Sample records for thad allen authorized

  1. Dr. Thad M. Adams Materials Technology Section

    E-Print Network [OSTI]

    Dr. Thad M. Adams Materials Technology Section Savannah River National Laboratory DOE Hydrogen extraction/handling/separation/storage operations · Applied R&D provided by Savannah River National for Hydrogen Service #12;Hydrogen Technology at the SavannahHydrogen Technology at the Savannah River SiteRiver

  2. Edgar Bowers & Allen Tate

    E-Print Network [OSTI]

    Yezzi, David

    2003-01-01T23:59:59.000Z

    Know Its Story: The Edgar Bowers Conference & ExhibitionApril 11, 2003, UCLA Edgar Bowers & Allen Tate by Davidto this morning. I knew Edgar Bowers only briefly, in San

  3. QER- Comment of Allen Young

    Broader source: Energy.gov [DOE]

    There is much that I can say about energy policy, but most important to me is the have no new infrastructure for fossil fuels, especially a proposed Kinder Morgan "northeast extension" pipeline through beautiful countryside in Massachusetts. There needs to be focus on renewables, plus conservation and efficiency. Allen Young

  4. Curriculum Vitae Allen F. Meyer

    E-Print Network [OSTI]

    Schmidt, Steven K.

    Curriculum Vitae Allen F. Meyer Education PhD, University of Colorado at Boulder, Ecology Publications Meyer, A.F., Lipson, D.A., Martin, A. P., Schadt, C.W., Schmidt, S.K. 2004. Molecular and Environmental Microbiology 70: 483-489. Meyer, A.F., Nemergut, D.R., Martin, A. P., Pescador, M.Y., Costello, E

  5. allene: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 160 Allen County...

  6. Allen Co: Proposed Penalty (2010-CW-0715)

    Broader source: Energy.gov [DOE]

    DOE alleged in a Notice of Proposed Civil Penalty that Allen Co. failed to certify a variety of faucets as compliant with the applicable water conservation standards.

  7. Thermodynamics of cuticular transpiration Allen G. Gibbs *

    E-Print Network [OSTI]

    Ahmad, Sajjad

    Review Thermodynamics of cuticular transpiration§ Allen G. Gibbs * School of Life Sciences, 4505 S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1067 4. Thermodynamics of transport processes Accepted 6 May 2011 Keywords: Cuticle Humidity Thermodynamics Transpiration Water vapor A B S T R A C

  8. Allen & Dorothy Calvin Doctoral Dissertation Grant The Allen & Dorothy Calvin Doctoral Dissertation Grants are awarded on a competitive

    E-Print Network [OSTI]

    Galles, David

    Allen & Dorothy Calvin Doctoral Dissertation Grant Overview The Allen & Dorothy Calvin Doctoral Dissertation Grants are awarded on a competitive basis to promising School of Education doctoral students process. REQUIRED DOCUMENTS · Completed Grant Application Form · Copy of the Dissertation Proposal Outline

  9. The Engineering Team Todd Allen (Team Leader)

    E-Print Network [OSTI]

    Wood, Stephen L.

    The Engineering Team Todd Allen (Team Leader) tallen@fit.edu Major: Ocean Engineering Speciality: Naval Architecture Sean Kuhn skuhn@fit.edu Major: Ocean Engineering Speciality: Naval Architecture Joseph Caldwell jcaldwel@fit.edu Major: Ocean Engineering Speciality: Underwater Technologies Seth Noyes

  10. Gabrielle Allen Center for Computation & Technology

    E-Print Network [OSTI]

    Allen, Gabrielle

    1 Gabrielle Allen Center for Computation & Technology Dept Computer Science Louisiana State, Models, Grids, Community #12;2 3 ---Third most powerful Hurricane to hit U.S Coast, Most Expensive Storm Size (width across) at landfall - 410 miles Radius of Hurricane Force winds at landfall - 85 miles

  11. AUTHORS Charles E. Whittle Edward L. Allen Chester L. Cooper

    Office of Scientific and Technical Information (OSTI)

    Escalation and Fixed Capital Charge Rates 5 Coal Required for 1975-201 0 6 Estimated US. Air Pollution Emissions for A.D. 2000 8 Land Requirements for Annual Fuel Production in...

  12. AUTHORS Charles E. Whittle Edward L. Allen Chester L. Cooper

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not Found Item Not Found The itemAIR SEPARATION BY

  13. allen milne edited: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 270 Allen County...

  14. allens creek-1 reactor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 160 Allen County...

  15. allens creek-2 reactor: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 160 Allen County...

  16. allen kaasik damilja: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 160 Allen County...

  17. allen dysert ii: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 166 Allen County...

  18. allene oxide cyclase: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 182 Allen County...

  19. allen kaasik aleksander: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 171 Allen County...

  20. allene ether nazarov: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 213 Allen County...

  1. arkovskaja allen kaasik: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 160 Allen County...

  2. allen kaasik margus: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 162 Allen County...

  3. allen byrnes md: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 295 Allen County...

  4. allen kaasik klli: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. 160 Allen County...

  5. Booz Allen Hamilton Response to Department of Energy Request...

    Energy Savers [EERE]

    Booz Allen Hamilton Response to Department of Energy Request for Information on Implementing the National Broadband Plan by Studying the Communications Requirements of Electric...

  6. Lee Allen Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant Jump to:Landowners and Wind EnergyIndiana: EnergyLands inLechee, Arizona:Lee Allen

  7. Allen, Texas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty EditCalifornia: Energy Resources Jump to: navigation,Alleghany HighPower JumpAllen,

  8. Ben Allen | Argonne Leadership Computing Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplex historian ...BESFor41BeforeAllen HPC Systems

  9. Bachelor of Fine Arts Lindsey Michelle Allen, Art

    E-Print Network [OSTI]

    Gering, Jon C.

    Bachelor of Fine Arts Lindsey Michelle Allen, Art Todd Christopher Baran, Art Mindy Lynnette Bryant Emily Dian Buford, Psychology Brennen Gail Bushnell, English Andrea Jeanne Calvin, English Erica Marie

  10. NUMERICAL APPROXIMATIONS OF ALLEN-CAHN AND CAHN ...

    E-Print Network [OSTI]

    2010-03-18T23:59:59.000Z

    F(u) being a given energy potential. An important feature of the Allen-Cahn and Cahn-Hilliard equations is that they can be viewed as the gradient flow of the ...

  11. 1536-1268/03/$17.00 2003 IEEE I Published by the IEEE CS and IEEE Communications Society PERVASIVE computing 15 Editor: Thad E. Starner I Georgia Institute of Technology I thad@cc.gatech.edu

    E-Print Network [OSTI]

    Starner, Thad E.

    ) the display mounted magnetically to the author's eyeglasses for quick donning and doffing. (a) (b) #12;plays. Some displays clip to eyeglasses (or sunglasses if the user does not wear eyeglasses). Others are mounted on a type of headband and sit far enough from the forehead that the user can wear eyeglasses

  12. John M. (Mike) McConnell Senior Vice President Booz Allen Hamilton

    E-Print Network [OSTI]

    John M. (Mike) McConnell Senior Vice President Booz Allen Hamilton Former Director of National for the leading consulting firm, Booz Allen Hamilton, and he is a member of the firm's Leadership Team. Mr. Mc of Staff, as Director of the National Security Agency, and later as Senior Vice President with Booz Allen

  13. 50% EFFICIENT SOLAR CELL ARCHITECTURES AND DESIGNS Allen Barnett1

    E-Print Network [OSTI]

    Honsberg, Christiana

    paths to low cost. Our central innovation is to co-design the optical, interconnect and solar cell cost drivers through novel solar cell architectures and optical elements. LOW CONCENTRATION50% EFFICIENT SOLAR CELL ARCHITECTURES AND DESIGNS Allen Barnett1 , Christiana Honsberg1 , Douglas

  14. MILESTONES TOWARD 50% EFFICIENT SOLAR CELL MODULES Allen Barnett1

    E-Print Network [OSTI]

    Honsberg, Christiana

    and a new silicon solar cell for the mid-energy photons, all while circumventing existing cost driversMILESTONES TOWARD 50% EFFICIENT SOLAR CELL MODULES Allen Barnett1 , Douglas Kirkpatrick2 LightSpin Technologies ABSTRACT: The Very High Efficiency Solar Cell (VHESC) program is developing

  15. Command Line Arguments in Ada95 Mark Allen Weiss

    E-Print Network [OSTI]

    Weiss, Mark Allen

    Command Line Arguments in Ada95 Mark Allen Weiss School of Computer Science Florida International (additional) arguments: ''­w'' and ''echo args.adb''. These are known as command line arguments. Command line on a command line can be accessed in an Ada program. In Ada83 there was no standard way of doing this. Ada95

  16. LowerLower--Cost Fuel CellsCost Fuel Cells Allen J. Bard, Arumugam Manthiram,Allen J. Bard, Arumugam Manthiram,

    E-Print Network [OSTI]

    Lightsey, Glenn

    1 LowerLower--Cost Fuel CellsCost Fuel Cells Allen J. Bard, Arumugam Manthiram,Allen J. BardMaterials Science and Engineering Program 2 CONVENTIONAL POWER PLANT DIRECT FUEL CELL POWER PLANT Heat power PEMFC: H2 fuel DMFC: Methanol fuel Fuel cells vs. conventional #12;2 3 Fuel cells could change

  17. 1Electricity from Sunlight: The Van Allen Probes Solar Panels NASA's twin Van Allen Probes spacecraft will be launched in 2012. The

    E-Print Network [OSTI]

    1Electricity from Sunlight: The Van Allen Probes Solar Panels NASA's twin Van Allen Probes of the surrounding four solar panel `wings' that provide power to the spacecraft instruments. The small blue rectangles within each of the four solar panels show the location of the solar cells used to power

  18. Mysterious electron stash found hidden among Van Allen belts

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTIONES2008-54174MoreMuseum Day atMyNERSCVan Allen

  19. Indicators to support environmental sustainability of bioenergy systems1 Authors: Allen C. McBridea

    E-Print Network [OSTI]

    Jager, Henriette I.

    indicators for soil quality, water13 quality and quantity, greenhouse gases, biodiversity, air quality includes the production or procurement of biomass38 feedstock, post-production processing and conversion are perceived to support rural development and employment. Fourth,49 technological advances continue to increa

  20. A history of Allen Academy, 1886-1968 

    E-Print Network [OSTI]

    LeUnes, Barbara Laverne

    1970-01-01T23:59:59.000Z

    A HISTORY OF ALIEN ACADEMY, 1886-1968 A Thesis by Barbara Laverne Le Unes Submitted to the Graduate College of Texas A&M U n i v e r s i t y i n p a r t i a l f u l f i l l m e n t of the requirement f o r the degree o MASTER OF ARTS January... 1970 E i s t o r y A HISTORY OF ALLEN ACADEMY, 1886-1968 a Tnesis Barbara Laverne Le Un< Approved as to s t y l e and content by: CChajar H ^ ^ t o ^ XHe a/3" o f L'e p ar t me n t) ^ no nicer; (Member; January 197^ 9 5 2 8 0 4 1 X I...

  1. A history of Allen Academy, 1886-1968

    E-Print Network [OSTI]

    LeUnes, Barbara Laverne

    1970-01-01T23:59:59.000Z

    A HISTORY OF ALIEN ACADEMY, 1886-1968 A Thesis by Barbara Laverne Le Unes Submitted to the Graduate College of Texas A&M U n i v e r s i t y i n p a r t i a l f u l f i l l m e n t of the requirement f o r the degree o MASTER OF ARTS January... 1970 E i s t o r y A HISTORY OF ALLEN ACADEMY, 1886-1968 a Tnesis Barbara Laverne Le Un< Approved as to s t y l e and content by: CChajar H ^ ^ t o ^ XHe a/3" o f L'e p ar t me n t) ^ no nicer; (Member; January 197^ 9 5 2 8 0 4 1 X I...

  2. Patricia Allen: Director of the Center for Agroecology and Sustainable Food Systems

    E-Print Network [OSTI]

    Allen, Patricia; Rabkin, Sarah

    2010-01-01T23:59:59.000Z

    and then the farm and the apprentice program and formalizingstill lives on, in the apprentice program. Allen: Yes. Andchanged. And now our apprentices have gone on to do amazing

  3. A review of "De Arte Graphica (Paris, 1668)." by Charles-Alphonse Dufresnoy, Edition, translation and commentary by Christopher Allen, Yasmin Haskell, and Frances Muecke.

    E-Print Network [OSTI]

    Gallucci, John A.

    2006-01-01T23:59:59.000Z

    226 SEVENTEENTH-CENTURY NEWS Charles-Alphonse Dufresnoy. De Arte Graphica (Paris, 1668). Edition, translation and commentary by Christopher Allen, Yasmin Haskell, and Frances Muecke. Geneva, Librairie Droz S. A., 2005. 560 pp. SF 158.00. Review... and the variations introduced by the Venetian painters. The chapter closes with discussion of the poem?s reception in France. Published by Mignard in 1668 in Latin, translated into French by Roger de Piles in 1668, the poem and its author became a part...

  4. Dissolved Oxygen in Allen CreekDissolved Oxygen in Allen Creek Dissolved oxygen (DO) enters the water by diffusion from air, as a by-product of photosynthesis and

    E-Print Network [OSTI]

    Tyler, Christy

    Dissolved Oxygen in Allen CreekDissolved Oxygen in Allen Creek Dissolved oxygen (DO) enters and rapids. There is an inverse relationship between temperature and DO, i.e. colder water holds more oxygen it supplies oxygen to aquatic organisms. Higher DO levels also give the water a better taste. Figure 2. During

  5. Precipitation of relativistic electrons of the Van Allen belts into the proton aurora

    SciTech Connect (OSTI)

    Jordanova, Vania K [Los Alamos National Laboratory; Miyoshi, Y [NAGOYA UNIV; Sakaguchi, K [NAGOYA UNIV; Shiokawa, K [NAGOYA UNIV; Evans, D S [SEC/NOAA; Albert, Jay [AFRL; Connors, M [UNIV OF ATHABASCA

    2008-01-01T23:59:59.000Z

    The Van Allen electron belts consist of two regions encircling the earth in which relativistic electrons are trapped in the earth's magnetic field. Populations of relativistic electrons in the Van Allen belts vary greatly with geomagnetic disturbance and they are a major source of damage to space vehicles. In order to know when and by how much these populations of relativistic electrons increase, it is important to elucidate not only the cause of acceleration of relativistic electrons but also the cause of their loss from the Van Allen belts. Here we show the first evidence that left-hand polarized electromagnetic ion cyclotron (EMIC) plasma waves can cause the loss of relativistic electrons into the atmosphere, on the basis of results of an excellent set of ground and satellite observations showing coincident precipitation of ions with energies of tens of keV and of relativistic electrons into an isolated proton aurora. The proton aurora was produced by precipitation of ions with energies of tens of keV due to EMIC waves near the plasma pause, which is a manifestation of wave-particle interactions. These observations clarify that ions with energies of tens of keV affect the evolution of relativistic electrons in the Van Allen belts via parasitic resonance with EMIC waves, an effect that was first theoretically predicted in the early 1970's.

  6. Dangling OD Confined in a Langmuir Monolayer Gang Ma, Xiangke Chen, and Heather C. Allen*

    E-Print Network [OSTI]

    Dangling OD Confined in a Langmuir Monolayer Gang Ma, Xiangke Chen, and Heather C. Allen generation spectroscopy at the air/D2O/monolayer interface, dangling OD bonds were investigated. Upon increasing the monolayer surface coverage, the dangling OD stretching mode showed a marked frequency red

  7. Development and modeling of iron-gallium alloys Rick Allen Kellogg

    E-Print Network [OSTI]

    Flatau, Alison B.

    Development and modeling of iron-gallium alloys by Rick Allen Kellogg A dissertation submitted APPENDIX C: POISSON'S RATIOS OF Fe-Al ALLOYS 154 REFERENCES 155 #12;iv ACKNOWLEDGEMENTS Many people deserve University and the Department of Aerospace Engineering and Engineering Mechanics for providing academic

  8. Optical source transformations N. Kundtz, D. A. Roberts, J. Allen, S. Cummer and D. R. Smith

    E-Print Network [OSTI]

    Cummer, Steven A.

    . Smith, "Optical design of reflectionless complex media by finite embedded coordinate transformationsOptical source transformations N. Kundtz, D. A. Roberts, J. Allen, S. Cummer and D. R. Smith Center for the design of complex media that control the propagation of electro- magnetic and other types of waves

  9. Rapid magnitude determination for earthquake early warning Richard M Allen University of Wisconsin-Madison

    E-Print Network [OSTI]

    Allen, Richard M.

    of an earthquake early warning system is to provide notification of ground shaking hazard before significant ground of hazard. Here I present an overview of such an early warning system designed for use with a dense seismic1 Rapid magnitude determination for earthquake early warning Richard M Allen ­ University

  10. Communicated by Allen Selverston Oscillating Networks: Control of Burst Duration by

    E-Print Network [OSTI]

    Columbia University

    and modeling studies indicate that the PD neurons play an important role in regulating the durationCommunicated by Allen Selverston Oscillating Networks: Control of Burst Duration by Electrically, a conditional oscillator, plays a dominant role in rhythm generation. In the work described here, we manipulate

  11. TOPIC: Shale Gas Emissions w/David Allen, Energy Institute HOST: Jeff Tester and Todd Cowen

    E-Print Network [OSTI]

    Angenent, Lars T.

    TOPIC: Shale Gas Emissions w/David Allen, Energy Institute HOST: Jeff Tester and Todd Cowen DATE fracturing of shale formations (shale gas) is projected by the Energy Information Administration to become the nation's energy landscape. However, the environmental impacts associated with ``fracking'' for shale gas

  12. Tracking deep mantle reservoirs with ultra-low velocity zones Allen K. McNamara a,

    E-Print Network [OSTI]

    Rhoads, James

    Tracking deep mantle reservoirs with ultra-low velocity zones Allen K. McNamara a, , Edward J, that directly overlies the core-mantle boundary (CMB). These regions have been dubbed Ultra-Low Velocity Zones. Introduction For over 15 yrs seismologists have mapped regions of ultra-low P- and S-wave velocities

  13. DYNAMIC TRACKING PHASED ARRAY DATA LINKS K. D. Brown Dr. Chris Allen

    E-Print Network [OSTI]

    Kansas, University of

    DYNAMIC TRACKING PHASED ARRAY DATA LINKS K. D. Brown Dr. Chris Allen NNSA-KCP University of Kansas link developed by National Nuclear Safety Administration's Kansas City Plant (NNSA-KCP) and the University of Kansas (KU) in support of NNSA's Remote Sensing Laboratory (NNSA-RSL) located at the Nevada

  14. Radar Sounding of Glaciers in Greenland C. Allen, B, Wohletz, and S, Gogineni

    E-Print Network [OSTI]

    Kansas, University of

    Radar Sounding of Glaciers in Greenland C. Allen, B, Wohletz, and S, Gogineni The University on several flights over Greenland glaciers during the summer of 1995. The radar data were collected the theory and present results of the homomorphic deconvolution procedure. INTRODUCTION The Greenland

  15. A microwave metamaterial with integrated power harvesting functionality Allen M. Hawkes,a)

    E-Print Network [OSTI]

    Cummer, Steven A.

    A microwave metamaterial with integrated power harvesting functionality Allen M. Hawkes power harvesting, the focus of this work. Power harvesting devices convert one type of energy to another, typically converting to a direct current (DC) signal. Many types of energy can be harvested, from acoustic

  16. Allene and pentatetraene cations as models for intramolecular charge transfer: Vibronic coupling Hamiltonian and conical intersections

    E-Print Network [OSTI]

    Markmann, Andreas

    and pentatetraene. Our aim is to simulate dynamically the charge transfer process when one component is artificiallyAllene and pentatetraene cations as models for intramolecular charge transfer: Vibronic coupling online 13 April 2005 We consider the vibronic coupling effects involving cationic states with degenerate

  17. DONOR HONOR ROLL -2012 Michael Allen Alice L. Bean, PhD

    E-Print Network [OSTI]

    DONOR HONOR ROLL - 2012 > $1000 Michael Allen Alice L. Bean, PhD Gisela M. Dreschhoff, PhD LCDR, Inc COL Brenda S. Johnson and LTC Lindley N. Johnson Carleton J. Lindgren, PhD Jack W. Lowry. Pintar, PhD Stephen J. Sanders, PhD Robert D. Talty, PhD & Dorothy W. Talty Bruce A. Twarog, PhD

  18. Asymmetric Carbon-Carbon Bond Formation gamma to a Carbonyl Group: Phosphine-Catalyzed Addition of Nitromethane to Allenes

    E-Print Network [OSTI]

    Smith, Sean W.

    A chiral phosphine catalyzes the addition of a carbon nucleophile to the ? position of an electron-poor allene (amide-, ester-, or phosphonate-substituted), in preference to isomerization to a 1,3-diene, in good ee and ...

  19. MESOHABITAT USE AND COMMUNITY STRUCTURE OF BRAZOS RIVER FISHES IN THE VICINITY OF THE PROPOSED ALLENS CREEK RESERVOIR 

    E-Print Network [OSTI]

    Gelwick, Frances P.; Li, Raymond Y.

    2003-01-01T23:59:59.000Z

    MESOHABITAT USE AND COMMUNITY STRUCTURE OF BRAZOS RIVER FISHES IN THE VICINITY OF THE PROPOSED ALLENS CREEK RESERVOIR Submitted to: Texas Water Development Board P.O. Box 13231, Capitol Station 1700 N. Congress Avenue Austin...

  20. Analysis and Modeling of Skywave Behavior Sherman Lo, Stanford University, Robert Wenzel, Booz Allen Hamilton, Per Enge,

    E-Print Network [OSTI]

    Stanford University

    Analysis and Modeling of Skywave Behavior Sherman Lo, Stanford University, Robert Wenzel, Booz Allen Hamilton, Per Enge, Stanford University 1.0 Introduction Skywave signals are an inherent part

  1. Author Guidelines

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About BecomeTechnologiesVehicleAuthor Guidelines Author

  2. Diagenesis and secondary porosity in Vicksburg sandstones, McAllen Ranch field, Hidalgo County, Texas

    E-Print Network [OSTI]

    Klass, Marcia Jean

    1981-01-01T23:59:59.000Z

    positions at NcAllen Ranch field. Production History Production of gas is from the "L", "P", "T", "U", "V", and "Y" 0 sandstores. Fluid temperatures at NcAllan field range from 240 F SWC 6 20 QV 20 mv SWC 4 SWC 6 20 PV T 2 core ~ o 0 1... 14. 5 20. 0 11. 5 9. 1 8. 3 0. 6 2 2 1 0. 3 0 0 6 5 1 0 0. 8 0 1 1 Average 0. 062 0. 356 0. 182 0. 062 16. 1 1. 4* I 5. 8 1. 2 *L&g normal 20 at McAllen field (Fig. 5 and Fig. 6) . Monocrystalline quartz content ranges from 17...

  3. On the Teichmuller tower of mapping class groups Allen Hatcher, Pierre Lochak and Leila Schneps

    E-Print Network [OSTI]

    Schneps, Leila

    On the Teichmuller tower of mapping class groups Allen Hatcher, Pierre Lochak and Leila Schneps;nition of d GT 1 , and show that #3; acts on the tower of pro#12;nite mapping class groups bm g;n for all sketch our version of this history. A Teichmuller tower consists of a collection of (algebraic, i.e. pro

  4. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not Found Item Not Found The itemAIR SEPARATION BYAbrasionAuthor Select Last Name

  5. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not Found Item Not Found The itemAIR SEPARATION BYAbrasionAuthor Select Last

  6. Allen J. Bard, 2013 | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProducts (VAP) VAP7-0973ManagedStrategic|Aljazeera story onImagingAllen J. Bard,

  7. Femtosecond-scale response of GaAs to ultrafast laser pulses Traian Dumitrica* and Roland E. Allen

    E-Print Network [OSTI]

    Allen, Roland E.

    Femtosecond-scale response of GaAs to ultrafast laser pulses Traian Dumitrica* and Roland E. Allen ordinary heating of the sample by phonon emission, there is convinc- ing evidence that ultrafast pulses of the initial stages of the interaction of a laser pulse with a semiconductor, which show that ultrafast disor

  8. Frontiers in Laser Cooling, Single-Molecule Biophysics, and Enrgy Science: A Talk from Leo Holberg and Allen Mills

    ScienceCinema (OSTI)

    Holberg, Leo; Mills, Allen [NIST

    2011-04-28T23:59:59.000Z

    Leo Holberg and Allen Mills present a talk at Frontiers in Laser Cooling, Single-Molecule Biophysics and Energy Science, a scientific symposium honoring Steve Chu, director of Lawrence Berkeley National Laboratory and recipient of the 1997 Nobel Prize in Physics. The symposium was held August 30, 2008 in Berkeley.

  9. Plays as Team Plans for Coordination and Adaptation Michael Bowling, Brett Browning, Allen Chang and Manuela Veloso

    E-Print Network [OSTI]

    Veloso, Manuela M.

    Plays as Team Plans for Coordination and Adaptation Michael Bowling, Brett Browning, Allen Chang, {mhb,brettb,mmv}@cs.cmu.edu, allenc@andrew.cmu.edu Abstract. Coordinated action for a team of robots, a complex domain with teams of robots in an adversarial setting, there is a great deal of uncertainty

  10. A Fiber-Optic-Based 1550-nm Laser Radar Altimeter with RF Pulse Compression Christopher Allen, Sivaprasad Gogineni

    E-Print Network [OSTI]

    Kansas, University of

    A Fiber-Optic-Based 1550-nm Laser Radar Altimeter with RF Pulse Compression Christopher Allen-the-shelf fiber-optic components and traditional RF and digital signal processing techniques to achieve fine erbium-doped fiber amplifiers (EDFAs) could be used to provide optical gain. The transmitted signal

  11. Genealogies from time-stamped sequence data Alexei Drummond, Geoff K. Nicholls, Allen G. Rodrigo, Wiremu Solomon

    E-Print Network [OSTI]

    Nicholls, Geoff

    Genealogies from time-stamped sequence data Alexei Drummond, Geoff K. Nicholls, Allen G. Rodrigo methods for recovering genealog- ical structure, population size and mutation rates from radiocarbon arising from radiocarbon calibration of fossil sequences are dominated by uncertainty in the genealogy

  12. A Polymer Scaffold for Protein Oligomerization Byron R. Griffith, Benjamin L. Allen, Alan C. Rapraeger, and Laura L. Kiessling*,,

    E-Print Network [OSTI]

    Rapraeger, Alan C.

    A Polymer Scaffold for Protein Oligomerization Byron R. Griffith, Benjamin L. Allen,§ Alan C, synthesis, and biological activity of a well-defined polymer for the oligomerization of proteins studies build on observations that saccharide-functionalized polymers can oligomerize concanavalin A.5

  13. Allen Hatcher

    E-Print Network [OSTI]

    2001-07-05T23:59:59.000Z

    If this latter strategy is pushed to its natural limit, homology ..... However, it is quite a challenging exercise to see exactly what this deformation retraction looks like ...

  14. Regional Development Authorities (Indiana)

    Broader source: Energy.gov [DOE]

    This legislation authorizes the establishment of local development authorities in Indiana. A development authority established under this law may acquire, construct, equip, own, lease, and finance...

  15. Review: [untitled] Author(s): Anton Schick

    E-Print Network [OSTI]

    Wellner, Jon A.

    Review: [untitled] Author(s): Anton Schick Source: Journal of the American Statistical Association, Vol. 89, No. 428 (Dec., 1994), pp. 1565- 1566 Published by: American Statistical Association Stable contact support@jstor.org. American Statistical Association is collaborating with JSTOR to digitize

  16. Legal Authorities for UESC

    Energy Savers [EERE]

    Legal Authorities for UESC Hosted by: FEDERAL UTILITY PARTNERSHIP WORKING GROUP SEMINAR November 5-6, 2014 Cape Canaveral. Florida General UESC Authority * 42 U.S.C. 8256(c) -...

  17. Competition between Atmospherically Relevant Fatty Acid Monolayers at the Air/Water Laura F. Voss, Christopher M. Hadad,* and Heather C. Allen*

    E-Print Network [OSTI]

    Competition between Atmospherically Relevant Fatty Acid Monolayers at the Air/Water Interface Laura F. Voss, Christopher M. Hadad,* and Heather C. Allen* Department of Chemistry, The Ohio State Uni Competition and oxidation of fatty acids spread at the air/water interface were investigated using surface

  18. The Analysis of Interference Effects in the Sum Frequency Spectra of Water Interfaces Mac G. Brown, Elizabeth A. Raymond, Heather C. Allen, Lawrence F. Scatena, and

    E-Print Network [OSTI]

    Richmond, Geraldine L.

    The Analysis of Interference Effects in the Sum Frequency Spectra of Water Interfaces Mac G. Brown, Elizabeth A. Raymond, Heather C. Allen, Lawrence F. Scatena, and Geraldine L. Richmond* Department involve the surface of liquid water. Unfortunately, obtaining spectral fits to vibrational spectra

  19. MULTI-OBJECTIVE MODELING IN RIVERWARE FOR USACE-SWD Allen Avance, Hydraulic Engineer, U.S. Army Corp of Engineers, Fort Worth, TX,

    E-Print Network [OSTI]

    control points; the system-wide flood control algorithm that computes flood control releases at all algorithms bring together RiverWare's object-oriented modeling features and the power and flexibilityMULTI-OBJECTIVE MODELING IN RIVERWARE FOR USACE-SWD Allen Avance, Hydraulic Engineer, U.S. Army

  20. A Pervasive Computing Solution to Asset, Problem and Knowledge Management Suman K. Kalia, Charles C. Tappert, Allen Stix, and Fred Grossman

    E-Print Network [OSTI]

    Tappert, Charles

    . Tappert, Allen Stix, and Fred Grossman School of Computer Science and Information Systems Pace University desktop support team across the U.S. Introduction The following quote (IBM Pervasive Computing Website computing" is relatively new, its concept has historical precedence. Companies like IBM (IBM Redbook 1995

  1. Virtual Symmetry Reduction E. Allen Emerson and John W. Havlicek \\Lambda

    E-Print Network [OSTI]

    Emerson, E. Allen

    : a one­lane bridge system, where the direction with priority for crossing changes dynamically These authors were supported in part by NSF grant CCR­980­4736, Semiconductor Research Corporation contract 99

  2. BIBLIOGRAPHY ON INSTITUTIONAL BARRIERS TO ENERGY CONSERVATION

    E-Print Network [OSTI]

    York, C.M.

    2011-01-01T23:59:59.000Z

    energy policy, (author) Booz, Allen & Hamilton, Inc. , 1978.Bethesda, M D : Booz, Allen & Hamilton, Inc. The objective

  3. OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY June 30, 2010 #12;OKLAHOMA STATE UNIVERSITY MEDICAL Authority Members Oklahoma State University Medical Authority Tulsa, Oklahoma We have audited the accompanying statements of financial position of the Oklahoma State University Medical Authority (the

  4. OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY June 30, 2009 #12;OKLAHOMA STATE UNIVERSITY MEDICAL Authority Members Oklahoma State University Medical Authority Tulsa, Oklahoma We have audited the accompanying statements of financial position of the Oklahoma State University Medical Authority (the

  5. Work Authorization System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-04-20T23:59:59.000Z

    It establishes a work authorization and control process for work performed by designated management and operating (M&O), management and integrating (M&I), environmental restoration management contracts (ERMC) and other contracts determined by the Procurement Executive (hereafter referred to as M&O contractors). Cancels DOE O 5700.7C. Canceled by DOE O 412.1A.

  6. Work Authorization System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-04-21T23:59:59.000Z

    To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's (DOE's) Planning, Programming, Budgeting, and Evaluation process. Cancels DOE O 412.1.

  7. Work Authorization System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-04-21T23:59:59.000Z

    To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's Planning, Programming, Budgeting, and Evaluation process. Admin Chg 1, dated 5-21-2014, cancels DOE O 412.1A.

  8. I. Studies on the Metal-Catalyzed Cycloadditions of Isocyanates and Unsaturated Systems and II. Chromium-Catalyzed Synthesis of 1,3-Butadienes via (Silylmethyl)allenes

    E-Print Network [OSTI]

    Duran Galvan, Maria

    2011-10-21T23:59:59.000Z

    the Synthesis of Propargylic Amine ............................... 75 Table 2.20 Use of (4-bromobut-2-yn-1-yl)dimethyl(phenyl)silane for the Synthesis of Allenic and Propargylic Amines..., the acid was not obtained in high purity. An alternative route is described in Scheme 1.15. Dimethyl 2-(2,2-dimethoxyethyl)malonate 1.45, obtained from the X N O MLn N X O * 12 alkylation of dimethyl malonate with 2-bromo-dimethoxyethane,20...

  9. Optimum Bribing for Queue Position Author(s): Leonard Kleinrock

    E-Print Network [OSTI]

    Kleinrock, Leonard

    Optimum Bribing for Queue Position Author(s): Leonard Kleinrock Source: Operations Research, Vol BRIBING FOR QUEUE POSITION* Leonard Kleinrock University of California, Los Angeles, California (Received

  10. Electronic authoring tools

    SciTech Connect (OSTI)

    Hurford, J.M.

    1987-01-01T23:59:59.000Z

    More than a decade ago, word processing software revolutionized the way documents were prepared, and productivity was increased. But the editing and formatting capabilities of most word processors did very little to prevent errors in spelling, typing, grammar, diction, style, or organization from slipping through to the final documents. In the past few years, the number of software tools that aid the author has increased substantially. They now vary in scope from simple spelling checkers to sophisticated diction analyzers and idea processors. Moreover, writing-aid-software described in this report is now available for many types of computing systems, including personal computers, scientific workstations, and mainframes. The various pieces of software can be used in interactive or non-interactive (batch) modes.

  11. Poster Title LA-UR Number Author(s) Thumbnail

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Water Individual Permit Posters 1 December 4, 2013 Poster Title LA-UR Number Author(s) Thumbnail Contributions of Nitrite-Nitrogen, Nitrate-Nitrogen, and Orthophosphate Levels in...

  12. COMPUTER USE AUTHORIZATION ASTRONOMY DEPARTMENT

    E-Print Network [OSTI]

    Militzer, Burkhard

    COMPUTER USE AUTHORIZATION ASTRONOMY DEPARTMENT RADIO ASTRONOMY LABORATORY THEORETICALASTROPHYSICS authorized to support charges for the computer account. Please give the completed form to Bill Boyd in 401: ____________________________ User I.D.: ________________________ CONDITIONS OF USE The Astronomy Department provides computing

  13. Shale mineralogy and burial diagenesis of Frio and Vicksburg Formations in two geopressured wells, McAllen Ranch area, Hidalgo County, Texas

    SciTech Connect (OSTI)

    Freed, R.L.

    1980-01-01T23:59:59.000Z

    Thirty-six shale samples ranging in depth from 1454 ft to 13,430 ft from Shell Oil Company No. 1 Dixie Mortage Loan well and 33 shale samples ranging in depth from 2183 ft to 13,632 ft from Shell Oil/Delhi-Taylor Oil Corporation No. 3 A.A. McAllen well were examined by x-ray techniques to determine the mineralogical parameters of the geopressured zone in the Vicksburg Fairway. Both wells have the same weight-percent trends with depth for the mineralogy: quartz, calcite, total clay, and potassium feldspar are constant; plagioclase feldspar gradually increases; kaolinite increases; discrete illite decreases; total mixed-layer illite-smectite (I/S) decreases; illite in mixed layer I/S increases; and smectite in mixed-layer I/S decreases. Chlorite is found only in the geopressured zone of each well. The Boles and Franks model is compatible with a steady supply of original mixed-layer I/S during the depositional history of the McAllen Ranch area. The constant content with depth of calcite, quartz, and potassium feldspar indicates that limited material, if any, is supplied by the shales to surrounding sands. The ions generated by changes within the clay minerals are involved in further clay mineral reactions as outlined above. In addition, magnesium and iron are involved in forming chlorite within the shales.

  14. Ecological Energetics in Early Homo Author(s): Herman Pontzer

    E-Print Network [OSTI]

    Pontzer, Herman

    Ecological Energetics in Early Homo Author(s): Herman Pontzer Reviewed work(s): Source: Current new forms of scholarship. For more information about JSTOR, please contact support.00. DOI: 10.1086/667402 Ecological Energetics in Early Homo by Herman Pontzer CA Online-Only Material

  15. Virginia Resources Authority Act (Virginia)

    Broader source: Energy.gov [DOE]

    The Virginia Resources Authority provides financing options to support community investment in a number of areas, including wastewater, flood prevention and dam safety, solid waste, water, land...

  16. Collabortive Authoring of Walden's Paths

    SciTech Connect (OSTI)

    Yuanling, Dr. Li [Texas A& M University; Bogen, Paul Logasa [ORNL; Pogue, Daniel [Halliburton Energy Services; Furuta, Dr. Richard Keith [Texas A& M University; ShipmanIII, Dr. Frank Major [Texas A& M University

    2012-01-01T23:59:59.000Z

    Collaborative Authoring of Walden's Paths. Theory and Practice of Digital Libraries. Lecture Notes in Computer Sciences 2012.Lecture Notes in Computer Sciences 2012

  17. James River Soil & Water Conservation District Youth Opportunities by John Bilzor and John Allen Attention local High School students! For currently enrolled Seniors (home schooled students included), the James River

    E-Print Network [OSTI]

    Liskiewicz, Maciej

    James River Soil & Water Conservation District Youth Opportunities by John Bilzor and John Allen of 2015 and majoring in conservation, environmental science, or agriculture. To apply for our college, the Virginia Association of Soil and Water Conservation Districts has sponsored a week-long summer conservation

  18. Flooding and Recycling Authorizations Konstantin (Kosta) Beznosov

    E-Print Network [OSTI]

    Flooding and Recycling Authorizations Konstantin (Kosta) Beznosov Laboratory for Education delivery channels with speculatively pre- computed authorizations and actively recycling them on a just Security Keywords authorization recycling, authorization flooding, access con- trol, authorization, publish

  19. Danish Energy Authority Project Document

    E-Print Network [OSTI]

    Danish Energy Authority Project Document Implementation of the EU directive on the energy performance of buildings: Development of the Latvian Scheme for energy auditing of buildings and inspection of boilers #12;List of abbreviations DEA Danish Energy Authority EU EPB EU energy performance of buildings

  20. AUTHORITY

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartmentDepartment of2 of 5) ALARA

  1. Ris Ris-M-QHl Title *nd author(s)

    E-Print Network [OSTI]

    · X I S4(T)N.(T)dT t 1»1 J J z o 3 x (2.2 1 * 1,2, ,nm #12;- 2 - In reactor physics calculationsRisø Risø-M-QHl m r- Q to Title *nd author(s) Calculation of Fission Product Decay Heat by P illustrations Oat* Group's own registration number(s) PH/LM/ge Abstract A method is described for calculating

  2. Shale mineralogy and burial diagenesis of Frio and Vicksburg Formations in two geopressured wells, McAllen Ranch area, Hidalgo County, Texas

    SciTech Connect (OSTI)

    Freed, R.L.

    1981-01-01T23:59:59.000Z

    Thirty-six shale samples ranging in depth from 1454 ft to 13,430 ft from Shell Oil Company No. 1 Dixie Mortgage Loan well and 33 shale samples ranging in depth from 2183 ft to 13,632 ft from Shell Oil/Delhi-Taylor Oil Corporation No. 3 A.A. McAllen well were examined by x-ray techniques to determine the mineralogical parameters of the geopressured zone in the Vicksburg Fairway. Both wells have the same weight-percent trends with depth for the mineralogy: quartz, calcite, total clay, and potassium feldspar are constant; plagioclase feldspar gradually increases; kaolinite increases; discrete illite decreases; total mixed-layer illite-smectite (I/S) decreases; illite in mixed-layer I/S increases; and smectite in mixed-layer I/S decreases. Chlorite is found only in the geopressured zone of each well.

  3. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    SciTech Connect (OSTI)

    Moniz, Ernest [U.S. Energy Secretary

    2014-02-03T23:59:59.000Z

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  4. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    ScienceCinema (OSTI)

    Moniz, Ernest [U.S. Energy Secretary

    2014-08-22T23:59:59.000Z

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  5. Authorization Recycling in RBAC Systems

    E-Print Network [OSTI]

    Authorization Recycling in RBAC Systems 1Laboratory for Education and Research in Secure Systems ·motivation ·recycling approach recycling algorithms experimental evaluations summary & future work #12 issued before (precise recycling) #12;6 Laboratory for Education and Research in Secure Systems

  6. Delaware Solid Waste Authority (Delaware)

    Broader source: Energy.gov [DOE]

    The Delaware Solid Waste Authority (DSWA) runs three landfills, all of which recover methane and generate electricity with a total capacity of 24 MWs. The DSWA Solid Waste Plan includes goals,...

  7. Water Pollution Control Authority (Alabama)

    Broader source: Energy.gov [DOE]

    The Water Pollution Control Revolving Loan Fund, is maintained in perpetuity and operated by the department as agent for the authority for the purposes stated herein. Grants from the federal...

  8. Author's personal copy Short communication

    E-Print Network [OSTI]

    s gives J, the air-earth current density J in the global electric circuit, J ¼ sP (1) which is sustainedAuthor's personal copy Short communication Smoke emissions from industrial western Scotland in 1859

  9. Retrofitting the Tennessee Valley Authority

    E-Print Network [OSTI]

    Zeiber, Kristen (Kristen Ann)

    2013-01-01T23:59:59.000Z

    As the flagship of the New Deal, the Tennessee Valley Authority (TVA) was a triumph of regional and environmental design that has since fallen on hard times. When writer James Agee toured the region in 1935, he described ...

  10. Danish Energy Authority Final report

    E-Print Network [OSTI]

    1 Danish Energy Authority Final report Kaliningrad Regional District Heating Network 2004 - 2006 2006 #12;Kaliningrad District Heating Network Project 2004 - 2006 2 Table of content The report........................................................................................................... 7 1.4.1 District heating in the Region

  11. Danish Energy Authority Final Report

    E-Print Network [OSTI]

    Danish Energy Authority Final Report Implementation of the EU directive on the energy performance of buildings: Development of the Latvian Scheme for energy auditing of buildings and inspection of boilers Final Report Implementation of the EPB directive in Latvia: Development of the Latvian Scheme for energy

  12. April 10, 2012 Student author

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    on coal power generation capacity growth. Coal Science and Engineering. 17(2): 217-224. (MinE) Bailey* , EApril 10, 2012 * Student author + Faculty member outside the College 1 2011 Peer Reviewed Archival Publications Abdul-Razzaq, W., R. Bushey, and G.L. Winn. 2011. Leakage of microwave ovens. Physics Education

  13. Designated Responsible Authority (DRA) Training

    E-Print Network [OSTI]

    Minnesota, University of

    · The role of Designated Responsible Authority (DRA) is defined in the Using Vehicles for University Business policy. · The head of each University department with permanently assigned vehicles must appoint. Be familiar with the policies and related documents governing the use of University vehicles, and direct

  14. JOURNAL AUTHORS SURVEY Prepared by

    E-Print Network [OSTI]

    Stevenson, Paul

    JISC/OSI JOURNAL AUTHORS SURVEY Report Prepared by Key Perspectives Ltd 48 Old Coach Road, Playing behind its development 4 2.2 Models and definitions of open access 8 2.2.1 Open access journals 8 2 4.1 Respondent profiles 18 4.2 Awareness of open access journals 18 4.2.1 Extent and longevity

  15. Virginia Offshore Wind Development Authority (Virginia)

    Broader source: Energy.gov [DOE]

    The Virginia Offshore Wind Development Authority is a public body, established for the purposes of facilitating, coordinating, and supporting the development, either by the Authority or by other...

  16. Virginia Coalfield Economic Development Authority (Virginia)

    Broader source: Energy.gov [DOE]

    The Virginia Coalfield Economic Development Authority (VACEDA) was created in 1988 to encourage economic development in the western section of the state. The Authority administers incentive and...

  17. Obama Administration Announces Billions in Lending Authority...

    Energy Savers [EERE]

    Billions in Lending Authority for Renewable Energy Projects and to Modernize the Grid Obama Administration Announces Billions in Lending Authority for Renewable Energy Projects and...

  18. Central Characterization Program (CCP) Transuranic Authorized...

    Office of Environmental Management (EM)

    Authorized Methods for Payload Control Central Characterization Program (CCP) Transuranic Authorized Methods for Payload Control This document was used to determine facts and...

  19. Author Guidelines for 8.5x11-inch Proceedings Manuscripts Author(s) Name(s)

    E-Print Network [OSTI]

    Dragan, Feodor F.

    Author Guidelines for 8.5x11-inch Proceedings Manuscripts Author(s) Name(s) Author Affiliation(s) E, then begin the main text. All manuscripts must be in English. 1. Introduction These guidelines include double-spacing. All paragraphs should be indented 1 pica (approximately 1/6- or 0.17-inch or 0.422 cm

  20. Author Guidelines for 8.5 x 11-inch Proceedings Manuscripts Author(s) Name(s)

    E-Print Network [OSTI]

    Xie, Tao

    Author Guidelines for 8.5 x 11-inch Proceedings Manuscripts Author(s) Name(s) Author Affiliation, then begin the main text. 1. Introduction All manuscripts must be in English. These guidelines include text in 10-point Times, single- spaced. Do not use double-spacing. All paragraphs should be indented 1

  1. Author Guidelines for 8.5 x 11inch Proceedings Manuscripts Author(s) Name(s)

    E-Print Network [OSTI]

    Author Guidelines for 8.5 x 11­inch Proceedings Manuscripts Author(s) Name(s) Author Affiliation, then begin the main text. 1. Introduction All manuscripts must be in English. These guidelines include text in 10­point Times, single­ spaced. Do not use double­spacing. All paragraphs should be indented 1

  2. Human Generated Power for Mobile Electronics Thad Starner Joseph A. Paradiso

    E-Print Network [OSTI]

    Starner, Thad E.

    batteries than phones to consumers. The phones sold to users include a rechargeable battery so repositories for music videos, movies, photos, and personal information such as e-mail. Laptops, which were computing over the past decade and describe how batteries affect design tradeoffs for mobile device

  3. TBB-0080 - In the Matter of Thad M. Gyer, esq and Stephani L. Ayers, esq |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014,ZaleskiThis Decision considers an Appeal of an

  4. Ornithological Observations 1 GUIDELINES TO AUTHORS

    E-Print Network [OSTI]

    de Villiers, Marienne

    Ornithological Observations 1 GUIDELINES TO AUTHORS Ornithological Observations is a semi flush left (no tabs or indents) and paragraphs must be separated by a line space. Authors are requested

  5. Cooperative Secondary Authorization Recycling , Matei Ripeanu

    E-Print Network [OSTI]

    failures and network delays. This paper presents the design of our cooperative secondary authorization recy not employ cooperation. 2 #12;Contents 1 Introduction 4 2 Secondary and Approximate Authorization Model (SAAM) 7 3 Cooperative Secondary Authorization Recycling (CSAR) 8 3.1 Design Requirements

  6. Time Dependent Priority Queues Author(s): Leonard Kleinrock and Roy P. Finkelstein

    E-Print Network [OSTI]

    Kleinrock, Leonard

    Time Dependent Priority Queues Author(s): Leonard Kleinrock and Roy P. Finkelstein Source DEPENDENT PRIORITY QUEUES Leonard Kileinrock Universityof California,Los Angeles, California and Roy P

  7. The Evolution of Science Museums Author(s): Silvio A. Bedini

    E-Print Network [OSTI]

    Short, Daniel

    The Evolution of Science Museums Author(s): Silvio A. Bedini Reviewed work(s): Source: TechnologyScienceMuseums SILVIO A. BEDINI He whoviewsonlytheproduceofhisowncountrymaybesaid toinhabita singleworld

  8. Oregon Underground Injection Control Program Authorized Injection...

    Open Energy Info (EERE)

    Oregon Underground Injection Control Program Authorized Injection Systems Webpage Jump to: navigation, search OpenEI Reference LibraryAdd to library Web Site: Oregon Underground...

  9. Regional Districts, Commissions, and Authorities (South Carolina)

    Broader source: Energy.gov [DOE]

    This legislation establishes a number of regional districts, commissions, and authorities with the power to implement regulations and development plans for protected park and recreational areas.

  10. HIPAA Authorization for Release of Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    required to sign this authorization as a condition to receiving treatment or payment for health care; enrolling in a health plan; or establishing eligibility for benefits. * The...

  11. Saint Paul Port Authority PACE Program

    Broader source: Energy.gov [DOE]

     Note:  In 2010, the Federal Housing Finance Agency (FHFA), which has authority over mortgage underwriters Fannie Mae and Freddie Mac, directed these enterprises against purchasing mortgages of...

  12. Alleghany Highlands Economic Development Authority (Virginia...

    Broader source: Energy.gov (indexed) [DOE]

    and any other support improvements it deems necessary, including flood control dams, and for direct loans and grants to private for-profit basic employers. The Authority...

  13. Montana Water Quality Permit Application, Nondegradation Authorization...

    Open Energy Info (EERE)

    LibraryAdd to library PermittingRegulatory Guidance - Supplemental Material: Montana Water Quality Permit Application, Nondegradation Authorization, and Permit FeesPermitting...

  14. REQUEST FOR TRAVEL AUTHORIZATION Document ID #

    E-Print Network [OSTI]

    Texas at Austin, University of

    REQUEST FOR TRAVEL AUTHORIZATION Document ID # Name: UTEID: Travel Dates: Begin: End: Destination," please allow one month for processssing. Helpful Information: Navigant (Travel Management) (512

  15. National Training and Education Resource Advanced Authoring Training

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Authoring Training Participant Guide NTER Advanced Authoring Training Participant Guide (032012 pw) 2 Contents OBJECTIVES ......

  16. April 2012 Julia Allen Jones

    E-Print Network [OSTI]

    Kurapov, Alexander

    . Warren, Mary Beth Adams, Melinda H. Benson, Emery Boose, Warren Brown, John L. Campbell, Alan Covich. (541) 737 1224 jonesj@geo.oregonstate.edu Education Ph.D., 1983 The Johns Hopkins University­2270. 2011 Crosssystem comparisons elucidate disturbance complexities and generalities. Peters, D. P. C., A

  17. ALLENE.PAULSONCOLLEGEOFSCIENCE&TECHNOLOGY DEPARTMENTOFBIOLOGY

    E-Print Network [OSTI]

    Hutcheon, James M.

    of the Georgia coast from the Savannah River to St. Mary's, Georgia. This complex ecosystem provides a habitat. Many biology courses include small corresponding labs, which offer students optimal opportunity the opportunity to participate in projects of regional, national, and international significance. Georgia Southern

  18. Grid Applications Dr Gabrielle Allen

    E-Print Network [OSTI]

    Allen, Gabrielle

    of chemistry and other codes (www.gridchem.org) ! Petroleum Engineering " UCoMS: Grid-enabling reservoir ! Requires incredible mix of technologies & expertise! ! Many scientific/engineering components " Physics? Finite elements? " Elliptic equations: multigrid, Krylov subspace,... " Mesh refinement ! Many different

  19. Danish Energy Authority Poland -Electricity and gas

    E-Print Network [OSTI]

    Danish Energy Authority Poland - Electricity and gas market development study and practical guidelines for using EU Funds Electricity sector analyses December 2004 #12;Danish Energy Authority Poland - Electricity and gas market development study and practical guidelines for using EU Funds Electricity sector

  20. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 500 01OCT12 01: Period of Performance: $1,174 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work 2014 Authorized Budget: Perry Functional Manager L. Dudek Approvals Signature Date NSTX-U Project

  1. Using the Web for Name Authority Work

    E-Print Network [OSTI]

    Whittaker, Beth M.; Spillane, Jodi Lynn

    2001-01-01T23:59:59.000Z

    While many catalogers are using the Web to find the information they need to perform authority work quickly and accurately, the full potential of the Web to assist catalogers in name authority work has yet to be realized. The ever-growing nature...

  2. Authorization in Trust Management: Features and Foundations

    E-Print Network [OSTI]

    Skalka, Christian

    ]. In this paper we survey state-of-the-art in trust management authorization, with an emphasis on formally wellAuthorization in Trust Management: Features and Foundations Peter C. Chapin University of Vermont and Christian Skalka University of Vermont and X. Sean Wang University of Vermont Trust management systems

  3. 'Builder's Apprentice' tells author's enlightening story

    E-Print Network [OSTI]

    Hoffman, Andrew J.

    'Builder's Apprentice' tells author's enlightening story By Brandon Meginley - For the CDT Friday, "Builder's Apprentice," Hoffman recounts working on custom homes -- mansions, really -- in the late 1980s. Under the mentorship of Jack Schneider, the titular "builder" to Hoffman's "apprentice," the author

  4. Policy-Based Authorization William R. Cook

    E-Print Network [OSTI]

    Cook, William R.

    Page 1 Policy-Based Authorization William R. Cook Department of Computer Sciences University of Texas at Austin Abstract This paper discusses policy-based authorization, an effective intermediate point between MAC and DAC that promises to combine the best features of both models. Policy

  5. *Corresponding author. Tel.: #1-510-643-2451; fax: #1-510-643-5098.

    E-Print Network [OSTI]

    Goldstein, Allen

    contributions to acetone mixing ratios in a rural environment Allen H. Goldstein*, Gunnar W. Schade Ecosystem correlated with acetone mixing ratios (r"0.80), suggesting that the quantity of biogenic and anthropogenic of biogenically and anthropogenically emitted volatile organic compounds (VOCs), and biomass burning

  6. Author's personal copy Identifying general laboratory

    E-Print Network [OSTI]

    Pawlowski, Wojtek

    three operating conditions are met: volatile chemical sources are controlled by local ventilation or localized exhaust points. In labora- tories, general ventilation is intended to control small sourcesAuthor's personal copy FEATURE Identifying general laboratory ventilation requirements using

  7. Black Literary Suite: Kansas Authors Edition

    E-Print Network [OSTI]

    Wiggins, Meredith Joan

    2015-03-04T23:59:59.000Z

    authors were born or lived in the Sunflower State, and their work often reflects their time in Kansas. This Black Literary Suite exhibit highlights four important black writers—Langston Hughes, Gwendolyn Brooks, Frank Marshall Davis, and Kevin Young...

  8. Safety Management Functions, Responsibilities, and Authorities Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-12-31T23:59:59.000Z

    This Manual defines safety management functions, responsibilities, and authorities for DOE senior management with responsibilities for line, support, oversight, and enforcement actions. Cancels DOE M 411.1-1B. Canceled by DOE O 450.2.

  9. FINLAND SOURCES 2007 -Forest industry production Authorities

    E-Print Network [OSTI]

    FINLAND SOURCES 2007 - Forest industry production Print Home Finland Government Authorities Local » Turnover » Profit » Energy Year 2006 » Shipping Business services Infrastructure Economy Education strategy of the EU's Forest-Based Industries Technology Platform provides a good basis for preparing

  10. Long Island Power Authority- Renewable Electricity Goal

    Broader source: Energy.gov [DOE]

    As a municipal utility, the Long Island Power Authority (LIPA) is not obligated to comply with the [http://www.dsireusa.org/library/includes/incentive2.cfm?Incentive_Code=N... New York Renewable...

  11. Low Level Radioactive Waste Authority (Michigan)

    Broader source: Energy.gov [DOE]

    Federal laws passed in 1980 and 1985 made each state responsible for the low-level radioactive waste produced within its borders. Act 204 of 1987 created the Low-Level Radioactive Waste Authority ...

  12. Safety Management Functions, Responsibilities, and Authorities Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-10-08T23:59:59.000Z

    This Manual defines safety management functions, responsibilities, and authorities for DOE senior management with responsibilities for line, support, oversight, and enforcement actions. Canceled by DOE M 411.1-1A. Does not cancel other directives.

  13. California's Sad Budget Saga Has Many Authors

    E-Print Network [OSTI]

    Johnston, Patrick

    2009-01-01T23:59:59.000Z

    Commentary California’s Sad Budget Saga Has Many AuthorsWhy can’t they solve the budget mess? If some of you oldtimers contributed to the budget crisis facing the state—and

  14. Safety Management Functions, Responsibilities, and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-05-22T23:59:59.000Z

    This Manual provides the responsibilities of Headquarters and field element offices required by DOE P 411.1, Safety Management Functions, Responsibilities and Authorities Policy, dated 1-28-97. It also contains detailed requirements to supplement the policy's direction for each DOE organization having safety management functions to establish and maintain separate documentation of their responsibilities and authorities. Cancels DOE M 411.1-1A. Canceled by DOE M 411.1-1C.

  15. author research productivity: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2007 -Forest industry production Authorities Renewable Energy Websites Summary: FINLAND SOURCES 2007 - Forest industry production Print Home Finland Government Authorities...

  16. New York Power Authority`s energy-efficient refigerator program for the New York City Housing Authority - savings evaluation

    SciTech Connect (OSTI)

    Pratt, R.G.; Miller, J.D.

    1997-09-01T23:59:59.000Z

    The New York Power Authority (NYPA) and the New York City Housing Authority (NYCHA) are replacing refrigerators in New York City public housing with new, highly energy-efficient models over a five-year period. This report describes the analysis of the energy cost savings achieved through the replacement of 20,000 refrigerators in 1996, the first year of the NYPA/NYCHA program. The NYPA/NYCHA project serves as the lynchpin of a larger program designed to offer energy-efficient appliances to housing authorities across the country. The national program is a partnership between the U.S. Department of Energy (DOE) and the Consortium for Energy Efficiency (CEE). Starting with the 1997 refrigerator contract, this program invites other housing authorities to join NYPA in its volume purchase of energy-efficient refrigerators, at the same price and terms available to NYPA. Through these volume purchases, DOE`s ENERGY STAR{reg_sign} Partnerships program hopes to encourage appliance manufacturers to bring more efficient appliances to the market and to provide volume purchasers with the per-unit price savings of a bulk purchaser. DOE asked the Pacific Northwest National Laboratory (PNNL) to establish a protocol for evaluating the savings achieved with the NYPA refrigerators. That protocol is summarized in this report.

  17. Web Information Retrieval Author Preprint for Web

    E-Print Network [OSTI]

    Hawking, David

    Web Information Retrieval Author Preprint for Web Nick Craswell and David Hawking 18 April 2009 1 Introduction This chapter outlines some distinctive characteristics of web information re- trieval, starting with a broad description of web data and the needs of web searching users, then working through ranking

  18. Risk Management for Distributed Authorization Christian Skalka

    E-Print Network [OSTI]

    Wang, Xiaoyang "Sean"

    Risk Management for Distributed Authorization Christian Skalka University of Vermont X. Sean Wang assess risk, but risk in trust management is usually an informal consideration. In this paper, we de trust management systems treat all assertions as equally valid up to certificate authentication

  19. COMPARING THE VANCOUVER INTERNATIONAL AIRPORT AUTHORITY'S

    E-Print Network [OSTI]

    prescribed authorities to conduct environmental impact assessments (EIAs) of projects carried out on federal environmental management. The International Association for Impact Assessment's (IAIA) Principles for EIA Best if the proposed CEAA regulations come into force. Keywords: Environmental impact assessment; best practice

  20. CENTRAL EUROPE MANAGING AUTHORITY CITY OF VIENNA

    E-Print Network [OSTI]

    Genova, Università degli Studi di

    CENTRAL EUROPE MANAGING AUTHORITY CITY OF VIENNA Municipal Department for European affairs (MA 27 PROGRAMME Thematic study: Energy efficiency and renewable energies in the CENTRAL EUROPE Programme Request European regions more competitive, innovative, attractive and accessible. The Central Europe Programme area

  1. Author's Copy 2Reviews in Mineralogy & Geochemistry

    E-Print Network [OSTI]

    Truhlar, Donald G

    Author's Copy 2Reviews in Mineralogy & Geochemistry Vol. 71 pp. 19-37, 2010 Copyright © Mineralogical Society of America 1529-6466/10/0071-0002$05.00 DOI: 10.2138/rmg.2010.71.2 The Minnesota Density Functionals and their Applications to Problems in Mineralogy and Geochemistry Yan Zhao Commercial Print Engine

  2. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    (Days) Total Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost: Period of Performance: $353 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Kozub

  3. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX: Period of Performance: $700 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Tresemer

  4. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 888 03MAY10A 03: Period of Performance: $949 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Budget: Labik Approvals Signature Date NSTX-U Project Manager R. Strykowsky 4- WBS Dictionary sheet

  5. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project: Period of Performance: $251 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Titus

  6. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project: Period of Performance: $4,516 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Denault

  7. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 1,401 23FEB09A: Period of Performance: $2,984 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Account Manager Stevenson Functional Manager M.Williams Approvals Signature Date NSTX-U Project Manager R

  8. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX: Period of Performance: $2,595 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Chrzanowski

  9. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project: Period of Performance: $102 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Blanchard

  10. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX: Period of Performance: $79 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Raki

  11. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project: Period of Performance: $442 Control Account Manager: Revision #: Revision Date: CLOSED Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Chrzanowski

  12. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX: Period of Performance: $388 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Blanchard

  13. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 1,401 23FEB09A: Period of Performance: $3,335 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Raki

  14. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 1,240 23FEB09A: Period of Performance: $2,260 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Denault

  15. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    (Days) Total Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) FY: Period of Performance: $5,812 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work

  16. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 1,366 23FEB09A: Period of Performance: $1,860 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Denault

  17. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX Upgrade Project Subtotal 1: Period of Performance: $3,618 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Perry

  18. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Float Budgeted Cost n n % PPCTe B Earned value cost (BCWP) m Bg o %CPlanned value cost (BCWS) NSTX: Period of Performance: $338 Control Account Manager: Revision #: Revision Date: July-11 Authorized Work Description: Attachments: ECP# Implement Date Prior Budget New Budget Name Control Account Manager Chrzanowski

  19. Constraints Techniques for Authoring Multimedia Documents

    E-Print Network [OSTI]

    Joseph Fourier Grenoble-I, Université

    Constraints Techniques for Authoring Multimedia Documents Muriel Jourdan, Cécile Roisin and Laurent://opera.inrialpes.fr/OPERA/ 1 Introduction A multimedia document is defined as a set of objects from different media (text been done for the definition of languages and formats of multimedia documents, largely focusing

  20. Author Proof Plants on red alert

    E-Print Network [OSTI]

    Schaefer, Martin

    Author Proof A Plants on red alert: do insects pay attention? H. Martin Schaefer* and Gregor Rolshausen Summary Two recent hypotheses have proposed that non-green plant colouration evolved as a defence against herbi- vores, either as protective colouration promoting handi- cap signals indicating plant

  1. Work Authorization Document NSTX Upgrade Project

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    by month. 3- Original Work Authorization Form (WAF) OHMIC Heating Coil (OH) Magnet Systems 23 February 2009 The ohmic heating solenoid subsystem consists of the new coils that will make up the center solenoid advance procurement of the copper conductor and co-wound [glass/Kapton] insulation. Also includes

  2. Guide to Authors About the Journal

    E-Print Network [OSTI]

    Loss, Daniel

    nature physics Guide to Authors About the Journal Aims and scope of the journal Nature Physics. The journal content reflects core physics disciplines, but is also open to a broad range of topics whose to experiment, also features. Research areas covered in the journal include: · Quantum physics · Atomic

  3. AUTHORIZATION FOR THE RELEASE OF INFORMATION

    E-Print Network [OSTI]

    Khan, Javed I.

    . Sport Club Name: Club Manager Name: % Driver's Information for Authorization to drive personal or rental. The university, its officers and employees shall not assume any liability for any personal property damage of my personal information to the Kent State University Sport Club program and the Department

  4. Natural and Experimental Boudinage and Pinch-and-Swell Structures Author(s): Hans Ramberg

    E-Print Network [OSTI]

    Lee, Cin-Ty Aeolus

    Natural and Experimental Boudinage and Pinch-and-Swell Structures Author(s): Hans Ramberg Source, and build upon a wide range of content in a trusted digital archive. We use information technology and tools BOUDINAGE AND PINCH-AND-SWELL STRUCTURES1 HANS RAMBERG University of Chicago ABSTRACT Examples of boudinage

  5. Deriving Morality from Politics: Rethinking the Formula of Humanity Author(s): Japa Pallikkathayil

    E-Print Network [OSTI]

    Machery, Edouard

    Deriving Morality from Politics: Rethinking the Formula of Humanity Author(s): Japa Pallikkathayil-1704/2010/12101-0001$10.00 116 Deriving Morality from Politics: Rethinking the Formula of Humanity* Japa Pallikkathayil Kant's Formula of Humanity famously forbids treating others merely as a means. It is unclear, however, what

  6. Storage Operators and Directed Lambda-Calculus Author(s): Rene David and Karim Nour

    E-Print Network [OSTI]

    Nour, Karim

    Storage Operators and Directed Lambda-Calculus Author(s): Rene David and Karim Nour Source, December 1995 STORAGE OPERATORS AND DIRECTED LAMBDA-CALCULUS RENE DAVID AND KARIM NOUR Abstract. Storage. With this calculus we get an equivalent-and simple-definition of the storage operators that allows to show some

  7. Coat Color and Solar Heat Gain in Animals Author(s): Glenn E. Walsberg

    E-Print Network [OSTI]

    Cavitt, John F.

    when exposed to solar radiation than do light surfaces. For ani- mals such as birds or mammalsCoat Color and Solar Heat Gain in Animals Author(s): Glenn E. Walsberg Source: BioScience, Vol. 33://www.jstor.org #12;Coat Color and Solar Heat Gain in Animals Glenn E. Walsberg The relationbetween coat color

  8. Copyright 2009 The Author(s) Journal compilation 2009 National Ground Water Association.

    E-Print Network [OSTI]

    Alvarez, Pedro J.

    Copyright © 2009 The Author(s) Journal compilation © 2009 National Ground Water Association. NGWA.org Ground Water Monitoring & Remediation 29, no. 3/ Summer 2009/pages 93­104 93 Pore Water Characteristics/day. This model aquifer system contained a residual nonaqueous phase liquid (NAPL) that extended from

  9. A. E.K.Ris Ris-M-QEI Title and author(s)

    E-Print Network [OSTI]

    A. E.K.Risø Risø-M-QEI Title and author(s) Power correlations for fuel management studies in LWR management studies a certain knowledge of the power distribution between different fuel types is required. It has to be calculated without detailed information on the position of the fuel in the core. Simple

  10. Teaching Singular Distributions to Undergraduates Author(s): L. H. Koopmans

    E-Print Network [OSTI]

    Stephens, David A.

    Statistician, Vol. 37, No. 4, Part 1 (Nov., 1983), pp. 313-316 Published by: American Statistical Association@jstor.org. American Statistical Association is collaborating with JSTOR to digitize, preserve and extend accessTeaching Singular Distributions to Undergraduates Author(s): L. H. Koopmans Source: The American

  11. Letters to the Editor Author(s): Joel E. Cohen and John Neter

    E-Print Network [OSTI]

    Cohen, Joel E.

    , Vol. 32, No. 1 (Feb., 1978), p. 39 Published by: American Statistical Association Stable URL: http@jstor.org. American Statistical Association is collaborating with JSTOR to digitize, preserve and extend accessLetters to the Editor Author(s): Joel E. Cohen and John Neter Source: The American Statistician

  12. Assimilation of Ultramafic Rock in Subduction-Related Magmatic Arcs Author(s): Peter B. Kelemen

    E-Print Network [OSTI]

    Assimilation of Ultramafic Rock in Subduction-Related Magmatic Arcs Author(s): Peter B. Kelemen Source: The Journal of Geology, Vol. 94, No. 6 (Nov., 1986), pp. 829-843 Published by: The University. http://www.jstor.org #12;ASSIMILATION OF ULTRAMAFIC ROCK IN SUBDUCTION-RELATED MAGMATIC ARCS1 PETER B

  13. A. E. K.Ris Ris-M-Dl^ Title and author(s)

    E-Print Network [OSTI]

    A. E. K.Risø Risø-M-Dl^ Title and author(s) Application of Statistical Linear El -it:tic Fracture illustrations Date October 1 -}? $ Department or group R e a c t o r Group's own registration number(s) 25 crack, same time and ated as statisti- ty functions, tial cracks, f failure prob- program utilizing ce

  14. 200 Area Deactivation Project Facilities Authorization Envelope Document

    SciTech Connect (OSTI)

    DODD, E.N.

    2000-03-28T23:59:59.000Z

    Project facilities as required by HNF-PRO-2701, Authorization Envelope and Authorization Agreement. The Authorization Agreements (AA's) do not identify the specific set of environmental safety and health requirements that are applicable to the facility. Therefore, the facility Authorization Envelopes are defined here to identify the applicable requirements. This document identifies the authorization envelopes for the 200 Area Deactivation.

  15. Applying the Continuous Monitoring Technical

    E-Print Network [OSTI]

    Agency, as well as Larry Feldman and Zach Ragland from Booz Allen Hamilton. The authors would also like

  16. State authority in an expanded territorial sea

    E-Print Network [OSTI]

    Fulbright, Michael Gene

    1977-01-01T23:59:59.000Z

    of the United States in the disputed area. The 1950 Texas case concerned claims encompassing the entire extent of the continental shelf off the coast of Texas. Texas conceded that the federal aovernment had paramount powers over this area with respect to nav... development and current status of state authority in the territorial sea. The possi- bility of the United States expanding its territorial sea to twelve miles is then examined. This paper then proceeds with an examination of what types of authoritl...

  17. Author Index Abezgauz, Ludmila P1

    E-Print Network [OSTI]

    Martin, Jan M.L.

    Author Index Abezgauz, Ludmila P1 Abu-Reziq, Raed S1b3 Abutbul, Inbal P130 Adadi, Racheli P2 Addadi, Lia S2c5, P67, P123, P129, P159, P182 Adler, Michal P69 Afri, Michal P3, P26, P38 Agmon, Noam P131 Aharoni, Anna P4 Aharonov, Yakir P106 Akiva, Udi S4c1 Albeck, Amnon S1c5, P5 Albu-Yaron, Ana P210

  18. Protocols for Authorized Release of Concrete

    SciTech Connect (OSTI)

    Smith, Agatha Marie; Meservey, Richard Harlan; Chen, S.Y.; Powell, James Edward; PArker, F.

    2000-06-01T23:59:59.000Z

    Much of the clean or slightly contaminated concrete from Decontamination and Decommissioning (D&D) activities could be re-used. Currently, there is no standardized approach, or protocol, for managing the disposition of such materials. Namely, all potential disposition options for concrete, including authorized release for re-use, are generally not fully evaluated in D&D projects, so large quantities have been unduly disposed of as low-level radioactive waste. As a result, costs of D&D have become prohibitively high, hindering expedient cleanup of surplus facilities. The ability to evaluate and implement the option of authorized release of concrete from demolition would result in significant cost savings, while maintaining protection of environmental health and safety, across the Department of Energy (DOE) complex. The Idaho National Engineering and Environmental Laboratory (INEEL), Argonne National Laboratory East (ANL-E), and Vanderbilt University have teamed to develop a protocol for the authorized release of concrete, based on the existing DOE guidance of Order 5400.5, that applies across the DOE complex. The protocol will provide a streamlined method for assessing risks and costs, and reaching optimal disposal options, including re-use of the concrete within the DOE system.

  19. Journal of Power Sources 196 (2011) 96409647 Contents lists available at ScienceDirect

    E-Print Network [OSTI]

    Endres. William J.

    2011-01-01T23:59:59.000Z

    Ghassemic , Reza Shahbazian Yassarc , Brenda Garcia-Diaza , Thad Adamsa a Savannah River National Laboratory

  20. authoring program based: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    authorization 3 with simplified content Cook, William R. 6 Authority-based keyword search in databases CiteSeer Summary: The ObjectRank system applies authority-based ranking...

  1. Presidential Permits and Export Authorizations - About the Program...

    Broader source: Energy.gov (indexed) [DOE]

    transmission lines which cross the U.S. international border; and 2.Authorizing exports of electric energy to foreign countries. The authority to grant Presidential permits...

  2. author webb dick: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of Host Use in a Tropical Insect Herbivore Community Author(s): George D. Weiblen, Campbell O. Webb, Vojtech Novotny, Yves Basset, Scott E. Biology and Medicine Websites...

  3. Santa Clara Valley Transportation Authority and San Mateo County...

    Energy Savers [EERE]

    Santa Clara Valley Transportation Authority and San Mateo County Transit District -- Fuel Cell Transit Buses: Evaluation Results Santa Clara Valley Transportation Authority and San...

  4. POLICY GUIDANCE MEMORANDUM #09A Direct Hire Authority for Acquisition...

    Office of Environmental Management (EM)

    9A Direct Hire Authority for Acquisition Positions (Expired) POLICY GUIDANCE MEMORANDUM 09A Direct Hire Authority for Acquisition Positions (Expired) THIS GUIDANCE HAS EXPIRED...

  5. POLICY GUIDANCE MEMORANDUM #34B Direct Hire Authority for Contract...

    Energy Savers [EERE]

    4B Direct Hire Authority for Contract Specialist positions POLICY GUIDANCE MEMORANDUM 34B Direct Hire Authority for Contract Specialist positions Policy Guidance Memorandum 34B...

  6. POLICY GUIDANCE MEMORANDUM #02 Using Schedule A Hiring Authority...

    Energy Savers [EERE]

    2 Using Schedule A Hiring Authority for ARRA Positions (Expired) POLICY GUIDANCE MEMORANDUM 02 Using Schedule A Hiring Authority for ARRA Positions (Expired) THIS GUIDANCE HAS...

  7. NMOCD - Form G-104 - Certificate of Compliance and Authorization...

    Open Energy Info (EERE)

    Authorization to Produce Geothermal Resources Author State of New Mexico Energy and Minerals Department Published New Mexico Oil Conservation Division, 1978 DOI Not Provided...

  8. authority wmata natural: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Plantago: Variation among Cohorts in a Natural Plant Population Author(s): Deborah A. Roach Biology and Medicine Websites Summary: classes can reduce the pre- cision of mortality...

  9. authority compressed natural: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Plantago: Variation among Cohorts in a Natural Plant Population Author(s): Deborah A. Roach Biology and Medicine Websites Summary: classes can reduce the pre- cision of mortality...

  10. Energy Department Conditionally Authorizes Cameron LNG to Export...

    Office of Environmental Management (EM)

    Conditionally Authorizes Cameron LNG to Export Liquefied Natural Gas Energy Department Conditionally Authorizes Cameron LNG to Export Liquefied Natural Gas February 11, 2014 -...

  11. New Energy Department Team Established to Help Local Authorities...

    Energy Savers [EERE]

    to Help Local Authorities Get Gas Stations Impacted by Hurricane Sandy Back Online New Energy Department Team Established to Help Local Authorities Get Gas Stations Impacted by...

  12. authors karen burns: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Page Topic Index 1 Marine Ecosystem Sensitivity to Climate Change Author(s): Raymond C. Smith, David Ainley, Karen Baker, Eugene Domack, Steve Emslie, Bill Geosciences Websites...

  13. Silicon Valley Power and Oklahoma Municipal Power Authority Win...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Silicon Valley Power and Oklahoma Municipal Power Authority Win 2014 Public Power Wind Awards Silicon Valley Power and Oklahoma Municipal Power Authority Win 2014 Public Power Wind...

  14. Laurentian Energy Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal Pwer Plant Jump to:Landowners and Wind Energy DevelopmentLaurentian Energy Authority Jump to:

  15. Guam Power Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdfGetec AG| Open Energy Information 2000)2004)PevafersaPlant BiomassAuthority

  16. Long Island Power Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |Jilin ZhongdiantouLichuan CityLiqcrytechLong Island Power Authority

  17. Marin Energy Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |JilinLu an Group JumpNew Hampshire:Marin Energy Authority Jump to:

  18. Massachusetts Bay Transportation Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |JilinLu an Group JumpNewMassachusetts Bay Transportation Authority Jump

  19. Bolivar Energy Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:EzfeedflagBiomass ConversionsSouthby 2022 |BleckleyMotionBoca DelEnergy Authority Jump to:

  20. Supplement 21, Part 1, Authors: A To Z 

    E-Print Network [OSTI]

    Hood, Martha W.; Tolson, Deborah A.; Kirby, Margie D.; Rayburn, Jane D.; Edwards, Shirley J.; Shaw, Judith H.

    1976-01-01T23:59:59.000Z

    -Subject Catalogues, contain- ing indices to the author references, are being issued. The Author Catalogue continues the format of previous supplements. The users should note that for each reference in the Author Catalogue, the author (s) plus the date and letter...

  1. 168 Hinweise fr die Autoren Instructions to Authors

    E-Print Network [OSTI]

    Wien, Universität

    in SMALL CAPITALS: SINGER (1964), KÜHNER & ROMAGNESI (1975), when more than two authors: SMITH & al. (1982

  2. A. E. K. Ris Ris-M~ Title and author(s)

    E-Print Network [OSTI]

    A. E. K. Risø Risø-M~ Title and author(s) The Human Data P r o c e s s o r an a System Component B i t s a ri d Pie c en o f a Mode 1 11 e ri s Ra sm11 s s e n 5 1 pages Date June Department or group ir; t e m s e n p; i .1 e e r designing control room s f o r i ri d m >1 r i a 1 proc e t * J

  3. Distributed with permission of author(s) by ISA 2007 Presented at THE 53rd

    E-Print Network [OSTI]

    Manikas, Theodore

    and characterization. This work has been concerned with the construction of individual nm scale battery arrays, OK 74104 dale-teeters@utulsa.edu Keywords: Nanotechnology, sensors, batteries, memory ABSTRACT of this effort, the authors have constructed nanoscale battery arrays that can implement power supply units

  4. The Author-Topic Model for Authors and Documents Michal Rosen-Zvi

    E-Print Network [OSTI]

    Steyvers, Mark

    - erative model for documents that extends La- tent Dirichlet Allocation (LDA; Blei, Ng, & Jordan, 2003- ing each document as a mixture of probabilistic top- ics (e.g., Blei, Ng, & Jordan, 2003; Hofmann-the-art approaches like Latent Dirichlet Allocation (Blei et al., 2003), and extends these approaches to author

  5. External Authorities and Peers Laboratory Ventilation Management Program

    E-Print Network [OSTI]

    Pawlowski, Wojtek

    External Authorities and Peers Laboratory Ventilation Management Program Guidance Document External Authorities and Peers This group encompasses external groups who do not manage laboratory ventilation systems to laboratory ventilation management. Roles Responsibilities Tracking Indicator Laboratory science peers

  6. Supplement 19, Part 1, Authors: A To Z 

    E-Print Network [OSTI]

    Segal, Dorothy B.; Humphrey, Judith M.; Edwards, Shirley J.; Kirby, Margie D.; Walker, Martha L.; Rayburn, Jane D.; Crawley, Lila R.; Podani, Jule M.

    1974-01-01T23:59:59.000Z

    to ? have been issued on an annual basis. Beginning with Supplement 15, the Parasite-Subject Catalogues, contain- ing indices to the author references, are being issued. The Author Catalogue continues the format of previous supplements. The users should...

  7. Energy Department Authorizes Alaska LNG Project, LLC to Export...

    Energy Savers [EERE]

    Authorizes Alaska LNG Project, LLC to Export Liquefied Natural Gas Energy Department Authorizes Alaska LNG Project, LLC to Export Liquefied Natural Gas May 28, 2015 - 1:55pm...

  8. author taylor jessica: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Oh, Elisa 2014-01-01 3 Celebrating Giant Steps toward a Synthetic History of Angiosperm Evolution Author(s): Taylor S. Feild and Erika J. Edwards Biology and Medicine Websites...

  9. Authorization basis status report (miscellaneous TWRS facilities, tanks and components)

    SciTech Connect (OSTI)

    Stickney, R.G.

    1998-04-29T23:59:59.000Z

    This report presents the results of a systematic evaluation conducted to identify miscellaneous TWRS facilities, tanks and components with potential needed authorization basis upgrades. It provides the Authorization Basis upgrade plan for those miscellaneous TWRS facilities, tanks and components identified.

  10. Fort Pierce Utilities Authority- Solar Water Heating Rebate

    Broader source: Energy.gov [DOE]

    Note: Fort Pierce Utilities Authority has completed its rebate program for 2015. Check the website for updates.

  11. Onsite Backup Generation and Interruption Insurance for Electricity Distribution Author(s): Joseph A. Doucet and Shmuel S. Oren

    E-Print Network [OSTI]

    Oren, Shmuel S.

    Onsite Backup Generation and Interruption Insurance for Electricity Distribution Author(s): Joseph customerownedonsitebackupdecisionswillpre-emptthe utility'splan to mitigatecompensationpaymentsbyprovidingonsitebackup generation access to The Energy Journal. http://www.jstor.org #12;Onsite Backup Generation and Interruption

  12. 300 Area Liquid Effluent Facilities (LEF) Authorization Envelope

    SciTech Connect (OSTI)

    WRIGHT, E.J.; STORDEUR, R.T.

    2000-04-07T23:59:59.000Z

    The purpose of this document is to establish the facility Authorization Envelope (AE) for the 300 Liquid Effluent Facilities (LEP )Project and identify the requirements related to the maintenance of the AE as Specified in HNF-PRO-2701, Authorization Envelope and Authorization Agreement. The 300 LEF Project consists of two separate facilities operating under one management organization. They are the 310 Facility and the 340 Facility. The AE documents the limits of operations for all 300 LEF Project activities.

  13. Santa Clara Valley Transportation Authority and San Mateo County...

    Energy Savers [EERE]

    Santa Clara Valley Transportation Authority and San Mateo County Transit District Fuel Cell Transit Buses: Preliminary Evaluation Results vtaprelimevalresults.pdf More...

  14. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30T23:59:59.000Z

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE excepted service authorities. Admin Chg 1 dated 6-20-12.

  15. Delegation of Acquisition Executive Authority for Capital Asset...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    PortsmouthPaducah Project Office by murphie DelegationAcquisitionExecAuthorityCapitalAssetProjPPPO-MurphieEM.pdf -- PDF Document, 284 KB ID: NA Type: Organizations' Assignment...

  16. Santa Clara Valley Transportation Authority and San Mateo County...

    Energy Savers [EERE]

    Authority Art Douwes Jerry Oxsen Sharon McElligott Ephraim Cadaing Bill Wilson Pat Smith Steve Maloon Jeff Flagg Cynthia Shephard Dwight Barnes Jim Wilhelm Craig Ferguson...

  17. Control and Accountability of Nuclear Materials: Responsibilities and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1992-09-23T23:59:59.000Z

    The order prescribes the Department of Energy (DOE) policies, responsibilities, and authorities for control and accountability of nuclear materials. Cancels DOE O 5633.2.

  18. Oklahoma Municipal Power Authority- Commercial and Industrial Energy Efficiency Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers the Demand and Energy Efficiency Program (DEEP) to eligible commercial, industrial, and municipal government customers served by OMPA. This...

  19. Oklahoma Municipal Power Authority- WISE Energy Efficiency Loan Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers loans for a variety of measures and equipment through its WISE Loan Program. This program encourages residential and commercial customers to...

  20. Energy Department Conditionally Authorizes Oregon LNG to Export...

    Broader source: Energy.gov (indexed) [DOE]

    WASHINGTON - The Energy Department announced today that it has conditionally authorized LNG Development Co., LLC (Oregon LNG) to export domestically produced liquefied natural gas...

  1. Energy Department Authorizes Additional Volume at Proposed Freeport...

    Broader source: Energy.gov (indexed) [DOE]

    - The Energy Department announced today that it has conditionally authorized Freeport LNG Expansion, L.P. and FLNG Liquefaction, LLC (Freeport) to export additional volumes of...

  2. Energy Department Authorizes Dominion's Proposed Cove Point Facility...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Department announced today that it has conditionally authorized Dominion Cove Point LNG, LP to export domestically produced liquefied natural gas (LNG) to countries that do...

  3. Energy Department Authorizes Second Proposed Facility to Export...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    - The Energy Department announced today that it has conditionally authorized Freeport LNG Expansion, L.P. and FLNG Liquefaction, LLC (Freeport) to export domestically produced...

  4. NNSA Authorizes Start-Up of Highly Enriched Uranium Materials...

    National Nuclear Security Administration (NNSA)

    Authorizes Start-Up of Highly Enriched Uranium Materials Facility at Y-12 | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the...

  5. Notice of Termination for Authorization under TPDES General Permit...

    Open Energy Info (EERE)

    Termination for Authorization under TPDES General Permit (TXR150000) Jump to: navigation, search OpenEI Reference LibraryAdd to library Reference: Notice of Termination for...

  6. File:Notice of Termination for Authorization under TPDES General...

    Open Energy Info (EERE)

    | Sign Up Search File Edit History Facebook icon Twitter icon File:Notice of Termination for Authorization under TPDES General Permit TXR150000.pdf Jump to: navigation,...

  7. Long Island Power Authority- Commercial Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Long Island Power Authority offers a variety of incentives for its non-residential customers to increase the energy efficiency of facilities through the Commercial Efficiency Program. Major...

  8. atomic energy authority: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Journal of Nuclear Materials, Volume 442, Issues 1-3, Plasma Physics and Fusion Websites Summary: or...

  9. Kissimmee Utility Authority- Commercial Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Kissimmee Utility Authority (KUA) offers several rebates to commercial customers for energy efficiency improvements. Rebates are available for HVAC maintenance, heat pumps, duct leak repairs,...

  10. Ak-Chin Electric Utility Authority (Arizona) EIA Revenue and...

    Open Energy Info (EERE)

    August 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for Ak-Chin Electric Utility Authority for August 2008. Monthly Electric Utility Sales...

  11. Fort Pierce Utilities Authority- Solar Water Heating Rebate (Florida)

    Broader source: Energy.gov [DOE]

    '''''Fort Pierce Utilities Authority has suspended the Solar Water Heating rebate program until 2013. Contact the utility for more information on these offerings.'''''

  12. 2011 Renewable Energy Data Book Author: Rachel Gelman

    E-Print Network [OSTI]

    facts and figures on energy in general, renewable electricity in the United States, and global renewable in U.S. Power Plants: Electricity's Thirst for a Precious Resource Authors: Kristen Averyt, Jeremy In this report of the Energy and Water in a Warming World Initiative, the authors present the first systematic

  13. Supplement 18, Part 1, Authors: A To Z 

    E-Print Network [OSTI]

    Segal, Dorothy B.; Humphrey, Judith M.; Edwards, Shirley J.; Kirby, Margie D.

    1970-01-01T23:59:59.000Z

    . This was completed with Supplement 6, published in 1956 ; since then supplements covering authors A to ? have been issued on an annual basis. Beginning with Supplement 15, the Parasite-Subject Catalogues, contain- ing indices to the author references, are being...

  14. A Pedagogical Interface for Authoring Adaptive e-Learning Courses

    E-Print Network [OSTI]

    Lau, W. H. Nynson

    to support adaptive e-learning course authoring for different types of students. They require teachers with its learning style type. When delivering a course, predefined rules and conditions are appliedA Pedagogical Interface for Authoring Adaptive e-Learning Courses Christopher Watson1 Frederick W

  15. Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING

    E-Print Network [OSTI]

    Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING Notice is hereby given that a special meeting of the Board of Directors of the Power and Water Resources Pooling Authority (PWRPA or service at least 3 days before the meeting. Requests should be sent to: Power and Water Resources Pooling

  16. PATIENT AUTHORIZATION FOR DISCLOSURE OF PROTECTED HEALTH INFORMATION

    E-Print Network [OSTI]

    Feschotte, Cedric

    abuse treatment program. I understand that if the authorized recipient of this information delay the processing of your request. Approximate Dates of Treatment: Information to be Disclosed I authorize the following health care provider(s) to DISCLOSE my patient information

  17. Using Shelves Creating Shelves in CaltechAUTHORS

    E-Print Network [OSTI]

    Koch, Christof

    Using Shelves Creating Shelves in CaltechAUTHORS Login to CaltechAUTHORS using your IMSS credentials. Click on "Manage Shelves" in the gray bar at the top of your screen. Click on "New Shelf of the Shelf in the Description field. Save your changes. To manage access for your shelves, go to the Manage

  18. Set # Name Size (Towne) Forward Reverse Probe Author Date Citation 1 TRL11, IRL11 ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 44264432

    E-Print Network [OSTI]

    ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 4426­4432 UL54 / Polymerase 2 UL75 T A P R I M B 218 ACCCGTTACGTGACGGTCAA TTGTCGGCGTTTTCTCCAAA Allen 1995 JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1995, p. 725­728 3 UL75 T A P O I M B 268 TACAACAAACCGATTGCCGC

  19. multimaterial topology optimization by volume constrained allen ...

    E-Print Network [OSTI]

    2014-04-04T23:59:59.000Z

    In [22], the optimization of the position of fuel assemblies in a nuclear reactor core has been formu- lated as a four-phase topology optimization problem based ...

  20. QER- Comment of Allen Young 2

    Broader source: Energy.gov [DOE]

    Here is a comment from me on the issue of energy infrastructure in Massachusetts. I will address only one issue: the proposed Kinder Morgan pipelines from Albany to Dracut. I am absolutely opposed to the construction of this pipeline and here are my reasons

  1. Shammie Anika Abul Samantha Lynn Allen

    E-Print Network [OSTI]

    Lozano-Robledo, Alvaro

    Christine Ogonowski Kelly Ann O'Keefe Kara Lynn O'Leary Sean P O'Leary Jessica Marie Olson Lindsay Michelle

  2. Todd G. Allen | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2, 2003 (NextTime-ResolvedTo: Ms.Campbell About UsG.

  3. Dan Allen | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisitingContract Management Fermi SitePARTOfficeOctober HanfordDecemberDamian HazenDan

  4. Jeffrey Allen Nichols | ornl.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |Is Your Home as Ready for SummerAccelerator PublicMedicalJeffrey

  5. NISTIR 7497 Security Architecture Design

    E-Print Network [OSTI]

    Daniel Steinberg Booz Allen Hamilton September 2010 U.S. Department of Commerce Gary Locke, Secretary The authors, Matthew Scholl and Kevin Stine from NIST and Kenneth Lin and Daniel Steinberg from Booz Allen. A special note of thanks goes to Denise Tauriello and Christina Salameh from Booz Allen for their keen

  6. Specification for the Asset Reporting Format 1.1

    E-Print Network [OSTI]

    Acknowledgments The authors, Adam Halbardier of Booz Allen Hamilton, David Waltermire of the National Institute of Standards and Technology (NIST) and Mark Johnson of Booz Allen Hamilton, wish to thank their colleagues who of Varen Technologies, Gary Newman of Belarc, and Rhonda Farrell of Booz Allen Hamilton for their keen

  7. Special Publication 800-95 Special Publication 800-95

    E-Print Network [OSTI]

    Institute of Standards and Technology (NIST) and Theodore Winograd of Booz Allen Hamilton, wish to thank Holley, and Karen Mercedes Goertzel of Booz Allen Hamilton. The authors would like to acknowledge Tim Colon, Steven Lavenhar, and Victoria Thompson of Booz Allen Hamilton, for their keen and insightful

  8. Reduction for Constrained Variational Problems and 2/2 ds Author(s): Robert Bryant and Phillip Griffiths

    E-Print Network [OSTI]

    Reduction for Constrained Variational Problems and 2/2 ds Author(s): Robert Bryant and Phillip BRYANT* and PHILLIP GRIFFITHS** Introduction. In this paper we will study certain functionals whose;526 ROBERT BRYANT AND PHILLIP GRIFFITHS also implies the existence of infinitely many closed immersed

  9. Nonlinear Pricing in Markets with Interdependent Demand Author(s): Shmuel S. Oren, Stephen A. Smith and Robert B. Wilson

    E-Print Network [OSTI]

    Oren, Shmuel S.

    Nonlinear Pricing in Markets with Interdependent Demand Author(s): Shmuel S. Oren, Stephen A. Smith S. OREN, t STEPHEN A. SMITH, t AND ROBERT B. WILSON? This paper provides a mathematical framework Sciences #12;S. S. OREN, S. A. SMITH AND R. B. WILSON demand externalities. Nonlinear pricing, defined

  10. Inhibition of Photosynthesis in Some Algae by Extreme-Red Light Author(s): Eugene Rabinowitch, Govindjee, Jan B. Thomas

    E-Print Network [OSTI]

    Govindjee

    Inhibition of Photosynthesis in Some Algae by Extreme-Red Light Author(s): Eugene Rabinowitch://www.jstor.org #12;Inhibition of Photosynthesis in Some Algae by Extreme"Red Light Abstract. Photosynthesis produced by far-red light (about 700 m,b) is reversibly inhibited in some algae by extreme-red light ( 750 m

  11. Revisiting Alexander von Humboldt's Initiation of Rock Coating Research Author(s): Ronald I. Dorn, David H. Krinsley, Jeffrey Ditto

    E-Print Network [OSTI]

    Dorn, Ron

    Revisiting Alexander von Humboldt's Initiation of Rock Coating Research Author(s): Ronald I. Dorn, David H. Krinsley, Jeffrey Ditto Reviewed work(s): Source: The Journal of Geology, Vol. 120, No. 1 Revisiting Alexander von Humboldt's Initiation of Rock Coating Research Ronald I. Dorn,1, * David H. Krinsley

  12. The Logical Inconsistency of the Old Quantum Theory of Black Body Radiation Author(s): John Norton

    E-Print Network [OSTI]

    radiation was manifestly logically in- consistent. It required the energies of electric resonatorsThe Logical Inconsistency of the Old Quantum Theory of Black Body Radiation Author(s): John Norton September, 1987 THE LOGICAL INCONSISTENCY OF THE OLD QUANTUM THEORY OF BLACK BODY RADIATION* JOHN NORTONt

  13. Evolution of Senescence: Late Survival Sacrificed for Reproduction Author(s): T. B. L. Kirkwood and M. R. Rose

    E-Print Network [OSTI]

    Rose, Michael R.

    Evolution of Senescence: Late Survival Sacrificed for Reproduction Author(s): T. B. L. Kirkwood Sciences. http://www.jstor.org #12;Evolution of senescence: late survival sacrificedfor reproduction T. B theories are the 'antagonistic pleiotropy' theory, based in population genetics, and the 'disposable soma

  14. Optimal Strategic Petroleum Reserve Policies: A Steady State Analysis Author(s): Shmuel S. Oren and Shao Hong Wan

    E-Print Network [OSTI]

    Oren, Shmuel S.

    Optimal Strategic Petroleum Reserve Policies: A Steady State Analysis Author(s): Shmuel S. Oren.S.A. OPTIMAL STRATEGIC PETROLEUM RESERVE POLICIES: A STEADY STATE ANALYSIS* SHMUEL S. OREN AND SHAO HONG WAN Petroleum Reserve (SPR) under a variety of supply and demand conditions. The optimal policy variables

  15. Supplement 20, Part 1, Authors: A To Z 

    E-Print Network [OSTI]

    Podani, Jule M.; Hood, Martha W.; Tolson, Deborah A.; Kirby, Margie D.; Crawley, Lila R.; Rayburn, Jane D.; Shaw, Judith H.; Edwards, Shirley J.

    1975-01-01T23:59:59.000Z

    with Supplement 15, the Parasite-Subject Catalogues, contain- ing indices to the author references, are being issued. The Author Catalogue continues the format of previous supplements. The users should note that for each reference in the Author Catalogue... of the United States Animal Health Associ- ation. Richmond. [Continuation of: Proc. Ann. Meet. U. S. Live Stock San. Ass.] [W3. (/9.9 Un3R) ] Proc. Ann. Meet. West. Sect. Am. Soc. Animal Sc.? Proceed- ings. Annual Meeting. Western Section. American Soc- iety...

  16. Export Administration Regulations EARB 298 -October 2001 LEGAL AUTHORITY

    E-Print Network [OSTI]

    Bernstein, Daniel

    Export Administration Regulations EARB 298 - October 2001 LEGAL AUTHORITY EXPORT ADMINISTRATION and other Presidential documents relevant to the export controls administered under the Export. Information will be updated periodically. prepared by The Office of the Chief Counsel for Export

  17. ETSU College of Medicine Onity Door Access Authorization Form

    E-Print Network [OSTI]

    Karsai, Istvan

    ETSU College of Medicine Onity Door Access Authorization Form Please grant access to: 6 access. ____ ALL AREAS (ETSU Service Personnel Only) Medical School Research & Training, VA Bldg. #119-Mail: johnsodl@etsu.edu #12;

  18. National Defense Authorization Act for Fiscal Year 2005, Information...

    Office of Environmental Management (EM)

    Defense Authorization Act for Fiscal Year 2005" (Public Law 108-375 Oct. 28 2004) Transition20082009EMAdditionalMaterialMACopy.pdf PUBLIC LAW 108-375-OCT. 28, 2004...

  19. Ris Ris-M-GUD Title and authors)

    E-Print Network [OSTI]

    Risø Risø-M-GUD Title and authors) TwO-DIMENSIONALLY-MODULATED, MAGNETIC STRUCTURE OP NEODYMIUM) Abstract The magnetic structure of dhcp Nd was deter- mined by combining the results of neutron dif

  20. Control and Accountability of Nuclear Materials Responsibilities and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1988-01-29T23:59:59.000Z

    The order prescribe the Department of Energy (DOE) policies, responsibilities, and authorities for control and accountability of nuclear materials. Cancels DOE O 5630.1. Canceled by DOE O 5633.2A.

  1. Energy Department Authorizes Dominion Cove Point LNG to Export...

    Energy Savers [EERE]

    Dominion Cove Point LNG to Export Liquefied Natural Gas Energy Department Authorizes Dominion Cove Point LNG to Export Liquefied Natural Gas May 7, 2015 - 1:00pm Addthis News Media...

  2. Energy Department Authorizes Cameron LNG and Carib Energy to...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cameron LNG and Carib Energy to Export Liquefied Natural Gas Energy Department Authorizes Cameron LNG and Carib Energy to Export Liquefied Natural Gas September 10, 2014 - 2:00pm...

  3. Methylene Chloride Management Plan Review and Approval Authority

    E-Print Network [OSTI]

    Rubloff, Gary W.

    (Main Office) (301) 405-3960 (Industrial Hygiene, Biological Safety, Occupational Safety, Hazardous Authority Prepared by: Industrial Hygienist Date Reviewed and Approved by: Chair- UM EH&S Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 PERSONAL HYGIENE PRACTICES

  4. Author's personal copy Fusion Engineering and Design 85 (2010) 687693

    E-Print Network [OSTI]

    Harilal, S. S.

    2010-01-01T23:59:59.000Z

    Salah El-Din El-Morshedya, , Ahmed Hassaneinb a Atomic Energy Authority, Cairo, Egypt b Purdue correlations. © 2010 Elsevier B.V. All rights reserved. 1. Introduction The divertor modules

  5. Long Island Power Authority- Residential Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Long Island Power Authority offers a variety of incentive programs which help residential customers upgrade to more energy efficient equipment and appliances in their homes. The Cool Homes Program...

  6. Author's personal copy Journal of Econometrics 147 (2008) 336349

    E-Print Network [OSTI]

    LaFrance, Jeffrey T.

    2008-01-01T23:59:59.000Z

    Author's personal copy Journal of Econometrics 147 (2008) 336­349 Contents lists available at ScienceDirect Journal of Econometrics journal homepage: www.elsevier.com/locate/jeconom The structure

  7. Oklahoma Municipal Power Authority- WISE Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers rebates on a variety of HVAC equipment through its WISE Rebate program. This program encourages residential customers and builders to upgrade to...

  8. Fort Pierce Utilities Authority- Residential Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Fort Pierce Utilities Authority offers a variety of incentives for their residential customers to save energy in their homes. Rebates are available for room A/C units, insulation upgrades, central...

  9. Ohio Air Quality Development Authority Tax Incentives (Ohio)

    Broader source: Energy.gov [DOE]

    The Ohio Air Quality Development Authority provides financing for new air quality facilities for all types of Ohio businesses, ranging from small, family-owned shops to multi-million-dollar...

  10. New York Power Authority- Energy Services Programs for Public Entities

    Broader source: Energy.gov [DOE]

    New York Power Authority (NYPA) provides energy efficiency improvements to eligible public sector organizations at no up-front cost. A range of energy efficient upgrades are available through...

  11. Ak-Chin Electric Utility Authority (Arizona) EIA Revenue and...

    Open Energy Info (EERE)

    January 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-01 Utility Company Ak-Chin Electric Utility Authority (Arizona) Place Arizona Start Date 2008-01-01...

  12. Ak-Chin Electric Utility Authority (Arizona) EIA Revenue and...

    Open Energy Info (EERE)

    8 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for Ak-Chin Electric Utility Authority for March 2008. Monthly Electric Utility Sales and Revenue...

  13. Ak-Chin Electric Utility Authority (Arizona) EIA Revenue and...

    Open Energy Info (EERE)

    April 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for Ak-Chin Electric Utility Authority for April 2008. Monthly Electric Utility Sales and...

  14. Ak-Chin Electric Utility Authority (Arizona) EIA Revenue and...

    Open Energy Info (EERE)

    December 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-12 Utility Company Ak-Chin Electric Utility Authority (Arizona) Place Arizona Start Date 2008-12-01...

  15. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1994-10-05T23:59:59.000Z

    To establish requirements and responsibilities for the employment and compensation of individuals when using the following DOE excepted service authority: a. Section 621(d) of the DOE Organization Act (42 United States Code (U.S.C.), section 7231(d), hereafter referred to as pay plan EJ. b. Section 3161(a) of the National Defense Authorization Act for Fiscal Year 1995 (Public Law 103-337, October 5, 1994) and renewals, hereafter referred to as pay plan EK.

  16. Recreation land policies of Texas river authorities operating reservoirs

    E-Print Network [OSTI]

    Ruesink, Lou Ellen

    1979-01-01T23:59:59.000Z

    RECREATION LAND POLICIES OF TEXAS RIVER AUTHORITIES OPERATING RESERVOIRS A Thesis by LOU ELLEN RUESINK Submitted to the Graduate College of Texas A1IM University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE... December 1979 Major Subject: Recreation and Resources Developmenr. RECREATION LAND POLICIES OF TEXAS RIVER AUTHORITIES OPERATING RESERVOIRS A Thesis by LOU ELLEN RUESINK Approved as to sty1e and content by: (Chairman of o ittee) (Member...

  17. Author: Duncan Woodhouse, Assistant Registrar for Information Security, Risk Management and Business Continuity Date Version Author Comments

    E-Print Network [OSTI]

    Davies, Christopher

    Author: Duncan Woodhouse, Assistant Registrar for Information Security, Risk Management Information Security Policy 2004 09/2008 D01 Duncan Woodhouse Adaption and consolidation of best practices Registrar for Information Security, Risk Management and Business Continuity 2 University of Warwick

  18. Strengthening the Nigerian Sovereign Investment Authority: A Policy Analysis of the Nigerian Excess Crude Account and the Nigerian Sovereign Investment Authority Act

    E-Print Network [OSTI]

    Ugwuibe, Cynthia

    2012-01-01T23:59:59.000Z

    Savings Authority Oil Investment Corporation of ReserveBrunei Iran Oil Oil Libyan Investment Authority Reserve Fundcurrent and future investments of oil windfalls. Since

  19. Interactions between Energy Efficiency Programs funded under the Recovery Act and Utility Customer-Funded Energy Efficiency Programs

    E-Print Network [OSTI]

    Goldman, Charles A.

    2011-01-01T23:59:59.000Z

    Minnesota OES), Sue Hason (WECC), Alan Hee, Robert Jackson (Power), Kathy Kuntz (WECC), Thad Kurowski (Colorado GEO),

  20. Integrating repositories with fuel cycles: The airport authority model

    SciTech Connect (OSTI)

    Forsberg, C. [Massachusetts Inst. of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139-4307 (United States)

    2012-07-01T23:59:59.000Z

    The organization of the fuel cycle is a legacy of World War II and the cold war. Fuel cycle facilities were developed and deployed without consideration of the waste management implications. This led to the fuel cycle model of a geological repository site with a single owner, a single function (disposal), and no other facilities on site. Recent studies indicate large economic, safety, repository performance, nonproliferation, and institutional incentives to collocate and integrate all back-end facilities. Site functions could include geological disposal of spent nuclear fuel (SNF) with the option for future retrievability, disposal of other wastes, reprocessing with fuel fabrication, radioisotope production, other facilities that generate significant radioactive wastes, SNF inspection (navy and commercial), and related services such as SNF safeguards equipment testing and training. This implies a site with multiple facilities with different owners sharing some facilities and using common facilities - the repository and SNF receiving. This requires a different repository site institutional structure. We propose development of repository site authorities modeled after airport authorities. Airport authorities manage airports with government-owned runways, collocated or shared public and private airline terminals, commercial and federal military facilities, aircraft maintenance bases, and related operations - all enabled and benefiting the high-value runway asset and access to it via taxi ways. With a repository site authority the high value asset is the repository. The SNF and HLW receiving and storage facilities (equivalent to the airport terminal) serve the repository, any future reprocessing plants, and others with needs for access to SNF and other wastes. Non-public special-built roadways and on-site rail lines (equivalent to taxi ways) connect facilities. Airport authorities are typically chartered by state governments and managed by commissions with members appointed by the state governor, county governments, and city governments. This structure (1) enables state and local governments to work together to maximize job and tax benefits to local communities and the state, (2) provides a mechanism to address local concerns such as airport noise, and (3) creates an institutional structure with large incentives to maximize the value of the common asset, the runway. A repository site authority would have a similar structure and be the local interface to any national waste management authority. (authors)

  1. The London Journal and its Authors, 1720-1723

    E-Print Network [OSTI]

    Realey, Charles Bechdolt

    1935-12-01T23:59:59.000Z

    OF KANSAS HUMANISTIC STUDIES, Vol. V, No. 3 The London Journal and Its Authors 1720-1723 The London Journal and Its Authors, 1720-1723 By CHARLES BECHDOLT REALEY Associate Professor of History University of Kansas UNIVERSITY OF KANSAS DEPARTMENT... OF JOURNALISM PRESS LAWRENCE, KANSAS 1935 COPYRIGHT, 1935 BY CHARLES 9. REALEY PRINTED IN THE U.S.A. The London Journal and Its Autkors 1720-1723 In September, 1720, the South Sea Bubble suddenly burst, and after a peaceful summer England was thrown...

  2. Cell Cycle . Author manuscript Aurora B kinase, an immobile passenger!

    E-Print Network [OSTI]

    Boyer, Edmond

    Cell Cycle . Author manuscript Page /1 2 Aurora B kinase, an immobile passenger! Marl ne Delacour Keywords Chromosomal passenger complex ; Aurora kinase ; Survivin ; INCENP ; Borealin ; FRAP ; Microtubule composed of Aurora B kinase, Survivin, Borealin and INCENP. The centromeric complex is involved

  3. CUNY EXPORT CONTROL PROCEDURES 5. Licenses and export authorizations

    E-Print Network [OSTI]

    Rosen, Jay

    CUNY EXPORT CONTROL PROCEDURES 5. Licenses and export authorizations This Section addresses how, ITAR items of any kind must not be exported, nor accessed by a non-U.S. person, without proper required depends on the type of export transaction subject to control; for example, temporary versus

  4. An Export Architecture for a Multimedia Authoring Environment

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    An Export Architecture for a Multimedia Authoring Environment Jan Mikác INRIA RhôneAlpes 655 04 60 leducbao@gmail.com ABSTRACT In this paper, we propose an export architecture that provides, Standardization. Keywords Export, multimedia document, publishing format, SMIL, Timesheets 1. INTRODUCTION

  5. 2001: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS

    E-Print Network [OSTI]

    RadioAstronomie Millimétrique, Institut de (IRAM)

    2001: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS 877. SEARCH FOR NH3 ICE IN COLD DUST ENVELOPES AROUND YSO's E. Dartois, L. d'Hendecourt 2001, A&A 365, 144 878. DISKS AND OUTFLOWS AROUND-Franco, F. Palla 2001, A&A 366, 873 879. SiO EMISSION FROM A HUGE, DETACHED SHELL IN IRC+10420 A. Castro

  6. Author Retrospective for Energy Conservation Techniques for Disk

    E-Print Network [OSTI]

    Bianchini, Ricardo

    Author Retrospective for Energy Conservation Techniques for Disk Array-based Servers Eduardo original paper ti- tled "Energy Conservation Techniques for Disk Array-based Servers", which was published.1145/2591635.2591666 Categories and Subject Descriptors D.4 [Operating systems]: Storage management Keywords Energy conservation

  7. Author's personal copy Can information alone change behavior?

    E-Print Network [OSTI]

    van Geen, Alexander

    .jdeveco.2006.12.002 #12;Author's personal copy 1. Introduction As many as one billion people in the world drink (WHO, 1999). People drink unsafe water because they are not informed about the risks to their health people to seek safe water with their own resources. We study how people react to information about

  8. Power measurements in fusion reactors Author: Aljaz Cufar

    E-Print Network [OSTI]

    Â?umer, Slobodan

    Seminar: Power measurements in fusion reactors Author: Aljaz Cufar Mentor: doc. dr. Andrej Trkov are presented and power balance condition for magnetic confinement plasma is estimated. The most important methods and detectors used for power measurements in today's largest magnetic confinement fusion reactors

  9. Authorized Dealer Certification Vendor Name Vendor Fax Number

    E-Print Network [OSTI]

    Selmic, Sandra

    -current" price list and contractual discounts for labor rates and parts offered to similarly situated public or private entities. * By conducting business with the University, the Authorized Dealer agrees to an internal audit by Tech auditors of invoices for billing compliance with pricing/discount structures

  10. Author Submission Guidelines 6/2007 Publication Submission Guidelines

    E-Print Network [OSTI]

    Collins, Gary S.

    Author Submission Guidelines 6/2007 Publication Submission Guidelines Things to think about when and Printing department uses the The Chicago Manual of Style guidelines for editing purposes. Submit text sentences and after colons · Tab to indent items in a vertical list · Use the indent feature to set off

  11. Author's personal copy Gasoline prices and traffic safety in Mississippi

    E-Print Network [OSTI]

    Levinson, David M.

    Author's personal copy Gasoline prices and traffic safety in Mississippi Guangqing Chi a, , Arthur November 2010 Keywords: Gasoline prices Traffic crashes Traffic safety Age Gender Race Problem: Limited literature suggests that gasoline prices have substantial effects on reducing fatal crashes. However

  12. The Ozone Layer in the 21st Lead Authors

    E-Print Network [OSTI]

    Robock, Alan

    CHAPTER 6 The Ozone Layer in the 21st Century Lead Authors: G.E. Bodeker D.W. Waugh Coauthors: H;#12;CHAPTER 6 THE OZONE LAYER IN THE 21ST CENTURY Contents SCIENTIFIC SUMMARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.5 6.2 A FRAMEWORK FOR EVALUATING CHANGES IN OZONE ABUNDANCES

  13. Revised 1997 Retail Electricity Price Forecast Principal Author: Ben Arikawa

    E-Print Network [OSTI]

    Revised 1997 Retail Electricity Price Forecast March 1998 Principal Author: Ben Arikawa Electricity 1997 FORE08.DOC Page 1 CALIFORNIA ENERGY COMMISSION ELECTRICITY ANALYSIS OFFICE REVISED 1997 RETAIL ELECTRICITY PRICE FORECAST Introduction The Electricity Analysis Office of the California Energy Commission

  14. authority renewable energy: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    authority renewable energy First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 2011 Renewable Energy Data...

  15. TRNEWS279MARCHAPRIL2012 The authors are Concrete

    E-Print Network [OSTI]

    Harms, Kyle E.

    . Most prefer the Standard Test Method for Electrical Indication of Concrete's Ability to Resist Chloride measurements across a wide range of permeability values, sample testing ages, and concrete mix designs (FigureTRNEWS279MARCH­APRIL2012 46 The authors are Concrete Research Engineers, Louisiana Transportation

  16. New block preconditioners for saddle point problems List of authors

    E-Print Network [OSTI]

    Boyer, Edmond

    New block preconditioners for saddle point problems List of authors: Michele Benzi 1 In this talk I will describe a class of block preconditioners for linear systems in saddle point form. The main focus with respect to problem parameters will be discussed, together with the effect of inexact solves. This is joint

  17. Multimedia Modeling Using MPEG-7 for Authoring Multimedia Integration

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Multimedia Modeling Using MPEG-7 for Authoring Multimedia Integration Tien Tran-Thuong WAM Project In this paper, we describe an approach to audiovisual data modeling for multimedia integration and synchronization. The approach chosen consists in using description tools from Multimedia Description Schemes

  18. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30T23:59:59.000Z

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE expected service authorities. Admin Chg 1, dated 6-20-12, cancels DOE O 329.1. Admin Chg 2, dated 12-3-14, cancels DOE O 329.1 Chg 1.

  19. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30T23:59:59.000Z

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE expected service authorities. Admin Chg 1, dated 6-20-12, cancels DOE O 329.1. Admin Chg 2, dated 12-3-14, cancels DOE O 329.1 Admin Chg 1. Admin Chg 2 updates locality rates.

  20. Ris Ris-M-GSZJ Title and authors)

    E-Print Network [OSTI]

    Risø Risø-M-GSZJ Title and authors) External Radiation Exposure Associated with Uranium/Thorium radia- tion levels because of extensive uranium and thorium mineralizations. The measuring programme THERMOLUMINESCENT DOSIMETRT THORIUM ORES URANIUM ORES #12;External Radiation Exposure Associated with Dranium/Thorium

  1. DARS Authorization Form Certificate in Engineering for Energy Sustainability

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    DARS Authorization Form Certificate in Engineering for Energy Sustainability College of Engineering and capstone projects must address energy sustainability in some manner and will be reviewed by the certificate the capstone requirement: Briefly describe your project and how it relates to energy sustainability (attach any

  2. Author's personal copy Reactivity of lithium exposed graphite surface

    E-Print Network [OSTI]

    Harilal, S. S.

    on the surface [18]. Hence the effect of lithium on plasma­wall interactions is expected to dependAuthor's personal copy Reactivity of lithium exposed graphite surface S.S. Harilal a, *, J in fusion devices [1­5]. For example, wall conditioning with thin lithium layers gives rise to low hydrogen

  3. ETSU College of Medicine CBORD Door Access Authorization Form

    E-Print Network [OSTI]

    Karsai, Istvan

    ETSU College of Medicine CBORD Door Access Authorization Form 6/13/2011 Please grant access to: This access will remain in effect until the individual is no longer an active ETSU faculty list areas this individual will need access to: ____ ALL AREAS - ETSU Service Personnel Only ­ (i

  4. Dimensioning hospital wards using the Erlang loss model Corresponding author

    E-Print Network [OSTI]

    -2006. Finally, we demonstrate the efficiency of merging departments. Keywords: hospital resource allocationDimensioning hospital wards using the Erlang loss model Corresponding author: A.M. de Bruin (MSc of Sciences Department of Mathematics Assistant professor Optimization of Business Processes L. van Zanten

  5. SCIENCE: JAMES WEBB SPACE TELESCOPE (JWST) Budget Authority Actual Estimate

    E-Print Network [OSTI]

    ) Prior FY 2011 FY 2012 FY 2013 FY 2014 FY 2015 FY 2016 FY 2017 BTC Total FY 2013 President's Budget TELESCOPE (JWST) Formulation Development Operations JWST-2 FY 2013 BUDGET Budget Authority Actual Estimate (in $ millions) Prior FY 2011 FY 2012 2013 FY 2014 FY 2015 FY 2016 FY 2017 BTC Total FY 2013 President

  6. Extending the GHS Weil Descent Attack No Author Given

    E-Print Network [OSTI]

    Hess, Florian

    Extending the GHS Weil Descent Attack No Author Given No Institute Given Abstract. In this paper we extend the Weil descent attack due to Gaudry, Hess and Smart (GHS) to a much larger class of elliptic curves. This extended attack applies to elds of composite degree over F2 . The principle behind

  7. University of Massachusetts Amherst Pre-Travel Authorization

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    University of Massachusetts Amherst Pre-Travel Authorization All University travel across all funding sources requires supervisory and funding administrator approval prior to confirming travel OF TRIP: OTHER COMMENTS: (Importance of trip/consequences if not funded, coverage of duties while absent

  8. Author's personal copy Solar modulation in surface atmospheric electricity

    E-Print Network [OSTI]

    Usoskin, Ilya G.

    . Differential solar modulation of the cosmic ray energy spectrum modifies the cosmic ray ionisation at differentAuthor's personal copy Solar modulation in surface atmospheric electricity R. Giles Harrison a of Oulu, Finland a r t i c l e i n f o Article history: Received 27 July 2009 Received in revised form 2

  9. Author's personal copy Atmospheric Environment 41 (2007) 90509063

    E-Print Network [OSTI]

    Zheng, Mei

    2007-01-01T23:59:59.000Z

    , Bo Wangc a Environmental Chemistry and Technology Program, University of Wisconsin, 660 North Park contributions from gasoline and diesel engines. r 2007 Elsevier Ltd. All rights reserved. Keywords: Wood smoke.08.011 ÃCorresponding author. Environmental Chemistry and Tech- nology Program, University of Wisconsin, 660 North Park

  10. Central Technical Authority Responsibilities Regarding Nuclear Safety Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-08-28T23:59:59.000Z

    The order establishes Central Technical Authority and Chief of Nuclear Safety/Chief of Defense Nuclear Safety responsibilities and requirements directed by the Secretary of Energy in the development and issuance of Department of Energy regulations and directives that affect nuclear safety. No cancellations.

  11. Solving the Linear Equation in Reservoir Simulation List of authors

    E-Print Network [OSTI]

    Boyer, Edmond

    analogous to those techniques, but ensures that material balance is preserved exactly within each planeSolving the Linear Equation in Reservoir Simulation List of authors: Julien Maes 1 Reservoir, so that solving the linear equations arising in Newtons step is more and more challenging. Simulators

  12. Author's personal copy Photoelectrochemical hydrogen production from water/

    E-Print Network [OSTI]

    Wood, Thomas K.

    coal and gasoline [3]. Moreover, hydrogen can be used in fuel cells to generate electricity, or directly as a transportation fuel [4]. Hydrogen can be generated from hydrocarbons and water resourcesAuthor's personal copy Photoelectrochemical hydrogen production from water/ methanol decomposition

  13. Author's personal copy Fuzzy modelling of the composting process

    E-Print Network [OSTI]

    Author's personal copy Fuzzy modelling of the composting process E. Giusti, S. Marsili May 2009 Available online 18 June 2009 Keywords: Composting Fuzzy models Fuzzy identification Fuzzy clustering a b s t r a c t Composting is a solid waste treatment process consisting of the biochemical

  14. Author's personal copy Protein folding: Then and now

    E-Print Network [OSTI]

    Dokholyan, Nikolay V.

    Author's personal copy Review Protein folding: Then and now Yiwen Chen 1 , Feng Ding 1 , Huifen Nie Available online 8 June 2007 Abstract Over the past three decades the protein folding field has undergone monumental changes. Originally a purely academic question, how a protein folds has now become vital

  15. Author's personal copy Protein folding in confined and crowded environments

    E-Print Network [OSTI]

    Weston, Ken

    Author's personal copy Review Protein folding in confined and crowded environments Huan-Xiang Zhou protein folding in cellular environments. Theories based on considerations of excluded volumes predict disparate effects on protein folding stability for confinement and crowding: confinement can stabilize

  16. www.elsevier.com/locate/neucom Author's Accepted Manuscript

    E-Print Network [OSTI]

    Bartlett, Marian Stewart

    embodiment (e.g., perception-action systems, biomechanics, motor control), and sensitivity to cognitivewww.elsevier.com/locate/neucom Author's Accepted Manuscript New trends in cognitive science Bartlett and Tony Jebara, New trends in cognitive science: Integrative approaches to learning

  17. A Sequence of Possibilities Constructive fictions, quantum authoring,

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    A Sequence of Possibilities Constructive fictions, quantum authoring, and the search for an ideal's responsibilities here become even broader than those of a composer who typically defines a detailed sequence of events. He is composing a sequence of possibilities ..." --Myron W. Krueger, Responsive Environments

  18. Author's personal copy Canada's program on nuclear hydrogen production

    E-Print Network [OSTI]

    Naterer, Greg F.

    for hydrogen as a clean energy carrier is a sustainable, low-cost method of producing it in large capacities al. [1]. Hydrogen is used widely by petrAuthor's personal copy Canada's program on nuclear hydrogen production and the thermochemical Cue

  19. Authorized Private Keyword Search over Encrypted Data in Cloud Computing

    E-Print Network [OSTI]

    Hou, Y. Thomas

    Authorized Private Keyword Search over Encrypted Data in Cloud Computing Ming Li, Shucheng Yu, Ning,ncao,wjlou}@ece.wpi.edu Dept. of CS, University of Arkansas at Little Rock, email: sxyu1@ualr.edu Abstract--In cloud computing In recent years, cloud computing is gaining much mo- mentum in the IT industry. Especially, we have seen

  20. BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A REGULAR STAFF POSITION

    E-Print Network [OSTI]

    Thompson, Michael

    BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A REGULAR STAFF POSITION GOVERNED BY THE UNIVERSITY OPERATING BUDGET POLICY (BUDGETING SERVICES) BUDGET UNIT: BUDGET UNIT MANAGER: ENVELOPE: ENVELOPE MANAGER/contract compensation cost: $ FUNDING, BUDGET AND PLANNING INFORMATION (to be provided by Budget Unit Manager

  1. BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A FACULTY POSITION

    E-Print Network [OSTI]

    Thompson, Michael

    BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A FACULTY POSITION GOVERNED BY THE UNIVERSITY OPERATING BUDGET POLICY (BUDGETING SERVICES) BUDGET UNIT: BUDGET UNIT MANAGER: ENVELOPE: ENVELOPE MANAGER: FACULTY;FUNDING, BUDGET AND PLANNING INFORMATION (to be provided by Budget Unit Manager, or delegate) 1. The total

  2. Letter-of-Offer Attachment Work Authorization Documentation --I-9

    E-Print Network [OSTI]

    Sheridan, Jennifer

    Letter-of-Offer Attachment Work Authorization Documentation -- I-9 This offer of employment is contingent upon verification of the appropriate identity and employment eligibility documentation on the Form and the list of acceptable documents, please see the Forms section of the U.S. Citizenship and Immigration

  3. Contact: Julia Allen, 0114 222 7014, julia.allen@sheffield.ac.uk Introducing Geomorphology

    E-Print Network [OSTI]

    Stevenson, Mark

    and the application of ecological ideas to conservation and environmental management. Aims: This unit aims of plants and animals and the application of ecological ideas to conservation and environmental management to conservation and environmental management. Assessment: 80% portfolio 20% Presentation Key Reading: No key

  4. The New York Power Authority`s energy-efficient refrigerator program for the New York City Housing Authority -- 1997 savings evaluation

    SciTech Connect (OSTI)

    Pratt, R.G.; Miller, J.D.

    1998-09-01T23:59:59.000Z

    This document describes the estimation of the annual energy savings achieved from the replacement of 20,000 refrigerators in New York City Housing Authority (NYCHA) public housing with new, highly energy-efficient models in 1997. The US Department of Housing and Urban Development (HUD) pays NYCHA`s electricity bills, and agreed to reimburse NYCHA for the cost of the refrigerator installations. Energy savings over the lifetime of the refrigerators accrue to HUD. Savings were demonstrated by a metering project and are the subject of the analysis reported here. The New York Power Authority (NYPA) identified the refrigerator with the lowest life-cycle cost, including energy consumption over its expected lifetime, through a request for proposals (RFP) issued to manufacturers for a bulk purchase of 20,000 units in 1997. The procurement was won by Maytag with a 15-ft{sup 3} top-freezer automatic-defrost refrigerator rated at 437 kilowatt-hours/year (kWh/yr). NYCHA then contracted with NYPA to purchase, finance, and install the new refrigerators, and demanufacture and recycle materials from the replaced units. The US Department of Energy (DOE) helped develop and plan the project through the ENERGY STAR{reg_sign} Partnerships program conducted by its Pacific Northwest National Laboratory (PNNL). PNNL designed the metering protocol and occupant survey used in 1997, supplied and calibrated the metering equipment, and managed and analyzed the data collected by NYPA. The objective of the 1997 metering study was to achieve a general understanding of savings as a function of refrigerator label ratings, occupant effects, indoor and compartment temperatures, and characteristics (such as size, defrost features, and vintage). The data collected in 1997 was used to construct models of refrigerator energy consumption as a function of key refrigerator and occupant characteristics.

  5. Title: Author(s):

    Office of Scientific and Technical Information (OSTI)

    Laboratory, Los Alamos, N.M. 87545 Introduction The advantages offered by the PEM fuel cell, efficient power generation with little or no environmental emissions, low operating...

  6. Title: Author(s):

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not FoundInformation DOEInformation Summary Big*The LA:UR- $-3233 Title:

  7. Author(s).

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProductsAlternativeOperationalAugust August 2015 Events2-7148 C 3898-3484

  8. Copyright 101 for Authors: Publication Agreements and Open Sharing

    E-Print Network [OSTI]

    Peterson, A. Townsend; Rolf, Rachel; Emmett, Ada

    2010-10-19T23:59:59.000Z

    of this version. The details of those relationships, and other offerings allowing open web use, are set forth at the following website: http://www.wiley.com/go/funderstatement. NIH grantees should check the box at the bottom of this document. 3. Final Published... as a government employee legally prevents you from signing this Agreement, please contact the editorial office. NIH Grantees Note to NIH Grantees Pursuant to NIH mandate, Wiley-Blackwell will post the accepted version of Contributions authored by NIH...

  9. Delegation as Officially Designated Federal Security Authority - DOE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration wouldDECOMPOSITIONPortal Decision SupportIntelligenceAuthority

  10. FIXED SINKAGE AND TRIM BARE HULL 5415 SIMULATIONS USING CFDSHIP-IOWA Shanti Bhushan, Thad Michael, JianmingYang, Pablo Carrica, and Frederick Stern

    E-Print Network [OSTI]

    Yang, Jianming

    over the blended k-/k- (BKW) model. However the total variation diminishing (TVD) convective scheme did BKW is performed to evaluate the capability of DES in predicting integral variables, vortical

  11. A Dynamic Model for Wave-Induced Light Fluctuations in a Kelp Forest Author(s): Stephen R. Wing, James J. Leichter, Mark W. Denny

    E-Print Network [OSTI]

    Denny, Mark

    A Dynamic Model for Wave-Induced Light Fluctuations in a Kelp Forest Author(s): Stephen R. Wing forestsand marine kelp forests (Pearcy 1990; Gerard 1984), and theirphoton Acknowledgments We acknowledgethe

  12. Mina de Malfois and the Death of the Author

    E-Print Network [OSTI]

    1 Not Actually Jenny (jennyanydots21) wrote in mdmfans, 2012-11-01 20:27:00 Mina de Malfois and the Death of the Author: Part 1 Well, I might be a bit late to the party, but here in honour of Halloween is an AU murder mystery. Hope you... enjoy! Disclaimer: while Minaverse happenings typically may or may not allude to real events, the murder in this case is entirely fictional and owes more to Agatha Christie than anything that ever actually happened, as I hope will be apparent from...

  13. Pennsylvania Energy Development Authority PEDA | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRoseConcernsCompanyPCN TechnologyFrance)Authority PEDA Jump to:

  14. Delegation of Acquisition Executive Authority for Capital Asset Projects at

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration wouldDECOMPOSITIONPortal Decision SupportIntelligenceAuthorityIdaho

  15. EPA - State NPDES Program Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOE FacilityDimondale,South, NewDyer County,ECO2Ltd Place:Notice|Authority Jump

  16. Ak-Chin Electric Utility Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof Energy 2,AUDITCaliforniaWeifangwikiAgoura Hills,Oeste PaulistaLiquideAuthority Jump

  17. 1 Assistant Professor and 2 Senior Faculty Research Assistant, Department of Forest Science, Oregon State University, Corvallis, OR 97331, USA. Email for corresponding author: luomad@fsl.orst.edu

    E-Print Network [OSTI]

    by pathogens and the effects of heavy metal toxins, promotes fine root develop- ment, and may produce effects on below-ground ecosystems. Overstory removal significantly reduced EMF sporocarp production but in turn facilitates uptake of nitrogen, phosphorus, other minerals and water to the plant (Allen 1991

  18. eMMaC: KnowledgeBased Color Critiquing Support for Novice Multimedia Authors

    E-Print Network [OSTI]

    Nakakoji, Kumiyo

    eMMaC: Knowledge­Based Color Critiquing Support for Novice Multimedia Authors Kumiyo Nakakoji, 1 in multimedia authoring has mainly focused on increasing features available to the title designer. While multimedia authoring system does not solve fundamental problems inherent in multimedia authoring tasks

  19. New York Power Authority/New York City Housing Authority refrigerator replacement program, first program year evaluation. Final report

    SciTech Connect (OSTI)

    Kinney, L.F.; Lewis, G. [Synertech Systems Corp., Syracuse, NY (United States); Pratt, R.G.; Miller, J. [Pacific Northwest National Lab., Richland, WA (United States)

    1997-08-01T23:59:59.000Z

    Acting as an energy services provider, the New York Power Authority (NYPA) has initiated a long-term project through which 20,000 refrigerators per year will be replaced with the most energy-efficient units possible in apartments managed by the New York City Housing Authority (NYCHA). Using bulk purchasing as an incentive to appliance manufacturers to produce energy-efficient refrigerators suitable for use in apartments, replaced in the first year of the program, which ended in December 1996. These units, kWh per year. Savings were determined by field testing and laboratory testing of 220 existing refrigerators and 56 newly-installed units. In the next program year, a 15.0-cubic-foot Maytag refrigerator, newly-designed in response to bulk purchasing incentives, is being installed. The new unit has a label rating of 437 kWh per year, 31 percent better than 1993 energy standards. Old refrigerators removed from apartments are {open_quotes}demanufactured{close_quotes} in an environmentally-appropriate way and both metals and refrigerants are recovered for reuse.

  20. ONSITE TRANSPORTATION AUTHORIZATION CHALLENGES AT THE SAVANNAH RIVER SITE

    SciTech Connect (OSTI)

    Watkins, R.; Loftin, B.; Hoang, D.; Maxted, M.

    2012-05-30T23:59:59.000Z

    Prior to 2008, transfers of radioactive material within the Savannah River Site (SRS) boundary, referred to as onsite transfers, were authorized by Transportation Safety Basis (TSB) documents that only required approval by the SRS contractor. This practice was in accordance with the existing SRS Transportation Safety Document (TSD). In 2008 the Department of Energy Savannah River Field Office (DOE-SR) requested that the SRS TSD be revised to require DOE-SR approval of all Transportation Safety Basis (TSB) documents. As a result, the primary SRS contractor embarked on a multi-year campaign to consolidate old or generate new TSB documents and obtain DOE-SR approval for each. This paper focuses on the challenges incurred during the rewriting or writing of and obtaining DOE-SR approval of all Savannah River Site Onsite Transportation Safety Basis documents.

  1. New York State Energy Research and Development Authority

    Broader source: Energy.gov [DOE]

    One of DOE's key partners is the New York State Energy Research and Development Authority (NYSERDA), which operates a successful combined heat and power (CHP) and clean distributed generation (DG) research, development, and deployment program. NYSERDA supports development and demonstration of CHP systems throughout all end-use sectors. It also collects and analyzes project performance data, conducts market studies, and supports the Northeast Clean Energy Application Center (CEAC). The NYSERDA-DOE partnership evaluates CHP project proposals and shares lessons learned through conferences, workshops, and other activities. This partnership has provided value to New York residents and to energy professionals across the country. NYSERDA projects have led to electric demand reduction, higher fuel efficiency, emissions reduction, lower energy costs, job creation, and increased product sales.

  2. Peoria Housing Authority(PHA) Weatherization Training Project

    SciTech Connect (OSTI)

    Phillip Chrismon; Jason Dollarhide

    2011-12-31T23:59:59.000Z

    The DOE Weatherization Training Project's goal is to obtain a solid foundation of administrative and technical knowledge so the Peoria Housing Authority (PHA) can establish and implement a successful Weatherization Program by 2011. The DOE weatherization Training Project's two objectives are to (1) build PHA's capabilities by (2) developing its staff members capacities via the acquisition of weatherization skills and competencies. The impacts from this project include: (a) the improvement and expansion of PHA staff skills, (b) the overall enhancement of the quality of the PHA workforce, which will (c) foster employment, (d) the ability to properly weatherize PHA housing stock, tribal buildings, and tribal members houses, which will (e) result in reduced energy use, and (f) improved tribal and household economies.

  3. Peak Dose Assessment for Proposed DOE-PPPO Authorized Limits

    SciTech Connect (OSTI)

    Maldonado, Delis [Oak Ridge Institute for Science and Education, Oak Ridge, TN (United States). Independent Environmental Assessment and Verification Program

    2012-06-01T23:59:59.000Z

    The Oak Ridge Institute for Science and Education (ORISE), a U.S. Department of Energy (DOE) prime contractor, was contracted by the DOE Portsmouth/Paducah Project Office (DOE-PPPO) to conduct a peak dose assessment in support of the Authorized Limits Request for Solid Waste Disposal at Landfill C-746-U at the Paducah Gaseous Diffusion Plant (DOE-PPPO 2011a). The peak doses were calculated based on the DOE-PPPO Proposed Single Radionuclides Soil Guidelines and the DOE-PPPO Proposed Authorized Limits (AL) Volumetric Concentrations available in DOE-PPPO 2011a. This work is provided as an appendix to the Dose Modeling Evaluations and Technical Support Document for the Authorized Limits Request for the C-746-U Landfill at the Paducah Gaseous Diffusion Plant, Paducah, Kentucky (ORISE 2012). The receptors evaluated in ORISE 2012 were selected by the DOE-PPPO for the additional peak dose evaluations. These receptors included a Landfill Worker, Trespasser, Resident Farmer (onsite), Resident Gardener, Recreational User, Outdoor Worker and an Offsite Resident Farmer. The RESRAD (Version 6.5) and RESRAD-OFFSITE (Version 2.5) computer codes were used for the peak dose assessments. Deterministic peak dose assessments were performed for all the receptors and a probabilistic dose assessment was performed only for the Offsite Resident Farmer at the request of the DOE-PPPO. In a deterministic analysis, a single input value results in a single output value. In other words, a deterministic analysis uses single parameter values for every variable in the code. By contrast, a probabilistic approach assigns parameter ranges to certain variables, and the code randomly selects the values for each variable from the parameter range each time it calculates the dose (NRC 2006). The receptor scenarios, computer codes and parameter input files were previously used in ORISE 2012. A few modifications were made to the parameter input files as appropriate for this effort. Some of these changes included increasing the time horizon beyond 1,050 years (yr), and using the radionuclide concentrations provided by the DOE-PPPO as inputs into the codes. The deterministic peak doses were evaluated within time horizons of 70 yr (for the Landfill Worker and Trespasser), 1,050 yr, 10,000 yr and 100,000 yr (for the Resident Farmer [onsite], Resident Gardener, Recreational User, Outdoor Worker and Offsite Resident Farmer) at the request of the DOE-PPPO. The time horizons of 10,000 yr and 100,000 yr were used at the request of the DOE-PPPO for informational purposes only. The probabilistic peak of the mean dose assessment was performed for the Offsite Resident Farmer using Technetium-99 (Tc-99) and a time horizon of 1,050 yr. The results of the deterministic analyses indicate that among all receptors and time horizons evaluated, the highest projected dose, 2,700 mrem/yr, occurred for the Resident Farmer (onsite) at 12,773 yr. The exposure pathways contributing to the peak dose are ingestion of plants, external gamma, and ingestion of milk, meat and soil. However, this receptor is considered an implausible receptor. The only receptors considered plausible are the Landfill Worker, Recreational User, Outdoor Worker and the Offsite Resident Farmer. The maximum projected dose among the plausible receptors is 220 mrem/yr for the Outdoor Worker and it occurs at 19,045 yr. The exposure pathways contributing to the dose for this receptor are external gamma and soil ingestion. The results of the probabilistic peak of the mean dose analysis for the Offsite Resident Farmer indicate that the average (arithmetic mean) of the peak of the mean doses for this receptor is 0.98 mrem/yr and it occurs at 1,050 yr. This dose corresponds to Tc-99 within the time horizon of 1,050 yr.

  4. Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System...

    Broader source: Energy.gov (indexed) [DOE]

    0 DOE Order 412.1a, Work Authorization System Administrative Change Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System Administrative Change Questions concerning this...

  5. Renewable success : development of good architecture in the case of Arriyadh Development Authority, Saudi Arabia

    E-Print Network [OSTI]

    Alkhabbaz, Mohammed H

    2010-01-01T23:59:59.000Z

    ArRiyadh Development Authority (ADA) is an unusual city development authority within the Saudi Arabian government hierarchy. Part of its responsibilities is coordinating and overseeing the design and building of buildings ...

  6. Procedure-level Authorization for Java Remote Method Invocation Using SSL Credentials

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    Procedure-level Authorization for Java Remote Method Invocation Using SSL Credentials Alexander of any thread assumptions. KEYWORDS Java, RMI, RPC, mobile code, SSL, Authorization #12;i TABLE............................................................ 2 Figure 2: The creation and registration of an SSL socket

  7. State Transmission Infrastructure Authorities: The Story So Far; December 2007 - December 2008

    SciTech Connect (OSTI)

    Porter, K.; Fink. S.

    2008-05-01T23:59:59.000Z

    This report examines the status and future direction of state transmission infrastructure authorities. It summarizes common characteristics, discusses current transmission projects, and outlines common issues the state infrastructure authorities have faced.

  8. How to Obtain Authorization to Import and/or Export Natural Gas...

    Office of Environmental Management (EM)

    How to Obtain Authorization to Import andor Export Natural Gas and LNG How to Obtain Authorization to Import andor Export Natural Gas and LNG LNG Exports | Long Terms | Blanket...

  9. 1.4P Form -Authorization Psychotherapy Notes.doc Rev: 08/12/2005

    E-Print Network [OSTI]

    Feschotte, Cedric

    in a substance abuse treatment program. 5. I understand that if the authorized recipient of this information of your request). Approximate Dates of Treatment: ___________________________________________________________________ 1. I authorize the following health care provider or facility to DISCLOSE or RECEIVE my patient

  10. Multiple Critical Vulnerabilities in Blackboard due to persistent Cross Site Scripting and Authorization bugs

    E-Print Network [OSTI]

    Sekar, R.

    and Authorization bugs Tung Tran ­ tunghack@gmail.com Alireza Saberi - saberi.alireza@gmail.com The current version

  11. Sandhill Crane Roost Site Characteristics in the North Platte River Valley Author(s): Martin J. Folk and Thomas C. Tacha

    E-Print Network [OSTI]

    Sandhill Crane Roost Site Characteristics in the North Platte River Valley Author(s): Martin J the North Platte River Valley (NPRV) of Nebraska in riverine and semipermanent palustrine wetlands from late in the Platte River. Cranes roosted in semipermanent wetlands where widths were >12 m, water depths were 5

  12. Marine Ecosystem Sensitivity to Climate Change Author(s): Raymond C. Smith, David Ainley, Karen Baker, Eugene Domack, Steve Emslie, Bill

    E-Print Network [OSTI]

    Howat, Ian M.

    Marine Ecosystem Sensitivity to Climate Change Author(s): Raymond C. Smith, David Ainley, Karen records reveal ecologicaltransitionsin theAntarcticPeninsularegion RaymondC. Smith (Sansom 1989, Stark 1994, Rott et al. 1996, Smith et al. 1996). Signifi- cantly, polar ecosystem research

  13. A Radio-Tracking System for Studying Movements of Deer Author(s): John R. Tester, Dwain W. Warner, William W. Cochran

    E-Print Network [OSTI]

    Minnesota, University of

    A Radio-Tracking System for Studying Movements of Deer Author(s): John R. Tester, Dwain W. Warner of Wildlife Management. http://www.jstor.org #12;A RADIO-TRACKINGSYSTEMFORSTUDYINGMOVEMENTSOF DEER JOHN R monitor movements of deer (Odocoileus virginianus) marked with radio transmitters. Constructiondetails

  14. Title: Refreshable tactile graphics using a lateral skin deformation device Author(s): Levesque V.1, Hayward V.1, Petit G.2, Dufresne A.2

    E-Print Network [OSTI]

    Hayward, Vincent

    Title: Refreshable tactile graphics using a lateral skin deformation device Author(s): Levesque V.1: Tactile graphics are useful to convey spatial information and concepts to visually impaired persons with maps, mathematical diagrams and other types of illustrations. Unfortunately, tactile graphics

  15. Aspen, Elk, and Fire in Northern Yellowstone Park Author(s): William H. Romme, Monica G. Turner, Linda L. Wallace, Jennifer S. Walker

    E-Print Network [OSTI]

    Turner, Monica G.

    Aspen, Elk, and Fire in Northern Yellowstone Park Author(s): William H. Romme, Monica G. Turner of America ASPEN, ELK, AND FIRE IN NORTHERN YELLOWSTONE NATIONAL PARK1 WILLIAM H. ROMME Department of Biology, Montana 59011 USA Abstract. Most stands of trembling aspen (Populus tremuloides) in northern Yellow- stone

  16. Modulation of Wave Forces on Kelp Canopies by Alongshore Currents Author(s): Brian Gaylord, Mark W. Denny, Mimi A. R. Koehl

    E-Print Network [OSTI]

    Denny, Mark

    Modulation of Wave Forces on Kelp Canopies by Alongshore Currents Author(s): Brian Gaylord, Mark W-871 ? 2003, by the American Society of Limnology and Oceanography,Inc. Modulation of wave forces on kelp fromtheinteractionof theseorganismswiththepassingfluid. Kelp forests provide essential habitat and food for hun- dreds

  17. Multiple Test Procedures for Identifying the Minimum Effective and Maximum Safe Doses of Author(s): Ajit C. Tamhane and Brent R. Logan

    E-Print Network [OSTI]

    Bustamante, Fabián E.

    Author(s): Ajit C. Tamhane and Brent R. Logan Source: Journal of the American Statistical Association, Vol. 97, No. 457 (Mar., 2002), pp. 293- 301 Published by: American Statistical Association Stable URL of scholarship. For more information about JSTOR, please contact support@jstor.org. American Statistical

  18. MOTOR VEHICLE RECORD AUTHORIZATION This form authorizes Parking and Transportation (PTS) Fleet Services to conduct a motor vehicle record check to

    E-Print Network [OSTI]

    Kirschner, Denise

    MOTOR VEHICLE RECORD AUTHORIZATION This form authorizes Parking and Transportation (PTS) ­ Fleet Services to conduct a motor vehicle record check to verify eligibility to operate University of Michigan (U-M) vehicles. Form Instructions: · Complete each section of the form · Print and fax

  19. Wide Ruled: A Friendly Interface to Author-Goal Based Story Generation

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    Wide Ruled: A Friendly Interface to Author-Goal Based Story Generation James Skorupski1 , Lakshmi@cs.ucsc.edu 2 Electronic Arts Abstract. We present Wide Ruled, an authoring tool for the creation of generative stories. It is based on the Universe author-goal-based model of story generation, and extends this model

  20. Interactive Story Generation for Writers: Lessons Learned from the Wide Ruled Authoring Tool

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    Interactive Story Generation for Writers: Lessons Learned from the Wide Ruled Authoring Tool James multi-disciplinary background in computational and narrative theory. Wide Ruled is an authoring tool be realized if we can create tools that open their authoring to a much wider audience. Typically, creating

  1. Co-Authoring with Structured Annotations Qixing Zheng, Kellogg Booth, and Joanna McGrenere

    E-Print Network [OSTI]

    McGrenere, Joanna

    Co-Authoring with Structured Annotations Qixing Zheng, Kellogg Booth, and Joanna Mc Most co-authoring tools support basic annotations, such as edits and comments that are anchored messages. This causes unnecessary overhead in the write-review-edit workflow inherent in co-authoring. We

  2. Eliminating Design and Execute Modes from Virtual Environment Authoring Gary Marsden & Shih-min Yang

    E-Print Network [OSTI]

    Marsden, Gary

    Eliminating Design and Execute Modes from Virtual Environment Authoring Systems Gary Marsden & Shih a virtual environment authoring tool for novices. In particular we set out to eliminate separate design on the results of a usability experiments comparing each environment. Keywords- Virtual reality authoring, modes

  3. EHS DSP Authorization Request Form 2012-001 Safety & Risk Management

    E-Print Network [OSTI]

    , regulations and Driver safety Program requirements. I authorize Safety & Risk Management to enroll me or more persons in one accident; $5,000 property damage). Vehicle Code Section 16020 (effective July 1EHS DSP Authorization Request Form 2012-001 Safety & Risk Management Request for Authorization

  4. Design and Testing of a Heat Transfer Model of a Raccon (Procyon Lotor) in a Closed Tree Den Author(s): Jeffrey Thorkelson and Robert K. Maxwell

    E-Print Network [OSTI]

    Minnesota, University of

    Design and Testing of a Heat Transfer Model of a Raccon (Procyon Lotor) in a Closed Tree Den Author. http://www.jstor.org #12;Ecology (1974) 55: pp. 29-39 DESIGN AND TESTING OF A HEAT TRANSFER MODEL

  5. Interactive Story Generation for Writers: Lessons Learned from the Wide Ruled Authoring Tool

    E-Print Network [OSTI]

    Skorupski, James; Mateas, Michael

    2009-01-01T23:59:59.000Z

    Portugal, J. 2004. Writing Interactive Fiction Scenarii withAuthoring Scenes for Adaptive, Interactive Performances. InPedagogically Oriented Interactive Dramas. In Lectures Notes

  6. * Corresponding author -kfingerman@berkeley.edu 1 Integrating Water Sustainability into the Low Carbon Fuel Standard

    E-Print Network [OSTI]

    Kammen, Daniel M.

    * Corresponding author - kfingerman@berkeley.edu 1 Integrating Water Sustainability into the Low implications of bioenergy only take into account consumption by biorefineries. Because the feedstock

  7. VIDEO PRODUCTION CONSENT AND RELEASE FORM I, ___________________________ hereby authorize the University of Connecticut and those acting

    E-Print Network [OSTI]

    Alpay, S. Pamir

    VIDEO PRODUCTION CONSENT AND RELEASE FORM I, ___________________________ hereby authorize/or voice on any medium ("recordings") including but not limited to video, audio, photographic, digital

  8. INSTRUCTIONS e-Portal and MMIS Signature Authorization Form Surplus Property Program -MM-3S

    E-Print Network [OSTI]

    Oliver, Douglas L.

    For Materials & Logistics Management Use Only: Signatures: Date: Date: ____________________________________________________ 1. Authorized Materials & Logistics Management Signature/31/14 OFFICE MATERIALS & LOGISTICS MANAGEMENT (MLM) #12;

  9. Author's personal copy Forcing technological change: A case of automobile emissions control

    E-Print Network [OSTI]

    Author's personal copy Forcing technological change: A case of automobile emissions control their research and development (R&D) processes concerning automobile emissions control technologies amid

  10. IEEE TRANSACTIONS ON PARALLEL AND DISTRIBUTED SYSTEMS, VOL. 19, NO. 7, JULY 2008 1 Cooperative Secondary Authorization Recycling

    E-Print Network [OSTI]

    Secondary Authorization Recycling Qiang Wei, Matei Ripeanu, Member, IEEE, and Konstantin Beznosov, Member recycles previously received authorizations and shares them with other application servers to mask authorization recycling system and its evaluation using simulation and prototype implementation. The results

  11. Special Publication 800-127 Guide to Securing WiMAX

    E-Print Network [OSTI]

    Padgette of Booz Allen Hamilton. The authors would also like to thank the WiMAX Forum of the National Institute of Standards and Technology (NIST) and Cyrus Tibbs and Matthew Sexton of Booz Allen Hamilton, wish to thank their colleagues who reviewed drafts of this document and contributed to its

  12. Excepted Service Authority for Exceptionally Well Qualified (EWQ) EQ Pay Plan Employees

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-10-21T23:59:59.000Z

    To establish requirements and responsibilities for the employment and compensation of individuals when using the following DOE excepted service authority: Section 313 division D of the Consolidated Appropriations Act of 2014 (Public Law 113-76), hereafter referred to as appointment authority EWQ and pay plan EQ.

  13. University of Newcastle upon Tyne Evaluation of Authorization-Authentication Tools: PERMIS, OASIS,

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    -Authentication Tools: PERMIS, OASIS, XACML & SHIBOLETH J. Wu and P. Periorellis TECHNICAL REPORT SERIES No. CS-TR-935 of Authorization-Authentication Tools: PERMIS, OASIS, XACML & SHIBOLETH J. Wu, P. Periorellis Abstract GOLD (Grid., PERIORELLIS, P.. Evaluation of Authorization-Authentication Tools: PERMIS, OASIS, XACML & SHIBOLETH [By] J. Wu

  14. Multimedia Authoring for CoPs Romain Deltour, Agn`es Guerraz, and Cecile Roisin

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Multimedia Authoring for CoPs Romain Deltour, Agn`es Guerraz, and C´ecile Roisin INRIA Rh and share information. As this information becomes more and more multimedia in nature, the challenge is to build multimedia authoring and publishing tools that meets CoPs requirements. In this paper we analyze

  15. Multimedia Authoring: A 3D Interactive Visualization Interface based on a Structured

    E-Print Network [OSTI]

    Joseph Fourier Grenoble-I, Université

    Multimedia Authoring: A 3D Interactive Visualization Interface based on a Structured Document Model E!mail: {Nabil.Layaida, Jean!Yves.Vion!Dury}@imag.fr Multimedia authoring process is inherently a complex and tedious task, users have to specify all the details of a multimedia presentation (temporal

  16. Invited Presentation, EdMedia '94 Vancouver, Canada page 1 Issues and Obstacles with Multimedia Authoring

    E-Print Network [OSTI]

    Invited Presentation, EdMedia '94 Vancouver, Canada page 1 Issues and Obstacles with Multimedia, multimedia authoring involves making hard choices, forecasting technological evolution and adapting of the common threads shared by three dissimilar cases of multimedia authoring which we have experimented with

  17. The Ryuichi Kitamura Paper Award For the best paper authored by a student mentor combination

    E-Print Network [OSTI]

    California at Davis, University of

    The Ryuichi Kitamura Paper Award For the best paper authored by a student ­ mentor combination students--more than 30 Ph.D. and 50 master's advisees. He was a selfless mentor devoted to ensuring to institute the Ryuichi Kitamura Award for the Best Paper by a Student Co-Authored with a Mentor. Eligibility

  18. Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING AND AGENDA

    E-Print Network [OSTI]

    Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING AND AGENDA Notice is hereby given that a special meeting of the Board of Directors of the Power and Water Resources Pooling Authority (PWRPA) will be held on November 25, 2013 at 10:00 a.m., at the Westlands Water District, 3130

  19. Discovering Concrete Attacks on Website Authorization by Formal Analysis Chetan Bansal

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . After years of ad hoc au- thentication and authorization mechanisms for web APIs, a series of standards to the APIs and support offered by prominent social networks, such as Facebook, Twitter, and Google, on the basis of new open standards such as the OAuth 2.0 authorization protocol. A formal analysis

  20. Community Management of Local Authority Woodlands in England 1 Shared Assets, December 2013

    E-Print Network [OSTI]

    .3 Workshop 10 3.4 Data quality 10 Box 1 ­ Summary of community management caseCommunity Management of Local Authority Woodlands in England 1 Shared Assets, December 2013 Community Management of Local Authority Woodlands in England A report to Forest Research

  1. Air Quality: Roles, Responsibilities, and Authorities Matrix Department: Chemical and General Safety

    E-Print Network [OSTI]

    Wechsler, Risa H.

    Air Quality: Roles, Responsibilities, and Authorities Matrix Department: Chemical and General Safety Program: Air Quality Owner: Program Manager Authority: ES&H Manual, Chapter 30, Air Quality1 The following tables summarize major air quality program requirements and map them to the appropriate

  2. Photo-Interview Authorization.doc Rev: 08/12/2005

    E-Print Network [OSTI]

    Feschotte, Cedric

    __________________________________________________________________________________ ___________________________________________________________________________________ I authorize the University of Utah Health Care (UHC) or news agencies to make photographs, slides in a federally funded program for the treatment of substance abuse, this authorization may allow UHC or news substance abuse information under the Federal Substance Abuse Confidentiality Requirements. 3. University

  3. 2009 No part may be reproduced in any form without prior authorization.

    E-Print Network [OSTI]

    Amin, S. Massoud

    /Tamper Detection 3. Comm. Protocol Security 4. Risk Mgmt. Enhancement 5. High Speed Encryption 1. Self Healing Grid without prior authorization. Goal: Optimize controls to compensate for damage or failure conditions prior authorization. Intelligent Flight Control System: Example ­ complete hydraulic failure (1997) #12

  4. Allen County Community College Transfer Program to University of Kansas

    E-Print Network [OSTI]

    (Aerospace Systems, Chemical Systems, Digital Electronic Systems, Electromechanical Control Systems) Number MODERN AMERICAN LITERATURE 3 COL 230 EARLY BRITISH LITERATURE 3 COL 211 MODERN BRITISH LITERATURE 3 CLSX

  5. Van Allen probes pinpoint driver of speeding electrons

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and making space safer for satellites." Related Audio This text will be replaced The sound file contains sounds of Chorus Waves captured by researchers at the University of...

  6. arabidopsis thaliana allene: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    thaliana Biotechnology Websites Summary: of Informatics Informatics Building 901 East 10th Street Bloomington, IN 47408 igunduz, sizhao, dalkilic, sunkim of interest is...

  7. Transients in chloroplast gene transcription Sujith Puthiyaveetil, John F. Allen *

    E-Print Network [OSTI]

    Allen, John F.

    of the reaction centres of photosystem I and photosystem II. Their transcription is regulated by changes in wave protein"). The changes in transcript abundance in the model plant Arabidopsis thali- ana were initiated recognized for its wide linear dynamic range of detection, high sensi- tivity and reproducibility over

  8. Exploring the Dynamic Radio Sky with the Allen Telescope Array

    E-Print Network [OSTI]

    Williams, Peter Kelsey George

    2012-01-01T23:59:59.000Z

    interpreters (e.g. , IPython; Pérez & Granger 2007),based on the NumPy and IPython packages. Over the course of

  9. allens creek nuclear: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Materials Science Websites Summary: International Workshop on Interfaces at Bear Creek October 20 - 24, 2009 Bear Creek Mountain Resort of Community and Economic Development...

  10. Partitioning of energy in the wake of Hurricane Allen

    E-Print Network [OSTI]

    Eble, Marie Cecilia

    1984-01-01T23:59:59.000Z

    of a two-layer ocean to a hurricane translating with constant speed. He found the baroclinic response to consist of both a pattern of upwelling and an inertio-gravity wave in the wake of the storm. He found the wake response to be highly dependent... on the storm's translation speed, with the greatest response occurring for a storm speed much larger than the baroclinic long wave speed. Once dispersion of the wake occurred, a geostrophically-balanced ridge was found to remain in the interface height...

  11. allene oxide synthase: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (NO) pathway is involved in asthma, and eosinophils participate in the regulation and Environment of Asthma (EGEA). Association analyses were conducted on four quantitative...

  12. anti kalda allen: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration to become the nation's energy landscape. However, the environmental impacts associated with fracking'' for shale gas Angenent, Lars T. First Page Previous...

  13. allen radiation belt: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    particles. Hudson, H S; Frewen, S F N; DeRosa, M L 2009-01-01 7 Drivers, Detection, and Impacts of Precipitation from the Radiation Belts C. J. Rodger1 Physics Websites Summary:...

  14. Josh Allen of Richland Operations Office Named 2014 Facility...

    Energy Savers [EERE]

    DOE FR of the Year. He is responsible for operational oversight of the Richland Site's Solid Waste Operations Complex, which processes and stores nuclear and transuranic...

  15. $1,000,000+ Jefferson F. Allen '67 '97P

    E-Print Network [OSTI]

    Napier, Terrence

    . Aronson '15P Shari L. Aronson '15P Dexter F. Baker '50 '57G '81H * ++ Dorothy H. Baker '50W Thomas J Foundation Howard Hughes Medical Institute ++ Brigitte D. Linz '14GP ++ Arthur C. Tauck, Jr. '53 '79P Harry

  16. Thermoptic analysis of bimetallic mirrors Daniel Vukobratovich and Allen Gerzoff

    E-Print Network [OSTI]

    plated with electroless nickel to reduce light scattering. The thermal coefficient of expansion of electroless nickel, 13.5 x 10 ­6 m/m­K, is significantly different from that of a typical mirror substrate in an electroless nickel plated mirror, which can induce optical surface distortion. Possible solutions to the ``bi

  17. allen telescope array: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    P; Canestrari, R; Chadwick, P; Chikawa, M; Carton, P -H; De Souza, V; Dipold, J; Doro, M; Durand, D; Dyrda, M; Giro, E; Glicenstein, J -F; Hanabata, Y; Hayashida, M; Hrabovski, M;...

  18. McAllen, TX Natural Gas Exports to Mexico

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto China (Million Cubic Feet) 3 00.0Feet)Year Jan FebCubic0,935

  19. Booz Allen Hamilton Response to Department of Energy Request for

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: The FutureCommentsEnergyandapproximatelyBoosting America'sInformation on

  20. Allen Park, Michigan: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty EditCalifornia: Energy Resources Jump to: navigation,Alleghany HighPower Jump

  1. James Allen | Center for Bio-Inspired Solar Fuel Production

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |Is Your Home as Ready for Summer asJacob Barhen (1999) JanuaryAna

  2. Josh Allen of Richland Operations Office Named 2014 Facility Representative

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed off Energy.gov.Energy02.pdf7 OPAMEnergyInvestigativeCoggin Aboutof the Year | Department of

  3. 2013 Federal Energy and Water Management Award Winner Jeff Allen |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: The Future of BadTHEEnergy Vehicle Analysis3 Facility EMS AnnualDepartment

  4. Van Allen probes pinpoint driver of speeding electrons

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening aTurbulenceUtilize Available Resources PrintVal L.ValuationVan

  5. Allen County, Indiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat 1AMEEAisinInformationNew York:Indiana: Energy Resources Jump

  6. Allen County, Kansas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat 1AMEEAisinInformationNew York:Indiana: Energy

  7. Allen County, Kentucky: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat 1AMEEAisinInformationNew York:Indiana:

  8. Allen County, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat 1AMEEAisinInformationNew York:Indiana:69946°, -84.1435136°

  9. Allen Parish, Louisiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat 1AMEEAisinInformationNew York:Indiana:69946°,Parish,

  10. * Corresponding author.

    E-Print Network [OSTI]

    unknown authors

    and data utility are often perceived to be at odds. An omniscient data source would have many the ability to compute the desired ‘‘beneficial outcome’ ’ of sharing data for mining without having to actually

  11. Author Select

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProductsAlternativeOperationalAugust August 2015 Events August 2015 eventStratus

  12. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not Found Item Not Found The itemAIR SEPARATION BYAbrasion

  13. Title Author

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2, 2003 (NextTime-Resolved Study91 to6-000Name

  14. Author Guidelines

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumni AlumniFederalAshley BoyleAnL-15-08MediaAugust 3 August

  15. Poison Frog Colors Are Honest Signals of Toxicity, Particularly for Bird Predators. Author(s): Martine E. Maan and Molly E. Cummings

    E-Print Network [OSTI]

    Cummings, Molly E.

    Poison Frog Colors Are Honest Signals of Toxicity, Particularly for Bird Predators. Author://www.jstor.org #12;vol. 179, no. 1 the american naturalist january 2012 E-Article Poison Frog Colors Are Honest-polymorphic strawberry poison frog, Dendrobates pumilio. Using a mouse-based toxicity assay, we find extreme variation

  16. Authorization and Driving History Form The following information will be retained on file by all agencies on their drivers authorized to operate a

    E-Print Network [OSTI]

    Harms, Kyle E.

    agencies on their drivers authorized to operate a State vehicle, or a private vehicle for state purposes ___________________________________________ Position: Staff_____ Faculty_____ Student_____ Is employee's primary purpose to drive vehicles? Yes_____ No/her private vehicle in the course and scope of employment? Yes_____ No_____ Date of last Driver Training

  17. Plastic Phenotypic Response to Light of 16 Congeneric Shrubs from a Panamanian Rainforest Author(s): Fernando Valladares, S. Joseph Wright, Eloisa Lasso, Kaoru Kitajima, Robert W.

    E-Print Network [OSTI]

    Saleska, Scott

    Plastic Phenotypic Response to Light of 16 Congeneric Shrubs from a Panamanian Rainforest Author, 81(7), 2000, pp. 1925-1936 ? 2000 by the Ecological Society of America PLASTIC PHENOTYPIC RESPONSE of California, Davis, California 95616 USA Abstract. The comparative phenotypic plasticity of 16 species

  18. 04.20.2007.HIPAA/Final Forms/Authorization Revised 03.30.2011 AUTHORIZATION FOR RELEASE OF PROTECTED HEALTH INFORMATION

    E-Print Network [OSTI]

    Lichtarge, Olivier

    not ___ consent to the disclosure of substance/alcohol abuse evaluation or treatment. Section 8. By signing below to the health care provider/organization designated above. b. Any treatment, payment, or my enrollment in any, _____________________________________________(print name) authorize the following health care provider and/or organization to disclose the following

  19. Final FY 2009 NEUP RD Awards (2).xls

    Energy Savers [EERE]

    Pumps University of South Carolina Chen, Fanglin (Frank) * Adams, Thad M. - Savannah River National Laboratory * Brinkman, Kyle - Savannah River National Laboratory *...

  20. Sediment Setback 

    E-Print Network [OSTI]

    Crawford, Amanda

    2005-01-01T23:59:59.000Z

    Montagna, research advisor. ? ?Spatial Patterns in Wetland Nutrient Biogeochemistry: Implications for Ecosystem Functions,? Thad Scott, Department of Biology at Baylor University; Robert Doyle, research advisor. ? ?Carbon Aerogel Electrodes...

  1. anisotropic spin-exchange rates: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3 He polarizations in excess of 90 such polarizations using spin- exchange optical pumping 8 . Such high polarizations have not been attained, however Walker, Thad G. 3 Spin...

  2. Sediment Setback

    E-Print Network [OSTI]

    Crawford, Amanda

    2005-01-01T23:59:59.000Z

    Montagna, research advisor. ? ?Spatial Patterns in Wetland Nutrient Biogeochemistry: Implications for Ecosystem Functions,? Thad Scott, Department of Biology at Baylor University; Robert Doyle, research advisor. ? ?Carbon Aerogel Electrodes...

  3. Applications for Change or Transfer of Control of Authorizations to Import or Export Natural Gas

    Broader source: Energy.gov [DOE]

    Applicants for authorization to import or export natural gas, including liquefied natural gas (LNG), apply on behalf of a given entity, whose corporate structure and place of business is detailed...

  4. Procedia Engineering 59 (2013) 183 192 1877-7058 2013 The Authors. Published by Elsevier Ltd.

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    2013-01-01T23:59:59.000Z

    . In this paper, novel computer aided algorithms and methods are developed for 3D printing of scaffold structures with `Cake' and `Zigzag' patterns are developed and 3D printed. © 2013 The Authors. Published

  5. UncorrectedAuthorProof Journal of Alzheimer's Disease xx (20xx) xxx

    E-Print Network [OSTI]

    30 31 Correspondence to: Jesse Mez, Gertrude H. Sergievsky Center, College of Physicians and Surgeons;UncorrectedAuthorProof 2 J. Mez et al. / Language versus Memory Alzheimer's Subgroups tion of patients with AD

  6. chmod 660 facebook: Friendsourcing Social Network Sites First Author Name (Blank if Blind Review)

    E-Print Network [OSTI]

    chmod 660 facebook: Friendsourcing Social Network Sites First Author Name (Blank if Blind Review and to draw the users back into the site, we friendsource Facebook, enabling active contributors Facebook applications, friendsourcing, social computing, online participation ACM Classification Keywords H

  7. Published on 9 February 2006 by authority of the House of Commons

    E-Print Network [OSTI]

    Haszeldine, Stuart

    Decommissioning of North Sea infrastructure 47 A Carbon Capture and Storage Authority 48 6 Costs and Incentives 50 61 Energy Review 61 CCS and renewables 62 CCS, nuclear energy and security of supply 63 Timescales 65

  8. Secure multi-party communication with quantum key distribution managed by trusted authority

    DOE Patents [OSTI]

    Nordholt, Jane Elizabeth; Hughes, Richard John; Peterson, Charles Glen

    2013-07-09T23:59:59.000Z

    Techniques and tools for implementing protocols for secure multi-party communication after quantum key distribution ("QKD") are described herein. In example implementations, a trusted authority facilitates secure communication between multiple user devices. The trusted authority distributes different quantum keys by QKD under trust relationships with different users. The trusted authority determines combination keys using the quantum keys and makes the combination keys available for distribution (e.g., for non-secret distribution over a public channel). The combination keys facilitate secure communication between two user devices even in the absence of QKD between the two user devices. With the protocols, benefits of QKD are extended to multi-party communication scenarios. In addition, the protocols can retain benefit of QKD even when a trusted authority is offline or a large group seeks to establish secure communication within the group.

  9. EM Renews Information-Sharing Agreement with United Kingdom's Nuclear Decommissioning Authority

    Broader source: Energy.gov [DOE]

    PHOENIX – EM’s top official this week renewed an agreement between DOE and the U.K.’s Nuclear Decommissioning Authority (NDA) that expands the scope of their information sharing.

  10. Author's personal copy Thorium-234 as a tracer of spatial, temporal and vertical variability

    E-Print Network [OSTI]

    Buesseler, Ken

    Author's personal copy Thorium-234 as a tracer of spatial, temporal and vertical variability 2009 Accepted 6 April 2009 Available online 16 April 2009 Keywords: Thorium-234 Particle flux Sediment

  11. East Tennessee State University Employee Payroll Deduction Authorization and Gift/Pledge Form

    E-Print Network [OSTI]

    Karsai, Istvan

    : ___________________________________________________ E#: _____________________________ Department: _____________________________________________ ETSU P-mail: _____________________________________@etsu.edu Spouse/Partner Name: ___________________________________Employer deductions. I hereby authorize the ETSU Foundation to deduct from my paycheck each month the amount

  12. UNIVERSITY OF MAINE AND CAMPUS RECREATION CAMPS HEALTH HISTORY AND MEDICAL AUTHORIZATION FORM

    E-Print Network [OSTI]

    Thomas, Andrew

    UNIVERSITY OF MAINE AND CAMPUS RECREATION CAMPS HEALTH HISTORY AND MEDICAL AUTHORIZATION FORM cooperation. HEALTH HISTORY Please check below those that apply and give approximate dates where applicable, please explain_______________________________________ 6. Is your child currently under the regular care

  13. Author built high-end Redding home Written by Liz Skalka

    E-Print Network [OSTI]

    Hoffman, Andrew J.

    's Apprentice, published by Huron River Press, details his experience building the "Shaw house," a name given the author of seven books and more than 80 articles. He lives in Ann Arbor, Mich. Builder's Apprentice

  14. Author's personal copy Unified behaviour of maximum soot yields of methane, ethane and propane

    E-Print Network [OSTI]

    Gülder, Ömer L.

    Author's personal copy Unified behaviour of maximum soot yields of methane, ethane and propane the current study and the previous measurements in similar flames with methane, ethane, and propane flames

  15. RELATING TO LOCAL GOVERNMENT; ENACTING THE RENEWABLE ENERGY FINANCING DISTRICT ACT; AUTHORIZING MUNICIPALITIES AND

    E-Print Network [OSTI]

    Kammen, Daniel M.

    TO LOCAL GOVERNMENT; ENACTING THE RENEWABLE ENERGY FINANCING DISTRICT ACT; AUTHORIZING MUNICIPALITIES to encourage the development of distributed generation renewable energy sources and the installation. the creation and administration of renewable energy financing districts to facilitate the development

  16. Employment Verification and Compensation Release Authorization Form Forward the completed form

    E-Print Network [OSTI]

    Employment Verification and Compensation Release Authorization Form Forward the completed form: Via Research Triangle Park, NC 27709 Attn: Employment Verification Name information relative to my employment with the IBM Corporation

  17. Author / Computing, 2000, Vol. 0, Issue 0, 1-2 Digital Storytelling in Africa

    E-Print Network [OSTI]

    Blake, Edwin

    Author / Computing, 2000, Vol. 0, Issue 0, 1-2 1 Digital Storytelling in Africa Gary Marsden1) , llda Ladeira1) , Thomas Reitmaier1) , Nicola J Bidwell2) Edwin Blake 1) 1) Department of Computer

  18. Author's personal copy Interpretation of interseismic deformations and the seismic cycle associated with

    E-Print Network [OSTI]

    Vigny, Christophe

    Author's personal copy Interpretation of interseismic deformations and the seismic cycle associated online 11 January 2013 Keywords: Seismic cycle Finite element Subduction Earthquake Viscoelastic asthenosphere Low viscosity wedge The deformations of the overriding and subducting plates during the seismic

  19. Puerto Rico Aqueduct and Sewer Authority General Consulting Services and Technical Support

    E-Print Network [OSTI]

    Gilbes, Fernando

    Puerto Rico Aqueduct and Sewer Authority General Consulting Services and Technical Support, and environmental engineering courses at various engineering schools in Puerto Rico. His work experience includes of Puerto Rico, PSC. (Managing Engineer) (2005- Present) Management of environmental services including

  20. Long Island Power Authority- Solar Initiative Feed-in Tariff (New York)

    Broader source: Energy.gov [DOE]

    The Long Island Power Authority's (LIPA) Feed-in Tariff II (FIT II) program provides fixed payments for electricity produced by approved photovoltaic systems over a fixed period of time. The...

  1. Author's personal copy Cellular and physiological mechanisms underlying blood flow regulation in the

    E-Print Network [OSTI]

    Newman, Eric A.

    Author's personal copy Cellular and physiological mechanisms underlying blood flow regulation n f o Article history: Available online 3 May 2012 Keywords: Blood flow Retina Choroid Regulation review the cellular and physiological mechanisms responsible for the regulation of blood flow

  2. Towards a deployable framework for delegation of authority in network applications

    E-Print Network [OSTI]

    Stockwell, Will (Will C.)

    2006-01-01T23:59:59.000Z

    The Delegation Framework is a collection of programs, network protocols and library interfaces that provide fine-grained delegation of authority to network systems. The design and implementation of the Delegation Framework ...

  3. Clin Cancer Res. Author manuscript Single nucleotide polymorphisms, apoptosis, and the development of

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Clin Cancer Res. Author manuscript Page /1 7 Single nucleotide polymorphisms, apoptosis apoptosis (RILA) and possess in vitro certain single nucleotide polymorphisms (SNPs) located in candidate ; Genotype ; Humans ; Neoplasms ; genetics ; pathology ; radiotherapy ; Polymorphism, Single Nucleotide

  4. *Corresponding Author email: sourabh.k.saha@gmail.com Genetic algorithm based optimization and post

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    *Corresponding Author email: sourabh.k.saha@gmail.com Genetic algorithm based optimization and post optimality analysis of multi-pass face milling Sourabh K. Saha* Department of Mechanical Engineering IIT

  5. Author's personal copy Mesoscale modeling of electric double layer capacitors with three-dimensional

    E-Print Network [OSTI]

    Pilon, Laurent

    Author's personal copy Mesoscale modeling of electric double layer capacitors with three Mesoscale modeling Mesoporous electrodes a b s t r a c t This paper presents general mathematical

  6. Optimizing terminal conditions using geometric guidance for low-control authority munitions

    E-Print Network [OSTI]

    Tisa, Paul C

    2008-01-01T23:59:59.000Z

    Small munition effectiveness is a function of miss distance from the target and ability to achieve a steep flight path angle at the target. Many small guided munitions have limited control authority to achieve these competing ...

  7. Author's personal copy Effectiveness of domestic wastewater treatment using microbial fuel cells

    E-Print Network [OSTI]

    2009 Elsevier Ltd. All rights reserved. 1. Introduction Conventional biological wastewater treatmentAuthor's personal copy Effectiveness of domestic wastewater treatment using microbial fuel cells 2009 Available online 5 September 2009 Keywords: Domestic wastewater treatment Energy recovery

  8. Ann Occup Hyg . Author manuscript Asbestos-related diseases in automobile mechanics

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Ann Occup Hyg . Author manuscript Page /1 7 Asbestos-related diseases in automobile mechanics Abstract Purpose Automobile mechanics have been exposed to asbestos number of automobile mechanics, little is known about the non-malignant respiratory diseases observed

  9. Proceedings of the 2011 AAEE Conference, Fremantle, Western Australia, Copyright Authors' names, 2011 Faculty Use of Research Based Instructional Strategies

    E-Print Network [OSTI]

    Henderson, Charles

    Proceedings of the 2011 AAEE Conference, Fremantle, Western Australia, Copyright © Authors' names Conference, Fremantle, Western Australia, Copyright © Authors' names, 2011 Table 1: Research Based Henderson Western Michigan University, Kalamazoo, USA charles.henderson@wmich.edu Abstract: Over the last 20

  10. Public Service Commission Authorization to Utilize an Alternative Method of Cost Recovery for Certain Base Load Generation (Mississippi)

    Broader source: Energy.gov [DOE]

    The Senate Bill 2793 authorizes the Public Service Commission (PSC) to utilize an alternative cost recovery for certain base load generation. The PSC is authorized to include in an electric...

  11. Waste Authority wins 8th law suit against resource recovery project

    SciTech Connect (OSTI)

    Not Available

    1989-03-01T23:59:59.000Z

    The cornerstone of a series of legal challenges launched against the plan to build a waste-to-energy resource recovery plant in the Port Washington sandpits has been dismissed by the New York State Supreme Court in favor of the North Hempstead Solid Waste Management Authority. The dismissal marks the fourth unsuccessful attempt by Residents for A More Beautiful Port Washington to have the environmental review performed by the Town's Solid Waste Management Authority overturned on the contention that it should have been performed by the State. The Residents law suit sought to have the entire two and one half year environmental review performed by the Solid Waste Management Authority discarded and redone by the New York State Department of Environmental Conservation.

  12. Print date 01/06/15 Save date 21/05/01 11:01 PLEASE DO NOT QUOTE WITHOUT AUTHOR’S PERMISSION

    E-Print Network [OSTI]

    Carol A Adams; Paper For; Apira Adelaide

    this research. I am particularly grateful to Yvonne Laing who acted as a research assistant on the project and who identified many of the sources of information. I am also grateful to Geoff Frost and Dave Owen for their comments on an earlier version of the paper. Further thanks are due to Samantha Benoy, External Affairs Manager, ICI and Frank Rose, Vice President, Group Safety, Security, Health and Environment for their comments on an earlier draft of this paper. All views expressed are those of the author unless otherwise stated.

  13. Environmental Assessment for Authorizing the Puerto Rico Electric Power Authority (PREPA) to allow Public Access to the Boiling Nuclear Superheat (BONUS) Reactor Building, Rincon, Puerto Rico

    SciTech Connect (OSTI)

    N /A

    2003-02-24T23:59:59.000Z

    The U.S. Department of Energy (DOE) proposes to consent to a proposal by the Puerto Rico Electric Power Authority (PREPA) to allow public access to the Boiling Nuclear Superheat (BONUS) reactor building located near Rincon, Puerto Rico for use as a museum. PREPA, the owner of the BONUS facility, has determined that the historical significance of this facility, as one of only two reactors of this design ever constructed in the world, warrants preservation in a museum, and that this museum would provide economic benefits to the local community through increased tourism. Therefore, PREPA is proposing development of the BONUS facility as a museum.

  14. Morris County Improvement Authority, Morris County, New Jersey Renewable Energy Initiative

    SciTech Connect (OSTI)

    Bonanni, John [Chair, Morris County Improvement Authority] Chair, Morris County Improvement Authority

    2013-05-01T23:59:59.000Z

    The Morris County Improvement Authority (?Authority?), a public body corporate and politic of the State of New Jersey and created and controlled by the County, at the direction of the County and through the Program guaranteed by the County, financed 3.2 MW of solar projects (?Solar Projects?) at fifteen (15) sites for seven (7) local government units (?Local Units?) in and including the County. The Program uses a Power Purchase Agreement (?PPA?) structure, where the Solar Developer constructs, operates and maintains all of the Solar Projects, for the benefit of the Local Units and the Authority, for the maximum State law allowable PPA period of fifteen (15) years. Although all fifteen (15) sites were funded by the Authority, only the Mennen Arena site was considered for the purposes of the required local match funding for this grant. Specifically at the Mennen Arena site, the Authority financed 1.6 MW of solar panels. On October 18, 2013, the DOE Grant was drawn down following completion of the necessary application documents and final execution of an agreement memorializing the contemplated transaction by the Local Units, the County, The Authority and the solar developer. The proceeds of the DOE Grant were then applied to reduce the PPA price to all Local Units across the program and increase the savings from approximately 1/3 to almost half off the existing and forecasted utility pricing over the fifteen (15) year term, without adversely affecting all of the other benefits. With the application of the rate buy down, the price of electricity purchased under the PPA dropped from 10.9 to 7.7 cents/kWh. This made acquisition of renewable energy much more affordable for the Local Units, and it enhanced the success of the program, which will encourage other counties and local units to develop similar programs.

  15. Log of a young author's thinking: George W. Cable's "Drop Shot".

    E-Print Network [OSTI]

    Sinitiere, Autry James

    1974-01-01T23:59:59.000Z

    . . t 1974 Major Subject: English LOG OF A YOUNG AUTHOR'S THINKING: GEORGE W CABLE'S "DROP SHOT" A Thesis by AUTRY JAMES SINITIERE Approved as to style and content by: Chairman of Committe Hea of Department M er ember) August 1974 & s ~~. )$, gg... APSTRACT Log of a Young Author's Thinking: George W. Cable's "Drop Shot" (August 1974) Autry James Sinitiere, B. A. , College of Santa Fe Chairman of Advisory Committee: Dr Richard H. Ballinger In February 1870 George W. Cable began writing a * p p...

  16. Hugh Rudnick (Universidad Catcilica de Chile, Santiago, Chile) I congratulate the authors on a much needed

    E-Print Network [OSTI]

    Catholic University of Chile (Universidad Católica de Chile)

    the authors on a much needed bibliography. The literature is very extensive and I understand the difficulty of Influence", Proceedings of the 6th Latin-American and the Caribbean Congress on E l d c Energy EconomicEuropeennes-Direction Generale de L' Energie, "First Draft Electricity Directive", Brussels, June 1991 [61 Doyle, C., Maher, M

  17. Author's personal copy Corundum-bearing garnet peridotite from northern Dominican Republic

    E-Print Network [OSTI]

    Author's personal copy Corundum-bearing garnet peridotite from northern Dominican Republic in the late Cretaceous to early Tertiary subduction complex in northern Dominican Republic. The garnet., 2009) and in the Rio San Juan Complex of northern Dominican Republic (Abbott et al., 2005, 2006, 2007

  18. COMMUNITY-BASED PUBLIC AUTHORING WITH MOBILE CHEMICAL SENSOR NETWORKS C. Brueton, 1

    E-Print Network [OSTI]

    Roussos, George

    . In this paper, we report on two aspects of our work: the design and development of a low-cost mobile wireless The Robotic Feral Public Authoring (RFPA) project seeks to combine low-cost robotics with geo new ways in which the exclusiveness of pollution sensing and robotics can be dispelled and a new sense

  19. Author's personal copy Infaunal burrow ventilation and pore-water transport in muddy sediments

    E-Print Network [OSTI]

    Shull, David H.

    burrow ventilation activities of organisms. Burrow ventilation is modeled as a simple non-local exchangeAuthor's personal copy Infaunal burrow ventilation and pore-water transport in muddy sediments D: bioturbation bioirrigation biogeochemistry benthic ecology radon Boston Harbor a b s t r a c t The ventilation

  20. Blood. Author manuscript Inhibition of aurora kinases for tailored risk-adapted treatment of multiple

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Blood. Author manuscript Page /1 14 Inhibition of aurora kinases for tailored risk.hose@med.uni-heidelberg.de> Abstract Genetic instability and cellular proliferation have been associated with Aurora-kinase expression by Affymetrix DNA-microarrays in 784 samplesAurora-A -B -C including two independent sets of 233 and 345 CD138

  1. Cell Cycle . Author manuscript Benzo e pyridoindoles, novel inhibitors of the aurora kinases[

    E-Print Network [OSTI]

    Boyer, Edmond

    Cell Cycle . Author manuscript Page /1 12 Benzo e pyridoindoles, novel inhibitors of the aurora: Annie Molla Abstract Aurora kinases are serine/threonine protein kinases of a chemical library we found that benzo e pyridoindole derivatives inhibited Aurora kinase.[ ] The most potent

  2. Cell Cycle . Author manuscript Role of survivin phosphorylation by aurora B in mitosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Cell Cycle . Author manuscript Page /1 9 Role of survivin phosphorylation by aurora B in mitosis proteins, INCENP, Aurora B, Survivin and Borealin. Survivin, in contrast to the other members by Aurora B at Threonine 117. In this work we have studied the role of the phosphorylation of Survivin

  3. Cell Cycle . Author manuscript Localization of aurora A and aurora B kinases during interphase: role of

    E-Print Network [OSTI]

    Boyer, Edmond

    Cell Cycle . Author manuscript Page /1 11 Localization of aurora A and aurora B kinases during Abstract Aurora kinases possess a conserved catalytic domain (CD-terminal domain of AuroraA (AurA) participates in the localization of the kinase to the centrosome in interphase

  4. Not to be cited without prior reference to the authors. ICES CM 2006 / H:12

    E-Print Network [OSTI]

    Heino, Mikko

    Not to be cited without prior reference to the authors. ICES CM 2006 / H:12 Theme session H the male phase and reproduce as females already in their first reproductive season) responds is parameterized for Epinephelus fuscoguttatus (common names: brown #12;marbled grouper or flowery cod

  5. Nov. 15, 2001 Mohammad al-Kahtani 1 Emerging Authorization and Authentication

    E-Print Network [OSTI]

    Sandhu, Ravi

    1 Nov. 15, 2001 Mohammad al-Kahtani 1 XML Emerging Authorization and Authentication Standards Nov. 15, 2001 Mohammad al-Kahtani 2 About the speaker · Name: Mohammad al-Kahtani · Doctoral Candidate in Software Engineering: George Mason University · Contact info: malkahta@gmu.edu #12;2 Nov. 15, 2001 Mohammad

  6. Author's personal copy Opportunities and barriers to pumped-hydro energy storage in the United States

    E-Print Network [OSTI]

    Jackson, Robert B.

    Author's personal copy Opportunities and barriers to pumped-hydro energy storage in the United available commercially for grid-tied electricity storage, pumped- hydro energy storage (PHES) and compressed air energy storage (CAES). Of the two, PHES is far more widely adopted. In the United States

  7. ScientificWorldJournal . Author manuscript Therapeutic antibodies for the treatment of pancreatic cancer

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    for the treatment of pancreatic cancer and describes the most promising avenues toward a significant improvementScientificWorldJournal . Author manuscript Page /1 10 Therapeutic antibodies for the treatment of pancreatic cancer Patrick Chames * , Brigitte Kerfelec , Daniel Baty Stress Cellulaire INSERM : U624

  8. Author's personal copy Modelling and automation of water and wastewater treatment processes

    E-Print Network [OSTI]

    Author's personal copy Preface Modelling and automation of water and wastewater treatment processes on the applications of modelling and automation to water and wastewater treatment processes. The session, under their profession, with automation figuring prominently among the new disciplines required to improve

  9. Author's personal copy Temporal and spatial trends of total petroleum hydrocarbons in the seawater

    E-Print Network [OSTI]

    Ma, Lena

    Author's personal copy Temporal and spatial trends of total petroleum hydrocarbons in the seawater hydrocarbons Bohai Bay Temporal and spatial trends Seawater a b s t r a c t The temporal and spatial distribution of total petroleum hydrocarbons (TPH) in the seawater of Tianjin Bohai Bay during 1996

  10. Impact of Private Tutoring on Learning Levels: Evidence from India Ambrish Dongre (Corresponding Author),

    E-Print Network [OSTI]

    Bandyopadhyay, Antar

    Author), Fellow, Centre for Policy Research, Dharam Marg, Chanakyapuri, New Delhi ­ 110 021, India. Email, Centre for Policy Research, Dharam Marg, Chanakyapuri, New Delhi ­ 110 021, India. Email: vibhutewary1 Impact of Private Tutoring on Learning Levels: Evidence from India Ambrish Dongre (Corresponding

  11. Hypertension . Author manuscript Validating the Framingham Hypertension Risk Score: results from the

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Hypertension . Author manuscript Page /1 9 Validating the Framingham Hypertension Risk Score A promising hypertension risk prediction score using data from the United States Framingham Offspring study performance of the Framingham hypertension risk score in a European population, the Whitehall II study

  12. Author's personal copy Automobile proximity and indoor residential concentrations of BTEX and MTBE

    E-Print Network [OSTI]

    Siegel, Jeffrey

    Author's personal copy Automobile proximity and indoor residential concentrations of BTEX and MTBE to indoor benzene and MTBE concentrations appeared to have been dominated by car exhaust concentrations of other BTEX components and methyl tert-butyl ether (MTBE) have been reported [5,6]. Up until

  13. SUMMARY OF 2007 ATLANTIC TROPICAL CYCLONE ACTIVITY AND VERIFICATION OF AUTHOR'S SEASONAL AND MONTHLY FORECASTS

    E-Print Network [OSTI]

    Gray, William

    10 12.25 8 5.75 Accumulated Cyclone Energy (ACE) (96.2) 130 170 170 150 148 100 68 Net Tropical't press us too hard on future events!!" 3 #12;DEFINITIONS Accumulated Cyclone Energy ­ (ACE) A measureSUMMARY OF 2007 ATLANTIC TROPICAL CYCLONE ACTIVITY AND VERIFICATION OF AUTHOR'S SEASONAL

  14. Author's personal copy Digestive utilization of ozone-exposed forage by rabbits (Oryctolagus cuniculus)

    E-Print Network [OSTI]

    Ditchkoff, Steve

    Author's personal copy Digestive utilization of ozone-exposed forage by rabbits (Oryctolagus Digestibility Forage quality Herbivore nutrition Phenolics Rabbits Southern Piedmont a b s t r a c t A mixture) in a digestibility experiment. Forages and feed refusals were analyzed for concentrations of total cell wall

  15. Nutr Cancer . Author manuscript Freeze-dried ham promotes azoxymethane-induced mucin-depleted foci

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Nutr Cancer . Author manuscript Page /1 9 Freeze-dried ham promotes azoxymethane-induced mucin and red meat consumption is associated with the risk of colorectal cancer. Meta-analyses have suggested that the risk associated with processed meat is higher. Most processed meats are cured and cooked, which leads

  16. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  17. Integrating Authored and Real-Time Social Media Pei-Yu (Peggy) Chi

    E-Print Network [OSTI]

    Lieberman, Henry

    introduces a new style of social media combining aspects of the real-time and authored styles explosion in the popularity of social media, giving people new ways of connecting and forming relationships of this paper is to introduce a new kind of hybrid of these two kinds of social media, which we refer to

  18. www.cesos.ntnu.no Author Centre for Ships and Ocean Structures Stationkeeping of moored structures

    E-Print Network [OSTI]

    Nørvåg, Kjetil

    structures in drifting ice Li Zhou May 28th, 2013 #12;2 www.cesos.ntnu.no Author ­ Centre for Ships and Ocean Structures Background Numerical model Ice model test Validation Extension: heading control Conclusions of stationkeeping in ice: · Dynamic global ice loads · Response of floating structures · Local ice loads

  19. Author's personal copy Power generation using an activated carbon and metal mesh cathode in a

    E-Print Network [OSTI]

    Author's personal copy Power generation using an activated carbon and metal mesh cathode Engineering, Zhejiang University, Hangzhou 310027, PR China c Separation and Conversion Technology, VITO online 24 September 2009 Keywords: Microbial fuel cell Activated carbon Metal mesh Cathode a b s t r a c

  20. LASER TRANSFER DOPING USING AMORPHOUS SILICON Rafel Ferr (Correspondence author)1

    E-Print Network [OSTI]

    LASER TRANSFER DOPING USING AMORPHOUS SILICON Rafel Ferré (Correspondence author)1 , Ralf Gogolin1@isfh.de ABSTRACT: We demonstrate and characterize "Laser Transfer Doping" (LTD) for producing locally doped regions. For this purpose we use nanosecond pulsed laser for transferring phosphorus doped amorphous silicon from a carrier