected moldic porosity in grainstones because the resulting calcite cement plugs the interparticle porosity.

  16. Geologic constraints to fluid flow in the Jurassic Arab D reservoir, eastern Saudi Arabia

    SciTech Connect (OSTI)

    Laing, J.E. (Saudi Aramco, Dhahran (Saudi Arabia))

    1991-08-01

    A giant oil field located in eastern Saudi Arabia has produced several billion barrels of 37{degree} API oil from fewer than 100 wells. The Upper Jurassic Arab Formation is the main producing unit, and is made up of a series of upward-shoaling carbonate and anhydrite members. Porous carbonates of the Arab D member make up the principle oil reservoir, and overlying Arab D anhydrite provides the seal. Principal reservoir facies are stromatoporoid-coral and skeletal grainstones. Reservoir drive is currently provided by flank water injection. Despite more than 30 years of flank water injection (1.5 billion bbl) into the northern area of the field, a thick oil column remains in the Arab D reservoir. Geological factors which affect fluid flow in this area are (1) a downdip facies change from permeable skeletal-stromatoporoid limestone to less permeable micritic limestone, (2) vertical permeability barriers resulting from shoaling-upward cycles, (3) a downdip tar mat, (4) dolomite along the flanks in the upper portion of the reservoir, (5) highly permeable intervals within the skeletal-stromatoporoid limestone, and (6) an updip, north to south facies change from predominantly stromatoporoid-coral grainstone to skeletal grainstone. These factors are considered in reservoir modeling, simulation studies, and planning locations for both water injection and producer wells.

  17. Fourier and autocorrelation analysis of estuarine tidal rhythmites, lower Breathitt Formation (Pennsylvania), eastern Kentucky, USA

    SciTech Connect (OSTI)

    Martino, R.L.; Sanderson, D.D. (Marshall Univ., Huntington, WV (United States))

    1993-01-01

    Outcrops of the Pennsylvanian Breathitt Formation in eastern Kentucky reveal a rhythmic pattern of siliciclastic sedimentation in a marginal marine coastal setting. A 15-23 m thick stratigraphic interval of thinly interbedded, fine sandstone and shale displays tidally generated features such as flaser and wavy current ripple bedding, bipolar paleocurrents, and cyclic thickening and thinning of mud-draped sandstone layers. A statistical analysis of sand layer thickness was carried out using shale partings as bounding surfaces for the individual sand units. Fourier and autocorrelation analyses were performed on two vertical sequences containing a total of over 2,100 layers. The results reveal the presence of four cycles of thickness variation. First-order cycles consist of alternating thick-thin sand layers. These daily couplets may reflect unequal flood and ebb currents during a single tidal cycle or dominant and subordinate tidal deposits in an ebb or flood dominated semidiurnal or mixed system. Second-order cycles typically consist of 11-14 sand layers and reflect spring-neap variations in tidal range and current velocities. Third-order cycles are usually composed of 24-35 layers and are formed in response to monthly variations in tidal range resulting from the ellipticity of the moon's orbit. Fourth-order cycles generally contain about 150 layers (range, 100-166) and were caused by seasonal maxima in tidal range associated with the solstice (winter, summer) and seasonal minima associated with the equinox (spring, fall).

  18. Tidal constituent database. West Coast of the United States and Eastern North pacific ocean. Technical note

    SciTech Connect (OSTI)

    NONE

    1995-01-01

    This technical note describes a database of tidal elevation boundary condition information generated in support of the `Long-Term Fate of Dredged Material Disposed in Open Water` research of the Dredging Research Program (DRP), being conducted at the U.S. Army Engineer Waterways Experiment Station. The database, described in detail by Hench and others (1994), allows the user to manually generate time series of tidal elevations or to use a program to access the full database to generate time series of both tidal elevations and currents for any location along the West Coast of the United States and Eastern North Pacific Ocean, extending from Seal Cape on Unimak Island, Alaska, in the North to Punta Parada, Peru, in the South. The land boundary includes the Pacific shorelines of Alaska, Canada, mainland United States, Mexico, Guatemala, El Salvador, Nicaragua, Costa Rica, Panama, Columbia, and Northern Peru. Although the capability to generate these time series was developed to provide input to the Long-Term Fate and Stability Model (LTFATE), the generated time series can be used for any application requiring tidal forcing data.

  19. Estimating Annual Precipitation in the Fenner Basin of the Eastern Mojave Desert, California

    SciTech Connect (OSTI)

    Davisson, M.L.; Rose, T.P.

    2000-05-15

    Metropolitan Water District (MWD) of southern California and Cadiz Inc. investigated the feasibility of storing Colorado River water in groundwater aquifers of the eastern Mojave Desert as a future drought mitigation strategy. This culminated in the public release of the Cadiz Groundwater Storage and Dry-Year Supply program Draft EIR, which included pilot percolation studies, groundwater modeling, and precipitation/runoff analysis in the Fenner groundwater basin, which overlies the proposed storage site. The project proposes to store and withdrawal Colorado River water over a 50-year period, but will not exceed the natural replenishment rates of the groundwater basin. Several independent analyses were conducted to estimate the rates of natural groundwater replenishment to the Fenner Groundwater Basin which was included in the Draft EIR. The US Geologic Survey, Water Resources Division (WRD) officially submitted comments during public review and concluded that the natural groundwater replenishment rates calculated for the Draft EIR were too high. In the WRD review, they provided a much lower recharge calculation based on a Maxey-Eakin estimation approach. This approach estimates annual precipitation over an entire basin as a function of elevation, followed by calibration against annual recharge rates. Previous attempts to create precipitation-elevation functions in western Nevada have been difficult and result in large uncertainty. In the WRD data analysis, the effect of geographic scale on the precipitation-elevation function was overlooked. This contributed to an erroneous Maxey-Eakin recharge estimate.

  20. Carboniferous tectonic history of the eastern flank of the Ozark dome

    SciTech Connect (OSTI)

    Nelson, W.J. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Detailed geologic mapping in southwestern Illinois and southeastern Missouri indicates that the eastern flank of the Ozark dome was a low positive area throughout Carboniferous (Mississippian and Pennsylvanian) time. Rock units of this age consistently thin onto the flank of the dome, and are punctuated by numerous disconformities. Effects of shoaling are prominent in Chesterian strata, which change from dominantly subtidal in the proto-Illinois basin to shallow subtidal, intertidal and supratidal on the flank of the dome. Although the dome probably was exposed subaerially for much of Carboniferous time, it contributed little sediment eastward. The exposed rocks were largely carbonates, which weathered by solution. Several long-lived basement structures on the east flank of the Ozarks were active during the Carboniferous. Chief among them were the Lincoln and Waterloo-Dupo anticlines, the Du Quoin monocline, and the Ste. Genevieve fault zone. All are high-angle reverse faults that strike north to northwest, and are overlain by sharp folds in sedimentary cover. Major displacements took place in late Valmeyeran to Atokan time, and addition deformation occurred in Desmoinesian through post-Pennsylvanian time. The compressional deformation probably is a product of the Ouachita orogeny.

  1. Effects of Aerosols on Autumn Precipitation over Mid-Eastern China

    SciTech Connect (OSTI)

    Chen, Siyu; Huang, J.; Qian, Yun; Ge, Jinming; Su, Jing

    2014-09-20

    Long-term observational data indicated a decreasing trend for the amount of autumn precipitation (i.e. 54.3 mm per decade) over Mid-Eastern China, especially after 1980s (~ 5.6% per decade). To examine the cause of the decreasing trend, the mechanisms associated with the change of autumn precipitation were investigated from the perspective of water vapor transportation, atmospheric stability and cloud microphysics. Results show that the decrease of convective available potential energy (i.e. 12.81 J kg-1/ decade) and change of cloud microphysics, which were closely related to the increase of aerosol loading during the past twenty years, were the two primary factors responsible for the decrease of autumn precipitation. Ours results showed that increased aerosol could enhance the atmospheric stability thus weaken the convection. Meanwhile, more aerosols also led to a significant decline of raindrop concentration and to a delay of raindrop formation because of smaller size of cloud droplets. Thus, increased aerosols produced by air pollution could be one of the major reasons for the decrease of autumn precipitation. Furthermore, we found that the aerosol effects on precipitation in autumn was more significant than in other seasons, partly due to the relatively more stable synoptic system in autumn. The impact of large-scale circulation dominated in autumn and the dynamic influence on precipitation was more important than the thermodynamic activity.

  2. Review of the Recent Frequency Performance of the Eastern, Western and ERCOT Interconnections

    SciTech Connect (OSTI)

    Lacommare, Kristina S H

    2010-12-20

    The reliable operation of an electric power system depends on careful management of the balance between generation and load to ensure that system frequency is maintained within narrow bounds around a scheduled value. Yet, maintaining frequency at the scheduled value is challenging because the load served is continuously changing, and occasionally, events such as the sudden loss of a large generation plant or large amount of load, cause frequency to deviate abruptly. This report reviews the recent history of frequency performance for all three U.S. interconnections: Eastern, Western, and the Electric Reliability Council of Texas (ERCOT). The review is based on data collected by the North American Electric Reliability Corporation (NERC). The review focuses on frequency response, which measures the performance of the interconnections immediately following sudden, large imbalances between load and generation. Trends in frequency response are presented and preliminary efforts are made to relate frequency response to other aspects of frequency performance and to examine aspects of the methods used to calculate frequency response.

  3. The Pleistocene biogeography of eastern North America: A nonmigration scenario for deciduous forest

    SciTech Connect (OSTI)

    Loehle, C.; Iltis, H.

    1998-12-31

    The current reconstruction of the vegetation of eastern North America at the last glacial maximum postulates a very wide zone of tundra and boreal forest south of the ice. This reconstruction requires that the deciduous forest retreated far to the south. The authors believe that this reconstruction is seriously in error. Geologic evidence for glacial activity or tundra is absent from the southern Appalachians. Positive evidence for boreal forest is based on pollen identifications for Picea, Betula, and Pinus, when in reality southern members of these genera have pollen that cannot be distinguished from that of northern members. Further, pollen of typical southern species such as oaks and hickories occurs throughout profiles that past authors had labeled boreal. Pollen evidence for a far southern deciduous forest refuge is lacking. Data on endemics are particularly challenging for the scenario in which deciduous forest migrated to the south and back. The southern Appalachian region is rife with endemics that are often extreme-habitat specialists unable to migrate. The previously glaciated zone is almost completely lacking in endemics. Outlier populations, range boundaries, and absence of certain hybrids all argue against a large boreal zone. The new reconstruction postulates a cold zone no more than 75--100 miles wide south of the ice in the East.

  4. Ambrosia Beetle (Coleoptera: Scolytidae) Species, Flight, and Attack on Living Eastern Cottonwood Trees.

    SciTech Connect (OSTI)

    D.R. Coyle; D.C. Booth: M.S. Wallace

    2005-12-01

    ABSTRACT In spring 2002, ambrosia beetles (Coleoptera: Scolytidae) infested an intensively managed 22-ha tree plantation on the upper coastal plain of South Carolina. Nearly 3,500 scolytids representing 28 species were captured in ethanol-baited traps from 18 June 2002 to 18 April 2004. More than 88% of total captures were exotic species. Five species [Dryoxylon onoharaensum (Murayama), Euwallacea validus (Eichhoff), Pseudopityophthorus minutissimus (Zimmermann), Xyleborus atratus Eichhoff, and Xyleborus impressus Eichhoff]) were collected in South Carolina for the Ã?Â?Ã?Â?rst time. Of four tree species in the plantation, eastern cottonwood, Populus deltoides Bartram, was the only one attacked, with nearly 40% of the trees sustaining ambrosia beetle damage. Clone ST66 sustained more damage than clone S7C15. ST66 trees receiving fertilization were attacked more frequently than trees receiving irrigation, irrigation_fertilization, or controls, although the number of S7C15 trees attacked did not differ among treatments. The study location is near major shipping ports; our results demonstrate the necessity for intensive monitoring programs to determine the arrival, spread, ecology, and impact of exotic scolytids.

  5. Structure and magnetic properties of Ce?(Ni/Al/Ga)??—A new phase with the La?Al?? structure type

    SciTech Connect (OSTI)

    Janka, Oliver; Shang, Tian; Baumbach, Ryan E.; Bauer, Eric D.; Thompson, Joe D.; Kauzlarich, Susan M.

    2015-03-01

    Single crystals of Ce?(Ni/Al/Ga)?? were obtained from an Al flux reaction. Single crystals of the title compound crystallizing in the orthorhombic space group Immm (No. 71, Z = 2) with a = 436.38(14), b = 1004.5(3) and c = 1293.4(4) pm. This is a standardized unit cell of the previously published La?Al?? structure type. Wavelength dispersive microprobe provides the composition of Ce?.?????Ni?.?????Al?.?????Ga?.?????. Single crystal refinement provides the composition Ce?Ni?.??Al?.??Ga?.?? with substitution of the Ni and Ga on the Al1 and Al4 sites with the Al2 and Al3 solely occupied by Al. Magnetic susceptibility measurements reveal antiferromagnetic ordering with TN = 4.8 K and there is no evidence for a ferromagnetic ordering that has been reported for Ce?Al??. The effective magnetic moment was found to be ?eff = 1.9?B/Ce, which is lower than the expected value for trivalent Ce (2.54?B/Ce).

  6. Genetic variation in the eastern subterranean termite Reticulitermes flavipes (Isoptera: Rhinotermitidae) 

    E-Print Network [OSTI]

    Benavides, Lucille H

    2006-04-12

    . 1993) and AT-J-T1 (CACTAAGGATAATCAATTATACGTC) (Jenkins et al. 1998). PCR was conducted in a Peltier thermal cycler (PTC-200, MJR). The following PCR program was used: an initial 94? C for 120 s; 50? C for 30 s; and 72? C for 60 s; for a total of 36...

  7. DEEP SEA RESEARCH PART II Circulation in the Eastern Bering Sea: Inferences

    E-Print Network [OSTI]

    Kurapov, Alexander

    of the North Pacific and Gulf of Alaska coastal currents connect with the Bering Sea basin and shelf through of Alaska, Fairbanks, Alaska, 99775, USA December 18, 2013, 1:54pm DRAFT #12;X - 2 DURSKI ET AL.: CIRC. EAST in determining the pattern of erosion of the water mass as the shelf warms and mixes. On the Bering Sea Shelf

  8. Kinetic energy distributions of sputtered neutral aluminum clusters: Al--Al{sub 6}

    SciTech Connect (OSTI)

    Coon, S.R.; Calaway, W.F.; Pellin, M.J.; Curlee, G.A.; White, J.M.

    1992-12-01

    Neutral aluminum clusters sputtered from polycrystalline aluminum were analyzed by laser postionization time-of-flight (TOF) mass spectrometry. The kinetic energy distributions of Al through Al{sub 6} were measured by a neutrals time-of-flight technique. The interpretation of laser postionization TOF data to extract velocity and energy distributions is presented. The aluminum cluster distributions are qualitatively similar to previous copper cluster distribution measurements from our laboratory. In contrast to the steep high energy tails predicted by the single- or multiple- collision models, the measured cluster distributions have high energy power law dependences in the range of E{sup {minus}3} to E{sup {minus}4.5}. Correlated collision models may explain the substantial abundance of energetic clusters that are observed in these experiments. Possible influences of cluster fragmentation on the distributions are discussed.

  9. Kinetic energy distributions of sputtered neutral aluminum clusters: Al--Al[sub 6

    SciTech Connect (OSTI)

    Coon, S.R.; Calaway, W.F.; Pellin, M.J. ); Curlee, G.A. . Dept. of Physics); White, J.M. . Dept. of Chemistry and Biochemistry)

    1992-01-01

    Neutral aluminum clusters sputtered from polycrystalline aluminum were analyzed by laser postionization time-of-flight (TOF) mass spectrometry. The kinetic energy distributions of Al through Al[sub 6] were measured by a neutrals time-of-flight technique. The interpretation of laser postionization TOF data to extract velocity and energy distributions is presented. The aluminum cluster distributions are qualitatively similar to previous copper cluster distribution measurements from our laboratory. In contrast to the steep high energy tails predicted by the single- or multiple- collision models, the measured cluster distributions have high energy power law dependences in the range of E[sup [minus]3] to E[sup [minus]4.5]. Correlated collision models may explain the substantial abundance of energetic clusters that are observed in these experiments. Possible influences of cluster fragmentation on the distributions are discussed.

  10. Roll Casting of Al-25%Si

    SciTech Connect (OSTI)

    Haga, Toshio [Osaka Institute of Technology, Omiya Asahiku Osaka city 535-8585 (Japan); Harada, Hideto [Graduate School of Osaka Institute of Technology, Omiya Asahiku Osaka city 535-8585 (Japan); Watari, Hisaki [Gunma University, Kiryu city, 376-8515 (Japan)

    2011-05-04

    Strip casting of Al-25%Si strip was tried using an unequal diameter twin roll caster. The diameter of the lower roll (large roll) was 1000 mm and the diameter of the upper roll (small roll) was 250 mm. Roll material was mild steel. The sound strip could be cast at the speeds ranging from 8 m/min to 12 m/min. The strip did not stick to the roll without the parting material. The primary Si, which existed at centre area of the thickness direction, was larger than that which existed at other area. The size of the primary Si was smaller than 0.2 mm. Eutectic Si was smaller 5 {mu}m. The as-cast strip was ranging from 2 mm to 3 mm thick and its width was 100 mm. The as-cast strip could be hot rolled down to 1 mm. The hot rolled strip was cold rolled. The primary Si became smaller and the pore occurred around the primary Si after the rolling.

  11. Molecular dynamics simulation comparison of atomic scale intermixing at the amorphous Al2O3/semiconductor interface for a-Al2O3/Ge, a-Al2O3/InGaAs,

    E-Print Network [OSTI]

    Kummel, Andrew C.

    /semiconductor interface for a-Al2O3/Ge, a-Al2O3/InGaAs, and a-Al2O3/InAlAs/InGaAs Evgueni A. Chagarov *, Andrew oxides Ge InGaAs InAlAs Oxide­semiconductor stack High-K oxide a b s t r a c t The structural properties of a-Al2O3/Ge, a-Al2O3/In0.5Ga0.5As and a-Al2O3/In0.5Al0.5As/InGaAs interfaces were investigated

  12. Engineering Al-based Thin Film Materials for Power Devices and Energy Storage Applications

    E-Print Network [OSTI]

    Perng, Ya-Chuan

    2012-01-01

    application on AlGaN/GaN, AlN can serve as a superior passivation layer to Al 2 O 3 because of its piezoelectric

  13. Reactive codoping of GaAlInP compound semiconductors

    DOE Patents [OSTI]

    Hanna, Mark Cooper (Boulder, CO); Reedy, Robert (Golden, CO)

    2008-02-12

    A GaAlInP compound semiconductor and a method of producing a GaAlInP compound semiconductor are provided. The apparatus and method comprises a GaAs crystal substrate in a metal organic vapor deposition reactor. Al, Ga, In vapors are prepared by thermally decomposing organometallic compounds. P vapors are prepared by thermally decomposing phospine gas, group II vapors are prepared by thermally decomposing an organometallic group IIA or IIB compound. Group VIB vapors are prepared by thermally decomposing a gaseous compound of group VIB. The Al, Ga, In, P, group II, and group VIB vapors grow a GaAlInP crystal doped with group IIA or IIB and group VIB elements on the substrate wherein the group IIA or IIB and a group VIB vapors produced a codoped GaAlInP compound semiconductor with a group IIA or IIB element serving as a p-type dopant having low group II atomic diffusion.

  14. Takeda Advances Diabetes Drug Development at the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Takeda Advances Diabetes Drug Development at the ALS Print Type 2 diabetes mellitus (T2DM), characterized by abnormally high blood glucose levels, affects hundreds of millions of...

  15. Six Berkeley Lab (Three ALS) Scientists Are 2012 APS Fellows

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    "seminal contributions to x-ray optics, instrumentation, and research with synchrotron radiation." David Robin of AFRD is the ALS Division Deputy for Operations and Accelerator...

  16. Stability and Rate Capability of Al Substituted Lithium-Rich...

    Office of Scientific and Technical Information (OSTI)

    Lithium-Rich High-Manganese Content Oxide Materials for Li-Ion Batteries The structures, electrochemical properties and thermal stability of Al-substituted lithium-excess...

  17. al-Qaida Strategy, Ideology, Doctrine, and Media

    ScienceCinema (OSTI)

    Dr. Jarret Brachman

    2010-09-01

    Dr. Jarret Brachman, an internationally recognized al-Qaida specialist, author and public lecturer, shares his thoughts on a range of topics, including the differences involved in fighting insurgent groups versus terrorist organizations, the future of the global al-Qaida movement, and assessing America's efforts to combat al-Qaida. In his talk, Brachman focuses specifically on current trends in al-Qaida's military and messaging strategies, both from the perspective of the group's senior leadership and its regional commands. Presented on June 17, 2010.

  18. ALS Capabilities Reveal Multiple Functions of Ebola Virus

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Capabilities Reveal Multiple Functions of Ebola Virus Print A central dogma of molecular biology is that a protein's sequence dictates its fold, and the fold dictates its...

  19. ALS X-Rays Shine a New Light on Catalysis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS in a novel way to observe the behavior of electrons during technologically important chemical reactions in metal oxide electrocatalysts. What they learned has upended...

  20. Lenguaje Java Avanzado 1 Introduccin al lenguaje Java.......................................................................................4

    E-Print Network [OSTI]

    Escolano, Francisco

    Lenguaje Java Avanzado Índice 1 Introducción al lenguaje Java.......................................................................................4 1.1 Java......................................................................................5 1.3 Componentes de un programa Java

  1. Acquisition Letter No. AL 2014-07 | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Acquisition Letter 07 - Benchmark Compensation Amount for Individual Executive Salary Actions SUMMARY: The purpose of Acquisition Letter (AL) 2014-07 is to establish the...

  2. A new look at geothermal energy potential of the eastern Snake River Plain, Idaho

    SciTech Connect (OSTI)

    Smith, R.P.; Faulder, D.D.; Jackson, S.M. (EG and G Idaho, Inc., Idaho Falls (USA)); Hackett, W.R. (Idaho State Univ., Pocatello (USA))

    1990-06-01

    Passage of the Yellowstone plume beneath the Eastern Snake River Plain (ESRP) left a wake of silicic batholiths and associated 4 to 6 Ma rhyolitic tuffs, a 1 km thick sequence of post 4 Ma basalt lava flows, and high heat flow comparable to that of the Basin-and-Range province. U.S.G.S. (United States Geological Survey) Circular 790 estimates that accessible resources are one-third larger than those of the Cascades, but geothermal exploration and research activities on the ESRP have quietly perished. The authors believe that the ESRP merits further attention as a geothermal exploration target. In this article, the first of several by their group, they identify relevant geological and geophysical features of the ESRP, the first step toward a meaningful exploration strategy. Although exploration is hindered by the heat-sapping effects of the overlying SRP aquifer, several geological features of the ESRP suggest that viable exploration targets exist beneath the aquifer: (1) the fracture zones of buried, Neogene silicic calderas; (2) Quaternary basaltic rift zones (several NW-trending ones and an axial one), which have been persistent zones of fissuring, minor faulting, and magma transport; (3) high-angle faults and fractures around the margin of the downwarped ESRP, including NW-trending basin-and-range faults and NE-trending marginal faults; and (4) fractured or brecciated zones near Pleistocene rhyolite domes and silicic intrusions. Existing geophysical data also constrain exploration targets. Aeromagnetic surveys show NW-trending highs that intersect a NE-trending axial high; rhyolite domes and youthful basaltic volcanism are localized along the highs and at intersections. Although the ESRP is remarkably aseismic, recently installed local seismic networks have identified contemporary microearthquakes that could preserve fracture permeability to depths of several kilometers.

  3. Tectonic history and analysis of structures in eastern Kansas and western Missouri

    SciTech Connect (OSTI)

    Berendsen, P.; Wilson, F.W. . Kansas Geological Survey)

    1993-03-01

    Orogenic events in and around the midcontinent in Proterozoic time were responsible for the formation of the dominant master set of younger northeast- and older northwest-trending faults that dominate the structure of the area today. Reactivation of these faults throughout geologic time gave rise to tectonic zones consisting of sets of anastomosing faults or other complex patterns. These zones are likely important in helping to determine the configuration of major uplifts and basins that involve the crust. The Nemaha tectonic zone defines the western boundary of both the Forest City and Cherokee basins, while a structural block delineated by the Chesapeake and Bolivar-Mansfield regional faults coincides with the approximate position of the Bourbon Arch, which is reflected in the thickness of Mississippian carbonate rocks. Rocks of the Ozark uplift began to be uplifted by the end of Maquoketa time. The uplift has historically been described as a landform, rather than a geologic structure. Hence, the extent and the boundaries of the uplift are ill-defined. The northeast-trending line forming the contact between Mississippian and Pennsylvanian rocks is commonly regarded as the western boundary. This boundary coincides with a major tectonic zone, extending northeastward from Oklahoma through Kansas and Missouri into at least southern Iowa. In the Tri-State area of Kansas, Oklahoma, and Missouri the zone is referred to as the Miami trough and features prominently in the localization of major ore deposits. This zone may then also be regarded as the eastern boundary of the Forest City and Cherokee basins.

  4. Selected Obs: Pacs03Characteristics of Temperature Inversions in the South-Eastern Pacific Stratocumulus Region

    E-Print Network [OSTI]

    Zuidema, Paquita

    applied (exception: Wang et al `05) #12;Epic 2001: Oct 10-25, 2001 Buoy: Oct 16-21 (8x/daily sondes) Stratus 03 Buoy: Nov. 15-21 (4x/daily sondes) Stratus 04: Dec 6-22 Buoy: Dec. 11-16 (6x/daily sondes) Stratus 05: Oct. 5-20 Buoy: Oct. 13-18 (6x/daily sondes) epic01 stratus03 stratus04 stratus05buoy #12

  5. Characterization of an Eastern Kentucky Devonian Shales well using a naturally fractured, layered reservoir description 

    E-Print Network [OSTI]

    Jochen, John Edward

    1993-01-01

    and pressure transient data for a single gas well completed in the Devonian Shales of the Appalachian Basin in Pike Co. , KY. This well was part of a three-well research program sponsored by the Gas Research Institute (GRI) to study the Devonian Shales.... , KY). From the tests conducted on the Preece No. 1, Hopkins et al. concluded that large Devonian Shales intervals which were treated jointly in a single wellbore often were not stimulated effectively, because small intervals accepted a...

  6. Electron mobility enhancement in AlN/GaN/AlN heterostructures with InGaN nanogrooves

    E-Print Network [OSTI]

    it was discovered by Davydov et al.1 and con- firmed by independent studies2,3 that its band gap is small, EG InN =0 The conduction band offset at GaN/AlN interface was estimated as EQW=0.7 EG AlN -EG GaN =1918 meV. The nanoN/GaN/AlN QW. The depth of the nanogroove is calculated as E0=0.8 EG GaN -EG InxGa1-xN . The band gap of InxGa1

  7. A nuclear magnetic resonance probe of Fe-Al and Al20V2Eu intermetallics 

    E-Print Network [OSTI]

    Chi, Ji

    2009-05-15

    packing of the atoms in positions which are not in contact with V atoms, Al 10 V has a large average atomic volume, 17 ? A 3 per atom. Low-temperature specific-heat and electrical-resistivity measurements showed a local soft mode ? Einstein model... of the ordering process. Knight shifts measure the e?ective field at the nucleus and provide the information about the local interaction mechanism(contact, core polarization, orbital, etc.) between the nucleus and the corresponding contribution(sp-band, d...

  8. Irradiation study of Ti6Al4V and Ti6Al4V1B for FRIB beam dump: Experimental plan

    E-Print Network [OSTI]

    McDonald, Kirk

    Irradiation study of Ti6Al4V and Ti6Al4V1B for FRIB beam dump: Experimental plan Aida Amroussia;Motivation · Study of irradiation damage in Ti-6Al-4V and Ti-6Al-4V-1B · Irradiation with different particles boron addition improves mechanical properties of Ti-6Al-4V after irradiation? Are the changes

  9. Gaseous modification of MCrAlY coatings

    DOE Patents [OSTI]

    Vance, Steven J. (Orlando, FL); Goedjen, John G. (Oviedo, FL); Sabol, Stephen M. (Orlando, FL); Sloan, Kelly M. (Longwood, FL)

    2000-01-01

    The present invention generally describes methods for modifying MCrAlY coatings by using gaseous carburization, gaseous nitriding or gaseous carbonitriding. The modified MCrAlY coatings are useful in thermal barrier coating systems, which may be used in gas turbine engines.

  10. Lanthanide Al-Ni base Ericsson cycle magnetic refrigerants

    DOE Patents [OSTI]

    Gschneidner, K.A. Jr.; Takeya, Hiroyuki

    1995-10-31

    A magnetic refrigerant for a magnetic refrigerator using the Ericsson thermodynamic cycle comprises DyAlNi and (Gd{sub 0.54}Er{sub 0.46})AlNi alloys having a relatively constant {Delta}Tmc over a wide temperature range. 16 figs.

  11. ACADEMIC PLAN AL512-MSED OLD CURRICULUM CODE_183

    E-Print Network [OSTI]

    Qiu, Weigang

    ACADEMIC PLAN AL512-MSED OLD CURRICULUM CODE_183 DEGREE CODE _27__ Hunter College of the City. Student's Signature Date ___________________ #12;ACADEMIC PLAN AL512-MSED OLD CURRICULUM CODE_183_ DEGREE Spring Summer SEDC 711 Advanced Study of Young Adult Literature in Our Diverse Society 3 Fall Spring

  12. An Extension of Al-Khalili's Qibla Table

    E-Print Network [OSTI]

    Roegel, Denis

    . . . . . . . . . . . . . . . . . . . . . . . . . 7 2.4 Coordinates of Mecca, now and then . . . . . . . . . . . . 8 3 The recomputed tablesAn Extension of Al-Khal¯il¯i's Qibla Table to the Entire World Denis Roegel 4 August 2008 #12;#12;An Extension of Al-Khal¯il¯i's Qibla Table to the Entire World Denis Roegel1 4 August 2008 Abstract

  13. Aluminum sulfate (alum; Al2 O) is used as a

    E-Print Network [OSTI]

    Sparks, Donald L.

    forms (phytic acid, polyphosphates, and monoesters) in alum- and non-alum­amended poultry litter. When increases. Overall, alum-amended litters exhibited higher proportions of Al-bound P species and phytic acid: inositol phosphates, sugar phosphates, nucleic acids, and phospholipids (Bar- nett, 1994a;Toor et al., 2006

  14. Estimation and Uncertainty Analysis of Impacts of Future Heat Waves on Mortality in the Eastern United States

    SciTech Connect (OSTI)

    Wu, Jianyong; Zhou, Ying; Gao, Yang; Fu, Joshua S.; Johnson, Brent; Huang, Cheng; Kim, Young-Min; Liu, Yang

    2014-01-01

    Background: It is anticipated that climate change will influence heat-related mortality in the future. However, the estimation of excess mortality attributable to future heat waves is subject to large uncertainties, which have not been examined under the latest greenhouse gas emission scenarios. Objectives: We estimated the future heat wave impact on mortality in the eastern United States (~ 1,700 counties) under two Representative Concentration Pathways (RCPs) and analyzed the sources of uncertainties. Methods Using dynamically downscaled hourly temperature projections in 2057-2059, we calculated heat wave days and episodes based on four heat wave metrics, and estimated the excess mortality attributable to them. The sources of uncertainty in estimated excess mortality were apportioned using a variance-decomposition method. Results: In the eastern U.S., the excess mortality attributable to heat waves could range from 200-7,807 with the mean of 2,379 persons/year in 2057-2059. The projected average excess mortality in RCP 4.5 and 8.5 scenarios was 1,403 and 3,556 persons/year, respectively. Excess mortality would be relatively high in the southern and eastern coastal areas. The major sources of uncertainty in the estimates are relative risk of heat wave mortality, the RCP scenarios, and the heat wave definitions. Conclusions: The estimated mortality risks from future heat waves are likely an order of magnitude higher than its current level and lead to thousands of deaths each year under the RCP8.5 scenario. The substantial spatial variability in estimated county-level heat mortality suggests that effective mitigation and adaptation measures should be developed based on spatially resolved data.

  15. Ethnohistoric Notes on the Ancient Tibetan Kingdom of sPo bo and its influence on the Eastern Himalayas

    E-Print Network [OSTI]

    Lazcano, Santiago

    2005-01-01

    ON THE ANCIENT TIBETANKINGDOM OF sPO BO AND ITS INFLUENCE ONTHE EASTERN HIMALAYAS1 Santiago Lazcano Translated from Spanish by Rita Granda …In late 1910 the Pome people killed a senior Chinese official. The Chinese replied with a punitiveexpedition which provoked... in the great gTsang po River5. Unlike most of Tibet,this area is humid and fertile and it is covered in dense forests and steepgorges. Wheat, barley, peaches and nuts grow in abundance. sPo yul is alsoknown for its production of honey, spices, bamboo...

  16. Eastern Renewable Generation Integration Study: Flexibility and High Penetrations of Wind and Solar; NREL (National Renewable Energy Laboratory)

    SciTech Connect (OSTI)

    Bloom, Aaron; Townsend, Aaron; Palchak, David

    2015-07-29

    Balancing wind and solar in a model is relatively easy. All you need to do is assume a very large system with infinite flexibility! But what if you don't have an infinitely flexible system? What if there are thousands of generators nestled in a handful of regions that are unlikely to change their operational practices? Would you still have enough flexibility to balance hundreds of gigawatts of wind and solar at a 5 minute level? At NREL, we think we can, and our industry partners agree. This presentation was presented at the IEEE Power and Energy Society General Meeting by Aaron Bloom, highlighting results of the Eastern Renewable Generation Integration Study.

  17. Attack on Han et al.'s ID-based Confirmer (Undeniable) Signature at ACM-EC'03

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Attack on Han et al.'s ID-based Confirmer (Undeniable) Signature at ACM-EC'03 Fangguo Zhang of Wollongong, NSW 2522 Australia {fangguo, rei, wsusilo}@uow.edu.au Abstract. At the fourth ACM conference for construction of ID-based cryptographic schemes. At the fourth ACM conference on electronic commerce (EC'03), S

  18. SILICON SURFACE PASSIVATION BY ULTRATHIN Al2O3 FILMS AND Al2O3/SiNx STACKS

    E-Print Network [OSTI]

    by thermal as well as by plasma-assisted atomic layer deposition (ALD) are very well suited for the effec, aluminum oxide (Al2O3) grown by atomic layer deposition (ALD) has been identified as a di- electric Ohrberg 1, 31860 Emmerthal, Germany ABSTRACT We show that aluminum oxide (Al2O3) layers depo- sited

  19. A Calibrated Maxey-Eakin Curve for the Fenner Basin of the Eastern Mojave Desert, California

    SciTech Connect (OSTI)

    Davisson, M.L.; Rose, T.P.

    2000-05-15

    Metropolitan Water District (MWD) of southern California and Cadiz Inc. investigated the feasibility of storing Colorado River water in groundwater aquifers of the eastern Mojave Desert as a future drought mitigation strategy. This culminated in the public release of the Cadiz Groundwater Storage and Dry-Year Supply program Draft EIR, which included pilot percolation studies, groundwater modeling, and precipitation/runoff analysis in the Fenner groundwater basin, which overlies the proposed storage site. The project proposes to store and withdrawal Colorado River water over a 50-year period, but will not exceed the natural replenishment rates of the groundwater basin. Several independent analyses were conducted to estimate the rates of natural groundwater replenishment to the Fenner Groundwater Basin, which was included in the Draft EIR. The US Geologic Survey, Water Resources Division (WRD) officially submitted comments during public review and concluded that the natural groundwater replenishment rates calculated for the Draft EIR were too high. In the WRD review, they provided a much lower recharge calculation based on a Maxey-Eakin estimation approach. This approach estimates annual precipitation over an entire basin as a function of elevation, followed by calibration against annual recharge rates. Recharge rates are estimated on the basis that some fraction of annual precipitation will recharge, and that fraction will increase with increasing elevation. This results in a hypothetical curve relating annual groundwater recharge to annual precipitation. Field validation of recharge rates is critical in order to establish credibility to any estimate. This is due to the fact that the Maxey-Eakin model is empirical. An empirical model is derived from practical experience rather than basic theory. Therefore, a validated Maxey-Eakin model in one groundwater basin does not translate to a different one. In the WRD's Maxey-Eakin model, they used a curve calibrated against three locations in western Nevada and applied it to the Fenner Basin. It is of particular importance to note that all three of the WRD's location are west of longitude 116{sup o}W, where annual precipitation is significantly lower. Therefore, The WRD's Maxey-Eakin curve was calibrated to a drier climate, and its application to the Fenner Basin lacks credibility.

  20. Wind Regimes in Complex Terrain of the Great Valley of Eastern Tennessee

    SciTech Connect (OSTI)

    Birdwell, Kevin R [ORNL

    2011-05-01

    This research was designed to provide an understanding of physical wind mechanisms within the complex terrain of the Great Valley of Eastern Tennessee to assess the impacts of regional air flow with regard to synoptic and mesoscale weather changes, wind direction shifts, and air quality. Meteorological data from 2008 2009 were analyzed from 13 meteorological sites along with associated upper level data. Up to 15 ancillary sites were used for reference. Two-step complete linkage and K-means cluster analyses, synoptic weather studies, and ambient meteorological comparisons were performed to generate hourly wind classifications. These wind regimes revealed seasonal variations of underlying physical wind mechanisms (forced channeled, vertically coupled, pressure-driven, and thermally-driven winds). Synoptic and ambient meteorological analysis (mixing depth, pressure gradient, pressure gradient ratio, atmospheric and surface stability) suggested up to 93% accuracy for the clustered results. Probabilistic prediction schemes of wind flow and wind class change were developed through characterization of flow change data and wind class succession. Data analysis revealed that wind flow in the Great Valley was dominated by forced channeled winds (45 67%) and vertically coupled flow (22 38%). Down-valley pressure-driven and thermally-driven winds also played significant roles (0 17% and 2 20%, respectively), usually accompanied by convergent wind patterns (15 20%) and large wind direction shifts, especially in the Central/Upper Great Valley. The behavior of most wind regimes was associated with detectable pressure differences between the Lower and Upper Great Valley. Mixing depth and synoptic pressure gradients were significant contributors to wind pattern behavior. Up to 15 wind classes and 10 sub-classes were identified in the Central Great Valley with 67 joined classes for the Great Valley at-large. Two-thirds of Great Valley at-large flow was defined by 12 classes. Winds flowed on-axis only 40% of the time. The Great Smoky Mountains helped create down-valley pressure-driven winds, downslope mountain breezes, and divergent air flow. The Cumberland Mountains and Plateau were associated with wind speed reductions in the Central Great Valley, Emory Gap Flow, weak thermally-driven winds, and northwesterly down sloping. Ridge-and-valley terrain enhanced wind direction reversals, pressure-driven winds, as well as locally and regionally produced thermally-driven flow.

  1. Stimulated emission and optical gain in AlGaN heterostructures grown on bulk AlN substrates

    SciTech Connect (OSTI)

    Guo, Wei, E-mail: wguo2@ncsu.edu; Bryan, Zachary; Kirste, Ronny; Bryan, Isaac; Hussey, Lindsay; Bobea, Milena; Haidet, Brian; Collazo, Ramón; Sitar, Zlatko [Department of Materials Science and Engineering, North Carolina State University, Raleigh, North Carolina 27695-7919 (United States); Xie, Jinqiao; Mita, Seiji [HexaTech, Inc., 991 Aviation Pkwy, Suite 800, Morrisville, North Carolina 27560 (United States); Gerhold, Michael [Engineering Science Directorate, Army Research Office, P.O. BOX 12211, Research Triangle Park, North Carolina 27703 (United States)

    2014-03-14

    Optical gain spectra for ?250?nm stimulated emission were compared in three different AlGaN-based structures grown on single crystalline AlN substrates: a single AlGaN film, a double heterostructure (DH), and a Multiple Quantum Well (MQW) structure; respective threshold pumping power densities of 700, 250, and 150?kW/cm{sup 2} were observed. Above threshold, the emission was transverse-electric polarized and as narrow as 1.8?nm without a cavity. The DH and MQW structures showed gain values of 50–60?cm{sup ?1} when pumped at 1?MW/cm{sup 2}. The results demonstrated the excellent optical quality of the AlGaN-based heterostructures grown on AlN substrates and their potential for realizing electrically pumped sub-280?nm laser diodes.

  2. Uganda-UNDP Territorial Approach to Climate Change (TACC) in Eastern Uganda

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S. EPAEnergy Informationin Africa | Open|

  3. ALS user meeting features 10th anniversary celebration

    SciTech Connect (OSTI)

    Robinson, Art

    2003-12-05

    The Advanced Light Source (ALS) saw first light on October 5, 1993, not quite to the day but close to 10 years before the 2003 ALS Users Association meeting, held October 6-8. Fittingly, the proceedings included retrospectives from two of the key players in the early history of the ALS, David Attwood and Jay Marx, and a display of photographs chronicling its construction and commissioning. Science highlights, highlights from young researchers, and posters constituted the meat of the program on Monday and Tuesday morning, while workshops took over Tuesday afternoon and all day Wednesday.

  4. DNP-Nurse Anesthesia TN Tuition O/S Tuition

    E-Print Network [OSTI]

    Cui, Yan

    ,286.00 200.00 3rd Year Totals Total 16,442.00 39,626.00 214.00 386.00 38.00 218.00 2,126.00 1,540.00 23 are in the 2nd academic year. Year 2 Fall and Spring and Year 3 Summer are in the 3rd academic year. Lastly.00 3,876.00 10,080.00 15,876.00 1,790.00 1st Year Totals Total 4,114.00 9,910.00 80.00 96.00 60.00 20

  5. NASA TECHNICAL NOTE NASA TN D----LUNAR LANDING AND

    E-Print Network [OSTI]

    Rathbun, Julie A.

    , Virginia 22151 - Price $1.00 i #12;LUNAR LANDING AND SmTE SEIXCTION STUDY By James L. Lewis and Charles D t with the use of mini" fuel, under abnormal lighting conditions, and over unfamiliar t e r r a i n void , starting at 1000 f e e t altitude 3. Study trajectory shape as a function of brightness level. A Marine UH

  6. Thomas G. Thompson TN121 23 February 12 March, 2001

    E-Print Network [OSTI]

    Key, Kerry

    transmitter broadcasts energy to seafloor electric field recorders, and magnetotelluric (MT) sounding on the transit back to San Diego (to evaluate the effect of the coast on the MT fields). These instruments will be recovered from the New Horizon in August 2001 during the second leg. Intermsofshipuseanddatacollection

  7. NCAR/TN-450+IA NCAR TECHNICAL NOTE

    E-Print Network [OSTI]

    Potter, Don

    and creep mutation . . . . . . . .. . . . .. . . . . .. . . . .. . . . 34 3.6 Performance on test problems . . .. . . . .. . . . .. . . . . . . . . . .. . . . .. . . . . .. . . . .. . . . . .7 1.4 A set of test problems Test problem P2

  8. ERDC/TN APCRP-BC-18 December 2010

    E-Print Network [OSTI]

    US Army Corps of Engineers

    conducted at the U.S. Army Engineer Research and Development Center (ERDC), Vicksburg, MS, from February to June 2006. The experiments used 3.5-L polycarbonate containers (18-cm diameter by 21-cm height) filled

  9. DOE - Office of Legacy Management -- Knoxville Iron Co - TN 07

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont,Manufacturing - OH 40 John VanKnolls

  10. P.O. Box 117, Oak Ridge, TN 37831

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesseworkSURVEYI/O Streams forOrhan Kizilkaya,P. Leslie Dutton P. Leslie

  11. Climate Action Champions: Knoxville, TN | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electric vehicle (PEV) chargingWASHINGTON, DCThe City of Dubuque,

  12. A regional scale modeling analysis of aerosol and trace gas distributions over the eastern Pacific during the INTEX-B field campaign

    E-Print Network [OSTI]

    2010-01-01

    A. C. , Kimmel, J. R. , Peltier, R. E. , Weber, R. J. ,125 ? W longitude. The Peltier et al. (2008) criteria usedDunlea et al. (2009) and Peltier et al. (2008) for the same

  13. Geochemistry of the Banded Iron Formations and their Host Rocks in the Eastern Desert of Egypt BACKUS, Ethan L.1, GAGNON, Kelli E.1, EL-SHAZLY, Aley K.1, and KHALIL, Khalil Isaac2

    E-Print Network [OSTI]

    El-Shazly, Aley

    Geochemistry of the Banded Iron Formations and their Host Rocks in the Eastern Desert of Egypt University, Egypt Sponsored by NSF-OISE-1004021 Session 92:T3. Sigma Gamma Epsilon Undergraduate Research over 30,000 km2 in the central Eastern Desert of Egypt. The deposits most resemble Algoma-type iron

  14. Hillebrand 1 A comparison of tectonics of the eastern Sierra Nevada, CA in the vicinity of Mt. Whitney and

    E-Print Network [OSTI]

    Shuster, David L.

    thought to show a low Cenozoic geothermal gradient of ~6 °C/km, but (U-T)/He data from House et al. (1997) shows that a moderate geotherm of ~25 °C/km is required for their age-elevation profile. Brady et al

  15. Comment on the narrow structure reported by Amaryan et al

    E-Print Network [OSTI]

    M. Anghinolfi; J. Ball; N. A. Baltzell; M. Battaglieri; I. Bedlinskiy; M. Bellis; A. S. Biselli; C. Bookwalter; S. Boiarinov; P. Bosted; V. D. Burkert; D. S. Carman; A. Celentano; S. Chandavar; P. L. Cole; V. Crede; R. De Vita; E. De Sanctis; B. Dey; R. Dickson; D. Doughty; M. Dugger; R. Dupre; H. Egiyan; A. El Alaoui; L. El Fassi; L. Elouadrhiri; P. Eugenio; G. Fedotov; M. Y. Gabrielyan; M. Garcon; G. P. Gilfoyle; K. L. Giovanetti; F. X. Girod; J. T. Goetz; E. Golovatch; M. Guidal; L. Guo; K. Hafidi; H. Hakobyan; D. Heddle; K. Hicks; M. Holtrop; D. G. Ireland; B. S. Ishkhanov; E. L. Isupov; H. S. Jo; K. Joo; P. Khetarpal; A. Kim; W. Kim; V. Kubarovsky; S. V. Kuleshov; H. Y. Lu; L. J. D. MacGregor; N. Markov; M. E. McCracken; B. McKinnon; M. D. Mestayer; C. A. Meyer; M. Mirazita; V. Mokeev; K. Moriya; B. Morrison; A. Ni; S. Niccolai; G. Niculescu; I. Niculescu; M. Osipenko; A. I Ostrovidov; K. Park; S. Park; S. Anefalos Pereira; S. Pisano; O. Pogorelko; S. Pozdniakov; J. W. Price; G. Ricco; M. Ripani; B. G. Ritchie; P. Rossi; D. Schott; R. A. Schumacher; E. Seder; Y. G. Sharabian; E. S. Smith; D. I Sober; S. S. Stepanyan; P. Stoler; W. Tang; M. Ungaro; B. Vernarsky; M. F. Vineyard; D. P. Weygand; M. H. Wood; N. Zachariou; B. Zhao

    2012-04-05

    The CLAS Collaboration provides a comment on the physics interpretation of the results presented in a paper published by M. Amaryan et al. regarding the possible observation of a narrow structure in the mass spectrum of a photoproduction experiment.

  16. Concrete Industry Benefits from Ancient Romans and the ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the model basis for C-A-S-H. The Al-tobermorite is produced by reaction of seawater, lime, and a particular volcanic ash that the Romans used in their concrete mixture. "Cement...

  17. He ion irradiation damage to Al/Nb multilayers

    SciTech Connect (OSTI)

    Misra, Amit; Li, Nan; Martin, M S; Anderoglu, Osman; Shao, L; Wang, H; Zhang, X

    2009-01-01

    We investigated the evolution of microstructure and mechanical properties of sputter-deposited Al/Nb multilayers with individual layer thickness, h, of 1-200 nm, subjected to helium ion irradiations: 100 keV He{sup +} ions with a dose of 6 x 10{sup 16}/cm{sup 2}. Helium bubbles, 1-2 nm in diameter, were observed. When h is greater than 25 nm, hardnesses of irradiated multilayers barely change, whereas radiation hardening is more significant at smaller h. Transmission electron microscopy and scanning transmission electron microscopy studies reveal the formation of a thin layer of Nb{sub 3}Al intermetallic along the Al/Nb interface as a consequence of radiation induced intermixing. The dependence of radiation hardening on h is interpreted by using a composite model considering the formation of the hard Nb{sub 3}Al intermetallic layer.

  18. ALS Global Agroecosystems 2014 -page 1 Global Agroecosystems

    E-Print Network [OSTI]

    Ma, Lena

    . House. 2010. Sustainable agroecosystem management: Integrating ecology, economics, and society. CRC Crop Production (AGR 4214C), and Agricultural Ecology (ALS 3153), or equivalents, or approval of topics that integrate ecological with agricultural principles to optimize resource conservation

  19. ALS X-Rays Shine a New Light on Catalysis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    times science has used high-brilliance x-rays to look so closely at these reactions. Lead author Dr. David Mueller at the ALS using x-rays to characterize working fuel cells....

  20. California Building Industry Association et al. v. State Water...

    Open Energy Info (EERE)

    California Building Industry Association et al. v. State Water Resources Control Board Jump to: navigation, search OpenEI Reference LibraryAdd to library Legal CaseHearing:...

  1. TI--CR--AL--O thin film resistors

    DOE Patents [OSTI]

    Jankowski, Alan F. (Livermore, CA); Schmid, Anthony P. (Solana Beach, CA)

    2000-01-01

    Thin films of Ti--Cr--Al--O are used as a resistor material. The films are rf sputter deposited from ceramic targets using a reactive working gas mixture of Ar and O.sub.2. Resistivity values from 10.sup.4 to 10.sup.10 Ohm-cm have been measured for Ti--Cr--Al--O film <1 .mu.m thick. The film resistivity can be discretely selected through control of the target composition and the deposition parameters. The application of Ti--Cr--Al--O as a thin film resistor has been found to be thermodynamically stable, unlike other metal-oxide films. The Ti--Cr--Al--O film can be used as a vertical or lateral resistor, for example, as a layer beneath a field emission cathode in a flat panel display; or used to control surface emissivity, for example, as a coating on an insulating material such as vertical wall supports in flat panel displays.

  2. Klystron "efficiency loop" for the ALS storage ring RF system

    E-Print Network [OSTI]

    Kwiatkowski, Slawomir; Julian, Jim; Baptiste, Kenneth

    2002-01-01

    to Mod, Feb. 7, 2002] SRRF Klystron Beam Current (A) [AfterTime (hrs) Figure 2: SRRF Klystron Efficiency Comparison forKLYSTRON “EFFICIENCY LOOP” FOR THE ALS STORAGE RING RF

  3. Six Berkeley Lab (Three ALS) Scientists Are 2012 APS Fellows

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of whom are currently or have previously been at the ALS. Only half of one percent of APS members are elected by their peers to be Fellows in any given year for exceptional...

  4. AlGaN/GaN-based power semiconductor switches

    E-Print Network [OSTI]

    Lu, Bin, Ph. D. Massachusetts Institute of Technology

    2013-01-01

    AlGaN/GaN-based high-electron-mobility transistors (HEMTs) have great potential for their use as high efficiency and high speed power semiconductor switches, thanks to their high breakdown electric field, mobility and ...

  5. The Complete Genome Sequence of Bacillus thuringiensis AlHakam

    SciTech Connect (OSTI)

    Challacombe, Jean F.; Altherr, Michael R.; Xie, Gary; Bhotika,Smriti S.; Brown, Nancy; Bruce, David; Campbell, Connie S.; Campbell,Mary L.; Chen, Jin; Chertkov, Olga; Cleland, Cathy; Dimitrijevic, Mira; Doggett, Norman A.; Fawcett, John J.; Glavina, Tijana; Goodwin, Lynne A.; Green, Lance D.; Han, Cliff S.; Hill, Karen K.; Hitchcock, Penny; Jackson, Paul J.; Keim, Paul; Kewalramani, Avinash Ramesh; Longmire, Jon; Lucas, Susan; Malfatti, Stephanie; Martinez, Diego; McMurry, Kim; Meincke, Linda J.; Misra, Monica; Moseman, Bernice L.; Mundt, Mark; Munk,A. Christine; Okinaka, Richard T.; Parson-Quintana, B.; Reilly, LeePhilip; Richardson, Paul; Robinson, Donna L.; Rubin, Eddy; Saunders,Elizabeth; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson,Linda S.; Tice, Hope; Ticknor, Lawrence O.; Wills, Patti L.; Gilna, Paul; Brettin, Thomas S.

    2007-04-01

    Bacillus thuringiensis is an insect pathogen that is widelyused as a biopesticide (3). Here we report the finished, annotated genomesequence of B. thuringiensis Al Hakam, which was collected in Iraq by theUnited Nations Special Commission (2).

  6. Homenaje nacional al maestro Carballido: Setenta años de Carballido

    E-Print Network [OSTI]

    Bixler, Jacqueline Eyring

    1995-10-01

    , comenzó el homenaje al Carballido dramaturgo con una ceremonia en Xalapa, donde se celebraron los 25 años de Tramoya, la revista de teatro que Carballido fundó y que sigue dirigiendo hoy en día. Después, se presentaron en la Ciudad de México dos mesas... redondas en torno al teatro de Carballido. La primera tuvo lugar en un sitio muy apropiado, el nuevo Centro Nacional de las Artes. En esta mesa, dedicada a "Carballido en el mundo," participaron dos investigadoras norteamericanas (Margaret Peden, de la...

  7. Discovery of a metastable Al20Sm4 phase

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ye, Z.; Zhang, F.; Sun, Y.; Mendelev, M. I.; Ott, R. T.; Park, E.; Besser, M. F.; Kramer, M. J.; Ding, Z.; Wang, C. -Z.; et al

    2015-03-09

    In this study, we present an efficient genetic algorithm, integrated with experimental diffraction data, to solve a nanoscale metastable Al20Sm4 phase that evolves during crystallization of an amorphous magnetron sputtered Al90Sm10 alloy. The excellent match between calculated and experimental X-ray diffraction patterns confirms an accurate description of this metastable phase. Molecular dynamic simulations of crystal growth from the liquid phase predict the formation of disordered defects in the devitrified crystal.

  8. ALS beamline design requirements: A guide for beamline designers

    SciTech Connect (OSTI)

    1996-06-01

    This manual is written as a guide for researchers in designing beamlines and endstations acceptable for use at the ALS. It contains guidelines and policies related to personnel safety and equipment and vacuum protection. All equipment and procedures must ultimately satisfy the safety requirements set aside in the Lawrence Berkeley National Laboratory (LBNL) Health and Safety Manual (PUB-3000) which is available from the ALS User Office or on the World WideWeb from the LBNL Homepage (http:// www.lbl.gov).

  9. Hypothetical AlF{sub 3} crystal structures

    SciTech Connect (OSTI)

    Le Bail, Armel . E-mail: alb@cristal.org; Calvayrac, Florent . E-mail: Florent.Calvayrac@univ-lemans.fr

    2006-10-15

    Applying a structure prediction computer programme (GRINSP=Geometrically Restrained INorganic Structure Prediction), the occurrence of 6-connected 3D networks was investigated, through AlF{sub 6} octahedra exclusive corner sharing. The five known AlF{sub 3} varieties were reproduced ({alpha}-, {beta}-, {eta}-, {kappa}- and {tau}-AlF{sub 3}) and seven hypothetical models were predicted. Among these still to be synthesized AlF{sub 3} phases, one can recognize two known structure t (TlCa{sub 2}Ta{sub 5}O{sub 15}, Ba{sub 4}CoTa{sub 10}O{sub 30}) and some easy to imagine intergrowths; however, a few others are completely unexpected, though simple. A comparison of the ab initio total energies of all the structures is provided, leading to the conclusion that the virtual models could well be viable. - Graphical abstract: Hypothetical AlF{sub 3} structure with a dense packing of corner-sharing AlF{sub 6} octahedra packed in tetrahedral blocks.

  10. RHQT Nb3Al 15-Tesla magnet design study

    SciTech Connect (OSTI)

    Yamada, R.; Ambrosio, G.; Barzi, E.; Kashikin, V.; Kikuchi, A.; Novitski, I.; Takeuchi, T.; Wake, M.; Zlobin, A.; /Fermilab /NIMC, Tsukuba /KEK, Tsukuba

    2005-09-01

    Feasibility study of 15-Tesla dipole magnets wound with a new copper stabilized RHQT Nb{sub 3}Al Rutherford cable is presented. A new practical long copper stabilized RHQT Nb{sub 3}Al strand is presented, which is being developed and manufactured at the National Institute of Material Science (NIMS) in Japan. It has achieved a non-copper J{sub c} of 1000A/mm{sup 2} at 15 Tesla at 4.2K, with a copper over non-copper ratio of 1.04, and a filament size less than 50 microns. For this design study a short Rutherford cable with 28 Nb{sub 3}Al strands of 1 mm diameter will be fabricated late this year. The cosine theta magnet cross section is designed using ROXIE, and the stress and strain in the coil is estimated and studied with the characteristics of the Nb{sub 3}Al strand. The advantages and disadvantages of the Nb{sub 3}Al cable are compared with the prevailing Nb{sub 3}Sn cable from the point of view of stress-strain, J{sub c}, and possible degradation of stabilizer due to cabling. The Nb{sub 3}Al coil of the magnet, which will be made by wind and react method, has to be heat treated at 800 degree C for 10 hours. As preparation for the 15 Tesla magnet, a series of tests on strand and Rutherford cables are considered.

  11. Vertical transmission of TnSNPV, TnCPV, AcMNPV, and possibly recombinant NPV in Trichoplusia ni

    E-Print Network [OSTI]

    Hammock, Bruce D.

    ; Risk assessment 1. Introduction Vertical transmission, or parent-to-offspring passage of a pathogenic microorganism, is a phenomenon commonly observed with insect viruses. Such transmis- sion is common pathogens generally is not critical for maintaining their populations in nature nor does it correlate

  12. * Middle Tennessee State University, Department of Physics and Astronomy, Murfreesboro, TN 37132 Vanderbilt University, Department of Chemistry, Nashville, TN 37235

    E-Print Network [OSTI]

    advantages over current silicon based solar cells. CdSe nanocrystals are facile and cost efficient to produce Current silicon based solar cells are limited, not due to advances in technology, but due to the physics of nanostructures to glass/ ITO substrate. Construct a device, test, and plot current-voltage data to find overall

  13. Adhesion and nonwetting-wetting transition in the Al -Al2O3 interface Qing Zhang, Tahir C agin, Adri van Duin, and William A. Goddard III

    E-Print Network [OSTI]

    Goddard III, William A.

    Adhesion and nonwetting-wetting transition in the AlÕ -Al2O3 interface Qing Zhang, Tahir C¸ agin 2004 Using a reactive force field ReaxFF , we investigated the structural, energetic, and adhesion and analysis of wetting and adhesion strength of liquid Al on an -Al2O3 surface via the sessile drop method.1

  14. ALS beamlines for independent investigators: A summary of the capabilities and characteristics of beamlines at the ALS

    SciTech Connect (OSTI)

    Not Available

    1992-08-01

    There are two mods of conducting research at the ALS: To work as a member of a participating research team (PRT). To work as a member of a participating research team (PRT); to work as an independent investigator; PRTs are responsible for building beamlines, end stations, and, in some cases, insertion devices. Thus, PRT members have privileged access to the ALS. Independent investigators will use beamline facilities made available by PRTs. The purpose of this handbook is to describe these facilities.

  15. Optically pumped cerium-doped LiSrAlF{sub 6} and LiCaAlF{sub 6}

    DOE Patents [OSTI]

    Marshall, C.D.; Payne, S.A.; Krupke, W.F.

    1996-05-14

    Ce{sup 3+}-doped LiSrAlF{sub 6} crystals are pumped by ultraviolet light which is polarized along the c axis of the crystals to effectively energize the laser system. In one embodiment, the polarized fourth harmonic light output from a conventional Nd:YAG laser operating at 266 nm is arranged to pump Ce:LiSrAlF{sub 6} with the pump light polarized along the c axis of the crystal. The Ce:LiSrAlF{sub 6} crystal may be placed in a laser cavity for generating tunable coherent ultraviolet radiation in the range of 280-320 nm. Additionally, Ce-doped crystals possessing the LiSrAlF{sub 6} type of chemical formula, e.g. Ce-doped LiCaAlF{sub 6} and LiSrGaF{sub 6}, can be used. Alternative pump sources include an ultraviolet-capable krypton or argon laser, or ultraviolet emitting flashlamps. The polarization of the pump light will impact operation. The laser system will operate efficiently when light in the 280-320 nm gain region is injected or recirculated in the system such that the beam is also polarized along the c axis of the crystal. The Ce:LiSrAlF{sub 6} laser system can be configured to generate ultrashort pulses, and it may be used to pump other devices, such as an optical parametric oscillator. 10 figs.

  16. Optically pumped cerium-doped LiSrAlF.sub.6 and LiCaAlF.sub.6

    DOE Patents [OSTI]

    Marshall, Christopher D. (Livermore, CA); Payne, Stephen A. (Castro Valley, CA); Krupke, William F. (Pleasanton, CA)

    1996-01-01

    Ce.sup.3+ -doped LiSrAlF.sub.6 crystals are pumped by ultraviolet light which is polarized along the c axis of the crystals to effectively energize the laser system. In one embodiment, the polarized fourth harmonic light output from a conventional Nd:YAG laser operating at 266 nm is arranged to pump Ce:LiSrAlF.sub.6 with the pump light polarized along the c axis of the crystal. The Ce:LiSrAlF.sub.6 crystal may be placed in a laser cavity for generating tunable coherent ultraviolet radiation in the range of 280-320 nm. Additionally, Ce-doped crystals possessing the LiSrAlF.sub.6 type of chemical formula, e.g. Ce-doped LiCaAlF.sub.6 and LiSrGaF.sub.6, can be used. Alternative pump sources include an ultraviolet-capable krypton or argon laser, or ultraviolet emitting flashlamps. The polarization of the pump light will impact operation. The laser system will operate efficiently when light in the 280-320 nm gain region is injected or recirculated in the system such that the beam is also polarized along the c axis of the crystal. The Ce:LiSrAlF.sub.6 laser system can be configured to generate ultrashort pulses, and it may be used to pump other devices, such as an optical parametric oscillator.

  17. First evidence of a distal early Holocene ash layer in Eastern Mediterranean deep-sea sediments derived from the Anatolian volcanic province

    E-Print Network [OSTI]

    Gilli, Adrian

    First evidence of a distal early Holocene ash layer in Eastern Mediterranean deep-sea sediments-4445, USA c Hacettepe University, Department of Geological Engineering, 06532 Beytepe-Ankara, Turkey d volcanic eruptions and distributed by tropospheric and stratospheric wind regimes and water currents can

  18. Proceedings of the 4th Fire in Eastern Oak Forests Conference 207GTR-NRS-P-102 GENESIS OF AN OAK-FIRE SCIENCE CONSORTIUM

    E-Print Network [OSTI]

    Proceedings of the 4th Fire in Eastern Oak Forests Conference 207GTR-NRS-P-102 GENESIS OF AN OAK-FIRE and to identify fire information needs of oak-dominated communities such as woodlands, forests, savannas through the Forest Service's Northern Research Station. Smaller groups such as the Fire Learning Network

  19. Age constraints on the formation and emplacement of Neoproterozoic ophiolites along the AllaqiHeiani Suture, South Eastern Desert of Egypt

    E-Print Network [OSTI]

    Stern, Robert J.

    ­Heiani Suture, South Eastern Desert of Egypt K.A. Ali a,d, , M.K. Azer b , H.A. Gahlan c , S.A. Wilde d , M., Richardson, TX 75080, USA b Geology Department, National Research Centre, Dokki-Cairo, Egypt c Geology Department, Faculty of Science, Assiut University, Assiut 71516, Egypt d Department of Applied Geology

  20. The El Mayah molasse basin in the Eastern Desert of Egypt A. Shalaby a,b,*, K. Stuwe a,*, H. Fritz a

    E-Print Network [OSTI]

    Fritz, Harald

    The El Mayah molasse basin in the Eastern Desert of Egypt A. Shalaby a,b,*, K. Stu¨we a,*, H. Fritz, Austria b Department of Geology, Mansoura University, Mansoura, Egypt Received 8 September 2004; received of kilometres of the East- ern Desert of Egypt. Its sedimentary record shows that deposition occurred in two

  1. Canopy disturbance history of old-growth Quercus alba sites in the eastern United States: Examination of long-term trends and broad-scale patterns

    E-Print Network [OSTI]

    Hart, Justin

    our understanding of natural disturbance frequency, community dynamics, and changes in forest systems disturbance include changes in drought frequency and intensity, changes in anthropogenic land use (i.e. timberCanopy disturbance history of old-growth Quercus alba sites in the eastern United States

  2. GEOPHYSICAL RESEARCH LETTERS, VOL. 0, NO. 0, PAGES 0-0, M 0, 2000 Tsunamis Within the Eastern Santa Barbara Channel

    E-Print Network [OSTI]

    Synolakis, Costas E.

    GEOPHYSICAL RESEARCH LETTERS, VOL. 0, NO. 0, PAGES 0-0, M 0, 2000 Tsunamis Within the Eastern Santa California, Los Angeles CA, 90089-2531 Abstract. Several locally generated tsunamis have been reported in Southern California during the past 200 years, yet the hazard from locally generated tsunamis has received

  3. Deep-SeaResearch, 1974,Vol.21,pp. 481 to 488.PergamonPress.Printed in Great Britain. Dissolved hydrocarbons in the eastern Gulf of Mexico Loop Current

    E-Print Network [OSTI]

    Iliffe, Thomas M.

    hydrocarbons in the eastern Gulf of Mexico Loop Current and the Caribbean Sea THOMASM. ILIFFE*and JOHNA. CALDER---Concentrations of dissolved non-polar hydrocarbons extracted from waters taken at several stations and depths in the Gulf THEREhave been few studies of the dissolved hydrocarbons in seawater. BLU~R (1970) reported carbon numbers

  4. Detrital-zircon geochronology of the eastern Magallanes foreland basin: Implications for Eocene kinematics of the northern Scotia Arc and Drake Passage

    E-Print Network [OSTI]

    Swanson-Hysell, Nicholas

    Detrital-zircon geochronology of the eastern Magallanes foreland basin: Implications for Eocene Editor: T.M. Harrison Keywords: provenance Drake Passage Antarctica Andes U/Pb geochronology U/Pb detrital-zircon geochronology of eleven sandstones collected from Cretaceous through Oligocene strata

  5. Comparison of high-pressure CO2 sorption isotherms on Eastern and Western US coals

    SciTech Connect (OSTI)

    Romanov, V; Hur, T -B; Fazio, J; Howard, B

    2013-10-01

    Accurate estimation of carbon dioxide (CO2) sorption capacity of coal is important for planning the CO2 sequestration efforts. In this work, we investigated sorption and swelling behavior of several Eastern and Western US coal samples from the Central Appalachian Basin and from San Juan Basin. The CO2 sorption isotherms have been completed at 55°C for as received and dried samples. The role of mineral components in coal, the coal swelling, the effects of temperature and moisture, and the error propagation have been analyzed. Changes in void volume due to dewatering and other factors such as temporary caging of carbon dioxide molecules in coal matrix were identified among the main factors affecting accuracy of the carbon dioxide sorption isotherms. The (helium) void volume in the sample cells was measured before and after the sorption isotherm experiments and was used to build the volume-corrected data plots.

  6. Elastic buckling of AlN ribbons on elastomeric substrate

    SciTech Connect (OSTI)

    Seo, H.-C.; Petrov, Ivan; Jeong, Hyejin; Chapman, Patrick; Kim, Kyekyoon

    2009-03-02

    For optoelectronic applications requiring unconventional substrates, use of flexible forms of semiconductors may be inevitable. We have fabricated a flexible form of single crystalline AlN ribbons with periodic and wavelike structures on an elastomeric substrate. Single crystalline AlN films were grown on Si (111) substrate using high vacuum unbalanced magnetron sputtering. Crystallinity of the AlN films was confirmed with x-ray diffraction and pole figure. The AlN ribbons were transferred to a prestrained (3.1%) elastomeric substrate and the resulting ''wavy'' ribbons on the substrate were flexible up to 30% strain without any crack formation on the surface. As the film thickness changed from 300 to 900 nm, the periods of the waves varied from 95 to 277 {mu}m, which were within a 10% error of the calculated values. When we applied more than 30% strain, mechanical instability, such as the failure of AlN ribbons due to the cracks on the surface and the merged ribbons, was observed.

  7. Breeding pond selection and movement patterns by eastern spadefoot toads (Scaphiopus holbrookii) in relation to weather and edaphic conditions.

    SciTech Connect (OSTI)

    Greenberg, Cathyrn, H.; Tanner, George, W.

    2004-08-31

    Cathryn H. Greenberg and George W. Tanner. 2004. Breeding pond selection and movement patterns by eastern spadefoot toads (Scaphiopus holbrookii) in relation to weather and edaphic conditions. J. Herp. 38(4):569-577. Abstract: Eastern Spadefoot Toads (Scaphiopus holbrookii) require fish-free, isolated, ephemeral ponds for breeding but otherwise inhabit the surrounding uplands, commonly xeric longleaf pine (Pinus palustris) ?wiregrass (Aristida beyrichiana). Hence both pond and upland conditions can potentially affect their breeding biology, and population persistence. Hardwood invasion due to fire suppression in sandhills could alter upland and pond suitability by higher hardwood density and increased transpiration. In this paper we explore breeding and neonatal emigration movements in relation to weather, hydrological conditions of ponds, and surrounding upland matrices. We use 9 years of data from continuous monitoring with drift fences and pitfall traps at 8 ephemeral ponds in 2 upland matrices: regularly-burned, savanna-like sandhills (n = 4), and hardwood-invaded sandhills (n = 4). Neither adult nor neonate captures differed between ponds within the 2 upland matrices, suggesting that they are tolerant of upland heterogeneity created by fire frequency. Explosive breeding occurred during 9 periods and in all seasons; adults were captured rarely otherwise. At a landscape-level rainfall, maximum change in barometric pressure, and an interaction between those 2 variables were significant predictors of explosive breeding. At a pond-level, rainfall, change in pond depth during the month prior to breeding, and days since a pond was last dry were significant predictors of adult captures. Transformation date, rather than weather, was associated with neonatal emigrations, which usually were complete within a week. Movement by first-captured adults and neonates was directional, but adult emigrations were apparently not always toward their origin. Our results suggest that Spadefoot Toads are highly adapted to breeding conditions and upland habitat heterogeneity created by weather patterns and fire frequency in Florida sandhills.

  8. La Formación Literaria de Agustín Yáñez y Al Filo del Agua: Formación literaria y temperamento

    E-Print Network [OSTI]

    Martínez, José Luis

    1983-01-01

    a A. Y. : Al filo del agua, op. cit. , p. X. Salvador Reyes299. 20. A. Y. : Al filo del agua, p. 113ss. 21. Ibidem, p.de Agustín Yáñez y Al Filo del Agua FORMACIÓN LITERARIA Y

  9. Bendable X-ray Optics at the ALS: Design, Tuning, Performance and Applications

    E-Print Network [OSTI]

    Yashchuk, Valeriy V.; Advanced Light Source, Lawrence Berkeley National Laboratory

    2008-01-01

    BENDABLE X-RAY OPTICS AT THE ALS: DESIGN, TUNING,ALS) of bendable x- ray optics widely used for focusing ofAn example of a bendable optic used at ALS beamline 5.0.2.

  10. ADHERENCE OF A12O3 TO CoCrAl COATINGS

    E-Print Network [OSTI]

    Whittle, D.P.

    2010-01-01

    Conference on Metallurgical Coatings, San Diego, CA, Aprilfr ADHERENCE OF AlgOg TO CoCrAl COATINGS D. P. Whittle, D. HADHERENCE OF Al 0 TO CoCrAl COATINGS D. P. Whittle, D. H.

  11. Microsoft Word - AL-Consolidated Approps FY 2008 as of feb 21...

    Energy Savers [EERE]

    AL-Consolidated Approps FY 2008 as of feb 21 2008 final.doc Microsoft Word - AL-Consolidated Approps FY 2008 as of feb 21 2008 final.doc Microsoft Word - AL-Consolidated Approps FY...

  12. Solution-based thermodynamic modeling of the Ni-Al-Mo system...

    Office of Scientific and Technical Information (OSTI)

    (Al,Mo,Ni)0.75(Al,Mo,Ni)0.25. Thus, -fcc and -Ni3Al are modeled with a single Gibbs free energy function with appropriate treatment of the chemical ordering contribution. In...

  13. Comparative breeding ecology of Lesser Sandhill Cranes (Grus canadensis canadensis) and Siberian cranes (G. leucogeranus) in Eastern Siberia 

    E-Print Network [OSTI]

    Watanabe, Tsuyoshi

    2007-04-25

    in the Kytalyk Resource Reserve in July 2000. 22 of arctic polygonal tundra includes sedges (Carex spp.), cotton grasses (Eriophrum spp.), bluegrasses (Poa spp.), and dwarf willows (Salix spp.) (Uspenskii et al. 1962, Matveev 1989...

  14. Total and organic Hg concentrations in cephalopods from the North Eastern Atlantic waters: influence of geographical origin and feeding

    E-Print Network [OSTI]

    Boyer, Edmond

    %). With the exception of oceanic squids, the digestive gland globally displayed higher T-Hg concentrations than its toxicity as a result of its enhanced penetration through lipid membranes (Boudou et al. 1983

  15. Sorbent Injection for Small ESP Mercury Control in Low Sulfur Eastern Bituminous Coal Flue Gas

    SciTech Connect (OSTI)

    Carl Richardson; Katherine Dombrowski; Douglas Orr

    2006-12-31

    This project Final Report is submitted to the U.S. Department of Energy (DOE) as part of Cooperative Agreement DE-FC26-03NT41987, 'Sorbent Injection for Small ESP Mercury Control in Low Sulfur Eastern Bituminous Coal Flue Gas.' Sorbent injection technology is targeted as the primary mercury control process on plants burning low/medium sulfur bituminous coals equipped with ESP and ESP/FGD systems. About 70% of the ESPs used in the utility industry have SCAs less than 300 ft2/1000 acfm. Prior to this test program, previous sorbent injection tests had focused on large-SCA ESPs. This DOE-NETL program was designed to generate data to evaluate the performance and economic feasibility of sorbent injection for mercury control at power plants that fire bituminous coal and are configured with small-sized electrostatic precipitators and/or an ESP-flue gas desulfurization (FGD) configuration. EPRI and Southern Company were co-funders for the test program. Southern Company and Reliant Energy provided host sites for testing and technical input to the project. URS Group was the prime contractor to NETL. ADA-ES and Apogee Scientific Inc. were sub-contractors to URS and was responsible for all aspects of the sorbent injection systems design, installation and operation at the different host sites. Full-scale sorbent injection for mercury control was evaluated at three sites: Georgia Power's Plant Yates Units 1 and 2 [Georgia Power is a subsidiary of the Southern Company] and Reliant Energy's Shawville Unit 3. Georgia Power's Plant Yates Unit 1 has an existing small-SCA cold-side ESP followed by a Chiyoda CT-121 wet scrubber. Yates Unit 2 is also equipped with a small-SCA ESP and a dual flue gas conditioning system. Unit 2 has no SO2 control system. Shawville Unit 3 is equipped with two small-SCA cold-side ESPs operated in series. All ESP systems tested in this program had SCAs less than 250 ft2/1000 acfm. Short-term parametric tests were conducted on Yates Units 1 and 2 to evaluate the performance of low-cost activated carbon sorbents for removing mercury. In addition, the effects of the dual flue gas conditioning system on mercury removal performance were evaluated as part of short-term parametric tests on Unit 2. Based on the parametric test results, a single sorbent (e.g., RWE Super HOK) was selected for a 30-day continuous injection test on Unit 1 to observe long-term performance of the sorbent as well as its effects on ESP and FGD system operations as well as combustion byproduct properties. A series of parametric tests were also performed on Shawville Unit 3 over a three-week period in which several activated carbon sorbents were injected into the flue gas duct just upstream of either of the two Unit 3 ESP units. Three different sorbents were evaluated in the parametric test program for the combined ESP 1/ESP 2 system in which sorbents were injected upstream of ESP 1: RWE Super HOK, Norit's DARCO Hg, and a 62:38 wt% hydrated lime/DARCO Hg premixed reagent. Five different sorbents were evaluated for the ESP 2 system in which activated carbons were injected upstream of ESP 2: RWE Super HOK and coarse-ground HOK, Norit's DARCO Hg and DARCO Hg-LH, and DARCO Hg with lime injection upstream of ESP 1. The hydrated lime tests were conducted to reduce SO3 levels in an attempt to enhance the mercury removal performance of the activated carbon sorbents. The Plant Yates and Shawville studies provided data required for assessing carbon performance and long-term operational impacts for flue gas mercury control across small-sized ESPs, as well as for estimating the costs of full-scale sorbent injection processes.

  16. Multiscalar Ecological Characterization of Say's and Eastern Phoebes and their Zone of Contact in the Great Plains

    E-Print Network [OSTI]

    Schukman, John M.; Lira-Noriega, André s; Peterson, A. Townsend

    2011-05-01

    . J. DRAPEK. 2001. Climate change effects on vegetation distribution and car- bon budget in the United States. Ecosystems 4:164–185. BRATTON, G. F., F. R. SCHAEFER, AND J. R. BRANDLE. 1995. Conser- vation forestry for sustainable Great Plains... of invasive woody plants (Coppedge et al. 2001), changes in agroforestry (Bratton et al. 1995), and anticipated shifts in response to climate change (Peterson 2003) raise the question of how the balance between the earlier-nesting East- ern Phoebe...

  17. Deformation behavior and dislocation mechanisms in TiAl alloys

    SciTech Connect (OSTI)

    Sriram, S.; Vasudevan, V.K. [Univ. of Cincinnati, OH (United States). Dept. of Materials Science and Engineering; Dimiduk, D.M. [Wright Lab., Wright-Patterson AFB, OH (United States)

    1995-08-01

    Polycrystalline Ti-50 and Ti-52Al (in at.%) alloys, with large grain sizes (50Al-300{mu}m, 52Al-500{mu}m) and containing low ({approximately}250 wt.ppm) levels of oxygen were deformed under compression over a wide temperature range (77--1,173 K). The 0.2% proof stress-temperature profiles comprise of three distinct regimes: Regime 1 (between 77--{approximately}600 K), regime 2 (between {approximately}600--1,073 K), and regime 3 (above 1,073 K). Deformation temperature influences the types of dislocations present, the nature of superdislocation dissociations, and the morphological characteristics of both ordinary and super dislocations. Collectively, experiment and theory suggest that the flow properties at low temperatures (regime 1) are controlled by lattice friction, whereas at higher temperatures (regime 2) the properties are dislocation obstacle controlled.

  18. Compton Profile Study of Intermetallic Ti{sub 3}Al

    SciTech Connect (OSTI)

    Vyas, V.; Sharma, G. [Department of Physics, Banasthali University, Banasthali-304022 (India); Mishra, M. C.; Sharma, B. K. [Department of Physics, University of Rajasthan, Jaipur-302004 (India); Joshi, K. B. [Department of Physics, University College of Science, M.L.Sukhadia University, Udaipur-313 002 (India)

    2011-10-20

    The Compton scattering measurement on intermetallic alloy Ti{sub 3}Al is reported in this work. The measurement is made using 59.54 keV gamma-rays from Am{sup 241} source. Theoretical calculation of Compton profile is also performed employing CRYSTAL code within the framework of density functional theory to compare with the measurement. The theoretical profile of the alloy is also synthesized following the superposition model taking the published Compton profiles of elemental solids from the APW method. The experimental study of charge transfer in the alloys has also been done by performing the experimental Compton profile measurements on Ti and Al following the superposition model and charge transfer from Al to Ti is clearly seen on the alloy formation.

  19. Improving properties of Mg with Al–Cu additions

    SciTech Connect (OSTI)

    Rashad, Muhammad; Pan, Fusheng; Asif, Muhammad; Hussain, Shahid; Saleem, Muhammad

    2014-09-15

    The present work reports improvement in tensile properties of the Mg matrix reinforced with micron-sized copper–aluminum particulate hybrids. The Al–Cu particulate hybrids were incorporated into the Mg matrix through powder metallurgy method. The synthesized alloys exhibited homogeneously dispersed Mg{sub 2}Cu particles in the matrix, therefore leading to a 110% increase in yield strength (221 MPa) and a 72% enhancement in ultimate tensile strength (284 MPa) by addition of 1.0 wt.%Al–0.6 wt.%Cu particle hybrids. Optical microscopy, scanning election microscopy, transmission electron microscopy and X-ray diffraction were used to investigate the microstructure and intermetallic phases of the synthesized alloys. - Highlights: • Mg matrix is reinforced with Al–Cu particulate hybrids. • Powder metallurgic method is used to fabricate the alloys. • Tensile strength and ductility were increased simultaneously.

  20. Frequency Comparison of Two High-Accuracy Al+ Optical Clocks

    E-Print Network [OSTI]

    C. -W. Chou; D. B. Hume; J. C. J. Koelemeij; D. J. Wineland; T. Rosenband

    2010-02-02

    We have constructed an optical clock with a fractional frequency inaccuracy of 8.6e-18, based on quantum logic spectroscopy of an Al+ ion. A simultaneously trapped Mg+ ion serves to sympathetically laser-cool the Al+ ion and detect its quantum state. The frequency of the 1S0->3P0 clock transition is compared to that of a previously constructed Al+ optical clock with a statistical measurement uncertainty of 7.0e-18. The two clocks exhibit a relative stability of 2.8e-15/ sqrt(tau), and a fractional frequency difference of -1.8e-17, consistent with the accuracy limit of the older clock.

  1. CONTAINMENT EVALUATION OF BREACHED AL-SNF FOR CASK TRANSPORT

    SciTech Connect (OSTI)

    Vinson, D. W.; Sindelar, R. L.; Iyer, N. C.

    2005-11-07

    Aluminum-based spent nuclear fuel (Al-SNF) from foreign and domestic research reactors (FRR/DRR) is being shipped to the Savannah River Site. To enter the U.S., the cask with loaded fuel must be certified to comply with the requirements in the Title 10 of the U.S. Code of Federal Regulations, Part 71. The requirements include demonstration of containment of the cask with its contents under normal and accident conditions. Al-SNF is subject to corrosion degradation in water storage, and many of the fuel assemblies are ''failed'' or have through-clad damage. A methodology has been developed with technical bases to show that Al-SNF with cladding breaches can be directly transported in standard casks and maintained within the allowable release rates. The approach to evaluate the limiting allowable leakage rate, L{sub R}, for a cask with breached Al-SNF for comparison to its test leakage rate could be extended to other nuclear material systems. The approach for containment analysis of Al-SNF follows calculations for commercial spent fuel as provided in NUREG/CR-6487 that adopts ANSI N14.5 as a methodology for containment analysis. The material-specific features and characteristics of damaged Al-SNF (fuel materials, fabrication techniques, microstructure, radionuclide inventory, and vapor corrosion rates) that were derived from literature sources and/or developed in laboratory testing are applied to generate the four containment source terms that yield four separate cask cavity activity densities; namely, those from fines; gaseous fission product species; volatile fission product species; and fuel assembly crud. The activity values, A{sub 2}, are developed per the guidance of 10CFR71. The analysis is performed parametrically to evaluate maximum number of breached assemblies and exposed fuel area for a proposed shipment in a cask with a test leakage rate.

  2. AL2002-05.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s iof1AGGIE SOL TheAL2001-04.pdf MoreAL2002-05.pdf

  3. AL2002-07.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s iof1AGGIE SOL TheAL2001-04.pdfAL2002-07.pdf More

  4. AL2002-08.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s s iof1AGGIE SOL TheAL2001-04.pdfAL2002-07.pdf

  5. AL2007-03.doc | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment| DepartmentAL/FAL 99-01 More Documents &AL2007-03.doc&#0; More

  6. AL2008-06.pdf | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment| DepartmentAL/FAL 99-01 More Documents7-09.pdf More DocumentsAL 2008-06

  7. Sub-threshold production of $?$(1385) baryons in Al+Al collisions at 1.9$A$ GeV

    E-Print Network [OSTI]

    FOPI Collaboration; X. Lopez; N. Herrmann; P. Crochet

    2007-10-26

    First measurement of sub-threshold $\\Sigma$(1385) production is presented. Experimental data are presented for Al+Al reactions at 1.9$A$ GeV measured with the FOPI detector at SIS/GSI. The $\\Sigma$(1385)/$\\Lambda$ ratio is found to be in good agreement with the transport and statistical model predictions. The results allow for a better understanding of sub-threshold strangeness production and strangeness exchange reaction which is the dominant process for $K^-$ production below and close-to threshold.

  8. Systems Approach to Sustainable Energy Organizer: Al George

    E-Print Network [OSTI]

    Walter, M.Todd

    Systems Approach to Sustainable Energy Organizer: Al George October 28, 2009, 12:00 ­ 1:30 PM, Rice of energy than most of the world has had previously. At the same time our traditional fossil fuels to be caused by man's influence on the environment. In order to effect a smooth transition from existing energy

  9. O'Reilly et al 1 The Leabra Cognitive Architecture

    E-Print Network [OSTI]

    O'Reilly, Randall C.

    O'Reilly et al 1 The Leabra Cognitive Architecture: How to Play 20 Principles with Nature and Win of the neural basis of human cognition, the Leabra cognitive architecture, which explains a great deal of brain. Instead, a single cognitive architecture should be used to simulate a wide range of data at many levels

  10. Al convegno associata la rappresentazione teatrale del testo

    E-Print Network [OSTI]

    Di Pillo, Gianni

    Roma. Alan Turing's legacy | L'eredità di Alan Turing Roma 12 e 13 Ottobre 2012 Accoglienza dei nell'invenzione del computer Roberto Cordeschi e Guglielmo Tamburrini h. 12.15-13.00 Alan Turing e lAl convegno è associata la rappresentazione teatrale del testo La mela di Alan, dedicata a Alan

  11. Supporting Information Mustonen et al. 10.1073/pnas.0805909105

    E-Print Network [OSTI]

    Lässig, Michael

    sense for us to discuss statistical measures of the variation of the energy phenotype, rather than the statistics of a single numerical phenotype, energy, much more cleanly than the statistics of possible 14-bpSupporting Information Mustonen et al. 10.1073/pnas.0805909105 SI Text Abf1 and Reb1 Energy

  12. AL-TR-1995-XXXX INFORMATION INTEGRATION FOR

    E-Print Network [OSTI]

    Chen-Burger, Yun-Heh (Jessica)

    AL-TR-1995-XXXX INFORMATION INTEGRATION FOR CONCURRENT ENGINEERING (IICE) IDEF3 PROCESS DESCRIPTION DIVISION SEPTEMBER 1995 INTERIM TECHNICAL REPORT FOR PERIOD APRIL 1992 - SEPTEMBER 1995 Approved for public release; distribution is unlimited. #12;i September 1995 Interim - February 1991 to September 1995 IDEF3

  13. J.M. Tarascon, et al. , Electrochemical energy storage

    E-Print Network [OSTI]

    Canet, Léonie

    J.M. Tarascon, et al. , Electrochemical energy storage for renewable energies CNRS, Jeudi 3 Octobre 28 TW Renewable EnergiesRenewable EnergiesRenewable Energies WHY ENERGY STORAGE ? Billionsdebarils Integration of RES requires massive energy storage to improve grid , reliability, quality and utilization

  14. ARTIFICIAL INTELLIGENCE Irish Al research pushes onto international stage

    E-Print Network [OSTI]

    Foley, Simon

    ARTIFICIAL INTELLIGENCE Irish Al research pushes onto international stage Since 2001, when 4C into the international league in terms of artificial intelligence and constraints programming. The 4C centre (Cork this quarter. Four papers were accepted by the American Association for Artificial Intelligence Conference

  15. Spin glass behavior in FeAl

    E-Print Network [OSTI]

    Lue, CS; Oner, Y.; Naugle, Donald G.; Ross, JH.

    2001-01-01

    and do not exhibit the be- havior attributed to rare-earth and actinide systems. FeAl2, however, clearly shows local-moment behavior leading to a spin-glass freezing at low temperatures. The resistivity of this material is large, comparable in size...

  16. Laehnemann et al. Genomics of rapid adaptation to antibiotics

    E-Print Network [OSTI]

    Beardmore, Robert

    Laehnemann et al. RESEARCH Genomics of rapid adaptation to antibiotics: Convergent evolution of antibiotic resistance in bacteria. The genomic underpinnings of such rapid changes may provide information use experimentally evolved Escherichia coli for a detailed dissection of the genomics of rapid

  17. c12) United States Patent Vertes et al.

    E-Print Network [OSTI]

    Vertes, Akos

    c12) United States Patent Vertes et al. (54) LASER ABLATION ELECTROSPRAY IONIZATION (LAESI disclaimer, the term ofthis patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days. This patent (10) Patent No.: US 8,809,774 B2 *Aug. 19, 2014(45) Date of Patent: (58) Field of Classification

  18. c12) United States Patent Vertes et al.

    E-Print Network [OSTI]

    Vertes, Akos

    c12) United States Patent Vertes et al. (54) THREE-DIMENSIONAL MOLECULAR IMAGING BY INFRARED LASER) ( *) Notice: Subject to any disclaimer, the term ofthis patent is extended or adjusted under 35 U.S.C. 154(b application file for complete search history. (56) References Cited U.S. PATENT DOCUMENTS 5,338,930 A 5

  19. 16/sept/2001 1 Alternativas al Pago por Capacidad

    E-Print Network [OSTI]

    Rudnick, Hugh

    1 16/sept/2001 1 Alternativas al Pago por Capacidad n Introducción n Alternativa 1: Call Option n Alternativa 2: PJM en Chile Carlos Altimiras - Francisco Moyano 16/sept/2001 2 Justificación Conceptual del/sept/2001 3 Experiencia Internacional sobre Remuneración de la Potencia n Alternativas no Reguladas n

  20. Lake Microbial Community Workflow Revised 02 Sept 09 ALS

    E-Print Network [OSTI]

    pump and manifold. Wear gloves from this part onward. 2. Place autoclaved yellow 500mL filter funnels Workflow Revised 02 Sept 09 ALS 2 Filtration Needed: Vacuum pump Vacuum manifold Autoclaved filter funnels per filter) 1 ceramic bead (1 per bead beater tube; 2 per filter) 1. Wear gloves at all times. 2