National Library of Energy BETA

Sample records for thad allen authorized

  1. MUSIC MODELS FOR MUSIC-SPEECH SEPARATION Thad Hughes and Trausti Kristjansson

    E-Print Network [OSTI]

    Cortes, Corinna

    MUSIC MODELS FOR MUSIC-SPEECH SEPARATION Thad Hughes and Trausti Kristjansson Google Research, USA ABSTRACT We consider the task of speech recognition with loud music background interference. We use model-based music-speech separation and train GMM models for music on the audio prior to speech. We show over 8

  2. Evaluating Functional Localizers: The Case of the FFA Marc G. Berman1,2, Joonkoo Park1, Richard Gonzalez1, Thad A. Polk1,3, Amanda Gehrke1,

    E-Print Network [OSTI]

    Jonides, John

    Gonzalez1, Thad A. Polk1,3, Amanda Gehrke1, Scott Knaffla1, and John Jonides1 1Department of Psychology

  3. QER- Comment of Allen Young

    Broader source: Energy.gov [DOE]

    There is much that I can say about energy policy, but most important to me is the have no new infrastructure for fossil fuels, especially a proposed Kinder Morgan "northeast extension" pipeline through beautiful countryside in Massachusetts. There needs to be focus on renewables, plus conservation and efficiency. Allen Young

  4. 2A New Belt for the Van Allen Belts! Soon after launch, NASA's Van Allen

    E-Print Network [OSTI]

    2A New Belt for the Van Allen Belts! Soon after launch, NASA's Van Allen Probes detected a new Third Belt in the Van Allen Radiation Belts that encircle Earth. Located between the Inner and Outer Belts, which have been known to scientists for decades, the third belt is very temporary. It only

  5. Theoretical Investigations of Cycloadditions and Subsequent Transformations Involving Allenes and Arenes to Form Complex Polycycles

    E-Print Network [OSTI]

    Pham, Hung Viet

    2015-01-01

    Allene with Benzene and Butadiene: Concerted, Stepwise, andAllene with Benzene and Butadiene: Concerted, Stepwise, andAllene with Benzene and Butadiene: Concerted, Stepwise, and

  6. Fish Cognition and Consciousness Colin Allen

    E-Print Network [OSTI]

    Indiana University

    Fish Cognition and Consciousness Colin Allen colallen@indiana.edu phone: +1-812-855-3622 fax: +1, Bloomington, IN 47405 USA Abstract Questions about fish consciousness and cognition are receiving increasing this hugely diverse set of species. Keywords Fish, learning, cognition, consciousness Submitted to J

  7. AUTHORS Charles E. Whittle Edward L. Allen Chester L. Cooper

    Office of Scientific and Technical Information (OSTI)

    cost of generating electricity 36 Proliferation and use o f nuclear weapons 47 Possible climate change induced by additional atmospheric carbon dioxide 47 Major Accidents and...

  8. AUTHORS Charles E. Whittle Edward L. Allen Chester L. Cooper

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report:Speeding accessby a contractor ofvarDOE PAGES ATLAS diboson excesses

  9. Booz Allen Hamilton Response to Department of Energy Request...

    Energy Savers [EERE]

    wish to consider to ensure success in its Smart Grid communications network requirement work streams including recommendations for risk mitigation. Booz Allen Hamilton Response...

  10. Michael Allen; Dongarra, Jack. [University of Tennessee, Knoxville...

    Office of Scientific and Technical Information (OSTI)

    Toward a new metric for ranking high performance computing systems. Heroux, Michael Allen; Dongarra, Jack. University of Tennessee, Knoxville, TN The High Performance Linpack...

  11. Ben Allen | Argonne Leadership Computing Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & Inspections AuditsBarbara2.0.1Ben Allen HPC Systems

  12. Todd G. Allen | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|inWestMayBuildingTheEasements30, 2008: US portionHeatG. Allen -

  13. Theoretical Investigations of Cycloadditions and Subsequent Transformations Involving Allenes and Arenes to Form Complex Polycycles

    E-Print Network [OSTI]

    Pham, Hung Viet

    2015-01-01

    Reactions of Allene with Benzene and Butadiene: Concerted,Reactions of Allene with Benzene and Butadiene: Concerted,For select examples with benzene as a diene: (a) Ciganek, E.

  14. On the optimality of Allen and Kennedy's algorithm for parallelism extraction in nested loops

    E-Print Network [OSTI]

    Vivien, Frédéric

    On the optimality of Allen and Kennedy's algorithm for parallelism extraction in nested loops Alain. The result of this paper is that Allen and Kennedy's algorithm is optimal when dependences are approximated found by Allen and Kennedy's algorithm, as long as dependence level is the only information available

  15. PREDICTION OF SUBURBAN ENCROACHMENT ON THE ETHAN ALLEN FIRING RANGE AND CAMP JOHNSON

    E-Print Network [OSTI]

    Ramsey, R. Douglas

    PREDICTION OF SUBURBAN ENCROACHMENT ON THE ETHAN ALLEN FIRING RANGE AND CAMP JOHNSON CHITTENDEN Prediction of Suburban Encroachment on the Ethan Allen Firing Range and Camp Johnson, Chittenden County for many National Guard training installations. The Ethan Allen Firing Range and Camp Johnson, Vermont

  16. IVAN ALLEN COLLEGE OF LIBERAL ARTS Congressman John Lewis --

    E-Print Network [OSTI]

    Goodisman, Michael

    during events at the Ivan Allen College of Liberal Arts on April 4. "John Lewis put his life on the line. P. "Bud" Peterson. "It is our privilege to honor the life and work of Congressman Lewis through. 4 · February 18, 2013 NEWS BRIEFS Cycling Improvements Coming to Nearby Neighborhoods The Atlanta

  17. The North Pacific Ecosystem Metadatabase S. Allen Macklin

    E-Print Network [OSTI]

    , NOAA 7600 Sand Point Way NE, Seattle, Washington 98115, U.S.A. E-mail: Allen.Macklin@noaa.gov Bernard A. Megrey Alaska Fisheries Science Center, NMFS 7600 Sand Point Way NE, Seattle, Washington 98115, U.S.A. E of data. For example, metadata for vertical profiles of ocean properties obtained from hydrographic casts

  18. 1Electricity from Sunlight: The Van Allen Probes Solar Panels NASA's twin Van Allen Probes spacecraft will be launched in 2012. The

    E-Print Network [OSTI]

    1Electricity from Sunlight: The Van Allen Probes Solar Panels NASA's twin Van Allen Probes of the surrounding four solar panel `wings' that provide power to the spacecraft instruments. The small blue rectangles within each of the four solar panels show the location of the solar cells used to power

  19. LowerLower--Cost Fuel CellsCost Fuel Cells Allen J. Bard, Arumugam Manthiram,Allen J. Bard, Arumugam Manthiram,

    E-Print Network [OSTI]

    Lightsey, Glenn

    1 LowerLower--Cost Fuel CellsCost Fuel Cells Allen J. Bard, Arumugam Manthiram,Allen J. BardMaterials Science and Engineering Program 2 CONVENTIONAL POWER PLANT DIRECT FUEL CELL POWER PLANT Heat power PEMFC: H2 fuel DMFC: Methanol fuel Fuel cells vs. conventional #12;2 3 Fuel cells could change

  20. Allen County Community College Transfer Program to University of Kansas

    E-Print Network [OSTI]

    Engineering Physics 2 5 GE3N CHEM 130 Chemistry 5 CHE 125 Chemistry 5 GE12, GE3N COMMUNICATION Core COMS 130 Engineering Physics 2 5 GE3N Chemistry: Students may take the 2 courses below or wait and take CHEM 150 Chemistry for Engineers at KU CHEM 130 Chemistry 5 CHE 125 Chemistry 5 GE12, GE3N #12;Allen County Community

  1. Thad G. Walker Research Highlights

    E-Print Network [OSTI]

    Yavuz, Deniz

    . Walker Publications in Refereed Journals 27 Physical Review Letters, Nature Physics 2 Reviews of Modern made a dramatic impact on atomic physics, resulting in three No- bel Prizes. Laser cooled atoms. (Pub. #52) · New concepts in single atom, single photon sources (Pub. # 62) · Record trapped

  2. On the Optimality of Allen and Kennedy's Algorithm for Parallelism Extraction in Nested Loops

    E-Print Network [OSTI]

    Vivien, Frédéric

    On the Optimality of Allen and Kennedy's Algorithm for Parallelism Extraction in Nested Loops Alain is that Allen and Kennedy's algorithm is optimal when dependences are approximated by dependence levels and Kennedy's algorithm, as long as dependence level is the only information available. 1 Introduction Many

  3. The energization of relativistic electrons in the outer Van Allen radiation belt

    E-Print Network [OSTI]

    Loss, Daniel

    LETTERS The energization of relativistic electrons in the outer Van Allen radiation belt YUE CHEN online: 1 July 2007; doi:10.1038/nphys655 The origin and dynamics of the Van Allen radiation belts is one. These observations represent an important step towards a more complete physical understanding of radiation belt

  4. Allen County, Indiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > All ByNewInformation Allen

  5. Allen Park, Michigan: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin: Energy ResourcesAirAlamoCalifornia:WaveMaryland) JumpPowerAllen

  6. A history of Allen Academy, 1886-1968 

    E-Print Network [OSTI]

    LeUnes, Barbara Laverne

    1970-01-01

    1970 E i s t o r y A HISTORY OF ALLEN ACADEMY, 1886-1968 a Tnesis Barbara Laverne Le Un< Approved as to s t y l e and content by: CChajar H ^ ^ t o ^ XHe a/3" o f L'e p ar t me n t) ^ no nicer; (Member; January 197^ 9 5 2 8 0 4 1 X I... t e r a Reserve O f f i c e r T r a i n i n g Corps -was organized at the academy. The m i l i t a r y program made r a p i d progress, and i n 19'-7, A l l e n Academy was selected ns an Honor M i l i t a r y School which i s the highest r a t i n...

  7. Allen, C.A. 15 GEOTHERMAL ENERGY; 20 FOSSIL-FUELED POWER PLANTS...

    Office of Scientific and Technical Information (OSTI)

    Liquid-fluidized-bed heat exchanger flow distribution models Cole, L.T.; Allen, C.A. 15 GEOTHERMAL ENERGY; 20 FOSSIL-FUELED POWER PLANTS; FLUIDIZED BED HEAT EXCHANGERS; DESIGN;...

  8. 0036-1445/81.'"2301-0005 $01.00/0 f^MATICAL REMARKS ON THE VAN ALLEN RADIATION BELT

    E-Print Network [OSTI]

    Knill, Oliver

    0036-1445/81.'"2301-0005 $01.00/0 f^MATICAL REMARKS ON THE VAN ALLEN RADIATION BELT: A SURVEY radiation belt, were seemingly i vv j . {severai vears. sd, some of these particles were observed to have center or "adiabatic" approximation.) Under these circumstances, it was #12;THE VAN ALLEN RADIATION BELT

  9. Title: Author(s):

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnicalInformation FederatedInformationTITLE: AUTHOR(S)Patterns,(Journal A uttwr(s):

  10. Allen County, Kansas ASHRAE 169-2006 Climate Zone | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > All ByNewInformation AllenAllen

  11. Allen, Sracic, Chauhan & Hansen, IMAC XXVIII, Jacksonville, Fl, 2010 Page 1 of 14

    E-Print Network [OSTI]

    Allen, Matthew S.

    a state-of-the-art wind turbine model called HAWC2 that includes both structural dynamic and aerodynamic Analysis of Linear Time Periodic Systems with Application to Wind Turbine Simulation Data Matthew S. Allen, such as turbomachinery, helicopters and wind turbines, must be modeled with linear time-periodic equations of motion

  12. School Name Team Name Coach/Teacher Bloomfield HS Van Allen Belts Jason McCaughey

    E-Print Network [OSTI]

    Devoret, Michel H.

    School Name Team Name Coach/Teacher Bloomfield HS Van Allen Belts Jason Mc Rangers Peter Schmitt Mauro Sheridan Middle School Apple Sue Brown Mercy HS Quanta Buff Bachenheimer Millbrook School Spooky Action Somerset Waters Naugatuck HS Gone Fission Marc Pardee

  13. UW CSE is housed in the Paul G. Allen Center for Computer Science & Engineering, made possible

    E-Print Network [OSTI]

    Washington at Seattle, University of

    UW CSE is housed in the Paul G. Allen Center for Computer Science & Engineering, made possible Computer graphics, computer vision, and animation Human-computer interaction and ubiquitous computing, and intelligent Internet systems Software engineering Computational biology and synthetic biology Computational

  14. TOPIC: Shale Gas Emissions w/David Allen, Energy Institute HOST: Jeff Tester and Todd Cowen

    E-Print Network [OSTI]

    Walter, M.Todd

    the nation's energy landscape. However, the environmental impacts associated with ``fracking'' for shale gasTOPIC: Shale Gas Emissions w/David Allen, Energy Institute HOST: Jeff Tester and Todd Cowen DATE: November 20th , 12:00 -1:00pm, 300 Rice Hall Atmospheric Impacts of Expanded Natural Gas Use Hydraulic

  15. Allen County Community College TRANSFER PROGRAM TO THE UNIVERSITY OF KANSAS

    E-Print Network [OSTI]

    Photo Media-B.F.A Number to call at KU for advising: (785) 864-3500 Website: http/Senior level for graduation. Photo Media Requirements (all students): KU Course Requirements Allen Course Equivalents ENGLISH (3 Courses) Core ENGL 101 Composition 3 COL 101 Composition 3 GE21 ENGL 102 Critical

  16. Tracking deep mantle reservoirs with ultra-low velocity zones Allen K. McNamara a,

    E-Print Network [OSTI]

    Rhoads, James

    Tracking deep mantle reservoirs with ultra-low velocity zones Allen K. McNamara a, , Edward J, that directly overlies the core-mantle boundary (CMB). These regions have been dubbed Ultra-Low Velocity Zones. Introduction For over 15 yrs seismologists have mapped regions of ultra-low P- and S-wave velocities

  17. Application of real time GPS to earthquake early warning Richard M. Allen1

    E-Print Network [OSTI]

    Allen, Richard M.

    in general including tsunami warning systems. Citation: Allen, R. M., and A. Ziv (2011), Application of real of earthquake magnitude for the purpose of earthquake early warning and real time earthquake information systems, 2008; Brown et al., 2009]. In the March 11, 2011 M9 Tohoku oki earthquake the JMA warning system issued

  18. Security Standards for the Global Information Grid Gary Buda, Booz Allen & Hamilton, Linthicum, MD 21090

    E-Print Network [OSTI]

    Lee, Ruby B.

    1 Security Standards for the Global Information Grid Gary Buda, Booz Allen & Hamilton, Linthicum security of the Global Information Grid (GIG). The context for "hardening" this infrastructure also describes the Department of Defense (DoD) activities aimed toward defining security requirements

  19. DONOR HONOR ROLL -2012 Michael Allen Alice L. Bean, PhD

    E-Print Network [OSTI]

    DONOR HONOR ROLL - 2012 > $1000 Michael Allen Alice L. Bean, PhD Gisela M. Dreschhoff, PhD LCDR, Inc COL Brenda S. Johnson and LTC Lindley N. Johnson Carleton J. Lindgren, PhD Jack W. Lowry. Pintar, PhD Stephen J. Sanders, PhD Robert D. Talty, PhD & Dorothy W. Talty Bruce A. Twarog, PhD

  20. Allen E. Paulson College of Engineering and Information Technology (CEIT) Community

    E-Print Network [OSTI]

    Hutcheon, James M.

    Allen E. Paulson College of Engineering and Information Technology (CEIT) Community What Graphics, ENGR 1133. Information Technology students will be preregistered for Introduction to IT, IT 1130. Participants will be provided the option to select a FYE course relevant to their major. ·DinnerwiththeDeanoftheCollegeofEngineeringandInformationTechnology

  1. Plume-driven plumbing and crustal formation in Iceland Richard M. Allen,1,2

    E-Print Network [OSTI]

    Allen, Richard M.

    Plume-driven plumbing and crustal formation in Iceland Richard M. Allen,1,2 Guust Nolet,1 W. Jason- dimensional (3-D) crustal S velocity model and Moho map for Iceland. It reveals a vast plumbing system feeding Iceland. The low-velocity structure is interpreted as the thermal halo of pipe work which connects

  2. Asymmetric Carbon-Carbon Bond Formation gamma to a Carbonyl Group: Phosphine-Catalyzed Addition of Nitromethane to Allenes

    E-Print Network [OSTI]

    Smith, Sean W.

    A chiral phosphine catalyzes the addition of a carbon nucleophile to the ? position of an electron-poor allene (amide-, ester-, or phosphonate-substituted), in preference to isomerization to a 1,3-diene, in good ee and ...

  3. A dual polarized x-band pulse radar for ground based electromagnetic scattering experiment / by Allen William White 

    E-Print Network [OSTI]

    White, Allen William

    1978-01-01

    A DUAL POLARIZED X-BAND PULSE RADAR FOR GROUND BASED ELECTROMAGNETIC SCATTERING EXPERIMENT A Thesis by Allen William White Submitted to the Graduate College of Texas A/M University in partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE May 1978 Major Subject: Electrical Engineering A DUAL POLARIZED X-BAND PULSE RADAR FOR GROUND BASED ELECTROMAGNETIC SCATTERING EXPERIMENTS A Thesis by Allen William White Approved as to style and content by: x m n o ommzttee...

  4. Dr. Thad M. Adams Materials Technology Section

    E-Print Network [OSTI]

    ­ compressors/pumps ­ purifiers/separators ­ heat pumps/refrigeration · Battery / Fuel Cells ­ Ni metal hydride) ­ Developing strategic university, industrial and other partnerships in hydrogen energy R&D and demonstrations Embrittlement of Stainless Steel Weld Heat Affected Zone · Tritium (Beta Radiation) Degradation of UHMW-PE Valve

  5. Multimedia Authoring III: Web Authoring

    E-Print Network [OSTI]

    Dahlquist, Kam D.

    Multimedia Authoring III: Web Authoring · Many multimedia applications today have a Web manifestation, whether it is the application itself or something about the application, like a DVD info Web site · The Web can "wrap" other types of content as well: Flash, audio, video · The Web provides technologies

  6. Origin of abnormal pressures in the lower Vicksburg, McAllen Ranch field, Hidalgo County, Texas 

    E-Print Network [OSTI]

    Habeck, Mark Frederick

    1982-01-01

    percent in the Frio to less than 30 percent in the Vicksburg . The geothermal gradient also changes from 1. 74'F/100 ft (31. 7'C/km) to 2. 80'F/100 ft (51 . O'C/km) . Temperatures in the Vicksburg exceed 200'F (93 'C) or that required for clay... field is summarized in Table 2. The geothermal gradient is greater than 2'P/100 ft (36. 4'C/km). The normal pressure gradient in the Gulf Coast is approximately 0 ' 465 psi/ft ( 10. 5 kPa/m); at McAllen Ranch the pressure gradient within the lower...

  7. Allen County, Indiana ASHRAE 169-2006 Climate Zone | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > All ByNewInformation Allen County,

  8. Allen J. Bard, 2013 | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0GrantsThe Life ofASCRLightAllen J. Bard, 2013 The

  9. On the generation of large amplitude spiky solitons by ultralow frequency earthquake emission in the Van Allen radiation belt

    SciTech Connect (OSTI)

    Mofiz, U. A. [School of Science and Technology, Bangladesh Open University, Gazipur-1705 (Bangladesh)

    2006-08-15

    The parametric coupling between earthquake emitted circularly polarized electromagnetic radiation and ponderomotively driven ion-acoustic perturbations in the Van Allen radiation belt is considered. A cubic nonlinear Schroedinger equation for the modulated radiation envelope is derived, and then solved analytically. For ultralow frequency earthquake emissions large amplitude spiky supersonic bright solitons or subsonic dark solitons are found to be generated in the Van Allen radiation belt, detection of which can be a tool for the prediction of a massive earthquake may be followed later.

  10. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report:Speeding accessby a contractor ofvarDOE PAGES11 PPPL-AtmosphericAuthor

  11. Genealogies from time-stamped sequence data Alexei Drummond, Geoff K. Nicholls, Allen G. Rodrigo, Wiremu Solomon

    E-Print Network [OSTI]

    Nicholls, Geoff

    Genealogies from time-stamped sequence data Alexei Drummond, Geoff K. Nicholls, Allen G. Rodrigo methods for recovering genealog- ical structure, population size and mutation rates from radiocarbon arising from radiocarbon calibration of fossil sequences are dominated by uncertainty in the genealogy

  12. Internal Energy Dependence of the H + Allene/H + Propyne Product Branching from the Unimolecular Dissociation of 2-Propenyl Radicals

    E-Print Network [OSTI]

    Butler, Laurie J.

    Internal Energy Dependence of the H + Allene/H + Propyne Product Branching from the Unimolecular product channels as a function of internal energy in the dissociating radical isomer. The data resolve with internal energy to the two isomeric product channels: Based on energetic considerations alone, one expects

  13. Frontiers in Laser Cooling, Single-Molecule Biophysics, and Enrgy Science: A Talk from Leo Holberg and Allen Mills

    ScienceCinema (OSTI)

    Holberg, Leo; Mills, Allen [NIST

    2011-04-28

    Leo Holberg and Allen Mills present a talk at Frontiers in Laser Cooling, Single-Molecule Biophysics and Energy Science, a scientific symposium honoring Steve Chu, director of Lawrence Berkeley National Laboratory and recipient of the 1997 Nobel Prize in Physics. The symposium was held August 30, 2008 in Berkeley.

  14. A Polymer Scaffold for Protein Oligomerization Byron R. Griffith, Benjamin L. Allen, Alan C. Rapraeger, and Laura L. Kiessling*,,

    E-Print Network [OSTI]

    Rapraeger, Alan C.

    A Polymer Scaffold for Protein Oligomerization Byron R. Griffith, Benjamin L. Allen,§ Alan C, synthesis, and biological activity of a well-defined polymer for the oligomerization of proteins studies build on observations that saccharide-functionalized polymers can oligomerize concanavalin A.5

  15. Finite-Amplitude Evolution of Instabilities Associated with the Coastal Upwelling Front SCOTT M. DURSKI AND J. S. ALLEN

    E-Print Network [OSTI]

    Pierce, Stephen

    offshore transport in the oceanic surface layer, causing horizontal flow divergence near the coast. DURSKI AND J. S. ALLEN College of Oceanic and Atmospheric Sciences, Oregon State University, Corvallis conditions off the Oregon coast, including cases with steady and with time-variable wind in a domain

  16. A versatile microelectromechanical system for nanomechanical testing B. Pant, B. L. Allen, T. Zhu, K. Gall, and O. N. Pierrona

    E-Print Network [OSTI]

    Zhu, Ting

    online 4 February 2011 This letter presents a microelectromechanical system MEMS material testing setup. © 2011 American Institute of Physics. doi:10.1063/1.3553195 Microelectromechanical systems MEMS wereA versatile microelectromechanical system for nanomechanical testing B. Pant, B. L. Allen, T. Zhu

  17. Allen Hatcher

    E-Print Network [OSTI]

    2001-07-05

    as this approach is from a strictly logical point of view, it places more demands on ...... 6. (a) Let X be the subspace of R2 consisting of the horizontal segment .... but more elaborate structures such as rings, modules, and algebras also arise. ...... The preceding analysis of ?1(Xm,n) did not need the assumption that m and n ...

  18. A background correction algorithm for Van Allen Probes MagEIS electron flux measurements

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Claudepierre, S. G.; O'Brien, T. P.; Blake, J. B.; Fennell, J. F.; Roeder, J. L.; Clemmons, J. H.; Looper, M. D.; Mazur, J. E.; Mulligan, T. M.; Spence, H. E.; et al

    2015-07-14

    We describe an automated computer algorithm designed to remove background contamination from the Van Allen Probes Magnetic Electron Ion Spectrometer (MagEIS) electron flux measurements. We provide a detailed description of the algorithm with illustrative examples from on-orbit data. We find two primary sources of background contamination in the MagEIS electron data: inner zone protons and bremsstrahlung X-rays generated by energetic electrons interacting with the spacecraft material. Bremsstrahlung X-rays primarily produce contamination in the lower energy MagEIS electron channels (~30–500 keV) and in regions of geospace where multi-M eV electrons are present. Inner zone protons produce contamination in all MagEIS energymore »channels at roughly L « less

  19. The occurrence and wave properties of H?-, He?-, and O?-band EMIC waves observed by the Van Allen Probes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Saikin, A. A.; Zhang, J. -C.; Allen, R. C.; Smith, C. W.; Kistler, L. M.; Spence, H. E.; Torbert, R. B.; Kletzing, C. A.; Jordanova, Vania K.

    2015-09-26

    We perform a statistical study of electromagnetic ion cyclotron (EMIC) waves detected by the Van Allen Probes mission to investigate the spatial distribution of their occurrence, wave power, ellipticity, and normal angle. The Van Allen Probes have been used which allow us to explore the inner magnetosphere (1.1 to 5.8 RE). Magnetic field measurements from the Electric and Magnetic Field Instrument Suite and Integrated Science on board the Van Allen Probes are used to identify EMIC wave events for the first 22 months of the mission operation (8 September 2012 to 30 June 2014). EMIC waves are examined in H?-,more »He?-, and O?-bands. Over 700 EMIC wave events have been identified over the three different wave bands (265 H?-band events, 438 He?-band events, and 68 O?-band events). EMIC wave events are observed between L = 2 – 8, with over 140 EMIC wave events observed below L = 4. The results show that H?-band EMIC waves have two peak magnetic local time (MLT) occurrence regions: pre-noon (09:00 0.1 nT²/Hz), especially in the afternoon sector. Ellipticity observations reveal that linearly polarized EMIC waves dominate in lower L shells.« less

  20. A background correction algorithm for Van Allen Probes MagEIS electron flux measurements

    SciTech Connect (OSTI)

    Claudepierre, S. G.; O'Brien, T. P.; Blake, J. B.; Fennell, J. F.; Roeder, J. L.; Clemmons, J. H.; Looper, M. D.; Mazur, J. E.; Mulligan, T. M.; Spence, H. E.; Reeves, G. D.; Friedel, R. H. W.; Henderson, M. G.; Larsen, B. A.

    2015-07-14

    We describe an automated computer algorithm designed to remove background contamination from the Van Allen Probes Magnetic Electron Ion Spectrometer (MagEIS) electron flux measurements. We provide a detailed description of the algorithm with illustrative examples from on-orbit data. We find two primary sources of background contamination in the MagEIS electron data: inner zone protons and bremsstrahlung X-rays generated by energetic electrons interacting with the spacecraft material. Bremsstrahlung X-rays primarily produce contamination in the lower energy MagEIS electron channels (~30–500 keV) and in regions of geospace where multi-M eV electrons are present. Inner zone protons produce contamination in all MagEIS energy channels at roughly L < 2.5. The background-corrected MagEIS electron data produce a more accurate measurement of the electron radiation belts, as most earlier measurements suffer from unquantifiable and uncorrectable contamination in this harsh region of the near-Earth space environment. These background-corrected data will also be useful for spacecraft engineering purposes, providing ground truth for the near-Earth electron environment and informing the next generation of spacecraft design models (e.g., AE9).

  1. A long-lived relativistic electron storage ring embedded in Earth's Outer Van Allen belt

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Baker, D. N.; Kanekal, S. G.; Hoxie, V. C.; Henderson, M. G.; Li, X.; Spence, H. E.; Elkington, S. R.; Friedel, R. H. W.; Goldstein, J.; Hudson, M. K.; et al

    2013-02-28

    Since their discovery over 50 years ago, the Earth’s Van Allen radiation belts are thought to consist of two distinct zones of trapped, highly energetic charged particles. The outer zone is comprised predominantly of mega-electron volt (MeV) electrons that wax and wane in intensity on time scales ranging from hours to days depending primarily on external forcing by the solar wind. Thus, the spatially separated inner zone is comprised of commingled high-energy electrons and very energetic positive ions (mostly protons), the latter being stable in intensity levels over years to decades. In situ energy-specific and temporally resolved spacecraft observations revealmore »an isolated third ring, or torus, of high-energy (E > 2 MeV) electrons that formed on 2 September 2012 and persisted largely unchanged in the geocentric radial range of 3.0 to ~3.5 Earth radii for over four weeks before being disrupted (and virtually annihilated) by a powerful interplanetary shock wave passage.« less

  2. Energetic electron precipitation associated with pulsating aurora: EISCAT and Van Allen Probe observations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Miyoshi, Y.; Oyama, S.; Saito, S.; Kurita, S.; Fujiwara, H.; Kataoka, R.; Ebihara, Y.; Kletzing, C.; Reeves, G.; Santolik, O.; et al

    2015-04-21

    Pulsating auroras show quasi-periodic intensity modulations caused by the precipitation of energetic electrons of the order of tens of keV. It is expected theoretically that not only these electrons but also subrelativistic/relativistic electrons precipitate simultaneously into the ionosphere owing to whistler mode wave-particle interactions. The height-resolved electron density profile was observed with the European Incoherent Scatter (EISCAT) Tromsø VHF radar on 17 November 2012. Electron density enhancements were clearly identified at altitudes >68 km in association with the pulsating aurora, suggesting precipitation of electrons with a broadband energy range from ~10 keV up to at least 200 keV. The riometermore »and network of subionospheric radio wave observations also showed the energetic electron precipitations during this period. During this period, the footprint of the Van Allen Probe-A satellite was very close to Tromsø and the satellite observed rising tone emissions of the lower band chorus (LBC) waves near the equatorial plane. Considering the observed LBC waves and electrons, we conducted a computer simulation of the wave-particle interactions. This showed simultaneous precipitation of electrons at both tens of keV and a few hundred keV, which is consistent with the energy spectrum estimated by the inversion method using the EISCAT observations. This result revealed that electrons with a wide energy range simultaneously precipitate into the ionosphere in association with the pulsating aurora, providing the evidence that pulsating auroras are caused by whistler chorus waves. We suggest that scattering by propagating whistler simultaneously causes both the precipitations of subrelativistic electrons and the pulsating aurora.« less

  3. The occurrence and wave properties of H?-, He?-, and O?-band EMIC waves observed by the Van Allen Probes

    SciTech Connect (OSTI)

    Saikin, A. A.; Zhang, J. -C.; Allen, R. C.; Smith, C. W.; Kistler, L. M.; Spence, H. E.; Torbert, R. B.; Kletzing, C. A.; Jordanova, Vania K.

    2015-09-26

    We perform a statistical study of electromagnetic ion cyclotron (EMIC) waves detected by the Van Allen Probes mission to investigate the spatial distribution of their occurrence, wave power, ellipticity, and normal angle. The Van Allen Probes have been used which allow us to explore the inner magnetosphere (1.1 to 5.8 RE). Magnetic field measurements from the Electric and Magnetic Field Instrument Suite and Integrated Science on board the Van Allen Probes are used to identify EMIC wave events for the first 22 months of the mission operation (8 September 2012 to 30 June 2014). EMIC waves are examined in H?-, He?-, and O?-bands. Over 700 EMIC wave events have been identified over the three different wave bands (265 H?-band events, 438 He?-band events, and 68 O?-band events). EMIC wave events are observed between L = 2 – 8, with over 140 EMIC wave events observed below L = 4. The results show that H?-band EMIC waves have two peak magnetic local time (MLT) occurrence regions: pre-noon (09:00 < MLT ? 12:00) and afternoon (15:00 < MLT ? 17:00) sectors. He?-band EMIC waves feature an overall stronger dayside occurrence. O?-band EMIC waves have one peak region located in the morning sector at lower L shells (L < 4). He?-band EMIC waves average the highest wave power overall (>0.1 nT²/Hz), especially in the afternoon sector. Ellipticity observations reveal that linearly polarized EMIC waves dominate in lower L shells.

  4. Depositional environment and reservoir characteristics of the lower Vicksburg sandstones, west McAllen Ranch Field, Hidalgo County, Texas 

    E-Print Network [OSTI]

    Marshall, William Dustin

    1978-01-01

    - script. I want to thank Tenneco Oil Company for providing the financial support for this research. Ny special thanks go to John Blankenship, Warren Trims, James Holmes and Chuck Hamilton of Tenneco for help in obtaining well logs, core analyses..., paleontology, and well histories in the NcAllen Ranch field area. I also want to thank Shell Oil Com- pany for providing cores presented to Texas A&M University. I would also like to thank the many fellow graduate students for their constructive suggestions...

  5. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Liquid fluidized bed heat exchanger flow distribution models Cole L T Allen C A GEOTHERMAL ENERGY FOSSIL FUELED POWER PLANTS FLUIDIZED BED HEAT EXCHANGERS DESIGN FLOW MODELS FLOW...

  6. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Energy Frontier Research Center Center for Materials Science of Nuclear Fuels Todd Allen MATERIALS SCIENCE Materials Science Nuclear Fuels Materials Science Nuclear Fuels...

  7. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Toward a new metric for ranking high performance computing systems Heroux Michael Allen Dongarra Jack University of Tennessee Knoxville TN The High Performance Linpack HPL or Top...

  8. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    The Sandia MEMS passive shock sensor : FY08 design summary.","Walraven, Jeremy Allen; Baker, Michael Sean; Clemens, Rebecca C.; Mitchell, John Anthony; Brake, Matthew Robert; Epp,...

  9. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Viscosity for Tokamaks Kimin Kim Jong Kyu Park and Allen H Boozer PLASMA PHYSICS AND FUSION TECHNOLOGY Tokamaks Numerical Verification Tokamaks Numerical Verification This Letter...

  10. Job Salary Prediction Anonymous Author(s)

    E-Print Network [OSTI]

    Freitas, Nando de

    050 051 052 053 Job Salary Prediction Anonymous Author(s) Affiliation Address email Abstract Kaggle based classifieds company, hosted a Kaggle competition with the goal of improving job salary pre- dictions for job postings in which the salary does not appear. Using various lin- ear models, random

  11. A Pervasive Computing Solution to Asset, Problem and Knowledge Management Suman K. Kalia, Charles C. Tappert, Allen Stix, and Fred Grossman

    E-Print Network [OSTI]

    Tappert, Charles

    . Tappert, Allen Stix, and Fred Grossman School of Computer Science and Information Systems Pace University desktop support team across the U.S. Introduction The following quote (IBM Pervasive Computing Website computing" is relatively new, its concept has historical precedence. Companies like IBM (IBM Redbook 1995

  12. Asymptotics and numerical efficiency of the Allen-Cahn model for phase interfaces with low energy in solids

    E-Print Network [OSTI]

    Hans-Dieter Alber

    2015-05-20

    The accurate simulation of phase interfaces in solids requires small model error and small numerical error. If a phase field model is used and the interface carries low interface energy, then the model error is only small if the interface width in the model is chosen small. Yet, for effective numerical computation the interface width should be large. Choosing the parameters, which determine the width, is therefore an optimality problem. We study this problem for the Allen-Cahn equation coupled to the elasticity equations by constructing an asymptotic solution of second order, which yields an expansion for the kinetic relation of the model. This expansion determines the choice of the parameters, however only if the difference between the expansion and the exact kinetic relation is uniformly small with respect to a second parameter controlling the interface energy. To show this uniformity we determine the asymptotics with respect to this second parameter by scaling of the model equations. Our investigations are formal.

  13. Recycling Authorizations: Toward Secondary and Approximate Authorizations Model

    E-Print Network [OSTI]

    of matching best suitable approximate authorizations. 1 Introduction Although, every authorization decision

  14. Proposal for Modification to Authorization of

    E-Print Network [OSTI]

    US Army Corps of Engineers

    with the most recent being in September 2014. In the long run, mitigation of the flooding problem would Independent External Peer Review (IEPR). The Recommended Alternative consists of a single optimized detention Road. Downstream of Allen Road to the Detroit River, the channel improvements vary in width. As part

  15. Near-earth injection of MeV electrons associated with intense dipolarization electric fields: Van Allen Probes observations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Dai, Lei; Wang, Chi; Duan, Suping; He, Zhaohai; Wygant, John R.; Cattell, Cynthia A.; Tao, Xin; Su, Zhenpeng; Kletzing, Craig; Baker, Daniel N.; et al

    2015-08-10

    Substorms generally inject tens to hundreds of keV electrons, but intense substorm electric fields have been shown to inject MeV electrons as well. An intriguing question is whether such MeV electron injections can populate the outer radiation belt. Here we present observations of a substorm injection of MeV electrons into the inner magnetosphere. In the premidnight sector at L~5.5, Van Allen Probes (Radiation Belt Storm Probes)-A observed a large dipolarization electric field (50 mV/m) over ~40 s and a dispersionless injection of electrons up to ~3 MeV. Pitch angle observations indicated betatron acceleration of MeV electrons at the dipolarization front.more »Corresponding signals of MeV electron injection were observed at LANL-GEO, THEMIS-D, and GOES at geosynchronous altitude. Through a series of dipolarizations, the injections increased the MeV electron phase space density by 1 order of magnitude in less than 3 h in the outer radiation belt (L > 4.8). Our observations provide evidence that deep injections can supply significant MeV electrons.« less

  16. Whistler anisotropy instabilities as the source of banded chorus: Van Allen Probes observations and particle-in-cell simulations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Fu, Xiangrong; Cowee, Misa M.; Friedel, Reinhard H.; Funsten, Herbert O.; Gary, S. Peter; Hospodarsky, George B.; Kletzing, Craig; Kurth, William; Larsen, Brian A.; Liu, Kaijun; et al

    2014-10-22

    Magnetospheric banded chorus is enhanced whistler waves with frequencies ?r e, where ?e is the electron cyclotron frequency, and a characteristic spectral gap at ?r ? ?e/2. This paper uses spacecraft observations and two-dimensional particle-in-cell simulations in a magnetized, homogeneous, collisionless plasma to test the hypothesis that banded chorus is due to local linear growth of two branches of the whistler anisotropy instability excited by two distinct, anisotropic electron components of significantly different temperatures. The electron densities and temperatures are derived from Helium, Oxygen, Proton, and Electron instrument measurements on the Van Allen Probes A satellite during a bandedmore »chorus event on 1 November 2012. The observations are consistent with a three-component electron model consisting of a cold (a few tens of eV) population, a warm (a few hundred eV) anisotropic population, and a hot (a few keV) anisotropic population. The simulations use plasma and field parameters as measured from the satellite during this event except for two numbers: the anisotropies of the warm and the hot electron components are enhanced over the measured values in order to obtain relatively rapid instability growth. The simulations show that the warm component drives the quasi-electrostatic upper band chorus and that the hot component drives the electromagnetic lower band chorus; the gap at ~?e/2 is a natural consequence of the growth of two whistler modes with different properties.« less

  17. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    Toward a new metric for ranking high performance computing systems.","Heroux, Michael Allen; Dongarra, Jack. University of Tennessee, Knoxville, TN","2013-06-01T04:00:00Z",108998...

  18. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    The Sandia MEMS passive shock sensor FY08 design summary Walraven Jeremy Allen Baker Michael Sean Clemens Rebecca C Mitchell John Anthony Brake Matthew Robert Epp David S Wittwer...

  19. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    Energy Frontier Research Center Center for Materials Science of Nuclear Fuels","Todd Allen","2014-04-01T04:00:00Z",1149020,"10.21721149020","INLEXT-14-31923","DE-AC07-05ID14517",...

  20. Jessica A. Allen Keith M. Allen

    E-Print Network [OSTI]

    Frantz, Kyle J.

    Tiffani N. Cooper Ashley M. Coutu Jamie K. Davenport Ashley K. Devero Thao P. Do Marina Dodita Nick J D. Smith Damani I. Sommers Danielle D. Spragin Kathryn J. Sublett Nikki A. Thomas Linh T. Tong Hai H

  1. OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY June 30, 2010 #12;OKLAHOMA STATE UNIVERSITY MEDICAL Authority Members Oklahoma State University Medical Authority Tulsa, Oklahoma We have audited the accompanying statements of financial position of the Oklahoma State University Medical Authority (the

  2. OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OKLAHOMA STATE UNIVERSITY MEDICAL AUTHORITY June 30, 2009 #12;OKLAHOMA STATE UNIVERSITY MEDICAL Authority Members Oklahoma State University Medical Authority Tulsa, Oklahoma We have audited the accompanying statements of financial position of the Oklahoma State University Medical Authority (the

  3. Whistler anisotropy instabilities as the source of banded chorus: Van Allen Probes observations and particle-in-cell simulations

    SciTech Connect (OSTI)

    Fu, Xiangrong [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Cowee, Misa M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Friedel, Reinhard H. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Funsten, Herbert O. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Gary, S. Peter [Space Science Institute, Boulder, CO (United States); Hospodarsky, George B. [Univ. of Iowa, Iowa City, IA (United States). Dept. of Physics and Astronomy.; Kletzing, Craig [Univ. of Iowa, Iowa City, IA (United States). Dept. of Physics and Astronomy.; Kurth, William [Univ. of Iowa, Iowa City, IA (United States). Dept. of Physics and Astronomy.; Larsen, Brian A. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Liu, Kaijun [Auburn Univ., Auburn, AL (United States). Dept. of Physics.; MacDonald, Elizabeth A. [NASA/Goddard Space Flight Center, Greenbelt, MD (United States); Min, Kyungguk [Auburn Univ., Auburn, AL (United States). Dept. of Physics.; Reeves, Geoffrey D. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skoug, Ruth M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Winske, Dan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-10-22

    Magnetospheric banded chorus is enhanced whistler waves with frequencies ?r < ?e, where ?e is the electron cyclotron frequency, and a characteristic spectral gap at ?r ? ?e/2. This paper uses spacecraft observations and two-dimensional particle-in-cell simulations in a magnetized, homogeneous, collisionless plasma to test the hypothesis that banded chorus is due to local linear growth of two branches of the whistler anisotropy instability excited by two distinct, anisotropic electron components of significantly different temperatures. The electron densities and temperatures are derived from Helium, Oxygen, Proton, and Electron instrument measurements on the Van Allen Probes A satellite during a banded chorus event on 1 November 2012. The observations are consistent with a three-component electron model consisting of a cold (a few tens of eV) population, a warm (a few hundred eV) anisotropic population, and a hot (a few keV) anisotropic population. The simulations use plasma and field parameters as measured from the satellite during this event except for two numbers: the anisotropies of the warm and the hot electron components are enhanced over the measured values in order to obtain relatively rapid instability growth. The simulations show that the warm component drives the quasi-electrostatic upper band chorus and that the hot component drives the electromagnetic lower band chorus; the gap at ~?e/2 is a natural consequence of the growth of two whistler modes with different properties.

  4. Work Authorization System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-04-21

    To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's (DOE's) Planning, Programming, Budgeting, and Evaluation process. Cancels DOE O 412.1.

  5. Work Authorization System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-04-21

    To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's Planning, Programming, Budgeting, and Evaluation process. Admin Chg 1, dated 5-21-2014, cancels DOE O 412.1A.

  6. Work Authorization System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-04-20

    It establishes a work authorization and control process for work performed by designated management and operating (M&O), management and integrating (M&I), environmental restoration management contracts (ERMC) and other contracts determined by the Procurement Executive (hereafter referred to as M&O contractors). Cancels DOE O 5700.7C. Canceled by DOE O 412.1A.

  7. Adventures on the C3H5O potential energy surface: OH+propyne, OH+allene and related reactions

    SciTech Connect (OSTI)

    Zádor, Judit; Miller, James A.

    2014-06-25

    We mapped out the stationary points and the corresponding conformational space on the C3H5O potential energy surface relevant for the OH + allene and OH + propyne reactions systematically and automatically using the KinBot software at the UCCSD(T)-F12b/cc-pVQZ-F12//M06-2X/6-311++G(d,p) level of theory. We used RRKM-based 1-D master equations to calculate pressure- and temperature-dependent, channel-specific phenomenological rate coefficients for the bimolecular reactions propyne + OH and allene + OH, and for the unimolecular decomposition of the CH3CCHOH, CH3C(OH)CH, CH2CCH2OH, CH2C(OH)CH2 primary adducts, and also for the related acetonyl, propionyl, 2-methylvinoxy, and 3-oxo-1-propyl radicals. The major channel of the bimolecular reactions at high temperatures is the formation propargyl + H2O, which makes the title reactions important players in soot formation at high temperatures. However, below ~1000 K the chemistry is more complex, involving the competition of stabilization, isomerization and dissociation processes. We found that the OH addition to the central carbon of allene has a particularly interesting and complex pressure dependence, caused by the low-lying exit channel to form ketene + CH3 bimolecular products. In this study, we compared our results to a wide range of experimental data and assessed possible uncertainties arising from certain aspects of the theoretical framework.

  8. Organizational Evaluation and Authority 

    E-Print Network [OSTI]

    Scott, Richard W.; Dornbusch, Sanford M.; Busching, Bruce C.; Laing, James D.

    2015-07-21

    condition for internal pressures for change in the authority system--in short, for instability of the system. Both conception and theory are limited in scope to organizations which fulfill these conditions: 1) Organizational sanctions are distributed..., at least in part, on the basis of evaluations made of participants. 2) Evaluators who influence the distribution of organizational sanctions attempt to base their evaluations, at least in part, on the performance of organizational tasks by participants...

  9. Logical Attestation: An Authorization Architecture

    E-Print Network [OSTI]

    Schneider, Fred B.

    , Credentials-Based Authorization 1. Introduction Secure coprocessors, such as industry standard Trusted

  10. State authorization manual. Volume 1

    SciTech Connect (OSTI)

    Brugler-Jones, S.

    1990-10-01

    The State Authorization Manual (SAM) (Vol. I) provides guidance for States applying for program revisions to their authorized RCRA State program. The SAM is an updated version of the 1988 State Consolidated RCRA Authorization Manual (SCRAM). It focuses on program revision applications rather than initial applications since most States have received initial authorization for the RCRA program. The SCRAM should continue to be used to assist States not yet authorized under the RCRA program.

  11. Supplement 2, Authors: A To C 

    E-Print Network [OSTI]

    Doss, Mildred A.; Humphrey, Judith M.

    1954-01-01

    ., Am. Soc. Parasitol., Ithaca, N. York. Sept. 8-10] ALLEN, NATHANIEL NEWTON; and DICKE, ROBERT JEROME. 1952 a.?Cattle lice control by clipping

  12. Enrico Fermi Awards Ceremony for Dr. Allen J. Bard and Dr. Andrew Sessler, February 2014 (Presentations, including remarks by Energy Secretary, Dr. Ernest Moniz)

    ScienceCinema (OSTI)

    Moniz, Ernest [U.S. Energy Secretary

    2014-08-22

    The Fermi Award is a Presidential award and is one of the oldest and most prestigious science and technology honors bestowed by the U.S. Government. On February 3, 2014 it was conferred upon two exceptional scientists. The first to be recognized is Dr. Allen J. Bard, 'for international leadership in electrochemical science and technology, for advances in photoelectrochemistry and photocatalytic materials, processes, and devices, and for discovery and development of electrochemical methods including electrogenerated chemiluminescence and scanning electrochemical microscopy.' The other honoree is Dr. Andrew Sessler, 'for advancing accelerators as powerful tools of scientific discovery, for visionary direction of the research enterprise focused on challenges in energy and the environment, and for championing outreach and freedom of scientific inquiry worldwide.' Dr. Patricia Dehmer opened the ceremony, and Dr. Ernest Moniz presented the awards.

  13. Multiple Sclerosis Journal The Author(s) 2013

    E-Print Network [OSTI]

    Gaser, Christian

    Multiple Sclerosis Journal 0(0) 1­8 © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/1352458513478673 msj.sagepub.com MULTIPLE SCLEROSIS MSJ JOURNAL Introduction (MRIs) are the most striking finding in multiple sclerosis (MS) and they have become the most important

  14. Predicting Job Salaries from Text Descriptions Anonymous Author(s)

    E-Print Network [OSTI]

    Freitas, Nando de

    050 051 052 053 Predicting Job Salaries from Text Descriptions Anonymous Author(s) Affiliation Address descriptions of the posted jobs. Many listings provide a salary, but as many as half do not. For those listings that do not provide a salary, it is useful to predict a salary based on the description of that job. We

  15. FAQ for Case Study Authors

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reviews FAQ for Case Study Authors Science Engagement Move your data Programs & Workshops Science Requirements Reviews Network Requirements Reviews Documents and Background...

  16. Author's personal copy Cosmogenic 7

    E-Print Network [OSTI]

    Usoskin, Ilya G.

    Author's personal copy Cosmogenic 7 Be and 22 Na in Finland: Production, observed periodicities a Radiation and Nuclear Safety Authority, Regional Laboratory in Northern Finland, Rovaniemi, Finland b Sodankyl¨a Geophysical Observatory, Oulu Unit, University of Oulu, Finland c Ioffe Physical

  17. Waste Management Coordinating Lead Authors

    E-Print Network [OSTI]

    Columbia University

    10 Waste Management Coordinating Lead Authors: Jean Bogner (USA) Lead Authors: Mohammed Abdelrafie Ahmed, C. Diaz, A. Faaij, Q. Gao, S. Hashimoto, K. Mareckova, R. Pipatti, T. Zhang, Waste Management University Press, Cambridge, United Kingdom and New York, NY, USA. #12;586 Waste Management Chapter 10 Table

  18. Authority and Review Chart Exhibit A R = REVIEW A = AUTHORITY

    E-Print Network [OSTI]

    Zhou, Yuanyuan

    Authority and Review Chart Exhibit A R = REVIEW A = AUTHORITY ¹ OFF-SCALE NOT HANDLED PER POLICY Chancellor Academic Affairs ASST PROF (LRF, In Residence, Clinical X) Appointment R R R³ R R R R R4 R A Merit/ Reappointment A A³ R A R A Merit with off-scale salary increase R R³ R R R R R A Merit with 6th Year Market os

  19. AUTHORITY

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s sconveyance of9,Septemeber 19, 2014

  20. Collaborative Authoring of Walden's Paths 

    E-Print Network [OSTI]

    Li, Yuanling

    2012-10-19

    The World Wide Web contains rich collections of digital materials that can be used in education and learning settings. The collaborative authoring prototype of Walden's Paths targets two groups of users: educators and ...

  1. Author Order and Research Quality

    E-Print Network [OSTI]

    Kissan, Joseph; Laband, David N.; Patil, Vivek

    2005-01-01

    We observe a great deal of heterogeneity in the manner in which author orderings are assigned both across and within academic markets. To better understand this phenomenon, we develop and analyze a stochastic model of ...

  2. Danish Energy Authority Final report

    E-Print Network [OSTI]

    1 Danish Energy Authority Final report Kaliningrad Regional District Heating Network 2004 - 2006 2006 #12;Kaliningrad District Heating Network Project 2004 - 2006 2 Table of content The report........................................................................................................... 7 1.4.1 District heating in the Region

  3. Retrofitting the Tennessee Valley Authority

    E-Print Network [OSTI]

    Zeiber, Kristen (Kristen Ann)

    2013-01-01

    As the flagship of the New Deal, the Tennessee Valley Authority (TVA) was a triumph of regional and environmental design that has since fallen on hard times. When writer James Agee toured the region in 1935, he described ...

  4. Interference Mitigation in Femtocell Network Using Anonymous Author(s)

    E-Print Network [OSTI]

    Freitas, Nando de

    the power adaptation process of the FUEs and MUE to be a discrete multi agent Markov decision problem 050 051 052 053 Interference Mitigation in Femtocell Network Using Q-learning Anonymous Author problems is the so-called co-tier and cross-tier interference caused by the new femtocell network layer

  5. n errla lona Guest Author -

    E-Print Network [OSTI]

    F R p · Fiber Remforced Plastics n errla lona·········· Guest Author - Dr. Aftab Mufti. P-Stengthening Using Prestressed Carbon Fiber Sheets In recent years, researthers at EMfA Duhendorl, Switzerland, have been working extensively on ~.I ,trengtllening reinforced concrete member.; u,mg lillht· weight carbon

  6. Designated Responsible Authority (DRA) Training

    E-Print Network [OSTI]

    Minnesota, University of

    · The role of Designated Responsible Authority (DRA) is defined in the Using Vehicles for University Business policy. · The head of each University department with permanently assigned vehicles must appoint. Be familiar with the policies and related documents governing the use of University vehicles, and direct

  7. JOURNAL AUTHORS SURVEY Prepared by

    E-Print Network [OSTI]

    Stevenson, Paul

    JISC/OSI JOURNAL AUTHORS SURVEY Report Prepared by Key Perspectives Ltd 48 Old Coach Road, Playing behind its development 4 2.2 Models and definitions of open access 8 2.2.1 Open access journals 8 2 4.1 Respondent profiles 18 4.2 Awareness of open access journals 18 4.2.1 Extent and longevity

  8. Danish Energy Authority Project Document

    E-Print Network [OSTI]

    for larger existing buildings subject to major renovation 4. Energy performance certification (energyDanish Energy Authority Project Document Implementation of the EU directive on the energy performance of buildings: Development of the Latvian Scheme for energy auditing of buildings and inspection

  9. Danish Energy Authority Final Report

    E-Print Network [OSTI]

    on the energy performance for larger existing buildings subject to major renovation 4. Energy performanceDanish Energy Authority Final Report Implementation of the EU directive on the energy performance of buildings: Development of the Latvian Scheme for energy auditing of buildings and inspection of boilers

  10. With Compliments of the Author

    E-Print Network [OSTI]

    Zhang, Meirong

    Operators and Matrices With Compliments of the Author OaM-08-50 889­899 Zagreb, Croatia Volume 8, Croatia. All correspondence and subscription orders should be addressed to the Editorial Office: www, Croatia Fax: +385 1 6008799 The content of this publication is indexed in Mathematical Reviews (Math

  11. Central Characterization Program (CCP) Transuranic Authorized...

    Office of Environmental Management (EM)

    Authorized Methods for Payload Control Central Characterization Program (CCP) Transuranic Authorized Methods for Payload Control This document was used to determine facts and...

  12. Energy Department Authorizes Corpus Christi Liquefaction Project...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Authorizes Corpus Christi Liquefaction Project to Export Liquefied Natural Gas Energy Department Authorizes Corpus Christi Liquefaction Project to Export Liquefied Natural Gas May...

  13. Peoria Tribe: Housing Authority- 2010 Project

    Broader source: Energy.gov [DOE]

    The Housing Authority of the Peoria Tribe of Indians of Oklahoma (Peoria Housing Authority or PHA) will conduct the "PHA Weatherization Training Project."

  14. Obama Administration Announces Billions in Lending Authority...

    Energy Savers [EERE]

    Billions in Lending Authority for Renewable Energy Projects and to Modernize the Grid Obama Administration Announces Billions in Lending Authority for Renewable Energy Projects and...

  15. Human Generated Power for Mobile Electronics Thad Starner Joseph A. Paradiso

    E-Print Network [OSTI]

    Starner, Thad E.

    batteries than phones to consumers. The phones sold to users include a rechargeable battery so repositories for music videos, movies, photos, and personal information such as e-mail. Laptops, which were computing over the past decade and describe how batteries affect design tradeoffs for mobile device

  16. Finding location using omnidirectional video on a wearable computing platform Wasinee Rungsarityotin, Thad E. Starner

    E-Print Network [OSTI]

    Starner, Thad E.

    seek the appropriate place and image from the training data to de- scribe what we currently see used in air quality studies [6]). A sense of location is also essential in the field of mo- bile

  17. TBB-0080 - In the Matter of Thad M. Gyer, esq and Stephani L. Ayers, esq |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergyPlan | Department ofSUPPLEMENTSwitzerland|ofSessions |2 - In the Matter9

  18. Patrick A. Simen Assistant Professor

    E-Print Network [OSTI]

    Simen, Patrick

    .D. in Computer Science & Engineering, University of Michigan. ! Advisor: Assoc. Prof. Thad Polk, Department of Michigan with Thad Polk, Psychology. National Research Service Award for postdoctoral research from

  19. Allen,M.J.and M.D.Moore.1976.Fauna of offshore structures,p.179186.South.Calif.CoastalWater Res.Proj.Ann.Rept. Bascom, W., A. J. Mearns, and M. D. Moore. 1976. A biological survey of oil platforms in the Santa Barbara Channel.

    E-Print Network [OSTI]

    Love, Milton

    R-1 REFERENCES Allen,M.J.and M.D.Moore.1976.Fauna of offshore structures,p.179­186.South of an International Workshop on Offshore Lease Abandonment and Platform Disposal: Technology, Regulation. J. Kendall, Jr. 1994. An indication of the process: offshore platforms as artificial reefs

  20. Grid Applications Dr Gabrielle Allen

    E-Print Network [OSTI]

    Allen, Gabrielle

    CCT Grid Application Areas ! Computational Chemistry " GridChem: Building community deployment simulations, drilling technologies, integration with sensors and wireless networks, dynamic data driven & DynaCode: Data workflows with coupled models, dynamic data driven scenarios, metadata. (scoop

  1. NTER Authoring Training Participant_Guide_2012 | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICESpecialAPPENDIX FOrigin ofAllenDepartment ofNSR&DNSTB NSUF ResearchNTER

  2. Flexible Visual Authoring Using Operation History

    E-Print Network [OSTI]

    Su, Sara

    Flexible Visual Authoring Using Operation History Sara Su Massachusetts Institute of Technology l Revisiting history Storing and retrieving state Hierarchical authoring Grouping, structure, selections #12;Operations and selections today Uses of history System activity logs, instrumentation (not our focus

  3. GM-Ford-Chrysler: Allocating Loan Authority

    Broader source: Energy.gov [DOE]

    Statement from GM, Ford, and Chrysler: "Allocating the $25 Billion in Direct Loan Authority to Loan Applicants"

  4. State authorization manual. Volume 2. Appendices

    SciTech Connect (OSTI)

    Brugler-Jones, S.

    1990-10-01

    The document provides the supportive appendices for Volume 1 of the State Authorization Manual (SAM), which provides guidance for States applying for program revisions to their authorized RCRA State program. Among the appendices are: various program checklists, lists of revision checklists by cluster, model Federal Register Notices, guidance for State Authorization Files, and guidance for using Wordperfect files and for CFR files.

  5. Standing Delegations of Authority as at 1 December 2014 1 STANDING DELEGATIONS OF AUTHORITY

    E-Print Network [OSTI]

    University of Technology, Sydney

    Standing Delegations of Authority as at 1 December 2014 1 STANDING DELEGATIONS OF AUTHORITY 1 the Delegation Principles outlined on pages 5 and 6. Any questions about the interpretation of the Standing Delegations of Authority, suggestions for amendment of the Standing Delegations of Authority and requests

  6. National Training and Education Resource Advanced Authoring Training

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Authoring Training Participant Guide NTER Advanced Authoring Training Participant Guide (032012 pw) 2 Contents OBJECTIVES ......

  7. Montana Water Quality Permit Application, Nondegradation Authorization...

    Open Energy Info (EERE)

    Montana Water Quality Permit Application, Nondegradation Authorization, and Permit Fees Jump to: navigation, search OpenEI Reference LibraryAdd to library PermittingRegulatory...

  8. Authorization basis for the 209-E Building

    SciTech Connect (OSTI)

    TIFFANY, M.S.

    1999-02-23

    This Authorization Basis document is one of three documents that constitute the Authorization Basis for the 209-E Building. Per the U.S. Department of Energy, Richland Operations Office (RL) letter 98-WSD-074, this document, the 209-E Building Preliminary Hazards Analysis (WHC-SD-WM-TI-789), and the 209-E Building Safety Evaluation Report (97-WSD-074) constitute the Authorization Basis for the 209-E Building. This Authorization Basis and the associated controls and safety programs will remain in place until safety documentation addressing deactivation of the 209-E Building is developed by the contractor and approved by RL.

  9. Oregon Underground Injection Control Program Authorized Injection...

    Open Energy Info (EERE)

    Systems Webpage Jump to: navigation, search OpenEI Reference LibraryAdd to library Web Site: Oregon Underground Injection Control Program Authorized Injection Systems Webpage...

  10. Coordination of Federal Authorizations for Electric Transmission...

    Broader source: Energy.gov (indexed) [DOE]

    rulemaking and opportunity for comment on the coordination of federal authorizations for electric transmission facilities, September 19, 2008 Coordination of Federal...

  11. Disposal Authorization Statement | Department of Energy

    Office of Environmental Management (EM)

    DAS requirements ensure the facility does not pose a threat to human health and the environment, defines the authorization for the design, construction, operation,...

  12. Stockroom Authorization Department of Chemistry & Biochemistry

    E-Print Network [OSTI]

    Morgan, Stephen L.

    Stockroom Authorization Department of Chemistry & Biochemistry University of South Carolina, GSRC supplies from the Dept. of Chemistry & Biochemistry Stockroom must bring with them this completed pre

  13. Danish Energy Authority Poland -Electricity and gas

    E-Print Network [OSTI]

    Danish Energy Authority Poland - Electricity and gas market development study and practical guidelines for using EU Funds Electricity sector analyses December 2004 #12;Danish Energy Authority Poland - Electricity and gas market development study and practical guidelines for using EU Funds Electricity sector

  14. Financial Policy Manual 2107 ACCOUNTING AUTHORITY & RESPONSIBILITY

    E-Print Network [OSTI]

    George, Edward I.

    Financial Policy Manual Page 1 2107 ACCOUNTING AUTHORITY & RESPONSIBILITY Effective: December 1986: Research Services PURPOSE To assign authority and responsibility for the accounting for sponsored projects must be separately accounted for per the terms of the award An advance account may be established prior

  15. Policy-Based Authorization William R. Cook

    E-Print Network [OSTI]

    Cook, William R.

    Page 1 Policy-Based Authorization William R. Cook Department of Computer Sciences University of Texas at Austin Abstract This paper discusses policy-based authorization, an effective intermediate point between MAC and DAC that promises to combine the best features of both models. Policy

  16. Using the Web for Name Authority Work

    E-Print Network [OSTI]

    Whittaker, Beth M.; Spillane, Jodi Lynn

    2001-01-01

    While many catalogers are using the Web to find the information they need to perform authority work quickly and accurately, the full potential of the Web to assist catalogers in name authority work has yet to be realized. The ever-growing nature...

  17. PP-22 British Columbia Hydro and Power Authority, Amendment 1967...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    PP-22 British Columbia Hydro and Power Authority, Amendment 1967 PP-22 British Columbia Hydro and Power Authority, Amendment 1967 Presidential permit authorizing British Columbia...

  18. The Lichens of Aton Forest, Connecticut Author(s): Mason E. Hale, Jr.

    E-Print Network [OSTI]

    LeTourneau, Peter M.

    The Lichens of Aton Forest, Connecticut Author(s): Mason E. Hale, Jr. Source: The Bryologist, Vol OF ATON FOREST THE LICHENS OF ATON FOREST, CONNECTICUT MASONE. HALE, JR. INTRODUCTION During the summer, CONNECTICUT MASONE. HALE, JR. INTRODUCTION During the summer of 1949 the author studied the lichens of Aton

  19. Delegation as Officially Designated Federal Security Authority...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Status: Current Effective Date: Sep 27, 2012 Re-delegation Allowed: No Authorities: DOE O 473.3 Related History Related to: DOE O 473.3, Protection Program Operations There...

  20. Safety Management Functions, Responsibilities, and Authorities Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-12-31

    This Manual defines safety management functions, responsibilities, and authorities for DOE senior management with responsibilities for line, support, oversight, and enforcement actions. Cancels DOE M 411.1-1B. Canceled by DOE O 450.2.

  1. Safety Management Functions, Responsibilities, and Authorities Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-10-08

    This Manual defines safety management functions, responsibilities, and authorities for DOE senior management with responsibilities for line, support, oversight, and enforcement actions. Canceled by DOE M 411.1-1A. Does not cancel other directives.

  2. Shared Authority Concerns in Automated Driving Applications

    E-Print Network [OSTI]

    Cummings, M.L.

    2014-05-13

    Given the move toward driverless cars, which includes the more short-term goal of driving assistance, what the appropriate shared authority and interaction paradigms should be between human drivers and the automation remains ...

  3. Safety Management Functions, Responsibilities, and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-05-22

    This Manual provides the responsibilities of Headquarters and field element offices required by DOE P 411.1, Safety Management Functions, Responsibilities and Authorities Policy, dated 1-28-97. It also contains detailed requirements to supplement the policy's direction for each DOE organization having safety management functions to establish and maintain separate documentation of their responsibilities and authorities. Cancels DOE M 411.1-1A. Canceled by DOE M 411.1-1C.

  4. State authority in an expanded territorial sea 

    E-Print Network [OSTI]

    Fulbright, Michael Gene

    1977-01-01

    . , University of West Florida Chairman of Advisory Committee: John L. Seymour The purpose of this thesis was to examine what types of state authority would extend to an expanded area of the territorial sea. This thesis first exa- mines the historical... miles ioso 82 facto for any Gulf State. State boundaries were to be determined by the historic action taken with respect to them jointly by Congress and the state itself. The authors of the SLA intended that such joint action wou~M fix the states...

  5. Risk Management for Distributed Authorization Christian Skalka

    E-Print Network [OSTI]

    Wang, Xiaoyang "Sean"

    Risk Management for Distributed Authorization Christian Skalka University of Vermont X. Sean Wang assess risk, but risk in trust management is usually an informal consideration. In this paper, we de trust management systems treat all assertions as equally valid up to certificate authentication

  6. Energy Resources and Convening Lead Author (CLA)

    E-Print Network [OSTI]

    Power S.p.A., Italy) S.C. Bhattacharya (International Energy Initiative, India) Maurice B. Dusseault (University of Waterloo, Canada) Luc Gagnon (HydroQuébec, Canada) Helmut Haberl (Klagenfurt University Leoben,Austria) Vladimir Yakushev (Gazprom, Russia) Contributing Authors (CA) Doug J. Arent (National

  7. WEAPONS ON CAMPUS Authority: Chief of Police

    E-Print Network [OSTI]

    Scharf, Fred

    05.501 WEAPONS ON CAMPUS Authority: Chief of Police History: Established September 14, 2006 Source of weapons on UNCW property. II. Policy A. The University of North Carolina system of campuses is classified be unlawful for any person to possess the following weapons on UNCW property: 1. Dynamite cartridge, bomb

  8. Guide to Authors About the Journal

    E-Print Network [OSTI]

    Loss, Daniel

    nature physics Guide to Authors About the Journal Aims and scope of the journal Nature Physics. The journal content reflects core physics disciplines, but is also open to a broad range of topics whose to experiment, also features. Research areas covered in the journal include: · Quantum physics · Atomic

  9. Page 1 of 1 Author Query Form

    E-Print Network [OSTI]

    Utsunomiya, Satoshi

    ;A/Author phone: C;A/Title C;A/Department Department of Nuclear Engineering and Radiological Sciences C 48109-2104 C;A/Country U.S.A. C;A/Title C;A/Department Department of Nuclear Engineering, and Nuclear Engineering and Radiological Science C;A/Institution University of Michigan C;A/Street Address

  10. COMPARING THE VANCOUVER INTERNATIONAL AIRPORT AUTHORITY'S

    E-Print Network [OSTI]

    prescribed authorities to conduct environmental impact assessments (EIAs) of projects carried out on federal environmental management. The International Association for Impact Assessment's (IAIA) Principles for EIA Best if the proposed CEAA regulations come into force. Keywords: Environmental impact assessment; best practice

  11. Web Information Retrieval Author Preprint for Web

    E-Print Network [OSTI]

    Hawking, David

    indexes is often called `the hidden web', `the deep web', or `web dark matter' (Bailey et al., 2000). 2Web Information Retrieval Author Preprint for Web Nick Craswell and David Hawking 18 April 2009 1 Introduction This chapter outlines some distinctive characteristics of web information re- trieval, starting

  12. Authorization in Trust Management: Features and Foundations

    E-Print Network [OSTI]

    Wang, Xiaoyang "Sean"

    Authorization in Trust Management: Features and Foundations Peter C. Chapin University of Vermont and Christian Skalka University of Vermont and X. Sean Wang University of Vermont Trust management systems' addresses: Peter Chapin, University of Vermont, Department of Computer Science, Burlington, VT 05405

  13. Intuitive Ontology Authoring using Controlled Natural Language

    E-Print Network [OSTI]

    Dimitrova, Vania

    in accordance with the requirements for the degree of Doctor of Philosophy University of Leeds School. 246-264. This paper was mostly written by me, and reviewed and improved by the other authors. ©2013 University of Leeds and Ronald Denaux #12;to... domain experts, I suppose. #12;Acknowledgements My

  14. Reconsidering Authority Scientific Expertise, Bounded Rationality,

    E-Print Network [OSTI]

    Strevens, Michael

    , perhaps, but disastrous for us, living in this world in which almost all information about anything sources; rather, we should give it special treatment, keeping track of it even after we have extracted of that authority. I will search for a semiformal model of epistemic backtracking, a model formal enough

  15. The Evolution of Science Museums Author(s): Silvio A. Bedini

    E-Print Network [OSTI]

    Short, Daniel

    University Press on behalf of the Society for the History of Technology Stable URL: http@jstor.org. . Society for the History of Technology and The Johns Hopkins University Press are collaborating with JSTORThe Evolution of Science Museums Author(s): Silvio A. Bedini Reviewed work(s): Source: Technology

  16. Storage Operators and Directed Lambda-Calculus Author(s): Rene David and Karim Nour

    E-Print Network [OSTI]

    Nour, Karim

    Storage Operators and Directed Lambda-Calculus Author(s): Rene David and Karim Nour Source, December 1995 STORAGE OPERATORS AND DIRECTED LAMBDA-CALCULUS RENE DAVID AND KARIM NOUR Abstract. Storage. With this calculus we get an equivalent-and simple-definition of the storage operators that allows to show some

  17. Deriving Morality from Politics: Rethinking the Formula of Humanity Author(s): Japa Pallikkathayil

    E-Print Network [OSTI]

    Machery, Edouard

    Deriving Morality from Politics: Rethinking the Formula of Humanity Author(s): Japa Pallikkathayil-1704/2010/12101-0001$10.00 116 Deriving Morality from Politics: Rethinking the Formula of Humanity* Japa Pallikkathayil Kant's Formula of Humanity famously forbids treating others merely as a means. It is unclear, however, what

  18. Rainbow Trout Production in Dystrophic Lakes Author(s): Waldo E. Johnson and Arthur D. Hasler

    E-Print Network [OSTI]

    Notre Dame, University of

    Rainbow Trout Production in Dystrophic Lakes Author(s): Waldo E. Johnson and Arthur D. Hasler://www.jstor.org #12;RAINBOW TROUT PRODUCTION IN DYSTROPHIC LAKES1 Waldo E. Johnson and Arthur D. Hasler Department, and it is well known that these small lakes contribute very little to the sport fishery of this area

  19. Carbon Dioxide Evolution from the Floor of Three Minnesota Forests Author(s): W. A. Reiners

    E-Print Network [OSTI]

    Thomas, David D.

    Carbon Dioxide Evolution from the Floor of Three Minnesota Forests Author(s): W. A. Reiners and extend access to Ecology. http://www.jstor.org #12;Late Spring 1968 CARBON DIOXIDE EVOLUTION RATES 471. Germination behavior of some halc- phytes. Bull. Res. Council Israel (D) 6: 187-188. CARBON DIOXIDE EVOLUTION

  20. Buy Coal! A Case for Supply-Side Environmental Policy Author(s): Brd Harstad

    E-Print Network [OSTI]

    Stølen, Ketil

    Buy Coal! A Case for Supply-Side Environmental Policy Author(s): Bård Harstad Reviewed work by The University of Chicago. All rights reserved. 0022-3808/2012/12001-0003$10.00 Buy Coal! A Case for Supply, world prices change and nonpartici- pants typically emit more; they may also extract the dirtiest type

  1. Journal of Philosophy, Inc. Author(s): Alan Ross Anderson and Nuel D. Belnap, Jr.

    E-Print Network [OSTI]

    Belnap, Nuel

    Journal of Philosophy, Inc. Enthymemes Author(s): Alan Ross Anderson and Nuel D. Belnap, Jr. Source: The Journal of Philosophy, Vol. 58, No. 23, American Philosophical Association Eastern Division Fifty: Journal of Philosophy, Inc. Stable URL: http://www.jstor.org/stable/2023169 Accessed: 28/05/2009 15

  2. Natural and Experimental Boudinage and Pinch-and-Swell Structures Author(s): Hans Ramberg

    E-Print Network [OSTI]

    Lee, Cin-Ty Aeolus

    Natural and Experimental Boudinage and Pinch-and-Swell Structures Author(s): Hans Ramberg Source, and build upon a wide range of content in a trusted digital archive. We use information technology and tools BOUDINAGE AND PINCH-AND-SWELL STRUCTURES1 HANS RAMBERG University of Chicago ABSTRACT Examples of boudinage

  3. Multivariate Analysis of Drosophila Courtship Author(s): Therese A. Markow and Stephen J. Hanson

    E-Print Network [OSTI]

    Markow, Therese

    Multivariate Analysis of Drosophila Courtship Author(s): Therese A. Markow and Stephen J. Hanson.Natl.Acad.Sci.USA Vol. 78, No. 1, pp. 430-434, January1981 Genetics Multivariate analysis of Drosophila (sequential%). Potential ap- plications of this multivariate analysis to investigations of neuro- biological

  4. Natural Selection and Culture Author(s): Peter J. Richerson and Robert Boyd

    E-Print Network [OSTI]

    Richerson, Peter J.

    Natural Selection and Culture Author(s): Peter J. Richerson and Robert Boyd Source: BioScience, Vol indicates your acceptance of JSTOR's Terms and Conditions of Use, available at http://www.jstor.org/page/info the discovery and use of these resources. For more information about JSTOR, please contact support

  5. A. E. K.Ris Ris-M-Dl^ Title and author(s)

    E-Print Network [OSTI]

    A. E. K.Risø Risø-M-Dl^ Title and author(s) Application of Statistical Linear El -it:tic Fracture illustrations Date October 1 -}? $ Department or group R e a c t o r Group's own registration number(s) 25 crack, same time and ated as statisti- ty functions, tial cracks, f failure prob- program utilizing ce

  6. On Stress and Linguistic Rhythm Author(s): Mark Liberman and Alan Prince

    E-Print Network [OSTI]

    Pennsylvania, University of

    On Stress and Linguistic Rhythm Author(s): Mark Liberman and Alan Prince Source: Linguistic Inquiry-336. Mark Liberman, On Stress and Linguistic Alan Prince Rhythm* 0. Prospectus In this essay a new theory to JSTOR Terms and Conditions #12;250 MARK LIBERMAN AND ALAN PRINCE patternsof stress in termsof

  7. Author Index Abezgauz, Ludmila P1

    E-Print Network [OSTI]

    Martin, Jan M.L.

    Author Index Abezgauz, Ludmila P1 Abu-Reziq, Raed S1b3 Abutbul, Inbal P130 Adadi, Racheli P2 Addadi, Lia S2c5, P67, P123, P129, P159, P182 Adler, Michal P69 Afri, Michal P3, P26, P38 Agmon, Noam P131 Aharoni, Anna P4 Aharonov, Yakir P106 Akiva, Udi S4c1 Albeck, Amnon S1c5, P5 Albu-Yaron, Ana P210

  8. Evaluating the Web Hubs and Authorities

    E-Print Network [OSTI]

    Ullman, Jeffrey D.

    1 Evaluating the Web PageRank Hubs and Authorities #12;2 PageRank Intuition: solve the recursive = the principal eigenvector of the stochastic matrix of the Web. A few fixups needed. #12;3 Stochastic Matrix of the Web Enumerate pages. Page i corresponds to row and column i. M [i,j ] = 1/n if page j links to n pages

  9. Contact-Handled Transuranic Waste Authorized Methods for Payload...

    Office of Environmental Management (EM)

    Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH TRAMPAC) Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH TRAMPAC) This...

  10. Energy Department Authorizes Dominion Cove Point LNG to Export...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Department Authorizes Dominion Cove Point LNG to Export Liquefied Natural Gas Energy Department Authorizes Dominion Cove Point LNG to Export Liquefied Natural Gas May 7,...

  11. Energy Department Authorizes Freeport LNG to Export Liquefied...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department Authorizes Freeport LNG to Export Liquefied Natural Gas Energy Department Authorizes Freeport LNG to Export Liquefied Natural Gas November 14, 2014 - 2:00pm Addthis News...

  12. Energy Department Authorizes Second Proposed Facility to Export...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Department Authorizes Second Proposed Facility to Export Liquefied Natural Gas Energy Department Authorizes Second Proposed Facility to Export Liquefied Natural Gas May 17,...

  13. Energy Department Authorizes Emera CNG, LLC's Application to...

    Office of Environmental Management (EM)

    Authorizes Emera CNG, LLC's Application to Export Compressed Natural Gas Energy Department Authorizes Emera CNG, LLC's Application to Export Compressed Natural Gas October 19, 2015...

  14. Orders Granting Natural Gas, LNG & CNG Authorizations Issued...

    Office of Environmental Management (EM)

    Orders Granting Natural Gas, LNG & CNG Authorizations Issued in 2014 Orders Granting Natural Gas, LNG & CNG Authorizations Issued in 2014 Order 3378 - Encana Natural Gas Inc. Order...

  15. Project Reports for Peoria Tribe: Housing Authority- 2010 Project

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Housing Authority of the Peoria Tribe of Indians of Oklahoma (Peoria Housing Authority or PHA) will conduct the "PHA Weatherization Training Project."

  16. Presidential Permits and Export Authorizations - About the Program...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    transmission lines which cross the U.S. international border; and 2.Authorizing exports of electric energy to foreign countries. The authority to grant Presidential permits...

  17. POLICY GUIDANCE MEMORANDUM #09A Direct Hire Authority for Acquisition...

    Office of Environmental Management (EM)

    09A Direct Hire Authority for Acquisition Positions (Expired) POLICY GUIDANCE MEMORANDUM 09A Direct Hire Authority for Acquisition Positions (Expired) THIS GUIDANCE HAS EXPIRED...

  18. POLICY GUIDANCE MEMORANDUM #02 Using Schedule A Hiring Authority...

    Office of Environmental Management (EM)

    02 Using Schedule A Hiring Authority for ARRA Positions (Expired) POLICY GUIDANCE MEMORANDUM 02 Using Schedule A Hiring Authority for ARRA Positions (Expired) THIS GUIDANCE HAS...

  19. Santa Clara Valley Transportation Authority and San Mateo County...

    Energy Savers [EERE]

    Santa Clara Valley Transportation Authority and San Mateo County Transit District -- Fuel Cell Transit Buses: Evaluation Results Santa Clara Valley Transportation Authority and San...

  20. Cooperation Among Balancing Authorities Offers Greater Use of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Cooperation Among Balancing Authorities Offers Greater Use of Renewable Energy with Lower Integration Costs Cooperation Among Balancing Authorities Offers Greater Use of Renewable...

  1. Augmenting a pH Medical Study with Wearable Video for Treatment of GERD Thad Starner and Daniel Ashbrook

    E-Print Network [OSTI]

    Starner, Thad E.

    for eight months and included uncontrolled vomiting, sud- den and severe weight loss, hoarseness, coughing

  2. Long Island Power Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon: EnergyLloyd, NewBranch Capital Jump to:Authority Jump to:

  3. Lower Colorado River Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona:Oregon:Lowell Point, Alaska: Energy ResourcesAuthority Jump to:

  4. Municipal Electric Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton HotMultilagosAuthority

  5. Tennessee Valley Authority (Kentucky) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfinMarketMemberI PLLCsourceValley Authority (Kentucky)

  6. Bolivar Energy Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental JumpInformationBio-GasIllinois:Energy Authority Jump to: navigation, search

  7. Property:Author | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII JumpQuarterly SmartDB-2,Information PromotingProperty EditAuthor Jump to:

  8. Property:Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII JumpQuarterly SmartDB-2,Information PromotingProperty EditAuthor Jump

  9. Property:File/Author | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation,Property Edit withExplorationTimePerMetricProperty EditAuthor

  10. Technology Partnership Ombudsman - Roles, Responsibilities, Authorities and

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OF APPLICABLEStatutory Authority J-I- 1May 20062012

  11. NercEnergy, Author at Nercenergy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJessework usesofPublications TheScience4.21 4.43EnergyAuthor: NercEnergy

  12. MULTIPLE AUTHORIZATION A Model and Architecture for Increased, Practical Security

    E-Print Network [OSTI]

    ]. Contraction-Minimal triangulations are called minimal or irreducible triangu- lations by various authors. 1

  13. Logical Attestation: An Authorization Architecture for Trustworthy Computing

    E-Print Network [OSTI]

    Sirer, Emin Gun

    system. Key words: simulation, interactive storytelling, story authoring 1 Introduction Storytelling

  14. Motor Fleet Request/Authorization Page 1 UNCW Travel System

    E-Print Network [OSTI]

    Olszewski Jr., Edward A.

    Motor Fleet Request/Authorization Page 1 UNCW Travel System Motor Fleet Request/Travel Authorization ENTER THE MOTOR FLEET REQUEST IN THE TRANSPORTATION SECTION OF THE TRAVEL AUTHORIZATION. PRESS CLICK TO ADD AND SELECT MOTOR FLEET FROM THE DROP-DOWN BOX. #12;Motor Fleet Request/Authorization Page 2

  15. 168 Hinweise fr die Autoren Instructions to Authors

    E-Print Network [OSTI]

    Wien, Universität

    in SMALL CAPITALS: SINGER (1964), KÜHNER & ROMAGNESI (1975), when more than two authors: SMITH & al. (1982

  16. Authorized limits for Fernald copper ingots

    SciTech Connect (OSTI)

    Frink, N.; Kamboj, S.; Hensley, J.; Chen, S. Y.

    1997-09-01

    This development document contains data and analysis to support the approval of authorized limits for the unrestricted release of 59 t of copper ingots containing residual radioactive material from the U.S. Department of Energy (DOE) Fernald Environmental Management Project (FEMP). The analysis presented in this document comply with the requirements of DOE Order 5400.5, {open_quotes}Radiation Protection of the Public and the Environment,{close_quotes} as well as the requirements of the proposed promulgation of this order as 10 CFR Part 834. The document was developed following the step-by-step process described in the Draft Handbook for Controlling Release for Reuse or Recycle Property Containing Residual Radioactive Material.

  17. TITLE: AUTHOR(S) SUBMITTED TO: Mm EVOLUTIO:l C: S!LICIC

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnicalInformation FederatedInformationTITLE: AUTHOR(S) SUBMITTED TO: Mm EVOLUTIO:l

  18. Telemetry as a Technique in the Study of Predation Author(s): L. David Mech

    E-Print Network [OSTI]

    Thomas, David D.

    in this regard by Marshall and Kupa (1963). These authors were able to locate four predator- killed grouse (Bonasa umbellus) and deter- mine the type of predation in three cases. Recently McEwen and Brown (1966 in a collar of dental acrylic (Mech et al. 1965). They were re- leased where captured. Movements

  19. Authorization basis status report (miscellaneous TWRS facilities, tanks and components)

    SciTech Connect (OSTI)

    Stickney, R.G.

    1998-04-29

    This report presents the results of a systematic evaluation conducted to identify miscellaneous TWRS facilities, tanks and components with potential needed authorization basis upgrades. It provides the Authorization Basis upgrade plan for those miscellaneous TWRS facilities, tanks and components identified.

  20. National Defense Authorization Act for Fiscal Year 1993 (PL 102...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    National Defense Authorization Act for Fiscal Year 1993 (PL 102-484) National Defense Authorization Act for Fiscal Year 1993 (PL 102-484) Section 3162 of the National Defense...

  1. Authoring Large and Complex Hypertext with Reusable Components 

    E-Print Network [OSTI]

    Park, Yung Ah

    2011-10-21

    from Petri net theory to select, categorize, and modify existing net fragments as building blocks for composing larger networks. Authors may switch modes between visual and textual authoring at will, thus combining the strengths of expressing large nets...

  2. Children’s story authoring with Propp’s morphology 

    E-Print Network [OSTI]

    Hammond, Sean Paul

    2011-06-30

    This thesis applies concepts from Vladimir Propp’s model of the narrative structure of fairy tales (Propp’s morphology) to a story authoring tool for children. A computer story authoring application based on Propp’s ...

  3. Fort Pierce Utilities Authority- Solar Water Heating Rebate

    Office of Energy Efficiency and Renewable Energy (EERE)

    Note: Fort Pierce Utilities Authority has completed its rebate program for 2015. Check the website for updates.

  4. Author's personal copy Physica D 239 (2010) 15271541

    E-Print Network [OSTI]

    Froyland, Gary

    2010-01-01

    particles is completely determined Corresponding author. Tel.: +61 2 9385 7050; fax: +61 2 9385 7123. E

  5. Legal Authority 1 Export Administration Regulations EARB 298 -October 2001

    E-Print Network [OSTI]

    Bernstein, Daniel

    Legal Authority 1 Export Administration Regulations EARB 298 - October 2001 Part I PRINCIPAL STATUTORY AUTHORITY FOR THE EXPORT ADMINISTRATION REGULATIONS #12;Legal Authority 2 1 The Act expired Presidential notices, continued in effect the provisions of the Export Administration Regulations. The Act

  6. Carolyn Henderson Allen Dir Academic & Research

    E-Print Network [OSTI]

    Capogna, Luca

    Cataloging Mary Gilbertson Head Serials Marilyn Rogers Head Binding Ellen Williams Library Information-Night Dennis Stephenson Brian Kelley Charles Sabo Rachel Fox vacant Cole Davis Olivia Wood Gale Golden Hurd Digital Projects tbd Learning Commons-Wknd Terry Wynn Circulation-Billing Alice Brown Lynne

  7. QER- Comment of Allen Young 2

    Broader source: Energy.gov [DOE]

    Here is a comment from me on the issue of energy infrastructure in Massachusetts. I will address only one issue: the proposed Kinder Morgan pipelines from Albany to Dracut. I am absolutely opposed to the construction of this pipeline and here are my reasons

  8. multimaterial topology optimization by volume constrained allen ...

    E-Print Network [OSTI]

    2014-04-04

    In [22], the optimization of the position of fuel assemblies in a nuclear reactor core ...... interface criterion for phase transitions in mixtures of cahn-hilliard fluids.

  9. Allen W. Groves Associate Vice President

    E-Print Network [OSTI]

    Reidenbach, Matthew A.

    Isbell Program Coordinator Vacant Directorof Student Activities Kendra Paisley Assistant Director Alyssa

  10. Shammie Anika Abul Samantha Lynn Allen

    E-Print Network [OSTI]

    Lozano-Robledo, Alvaro

    Christine Ogonowski Kelly Ann O'Keefe Kara Lynn O'Leary Sean P O'Leary Jessica Marie Olson Lindsay Michelle

  11. A biography of Forrest C. "Phog" Allen

    E-Print Network [OSTI]

    Elston, Donald W.

    1967-01-01

    stream_size 127568 stream_content_type text/plain stream_name elston_1967_3513000.pdf.txt stream_source_info elston_1967_3513000.pdf.txt Content-Encoding UTF-8 Content-Type text/plain; charset=UTF-8 A BIOGRAPHY..., Bess Wallace, were close friends. (1) Forrest's interests as a child centered mni.nly around sports and athletics. He and his brothers played .football, baseball and later basketball. Although his father hud a great deal of ath1etio ability, he did...

  12. Neurogenomics and the Allen Brain Atlas

    E-Print Network [OSTI]

    Boguski, Mark S.

    " coined by T. Roderick ­ Gene + Chromosome + "ics" = Genomics · 1990 Human Genome Project launched · 1998 Human Genome Project accelerated · 2000 "Draft" sequence available in June · 2001 Historic of the genome project Lessons Promises S. Tilghman, Genome Res. 6:773, 1996 #12;Lessons learned, promises kept

  13. Disturbing the Balance – Woody Allen Reads Dostoyevsky

    E-Print Network [OSTI]

    Bobrowski, Micha?

    2011-02-01

    with the story of Judah Rosenthal. Zosima tells the story of Mikhail, who killed his mistress and went unpunished (Dostoyevsky 1990: 301–313). The blame was placed on the innocent servant of the victim. Mikhail continued to be a respected member of his... community. Up until this moment the story is almost identical to Judah Rosenthal’s. The differences lie in the reactions of the perpetrators to their deeds. Mikhail car- ried a burden of guilt, which caused moral and psychological pain beyond his endurance...

  14. Updated August 2012 Allen County Community College

    E-Print Network [OSTI]

    Sciences GE3N BIOL 100 Princ of Biology 3 BIO 102 Princ of Biology 5 BIOL 150 Princ of Cell and Mole Biology 5 BIO 150 Biology 5 BIOL 152 Princ of Organismal Biology 5 BIO 210 Biology 2 5 CHEM 110 College

  15. Lee Allen Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona: EnergyLebanon County, Pennsylvania: EnergyLectrique Solaire

  16. Dan Allen | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE ProjectREMOTE-HANDLEDDirectives,DRB000DamianDan

  17. Allen, Texas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin: Energy ResourcesAirAlamoCalifornia:WaveMaryland)

  18. Set # Name Size (Towne) Forward Reverse Probe Author Date Citation 1 TRL11, IRL11 ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 44264432

    E-Print Network [OSTI]

    ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 4426­4432 UL54 / Polymerase 2 UL75 T A P R I M B 218 ACCCGTTACGTGACGGTCAA TTGTCGGCGTTTTCTCCAAA Allen 1995 JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1995, p. 725­728 3 UL75 T A P O I M B 268 TACAACAAACCGATTGCCGC

  19. RCRA (Resource Conservation and Recovery Act) final authorization guidance manual

    SciTech Connect (OSTI)

    Not Available

    1983-06-10

    The document provides guidance regarding final authorization of State Hazardous Waste programs for the pre-HSWA RCRA program. The manual establishes a process and schedule for State Authorization applications, and provides detailed guidance on what State programs must contain in order to qualify for final authorization. The primary audience is U.S. EPA Headquarters and Regional offices and also State agencies, but public requests have also been received so they are included in that broad audience.

  20. 16 USC 797a - Congressional Authorization for Projects Within...

    Open Energy Info (EERE)

    16 USC 797a - Congressional Authorization for Projects Within National Parks or Monuments Jump to: navigation, search OpenEI Reference LibraryAdd to library Legal Document-...

  1. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    Valley Authority, Knoxville, TN (United States)","20 FOSSIL-FUELED POWER PLANTS; 32 ENERGY CONSERVATION, CONSUMPTION, AND UTILIZATION; 42 ENGINEERING NOT INCLUDED IN OTHER...

  2. Control and Accountability of Nuclear Materials: Responsibilities and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1992-09-23

    The order prescribes the Department of Energy (DOE) policies, responsibilities, and authorities for control and accountability of nuclear materials. Cancels DOE O 5633.2.

  3. Oklahoma Municipal Power Authority- WISE Energy Efficiency Loan Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers loans for a variety of measures and equipment through its WISE Loan Program. This program encourages residential and commercial customers to...

  4. National Defense Authorization Act for Fiscal Year 2000 § 3164...

    Broader source: Energy.gov (indexed) [DOE]

    Scope: Section 3164 of the National Defense Authorization Act for Fiscal Year 2000 implements a whistleblower protection program to ensure that covered individuals may...

  5. Chapter VII Appendix D FEDERAL EMERGENCY AUTHORITIES AND POLICY...

    Office of Environmental Management (EM)

    Gasoline Supply Reserve, and provides for the presidentially directed drawdown of the reserves through the Secretary of Energy. It also authorizes the Secretary of Energy to...

  6. Applications for Change or Transfer of Control of Authorizations...

    Broader source: Energy.gov (indexed) [DOE]

    Applicants for authorization to import or export natural gas, including liquefied natural gas (LNG), apply on behalf of a given entity, whose corporate structure and place of...

  7. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE excepted service authorities. Admin Chg 1 dated 6-20-12.

  8. Title 10 CFR 900 Coordination of Federal Authorizations for Electric...

    Open Energy Info (EERE)

    Title 10 CFR 900 Coordination of Federal Authorizations for Electric Transmission Facilities Jump to: navigation, search OpenEI Reference LibraryAdd to library Legal Document-...

  9. Kissimmee Utility Authority- Commercial Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Kissimmee Utility Authority (KUA) offers several rebates to commercial customers for energy efficiency improvements. Rebates are available for HVAC maintenance, heat pumps, duct leak repairs,...

  10. Acronyms A AAAP Accelerated Access Authorization Program ACREM...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    12 I IAA Interim Access Authorization ICAM Identity, Credential, and Access Management IEA Office of Independent Enterprise Assessments IG Inspector General IN Office of...

  11. Author's personal copy Large deformation and electrochemistry of polyelectrolyte gels

    E-Print Network [OSTI]

    Hong, Wei

    Author's personal copy Large deformation and electrochemistry of polyelectrolyte gels Wei Hong and electrochemistry. A specific material model is described, including the effects of stretching the network, mixing

  12. National Defense Authorization Act for Fiscal Year 2005, Information...

    Broader source: Energy.gov (indexed) [DOE]

    Section 3116 from "National Defense Authorization Act for Fiscal Year 2005" (Public Law 108-375 Oct. 28 2004) Transition20082009EMAdditionalMaterialMACopy.pdf PUBLIC LAW...

  13. Oklahoma Municipal Power Authority- Commercial and Industrial Energy Efficiency Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers the Demand and Energy Efficiency Program (DEEP) to eligible commercial, industrial, and municipal government customers served by OMPA. This...

  14. Energy Department Authorizes Additional Volume at Proposed Freeport...

    Energy Savers [EERE]

    Additional Volume at Proposed Freeport LNG Facility to Export Liquefied Natural Gas Energy Department Authorizes Additional Volume at Proposed Freeport LNG Facility to Export...

  15. Energy Department Authorizes Second Proposed Facility to Export...

    Broader source: Energy.gov (indexed) [DOE]

    - The Energy Department announced today that it has conditionally authorized Freeport LNG Expansion, L.P. and FLNG Liquefaction, LLC (Freeport) to export domestically produced...

  16. Energy Department Authorizes American LNG Marketing LLC's Application...

    Energy Savers [EERE]

    American LNG Marketing LLC's Application to Export Liquefied Natural Gas Energy Department Authorizes American LNG Marketing LLC's Application to Export Liquefied Natural Gas...

  17. Energy Department Authorizes Alaska LNG Project, LLC to Export...

    Broader source: Energy.gov (indexed) [DOE]

    Department announced today that it has issued a conditional authorization for the Alaska LNG Project, LLC (Alaska LNG) to export domestically produced liquefied natural gas (LNG)...

  18. Energy Department Authorizes Dominion's Proposed Cove Point Facility...

    Office of Environmental Management (EM)

    Department announced today that it has conditionally authorized Dominion Cove Point LNG, LP to export domestically produced liquefied natural gas (LNG) to countries that do...

  19. Energy Department Conditionally Authorizes Cameron LNG to Export...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Cameron LNG to Export Liquefied Natural Gas Energy Department Conditionally Authorizes Cameron LNG to Export Liquefied Natural Gas February 11, 2014 - 11:15am Addthis WASHINGTON -...

  20. Energy Department Conditionally Authorizes Oregon LNG to Export...

    Broader source: Energy.gov (indexed) [DOE]

    WASHINGTON - The Energy Department announced today that it has conditionally authorized LNG Development Co., LLC (Oregon LNG) to export domestically produced liquefied natural gas...

  1. DOE Replies Support NRC Commissioners and Authority to Withdraw...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    that the arguments that it lacked authority to withdraw the pending Yucca Mountain license application are uniformly without merit. DOE's reply brief is available here. In a...

  2. Notice of Termination for Authorization under TPDES General Permit...

    Open Energy Info (EERE)

    Termination for Authorization under TPDES General Permit (TXR150000) Jump to: navigation, search OpenEI Reference LibraryAdd to library Reference: Notice of Termination for...

  3. National Training and Education Resource Authoring Course Participant...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    adding questions to the pool as needed. Begin a glossary and continue adding terms to the glossary as needed. NTER Authoring Participant Guide (012012 pw) 10 LOGIN To...

  4. Listing of DOE/FE Authorizations Issued in 2015 | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Stabilis Energy Services LLC Modification to include Agency Rights Errata 3563 14-175-NG 010815 MPower Energy LLC Modification to increase requested authority Errata 3521...

  5. NMOCD - Form G-104 - Certificate of Compliance and Authorization...

    Open Energy Info (EERE)

    Resources Author State of New Mexico Energy and Minerals Department Published New Mexico Oil Conservation Division, 1978 DOI Not Provided Check for DOI availability: http:...

  6. Santa Clara Valley Transportation Authority and San Mateo County...

    Energy Savers [EERE]

    Santa Clara Valley Transportation Authority and San Mateo County Transit District Fuel Cell Transit Buses: Preliminary Evaluation Results vtaprelimevalresults.pdf More...

  7. Presidential Permits and Export Authorizations - About the Program...

    Office of Environmental Management (EM)

    electric energy to foreign countries. The authority to grant Presidential permits is derived from the constitutional power of the President to protect the territorial integrity...

  8. Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING

    E-Print Network [OSTI]

    Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING Notice is hereby given that a special meeting of the Board of Directors of the Power and Water Resources Pooling Authority (PWRPA or service at least 3 days before the meeting. Requests should be sent to: Power and Water Resources Pooling

  9. Export Administration Regulations EARB 298 -October 2001 LEGAL AUTHORITY

    E-Print Network [OSTI]

    Bernstein, Daniel

    omitted text. PART I Principal Statutory Authority 1. Export Administration Act of 1979, as amended (Pub) . . . . . . . . . . . . 69 PART II Executive Orders and Other Presidential Documents Relevant to Part I Statutory Authorities 1. E.O. 12002 - Administration of the Export Administration Act of 1969, as amended (42 FR 35623; 3

  10. Web authoring principles Deborah Cross, ANU Web Coordinator

    E-Print Network [OSTI]

    Web authoring principles Deborah Cross, ANU Web Coordinator ANU Marketing Office #12;Remembering today's session · All tips available in the web style guide at styles.anu.edu.au/guide/author.php · Contact your local web manager · Contact the ANU web team via webstyle@anu.edu.au 2 #12;3 Possible

  11. A Pedagogical Interface for Authoring Adaptive e-Learning Courses

    E-Print Network [OSTI]

    Lau, W. H. Nynson

    different approaches towards learning. In light of this, adaptive educational hypermedia systems (AEHSsA Pedagogical Interface for Authoring Adaptive e-Learning Courses Christopher Watson1 Frederick W to support adaptive e-learning course authoring for different types of students. They require teachers

  12. A Subject-Delegated Decryption Scheme with "Tightly" Limited Authority

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Subject-Delegated Decryption Scheme with "Tightly" Limited Authority Lihua Wang1 , Takeshi@cs.tsukuba.ac.jp Abstract. In this paper, we present a new proxy cryptosystem named subject-delegated decryption scheme subjects. The advantage of our scheme is that the proxy authorities are tightly limited ("Tightly" Limited

  13. A Web-based Animation Authoring Application for Quadrupedal Characters 

    E-Print Network [OSTI]

    Murphy, Krista Lea

    2014-12-03

    AUTHORING APPLICATION FOR QUADRUPEDAL CHARACTERS A Thesis by KRISTA LEA MURPHY Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Chair... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 1.2 Contributions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 2. BACKGROUND . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 2.1 Methods for Authoring Animation . . . . . . . . . . . . . . . . . . . . 3 2...

  14. 2008 The Authors Journal Compilation 2008 Blackwell Publishing Ltd

    E-Print Network [OSTI]

    Troch, Peter

    © 2008 The Authors Journal Compilation © 2008 Blackwell Publishing Ltd Geography Compass 2 (2008 and Water Resources, University of Arizona Abstract Predictions of hydrologic system response to natural some threshold #12;2 Landscape heterogeneity and hydrological theory © 2008 The Authors Geography

  15. Inhibition of Photosynthesis in Some Algae by Extreme-Red Light Author(s): Eugene Rabinowitch, Govindjee, Jan B. Thomas

    E-Print Network [OSTI]

    Govindjee

    Inhibition of Photosynthesis in Some Algae by Extreme-Red Light Author(s): Eugene Rabinowitch://www.jstor.org #12;Inhibition of Photosynthesis in Some Algae by Extreme"Red Light Abstract. Photosynthesis produced by far-red light (about 700 m,b) is reversibly inhibited in some algae by extreme-red light ( 750 m

  16. NGWA.org Ground Water Monitoring & Remediation 31, no. 3/ Summer 2011/pages 111118 111 2011, The Author(s)

    E-Print Network [OSTI]

    Alvarez, Pedro J.

    are commonly used to mitigate the risk of hydrocarbon-contaminated aquifers. Recent research on the effectsNGWA.org Ground Water Monitoring & Remediation 31, no. 3/ Summer 2011/pages 111­118 111 © 2011, The Author(s) Ground Water Monitoring & Remediation © 2011, National Ground Water Association. doi: 10.1111/j

  17. NGWA.org Ground Water Monitoring & Remediation 00, no. 0/ xxxx 0000/pages 0000 1 2012, The Author(s)

    E-Print Network [OSTI]

    Clement, Prabhakar

    NGWA.org Ground Water Monitoring & Remediation 00, no. 0/ xxxx 0000/pages 00­00 1 © 2012, The Author(s) Ground Water Monitoring & Remediation © 2012, National Ground Water Association. doi: 10.1111/j1745­6592.2012.01392.x Modeling Dehalococcoides sp. Augmented Bioremediation in a Single Fracture

  18. Species Diversity of Seed-Eating Desert Rodents in Sand Dune Habitats Author(s): James H. Brown

    E-Print Network [OSTI]

    Brown, James H.

    Species Diversity of Seed-Eating Desert Rodents in Sand Dune Habitats Author(s): James H. Brown DIVERSITY OF SEED-EATING DESERT RODENTS IN SAND DUNE HABITATS' JAMES H. BROWN Department of Biology, University of Utah, Salt Lake City 84112 Abstract.The seed-eatingrodent faunas were sampled on 18 dunes

  19. Caloric Values of Organic Matter in Woodland, Swamp, and Lake Soils Author(s): Eville Gorham and Jon Sanger

    E-Print Network [OSTI]

    Thomas, David D.

    Caloric Values of Organic Matter in Woodland, Swamp, and Lake Soils Author(s): Eville Gorham VALUES OF ORGANIC MATTER IN WOODLAND, SWAMP, AND LAKE SOILS' EVILLE GORHAM AND JON SANGER Department, and lake soils and in certain plants. Mean values in kilocalories per gram are: 11 woodland soils, 5.04; 20

  20. Optimal Strategic Petroleum Reserve Policies: A Steady State Analysis Author(s): Shmuel S. Oren and Shao Hong Wan

    E-Print Network [OSTI]

    Oren, Shmuel S.

    Optimal Strategic Petroleum Reserve Policies: A Steady State Analysis Author(s): Shmuel S. Oren.S.A. OPTIMAL STRATEGIC PETROLEUM RESERVE POLICIES: A STEADY STATE ANALYSIS* SHMUEL S. OREN AND SHAO HONG WAN Petroleum Reserve (SPR) under a variety of supply and demand conditions. The optimal policy variables

  1. The Diversity of Pigments in Lake Sediments and Its Ecological Significance Author(s): Jon E. Sanger and Eville Gorham

    E-Print Network [OSTI]

    Thomas, David D.

    The Diversity of Pigments in Lake Sediments and Its Ecological Significance Author(s): Jon E SEDIMENTS AND ITS ECOLOGICAL SIGNIFICANCE' JonE. Sanger2and Eville Gorham Departmentof Botany givingmuch attentionto thestudyof sediments,fortheirfossilscan provideclues to lake conditionspast

  2. Revisiting Alexander von Humboldt's Initiation of Rock Coating Research Author(s): Ronald I. Dorn, David H. Krinsley, Jeffrey Ditto

    E-Print Network [OSTI]

    Dorn, Ron

    Revisiting Alexander von Humboldt's Initiation of Rock Coating Research Author(s): Ronald I. Dorn Revisiting Alexander von Humboldt's Initiation of Rock Coating Research Ronald I. Dorn,1, * David H. Krinsley the 2-century-old hypothesis of an ac- cretionary nature of the Orinoco coating. The remarkable Orinoco

  3. Allen Hall....................................ALLEN D2 Alumni Hall..................................ALUM E2

    E-Print Network [OSTI]

    Kalisz, Susan

    F1 · Old Engineering Hall ....................OEH D2 Oxford Bldg.(3501 Forbes Ave.) OXFRD C4.............................BELLH G2 Bellefield Presbyterian Church...PRES D3 Bellefield Towers.........................BELLT F1 ....................CHILD C3 Clapp Hall..................................CLAPP F1 Community of Reconciliation Bldg. ..CR F1

  4. Control and Accountability of Nuclear Materials Responsibilities and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1988-01-29

    The order prescribe the Department of Energy (DOE) policies, responsibilities, and authorities for control and accountability of nuclear materials. Cancels DOE O 5630.1. Canceled by DOE O 5633.2A.

  5. Oklahoma Municipal Power Authority- WISE Energy Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers rebates on a variety of HVAC equipment through its WISE Rebate program. This program encourages residential customers and builders to upgrade to...

  6. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    energy spectra of gamma ray emission from the decay of KK gravitons trapped by the gravity of the remnant neutron stars (NS). These and other authors have used EGRET data on NS...

  7. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    energy spectra of gamma ray emission from the decay of KK gravitons trapped by the gravity of the remnant neutron stars NS These and other authors have used EGRET data on NS to...

  8. * corresponding author A Statistical Analysis of Student Design Projects

    E-Print Network [OSTI]

    Sobek II, Durward K.

    * corresponding author A Statistical Analysis of Student Design Projects: Helping Good Design activity. A regression analysis indicates that approximately 60% of the variance in design outcome can positively with design quality. The data codification and analysis procedures are presented

  9. Author's personal copy Biosensors and Bioelectronics 25 (2010) 11551159

    E-Print Network [OSTI]

    2010-01-01

    Author's personal copy Biosensors and Bioelectronics 25 (2010) 1155­1159 Contents lists available at ScienceDirect Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios Variation

  10. Author's personal copy Biosensors and Bioelectronics 25 (2010) 22702275

    E-Print Network [OSTI]

    Brolo, Alexandre G.

    2010-01-01

    Author's personal copy Biosensors and Bioelectronics 25 (2010) 2270­2275 Contents lists available at ScienceDirect Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios Multilayer

  11. 15.269 Literature, Ethics and Authority, Fall 2005

    E-Print Network [OSTI]

    Hafrey, Leigh

    This course explores how we use story to articulate ethical norms. The syllabus consists of short fiction, novels, plays, feature films and some non-fiction. Major topics include leadership and authority, professionalism, ...

  12. Author's personal copy Mechanical and electrical properties of aligned

    E-Print Network [OSTI]

    Zhu, Yuntian T.

    Author's personal copy Mechanical and electrical properties of aligned carbon nanotube/C) composites rivaling or exceeding the mechanical and electrical properties of current carbon fiber fabricated CNT/ polyacrylonitrile (PAN) precursor composites with high degree of CNT alignment, and car

  13. Delegation of Acquisition Executive Authority for Capital Asset...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Status: Current Effective Date: Aug 17, 2012 Re-delegation Allowed: No Authorities: DOE O 413.3B Related History Related to: DOE O 413.3B, Program and Project Management for...

  14. Delegation of Acquisition Executive Authority for Capital Asset...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Status: Current Effective Date: Feb 25, 2011 Re-delegation Allowed: No Authorities: DOE O 413.3B Related History Related to: DOE O 413.3B, Program and Project Management for...

  15. Delegation of Acquisition Executive Authority for Capital Asset...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Status: Current Effective Date: Jul 15, 2011 Re-delegation Allowed: No Authorities: DOE O 413.3B Related History Related to: DOE O 413.3B, Program and Project Management for...

  16. Delegation of Authority for Safeguards and Security (EM) - DOE...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Current Effective Date: Apr 09, 2010 Re-delegation Allowed: No Authorities: DOE O 151.1C, DOE O 470.2B Related History Related to: DOE O 470.2B, Independent Oversight and...

  17. Delegation of Authority for Issuance of Contractor Security Credential...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Status: Current Effective Date: Mar 21, 2013 Re-delegation Allowed: No Authorities: DOE O 473.3 Related History Related to: DOE O 473.3, Protection Program Operations There...

  18. Contributors' Authorization to Publish SPRINGER SCIENCE+BUSINESS MEDIA, LLC

    E-Print Network [OSTI]

    Liu, Huan

    will be responsible for any costs that may be associated with obtaining such permission. #12;Contributor Authorization 1 December 2008 12325450 p 2 3. Warranties extended The Contributor represents and warrants

  19. Author's Accepted Manuscript ORBIT-CENTERED ATMOSPHERIC DENSITY

    E-Print Network [OSTI]

    Wohlberg, Brendt

    solar and geomagnetic activities and different prediction windows. Compar- ison with previouslyAuthor's Accepted Manuscript ORBIT-CENTERED ATMOSPHERIC DENSITY PREDICTION USING ARTIFICIAL NEURAL Shoemaker, Riccardo Bevilacqua, ORBIT-CENTERED ATMOSPHERIC DENSITY PREDICTION USING ARTIFICIAL NEURAL

  20. ETSU College of Medicine Onity Door Access Authorization Form

    E-Print Network [OSTI]

    Karsai, Istvan

    ETSU College of Medicine Onity Door Access Authorization Form Please grant access to: 6 access. ____ ALL AREAS (ETSU Service Personnel Only) Medical School Research & Training, VA Bldg. #119-Mail: johnsodl@etsu.edu #12;

  1. 'Recommended by Duncan Hines': Automobility, Authority, and American Gastronomy

    E-Print Network [OSTI]

    Talbott, Damon Lee

    2008-06-09

    How did Duncan Hines become an authority on roadside dining? What role did he have in the consumption of food and the use of automobiles? What were the messages he pronounced to his audiences? In "'Recommended by Duncan ...

  2. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-12-07

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE expected service authorities. Supersedes DOE O 329.1. Superseded by DOE O 329.1A Chg 2 (Admin Chg).

  3. Fort Pierce Utilities Authority- Residential Energy Efficiency Rebate Program

    Office of Energy Efficiency and Renewable Energy (EERE)

    Fort Pierce Utilities Authority offers a variety of incentives for their residential customers to save energy in their homes. Rebates are available for room A/C units, insulation upgrades, central...

  4. Energy Department Authorizes Cameron LNG and Carib Energy to...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Cameron LNG and Carib Energy to Export Liquefied Natural Gas Energy Department Authorizes Cameron LNG and Carib Energy to Export Liquefied Natural Gas September 10, 2014 - 2:00pm...

  5. Energy Department Authorizes Third Proposed Facility to Export...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Gas August 7, 2013 - 12:00pm Addthis NEWS MEDIA CONTACT (202) 586-4940 WASHINGTON - The Energy Department announced today that it has conditionally authorized Lake Charles...

  6. Energy Department Authorizes Second Proposed Facility to Export...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Gas May 17, 2013 - 12:00pm Addthis News Media Contact (202) 586-4940 WASHINGTON - The Energy Department announced today that it has conditionally authorized Freeport LNG...

  7. POLICY GUIDANCE MEMORANDUM #34B Direct Hire Authority for Contract...

    Broader source: Energy.gov (indexed) [DOE]

    Guidance Memorandum 34B serves as an amendment to Policy Guidance Memorandum 34A regarding the use of the Direct Hire Authority for Contract Specialist positions. As stated in...

  8. ENROLLMENT FORM AND AUTHORIZATION OF PAYROLL DEDUCTION OF MEMBERSHIP DUES

    E-Print Network [OSTI]

    Firestone, Jeremy

    and the Association. This authorization shall cease upon termination of employment with the University or upon employee, and that no partial deductions will be made. Employee Signature Date (Print) Last Name, First

  9. National Defense Authorization Act for Fiscal Year 2005, Information...

    Office of Environmental Management (EM)

    EMAdditionalMaterialMACopy.pdf PUBLIC LAW 108-375-OCT. 28, 2004 118 STAT. 1811 Public Law 108-375, 108th Congress National Defense Authorization Act for Fiscal Year 2005,...

  10. Author's personal copy Journal of Hazardous Materials 190 (2011) 909915

    E-Print Network [OSTI]

    Ma, Lena

    2011-01-01

    bioenergy technologies make it possible to convert waste biomass into value-added biochar and Corresponding author. E-mail address: lqma@ufl.edu (L.Q. Ma). at the same time produce bioenergy. Sugar beet tailing

  11. Recreation land policies of Texas river authorities operating reservoirs 

    E-Print Network [OSTI]

    Ruesink, Lou Ellen

    1979-01-01

    RECREATION LAND POLICIES OF TEXAS RIVER AUTHORITIES OPERATING RESERVOIRS A Thesis by LOU ELLEN RUESINK Submitted to the Graduate College of Texas A1IM University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE... December 1979 Major Subject: Recreation and Resources Developmenr. RECREATION LAND POLICIES OF TEXAS RIVER AUTHORITIES OPERATING RESERVOIRS A Thesis by LOU ELLEN RUESINK Approved as to sty1e and content by: (Chairman of o ittee) (Member...

  12. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1994-10-05

    To establish requirements and responsibilities for the employment and compensation of individuals when using the following DOE excepted service authority: a. Section 621(d) of the DOE Organization Act (42 United States Code (U.S.C.), section 7231(d), hereafter referred to as pay plan EJ. b. Section 3161(a) of the National Defense Authorization Act for Fiscal Year 1995 (Public Law 103-337, October 5, 1994) and renewals, hereafter referred to as pay plan EK.

  13. Dy Charles Fitzhugn Tulnim Authority on I& teorology

    E-Print Network [OSTI]

    Dy Charles Fitzhugn Tulnim Authority on I& teorology Although the origin of ball 1i * "alther Brand, i n Germany, cofltains a c r i t i c a l analysis of Z l E cu6e6 Of b e l l lightning, 'selected from a auch l a r g e r numbar of r f p o r t s t o which t h e author Bull lightning occurs

  14. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    microelectromechanical systems. (3) miniaturization (3) performance (3) shock waves (3) aging (2) damage (2) diagnostic techniques (2) Filter by Author Walraven, Jeremy Allen (22)...

  15. Author: Duncan Woodhouse, Assistant Registrar for Information Security, Risk Management and Business Continuity Date Version Author Comments

    E-Print Network [OSTI]

    Davies, Christopher

    Author: Duncan Woodhouse, Assistant Registrar for Information Security, Risk Management Information Security Policy 2004 09/2008 D01 Duncan Woodhouse Adaption and consolidation of best practices Registrar for Information Security, Risk Management and Business Continuity 2 University of Warwick

  16. Strengthening the Nigerian Sovereign Investment Authority: A Policy Analysis of the Nigerian Excess Crude Account and the Nigerian Sovereign Investment Authority Act

    E-Print Network [OSTI]

    Ugwuibe, Cynthia

    2012-01-01

    Savings Authority Oil Investment Corporation of ReserveBrunei Iran Oil Oil Libyan Investment Authority Reserve Fundcurrent and future investments of oil windfalls. Since

  17. Integrating repositories with fuel cycles: The airport authority model

    SciTech Connect (OSTI)

    Forsberg, C. [Massachusetts Inst. of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139-4307 (United States)

    2012-07-01

    The organization of the fuel cycle is a legacy of World War II and the cold war. Fuel cycle facilities were developed and deployed without consideration of the waste management implications. This led to the fuel cycle model of a geological repository site with a single owner, a single function (disposal), and no other facilities on site. Recent studies indicate large economic, safety, repository performance, nonproliferation, and institutional incentives to collocate and integrate all back-end facilities. Site functions could include geological disposal of spent nuclear fuel (SNF) with the option for future retrievability, disposal of other wastes, reprocessing with fuel fabrication, radioisotope production, other facilities that generate significant radioactive wastes, SNF inspection (navy and commercial), and related services such as SNF safeguards equipment testing and training. This implies a site with multiple facilities with different owners sharing some facilities and using common facilities - the repository and SNF receiving. This requires a different repository site institutional structure. We propose development of repository site authorities modeled after airport authorities. Airport authorities manage airports with government-owned runways, collocated or shared public and private airline terminals, commercial and federal military facilities, aircraft maintenance bases, and related operations - all enabled and benefiting the high-value runway asset and access to it via taxi ways. With a repository site authority the high value asset is the repository. The SNF and HLW receiving and storage facilities (equivalent to the airport terminal) serve the repository, any future reprocessing plants, and others with needs for access to SNF and other wastes. Non-public special-built roadways and on-site rail lines (equivalent to taxi ways) connect facilities. Airport authorities are typically chartered by state governments and managed by commissions with members appointed by the state governor, county governments, and city governments. This structure (1) enables state and local governments to work together to maximize job and tax benefits to local communities and the state, (2) provides a mechanism to address local concerns such as airport noise, and (3) creates an institutional structure with large incentives to maximize the value of the common asset, the runway. A repository site authority would have a similar structure and be the local interface to any national waste management authority. (authors)

  18. Statutory Authority for an SPR Drawdown | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OF APPLICABLEStatutory Authority for an SPR Drawdown Statutory Authority for an

  19. Revised 1997 Retail Electricity Price Forecast Principal Author: Ben Arikawa

    E-Print Network [OSTI]

    Revised 1997 Retail Electricity Price Forecast March 1998 Principal Author: Ben Arikawa Electricity 1997 FORE08.DOC Page 1 CALIFORNIA ENERGY COMMISSION ELECTRICITY ANALYSIS OFFICE REVISED 1997 RETAIL ELECTRICITY PRICE FORECAST Introduction The Electricity Analysis Office of the California Energy Commission

  20. Corresponding author Measuring Concrete Crosstie Rail Seat Pressure Distribution

    E-Print Network [OSTI]

    Barkan, Christopher P.L.

    loads and cumulative freight tonnages, as well as increased interest in high speed passenger rail severe service conditions, such as areas of high curvature, heavy axle load or high speed passenger train1 Corresponding author Measuring Concrete Crosstie Rail Seat Pressure Distribution with Matrix

  1. Criminal History Check Disclosure Notice and Release Authorization

    E-Print Network [OSTI]

    Escher, Christine

    background information may include, but are not limited to: address history; criminal records and historyCriminal History Check Disclosure Notice and Release Authorization *Please attach a copy of your% for National criminal history checks. Hiring Department Index Number: __________________ Activity Code

  2. BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A REGULAR STAFF POSITION

    E-Print Network [OSTI]

    Thompson, Michael

    BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A REGULAR STAFF POSITION GOVERNED BY THE UNIVERSITY OPERATING BUDGET POLICY (BUDGETING SERVICES) BUDGET UNIT: BUDGET UNIT MANAGER: ENVELOPE: ENVELOPE MANAGER/contract compensation cost: $ FUNDING, BUDGET AND PLANNING INFORMATION (to be provided by Budget Unit Manager

  3. BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A FACULTY POSITION

    E-Print Network [OSTI]

    Thompson, Michael

    BUDGET FORM AUTHORIZATION FOR COMMITMENT TO A FACULTY POSITION GOVERNED BY THE UNIVERSITY OPERATING BUDGET POLICY (BUDGETING SERVICES) BUDGET UNIT: BUDGET UNIT MANAGER: ENVELOPE: ENVELOPE MANAGER: FACULTY;FUNDING, BUDGET AND PLANNING INFORMATION (to be provided by Budget Unit Manager, or delegate) 1. The total

  4. 2000: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS

    E-Print Network [OSTI]

    RadioAstronomie Millimétrique, Institut de (IRAM)

    2000: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS 815. NEW MOLECULES IN COMET C/1995 01, E. Gérard, B. Germain, M. Houde, D. Mehringer, R. Moreno, T.G. Paubert, H. Rauer 2000, A&A 353, 1101. Bachiller, S. Guilloteau, J.P. Maillard, A. Omont 2000, A&A 353, L25 817. CO DETECTION OF THE EXTREMELY RED

  5. Authorized Investigator's Laboratory Survey Record Room Diagram and Survey Instruments

    E-Print Network [OSTI]

    Sniadecki, Nathan J.

    . 4) All records must be available for inspection and kept for 3 calendar years. Survey InstrumentsAuthorized Investigator's Laboratory Survey Record Room Diagram and Survey Instruments u Instrument Code * Model # Serial # Type Action Level Instrument action level is twice the bkg count

  6. Author's personal copy GPU based real-time instrument tracking

    E-Print Network [OSTI]

    Author's personal copy GPU based real-time instrument tracking with three-dimensional ultrasound q April 2007; accepted 4 June 2007 Available online 5 July 2007 Abstract Real-time three-dimensional ultrasound enables new intracardiac surgical procedures, but the distorted appearance of instruments

  7. v. 1.1 May 2010 William Henning, lead author

    E-Print Network [OSTI]

    ) positioning for over fifteen years, the internet was the primary source for definitive documents. The following are gratefully acknowledged as sources for research and information: National Geodetic Survey introduced the author as a much younger man to GPS many years ago and remains a readily accessible source

  8. Breakthrough Makes LED Lights More Versatile Author: Andrea Thompson

    E-Print Network [OSTI]

    Rogers, John A.

    Breakthrough Makes LED Lights More Versatile Author: Andrea Thompson Source: http these limitations by combining the best of two worlds of LEDs to make ultrathin, ultrasmall and flexible light-sized inorganic LEDs after a request from Ford Motor Co. to create a third brake light for cars that would

  9. Building Visual Knowledge in a `Cinematic Hypertext' authoring environment

    E-Print Network [OSTI]

    Shipman, Frank

    1 Building Visual Knowledge in a `Cinematic Hypertext' authoring environment Clara Mancini them, the cinematic medium is the closest to hypertext and the analogy between cinema and hypertext in general1 has been pointed out in more than one occasion [3,7,8]. In particular, though, cinematic language

  10. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE expected service authorities. Admin Chg 1, dated 6-20-12, cancels DOE O 329.1. Admin Chg 2, dated 12-3-14, cancels DOE O 329.1 Chg 1.

  11. Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30

    The order establishes requirements and responsibilities for the employment and compensation of individuals when using DOE expected service authorities. Admin Chg 1, dated 6-20-12, supersedes DOE O 329.1. Admin Chg 2, dated 12-3-14, supersedes DOE O 329.1 Admin Chg 1. Admin Chg 2 updates locality rates.

  12. Central Technical Authority Responsibilities Regarding Nuclear Safety Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-08-28

    The order establishes Central Technical Authority and Chief of Nuclear Safety/Chief of Defense Nuclear Safety responsibilities and requirements directed by the Secretary of Energy in the development and issuance of Department of Energy regulations and directives that affect nuclear safety. Does not cancel/supersede other directives.

  13. * Corresponding author address: Jrg Schweizer, WSL Institute for Snow and

    E-Print Network [OSTI]

    Jamieson, Bruce

    ___________________ * Corresponding author address: Jürg Schweizer, WSL Institute for Snow Institute for Snow and Avalanche Research SLF, Davos, Switzerland 2 Department of Geological Sciences of Calgary, Calgary AB, Canada ABSTRACT: The release of a dry-snow slab avalanche is preceded by a series

  14. ETSU College of Medicine CBORD Door Access Authorization Form

    E-Print Network [OSTI]

    Karsai, Istvan

    ETSU College of Medicine CBORD Door Access Authorization Form 6/13/2011 Please grant access to: This access will remain in effect until the individual is no longer an active ETSU faculty list areas this individual will need access to: ____ ALL AREAS - ETSU Service Personnel Only ­ (i

  15. Author's personal copy Protein folding: Then and now

    E-Print Network [OSTI]

    Dokholyan, Nikolay V.

    Author's personal copy Review Protein folding: Then and now Yiwen Chen 1 , Feng Ding 1 , Huifen Nie Available online 8 June 2007 Abstract Over the past three decades the protein folding field has undergone monumental changes. Originally a purely academic question, how a protein folds has now become vital

  16. Authorization Federation in IaaS Multi Cloud Navid Pustchi

    E-Print Network [OSTI]

    Sandhu, Ravi

    Authorization Federation in IaaS Multi Cloud Navid Pustchi Institute for Cyber Security Department; Cloud Federation; Distributed Access Control; Security; Trust Management. 1. INTRODUCTION Cloud of Computer Science Univ of Texas at San Antonio tam498@my.utsa.edu Ram Krishnan Institute for Cyber Security

  17. Author's personal copy Comparison of microbial electrolysis cells operated with

    E-Print Network [OSTI]

    Keywords: Boosted power Energy input Hydrogen Methane Microbial electrolysis cell Set anode potential a bAuthor's personal copy Comparison of microbial electrolysis cells operated with added voltage s t r a c t Hydrogen production in a microbial electrolysis cell (MEC) can be achieved by either setting

  18. 2004: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS

    E-Print Network [OSTI]

    RadioAstronomie Millimétrique, Institut de (IRAM)

    2004: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS 1012. MASS-LOSS FROM DUSTY, LOW OUTFLOW. Cesaroni, L. Testi, C.M. Walmsley, S. Molinari, R. Neri, D. Shepherd, J. Brand, F. Palla, Q. Zhang 2004, A. Zuther, M. Krips, C. Straubmeier 2004, A&A 414, 497 1015. MOLECULAR GAS IN NUclei OF GAlaxies (NUGA) II

  19. Author's Accepted Manuscript Full range determination of 222

    E-Print Network [OSTI]

    ; surface water; groundwater. 1. INTRODUCTION Radon is a rare gas with three natural radioactive isotopesAuthor's Accepted Manuscript Full range determination of 222 Rn at the watershed scale by liquid Rn at the watershed scale by liquid scintillation counting, Applied Radiation and Isotopes, http

  20. Tamper-Evident Digital Signatures: Protecting Certification Authorities Against Malware

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Tamper-Evident Digital Signatures: Protecting Certification Authorities Against Malware Jong Youl of Informatics, Indiana University at Bloomington, IN 47406 Abstract. We introduce the notion of tamper schemes tamper-evident since any deviation from the protocol is immediately detectable. We demonstrate our

  1. Author's personal copy Evolution and Phylogeny of Communication

    E-Print Network [OSTI]

    Ord, Terry

    Author's personal copy Evolution and Phylogeny of Communication T. J. Ord, University of New South History In broad terms, the way in which animals communicate with one another is dependent on three key than others. Yet, how communication evolves in response to social and environmental selection pressures

  2. An Export Architecture for a Multimedia Authoring Environment

    E-Print Network [OSTI]

    Joseph Fourier Grenoble-I, Université

    An Export Architecture for a Multimedia Authoring Environment Jan Mikác INRIA RhôneAlpes 655 04 60 leducbao@gmail.com ABSTRACT In this paper, we propose an export architecture that provides, Standardization. Keywords Export, multimedia document, publishing format, SMIL, Timesheets 1. INTRODUCTION

  3. Enhancing Clustering Blog Documents by Utilizing Author/Reader Comments

    E-Print Network [OSTI]

    Zhang, Jun

    Enhancing Clustering Blog Documents by Utilizing Author/Reader Comments Beibei Li Department)257-3892 jzhang@cs.uky.edu ABSTRACT Blogs are a new form of internet phenomenon and a vast ever- increasing information resource. Mining blog files for information is a very new research direction in data mining. We

  4. authors here 1 Computational Mechanism Design page 4

    E-Print Network [OSTI]

    Chen, Yiling

    Title Here Edited by authors here #12;#12;Contents 1 Computational Mechanism Design page 4 3 #12;1 COMPUTATIONAL MECHANISM DESIGN Abstract Computational mechanism design brings together the concern in microeco.1 Introduction Mechanism design (MD) is a sub-field of microeconomics and game the- ory which considers how

  5. Author's personal copy Protein folding in confined and crowded environments

    E-Print Network [OSTI]

    Weston, Ken

    Author's personal copy Review Protein folding in confined and crowded environments Huan-Xiang Zhou protein folding in cellular environments. Theories based on considerations of excluded volumes predict disparate effects on protein folding stability for confinement and crowding: confinement can stabilize

  6. Authority and the production of knowledge in archaeology

    E-Print Network [OSTI]

    Pruitt, Tera Corinne

    2011-10-11

    the original unpublished thesis for which the author does not permission to publish or copyright appear in this online thesis as placeholders, which include information about where the reader can find the original image.   iv Acknowledgements       I...   and  practical  opportunities  to  grow.  I  also  thank  Marie  Louise  Stig  Sørensen and  Neil  Brodie  for   their   support   and   expert   commentary,   especially   during  my   early   research.   I...

  7. Author's personal copy Fuzzy modelling of the composting process

    E-Print Network [OSTI]

    Author's personal copy Fuzzy modelling of the composting process E. Giusti, S. Marsili May 2009 Available online 18 June 2009 Keywords: Composting Fuzzy models Fuzzy identification Fuzzy clustering a b s t r a c t Composting is a solid waste treatment process consisting of the biochemical

  8. An Authorization Framework for a Grid Based Component Architecture

    E-Print Network [OSTI]

    Security Infrastructure (GSI) [1] is widely accepted as the standard for authentication on the Grid for security. Desired characteristics of Grid security include: · The ability to verify the identityAn Authorization Framework for a Grid Based Component Architecture Lavanya Ramakrishnan1 , Helen

  9. 2011 Renewable Energy Data Book Author: Rachel Gelman

    E-Print Network [OSTI]

    2011 Renewable Energy Data Book Author: Rachel Gelman The 2011 Renewable Energy Data Book provides energy development and investments. Rich graphics and depth and breadth of data make the Data Book series facts and figures on energy in general, renewable electricity in the United States, and global renewable

  10. CUNY EXPORT CONTROL PROCEDURES 5. Licenses and export authorizations

    E-Print Network [OSTI]

    Rosen, Jay

    CUNY EXPORT CONTROL PROCEDURES 5. Licenses and export authorizations This Section addresses how, ITAR items of any kind must not be exported, nor accessed by a non-U.S. person, without proper required depends on the type of export transaction subject to control; for example, temporary versus

  11. The Ozone Layer in the 21st Lead Authors

    E-Print Network [OSTI]

    Robock, Alan

    CHAPTER 6 The Ozone Layer in the 21st Century Lead Authors: G.E. Bodeker D.W. Waugh Coauthors: H;#12;CHAPTER 6 THE OZONE LAYER IN THE 21ST CENTURY Contents SCIENTIFIC SUMMARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.5 6.2 A FRAMEWORK FOR EVALUATING CHANGES IN OZONE ABUNDANCES

  12. 6. Fracture mechanics lead author: J, R. Rice

    E-Print Network [OSTI]

    6. Fracture mechanics lead author: J, R. Rice Division of Applied Sciences, Harvard University. F. Shih, and the ASME/AMD Technical Committee on Fracture Mechanics, pro- vided by A. S. Argon, S. N, W. D. Stuart, and R. Thomson. 6.0 ABSTRACT Fracture mechanics is an active research field

  13. XPOLA An Extensible Capability-based Authorization Infrastructure for Grids

    E-Print Network [OSTI]

    , especially with the host account maintenance and certificate management. This paper proposes a capability-based infrastructure that provides a fine-grained authorization solution to Web service deployments, and also manages collaboration and resource sharing securely across multiple domains. Interests from academia and industry

  14. Author's personal copy Journal of Power Sources 195 (2010) 75487558

    E-Print Network [OSTI]

    Daraio, Chiara

    2010-01-01

    on hydrogen polymer electrolyte membrane fuel cells (PEMFC) with countless publications on nearly every aspect of a PEMFC available [8­15]. A very convenient assumption, i.e. that Corresponding author. Tel.: +41 44 632 impedance analysis of PEMFC greatly and thus led to enhanced interest in the diagnostic technique

  15. Author's personal copy Computer Physics Communications 185 (2014) 10271037

    E-Print Network [OSTI]

    Tyc, Tomas

    2014-01-01

    Author's personal copy Computer Physics Communications 185 (2014) 1027­1037 Contents lists TIM: Ray-tracer TIM, with additional specialist scientific capabilities Stephen Oxburgha , Tomás Tycb transform Geometrical optics Perfect imaging METATOYs a b s t r a c t We describe several extensions to TIM

  16. Author's personal copy Fusion Engineering and Design 85 (2010) 687693

    E-Print Network [OSTI]

    Harilal, S. S.

    2010-01-01

    Author's personal copy Fusion Engineering and Design 85 (2010) 687­693 Contents lists available. The ITERTHA code is also benchmarked against the thermal-hydraulic calculation of the outer divertor flux and thus accurate calculation of the CHF requires the use of the appropriate FEPF for the given

  17. Author's personal copy Journal of Algebra 320 (2008) 17691770

    E-Print Network [OSTI]

    Kabbaj, Salah-Eddine

    2008-01-01

    Author's personal copy Journal of Algebra 320 (2008) 1769­1770 www.elsevier.com/locate/jalgebra Corrigendum Corrigendum to "Class semigroups of integral domains" [J. Algebra 264 (2) (2003) 620­640] S is a strongly stable domain. Moreover, when any one condition holds, R is Boole regular with S(R) = FOV (R

  18. Author's personal copy Solar modulation in surface atmospheric electricity

    E-Print Network [OSTI]

    Usoskin, Ilya G.

    Author's personal copy Solar modulation in surface atmospheric electricity R. Giles Harrison a is the major source of air's electrical conductivity over the oceans and well above the continents atmospheric electrical circuit, including the local vertical current density and the related surface potential

  19. Specification and Analysis of Attribute-based Authorization Policy

    E-Print Network [OSTI]

    Sandhu, Ravi

    Policy The Big Goal Flexible, scalable authorization for decentralized, collaborative environments policy to support collaboration in open systems RT: A Role-based Trust-management* framework Need © William H. Winsborough 6 Role-based Trust Management (RT) A family of credential / policy languages

  20. Specification and Analysis of Attribute-based Authorization Policy

    E-Print Network [OSTI]

    Sandhu, Ravi

    Policy The Big Goal Flexible, scalable authorization for decentralized, collaborative environments policy to support collaboration in open systems RT: A Role-based Trust-management* framework Need. Winsborough 6 Role-based Trust Management (RT) A family of credential / policy languages Simplest, RT0, has

  1. Memorandum, Protective Force Law Enforcement Authority- May 1, 2009

    Broader source: Energy.gov [DOE]

    Investigation allegations that contractor procetive force personnel at a DOE site exceeded their legistative ,regulatory, and policy-based authority by providing on-duty, armed off-site assistance to local law enforcement authorites during other than recapture/recovery operations, and by accessing the local law enforcement database for background checks during the course of on-site administrative traffic stops.

  2. Author's personal copy Gasoline prices and traffic safety in Mississippi

    E-Print Network [OSTI]

    Levinson, David M.

    more than 16% from 1973 to 1974 when the oil crisis occurred. International oil prices historically-grade unleaded gasoline price data from the Energy Information Administration of the U.S. Department of EnergyAuthor's personal copy Gasoline prices and traffic safety in Mississippi Guangqing Chi a, , Arthur

  3. Author's personal copy Perforated diode neutron detector modules fabricated from

    E-Print Network [OSTI]

    Shultis, J. Kenneth

    Author's personal copy Perforated diode neutron detector modules fabricated from high Perforated detectors Perforated diodes a b s t r a c t Compact neutron detectors are being designed that are mass produced from high-purity Si wafers. Each detector has thousands of circular perforations etched

  4. Author's personal copy Molecular & Biochemical Parasitology 155 (2007) 167171

    E-Print Network [OSTI]

    Davis, Richard E.

    2007-01-01

    Author's personal copy Molecular & Biochemical Parasitology 155 (2007) 167­171 Short technical report An improved and secreted luciferase reporter for schistosomes Guofeng Cheng, Richard E. Davis in schistosomes. In the current study, we demonstrate that a Gaussia luciferase reporter leads to significantly

  5. Nonlinear Pricing in Markets with Interdependent Demand Author(s): Shmuel S. Oren, Stephen A. Smith and Robert B. Wilson

    E-Print Network [OSTI]

    Oren, Shmuel S.

    such as electric power are priced with increasing unit prices (e.g., lifeline rates), but such pricing. This paper has been with the authors for 3 revisions. t Department of Engineering-Economic Systems, Stanford which significantly improved the quality of this paper. We also thank Subrata Sen and Donald Morrison

  6. Large Torsional Oscillations in Suspension Bridges Revisited: Fixing an Old Approximation Author(s): P. J. McKenna

    E-Print Network [OSTI]

    McKenna, Joseph

    Large Torsional Oscillations in Suspension Bridges Revisited: Fixing an Old Approximation Author to The American Mathematical Monthly. http://www.jstor.org #12;LargeTorsionalOscillations in SuspensionBridges,FredericD. Schwartzwrites "The Tacoma NarrowsBridgecollapse is technology'sversionoftheJFK assassi- nation. There

  7. Copyright 101 for Authors: Publication Agreements and Open Sharing

    E-Print Network [OSTI]

    Peterson, A. Townsend; Rolf, Rachel; Emmett, Ada

    2010-10-19

    of this version. The details of those relationships, and other offerings allowing open web use, are set forth at the following website: http://www.wiley.com/go/funderstatement. NIH grantees should check the box at the bottom of this document. 3. Final Published... as a government employee legally prevents you from signing this Agreement, please contact the editorial office. NIH Grantees Note to NIH Grantees Pursuant to NIH mandate, Wiley-Blackwell will post the accepted version of Contributions authored by NIH...

  8. REQUEST FOR RECORDS DISPOSITION AUTHORITY | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuildingBudget ||Department ofRequest for Records Disposition Authority

  9. The New York Power Authority`s energy-efficient refrigerator program for the New York City Housing Authority -- 1997 savings evaluation

    SciTech Connect (OSTI)

    Pratt, R.G.; Miller, J.D.

    1998-09-01

    This document describes the estimation of the annual energy savings achieved from the replacement of 20,000 refrigerators in New York City Housing Authority (NYCHA) public housing with new, highly energy-efficient models in 1997. The US Department of Housing and Urban Development (HUD) pays NYCHA`s electricity bills, and agreed to reimburse NYCHA for the cost of the refrigerator installations. Energy savings over the lifetime of the refrigerators accrue to HUD. Savings were demonstrated by a metering project and are the subject of the analysis reported here. The New York Power Authority (NYPA) identified the refrigerator with the lowest life-cycle cost, including energy consumption over its expected lifetime, through a request for proposals (RFP) issued to manufacturers for a bulk purchase of 20,000 units in 1997. The procurement was won by Maytag with a 15-ft{sup 3} top-freezer automatic-defrost refrigerator rated at 437 kilowatt-hours/year (kWh/yr). NYCHA then contracted with NYPA to purchase, finance, and install the new refrigerators, and demanufacture and recycle materials from the replaced units. The US Department of Energy (DOE) helped develop and plan the project through the ENERGY STAR{reg_sign} Partnerships program conducted by its Pacific Northwest National Laboratory (PNNL). PNNL designed the metering protocol and occupant survey used in 1997, supplied and calibrated the metering equipment, and managed and analyzed the data collected by NYPA. The objective of the 1997 metering study was to achieve a general understanding of savings as a function of refrigerator label ratings, occupant effects, indoor and compartment temperatures, and characteristics (such as size, defrost features, and vintage). The data collected in 1997 was used to construct models of refrigerator energy consumption as a function of key refrigerator and occupant characteristics.

  10. Community Management of Local Authority Woodlands in England 1 Shared Assets, December 2013

    E-Print Network [OSTI]

    Community Management of Local Authority Woodlands in England 1 Shared Assets Management of Local Authority Woodlands in England 3 Shared Assets, December 2013 #12;Community Management of Local Authority Woodlands in England 4 Shared Assets

  11. Does Political Geography Determine Political Destiny? A Review of The New Political Geography of California by Frederick Douzet, Thad Kousser, and Kenneth Miller

    E-Print Network [OSTI]

    Boushey, Graeme

    2011-01-01

    Review Does Political Geography Determine Political Destiny?of The New Political Geography of California by FrédérickMiller’s The New Political Geography of California (2008),

  12. Author(s).

    Office of Scientific and Technical Information (OSTI)

    o f Porous Granular Ejrplosives," Shock Waves in Condensed Matter - 1983, Santa Fe, New Mexico, Proc. A P S Topical Cod., J. R. h a y , R. A. Graham, and G . K. Straub, eds.,...

  13. Author(s).

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report: Achievements of structural genomicsOffice of ScientificArthur8-3484 Approved

  14. Date ________________________ Dept/Prog ______________________________________________________________________________ Chair/Dir Name ______________________________Manual or Digital Signature of authorized approver ________________________________________

    E-Print Network [OSTI]

    Lewis, Robert Michael

    ____________________________________ Salary Index 1 ____________________ Org Code 1 ____________________ % for split funding ____________________ Salary Index 2 ____________________ Org Code 2 ____________________ % for split funding Salary ____________________ Authorized Salary ____________________ Authorized Salary

  15. EPA - State NPDES Program Authority | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsAreaforInformation ECrNEPAState NPDES Program Authority

  16. Tennessee Valley Authority (North Carolina) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfinMarketMemberI PLLCsourceValley Authority

  17. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILITY

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference)Feedback SystemGimbaled X-Ray Head (JournalSciTechAUTHORS SUBJECT

  18. Secure Knowledge Management for Health Care Organizations Authors: D.Mundy, D.W.Chadwick

    E-Print Network [OSTI]

    Kent, University of

    's eligibility to receive specific categories of information. [NIS, 1992] (see section 3) ?? authorization: 1

  19. Authorized Agent Indemnification Policy Approved by the Colorado School of Mines Board of Trustees, December

    E-Print Network [OSTI]

    against an Authorized Agent based upon sanctions imposed upon the Authorized Agent or CSM by a judicial: 3.2.1 Throughout the course of the matter that gave rise to the sanctions, the Authorized Agent of the matter that gave rise to the sanctions, the Authorized Agent was acting in good faith; and 3

  20. New York Power Authority/New York City Housing Authority refrigerator replacement program, first program year evaluation. Final report

    SciTech Connect (OSTI)

    Kinney, L.F.; Lewis, G.; Pratt, R.G.; Miller, J.

    1997-08-01

    Acting as an energy services provider, the New York Power Authority (NYPA) has initiated a long-term project through which 20,000 refrigerators per year will be replaced with the most energy-efficient units possible in apartments managed by the New York City Housing Authority (NYCHA). Using bulk purchasing as an incentive to appliance manufacturers to produce energy-efficient refrigerators suitable for use in apartments, replaced in the first year of the program, which ended in December 1996. These units, kWh per year. Savings were determined by field testing and laboratory testing of 220 existing refrigerators and 56 newly-installed units. In the next program year, a 15.0-cubic-foot Maytag refrigerator, newly-designed in response to bulk purchasing incentives, is being installed. The new unit has a label rating of 437 kWh per year, 31 percent better than 1993 energy standards. Old refrigerators removed from apartments are {open_quotes}demanufactured{close_quotes} in an environmentally-appropriate way and both metals and refrigerants are recovered for reuse.

  1. Peoria Housing Authority(PHA) Weatherization Training Project

    SciTech Connect (OSTI)

    Phillip Chrismon; Jason Dollarhide

    2011-12-31

    The DOE Weatherization Training Project's goal is to obtain a solid foundation of administrative and technical knowledge so the Peoria Housing Authority (PHA) can establish and implement a successful Weatherization Program by 2011. The DOE weatherization Training Project's two objectives are to (1) build PHA's capabilities by (2) developing its staff members capacities via the acquisition of weatherization skills and competencies. The impacts from this project include: (a) the improvement and expansion of PHA staff skills, (b) the overall enhancement of the quality of the PHA workforce, which will (c) foster employment, (d) the ability to properly weatherize PHA housing stock, tribal buildings, and tribal members houses, which will (e) result in reduced energy use, and (f) improved tribal and household economies.

  2. New York State Energy Research and Development Authority

    Office of Energy Efficiency and Renewable Energy (EERE)

    One of DOE's key partners is the New York State Energy Research and Development Authority (NYSERDA), which operates a successful combined heat and power (CHP) and clean distributed generation (DG) research, development, and deployment program. NYSERDA supports development and demonstration of CHP systems throughout all end-use sectors. It also collects and analyzes project performance data, conducts market studies, and supports the Northeast Clean Energy Application Center (CEAC). The NYSERDA-DOE partnership evaluates CHP project proposals and shares lessons learned through conferences, workshops, and other activities. This partnership has provided value to New York residents and to energy professionals across the country. NYSERDA projects have led to electric demand reduction, higher fuel efficiency, emissions reduction, lower energy costs, job creation, and increased product sales.

  3. ONSITE TRANSPORTATION AUTHORIZATION CHALLENGES AT THE SAVANNAH RIVER SITE

    SciTech Connect (OSTI)

    Watkins, R.; Loftin, B.; Hoang, D.; Maxted, M.

    2012-05-30

    Prior to 2008, transfers of radioactive material within the Savannah River Site (SRS) boundary, referred to as onsite transfers, were authorized by Transportation Safety Basis (TSB) documents that only required approval by the SRS contractor. This practice was in accordance with the existing SRS Transportation Safety Document (TSD). In 2008 the Department of Energy Savannah River Field Office (DOE-SR) requested that the SRS TSD be revised to require DOE-SR approval of all Transportation Safety Basis (TSB) documents. As a result, the primary SRS contractor embarked on a multi-year campaign to consolidate old or generate new TSB documents and obtain DOE-SR approval for each. This paper focuses on the challenges incurred during the rewriting or writing of and obtaining DOE-SR approval of all Savannah River Site Onsite Transportation Safety Basis documents.

  4. Roles and Delegation of Authority (R/DA) System

    SciTech Connect (OSTI)

    ABBOTT,JOHN P.; HUTCHINS,JAMES C.; SCHOCH,DAVID G.

    1999-11-01

    The processes of defining managerial roles and providing for delegation of authority are essential to any enterprise. At most large organizations, these processes are defined in policy manuals and through sets of standard operating procedures for many, if not all, business and administrative functions. Many of these staff-initiated, administrative functions require the routing of documents for approval to one or more levels of management. These employee-oriented, back office types of workflows tend to require more flexibility in determining to whom these documents should go to, while, at the same time, providing the responsible parties with the flexibility to delegate their approval authority or allow others to review their work. Although this practice is commonplace in manual, paper-based processes that exist in many organizations, it is difficult to provide the same flexibility in the more structured, electronic-based, workflow systems. The purpose of this report is to present a framework or architecture for creating a R/DA system and provide some insights associated with its design and utilization. To improve understanding and clarify subsequent discussion, the goals and requirements for the major R/DA system components, namely, the database and interface modules, are initially presented along with the identification of important concepts and the definition of critical terms. Next high-level functions relating the types of inputs to the outputs of the R/DA interface module are introduced and discussed. Then the relationships between the major R/DA modules and the primary components associated with its creation and maintenance are presented and analyzed. Finally, some conclusions are drawn relative to the advantages associated with developing a R/DA system for use in implementing an enterprise-wide, work-facilitating information system.

  5. UB LIS 571 Soergel Lecture 7.2a, Reading 1 The Author Approach: Conditions and Cases

    E-Print Network [OSTI]

    Soergel, Dagobert

    having more than one Author 1.1 Document prepared by an author with the aid of collaborators how many authors have to be named before title takes precedence over author. 1.4 Document in which

  6. Peak Dose Assessment for Proposed DOE-PPPO Authorized Limits

    SciTech Connect (OSTI)

    Maldonado, Delis

    2012-06-01

    The Oak Ridge Institute for Science and Education (ORISE), a U.S. Department of Energy (DOE) prime contractor, was contracted by the DOE Portsmouth/Paducah Project Office (DOE-PPPO) to conduct a peak dose assessment in support of the Authorized Limits Request for Solid Waste Disposal at Landfill C-746-U at the Paducah Gaseous Diffusion Plant (DOE-PPPO 2011a). The peak doses were calculated based on the DOE-PPPO Proposed Single Radionuclides Soil Guidelines and the DOE-PPPO Proposed Authorized Limits (AL) Volumetric Concentrations available in DOE-PPPO 2011a. This work is provided as an appendix to the Dose Modeling Evaluations and Technical Support Document for the Authorized Limits Request for the C-746-U Landfill at the Paducah Gaseous Diffusion Plant, Paducah, Kentucky (ORISE 2012). The receptors evaluated in ORISE 2012 were selected by the DOE-PPPO for the additional peak dose evaluations. These receptors included a Landfill Worker, Trespasser, Resident Farmer (onsite), Resident Gardener, Recreational User, Outdoor Worker and an Offsite Resident Farmer. The RESRAD (Version 6.5) and RESRAD-OFFSITE (Version 2.5) computer codes were used for the peak dose assessments. Deterministic peak dose assessments were performed for all the receptors and a probabilistic dose assessment was performed only for the Offsite Resident Farmer at the request of the DOE-PPPO. In a deterministic analysis, a single input value results in a single output value. In other words, a deterministic analysis uses single parameter values for every variable in the code. By contrast, a probabilistic approach assigns parameter ranges to certain variables, and the code randomly selects the values for each variable from the parameter range each time it calculates the dose (NRC 2006). The receptor scenarios, computer codes and parameter input files were previously used in ORISE 2012. A few modifications were made to the parameter input files as appropriate for this effort. Some of these changes included increasing the time horizon beyond 1,050 years (yr), and using the radionuclide concentrations provided by the DOE-PPPO as inputs into the codes. The deterministic peak doses were evaluated within time horizons of 70 yr (for the Landfill Worker and Trespasser), 1,050 yr, 10,000 yr and 100,000 yr (for the Resident Farmer [onsite], Resident Gardener, Recreational User, Outdoor Worker and Offsite Resident Farmer) at the request of the DOE-PPPO. The time horizons of 10,000 yr and 100,000 yr were used at the request of the DOE-PPPO for informational purposes only. The probabilistic peak of the mean dose assessment was performed for the Offsite Resident Farmer using Technetium-99 (Tc-99) and a time horizon of 1,050 yr. The results of the deterministic analyses indicate that among all receptors and time horizons evaluated, the highest projected dose, 2,700 mrem/yr, occurred for the Resident Farmer (onsite) at 12,773 yr. The exposure pathways contributing to the peak dose are ingestion of plants, external gamma, and ingestion of milk, meat and soil. However, this receptor is considered an implausible receptor. The only receptors considered plausible are the Landfill Worker, Recreational User, Outdoor Worker and the Offsite Resident Farmer. The maximum projected dose among the plausible receptors is 220 mrem/yr for the Outdoor Worker and it occurs at 19,045 yr. The exposure pathways contributing to the dose for this receptor are external gamma and soil ingestion. The results of the probabilistic peak of the mean dose analysis for the Offsite Resident Farmer indicate that the average (arithmetic mean) of the peak of the mean doses for this receptor is 0.98 mrem/yr and it occurs at 1,050 yr. This dose corresponds to Tc-99 within the time horizon of 1,050 yr.

  7. State Transmission Infrastructure Authorities: The Story So Far; December 2007 - December 2008

    SciTech Connect (OSTI)

    Porter, K.; Fink. S.

    2008-05-01

    This report examines the status and future direction of state transmission infrastructure authorities. It summarizes common characteristics, discusses current transmission projects, and outlines common issues the state infrastructure authorities have faced.

  8. Renewable success : development of good architecture in the case of Arriyadh Development Authority, Saudi Arabia

    E-Print Network [OSTI]

    Alkhabbaz, Mohammed H

    2010-01-01

    ArRiyadh Development Authority (ADA) is an unusual city development authority within the Saudi Arabian government hierarchy. Part of its responsibilities is coordinating and overseeing the design and building of buildings ...

  9. How to Obtain Authorization to Import and/or Export Natural Gas...

    Energy Savers [EERE]

    How to Obtain Authorization to Import andor Export Natural Gas and LNG How to Obtain Authorization to Import andor Export Natural Gas and LNG LNG Exports | Long Terms | Blanket...

  10. Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System...

    Energy Savers [EERE]

    Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System Administrative Change Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System Administrative Change...

  11. Emission Testing of Washington Metropolitan Area Transit Authority (WMATA) Natural Gas and Diesel Transit Buses

    SciTech Connect (OSTI)

    Melendez, M.; Taylor, J.; Wayne, W. S.; Smith, D.; Zuboy, J.

    2005-12-01

    An evaluation of emissions of natural gas and diesel buses operated by the Washington Metro Area Transit Authority.

  12. CONSENT AND RELEASE FORM I, (student)_________________ hereby authorize the University of Connecticut and those

    E-Print Network [OSTI]

    Chandy, John A.

    of Connecticut and those acting pursuant to its authority ( "University") to record my likeness and/or voice

  13. ISIS 9.0 | Student Center -Assign Authorized User Access 1 Created: 08.05.14

    E-Print Network [OSTI]

    Capogna, Luca

    ISIS 9.0 | Student Center - Assign Authorized User Access 1 Created: 08.05.14 Assign Authorized User Access Student Center ISIS 9.0 Set Up a New Authorized User This set up allows parents and other that allows the University to discuss items covered by FERPA with your user. 1. Log in to your ISIS Student

  14. EHS DSP Authorization Request Form 2012-001 Safety & Risk Management

    E-Print Network [OSTI]

    EHS DSP Authorization Request Form 2012-001 Safety & Risk Management Request for Authorization, regulations and Driver safety Program requirements. I authorize Safety & Risk Management to enroll me completed forms to sfehs@sfsu.edu. Questions? Contact Safety & Risk Management at (415) 338-2565 Safety

  15. A review of the history of alkali-aggregate reaction at three of the Tennessee Valley Authority`s dams

    SciTech Connect (OSTI)

    Wagner, C.D.; Newell, V.A.

    1995-12-31

    Three of The Tennessee Valley Authority (TVA) major hydroelectric projects are experiencing alkali-aggregate reaction (AAR), These projects include Fontana Dam and Powerhouse, Hiwassee Dam and Powerhouse, and Chickamauga Lock, Dam and Powerhouse, All of these dams are considered {open_quotes}high hazard,{close_quotes} causing significant economic losses from loss of power, replacement of the dam and generation facilities, and loss of life should they fail. This paper presents an overview of the descriptions of each of these projects, including construction and original instrumentation installed in the structure during construction, All of these projects are now 50 to 60 years old and are experiencing problems in one or more locations due to AAR with no indication of any slowing of the concrete growth process, Concrete problems at these projects came as no surprise. Cracks were noted within 5 years of construction, and by 1980 some of these cracks were 1/2 inch in width. continuous monitoring of these projects has always been a priority. This paper will discuss how the growth from AAR has affected each structure, which structures have been affected most, and why. It will discuss how TVA has managed AAR at these projects in the past and how TVA is changing from a reactive to a pro-active approach in its response to AAR.

  16. A Map of Visual Space Induced in Primary Auditory Cortex Author(s): Anna W. Roe, Sarah L. Pallas, Jong-On Hahm, Mriganka Sur

    E-Print Network [OSTI]

    Sur, Mriganka

    A Map of Visual Space Induced in Primary Auditory Cortex Author(s): Anna W. Roe, Sarah L. Pallas, Jong-On Hahm, Mriganka Sur Source: Science, New Series, Vol. 250, No. 4982 (Nov. 9, 1990), pp. 818 of this work. Publisher contact information may be obtained at http

  17. Energy and Nutrient Dynamics of Forest Floors in Three Minnesota Forests Author(s): W. A. Reiners and N. M. Reiners

    E-Print Network [OSTI]

    Thomas, David D.

    Energy and Nutrient Dynamics of Forest Floors in Three Minnesota Forests Author(s): W. A. Reiners. http://www.jstor.org #12;497 ENERGY AND NUTRIENT DYNAMICS OF FOREST FLOORS IN THREE MINNESOTA FORESTS and subsequent utilization by heterotrophs is a major pathway of energy flow. Forest floors can also

  18. A Radio-Tracking System for Studying Movements of Deer Author(s): John R. Tester, Dwain W. Warner, William W. Cochran

    E-Print Network [OSTI]

    Minnesota, University of

    A Radio-Tracking System for Studying Movements of Deer Author(s): John R. Tester, Dwain W. Warner of Wildlife Management. http://www.jstor.org #12;A RADIO-TRACKINGSYSTEMFORSTUDYINGMOVEMENTSOF DEER JOHN R monitor movements of deer (Odocoileus virginianus) marked with radio transmitters. Constructiondetails

  19. Ecosystem Services in Decision Making: Time to Deliver Author(s): Gretchen C. Daily, Stephen Polasky, Joshua Goldstein, Peter M. Kareiva, Harold A.

    E-Print Network [OSTI]

    Vermont, University of

    Ecosystem Services in Decision Making: Time to Deliver Author(s): Gretchen C. Daily, Stephen. 7, No. 1, The Role of Ecosystem Services in Conservation and Resource Management (Feb., 2009), pp of content in a trusted digital archive. We use information technology and tools to increase productivity

  20. RENEWAL OF WORK PERMITS/STUDENT AUTHORIZATIONS FOR MSP Please note that copies of work permits/student authorizations must be submitted to

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    RENEWAL OF WORK PERMITS/STUDENT AUTHORIZATIONS FOR MSP Please note that copies of work permits in which a Work Permit or Student Authorization expires. If they are renewed, coverage will only) If the renewal date is the day immediately following the expiration of the previous permit

  1. An Infinite Family in $\\pi_\\ast S^0$ Derived from Mahowald's $\\eta_j$ Family Author(s): Robert R. Bruner

    E-Print Network [OSTI]

    Bruner, Robert R.

    An Infinite Family in $\\pi_\\ast S^0$ Derived from Mahowald's $\\eta_j$ Family Author(s): Robert R & Conditions of Use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp . JSTOR is a not@jstor.org. . American Mathematical Society is collaborating with JSTOR to digitize, preserve and extend access

  2. Testing Video Playback to Lizards in the Field Author(s): David L. Clark, Joseph M. Macedonia and Gil G. Rosenthal

    E-Print Network [OSTI]

    Macedonia, Joseph

    Testing Video Playback to Lizards in the Field Author(s): David L. Clark, Joseph M. Macedonia-423 Testing Video Playback to Lizards in the Field DAVIDL. CLARK,JOSEPHM. MACEDONIA,AND GIL G. ROSENTHAL Video), birds (Evans and Marler, 1991; Evans et al., 1993a, 1993b), lizards (Macedonia et al., 1994; Macedonia

  3. Concern over Immigration and Support for Public Services

    E-Print Network [OSTI]

    McGhee, Eric M; Neiman, Max

    2010-01-01

    San Diego, California. Myers, Dowell. 2007. Immigrants andSage Foundation. Myers, Dowell, John Pitkin, and Julie Park.Nathan Kalmoe, Thad Kousser, Dowell Myers, Carole Tolbert,

  4. Exploring the Dynamic Radio Sky with the Allen Telescope Array

    E-Print Network [OSTI]

    Williams, Peter Kelsey George

    2012-01-01

    419 Binder, R. V. 1996, Software Testing, Verification, &Software and hardware will inevitably fail, and testing ofwhy scientific software so often lacks systematic testing

  5. CERF THEORY FOR GRAPHS Allen Hatcher and Karen Vogtmann

    E-Print Network [OSTI]

    Vogtmann, Karen

    * *enerators, a good space on which this group acts was constructed in [3]. In the present pa* *per we study, specifying basepoints has certain technical advantages. I* *n partic- ular, basepoints give rise to a nice

  6. Exploring the Dynamic Radio Sky with the Allen Telescope Array

    E-Print Network [OSTI]

    Williams, Peter Kelsey George

    2012-01-01

    5.3.6 Multi-Epoch Photometry . . . . . . . . . 5.3.7A.3 Photometry . . . . . . . . . . . . . .Imaging and Photometry B Probability of Constancy From a Set

  7. Allen County Community College Transfer Program to University of Kansas

    E-Print Network [OSTI]

    GE3N, GE12 CHEM 330 & 331 Organic Chemistry 5 CHE 265 Organic Chemistry 1 5 Petroleum Engineering: KU Engineering Physics 2 5 GE3N CHEM 130 Chemistry 5 CHE 125 Chemistry 5 GE12, GE3N CHEM 135 Chemistry 2 5 CHE & Petroleum Engineering (Subplans of Environmental, Biomedical, Petroleum, Pre-Med) Number to call at KU

  8. Dr. Dean W. Ahrenholz Dr. M. James Allen

    E-Print Network [OSTI]

    . Deqin Cai Dr. Mark H. Carr Dr. Gonzalo C. Castillo Dr. Jose I. Castro Dr. D. Chapman Dr. Kenneth K. Chew. Douglas A. DeVries Dr. David Die Dr. James G. Ditty Announcement The editorial staff of Fishery Bulletin.A. Rowden Dr. David J. Rugh Dr. Bernard Sainte-Marie Dr. R.A. Santos Dr. Thomas Sawyer Dr.

  9. Van Allen probes pinpoint driver of speeding electrons

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    how the acceleration took place. Right now, the team believes that electromagnetic radio waves somehow excite the electrons into a higher-energy state, much like a microwave...

  10. Allen Press http://www.jstor.org/stable/3783366 .

    E-Print Network [OSTI]

    influencingwintermovementsof elk.J.Mammal. 65:524-526. UNSWORTH,J. W., L. KUCK,ANDE. O. GARTON. 1990. Elk sightabilitymodel:524-526. UNSWORTH,J. W., L. KUCK,ANDE. O. GARTON. 1990. Elk sightabilitymodel validationat the National Bison

  11. DSP COMMUNICATIONS EXPERIMENT Gale Allen, Ph.D.

    E-Print Network [OSTI]

    Allen, Gale

    including spectrum analyzers, function generators, and oscilloscopes. Many different types of digital. The oscillator part of the circuit was implemented using a function generator (Figures 3, 4, 5). That reduced and Youngblood's recent PowerPoint presentations6,7 were very helpful. The experiment involves synchronous

  12. NUMERICAL APPROXIMATIONS OF ALLEN-CAHN AND CAHN ...

    E-Print Network [OSTI]

    2010-03-18

    schemes that satisfy a corresponding discrete energy law, or in other words, energy ... Our first objective is to design stabilized semi-implicit schemes that satisfy an energy ...... Numerical analysis of a continuum model of phase transition.

  13. INTERNAL CURING RESEARCH ON US-54 IN ALLEN CO, KS

    E-Print Network [OSTI]

    Cast 9:30 AM 10:30 AM Initial Set 6:10 PM (8:40 hours) 4:30 PM (6:00 hours) Final Set 10:20 PM (12 28 Day Shrinkage 0.030% 0.035% 28 Day Elastic Modulus 3500 ksi 3630 ksi 28 Day Poisson's Ratio 0.21 0

  14. Jeremy Allen; Baker, Michael Sean; Clemens, Rebecca C.; Mitchell...

    Office of Scientific and Technical Information (OSTI)

    Shock waves-Measurement. This report summarizes design and modeling activities for the MEMS passive shock sensor. It provides a description of past design revisions, including the...

  15. Allen West gets significant support from Indian River County donors

    E-Print Network [OSTI]

    Fernandez, Eduardo

    Executive Committee chairman. Indian River's haul for West tops the $13,260 that Democratic-leaning St campaign has cost almost $8 million. John Brehmer, a retired Illinois manufacturing director who moved

  16. Updated 4/27/2015 Allen County Community College

    E-Print Network [OSTI]

    ECONOMICS- Choose one Core ECON 142 Princ of Microeconomics 3 ECO 207 Microeconomics 3 GE3S ECON 144 Princ Cultural Anthropology 3 ANT 111 Cultural Anthropology 3 GEOG 100 World Regional Geography 3 GEO 104 Princ

  17. Updated April 27, 2015 Allen County Community College

    E-Print Network [OSTI]

    Sciences GE3N BIOL 100 Princ of Biology 3 BIO 102 Princ of Biology 5 BIOL 150 Princ of Cell and Mole Biology 5 BIO 150 Biology 5 BIOL 152 Princ of Organismal Biology 5 BIO 210 Biology 2 5 CHEM 110 College

  18. March 6 and 7, 2015 Allen Building, Room 1002

    E-Print Network [OSTI]

    Bermúdez, José Luis

    Wolfram (Berkeley) "Using Randomized Encouragement Design Approaches to Analyze Energy Programs" 4:15 Iwan:00 ADJOURN 6:00 Dinner Saturday, March 7 8:00 Breakfast 8:30 John Horton (New York University) "Price Floors Puller (Texas A&M University) "Information Intervention and Energy Policy" 11:45 Lunch #12;

  19. Van Allen probes pinpoint driver of speeding electrons

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -Using supercritical carbonValgrindandValuationVan

  20. Mysterious electron stash found hidden among Van Allen belts

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStressMoveMuncrief Ames019 For moreMy FirstMyVan

  1. Josh Allen of Richland Operations Office Named 2014 Facility Representative

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergy CopyrightsRoomRussianJonathan Male -of the Year |

  2. McAllen, TX Natural Gas Exports to Mexico

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr 2012DecadeTotal Consumptionper ThousandCubicYear Jan

  3. McAllen, TX Natural Gas Exports to Mexico

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr 2012DecadeTotal Consumptionper ThousandCubicYear

  4. 2013 Federal Energy and Water Management Award Winner Jeff Allen |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing ToolInternationalReport FY2014ConferenceofEnergy Oak2013 EIADepartment of Energy

  5. Allen County, Kansas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > All ByNewInformation

  6. Allen County, Kentucky: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > All

  7. Allen County, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > AllOhio ASHRAE 169-2006 Climate

  8. Allen Parish, Louisiana: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolarOpen5All Home > AllOhio ASHRAE 169-2006Parish,

  9. Booz Allen Hamilton Response to Department of Energy Request for

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De pEnergy Industrial LocalAprilstaff

  10. James Allen | Center for Bio-Inspired Solar Fuel Production

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenryInhibitingInteractivePGASelectron tomographyJacquelineAna Moore

  11. University of Alberta Library Release Form

    E-Print Network [OSTI]

    Amaral, José Nelson

    University of Alberta Library Release Form Name of Author: Shane Allen Brewer Title of Thesis: 2010 Permission is hereby granted to the University of Alberta Library to reproduce single copies Allen Brewer Box 1764 Camrose, Alberta Canada, T4V 1X7 Date: #12;I can do everything through him who

  12. Balancing Water Projects and Wildlife: New Authority for the California Water Resources Control Board

    E-Print Network [OSTI]

    Gawthrop, Janet

    1986-01-01

    both environmental control and water use, the Board stillattorneys for the Water Resources Control Board describedWater Resources Control Board (Water Board) the authority to

  13. Author's personal copy Distributed hydrogen production from ethanol in a microfuel processor

    E-Print Network [OSTI]

    Khandekar, Sameer

    Author's personal copy Distributed hydrogen production from ethanol in a microfuel processor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 525 2. Methods of hydrogen production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 525 2.4. Bio-hydrogen

  14. Existing Homes Retrofit Case Study: Yakama Nation Housing Authority, Wapato, WA

    SciTech Connect (OSTI)

    2009-09-01

    This is a Building America fact sheet describing the Yakama Nation Housing Authority's retrofit of 25 homes on the reservation to make them more energy efficient.

  15. THE UNIVERSITY OF TEXAS HEALTH SCIENCE CENTER AT SAN ANTONIO DIRECT DEPOSIT AUTHORIZATION FORM

    E-Print Network [OSTI]

    Nicholson, Bruce J.

    adopted or amended. If I am currently a UTHSC student, I understand that I am authorizing Student. Department: ____________________________Work Telephone Number: _________________ B. FINANCIAL INSTITUTION

  16. Washington Metropolitan Area Transit Authority: Compressed Natural Gas Transit Bus Evaluation

    SciTech Connect (OSTI)

    Chandler, K.; Eberts, E.; Melendez, M.

    2006-04-01

    Evaluates compressed natural gas (CNG) powered transit buses at Washington Metropolitan Area Transit Authority (WMATA), providing a comparison between them and standard diesel transit buses.

  17. How Do I Get Authorization to Work with Lasers at the ALS?

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    case, the process is usually much simpler. These laser systems will have already had a formal review and authorization Activity Hazard Document (AHD), and the bulk of any...

  18. Puerto Rico Aqueduct and Sewer Authority General Consulting Services and Technical Support

    E-Print Network [OSTI]

    Gilbes, Fernando

    Puerto Rico Aqueduct and Sewer Authority General Consulting Services and Technical Support permitting and environmental compliance related activities on behalf of the Puerto Rico Aqueduct and Sewer and Sewer Authority. Project Manager for two $400,000 Brownfields community-wide redevelopment projects

  19. A Google Scholar gadget for calculating author citations and other statistical information regarding publications. more... Statistics

    E-Print Network [OSTI]

    Sriraman, Bharath

    -Index: 17 scholar.google.com Copyright - Jan Feyereisl (v.1.211) Project Page view publications AuthorA Google Scholar gadget for calculating author citations and other statistical information regarding publications. more... Statistics: Citations for 'Sriraman.B' : 1153 Cited Publications: 100 H

  20. Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING AND AGENDA

    E-Print Network [OSTI]

    Power and Water Resources Pooling Authority NOTICE OF SPECIAL MEETING AND AGENDA Notice is hereby given that a special meeting of the Board of Directors of the Power and Water Resources Pooling Authority (PWRPA) will be held on November 25, 2013 at 10:00 a.m., at the Westlands Water District, 3130

  1. Author's personal copy Progress in Particle and Nuclear Physics 62 (2009) 468472

    E-Print Network [OSTI]

    Bauer, Wolfgang

    2009-01-01

    Author's personal copy Progress in Particle and Nuclear Physics 62 (2009) 468­472 Contents lists available at ScienceDirect Progress in Particle and Nuclear Physics journal homepage: www.ppnp.2008.12.035 #12;Author's personal copy T. Strother, W. Bauer / Progress in Particle and Nuclear Physics

  2. Excepted Service Authority for Exceptionally Well Qualified (EWQ) EQ Pay Plan Employees

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-10-21

    To establish requirements and responsibilities for the employment and compensation of individuals when using the following DOE excepted service authority: Section 313 division D of the Consolidated Appropriations Act of 2014 (Public Law 113-76), hereafter referred to as appointment authority EWQ and pay plan EQ.

  3. AUTHORIZATION TO USE AND DISCLOSE PROTECTED HEALTH INFORMATION FOR RESEARCH PURPOSES

    E-Print Network [OSTI]

    Karsai, Istvan

    AUTHORIZATION TO USE AND DISCLOSE PROTECTED HEALTH INFORMATION FOR RESEARCH PURPOSES The privacy health information (protected health information). The privacy law requires me to sign an authorization (or agreement) in order for researchers to be able to use or disclose my protected health information

  4. AUTHORIZATION TO USE OR DISCLOSE HEALTH INFORMATION Patient/Employee Name: ___________________________ Date of Birth: ___________Medical Record #: __________________

    E-Print Network [OSTI]

    New Mexico, University of

    information _____ initial 4. I understand that I have a right to revoke this Authorization at any time. I, I have the right to examine and copy the information to be disclosed. A copy of this signedAUTHORIZATION TO USE OR DISCLOSE HEALTH INFORMATION Patient/Employee Name

  5. Speaker Release and Agreement _______________________ ("Speaker") hereby authorizes New Jersey Institute of Technology

    E-Print Network [OSTI]

    Haimovich, Alexander

    Institute of Technology and its agents, designees or representatives (collectively, "New Jersey Institute: __________________________________________________________________________ Event Location Date Select One: Speaker further authorizes New Jersey Institute of Technology for internal on-campus use only. Speaker further authorizes New Jersey Institute of Technology to broadcast

  6. RHP: HOW CLIMATE MODELS GAIN AND EXERCISE How Climate Models Gain and Exercise Authority

    E-Print Network [OSTI]

    Hulme, Mike

    49 LHP: HULME RHP: HOW CLIMATE MODELS GAIN AND EXERCISE AUTHORITY 2 How Climate Models Gain and Exercise Authority Mike Hulme Introduction Numerical climate models have become central to the unfolding story of climate change. Climate models underpin the knowledge claims and risk assessments

  7. Macaroons: Cookies with Contextual Caveats for Decentralized Authorization in the Cloud

    E-Print Network [OSTI]

    Cortes, Corinna

    Macaroons: Cookies with Contextual Caveats for Decentralized Authorization in the Cloud Arnar,ataly,mvrable,mzero}@google.com Abstract--Controlled sharing is fundamental to distributed systems; yet, on the Web, and in the Cloud introduces macaroons: flexible authorization cre- dentials for Cloud services that support decentralized

  8. Manuscript Preprint "NOTICE: this is the author's version of a work that was accepted for publication in

    E-Print Network [OSTI]

    Berggren, Karl K.

    Massachusetts Avenue, Cambridge, MA 02139. * Corresponding author: berggren@mit.edu Abstract: We demonstrated

  9. A Scalable Approach for the Secure and Authorized Tracking of the Availability of Entities in Distributed Systems

    E-Print Network [OSTI]

    , security and authorization 1. Introduction Over the past decade we have witnessed the proliferation

  10. Grading for 6100 Project Objective Did the authors clearly state their objective? Does the research support this

    E-Print Network [OSTI]

    Allan, Vicki H.

    Grading for 6100 Project Objective Did the authors clearly state their objective? Does the research support this objective? Does the author sell his/her ideas? References Do the authors have cited for the origin of the figure? Creativity Does the project incorporate the authors' own opinions

  11. Pollen Removal and Deposition by Honeybee and Bumblebee Visitors to Apple and Almond Author(s): James D. Thomson and Karen Goodell

    E-Print Network [OSTI]

    Thomson, James D.

    Pollen Removal and Deposition by Honeybee and Bumblebee Visitors to Apple and Almond Flowers Author melliferaand Bombusspp. duringsinglevisitsto fourcultivarsof apples(Golden Delicious, Starkrimson fromappleflowersbutBombus deposited more pollen on stigmas. Pollen-collecting bees removed more pollen from apple

  12. Space-Time Modelling with Long-Memory Dependence: Assessing Ireland's Wind Power Author(s): John Haslett and Adrian E. Raftery

    E-Print Network [OSTI]

    Yandell, Brian S.

    Space-Time Modelling with Long-Memory Dependence: Assessing Ireland's Wind Power Resource Author the long termaverage power output froma wind turbinegenerator at a site forwhich few data on wind speeds and Conditions #12;Appl. Statist.(1989) 38, No. 1, pp. 1-50 Space-timeModellingwithLong-memory Dependence:AssessingIreland'sWind

  13. Authorization and Driving History Form The following information will be retained on file by all agencies on their drivers authorized to operate a

    E-Print Network [OSTI]

    Harms, Kyle E.

    agencies on their drivers authorized to operate a State vehicle, or a private vehicle for state purposes ___________________________________________ Position: Staff_____ Faculty_____ Student_____ Is employee's primary purpose to drive vehicles? Yes_____ No/her private vehicle in the course and scope of employment? Yes_____ No_____ Date of last Driver Training

  14. Plastic Phenotypic Response to Light of 16 Congeneric Shrubs from a Panamanian Rainforest Author(s): Fernando Valladares, S. Joseph Wright, Eloisa Lasso, Kaoru Kitajima, Robert W.

    E-Print Network [OSTI]

    Saleska, Scott

    Plastic Phenotypic Response to Light of 16 Congeneric Shrubs from a Panamanian Rainforest Author, 81(7), 2000, pp. 1925-1936 ? 2000 by the Ecological Society of America PLASTIC PHENOTYPIC RESPONSE of California, Davis, California 95616 USA Abstract. The comparative phenotypic plasticity of 16 species

  15. Resource Utilization and Coexistence of Seed-Eating Desert Rodents in Sand Dune Habitats Author(s): James H. Brown and Gerald A. Lieberman

    E-Print Network [OSTI]

    Brown, James H.

    Resource Utilization and Coexistence of Seed-Eating Desert Rodents in Sand Dune Habitats Author UTILIZATION AND COEXISTENCE OF SEED-EATING DESERT RODENTS IN SAND DUNE HABITATS' JAMES H. BROWN Department how these differences affect the utilization of seeds. Our estimates of total overlap in resource

  16. Distribution of Energy Use and Biomass Among Species of North American Terrestrial Birds Author(s): Brian A. Maurer and James H. Brown

    E-Print Network [OSTI]

    Brown, James H.

    Distribution of Energy Use and Biomass Among Species of North American Terrestrial Birds Author, 69(6), 1988, pp. 1923-1932 ? 1988 by the Ecological Society of America DISTRIBUTION OF ENERGY USE. The distribution of biomass and energy use among species with different body sizes provides an empirical basis

  17. Poison Frog Colors Are Honest Signals of Toxicity, Particularly for Bird Predators. Author(s): Martine E. Maan and Molly E. Cummings

    E-Print Network [OSTI]

    Cummings, Molly E.

    Poison Frog Colors Are Honest Signals of Toxicity, Particularly for Bird Predators. Author://www.jstor.org #12;vol. 179, no. 1 the american naturalist january 2012 E-Article Poison Frog Colors Are Honest-polymorphic strawberry poison frog, Dendrobates pumilio. Using a mouse-based toxicity assay, we find extreme variation

  18. Design and Testing of a Heat Transfer Model of a Raccon (Procyon Lotor) in a Closed Tree Den Author(s): Jeffrey Thorkelson and Robert K. Maxwell

    E-Print Network [OSTI]

    Minnesota, University of

    Design and Testing of a Heat Transfer Model of a Raccon (Procyon Lotor) in a Closed Tree Den Author. http://www.jstor.org #12;Ecology (1974) 55: pp. 29-39 DESIGN AND TESTING OF A HEAT TRANSFER MODEL of Ecology and Behavioral Biology, Universityof Minnesota, St. Paul, Minnesota 55101 Aabstract. A heat

  19. Author Guidelines

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & Inspections Audits & Inspections AuditsAugust 29,

  20. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report:Speeding accessby a contractor ofvarDOE PAGES11 PPPL-Atmospheric

  1. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report:Speeding accessby a contractor ofvarDOE PAGES11

  2. Author Select

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield MunicipalTechnical Report: Achievements of structural genomicsOffice of ScientificArthur

  3. Author Guidelines

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of raregovAboutRecovery ActTools to someoneAstrophysics &Aurora Home

  4. Title Author

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S.Week DayDr.Theories81 to 1990 Timeline2 Hewlett-PackardNext

  5. Copyright and Publishing Literacy for ETD Authors: Applying the Theft of the Mind Model 

    E-Print Network [OSTI]

    Clement, Gail; Bianchi, Jo Ann

    2013-02-28

    Thanks to a fruitful collaboration between the Scholarly Communication office in the University Libraries, and the Thesis Office in the Graduate School, ETD authors and their faculty advisers at Texas A&M University now enhance their understanding...

  6. Secure multi-party communication with quantum key distribution managed by trusted authority

    DOE Patents [OSTI]

    Nordholt, Jane Elizabeth; Hughes, Richard John; Peterson, Charles Glen

    2013-07-09

    Techniques and tools for implementing protocols for secure multi-party communication after quantum key distribution ("QKD") are described herein. In example implementations, a trusted authority facilitates secure communication between multiple user devices. The trusted authority distributes different quantum keys by QKD under trust relationships with different users. The trusted authority determines combination keys using the quantum keys and makes the combination keys available for distribution (e.g., for non-secret distribution over a public channel). The combination keys facilitate secure communication between two user devices even in the absence of QKD between the two user devices. With the protocols, benefits of QKD are extended to multi-party communication scenarios. In addition, the protocols can retain benefit of QKD even when a trusted authority is offline or a large group seeks to establish secure communication within the group.

  7. Paying for transit operations : challenges and solutions for the Chicago Transit Authority

    E-Print Network [OSTI]

    Kirschbaum, Julie B

    2004-01-01

    This research identifies the challenges Chicagoland must confront to maintain a quality transit system. It analyzes the organizational and funding structure of the Regional Transportation Authority and its three service ...

  8. VOL. 14 NO. 1, MARCH, 2009 Contents | Author index | Subject index | Search | Home

    E-Print Network [OSTI]

    Antunes, Pedro

    VOL. 14 NO. 1, MARCH, 2009 Contents | Author index | Subject index | Search | Home Evaluating and their performance compared. Results. The method contributes to formative evaluation regarding the manipulation management, connected and disconnected modes, and other aspects. This concealment challenges groupware

  9. Author's personal copy Thorium-234 as a tracer of spatial, temporal and vertical variability

    E-Print Network [OSTI]

    Buesseler, Ken

    Author's personal copy Thorium-234 as a tracer of spatial, temporal and vertical variability 2009 Accepted 6 April 2009 Available online 16 April 2009 Keywords: Thorium-234 Particle flux Sediment

  10. East Tennessee State University Employee Payroll Deduction Authorization and Gift/Pledge Form

    E-Print Network [OSTI]

    Karsai, Istvan

    : ___________________________________________________ E#: _____________________________ Department: _____________________________________________ ETSU P-mail: _____________________________________@etsu.edu Spouse/Partner Name: ___________________________________Employer deductions. I hereby authorize the ETSU Foundation to deduct from my paycheck each month the amount

  11. North Carolina DOT's Experience with Fiber Reinforced Polymers Authors: Rodger D. Rochelle

    E-Print Network [OSTI]

    North Carolina DOT's Experience with Fiber Reinforced Polymers Authors: Rodger D. Rochelle Gichuru Muchane Sami H. Rizkalla Janos Gergely #12;ABSTRACT This paper discusses North Carolina Department Research Engineer, Research and Development Unit, North Carolina Department of Transportation, 1549 Mail

  12. Author's personal copy Mesoscale modeling of electric double layer capacitors with three-dimensional

    E-Print Network [OSTI]

    Pilon, Laurent

    Author's personal copy Mesoscale modeling of electric double layer capacitors with three Mesoscale modeling Mesoporous electrodes a b s t r a c t This paper presents general mathematical

  13. DOE Makes Filing with NRC in Support OF Authority to Withdraw Yucca Application

    Broader source: Energy.gov [DOE]

    DOE today urged the NRC to conclude that DOE has the legal authority to withdraw the pending Yucca Mountain license application.  DOE argued that the NRC should review and reverse the contrary...

  14. Networks: Contribution to the Encyclopedia of Science, Technology, and Author: Anna Nagurney

    E-Print Network [OSTI]

    Nagurney, Anna

    Networks: Contribution to the Encyclopedia of Science, Technology, and Ethics Author: Anna Nagurney our business today. Communication networks enable the transmission of voice, data, information, and transportation and communication networks. Transportation networks provide us with the means of crossing physical

  15. ENTRY ARTIFICIAL INTELLIGENCE [ENTRY ARTIFICIAL INTELLIGENCE] Authors: Oliver Knill: March 2000 Literature: Peter Norvig,

    E-Print Network [OSTI]

    Knill, Oliver

    ENTRY ARTIFICIAL INTELLIGENCE [ENTRY ARTIFICIAL INTELLIGENCE] Authors: Oliver Knill: March 2000 Literature: Peter Norvig, Paradigns of Artificial Intelligence Programming Daniel Juravsky and James Martin interface to a neural net simulator. artificial intelligence [artificial intelligence] (AI) is a field

  16. WiPrint: 3D Printing Your Wireless Coverage Author: Justin Chan

    E-Print Network [OSTI]

    WiPrint: 3D Printing Your Wireless Coverage Author: Justin Chan Advisor: Xia Zhou Dartmouth WiPrint, a novel approach to customiz- ing wireless signal maps using 3D printed glossy reflectors

  17. Applications for Change or Transfer of Control of Authorizations to Import or Export Natural Gas

    Broader source: Energy.gov [DOE]

    Applicants for authorization to import or export natural gas, including liquefied natural gas (LNG), apply on behalf of a given entity, whose corporate structure and place of business is detailed...

  18. *Corresponding author. Tel.: #1-612-626-7781; fax: #1-612-625-4583.

    E-Print Network [OSTI]

    Giannakis, Georgios

    , the present bibli- ography includes most of the references which have appeared in the period 1979 in this bibli- ography. Finally, the authors would like to thank Professor Martin Schetzen, Northeastern Univer

  19. Author's personal copy Unified behaviour of maximum soot yields of methane, ethane and propane

    E-Print Network [OSTI]

    Gülder, Ömer L.

    Author's personal copy Unified behaviour of maximum soot yields of methane, ethane and propane the current study and the previous measurements in similar flames with methane, ethane, and propane flames

  20. The completion of Edwin Drood: endings and authority in finished and unfinished narratives 

    E-Print Network [OSTI]

    Hoel, Camilla Ulleland

    2012-11-27

    Through an analysis of the reception of Charles Dickens’ unfinished The Mystery of Edwin Drood this thesis establishes the centrality of the figure of the author as the perceived sanction for the completed text. Through ...

  1. Procedia Engineering 59 (2013) 183 192 1877-7058 2013 The Authors. Published by Elsevier Ltd.

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    2013-01-01

    . In this paper, novel computer aided algorithms and methods are developed for 3D printing of scaffold structures with `Cake' and `Zigzag' patterns are developed and 3D printed. © 2013 The Authors. Published

  2. How regional authorities can achieve economic development through investments in the logistics sector

    E-Print Network [OSTI]

    Khan, Taimur, 1973-

    2004-01-01

    Lessons for how a regional authority should develop its logistics sector are learned through case studies on four areas (section 2). In addition, a "logistics attractiveness" ranking framework is developed and applied ...

  3. A Case Study of the Defense Support of Civil Authorities Program 

    E-Print Network [OSTI]

    Johnston, Suzanne 1963-

    2013-01-04

    The intent of this record of study is to examine the effectiveness of the Defense Support of Civil Authorities program through the theoretical lens of adult learning. The study explores the program graduates’ individual and organizational attempts...

  4. Responsible Mothers and Well Born Children: Social Authorities and the Discourses of Nineteenth Century Pregnancy

    E-Print Network [OSTI]

    Barnes-Brus, Tori

    2011-02-04

    During the late nineteenth century, issues of pregnancy and reproduction were deeply political. Competing authorities converged and diverged in the ways they presented their messages regarding women's "proper place" and ...

  5. Copyright (C) 2012 by the author. All rights reserved. TEACHING AND ASSESSMENT OF MATHEMATICAL

    E-Print Network [OSTI]

    Hallstrom, Jason

    Copyright (C) 2012 by the author. All rights reserved. TEACHING AND ASSESSMENT OF MATHEMATICAL, and Pradip Srimani for their comments on topics of this dissertation. Thanks also to all the educators who

  6. NMAC 19.14.55 Certificate of Compliance and Authorization to...

    Open Energy Info (EERE)

    for a Certificate of Compliance and Authorization to Produce Geothermal Resources in New Mexico. Published NA Year Signed or Took Effect 1983 Legal Citation NMAC 19.14.55 DOI Not...

  7. Effects of a Legitimate Authority's Justification of Inequality on the Mobilization of Revolutionary Coalitions 

    E-Print Network [OSTI]

    Linewebber, David; Barr-Bryan, Dorine; Zelditch, Morris Jr

    2015-08-15

    The authors explore revolutionary coalition formation in equitable situations. They posited that actors would form such coalitions if the equitable relations were threatened. Results of an experimental test of that idea were not confirmatory...

  8. Author's personal copy Beryllium-10 terrestrial cosmogenic nuclide surface exposure dating of Quaternary

    E-Print Network [OSTI]

    Frankel, Kurt L.

    Author's personal copy Beryllium-10 terrestrial cosmogenic nuclide surface exposure dating Terrestrial cosmogenic nuclides Optically stimulated luminescence Alluvial fans Shore lines Lake Manly nuclide (TCN) surface exposure methods in Death Valley. The 10 Be TCN ages show considerable variance

  9. Tracking and evaluating economic self-sufficiency programs in moving to work housing authorities

    E-Print Network [OSTI]

    Evans, Kathleen Nessa

    2012-01-01

    This thesis investigates the measurement and evaluation of economic self-sufficiency programs at the Cambridge Housing Authority (CHA). CHA has established a reputation as a leading innovator and implementer, but the agency ...

  10. Listing of DOE/FE Authorizations/Orders Issued in 2015

    Broader source: Energy.gov [DOE]

    The following chart contains all Orders issued by the Office of Natural Gas Regulatory Activities in 2015 thru November 25th. The orders include all new or renewed authority to Import and Export...

  11. Author's personal copy Initial anisotropy in demineralized bovine cortical bone in compressive

    E-Print Network [OSTI]

    McKittrick, Joanna

    Author's personal copy Initial anisotropy in demineralized bovine cortical bone in compressive Cortical bone Cyclic compression Demineralization The mechanical properties of demineralized bovine and transverse directions. The bone was demineralized by 10% ethylenediaminetetraacetic acid (EDTA) (100% protein

  12. Towards a deployable framework for delegation of authority in network applications

    E-Print Network [OSTI]

    Stockwell, Will (Will C.)

    2006-01-01

    The Delegation Framework is a collection of programs, network protocols and library interfaces that provide fine-grained delegation of authority to network systems. The design and implementation of the Delegation Framework ...

  13. *Corresponding Author email: sourabh.k.saha@gmail.com Genetic algorithm based optimization and post

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    *Corresponding Author email: sourabh.k.saha@gmail.com Genetic algorithm based optimization and post optimality analysis of multi-pass face milling Sourabh K. Saha* Department of Mechanical Engineering IIT

  14. EM Renews Information-Sharing Agreement with United Kingdom's Nuclear Decommissioning Authority

    Broader source: Energy.gov [DOE]

    PHOENIX – EM’s top official this week renewed an agreement between DOE and the U.K.’s Nuclear Decommissioning Authority (NDA) that expands the scope of their information sharing.

  15. Excepted Service Authority for Exceptionally Well Qualified (EWQ) EQ Pay Plan Employees

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-03-10

    The order establishes requirements and responsibilities for the employment and compensation of individuals using Section 313 division D of the Consolidated Appropriations Act of 2014 (Public Law 113-76). Does not cancel other directives. The page change allows more efficient and effective management of the EWQ authority. The revisions delegate authorities for certain personnel actions that previously required approval from the Executive Resources Board (ERB) and/or Senior Management Review Board (SMRB) directly to the Head of the Departmental Element.

  16. DRAFT - DOE O 329.1A, Excepted Service Authorities for EJ and EK Pay Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    To establish requirements and responsibilities for the employment and compensation of individuals when using the following DOE excepted service authority: a. Section 621(d) of the DOE Organization Act (42 United States Code (U.S.C.), section 7231(d), hereafter referred to as pay plan EJ. b. Section 3161(a) of the National Defense Authorization Act for Fiscal Year 1995 (Public Law 103-337, October 5, 1994) and renewals, hereafter referred to as pay plan EK.

  17. Sandia Energy - EC Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    581 times Category Energy Security, Energy Storage, Energy Surety, Energy Surety Microgrid, Fact Sheet report-id SAND-2012-0552P author Mark Allen year 2012 Sandia's Smart...

  18. Copyright 2011 by the author(s). Published here under license by the Resilience Alliance. Van der Leeuw, S., R. Costanza, S. Aulenbach, S. Brewer, M. Burek, S. Cornell, C. Crumley, J. A.

    E-Print Network [OSTI]

    Vermont, University of

    Copyright © 2011 by the author(s). Published here under license by the Resilience Alliance. Van der dependent on a limited resource, global climate disruption, and the opening up of the Arctic to further oil

  19. Public Service Commission Authorization to Utilize an Alternative Method of Cost Recovery for Certain Base Load Generation (Mississippi)

    Broader source: Energy.gov [DOE]

    The Senate Bill 2793 authorizes the Public Service Commission (PSC) to utilize an alternative cost recovery for certain base load generation. The PSC is authorized to include in an electric...

  20. Morris County Improvement Authority, Morris County, New Jersey Renewable Energy Initiative

    SciTech Connect (OSTI)

    Bonanni, John Chair, Morris County Improvement Authority

    2013-05-01

    The Morris County Improvement Authority (?Authority?), a public body corporate and politic of the State of New Jersey and created and controlled by the County, at the direction of the County and through the Program guaranteed by the County, financed 3.2 MW of solar projects (?Solar Projects?) at fifteen (15) sites for seven (7) local government units (?Local Units?) in and including the County. The Program uses a Power Purchase Agreement (?PPA?) structure, where the Solar Developer constructs, operates and maintains all of the Solar Projects, for the benefit of the Local Units and the Authority, for the maximum State law allowable PPA period of fifteen (15) years. Although all fifteen (15) sites were funded by the Authority, only the Mennen Arena site was considered for the purposes of the required local match funding for this grant. Specifically at the Mennen Arena site, the Authority financed 1.6 MW of solar panels. On October 18, 2013, the DOE Grant was drawn down following completion of the necessary application documents and final execution of an agreement memorializing the contemplated transaction by the Local Units, the County, The Authority and the solar developer. The proceeds of the DOE Grant were then applied to reduce the PPA price to all Local Units across the program and increase the savings from approximately 1/3 to almost half off the existing and forecasted utility pricing over the fifteen (15) year term, without adversely affecting all of the other benefits. With the application of the rate buy down, the price of electricity purchased under the PPA dropped from 10.9 to 7.7 cents/kWh. This made acquisition of renewable energy much more affordable for the Local Units, and it enhanced the success of the program, which will encourage other counties and local units to develop similar programs.

  1. Each subject code is under the specified authority of an identified unit, as identified in the Nomenclature Report. The specified authority may permit the use of a course label under its authority by another unit for a specific course or courses upon agre

    E-Print Network [OSTI]

    Saskatchewan, University of

    Each subject code is under the specified authority of an identified unit, as identified by another unit for a specific course or courses upon agreement by the specified authority, with the secondary unit then having administrative, content and/or resource authority for this specific course

  2. Energy Procedia 37 (2013) 3583 3593 1876-6102 2013 The Authors. Published by Elsevier Ltd.

    E-Print Network [OSTI]

    Devernal, Anne

    2013-01-01

    and the challenge in identifying CO2 leakage from deeper-seated reservoirs. © 2013 The Authors. Published; leakage experiment Carbon Capture and Storage (CCS) sites are often located at depths greater than 800 m-glacial deposits in September 2011. The site was characterized in 2010 through the drilling of an appraisal well

  3. EFFECTIVENESS OF LEAD-LAG PHASING ON PROGRESSION BANDWIDTH Zong Tian (Corresponding Author)

    E-Print Network [OSTI]

    Tian, Zong Z.

    EFFECTIVENESS OF LEAD-LAG PHASING ON PROGRESSION BANDWIDTH Zong Tian (Corresponding Author) Varun of using lead-lag phasing, and 2) the effect of number of signals on progression bandwidth. A computer that lead-lag phasing had a significant advantage over the leading left-turn and lagging left-turn phasing

  4. Author's personal copy The effects of outgassing on the transition between effusive and explosive

    E-Print Network [OSTI]

    Manga, Michael

    Author's personal copy The effects of outgassing on the transition between effusive and explosive 2012 Editor: T. Elliot Keywords: Effusive­explosive transition Conduit Textures Permeability Outgassing a b s t r a c t The eruption style of silicic magmas is affected by the loss of gas (outgassing

  5. Author's personal copy Sensitivity of the Atlantic Ocean circulation to a hydraulic overflow

    E-Print Network [OSTI]

    Levermann, Anders

    Author's personal copy Sensitivity of the Atlantic Ocean circulation to a hydraulic overflow the explicit representation of the overflows using a parameterisation by hydraulic constraints and compare circulation (AMOC) (Redler and Böning, 1997; Kuhlbrodt et al., 2007). The potential energy stored in the dense

  6. Author's personal copy The Lago Cardiel Basin, Argentina (49S): Origin and evolution

    E-Print Network [OSTI]

    Gilli, Adrian

    Author's personal copy The Lago Cardiel Basin, Argentina (49°S): Origin and evolution revealed with an airgun source in the closed lake system of Lago Cardiel, Argentina (49°S). As part of an ongoing study reflection surveys in the closed lake system of Lago Cardiel, Argentina (Fig. 1), with 3.5-kHz and boomer

  7. UNIVERSITY OF CALIFORNIA SAN DIEGO AUTHORIZATION TO APPROVE UNIVERSITY SPONSORED SPECIAL ENTERTAINMENT

    E-Print Network [OSTI]

    California at San Diego, University of

    UNIVERSITY OF CALIFORNIA SAN DIEGO AUTHORIZATION TO APPROVE UNIVERSITY SPONSORED SPECIAL, original will be forwarded to UC San Diego Travel and a copy provided to the department and Policy to UC San Diego Travel. Responsibility: Approval for all special university-sponsored entertainment

  8. Author's personal copy A novel ocean color index to detect oating algae in the global oceans

    E-Print Network [OSTI]

    Meyers, Steven D.

    Author's personal copy A novel ocean color index to detect oating algae in the global oceans December 2008 Received in revised form 15 May 2009 Accepted 23 May 2009 Keywords: Floating Algae Index (FAI Remote sensing Ocean color Climate data record Various types of oating algae have been reported in open

  9. Resources at METU Library Author Year Book Title METU Library Call No.

    E-Print Network [OSTI]

    Hasýrcý, Vasýf

    Resources at METU Library Author Year Book Title METU Library Call No. 1. Buskist, C. J. 2014 40 impact, and future trends LB1738 .T43 2013 3. Hunt, L.& Chalmers,D. (Eds) 2013 University teaching, faculty, trends BF637.C6 .C68 2012 19. Moss, M.H. 2012 Education and its discontents: Teaching

  10. Guest Author Dr. Urs Meier Restoration of a Historic Wooden Bridge

    E-Print Network [OSTI]

    F R p Fiber Reinforced Plastics n er a Guest Author Dr. Urs Meier Restoration of a Historic Wooden of carbon fibre reinforced plastics in resto planks pretensioned transversely. The CrO" girders were strengthonoM using carbon ~bre reinforced ell

  11. Author's personal copy Current status and outlook for silicon-based optical biosensors

    E-Print Network [OSTI]

    Weiss, Sharon

    Author's personal copy Current status and outlook for silicon-based optical biosensors S.M. Weiss a. The advantages of these silicon-based optical biosensors for high sensitivity detection include a low analyte silicon waveguide biosensors. Sections 3 and 4 highlight more conventional silicon photonics technology

  12. LASER TRANSFER DOPING USING AMORPHOUS SILICON Rafel Ferr (Correspondence author)1

    E-Print Network [OSTI]

    LASER TRANSFER DOPING USING AMORPHOUS SILICON Rafel Ferré (Correspondence author)1 , Ralf Gogolin1@isfh.de ABSTRACT: We demonstrate and characterize "Laser Transfer Doping" (LTD) for producing locally doped regions. For this purpose we use nanosecond pulsed laser for transferring phosphorus doped amorphous silicon from a carrier

  13. Energy Procedia 37 (2013) 2212 2223 1876-6102 2013 The Authors. Published by Elsevier Ltd.

    E-Print Network [OSTI]

    2013-01-01

    attractiveness of the PHICCOS feeding system is assessed through calculation of its capital costs and resultingEnergy Procedia 37 (2013) 2212­ 2223 1876-6102 © 2013 The Authors. Published by Elsevier Ltd levelized cost of electricity, relative to competing commercial technologies. The findings of this work show

  14. Test Authorization Form DSS Testing Office 0118 Shoemaker University of Maryland, College Park 20742

    E-Print Network [OSTI]

    Hill, Wendell T.

    Test Authorization Form DSS Testing Office 0118 Shoemaker University of Maryland, College Park) _______________________________________ *** Instructor and Student should decide upon mutually agreeable date and time. Online Test Request (a and signed by instructor or TA. This form must accompany each exam. Test may be faxed (301.314.9478), emailed

  15. Author's personal copy Methane evolution from UV-irradiated spacecraft materials under simulated

    E-Print Network [OSTI]

    Schuerger, Andrew C.

    Author's personal copy Methane evolution from UV-irradiated spacecraft materials under simulated a b s t r a c t Fifteen organic and three inorganic compounds were tested for methane (CH4) evolution methane at the min- imum detection level 0.5 ppm, or above. In contrast, all organic compounds evolved

  16. The CourseMarker CBA System: Improvements over Ceilidh COLIN HIGGINS (CORRESPONDING AUTHOR)

    E-Print Network [OSTI]

    Higgins, Colin

    1 The CourseMarker CBA System: Improvements over Ceilidh COLIN HIGGINS (CORRESPONDING AUTHOR and future directions are discussed. Keywords Free Response Computer Based Assessment (CBA); Automatic historical overview of the CBA systems that have been developed over the last 20 years. The following

  17. Author's personal copy People, oceans and scale: governance, livelihoods and climate

    E-Print Network [OSTI]

    Charles, Anthony

    Author's personal copy People, oceans and scale: governance, livelihoods and climate change­ecological systems perspective. Several key themes are examined: governance and decision-making, livelihoods and well scales, from the local to the global. While much attention in the literature lies on global and large

  18. Author's personal copy C H A P T E R 9

    E-Print Network [OSTI]

    Niu, Fenglin

    Rice University c Carnegie Institute Handbook of Geophysical Exploration: Seismic Exploration, VolumeAuthor's personal copy C H A P T E R 9 ACQUISITION OF CROSSWELL SEISMIC MONITORING DATA Thomas M 176 References 176 1. INTRODUCTION Seismic velocity (both compressional and shear) is a fundamental

  19. Nutr Cancer . Author manuscript Freeze-dried ham promotes azoxymethane-induced mucin-depleted foci

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Nutr Cancer . Author manuscript Page /1 9 Freeze-dried ham promotes azoxymethane-induced mucin and red meat consumption is associated with the risk of colorectal cancer. Meta-analyses have suggested that the risk associated with processed meat is higher. Most processed meats are cured and cooked, which leads

  20. Author's personal copy The behaviors of ferromagnetic nano-particles in and around blood vessels

    E-Print Network [OSTI]

    Rubloff, Gary W.

    Author's personal copy The behaviors of ferromagnetic nano-particles in and around blood vessels Blood vessels Treatment depth Non-dimensional parameters In-vivo experiments a b s t r a c t In magnetic, and the applied magnetic fields. Using physical first-principles and a sophisticated vessel-membrane-tissue (VMT