Sample records for tested bone char

  1. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat 

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    In this study, two mechanical testing procedures were developed to test the strength of cancellous bone from the proximal tibia of the rat, the "punch method" and the "whole slice method". These were used to quantify the effect of ovariectomy on rat...

  2. Methods for testing the strength of cancellous bone and tested method effects on cortical bone in the ovariectomized rat

    E-Print Network [OSTI]

    Ruhmann, Sean Phillip

    1998-01-01T23:59:59.000Z

    of the effect of two testing methods, torsion and three-point bending, on the mechanical strength of the rat femur and the changes in strength due to ovariectomy. From these tests, little change in cortical bone properties for the OVX rats compared to the Sham...

  3. Methods for identifying cancellous bone specimen location and size for the Reduced Platen Compression Test 

    E-Print Network [OSTI]

    Cowen, Kyle Ray

    2013-02-22T23:59:59.000Z

    , and stimuli on the skeleton and its ability to perform these everyday functions. The current state of bone testing is focused on understanding the mechanical properties of bone through use of traditional mechanical testing procedures such as three point...

  4. Adsorption of UCG organics by coal, char, activated char and ash

    SciTech Connect (OSTI)

    Humenick, M.J.; Morgan, J.R.; Nolan, B.T.

    1987-01-01T23:59:59.000Z

    The aqueous adsorption of Underground Coal Gasification (UCG) organics generated during gas production was tested in the laboratory to determine the organic's affinity for surroundings in the region of the burn cavity. Coal from the Rosebud coal mine in Hanna, Wyoming along with char, activated char, and ash were studied during this work. Contaminated ground water was simulated by preparing a solution of Hanna IVB condensate in Hanna ground water. Adsorption isotherm studies and leaching tests were performed at 5 and 22/sup 0/C. Leaching tests using tap water showed that only the char could release organic material to water. The adsorption tests showed that all four types of media could adsorb organics from solution. Measures of organic materials in water included Total Organic Carbon (TOC), phenol, o-cresol, and p+m cresol. The experiments indicated that activated char was the most effective adsorbent, while the others were about equal in effectiveness. Adsorption behavior could be modeled in many instances by the equations of Langmuir and Freundlich. However, not all data taken followed these models.

  5. Investigation of a sulfur reduction technique for mild gasification char

    SciTech Connect (OSTI)

    Knight, R.A.

    1991-01-01T23:59:59.000Z

    The object of this program is to investigate the desulfurization of mild gasification char using hydrogen/methane mixtures in a laboratory-scale experimental study. In the first year of the two- year program, char is being treated with mixtures of H{sub 2} and CH{sub 4} at temperatures of 1100{degrees}C to 1550{degrees}F and pressures of 50 to 100 psig. The effects of temperature, pressure, residence time, gas velocity, and gas composition on sulfur removal and carbon gasification are being determined. The batch experiments are being performed in a nominal 2-inch-ID stainless-steel, batch, fluidized-bed reactor. The char to be desulfurized was produced by the IGT mild gasification process research unit (PRU) in a recently completed DOE/METC-sponsored technology development program. The parent coal was Illinois No. 6 from a preparation plant, and the char from the selected test contains 4.58 wt% sulfur. In the first quarter, we have obtained and prepared a char for the desulfurization tests. Ultimate and proximate analyses were performed on this char, and its pore size distribution and surface area were determined. Also this quarter, the fluidized-bed reactor system was constructed and equipped with high pressure mass flow controllers and a high pressure sintered metal filter to remove fines from the effluent gas stream.

  6. Bench-scale development of mild gasification char desulfurization. Technical report, 1 March--31 May 1994

    SciTech Connect (OSTI)

    Knight, R.A. [Inst. of Gas Technology, Chicago, IL (United States)

    1994-09-01T23:59:59.000Z

    The goal of this project is to scale up a process, developed under a previous ICCI grant, for desulfurization of mild gasification char by treatment with hydrogen-rich process-derived fuel gas at 650--760 C and 7--15 atm. The char can be converted into a low-sulfur metallurgical form coke. In the prior study, IBC-105 coal with 4.0 wt% sulfur was converted to chars with less than 1.0 wt% sulfur in a laboratory-scale batch reactor. The susceptibility of the char to desulfurization was correlated with physicochemical char properties and mild gasification conditions. Acid pretreatment of the coal prior to mild gasification was also shown to significantly enhance subsequent sulfur removal. In this study, IGT is conducting continuous bench-scale tests in a 1-lb/h fluidized-bed reactor to determine the preferred process conditions and obtain steady-state data necessary for process design and scale-up. The desulfurized chars are to be used to produce low-sulfur form coke, which will be evaluated for density, reactivity, and strength properties relevant to utilization in blast furnaces. This quarter, 2,500 g of mild gasification char was produced from untreated IBC-105 coal in the bench-scale reactor. Half of this char will be subjected to sulfuric acid treatment to enhance subsequent desulfurization. Char-producing runs were also initiated with acid-pretreated coal, which will produce about 1,250 g of char.

  7. The effect of 150?m expandable graphite on char expansion of intumescent fire retardant coating

    SciTech Connect (OSTI)

    Ullah, Sami, E-mail: samichemist1@gmail.com; Shariff, A. M., E-mail: azmish@petronas.com.my, E-mail: azmibustam@petronas.com.my; Bustam, M. A., E-mail: azmish@petronas.com.my, E-mail: azmibustam@petronas.com.my [Research Center for Carbon Dioxide Capture, Department of Chemical Engineering, Universiti Techologi PETRONAS, Bandar Sri Iskandar, Tronoh 31750 Perak (Malaysia); Ahmad, Faiz, E-mail: faizahmadster@gmail.com [Department of Mechanical Engineering, Universiti Techologi PETRONAS, Bandar Sri Iskandar, Tronoh 31750 Perak (Malaysia)

    2014-10-24T23:59:59.000Z

    Intumescent is defined as the swelling of certain substances to insulate the underlying substrate when they are heated. In this research work the effect of 150?m expandable graphite (EG) was studied on char expansion, char morphology and char composition of intumescent coating formulations (ICFs). To study the expansion and thermal properties of the coating, nine different formulations were prepared. The coatings were tested at 500 °C for one hour and physically were found very stable and well bound with the steel substrate. The morphology was studied by Scanning Electron Microscopy (SEM). The char composition was analysed by X-ray Diffraction (XRD) and Fourier transform infrared spectroscopy (FTIR) techniques. EG above than 10.8wt% expands the char abruptly with uniform network structure and affect the outer surface of the char.

  8. Char binder for fluidized beds

    DOE Patents [OSTI]

    Borio, Richard W. (Somers, CT); Accortt, Joseph I. (Simsbury, CT)

    1981-01-01T23:59:59.000Z

    An arrangement that utilizes agglomerating coal as a binder to bond coal fines and recycled char into an agglomerate mass that will have suitable retention time when introduced into a fluidized bed 14 for combustion. The simultaneous use of coal for a primary fuel and as a binder effects significant savings in the elimination of non-essential materials and processing steps.

  9. Modeling of NO{sub x} release from a single coal particle. 2: Formation of NO from char-nitrogen

    SciTech Connect (OSTI)

    Visona, S.P.; Stanmore, B.R. [Univ. of Queensland, Brisbane, Queensland (Australia)] [Univ. of Queensland, Brisbane, Queensland (Australia)

    1996-08-01T23:59:59.000Z

    Computational modeling has been carried out to study the formation of nitric oxide during the combustion of a single spherical char particle. Combustion conditions are representative of pulverized coal in the temperature range 1,250 to 1,750 K. The model is a generalized mechanistic model with nitric oxide or HCN being released directly from the char N. Homogeneous gas-phase reactions of NO occur within the particle, as well as heterogeneous NO reduction on the char`s surface. Intrinsic rate kinetics are used to model the char combustion, while the NO reduction kinetics are chosen from the literature. The model was tested against experimental results for coal chars found in the literature and the authors` own work with petroleum coke. Modeling suggests that two mechanisms are possible for the conversion of char N to NO at high temperatures: char N goes completely to NO and is subsequently reduced on the char`s surface; or char N goes completely to HCN and is oxidized and reduced in the atmosphere external to the particle. Both approaches produce realistic results when applied to a laminar flow computational fluid flow/heat transfer model of a drop tube furnace. The model describes NO formation at high temperatures and does not consider N{sub 2}O reactions which are important at fluidized bed temperatures.

  10. Longitudinal ultrasound measurement of the equine third metacarpal bone as a predictor of mechanical testing properties 

    E-Print Network [OSTI]

    Dyer, Stephanie Ann

    1999-01-01T23:59:59.000Z

    diagnostic technique to identify the onset of bucked shins. The purpose of this study was to determine if the longitudinal speed of sound as measured by Soundscan 2000[] was an appropriate predictor of bone strength characterized by mechanical testing...

  11. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck 

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ESTIMATING CANCELLOIJS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1998 Major Subject: Mechanical Engineering ESTIMATING CANCELLOUS BONE PROPERTIES OF THE RAT FROM MECHANICAL TESTING OF THE FEMORAL NECK A Thesis by JENNIFER ANN GROVES Submitted to Texas Ai8:M University...

  12. Combustion properties of coal-char blends: NO{sub x} emission characteristics. [Quarterly] technical report, March 1, 1993--May 31, 1993

    SciTech Connect (OSTI)

    Rostam-Abadi, M.; Khan, L.; Khan, S. [Illinois State Geological Survey, Champaign, IL (United States); Smoot, L.D.; Germane, G.J.; Eatough, C.N. [Brigham Young Univ., Provo, UT (United States). Advanced Combustion Engineering Research Center

    1993-09-01T23:59:59.000Z

    Tests under pulverized coal combustion conditions suggest that NO{sub x} formed during release of volatile matter far exceed NO{sub x} formed during combustion of the resulting char. This is attributed to char/NO{sub x} interactions by both direct reduction of NO{sub x} by carbon and char-catalyzed reduction by CO. This implies combustion of char not only produces substantially lower NO{sub x} but the presence of char in the flame during initial stages of combustion may potentially provide catalytic activity for reduction of NO{sub x} produced from volatile nitrogen. The goal of the project is to determine if the concept of NO{sub x} reduction by char/NO{sub x} interactions, while maintaining a high combustion efficiency by co-firing coal with char, is a technically feasible way to reduce NO{sub x}, emissions. The project will provide important combustion data required to establish the feasibility of utilizing chars in industrial combustion applications and the advantages of burning coal-char blends in reducing NO{sub x} and SO{sub 2} emissions. During the reporting period, 19 runs were made with a continuous feed charring oven (CFCO) to produce 237 pounds of char(about 16%vm) required for preparing coal-char blends.

  13. Integrated methods for production of clean char and its combustion properties. Technical report, December 1, 1991--February 29, 1992

    SciTech Connect (OSTI)

    DeBarr, J.A.; Rostam-Abadi, M. [Illinois State Geological Survey, Champaign, IL (United States); Gullett, B.K. [Environmental Protection Agency, Research Triangle, NC (United States); Benson, S.A.; Toman, D.L. [Univ. of North Dakota Energy and Environmental Research Center, Grand Forks (United States)

    1992-08-01T23:59:59.000Z

    The overall objective of this two-year program is to produce low sulfur char using an integrated process scheme which combines physical coal cleaning, mild gasification and char desulfurization. The goal of the project is to produce chars with 50% or more lower sulfur emissions than that of the parent coal, and at minimum meet 1995 emission standards of 2.5 lbs S0{sub 2}/MMBtu. This project is a cooperative effort between the ISGS, UNDEERC and the US EPA and is cost-shared with the US EPA and the US DOE through UNDEERC. Mild gasification and char desulfurization studies are conducted with six coals selected from the Illinois Basin Coal (IBC) Sample Program in a batch fluidized-bed reactor at the ISGS. Pound quantities of chars for combustion testing are prepared in a continuous rotary kiln reactor under optimized conditions of mild gasification and char desulfurization. Burning characteristics and ash deposition behaviors of desulfurized chars are determined at the US EPA in a 14 kill pilot-scale combustor and at UNDEERC in a drop tube furnace (DTF). In some tests, methane is examined as an auxiliary fuel, and high-surface-area hydrated lime developed at ISGS is used to further reduce S0{sub 2} emissions. Complete analyses of the fuels are obtained to aid char desulfurization studies and help explain combustion and S0{sub 2} emission characteristics of the char.

  14. Joint inversion of electrical and seismic data for Fracture char...

    Broader source: Energy.gov (indexed) [DOE]

    Joint inversion of electrical and seismic data for Fracture char. and Imaging of Fluid Flow in Geothermal Systems Joint inversion of electrical and seismic data for Fracture char....

  15. Char reactions during kraft black liquor pyrolysis

    SciTech Connect (OSTI)

    Frederick, W.J.; Sricharoenchaikul, V.; Reis, V.V. [Oregon State Univ., Corvallis, OR (United States)

    1995-12-01T23:59:59.000Z

    The pyrolysis characteristics of dried black liquor particles were investigated at high heating rates in a laminar entrained-flow reactor at temperatures of 600-1100{degrees}C. Primary pyrolysis of the organic fraction occurred very rapidly, in less 0.5 seconds. Char yields at the end or volatiles evolution were 58-72%. The decreased with increasing reactor temperature to 900{degrees}C but remained constant at higher temperatures. 35-65% of the fuel nitrogen was volatilized, nearly all in less than 0.5 s. Relatively little fuel nitrogen was evolved from the char. Significant alkali metal chloride volatization from the char occurred at all temperatures, while additional sodium volatilization became important above 900{degrees}C. Reduction of sulfur species in the char increased rapidly with increasing temperature. A temperature-dependent delay time in the onset of Na{sub 2}S formation was observed.

  16. Investigation of Celotex trademark charring depths in the DT-18 shipping container

    SciTech Connect (OSTI)

    Anderson, J.C.

    1992-03-01T23:59:59.000Z

    Celotex {trademark}, the insulating material used between the outer and inner containers of the DT-18 shipping package, undergoes decomposition, combustion, or both when heated to temperatures exceeding 150{degrees}C. Several DT-18 packages that had previously undergone hypothetical thermal accident testing were opened and Celotex {trademark} charring depths ranging from {1/2} to 1 {1/2} in. were recorded. The majority of char depth data taken was between 3/4 and 1 {1/4} in. One-dimensional HEATING 7.1 models of the DT-18 package were developed. HEATING predicts charring depths of 1 to 1 1/8 in., which are in good agreement with measured values. Both experimental and analytical data indicate that charring is fairly uniform over the DT-18 package. 7 refs.

  17. Investigation of Celotex{trademark} charring depths in the DT-18 shipping container

    SciTech Connect (OSTI)

    Anderson, J.C.

    1992-03-01T23:59:59.000Z

    Celotex {trademark}, the insulating material used between the outer and inner containers of the DT-18 shipping package, undergoes decomposition, combustion, or both when heated to temperatures exceeding 150{degrees}C. Several DT-18 packages that had previously undergone hypothetical thermal accident testing were opened and Celotex {trademark} charring depths ranging from {1/2} to 1 {1/2} in. were recorded. The majority of char depth data taken was between 3/4 and 1 {1/4} in. One-dimensional HEATING 7.1 models of the DT-18 package were developed. HEATING predicts charring depths of 1 to 1 1/8 in., which are in good agreement with measured values. Both experimental and analytical data indicate that charring is fairly uniform over the DT-18 package. 7 refs.

  18. Integrated methods for production of clean char and its combustion properties. [Quarterly] report, March 1, 1992--May 31, 1992

    SciTech Connect (OSTI)

    DeBarr, J.A.; Rostam-Abadi, M. [Illinois State Geological Survey, Champaign, IL (United States); Gullett, B.K. [Environmental Protection Agency, Research Triangle Park, NC (United States); Benson, S.A.; Toman, D.L. [North Dakota Univ., Grand Forks, ND (United States). Energy and Environmental Research Center

    1992-10-01T23:59:59.000Z

    The objective of this program is to produce chars with SO{sub 2} emissions at least 50% lower than those of the parent coals, and which at minimum meet the year 1995 emission standard of 2.5 lbs SO{sub 2}/MMBtu. This will be accomplished using an integrated process which combines physical coal cleaning, mild gasification and char desulfurization. This project is a cooperative effort between the ISGS, UNDEERC and the US EPA and is cost-shared with the US EPA and the US DOE through UNDEERC. Mild gasification and char desulfurization studies are conducted in a batch fluidized-bed reactor and a continuous rotary kiln reactor using six coals selected from the Illinois Basin Coal (IBC) Sample Program. Burning characteristics and ash deposition behaviors of desulfurized chars are determined at the US EPA in a 14 kill pilot-scale combustor and at UNDEERC in a drop tube furnace (DTF). Complete analyses of the fuels are obtained to aid char desulfurization studies and help explain combustion and SO{sub 2} emission characteristics of the chars. During this reporting period, preliminary low temperature oxidation (LTO) studies were conducted to desulfurize chars derived from mild gasification. Under non-optimized conditions, SO{sub 2} emissions (lbs SO{sub 2}/MMBtu) of the six coals were reduced over 60%. Physical coal cleaning, mild gasification and char desulfurization reduced the SO{sub 2} emissions of two of the coals nearly 70%. Chars prepared from four of the six coals tested had SO{sub 2} emissions of less than 2.5 lbs SO{sub 2}/MMBtu. The average yield of low sulfur char obtained after pyrolysis and LTO was nearly 64% by weight of the original coal. Thermogravimetric (TG) experiments showed that LTO chars are easier to burn than mild gasification chars, due to an increase in surface areas of desulfurized chars during oxygen treatment. Surface areas measured by nitrogen adsorption were 126 to 234 m{sup 2}/g for LTO chars and <5 m{sup 2}/g for mild gasification chars.

  19. Characterization of chars from coal-tire copyrolysis

    SciTech Connect (OSTI)

    Mastral, A.M.; Callen, M.S.; Murillo, R. [CSIC, Zaragoza (Spain). Inst. de Carboquimica] [CSIC, Zaragoza (Spain). Inst. de Carboquimica; Alvarez, R.; Clemente, C. [UM, Madrid (Spain). ETS de Ingenieros de Minas] [UM, Madrid (Spain). ETS de Ingenieros de Minas

    1999-07-01T23:59:59.000Z

    The objective of this work is the characterization of the solid conversion product from coal-tire copyrolysis because, nowadays, any new process should be faced without resolving the problem of the subproducts generated. A low-rank coal and a nonspecific mixture of scrap automotive tires, 50/50 w/w, have been coprocessed at 400 C for 30 min at different H{sub 2} pressures and atmospheres. Once the most valuable conversion products, the liquids, were recovered by tetrahydrofuran extraction, a complementary battery of analytical techniques was applied to characterize the solids or chars, looking for their possible use. {sup 13}C nuclear magnetic resonance, infrared, immediate and ultimate analyses, ASA, and scanning electron microscopy-energy-dispersive X-ray spectrometry were performed on them. By X-ray diffractometry the presence of sphalerite, pyrrhotite, and anhydrite was detected. Thermogravimetric studies demonstrated that the combustion induction temperature is 400 C. Char combustion tests at 900 C with discussion of NO{sub x}, SO{sub x}, and polycyclic aromatic hydrocarbon emissions are included. Mineral matter behaves as if only coal is processed with the Zn exception, from ZnO in the tire, which is converted into ZnS. It is shown that the char organic component has a higher aromaticity than the one from coal.

  20. Integrated methods for production of clean char and its combustion properties

    SciTech Connect (OSTI)

    DeBarr, J.A.

    1991-01-01T23:59:59.000Z

    The overall objective of this two-year program is to produce clean char using an integrated process scheme which combines physical coal cleaning, mild gasification and char oxydesulfurization. Low sulfur chars which could be used in utility boilers to meet 1995 emission standards of 2.5 lbs DO{sub 2}/MMBtu are produced from Illinois coals having emissions of >5 lbs SO{sub 2}/MMBtu. Mild gasification and low temperature oxidation studies for sulfur removal are conducted with selected coals from the Illinois Basin Coal (IBC) Sample Program in a batch fixed-bed reactor at the ISGS. Pound quantities of chars for combustion testing are prepared in a continuous rotary kiln reactor under optimized conditions of mild gasification and oxydesulfurization. Burning characteristics and ash deposition behaviors of desulfurized chars are determined to ensure that a useable fuel is produced. These tests are done at the University of North Dakota Energy and Environmental Research Center (UNDEERC) in a drop tube furnace (DTF), and at the US EPA in a 14 kW pilot-scale combustor. In some tests, methane is examined as an auxiliary fuel, and high-surface-area hydrated lime developed at ISGS is used to further reduce SO{sub 2} emissions. Complete analyses of the fuels are obtained to aid char desulfurization studies and help explain combustion and SO{sub 2} emission characteristics of the char. This project is a cooperative effort between the ISGS, UNDEERC and the US EPA and is cost-shared with US EPA and the US DOE through UNDEERC.

  1. Gasification and combustion modeling for porous char particles

    E-Print Network [OSTI]

    Singer, Simcha Lev

    2012-01-01T23:59:59.000Z

    Gasification and combustion of porous char particles occurs in many industrial applications. Reactor-scale outputs of importance depend critically on processes that occur at the particle-scale. Because char particles often ...

  2. Utilization of char from biomass gasification in catalytic applications

    E-Print Network [OSTI]

    temperature or time. In addition, micropores were observed in char that was made in CO2, but not in char, but sintering was not observed during gasification with CO2. This showed that the properties of char depend catalytically or thermally. However, thermal decomposition requires high temperatures, and catalyst deactivation

  3. Characterizing and modeling combustion of mild-gasification chars in pressurized fluidized beds

    SciTech Connect (OSTI)

    Daw, C.S.

    1993-03-01T23:59:59.000Z

    Performance estimates for the UCC2, IGTP1, and IGTP2 chars were made for a typical utility PFBC boiler having nominal characteristics similar to those of the American Electric Power 75 MW(e) Tidd PFBC demonstration facility. Table 2 summarizes the assumed boiler operating conditions input to the PFBC simulation code. Input fuel parameters for the chars and reference fuels were determined from their standard ASTM analyses (Table 1) and the results of the bench-scale characterization tests at B&W`s Alliance Research Center. The required characterization information for the reference fuels was available from the B&W data base, and the combustion reactivity information for the mild-gasification chars was generated in the pressurized bench-scale reactor as described earlier. Note that the combustion reactivity parameters for Beulah lignite are those previously measured at low-pressure conditions. It was necessary to use the previous values as the new parameters could not be accurately measured in the pressurized bench-scale facility. Based on very limited measurements of particle size attrition in paste-type feed systems, it was assumed that all of the fuels (including the chars) would have a very small (essentially negligible) degree of attrition in the feed system. Char devolatilization parameters were assumed to be equal to those of anthracite because of the very low levels of volatiles present in UCC2, IGTP1, and IGTP2. Major fuel input parameters and higher heating values are summarized in Table 3.

  4. Characterizing and modeling combustion of mild-gasification chars in pressurized fluidized beds

    SciTech Connect (OSTI)

    Daw, C.S.

    1993-01-01T23:59:59.000Z

    Performance estimates for the UCC2, IGTP1, and IGTP2 chars were made for a typical utility PFBC boiler having nominal characteristics similar to those of the American Electric Power 75 MW(e) Tidd PFBC demonstration facility. Table 2 summarizes the assumed boiler operating conditions input to the PFBC simulation code. Input fuel parameters for the chars and reference fuels were determined from their standard ASTM analyses (Table 1) and the results of the bench-scale characterization tests at B W's Alliance Research Center. The required characterization information for the reference fuels was available from the B W data base, and the combustion reactivity information for the mild-gasification chars was generated in the pressurized bench-scale reactor as described earlier. Note that the combustion reactivity parameters for Beulah lignite are those previously measured at low-pressure conditions. It was necessary to use the previous values as the new parameters could not be accurately measured in the pressurized bench-scale facility. Based on very limited measurements of particle size attrition in paste-type feed systems, it was assumed that all of the fuels (including the chars) would have a very small (essentially negligible) degree of attrition in the feed system. Char devolatilization parameters were assumed to be equal to those of anthracite because of the very low levels of volatiles present in UCC2, IGTP1, and IGTP2. Major fuel input parameters and higher heating values are summarized in Table 3.

  5. Investigation of a sulfur reduction technique for mild gasification char. Technical report, September 1, 1991--November 30, 1991

    SciTech Connect (OSTI)

    Knight, R.A.

    1991-12-31T23:59:59.000Z

    The object of this program is to investigate the desulfurization of mild gasification char using hydrogen/methane mixtures in a laboratory-scale experimental study. In the first year of the two- year program, char is being treated with mixtures of H{sub 2} and CH{sub 4} at temperatures of 1100{degrees}C to 1550{degrees}F and pressures of 50 to 100 psig. The effects of temperature, pressure, residence time, gas velocity, and gas composition on sulfur removal and carbon gasification are being determined. The batch experiments are being performed in a nominal 2-inch-ID stainless-steel, batch, fluidized-bed reactor. The char to be desulfurized was produced by the IGT mild gasification process research unit (PRU) in a recently completed DOE/METC-sponsored technology development program. The parent coal was Illinois No. 6 from a preparation plant, and the char from the selected test contains 4.58 wt% sulfur. In the first quarter, we have obtained and prepared a char for the desulfurization tests. Ultimate and proximate analyses were performed on this char, and its pore size distribution and surface area were determined. Also this quarter, the fluidized-bed reactor system was constructed and equipped with high pressure mass flow controllers and a high pressure sintered metal filter to remove fines from the effluent gas stream.

  6. Experimental studies on the group combustion of coal char particles

    E-Print Network [OSTI]

    Dahdah, Tarek Farid

    1988-01-01T23:59:59.000Z

    of temperatures in excess of 1200 K was built for this purpose. Although this study concerns char combustion, the apparatus can also be used for ignition Journal model is Journal of Heat Transfer. and combustion of pulverized coal particles. What is char...EXPERIMENTAL STUDIES ON THE GROUP COMBUSTION OF COAL CHAR PARTICLES A Thesis by TAREK FARID DAHDAH Submitted to the Graduate College of Texas ASSAM University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE May...

  7. Oil shale ash-layer thickness and char combustion kinetics

    SciTech Connect (OSTI)

    Aldis, D.F.; Singleton, M.F.; Watkins, B.E.; Thorsness, C.B.; Cena, R.J.

    1992-04-15T23:59:59.000Z

    A Hot-Recycled-Solids (HRS) oil shale retort is being studied at Lawrence Livermore National Laboratory. In the HRS process, raw shale is heated by mixing it with burnt retorted shale. Retorted shale is oil shale which has been heated in an oxygen deficient atmosphere to pyrolyze organic carbon, as kerogen into oil, gas, and a nonvolatile carbon rich residue, char. In the HRS retort process, the char in the spent shale is subsequently exposed to an oxygen environment. Some of the char, starting on the outer surface of the shale particle, is burned, liberating heat. In the HRS retort, the endothermic pyrolysis step is supported by heat from the exothermic char combustion step. The rate of char combustion is controlled by three resistances; the resistance of oxygen mass transfer through the gas film surrounding the solid particle, resistance to mass transfer through a ash layer which forms on the outside of the solid particles as the char is oxidized and the resistance due to the intrinsic chemical reaction rate of char and oxygen. In order to estimate the rate of combustion of the char in a typical oil shale particle, each of these resistances must be accurately estimated. We begin by modeling the influence of ash layer thickness on the over all combustion rate of oil shale char. We then present our experimental measurements of the ash layer thickness of oil shale which has been processed in the HRS retort.

  8. Joint inversion of electrical and seismic data for Fracture char...

    Broader source: Energy.gov (indexed) [DOE]

    Joint inversion of electrical and seismic data for Fracture char. and Imaging of Fluid Flow in Geothermal Systems Michael Batzle, PI Colorado School of Mines Track Name: Fluid...

  9. Integrated methods for production of clean char and its combustion properties. Technical report, September 1, 1991--November 30, 1991

    SciTech Connect (OSTI)

    DeBarr, J.A.

    1991-12-31T23:59:59.000Z

    The overall objective of this two-year program is to produce clean char using an integrated process scheme which combines physical coal cleaning, mild gasification and char oxydesulfurization. Low sulfur chars which could be used in utility boilers to meet 1995 emission standards of 2.5 lbs DO{sub 2}/MMBtu are produced from Illinois coals having emissions of >5 lbs SO{sub 2}/MMBtu. Mild gasification and low temperature oxidation studies for sulfur removal are conducted with selected coals from the Illinois Basin Coal (IBC) Sample Program in a batch fixed-bed reactor at the ISGS. Pound quantities of chars for combustion testing are prepared in a continuous rotary kiln reactor under optimized conditions of mild gasification and oxydesulfurization. Burning characteristics and ash deposition behaviors of desulfurized chars are determined to ensure that a useable fuel is produced. These tests are done at the University of North Dakota Energy and Environmental Research Center (UNDEERC) in a drop tube furnace (DTF), and at the US EPA in a 14 kW pilot-scale combustor. In some tests, methane is examined as an auxiliary fuel, and high-surface-area hydrated lime developed at ISGS is used to further reduce SO{sub 2} emissions. Complete analyses of the fuels are obtained to aid char desulfurization studies and help explain combustion and SO{sub 2} emission characteristics of the char. This project is a cooperative effort between the ISGS, UNDEERC and the US EPA and is cost-shared with US EPA and the US DOE through UNDEERC.

  10. Apparatus for mixing char-ash into coal stream

    DOE Patents [OSTI]

    Blaskowski, Henry J. (Avon, CT)

    1982-03-16T23:59:59.000Z

    Apparatus for obtaining complete mixing of char with coal prior to the introduction of the mixture into the combustor (30) of a coal gasifier (10). The coal is carried in one air stream (22), and the char in another air stream (54), to a riffle plate arrangement (26), where the streams of solid are intimately mixed or blended.

  11. Influence of pressure on coal pyrolysis and char gasification

    SciTech Connect (OSTI)

    Haiping Yang; Hanping Chen; Fudong Ju; Rong Yan; Shihong Zhang [Huazhong University of Science and Technology, Wuhan (China). State Key Laboratory of Coal Combustion

    2007-12-15T23:59:59.000Z

    Coal char structure varied greatly with pyrolysis pressure, which has a significant influence on the gasification reactivity. In this study, the influence of pressure on the behavior of coal pyrolysis and physicochemical structure and gasification characteristics of the resultant coal char was investigated using a pressurized thermogravimetric analyzer combined with an ambient thermogravimetric analyzer. First, the pyrolysis of Shenfu (SF) bituminous coal was performed in a pressurized thermogravimetric analyzer (TGA) at different pressures (0.1, 0.8, 1.5, 3, and 5 MPa). The volatile mainly evolved out at 400-800{sup o}C. The gas products are mainly CO{sub 2}, CO, CH{sub 4}, and light aliphatics with some water. It was observed that the pyrolysis of coal was shifted to lower temperature (50{sup o}C) with pressure increasing from ambient to 5 MPa, and the devolatilization rate of coal pyrolysis was decreased and the coal char yield was increased slightly. The structure of solid coal char was analyzed using FTIR, ASAP2020, and CNHS. In the solid char, the main organic functional groups are mainly CO, C-C (alkane), C-H ar, C-O-C, and C=C ar. The carbon content was increased while H content decreased. Finally, the gasification of the solid char was preformed at ambient pressure with CO{sub 2} as gasify agent. The gasification process of coal char can be divided into postpyrolysis and char gasification. Higher pressure accelerated the initial stage of char gasification, and higher gasification reactivity was observed for char derived at 5 MPa. 23 refs., 8 figs., 5 tabs.

  12. Combustion properties of coal-char blends: NO{sub x} emission characteristics. Interim final technical report, September 1, 1992--August 31, 1993

    SciTech Connect (OSTI)

    Rostam-Abadi, M.; Khan, L.; Khan, S. [Illinois State Geological Survey, Champaign, IL (United States); Smoot, L.D.; Germane, G.J.; Eatough, C.N. [Brigham Young Univ., Provo, UT (United States). Advanced Combustion Engineering Research Center

    1993-12-31T23:59:59.000Z

    Under pulverized coal combustion conditions, NO{sub x} formed during the release of volatile matter far exceed NO{sub x} formed from combustion of the resulting char. It is believed that interactions of NO{sub x} with char is responsible for the reduced NO{sub x} formation from the combustion of char. The goal of this research is to assess the potential technical and economical benefits of co-firing coal-char blends in pulverized coal boilers to reduce NO{sub x}. The rationale for the proposed research is that the presence of char in the flame during the initial stages of combustion may provide catalytic activity for reduction of NO{sub x} produced from volatile nitrogen. This project is a cooperative effort between the Illinois State Geological Survey (ISGS) and BYU/ACERC. Seven hundred and fifty pounds of three coal-char blends containing 12.5%, 25%, and 50% char and 125 pounds of a coal-activated carbon blend containing 12.5% activated carbon were prepared. The volatile matter contents of the blends ranged from 27.3 to 35.6% (dry basis). Char (16.2 wt% volatile matter) was made from an Illinois No. 6 coal (Peabody Coal Company) in a continuous feed charring oven under mild gasification conditions. Nine combustion tests will be performed with the coal and blends in a 0.5--1.0 MBtu/hr combustor located at BYU. Combustion data will be analyzed to determine the effect of blend type, stoichiometry, and flame temperature on NO{sub x} formation, ignition characteristics, flame stability, and combustion efficiency. A four month no-cost extension has been requested for the project. The results of the combustion tests will be reported in the final technical report in December 1993.

  13. Behavior of chars from Bursa Mustafa Kemal Pasa Alpagut and Balkesir Dursunbey Cakiirca Lignite (Turkey) during non-catalytic and catalytic gasification

    SciTech Connect (OSTI)

    Bozkurt, Y.; Misirlioglu, Z.; Sinag, A.; Tekes, A.T.; Canel, M. [Ankara University, Ankara (Turkey). Dept. of Chemistry

    2008-07-01T23:59:59.000Z

    The reactivities of chars obtained by pyrolysis of Bursa Mustafa Kemal Pasa Alpagut lignite and Balkesir Dursunbey Cakiirca lignite (Turkey) at different temperatures were determined by CO{sub 2} gasification and by combustion with O{sub 2}. Catalytic effect of Na{sub 2}CO{sub 3} on the CO{sub 2} and O{sub 2} gasification reactivity of chars was investigated. Gasification tests were performed in the fixed bed reactors operating at ambient pressure. Reactivity of chars during the CO{sub 2} gasification reactions was determined by calculating the reaction rate constants and reactivity of chars during the O{sub 2} gasification was determined by using ignition temperatures of the samples. Activation energies and Arrhenius constants of the chars on the CO{sub 2} gasification reactions were also calculated by the help of Arrhenius curves. The activation energy for CO{sub 2} gasification was generally decreased with pyrolysis temperature, due to the different surface characteristics and different nature of carbon atoms gasified as the gasification reactions proceed. Generally, the increase in pyrolysis temperature leads to an increase in gasification reactivity with CO{sub 2}. The reactivity of chars in catalytic gasification was higher than the corresponding non-catalytic reactivity of the same chars. Ignition temperature increased with increasing pyrolysis temperature.

  14. Mixed Waste Treatment Using the ChemChar Thermolytic Detoxification Technique

    SciTech Connect (OSTI)

    Kuchynka, D.J.

    1997-01-01T23:59:59.000Z

    This R and D program addresses the treatment of mixed waste employing the ChemChar Thermolytic Detoxification process. Surrogate mixed waste streams will be treated in a four inch diameter, continuous feed, adiabatic reactor with the goal of meeting all regulatory treatment levels for the contaminants in the surrogates with the concomitant production of contaminant free by-products. Successful completion of this program will show that organic contaminants in mixed waste surrogates will be converted to a clean, energy rich synthesis gas capable of being used, without further processing, for power or heat generation. The inorganic components in the surrogates will be found to be adsorbed on a macroporous coal char activated carbon substrate which is mixed with the waste prior to treatment. These contaminants include radioactive metal surrogate species, RCRA hazardous metals and any acid gases formed during the treatment process. The program has three main tasks that will be performed to meet the above objectives. The first task is the design and construction of the four inch reactor at Mirage Systems in Sunnyvale, CA. The second task is production and procurement of the activated carbon char employed in the ChemChartest runs and identification of two surrogate mixed wastes. The last task is testing and operation of the reactor on char/surrogate waste mixtures to be performed at the University of Missouri. The deliverables for the project are a Design Review Report, Operational Test Plan, Topical Report and Final Report. This report contains only the results of the design and construction carbon production-surrogate waste identification tasks.Treatment of the surrogate mixed wastes has just begun and will not be reported in this version of the Final Report. The latter will be reported in the final version of the Final Report.

  15. Combustion of char-coal waste pellets for high efficiency and low NO{sub x}. Technical report, September 1--November 30, 1994

    SciTech Connect (OSTI)

    Rajan, S. [Southern Illinois Univ., Carbondale, IL (United States)

    1994-12-31T23:59:59.000Z

    Illinois coals are prime candidates for use in Integrated Gasification Combined Cycle (IGCC) plants because of their high volatility and good char reactivity. In these plants, partial gasification of the coal in the presence of limestone eliminates the major portion of the sulfur species in the product gases, which are used as fuel for the topping cycle. The char produced is high in ash content, the major portion of which is calcium sulfide. It is also low in volatiles and of low density, compared to the parent coal. The economic success of the gasification route depends on the subsequent utilization of the residual char for raising steam for use in a Rankine cycle bottoming plant and/or preheating the air to the gasifier. Fluidized bed combustion of the char appears an attractive way of utilizing the char. Areas of concern in the fluidized bed combustion of the high ash, low volatility char are: attainment of high carbon conversion efficiencies; reduction of oxides of nitrogen emissions; reduction/elimination of corrosive chlorine species; reduction/elimination of sodium and other alkali species; and efficient usage of the calcium present in the ash to reduce sulfur compounds. The aim of the present project is to investigate ways of improving the carbon conversion efficiency, sulfur capture efficiency and NO{sub x} reduction during the fluidized bed combustion by pelletizing the low density char with coal and coal wastes using cornstarch or wood lignin as binder. During this first quarter, the parent coals and the chars to be tested have been analyzed. Particle size distributions have been measured. Sample pellets have been made evaluation of their properties.

  16. Correlation for the total sulfur content in char after devolatilization

    SciTech Connect (OSTI)

    Vasilije Manovic; Borislav Grubor [University of Belgrade, Belgrade (Serbia & Montenegro)

    2006-02-01T23:59:59.000Z

    The overall process of coal combustion takes place in two successive steps: devolatilization and char combustion. The fate of sulfur during the devolatilization of coal of different rank was investigated. The significance of the investigation is in fact that a major part of sulfur release occurs during devolatilization of coal, (i.e., emission of sulfur oxides during combustion of coal largely depends on sulfur release during devolatilization). The experimental investigations were conducted to obtain the data about the quantitative relation between sulfur content in the coal and sulfur content in the char. Standard procedures were used for obtaining the chars in a laboratory oven and determining the sulfur forms in the coal and char samples. The experiments were done with ground coal samples ({lt}0.2 mm), at the temperatures in the range of 500-1000{sup o}C. We showed that the amount of sulfur remaining in the char decreases, but not significantly in the temperature range 600-900{sup o}C. On the basis of the theoretical consideration of behavior of sulfur forms during devolatilization, certain simplifying assumptions, and obtained experimental data, we propose two correlations to associate the content of sulfur in the coal and in the char. The correlations are based on the results of the proximate analysis and sulfur forms in coal. Good agreement was found when the proposed correlations were compared with the experimental results obtained for investigated coals. Moreover, the correlations were verified by results found in the literature for numerous Polish, Albanian, and Turkish coals. Significant correlations (P {lt}0.05) between observed and calculated data with correlation coefficient, R {gt}0.9, were noticed in the case of all coals. 25 refs., 3 figs., 2 tabs.

  17. Production and use of activated char for combined SO{sub 2}/NO{sub x} removal. Technical report, March 1, 1994--May 31, 1994

    SciTech Connect (OSTI)

    Lizzio, A.A.; DeBarr, J.A.; Kruse, C.W.; Rostam-Abadi, M.; Donnals, G.L.; Rood, M.J.

    1994-09-01T23:59:59.000Z

    Carbon adsorbents have been shown to remove sulfur oxides from flue gas, and also serve as a catalyst for reduction of nitrogen oxides at temperatures between 80 and 150{degrees}C. The overall objective of this project is to determine whether Illinois coal is a suitable feedstock for the production of activated char which could be used as a catalyst for combined SO{sub 2}/NO{sub x} removal, and to evaluate the potential application of the products in flue gas cleanup. Key production variables will be identified to help design and engineer activated char with the proper pore structure and surface chemistry to enable the development of an effective SO{sub 2}/NO{sub x} removal catalyst. The ISGS agreed to provide 500 pounds of activated char to STEAG for tests in a demonstration unit to clean flue gas from a U.S. waste incinerator. The STEAG process requires an activated char with a N{sub 2} BET surface area < 300 m{sup 2}/g, i.e., lower than that of most commercially available activated carbons. An extensive series of tests was conducted to determine process conditions for making such an adsorbent from a Colchester No. 2 coal (Industry Mine coal). Using a 4 in. ID continuous rotary tube kiln (RTK) and a continuous feed charring oven, pound quantities of activated char were produced that matched well the properties of the adsorbent currently used by STEAG. A three step process, which included preoxidation, pyrolysis, and activation, was devised to produce a suitable char from this caking coal.

  18. MODELING CHAR OXIDATION AS A FUNCTION OF PRESSURE USING AN INTRINSIC LANGMUIR RATE EQUATION

    E-Print Network [OSTI]

    Fletcher, Thomas H.

    char oxidation and large-particle combustion in fixed beds. The HP-CBK model was evaluated combustion data; 3) large particle oxidation data; 4) pulverized char drop-tube data, and 5) TGA and FFB data

  19. Recovery Boiler Modeling: An Improved Char Burning Model Including Sulfate Reduction and Carbon Removal

    E-Print Network [OSTI]

    Grace, T. M.; Wag, K. J.; Horton, R. R.; Frederick, W. J.

    gasification, reactions between oxygen and combustibles in the boundary layer, and integration of sulfate reduction and sulfide reoxidation into the char burning process. Simulations using the model show that for typical recovery boiler conditions, char burning...

  20. CORROSION OF Fe-10Al-Cr ALLOYS BY COAL CHAR

    E-Print Network [OSTI]

    Gordon, B.A.

    2011-01-01T23:59:59.000Z

    Potent.ials Encountered in Coal Conversion Systems", NASA TNof Illinois #6 ash and coal char. Figure 1. Cross sectionsof Fe-lOAl-Cr Alloys by Coal Char B. A. Gordon and V.

  1. Integrated production/use of ultra low-ash coal, premium liquids and clean char. Interim final technical report, 1 September, 1992--31 August, 1993

    SciTech Connect (OSTI)

    Kruse, C.W.; Carlson, S.L. [Illinois State Geological Survey, Champaign, IL (United States); Fatemi, M. [Amoco Research Center, Naperville, IL (United States); Snoeyink, V.L.; Feizoulof, C.A. [Univ. of Illinois, Urbana, IL (United States); Klavetter, E. [Sandia National Labs., Albuquerque, NM (United States)

    1993-12-31T23:59:59.000Z

    The ultimate objective of this project is to attain high-value, coal-derived products, especially varieties of char, from Illinois coal. The chars (carbons) made in this study, because of their special properties, could become the marketable materials having the highest value in the product set. Tests this quarter followed up on an unexpected correlation of surface properties of a variety of oxidized carbons with adsorption phenomena. Additional oxidized carbons were made at the ISGS and tests to establish the reproducibility of results were begun. Work will be continued through December on a no-cost extension.

  2. Integrated production/use of ultra low-ash coal, premium liquids and clean char. [Quarterly] technical report, March 1, 1993--May 31, 1993

    SciTech Connect (OSTI)

    Kruse, C.W.; Carlson, S.L. [Illinois State Geological Survey, Champaign, IL (United States); Fatemi, M. [Amoco Research Center, Naperville, IL (United States); Snoeyink, V.L.; Feizoulof, C.A. [Illinois Univ., Urbana, IL (United States); Klavetter, E. [Sandia National Labs., Albuquerque, NM (United States)

    1993-09-01T23:59:59.000Z

    Tests this quarter showed the adsorption efficiency of an oxidized activated ChemCoal{trademark} (OACC) char for removing volatile organic compounds (VOCs) from spiked water is higher than for unoxidized activated char (ACC). OACC destroyed (or reacted with) a higher percentage of VOCs when loaded char was heated quickly to 850{degrees}C. This was expected based on the OACC`s superiority as an elimination catalyst. Aromatic VOCs appeared to be adsorbed on the chars more readily than the chlorinated ones but the multichlorinated VOCs appeared to be adsorbed more strongly. The performance of two oxidized carbons (OST3-9 and OACC chars) for the removal of the VOCs from two industrial waste waters spiked with VOCs appeared similar. The more active catalyst, OST3-9 appeared more effective than OACC in destroying the adsorbed materials. A series of carbons having differing levels of oxygen on the surface was prepared by desorbing oxygen from the surface placed there by nitric acid oxidation. Tests revealed that the capacity to adsorb 2-nitrophenol increased as the outgassing temperature was increased. This indicates that PNP adsorption is increased as surface oxygen is removed from the carbon.

  3. Development of a high-performance coal-fired power generating system with pyrolysis gas and char-fired high-temperature furnace (HITAF): Volume 3. Final report

    SciTech Connect (OSTI)

    NONE

    1996-05-01T23:59:59.000Z

    Testing of an atmospheric circulating bed pyrolyzer was done at Southern Illinois University. A variety of experiments have been conducted in a laboratory scale pyrolyzer with coal input flow rates from 2 to 6 lb/h. three feed coal particle sizes, corresponding to a nominal -40 mesh, -30 mesh and -18 mesh were used. The limestone used in the tests was a Genstar limestone. Parameters investigated in the tests include the influence of superficial velocity, temperature and coal-air mass ratios. Char particle size distributions under various test conditions have been measured and the char composition determined. Fuel gas composition, yields and heating values have been investigated. Char morphology has been studied using scanning electron microscopy. Char reactivity for selected samples has been measures, and the influence of feed coal size, bed temperature and superficial velocity has been determined. Material balance calculations have been performed and found to be in very good agreement. Energy audit calculations for the process have been made to investigate the flow of energy and to estimate the losses during the process. Full details of the data, results obtained and conclusions drawn are presented.

  4. Energy and environmental research emphasizing low-rank coal: Task 5.7, Coal char fuel evaporation canister sorbent

    SciTech Connect (OSTI)

    Aulich, T.R.; Grisanti, A.A.; Knudson, C.L.

    1995-08-01T23:59:59.000Z

    Atomobile evaporative emission canisters contain activated carbon sorbents that trap and store fuel vapors emitted from automobile fuel tanks during periods of hot ambient temperatures and after engine operation. When a vehicle is started, combustion air is pulled through the canister, and adsorbed vapors are removed from the sorbent and routed to the intake manifold for combustion along with fuel from the tank. The two primary requirements of an effective canister sorbent are that (1) it must be a strong enough adsorbent to hold on to the fuel vapors that contact it and (2) it must be a weak enough adsorbent to release the captured vapors in the presence of the airflow required by the engine for fuel combustion. Most currently available commercial canister sorbents are made from wood, which is reacted with phosphoric acid and heat to yield an activated carbon with optimum pore size for gasoline vapor adsorption. The objectives of Task 5.7 were to (1) design and construct a test system for evaluating the performance of different sorbents in trapping and releasing butane, gasoline, and other organic vapors; (2) investigate the use of lignite char as an automobile fuel evaporation canister sorbent; (3) compare the adsorbing and desorbing characteristics of lignite chars with those of several commercial sorbents; and (4) investigate whether the presence of ethanol in fuel vapors affects sorbent performance in any way. Tests with two different sorbents (a wood-derived activated carbon and a lignite char) showed that with both sorbents, ethanol vapor breakthrough took about twice as long as hydrocarbon vapor breakthrough. Possible reasons for this, including an increased sorbent affinity for ethanol vapors, will be investigated. If this effect is real (i.e., reproducible over an extensive series of tests under varying conditions), it may help explain why ethanol vapor concentrations in SHED test evaporative emissions are often lower than would be expected.

  5. Bio-Char Soil Management on Highly Weathered Soils in the Humid Tropics

    E-Print Network [OSTI]

    Lehmann, Johannes

    therefore have to be applied each year to sustain soil productivity. Management of black carbon (C36 Bio-Char Soil Management on Highly Weathered Soils in the Humid Tropics Johannes Lehmann1), ColombiaQ1 CONTENTS 36.1 Bio-Char Management and Soil Nutrient Availability

  6. Studies of NO-char reaction kinetics obtained from drop-tube furnace and thermogravimetric experiments

    SciTech Connect (OSTI)

    Shaozeng Sun; Juwei Zhang; Xidong Hu; Shaohua Wu; Jiancheng Yang; Yang Wang; Yukun Qin [Harbin Institute of Technology, Harbin (China). Combustion Engineering Research Institute

    2009-01-15T23:59:59.000Z

    Four coal chars were prepared in a flat flame flow reactor (FFR), which can simulate the temperature and gas composition of a real pulverized coal combustion environment. The pore structure of chars was measured by mercury porosimetry and nitrogen adsorption, and the Hg and Brunauer-Emmett-Teller (BET) surface areas were obtained. The kinetics of NO-char was studied in a drop-tube furnace (DTF) and thermogravimetric analyzer (TGA). In the TGA experiments, the random pore model (RPM) was applied to describe the NO-char reactions and obtain the intrinsic kinetics. By presenting the data of DTF and TGA experiments on the same Arrhenius plot, it can be concluded that TGA is an available tool to study the kinetics of a high-temperature NO-char reaction. With respect to the DTF experiments, in comparison to the BET surface area, the Hg surface area is a better basis for normalizing the reactivity of different coal chars because of less scatter in the measured values, better agreement with TGA experimental data, and more stable values during the process of reaction. Moreover, by comparing the Hg surface area of chars before and after reactions, it is believed that the Hg surface area basis is more appropriate for high-rank coal chars. The determined kinetic rate constants are in good agreement with other data in the literature, and a new rate constant expression is proposed. 30 refs., 8 figs., 7 tabs.

  7. Effect of CO2 gasification reaction on oxycombustion of pulverized coal char.

    SciTech Connect (OSTI)

    Molina, Alejandro (Universidad Nacional de Colombia, Medellin, Colombia); Hecht, Ethan S.; Shaddix, Christopher R.; Haynes, Brian S. (University of Sydney, New South Wales, Australia)

    2010-07-01T23:59:59.000Z

    For oxy-combustion with flue gas recirculation, as is commonly employed, it is recognized that elevated CO{sub 2} levels affect radiant transport, the heat capacity of the gas, and other gas transport properties. A topic of widespread speculation has concerned the effect of the CO{sub 2} gasification reaction with coal char on the char burning rate. To give clarity to the likely impact of this reaction on the oxy-fuel combustion of pulverized coal char, the Surface Kinetics in Porous Particles (SKIPPY) code was employed for a range of potential CO{sub 2} reaction rates for a high-volatile bituminous coal char particle (130 {micro}m diameter) reacting in several O{sub 2} concentration environments. The effects of boundary layer chemistry are also examined in this analysis. Under oxygen-enriched conditions, boundary layer reactions (converting CO to CO{sub 2}, with concomitant heat release) are shown to increase the char particle temperature and burning rate, while decreasing the O{sub 2} concentration at the particle surface. The CO{sub 2} gasification reaction acts to reduce the char particle temperature (because of the reaction endothermicity) and thereby reduces the rate of char oxidation. Interestingly, the presence of the CO{sub 2} gasification reaction increases the char conversion rate for combustion at low O{sub 2} concentrations, but decreases char conversion for combustion at high O{sub 2} concentrations. These calculations give new insight into the complexity of the effects from the CO{sub 2} gasification reaction and should help improve the understanding of experimentally measured oxy-fuel char combustion and burnout trends in the literature.

  8. Kinetics of gasification of black liquor char by steam

    SciTech Connect (OSTI)

    Li, J.; van Heiningen, A.R.P. (Dept. of Chemical Engineering, McGill Univ., Pulp and Paper Research Inst. of Canada, Montreal, Quebec (CA))

    1991-07-01T23:59:59.000Z

    This paper reports on the steam gasification kinetics of kraft black liquor char that were studied in a thermogravimetric analysis reactor. The effect of steam and hydrogen concentration on gasification rate can be described by Langmuir-Hinshelwood type kinetics. An activation energy of 210 kJ/mol was obtained. Methane formation was negligible, and H{sub 2}S was the major gaseous sulfur-containing product obtained over the temperature range studied, 873-973 K. The CO{sub 2} concentration was higher than calculated for the water-shift reaction at equilibrium. A gasification mechanism is proposed whereby CO{sub 2} is one of the primary gasification products.

  9. Integrated production/use of ultra low-ash coal, premium liquids and clean char. Final technical report, September 1, 1991--August 31, 1992

    SciTech Connect (OSTI)

    Kruse, C.W.; Carlson, S.L. [Illinois State Geological Survey, Champaign, IL (United States); Snoeyink, V.L.; Feizoulof, C.; Assanis; Syrimis, M. [Illinois Univ., Urbana (United States); Fatemi, S.M. [Amoco, Naperville, IL (United States)

    1992-12-31T23:59:59.000Z

    The objective of this research is to invert the conventional scale of values for products of coal utilization processes by making coal chars (carbons) that, because of their unique properties, are the most valuable materials in the product slate. A unique type of coal-derived carbon studied in this project is oxidized activated coal char having both adsorptive and catalyst properties. Major program elements were (a) preparation and characterization of materials (b) characterization of carbons and catalyst testing (c) completion of diesel engine testing of low-ash coal and (d) initiation of a two-year adsorption study. Materials prepared were (a) two low-ash coal samples one via ChemCoal processing of IBC-109 and the other by acid dissolution of IBC-109`s mineral matter, (b) coal char (MG char), (c) activated low-ash carbon (AC), (d) oxidized activated carbon (OAC). Amoco continued its support with state-of-the art analytical capabilities and development of catalyst testing procedures. Diesel engine tests were made with low ash coal dispersed in diesel fuel at solid loadings of 20% and 35%. The slurry was successfully burned in cylinder 2 of a two-cylinder diesel engine, after modifications of the engine`s fuel injection system. The higher speed proved to be more favorable but the slurry burned with a slightly improved thermal and combustion efficiency at both speeds with respect to diesel fuel alone. Adsorption studies included preparation of seven base-line carbon samples and their characterization, including their N{sub 2} BET surface areas and apparent densities. Paranitrophenol (PNP) adsorption isotherms were determined for the six controls. Oxidation of carbon with nitric acid decreases activated carbon`s PNP adsorption capacity while air oxidation increases adsorption capacity.

  10. Characterizing and modeling combustion of mild-gasification chars in pressurized fluidized beds

    SciTech Connect (OSTI)

    Daw, C.S.

    1995-10-01T23:59:59.000Z

    Oak Ridge National Laboratory (ORNL) is supported by the Morgantown Energy Technology Center (METC) of the Department of Energy (DOE) under FWP-FEAA310 to characterize the fuel properties of liquid and char coproducts from the mild gasification of coal, Because most of the energy content of coals subjected to mild gasification is retained in the byproduct char, efficient and cost-effective utilization of the char is essential in insuring that candidate gasification processes are commercially viable. One potential use for char of particular interest to DOE is pressurized fluidized bed combustion (PFBC). PFBC is of particular interest because it has the potential for 10 to 30 percent greater overall energy efficiency than atmospheric fluidized bed combustion (AFBC), While bench-scale tools and analytical procedures for characterizing fuels for AFBC have been recently demonstrated, no such tools have been reliably demonstrated for PFBC. This report summarizes the results of joint research collaboration between ORNL and B&W that has been directed at modifying the previously developed AFBC fuel characterization procedures to be applicable for mild-gasification chars and PFBC conditions. The specific objectives were to: (1) characterize the combustion reactivity of a selected set of candidate mild- gasification chars at PFB conditions; (2) compare the measured char characteristics with those of more conventional PFBC fuels; (3) modify an AFBC computer code previously developed by B&W and ORNL for the Electric Power Research Institute (EPRI) to predict PFBC performance; and (4) apply the modified code and measured char combustion characteristics to make performance predictions for the candidate chars relative to more conventional fuels.

  11. THE EFFECT OF COAL CHAR ON THE CORROSION OF 304 SS

    E-Print Network [OSTI]

    Foerster, Thomas Friedrich Wilhelm

    2011-01-01T23:59:59.000Z

    of Iron-Base Alloys by Coal Char at 87l D e and 982° e" (of Structural Materials in Coal Gasifier Atmospheres".of Structural Haterials in Coal Gasifier Atmospheres". UCLA,

  12. Recovery Boiler Modeling: An Improved Char Burning Model Including Sulfate Reduction and Carbon Removal 

    E-Print Network [OSTI]

    Grace, T. M.; Wag, K. J.; Horton, R. R.; Frederick, W. J.

    1994-01-01T23:59:59.000Z

    This paper describes an improved model of char burning during black liquor combustion that is capable of predicting net rates of sulfate reduction to sulfide as well as carbon burnup rates. Enhancements include a proper ...

  13. CORROSION OF IRON-BASE ALLOYS BY COAL CHAR AT 871 AND 982 C

    E-Print Network [OSTI]

    Gordon, Bruce Abbott

    2011-01-01T23:59:59.000Z

    a net exporter of energy (coal and oil) (1),' but by 1973and Coal Char i The Energy Crisis Coal Processing .small role coal plays in the current energy picture. u u

  14. Integrated production/use of ultra low-ash coal, premium liquids and clean char

    SciTech Connect (OSTI)

    Kruse, C.W.

    1991-01-01T23:59:59.000Z

    This integrated, multi-product approach for utilizing Illinois coal starts with the production of ultra low-ash coal and then converts it to high-vale, coal-derived, products. The ultra low-ash coal is produced by solubilizing coal in a phenolic solvent under ChemCoal{trademark} process conditions, separating the coal solution from insoluble ash, and then precipitating the clean coal by dilution of the solvent with methanol. Two major products, liquids and low-ash char, are then produced by mild gasification of the low-ash coal. The low ash-char is further upgraded to activated char, and/or an oxidized activated char which has catalytic properties. Characterization of products at each stage is part of this project.

  15. Cracking of simulated oil refinery off-gas over a coal char, petroleum coke, and quartz

    SciTech Connect (OSTI)

    Yuan Zhang; Jin-hu Wu; Dong-ke Zhang [Chinese Academy of Sciences, Taiyuan (China). Institute of Coal Chemistry

    2008-03-15T23:59:59.000Z

    The cracking of oil refinery off-gas, simulated with a gas mixture containing methane (51%), ethylene (21.4%), ethane (21.1%), and propane (6.5%), over a coal char, petroleum coke, and quartz, respectively, has been studied in a fixed bed reactor. The experiments were performed at temperatures between 850 and 1000{sup o}C and at atmospheric pressure. The results show that the conversions of all species considered increased with increasing temperature. Ethane and propane completely decomposed over all three bed materials in the temperature range investigated. However, the higher initial conversion rates of methane and ethylene cracking at all temperatures were observed only over the coal char and not on the petroleum coke and quartz, indicating a significant catalytic effect of the coal char on methane and ethylene cracking. Methane and ethylene conversions decreased with reaction time due to deactivation of the coal char by carbon deposition on the char surface and, in the later stage of a cracking experiment, became negative, suggesting that methane and ethylene had been formed during the cracking of ethane and propane. 16 refs., 13 figs., 2 tabs.

  16. The fate of char-N at pulverized coal conditions Jennifer P. Spinti*, David W. Pershing

    E-Print Network [OSTI]

    Utah, University of

    of Chemical Engineering, University of Utah, Salt Lake City, UT 84112, USA Received 25 January 2002; received 1. Introduction The abundance of coal as an energy source is offset by the negative environmental-programmed gasification in 20% O2 (balance Ar) of 6 coals of varying rank and of the chars produced from the coals

  17. A Novel Technology for the Reduction of NOx on Char by Microwaves 

    E-Print Network [OSTI]

    Buenger, C.; Peterson, E.

    1994-01-01T23:59:59.000Z

    of these applications. The technology is directed at NOx reduction but may also address other pollutants like SO2. The technology employees char, a heat treated and devolitilized form of coal, to adsorb NOx from the flue (or waste) gas. Adsorption of greater than 99...

  18. A Database Architecture For Real-Time Motion Retrieval Charly Awad, Nicolas Courty and Sylvie Gibet

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A Database Architecture For Real-Time Motion Retrieval Charly Awad, Nicolas Courty and Sylvie Gibet, leading to an ex- ponential growth of the size of motion databases. Conse- quently indexing, querying, and retrieving motion capture data have become important considerations in the usability of such databases. Our

  19. Formation of CO precursors during char gasification with O2, CO2 and H2O

    E-Print Network [OSTI]

    Truong, Thanh N.

    Formation of CO precursors during char gasification with O2, CO2 and H2O Alejandro Montoya a are presented to get insight into an unified mechanism of uncatalyzed carbon gasification. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Gasification; Chemisorption; Molecular simulation; Surface

  20. Differences in gasification behaviors and related properties between entrained gasifier fly ash and coal char

    SciTech Connect (OSTI)

    Jing Gu; Shiyong Wu; Youqing Wu; Ye Li; Jinsheng Gao [East China University of Science and Technology, Shanghai (China). Department of Chemical Engineering for Energy Resources and Key Laboratory of Coal Gasification of Ministry of Education

    2008-11-15T23:59:59.000Z

    In the study, two fly ash samples from Texaco gasifiers were compared to coal char and the physical and chemical properties and reactivity of samples were investigated by scanning electron microscopy (SEM), SEM-energy-dispersive spectrometry (EDS), X-ray diffraction (XRD), N{sub 2} and CO{sub 2} adsorption method, and isothermal thermogravimetric analysis. The main results were obtained. The carbon content of gasified fly ashes exhibited 31-37%, which was less than the carbon content of 58-59% in the feed coal. The fly ashes exhibited higher Brunauer-Emmett-Teller (BET) surface area, richer meso- and micropores, more disordered carbon crystalline structure, and better CO{sub 2} gasification reactivity than coal char. Ashes in fly ashes occurred to agglomerate into larger spherical grains, while those in coal char do not agglomerate. The minerals in fly ashes, especial alkali and alkaline-earth metals, had a catalytic effect on gasification reactivity of fly ash carbon. In the low-temperature range, the gasification process of fly ashes is mainly in chemical control, while in the high-temperature range, it is mainly in gas diffusion control, which was similar to coal char. In addition, the carbon in fly ashes was partially gasified and activated by water vapor and exhibited higher BET surface area and better gasification activity. Consequently, the fact that these carbons in fly ashes from entrained flow gasifiers are reclaimed and reused will be considered to be feasible. 15 refs., 7 figs., 5 tabs.

  1. Changes in char structure during the gasification of a Victorian brown coal in steam and oxygen at 800{degree}C

    SciTech Connect (OSTI)

    Xin Guo; Hui Ling Tay; Shu Zhang; Chun-Zhu Li [Monash University, Vic. (Australia). Department of Chemical Engineering

    2008-11-15T23:59:59.000Z

    Char structure is an important factor influencing its reactivity during gasification. This study aims to investigate the changes in char structure during the gasification of brown coal. A Victorian brown coal was gasified in a fluidized-bed/fixed-bed reactor at 800{degree}C in atmospheres containing 15% H{sub 2}O, 2000 ppm O{sub 2}, or 15% H{sub 2}O and 2000 ppm O{sub 2}, respectively. Although the char gasification in 2000 ppm O{sub 2} was mainly rate-limited by the external diffusion of O{sub 2}, the char-H{sub 2}O reaction was mainly rate-limited by the chemical reactions. The structural features of char at different levels of char gasification conversion were examined with FT-Raman spectroscopy. Our results show that the chars from the gasification in the mixture of 2000 ppm O{sub 2} and 15% H{sub 2}O had almost the same features as the chars from the gasification in 15% H{sub 2}O alone when the same levels of char conversion were achieved. Both the thermal decomposition of char and the char gasification reactions could result in changes in char structure during gasification. 29 refs., 5 figs., 1 tab.

  2. Integrated production/use of ultra low-ash coal, premium liquids and clean char. Technical report, March 1, 1992--May 31, 1992

    SciTech Connect (OSTI)

    Kruse, C.W.; Carlson, S.L. [Illinois State Geological Survey, Champaign, IL (United States); Snoeyink, V.L.; Feizoulof, C.; Assanis, D.N.; Syrimis, M. [Illinois Univ., Urbana, IL (United States); Fatemi, S.M. [Amoco Research Center, Naperville, IL (United States)

    1992-10-01T23:59:59.000Z

    The first step in the envisioned integrated, multi-product approach for utilizing Illinois coal is the production of ultra low-ash coal. Subsequent steps would convert low-ash coal to high-value products through mild gasification, char activation, and oxidation reactions. Approximately eight pounds of low-ash coal has been obtained from the crude reactor slurry produced for us at the University of North Dakota Energy and Environmental Research Center (UNDEERC). After treatment to remove the remaining meta-cresol, this material will be subjected to mild gasification. Low-ash mild gasification char will be activated and a catalyst surface will be added by oxidation. A 20% coal: 80% diesel fuel slurry was tested in cylinder two of a two-cylinder, diesel engine after the necessary modifications in the engine`s fuel injection system were made. Four tests indicated that the coal successfully substitutes for diesel fuel in the slurry. The fuel burns in the cylinder, with slightly improved thermal and combustion efficiency. The tests were performed at 1800 rpm and 2200 rpm and 75% load. The change in the surface properties of Calgon F-400 commercial activated carbon caused by several treatments were examined by X-ray Photoelectron Spectroscopy (XPS).

  3. CHAR CRYSTALLINE TRANSFORMATIONS DURING COAL COMBUSTION AND THEIR IMPLICATIONS FOR CARBON BURNOUT

    SciTech Connect (OSTI)

    ROBERT H. HURT

    1998-09-08T23:59:59.000Z

    Recent work at Sandia National Laboratories, Imperial College, and the U.K. utility PowerGen, has identified an important mechanism believed to have a large influence on unburned carbon levels from pulverized coal-fired boilers. That mechanism is char carbon crystalline rearrangements on subsecond times scales at temperatures of 1800 - 2500 K, which lead to char deactivation in the flame zones of furnaces. The so-called thermal annealing of carbons is a well known phenomenon, but its key role in carbon burnout has only recently been appreciated, and there is a lack of quantitative data in this time/temperature range. In addition, a new fundamental tool has recently become available to study crystalline transformations, namely high resolution transmission electron microscopy (HRTEM) fringe imaging, which provides a wealth of information on the nature and degree of crystallinity in carbon materials such as coal chars. Motivated by these new developments, this University Coal Research project has been initiated with the following two goals:  to determine transient, high-temperature, thermal deactivation kinetics as a function of parent coal and temperature history.  to characterize the effect of this thermal treatment on carbon crystalline structure through high-resolution transmission electron microscopy and specialized, quantitative image analysis. Work is currently underway on the following three tasks: Task 1 Experimental technique development. The goal of this task is to develop and demonstrate an apparatus and procedure for measuring transient, high-temperature, thermal deactivation of coal chars. While peak gas temperatures in boilers are often in the range 1800 - 2000 K, peak particle temperatures can be much higher due to high rates of heat release at the particle surface due to exothermic carbon oxidation. The prototype transient heat treatment apparatus is based on an inert-gas purged graphite-rod sample holder that is subjected to rapid Joule heating to temperatures approaching 3000 o C. For the measurement of temperature histories an optical diagnostic is being developed that offers sufficient spatial resolution to distinguish the sample temperature from the substrate temperature. The optical diagnostic is based on a CID camera, a high-power lens, and movable mirrors to projecting multiple, filtered images onto a single chip. Oxidation kinetics are measured on the heat treated samples by a nonisothermal TGA technique. Task 2 Thermal deactivation kinetics. The goal of this task is to quantify thermal char deactivation as a function of temperature history and parent coal, with an emphasis on inert environments at temperatures and times found in combustion systems. The results are to be cast in the form of deactivation kinetics useful for incorporation in combustion models. Task 3 Crystal structure characterization. Crystal structure characterization provides important insight into the mechanisms of thermal char deactivation, and the degree of crystalline transformations has shown a strong correlation with reactivity changes in recent combustion studies [Davis et al., 1992, Beeley et al., 1996]. This task seeks to improve our understanding of char carbon crystalline transformations under combustion conditions by analyzing a large set of HRTEM fringe images for a series of flame-generated chars whose reactivities have been previously reported [Hurt et al., 1995, Beeley et al., 1996]. As a first step, a new technique is being developed for the quantitative analysis of fringe images, extending previous work to allow measurement of a complete set of crystal structure parameters including mean layer size, mean stacking height, interlayer spacing, layer curvature, amorphous fraction, and degree of anisotropy. The resulting database will revealing, at a very fundamental level, the basic differences in char crystal structure due to parent coal rank and to temperature history in the range of interest to combustion systems.

  4. Method and apparatus for acoustically monitoring the flow of suspended solid particulate matter. [Patent application; monitoring char flow in coal gasifier

    DOE Patents [OSTI]

    Roach, P.D.; Raptis, A.C.

    1980-11-24T23:59:59.000Z

    A method and apparatus for monitoring char flow in a coal gasifier system includes flow monitor circuits which measure acoustic attenuation caused by the presence of char in a char line and provides a char flow/no flow indication and an indication of relative char density. The flow monitor circuits compute the ratio of signals in two frequency bands, a first frequency band representative of background noise, and a second higher frequency band in which background noise is attenuated by the presence of char. Since the second frequency band contains higher frequencies, the ratio can be used to provide a flow/no flow indication. The second band can also be selected so that attenuation is monotonically related to particle concentration, providing a quantitative measure of char concentration.

  5. Digital image processing applications in the ignition and combustion of char/coal particles

    E-Print Network [OSTI]

    Kharbat, Esam Tawfiq

    1992-01-01T23:59:59.000Z

    pressure, and reduced bed heights in fluidized beds increase the volatile yields. Once released, volatiles undergo oxidation in the gas phase. During the volatile combustion period, the gas temperature is much higher than the particle temperatures... still reach the particle surface and heterogeneous combustion of fixed carbon and in situ volatile matter can proceed in parallel with gas phase combustion. Extensive theoretical and experimental studies characterizing char/coal isolated particles...

  6. The role of pore structure on char reactivity. Quarterly progress report, April 1995--June 1995

    SciTech Connect (OSTI)

    Sarofim, A.F.

    1995-07-01T23:59:59.000Z

    In order to examine the role of pore structure, studies will be conducted on coal chars in the electrodynamic balance. Larger particles will also be examined using a fluidized bed to examine diffusion control reactions, and soots will also be investigated to examine the role of meso-and micro-pores without macro-pore interference. These studies will allow a full range of particles sizes and temperatures to be investigated and eventually modelled.

  7. Adding value to coal conversion`s char: A strategy for lower-priced fuels

    SciTech Connect (OSTI)

    Kruse, C.W. [Illinois State Geological Survey, Champaign, IL (United States); Fatemi, M. [Amoco Corporation, Naperville, IL (United States); Feizoulof, C. [Univ. of Illinois, Urbana, IL (United States)

    1994-12-31T23:59:59.000Z

    Coal`s low hydrogen to carbon ratio gives coal physical properties that are not the most desired in fuel markets. The problem is dealt with in conversion technologies designed to upgrade coal to more desirable fuels by either: (1) chemically adding hydrogen, as in liquefaction or high-BTU gasification, or (2) the production of char, as in mild gasification. The first option is neither cost-effective nor environmentally sound. Liquefaction results in the production of one mole of carbon dioxide for each mole of hydrogen needed. The result is that despite the preferred hydrogen to carbon ratio in the fuel, carbon dioxide is produced in greater quantities than it would be by simply burning the coal. The depressed market value of char is the primary drawback of coal utilization technologies exercising the second option. Making value-added, non-fuel products from char could significantly improve the economics of overall operations and result in competitively-priced premium hydrocarbon fuels. The research goal of a growing number of groups, including ours, is to produce and describe carbon products which will command higher prices than the carbon (coal) from which they were produced.

  8. Char Crystalline Transformations During Coal Combustion and Their Implication for Carbon Burnout

    SciTech Connect (OSTI)

    Robert H. Hurt

    1997-12-30T23:59:59.000Z

    Recent work at Sandia National Laboratories, Imperial College, and the U.K. utility PowerGen, has identified an important mechanism believed to have a large influence on unburned carbon levels from pulverized coal fired boilers. That mechanism is char carbon crystalline rearrangements on subsecond times scales at temperatures of 1800 - 2500 K, which lead to char deactivation in the flame zones of furnaces. The so-called thermal annealing of carbons is a well known phenomenon, but its key role in carbon burnout has only recently been appreciated, and there is a lack of quantitative data in this time/temperature range. In addition, a new fundamental tool has recently become available to study crystalline transformations, namely high resolution transmission electron microscopy (HRTEM) fringe imaging, which provides a wealth of information on the nature and degree of crystallinity in carbon materials such as coal chars. Motivated by these new developments, this University Coal Research project has been initiated with the following two goals:  to determine transient, high-temperature, thermal deactivation kinetics as a function of parent coal and temperature history.  to characterize the effect of this thermal treatment on carbon crystalline structure through high-resolution transmission electron microscopy and specialized, quantitative image analysis. Work is currently underway on the following three tasks: Task 1 Experimental technique development. The goal of this task is to develop and demonstrate an apparatus and procedure for measuring transient, high-temperature, thermal deactivation of coal chars. While peak gas temperatures in boilers are often in the range 1800 - 2000 K, peak particle temperatures can be much higher due to high rates of heat release at the particle surface due to exothermic carbon oxidation. The prototype transient heat treatment apparatus is based on an inert-gas purged graphite-rod sample holder that is subjected to rapid Joule heating to temperatures approaching 3000 o C. For the measurement of temperature histories an optical diagnostic is being developed that offers sufficient spatial resolution to distinguish the sample temperature from the substrate temperature. The optical diagnostic is based on a CID camera, a high-power lens, and movable mirrors to projecting multiple, filtered images onto a single chip. Oxidation kinetics are measured on the heat treated samples by a nonisothermal TGA technique. Task 2 Thermal deactivation kinetics. The goal of this task is to quantify thermal char deactivation as a function of temperature history and parent coal, with an emphasis on inert environments at temperatures and times found in combustion systems. The results are to be cast in the form of deactivation kinetics useful for incorporation in combustion models.

  9. Bone loss during energy restriction: mechanistic role of leptin 

    E-Print Network [OSTI]

    Baek, Kyunghwa

    2009-05-15T23:59:59.000Z

    ), dual energy X-ray absorptiometry (DEXA) and mechanical testing. As a whole body measure, biochemical markers of bone turnover can be used to quantify changes in bone formation (e.g., osteocalcin, OC) and bone resorption (e.g., deoxypyridonoline...

  10. Irradiation Effects on Human Cortical Bone Fracture Behavior

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on different size scales within bone, as well as the role of sustained irradiation damage. Combining in situ mechanical testing with synchrotron x-ray diffraction imaging and...

  11. attenuates bone cancer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    human bone were studied via the small scale mechanical loading test. Failure analysis was conducted... Jang, Eunhwa 2012-10-19 19 ORIGINAL ARTICLE JBMR Cancer Treatment...

  12. Integrated methods for production of clean char and its combustion properties. [Quarterly] technical report, March 1, 1993--May 31, 1993

    SciTech Connect (OSTI)

    DeBarr, J.A.; Rostam-Abadi, M. [Illinois State Geological Survey, Champaign, IL (United States); Gullett, B.K. [Environmental Protection Agency, Research Triangle Park, NC (United States); Benson, S.A. [North Dakota Univ., Grand Forks, ND (United States). Energy and Environmental Research Center

    1993-09-01T23:59:59.000Z

    An integrated method consisting of physical coal cleaning, mild gasification (MG) and low temperature oxidation (LTO) is proposed to produce chars with SO{sub 2} emissions at least 50% lower than those of their parent coals. MG and char desulfurization studies are conducted in both a batch fluidized-bed reactor (FBR) and in a continuous rotary tube kiln (RTK). Combustion properties and ash deposition behaviors of desulfurized chars are determined at the US EPA in a 14 kill pilotscale combustor and at UNDEERC in a drop tube furnace (DTF). This project is cost-shared with the US EPA and the US DOE through UNDEERC. During the first year of this two year project, six coals from the IBC sample program (IBC-101, 102, 104, 105, 106 and 109) were studied. Under non-optimized conditions in the FBR, desulfurized chars were made with SO{sub 2} emissions 60--71% lower than the parent coals, depending on the coal. Chars prepared from four of the six coals had SO{sub 2} emissions less than 2.5 lbs SO{sub 2}/MMBtu. Under optimum conditions, SO{sub 2} emissions of one of the coals were reduced nearly 67%, from 4.60 to 1.49 lbs SO{sub 2}/MMBtu. MG reduced the chlorine content of one coal 93%.

  13. Oil production by entrained pyrolysis of biomass and processing of oil and char

    DOE Patents [OSTI]

    Knight, James A. (Atlanta, GA); Gorton, Charles W. (Atlanta, GA)

    1990-01-02T23:59:59.000Z

    Entrained pyrolysis of lignocellulosic material proceeds from a controlled pyrolysis-initiating temperature to completion of an oxygen free environment at atmospheric pressure and controlled residence time to provide a high yield recovery of pyrolysis oil together with char and non-condensable, combustible gases. The residence time is a function of gas flow rate and the initiating temperature is likewise a function of the gas flow rate, varying therewith. A controlled initiating temperature range of about 400.degree. C. to 550.degree. C. with corresponding gas flow rates to maximize oil yield is disclosed.

  14. Modelling Rates of Gasification of a Char Particle in Chemical Looping Combustion

    E-Print Network [OSTI]

    Saucedo, Marco A.; Dennis, John S.; Scott, Stuart A.

    2014-07-15T23:59:59.000Z

    with that in the initial particle. Keywords Chemical-looping combustion; gasification; coal; CO2 separation; fluidisation 3 Nomenclature 12ckA Pre-exponential factor for the rate constant 2ck1, mol s -1 g-1 bar-1 12ckA Pre-exponential factor for the rate constant 2ck2... 1 Modelling Rates of Gasification of a Char Particle in Chemical Looping Combustion Marco A. Saucedoa*, John S. Dennisa, Stuart A. Scottb aDepartment of Chemical Engineering and Biotechnology, University of Cambridge, Pembroke Street, Cambridge...

  15. Char crystalline transformations during coal combustion and their implications for carbon burnout

    SciTech Connect (OSTI)

    Hurt, R.H.

    1999-07-07T23:59:59.000Z

    Residual, or unburned carbon in fly ash affects many aspects of power plant performance and economy including boiler efficiency, electrostatic precipitator operation, and ash as a salable byproduct. There is a large concern in industry on the unburned carbon problem due to a variety of factors, including low-NOx combustion system and internationalization of the coal market. In recent work, it has been found that residual carbon extracted from fly ash is much less reactive than the laboratory chars on which the current kinetics are based. It has been suggested that thermal deactivation at the peak temperature in combustion is a likely phenomenon and that the structural ordering is one key mechanism. The general phenomenon of carbon thermal annealing is well known, but there is a critical need for more data on the temperature and time scale of interest to combustion. In addition, high resolution transmission electron microscopy (HRTEM) fringe imaging, which provides a wealth of information on the nature and degree of crystallinity in carbon materials such as coal chars, has become available. Motivated by these new developments, this University Coal Research project has been initiated with the following goals: (1) To determine transient, high-temperature, thermal deactivation kinetics as a function of parent coal and temperature history. (2) To characterize the effect of the thermal treatment on carbon crystalline structure through high-resolution transmission electron microscopy and specialized, quantitative image analysis.

  16. Char crystalline transformations during coal combustion and their implications for carbon burnout

    SciTech Connect (OSTI)

    Hurt, R.H.

    1999-03-11T23:59:59.000Z

    Residual, or unburned carbon in fly ash affects many aspects of power plant performance and economy including boiler efficiency, electrostatic precipitator operation, and ash as a salable byproduct. There is a large concern in industry on the unburned carbon problem due to a variety of factors, including low-NOx combustion system and internationalization of the coal market. In recent work, it has been found that residual carbon extracted from fly ash is much less reactive than the laboratory chars on which the current kinetics are based. It has been suggested that thermal deactivation at the peak temperature in combustion is a likely phenomenon and that the structural ordering is one key mechanism. The general phenomenon of carbon thermal annealing is well known, but there is a critical need for more data on the temperature and time scale of interest to combustion. In addition, high resolution transmission electron microscopy (HRTEM) fringe imaging, which provides a wealth of information on the nature and degree of crystallinity in carbon materials such as coal chars, has become available. Motivated by these new developments, this University Coal Research project has been initiated with the following goals: to determine transient, high-temperature, thermal deactivation kinetics as a function of parent coal and temperature history; and to characterize the effect of this thermal treatment on carbon crystalline structure through high-resolution transmission electron microscopy and specialized, quantitative image analysis.

  17. Characterization and biodegradation of water-soluble biomarkers and organic carbon extracted from low temperature chars

    SciTech Connect (OSTI)

    Norwood, Matt J.; Louchouarn, Patrick; Kuo, Li-Jung; Harvey, Omar

    2013-03-16T23:59:59.000Z

    This study demonstrates that wildfires/biomass combustion may be an important source of labile pyrogenic water-soluble organic matter (Py-WSOM) to aquatic systems. Spectroscopic analysis (of the solid char and Py-WSOM) with Fourier transform infrared spectroscopy (FTIR) indicated that the Py-WSOM extracted from two low temperature chars (one wood, one grass) was dominated by polar moieties (-OH and C-O) derived from depolymerization and fragmentation of lignocellulose. Incubation experiments under aerobic conditions with unsterilized river water suggested that Py-WSOM and associated biomarkers may have turnover rates on the order of weeks to months, consistent with mixing and transport conditions of riverine systems. For example, pyrogenic dissolved organic carbon (Py-DOC) had a half-life of 30-40 days. Turnover rate for the combustion biomarkers was shorter, with levoglucosan and free lignin phenols having a half-life around 3-4 days and polymeric lignin components 13-14 days. The latter observations contradict earlier studies on the biodegradation of dissolved lignin and point to the need for re-assessment of lignin degradation kinetics in well-mixed riverine systems, particularly when such lignin components are derived from thermally altered plant material that may exist in a form more labile than that in highly processed riverine DOM.

  18. Bone Cancer Rates in Dinosaurs Compared with Modern Vertebrates

    E-Print Network [OSTI]

    L. C. Natarajan; A. L. Melott; B. M. Rothschild; L. D. Martin

    2007-10-16T23:59:59.000Z

    Data on the prevalence of bone cancer in dinosaurs is available from past radiological examination of preserved bones. We statistically test this data for consistency with rates extrapolated from information on bone cancer in modern vertebrates, and find that there is no evidence of a different rate. Thus, this test provides no support for a possible role of ionizing radiation in the K-T extinction event.

  19. INVEST IN YOUR BONES Bone Basics

    E-Print Network [OSTI]

    replace- ment at menopause may prevent bone loss and/or osteoporosis. Also find out if there is a need in your bones? Osteoporosis, a major health problem in America, affects over 10 million persons, with 34 million at a high risk of developing the disease (National Osteoporosis Foundation, 2010). Dubbed

  20. Cooperative research on the combustion characteristics of cofired desulfurized Illinois coal and char with natural gas. Final technical report, September 1, 1991--August 31, 1992

    SciTech Connect (OSTI)

    Buckius, R.O.; Wu, Cheng-Kang; Krier, H.; Peters, J.E. [Illinois Univ., Urbana-Champaign, IL (United States)

    1992-12-31T23:59:59.000Z

    The DTFF is extended to larger sample collecting capability and higher temperatures, resulting in the establishment of the Ash Characterization Facility and the High Temperature Drop Tube Furnace. The Ash Characterization Facility enables continuous coal injection and sampling under controlled conditions. Several hundred milligrams of char or ash can be collected in one-half hour. The High Temperature Drop Tube Furnace uses a plasma torch to preheat the gas to over 2000 K and inject it into a ceramic tube which enters a furnace designed for 1700{degrees}C (1973 K) operation, so that temperatures and heating rates encountered by pulverized coal particles in the flames of large boilers or in the advanced slagging cyclone combustors can be simulated. An aerodynamic coal feeder works well in supplying coal continuously to the drop tube. A watercooled, Helium-quench sampling probe collects the solid samples. A scanning electron microscope is used to study the morphology of ash and char particles. A sulfur determinator, a gas chromatograph provide analytical means in the laboratory, and the Illinois State Geological Survey performs other necessary analyses of the samples. Tests on cofiring coal with I to 4% methane show that sulfur retention in ash was related to temperature and residence time. The addition of methane caused changes in gas temperature profile in the tube and also changes in chemical composition of the gases. The overall effect on sulfur retention is seen to be a result of several complex interacting factors. Further detailed studies are necessary to clarify the contribution of each factor and to provide clues to the mechanism of the process.

  1. ACS Div of Fuel Chem Preprints 44:4, 1016-1019 (August, 1999) KINETICS OF HIGH PRESSURE CHAR OXIDATION

    E-Print Network [OSTI]

    Fletcher, Thomas H.

    ACS Div of Fuel Chem Preprints 44:4, 1016-1019 (August, 1999) KINETICS OF HIGH PRESSURE CHAR) by devolatilizing Pittsburgh #8 coal at #12;ACS Div of Fuel Chem Preprints 44:4, 1016-1019 (August, 1999) high

  2. Evaluation of charred porous polymers as a method of storm water pollution prevention for shipyards

    SciTech Connect (OSTI)

    Clark, G.E.

    1998-08-01T23:59:59.000Z

    Most shipyards have viable Best Management Practices (BMPs) in place to mitigate the transport of heavy metals to surface waters by storm water. Despite aggressive efforts to control storm water, shipyards have come under increased regulatory pressure to further reduce concentrations of heavy metals, such as copper and nickel, in storm water discharges. The tightening of regulatory requirements warrants research into additional BMPs. The objectives of this research project were to: (1) determine the feasibility of placing a replaceable cartridge of adsorbent material within a storm water collection system; and (2) evaluate two commercially available charred porous polymer adsorbents for the removal of heavy metals from storm water. The results indicated that there are commercially available storm water treatment components which could be adapted to house a cartridge of porous adsorbent material.

  3. Char particle fragmentation and its effects on unburned carbon during pulverized coal combustion. Quarterly report, January 1, 1995--March 31, 1995

    SciTech Connect (OSTI)

    Mitchell, R.E.

    1995-08-01T23:59:59.000Z

    This document is the tenth quarterly status report of work on a project concerned with the fragmentation of char particles during pulverized coal combustion that is being conducted at the High Temperature Gasdynamics Laboratory at Stanford University. The project is intended to satisfy, in part, PETC`s research efforts to understand the chemical and physical processes that govern coal combustion. The work is pertinent to the char oxidation phase of coal combustion and focuses on how the fragmentation of coal char particles affects overall mass loss rates and how char fragmentation phenomena influence coal conversion efficiency. The knowledge and information obtained will allow the development of engineering models that can be used to predict accurately char particle temperatures and total mass loss rates during pulverized coal combustion. The overall objectives of the project are: (1) to characterize fragmentation events as a function of combustion environment, (2) to characterize fragmentation with respect to particle porosity and mineral loadings, (3) to assess overall mass loss rates with respect to particle fragmentation, and (4) to quantify the impact of fragmentation on unburned carbon in ash. The knowledge obtained during the course of this project will be used to predict accurately the overall mass loss rates of coals based on the mineral content and porosity of their chars. The work will provide a means of assessing reasons for unburned carbon in the ash of coal fired boilers and furnaces. Accomplishments for this period are presented for Task 3, char fragmentation studies and Task 4, fragmentation modelling.

  4. Production and use of activated char for combined SO{sub 2}/NO{sub x} removal. [Quarterly] technical report, December 1, 1993--February 28, 1994

    SciTech Connect (OSTI)

    Lizzio, A.A.; DeBarr, J.A.; Rostram-Abadi, M. [Illinois State Geological Survey, Champaign, IL (United States); Rood, M.J. [Illinois Univ., Urbana, IL (United States)

    1994-06-01T23:59:59.000Z

    During this reporting period, a thermogravimetric technique was developed to determine the kinetics of SO{sub 2} adsorption on a series of chars prepared from IBC-102 coal. Also, a temperature programmed desorption (TPD) method was developed to determine the nature and extent of carbon-oxygen (C-O) complexes formed on the surface of the char. An attempt was made to relate this information to observed SO{sub 2} adsorption behavior. An IBC-102 char prepared with an N{sub 2}-BET surface area of 10 m{sup 2}/g adsorbed significantly less SO{sub 2} than chars prepared with surface areas > 200 m{sup 2}/g. However, for chars with surface areas > 200 m{sup 2}/g, the amount of available surface area was not as important as the chemistry of the surface. A steam activated char adsorbed the most SO{sub 2}, comparable to the amount adsorbed by a commercial activated carbon. TPD performed on the steam activated char revealed the presence of CO-forming C-O complexes which were basic in nature. The other chars all contained significant amounts of more acidic CO{sub 2}-forming complexes. Because SO{sub 2} is an acid gas, a carbon adsorbent with a basic surface should adsorb more SO{sub 2}. To enhance SO{sub 2} adsorption, a novel char preparation method was devised to 2 create a basic surface with up to ten times more CO-forming C-O complexes than formed by steam activation.

  5. Integrated production/use of ultra low-ash coal, premium liquids and clean char. [Quarterly] report, December 1, 1991--February 29, 1992

    SciTech Connect (OSTI)

    Kruse, C.W. [Illinois State Geological Survey, Champaign, IL (United States)

    1992-08-01T23:59:59.000Z

    The first step in the integrated, mufti-product approach for utilizing Illinois coal is the production of ultra low-ash coal. Subsequent steps convert low-ash coal to high-value, coal-derived, products. The ultra low-ash coal is produced by solubilizing coal in a phenolic solvent under ChemCoal{trademark} process conditions, separating the coal solution from insoluble ash, and then precipitating the clean coal by dilution of the solvent with methanol. Two major products, liquids and low-ash char, are then produced by mild gasification of the low-ash coal. The low ash-char is further upgraded to activated char, and/or an oxidized activated char which has catalytic properties. Characterization of products at each stage is part of this project.

  6. Integrated production/use of ultra low-ash coal, premium liquids and clean char. Technical report, September 1, 1991--November 30, 1991

    SciTech Connect (OSTI)

    Kruse, C.W.

    1991-12-31T23:59:59.000Z

    This integrated, multi-product approach for utilizing Illinois coal starts with the production of ultra low-ash coal and then converts it to high-vale, coal-derived, products. The ultra low-ash coal is produced by solubilizing coal in a phenolic solvent under ChemCoal{trademark} process conditions, separating the coal solution from insoluble ash, and then precipitating the clean coal by dilution of the solvent with methanol. Two major products, liquids and low-ash char, are then produced by mild gasification of the low-ash coal. The low ash-char is further upgraded to activated char, and/or an oxidized activated char which has catalytic properties. Characterization of products at each stage is part of this project.

  7. Analyzing organic sulfur in coal/char: Integrated mild gasification/XANES methods. Technical report, 1 March--31 May 1994

    SciTech Connect (OSTI)

    Palmer, S.R. [Southern Illinois Univ., Carbondale, IL (United States). Dept. of Mechanical Engineering and Energy Processes; Huffman, G.P. [Kentucky Univ., Lexington, KY (United States)

    1994-09-01T23:59:59.000Z

    The overall goal of this study is to improve the understanding of sulfur in coals/chars via the use of combined advanced non-destructive and advanced destructive methods of sulfur analysis. This study combines selective oxidation, analytical pyrolysis, and sulfur X-ray Absorption Near Edge Structure Spectroscopy (XANES) analysis. Samples with a wide variety of sulfur contents, (0.63% to 4.40%) have been prepared for use in this study. This includes steam gasification chars, oxidized coals and desulfurized coals as well of the original unaltered coals. Mild pyrolysis and preliminary XANES data shows that the sulfur chemistry of gasification chars is significantly different from that of the original coals. Mild pyrolysis of the samples that were oxidized with peroxyacetic acid showed that the level of simple thiophene structures observed in the pyrolysis products declines with increasing levels of oxidation. Sulfur XANES spectra of treated samples showed various effects depending on the treatment severity. For the less severely treated samples (demineralization and solvent extraction), the XANES spectra were similar, although not identical, to the untreated coal spectra, whereas the more severe treatments (steam at 450 C; peroxyacetic acid at 25 C) showed preferential oxidation of one or more sulfur-bearing phases in the original coal. Additional samples have recently been examined by XANES and W-band EPR and the data is currently being processed and evaluated.

  8. Biodegradable synthetic bone composites

    DOE Patents [OSTI]

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01T23:59:59.000Z

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  9. Structural characteristics and gasification reactivity of chars prepared from K{sub 2}CO{sub 3} mixed HyperCoals and coals

    SciTech Connect (OSTI)

    Atul Sharma; Hiroyuki Kawashima; Ikuo Saito; Toshimasa Takanohashi [National Institute of Advanced Industrial Science and Technology, Ibaraki (Japan). Advanced Fuel Group

    2009-04-15T23:59:59.000Z

    HyperCoal is a clean coal with mineral matter content <0.05 wt %. Oaky Creek (C = 82%), and Pasir (C = 68%) coals were subjected to solvent extraction method to prepare Oaky Creek HyperCoal, and Pasir HyperCoal. Experiments were carried out to compare the gasification reactivity of HyperCoals and parent raw coals with 20, 40, 50 and 60% K{sub 2}CO{sub 3} as a catalyst at 600, 650, 700, and 775{sup o}C with steam. Gasification rates of coals and HyperCoals were strongly influenced by the temperature and catalyst loading. Catalytic steam gasification of HyperCoal chars was found to be chemical reaction controlled in the 600-700{sup o}C temperature range for all catalyst loadings. Gasification rates of HyperCoal chars were found to be always higher than parent coals at any given temperature for all catalyst loadings. However, X-ray diffraction results showed that the microstructures of chars prepared from coals and HyperCoals were similar. Results from nuclear magnetic resonance spectroscopy show no significant difference between the chemical compositions of the chars. Significant differences were observed from scanning electron microscopy images, which showed that the chars from HyperCoals had coral-reef like structures whereas dense chars were observed for coals. 26 refs., 8 figs., 2 tabs.

  10. A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone Marrow Mesenchymal Stem Cell Transplantation

    E-Print Network [OSTI]

    Miga, Michael I.

    A Novel Inverse Finite Element Analysis to Assess Bone Fracture Healing in Mice Receiving Bone generation, and an iterative optimization (using finite element analysis) of the fracture callus material approach includes acquisition of microCT image volumes, biomechanical testing, finite element mesh

  11. A Graph-based Approach for Computational Model of Bone Microstructure

    E-Print Network [OSTI]

    Buffalo, State University of New York

    azhang@buffalo.edu ABSTRACT Osteoporosis, a condition in which bones become fragile and more likely bone due to osteoporosis. The diagnosis of osteoporosis is commonly done by tests that measure for the diagnosis of osteoporosis are limited due to the lack of good measurements of bone quality. In this paper

  12. Rapid gasification of nascent char in steam atmosphere during the pyrolysis of Na- and Ca-ion-exchanged brown coals in a drop-tube reactor

    SciTech Connect (OSTI)

    Ondej Maek; Sou Hosokai; Koyo Norinaga; Chun-Zhu Li; Jun-ichiro Hayashi [Hokkaido University, Kita-ku (Japan). Center for Advanced Research of Energy Conversion Materials

    2009-09-15T23:59:59.000Z

    Several recent studies on in situ steam gasification of coal suggest a possibility of extremely fast steam gasification of char from rapid pyrolysis of pulverized brown coal. The unprecedented rate of char steam gasification can be achieved by exposing nascent char, that is, after tar evolution (temperature range >600{sup o}C), but before devolatilization (<900{sup o}C), to steam in the presence of Na and/or Ca dispersed in/on the char. In this study, we conducted rapid pyrolysis experiments using ion-exchanged Loy Yang brown coal samples, that is, H-form coal with Na/Ca contents <0.001 wt %, Na-form coal with Na content = 2.8 wt % and Ca-form coal with Ca content = 3.2 wt %. These samples were pyrolyzed in an atmospheric drop-tube reactor at a temperature of 900{sup o}C, inlet steam concentration of 50 vol. %, and a particle residence times of 2.8 s. The char yields from the pyrolysis of Na-form and Ca-form coals were as low as 12 and 33% on the respective coal carbon bases, and accounted for only 18 and 53% of the char yields from the full devolatilization of the respective coals at 900{sup o}C. In addition, the pyrolysis also consumed as much as 0.7-1.1 mol of H{sub 2}O per mol of coal C. On the other hand, the nascent char from the H-form coal allowed carbon deposition from the nascent tar, resulting in a char yield as high as 115% of that from the full devolatilization. The chars from the Na-form and Ca-form coals also acted as catalysts for steam reforming of tar, which was evidenced by significant negative synergistic effects of blending of H-form coal with Na-form coal or Ca-form coal on the tar and soot yields. 57 refs., 6 figs.

  13. Pyrolysis of waste animal fats in a fixed-bed reactor: Production and characterization of bio-oil and bio-char

    SciTech Connect (OSTI)

    Ben Hassen-Trabelsi, A., E-mail: aidabenhassen@yahoo.fr [Centre de Recherche et de Technologies de l’Energie (CRTEn), Technopôle Borj-Cédria, B.P 95, 2050, Hammam Lif (Tunisia); Kraiem, T. [Centre de Recherche et de Technologies de l’Energie (CRTEn), Technopôle Borj-Cédria, B.P 95, 2050, Hammam Lif (Tunisia); Département de Géologie, Université de Tunis, 2092, Tunis (Tunisia); Naoui, S. [Centre de Recherche et de Technologies de l’Energie (CRTEn), Technopôle Borj-Cédria, B.P 95, 2050, Hammam Lif (Tunisia); Belayouni, H. [Département de Géologie, Université de Tunis, 2092, Tunis (Tunisia)

    2014-01-15T23:59:59.000Z

    Highlights: • Produced bio-fuels (bio-oil and bio-char) from some animal fatty wastes. • Investigated the effects of main parameters on pyrolysis products distribution. • Determined the suitable conditions for the production of the maximum of bio-oil. • Characterized bio-oils and bio-chars obtained from several animal fatty wastes. - Abstract: Several animal (lamb, poultry and swine) fatty wastes were pyrolyzed under nitrogen, in a laboratory scale fixed-bed reactor and the main products (liquid bio-oil, solid bio-char and syngas) were obtained. The purpose of this study is to produce and characterize bio-oil and bio-char obtained from pyrolysis of animal fatty wastes. The maximum production of bio-oil was achieved at a pyrolysis temperature of 500 °C and a heating rate of 5 °C/min. The chemical (GC–MS analyses) and spectroscopic analyses (FTIR analyses) of bio-oil showed that it is a complex mixture consisting of different classes of organic compounds, i.e., hydrocarbons (alkanes, alkenes, cyclic compounds…etc.), carboxylic acids, aldehydes, ketones, esters,…etc. According to fuel properties, produced bio-oils showed good properties, suitable for its use as an engine fuel or as a potential source for synthetic fuels and chemical feedstock. Obtained bio-chars had low carbon content and high ash content which make them unattractive for as renewable source energy.

  14. Invest in Your Bones Bone Mineral Calcium and Vitamin D

    E-Print Network [OSTI]

    beans, eggs, and nuts. Sardines and salmon with bones, oysters, kidney beans, and tofu made with calcium

  15. Coal combustion science: Task 1, Coal char combustion: Task 2, Fate of mineral matter. Quarterly progress report, July--September 1993

    SciTech Connect (OSTI)

    Hardesty, D.R. [ed.; Hurt, R.H.; Davis, K.A.; Baxter, L.L.

    1994-07-01T23:59:59.000Z

    Progress reports are presented for the following tasks: (1) kinetics and mechanisms of pulverized coal char combustion and (2) fate of inorganic material during coal combustion. The objective of Task 1 is to characterize the combustion behavior of selected US coals under conditions relevant to industrial pulverized coal-fired furnaces. In Sandia`s Coal Combustion Laboratory (CCL), optical techniques are used to obtain high-resolution images of individual burning coal char particles and to measure, in situ, their temperatures, sizes, and velocities. Detailed models of combustion transport processes are then used to determine kinetic parameters describing the combustion behavior as a function of coal type and combustion environment. Partially reacted char particles are also sampled and characterized with advanced materials diagnostics to understand the critical physical and chemical transformations that influence reaction rates and burnout times. The ultimate goal of the task is the establishment of a data base of the high temperature reactivities of chars from strategic US coals, from which important trends may be identified and predictive capabilities developed. The overall objectives for task 2 are: (1) to complete experimental and theoretical investigation of ash release mechanisms; (2) to complete experimental work on char fragmentation; (3) to establish the extent of coal (as opposed to char) fragmentation as a function of coal type and particle size; (4) to develop diagnostic capabilities for in situ, real-time, qualitative indications of surface species composition during ash deposition, with work continuing into FY94; (5) to develop diagnostic capabilities for in situ, real-time qualitative detection of inorganic vapor concentrations; and (6) to conduct a literature survey on the current state of understanding of ash deposition, with work continuing into FY94.

  16. Study on the effect of heat treatment and gasification on the carbon structure of coal chars and metallurgical cokes using fourier transform Raman spectroscopy

    SciTech Connect (OSTI)

    S. Dong; P. Alvarez; N. Paterson; D.R. Dugwell; R. Kandiyoti [Imperial College London, London (United Kingdom). Department of Chemical Engineering

    2009-03-15T23:59:59.000Z

    Differences in the development of carbon structures between coal chars and metallurgical cokes during high-temperature reactions have been investigated using Raman spectroscopy. These are important to differentiate between different types of carbons in dust recovered from the top gas of the blast furnace. Coal chars have been prepared from a typical injectant coal under different heat-treatment conditions. These chars reflected the effect of peak temperature, residence time at peak temperature, heating rate and pressure on the evolution of their carbon structures. The independent effect of gasification on the development of the carbon structure of a representative coal char has also been studied. A similar investigation has also been carried out to study the effect of heat-treatment temperature (from 1300 to 2000{sup o}C) and gasification on the carbon structure of a typical metallurgical coke. Two Raman spectral parameters, the intensity ratio of the D band to the G band (I{sub D}/I{sub G}) and the intensity ratio of the valley between D and G bands to the G band (I{sub V}/I{sub G}), have been found useful in assessing changes in carbon structure. An increase in I{sub D}/I{sub G} indicates the growth of basic graphene structural units across the temperature range studied. A decrease in I{sub V}/I{sub G} appears to suggest the elimination of amorphous carbonaceous materials and ordering of the overall carbon structure. The Raman spectral differences observed between coal chars and metallurgical cokes are considered to result from the difference in the time-temperature history between the raw injectant coal and the metallurgical coke and may lay the basis for differentiation between metallurgical coke fines and coal char residues present in the dust carried over the top of the blast furnace. 41 refs., 17 figs., 3 tabs.

  17. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-05-09T23:59:59.000Z

    A device is described for stimulating bone tissue by applying a low level alternating current signal directly to the patient`s skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures. 5 figs.

  18. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1995-01-01T23:59:59.000Z

    A device for stimulating bone tissue by applying a low level alternating current signal directly to the patient's skin. A crystal oscillator, a binary divider chain and digital logic gates are used to generate the desired waveforms that reproduce the natural electrical characteristics found in bone tissue needed for stimulating bone growth and treating osteoporosis. The device, powered by a battery, contains a switch allowing selection of the correct waveform for bone growth stimulation or osteoporosis treatment so that, when attached to the skin of the patient using standard skin contact electrodes, the correct signal is communicated to the underlying bone structures.

  19. Char crystalline transformations during coal combustion and their implications for carbon burnout. Semiannual technical progress report, July 1, 1996--January 1, 1997

    SciTech Connect (OSTI)

    Hurt, R.H.

    1997-06-01T23:59:59.000Z

    This paper reports on research concerned with coal combustion and the crystal transformations of coal chars. Goals were to: determine transient high-temperature deactivation kinetics as a function of parent coal; and to characterize the effect of thermal treatments on the carbon crystal structure.

  20. Production and use of activated char for combined SO{sub 2}/NO{sub x} removal. Technical report, September 1--November 30, 1993

    SciTech Connect (OSTI)

    Lizzio, A.A.; DeBarr, J.A.; Rostam-Abadi, M. [Illinois Dept. of Energy and Natural Resources, Springfield, IL (United States). Geological Survey

    1993-12-31T23:59:59.000Z

    Carbon adsorbents have been shown to remove sulfur oxides from flue gas, and also serve as a catalyst for reduction of nitrogen oxides at temperatures between 80 and 150{degrees}C. The overall objective of this project is to determine whether Illinois coal is a suitable feed stock for the production of activated char which could be used as a catalyst for removal of SO{sub 2}/NO{sub x} from combustion flue gas, and to evaluate the potential application of the products in flue gas cleanup. Key production variables will be identified to help design and engineer activated char with the proper pore structure and surface chemistry. During this reporting period, a series of chats was prepared from an Illinois coal (IBC-102). A 48{times}100 mesh size fraction of IBC-102 coal was physically cleaned to reduce its ash content from 5.5 to 3.6%. The clean coal was pyrolyzed in a fluidized-bed reactor at 500, 700 and 900{degrees}C. The surface area and oxygen content of the char was varied either by oxidation in 10% O{sub 2} or by nitric acid treatment. Steam activation or chemical activation using potassium hydroxide was employed to enhance surface area development. Nitrogen BET surface areas of the chars ranged from 1 to 800 M{sup 2}/g.

  1. TRP0033 - PCI Coal Combustion Behavior and Residual Coal Char Carryover in the Blast Furnace of 3 American Steel Companies during Pulverized Coal Injection (PCI) at High Rates

    SciTech Connect (OSTI)

    Veena Sahajwalla; Sushil Gupta

    2005-04-15T23:59:59.000Z

    Combustion behavior of pulverized coals (PC), gasification and thermal annealing of cokes were investigated under controlled environments. Physical and chemical properties of PCI, coke and carbon residues of blast furnace dust/sludge samples were characterized. The strong influence of carbon structure and minerals on PCI reactivity was demonstrated. A technique to characterize char carryover in off gas emissions was established.

  2. Methods and modeling for the reduced platen compression of cancellous bone in the rodent proximal tibia 

    E-Print Network [OSTI]

    Rogers, William Elliott

    2002-01-01T23:59:59.000Z

    This study focused on the reduced platen compression (RPC) test of cancellous bone in the rodent proximal tibia. The objective was to improve methods for this mechanical test, specifically in the areas of specimen location, specimen preparation...

  3. INVEST IN YOUR BONES Living with Osteoporosis

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Living with Osteoporosis Leaflet 5 Living with osteoporosis can be done environment safe to avoid falls. Early detection of bone loss or osteoporosis is now possible with bone to be most effective in reducing bone loss during the five to ten years following menopause, when bone loss

  4. Evaluation of Infrasound and Strobe Lights for Eliciting Avoidance Behavior in Juvenile Salmon and Char

    SciTech Connect (OSTI)

    Mueller, Robert P. (BATTELLE (PACIFIC NW LAB)); Neitzel, Duane A. (BATTELLE (PACIFIC NW LAB)); Amidan, Brett G. (BATTELLE (PACIFIC NW LAB))

    2001-12-01T23:59:59.000Z

    Laboratory tests were conducted using juvenile chinook salmon Oncorhynchus tshawytscha, brook trout Salvelinus fontinalis, and rainbow trout O. mykiss to determine specific behavior responses to infrasound (< 20 Hz) and flashing strobe lights. The objective of these tests was to determine if juvenile salmonids could be deterred from entrainment at water diversion structures. Caged fish were acclimated in a static test tank and their behavior was recorded using low light cameras. Species-specific behavior was characterized by measuring movements of the fish within the cage and by observing startle and habituation responses. Wild chinook salmon (40-45 mm TL) and hatchery reared chinook salmon (45-50 mm TL) exhibited avoidance responses when initially exposed to a 10-Hz volume displacement source of infrasound. Rainbow and eastern brook trout (25-100 mm TL) did not respond with avoidance or other behaviors to infrasound. Evidence of habituation to the infrasound source was evident for chinook salmon during repeated exposures. Wild and hatchery chinook displayed a higher proportion of movement during the initial exposures to infrasound when the acclimation period in the test tank was 2-3 h as compared to a 12-15 h acclimation period. A flashing strobe light produced consistent movement in wild chinook salmon (60% of the tests), hatchery reared chinook salmon (50%), and rainbow trout (80%). No measurable responses were observed for brook trout. Results indicate that consistent, repeatable responses can be elicited from some fish using high-intensity strobe lights under a controlled laboratory testing. The species specific behaviors observed in these experiments might be used to predict how fish might react to low-frequency sound and strobe lights in a screening facility.

  5. Endocortical bone loss in osteoporosis: the role of bone surface availability

    E-Print Network [OSTI]

    Buenzli, Pascal R; Clement, John G; Pivonka, Peter

    2012-01-01T23:59:59.000Z

    Age-related bone loss and postmenopausal osteoporosis are disorders of bone remodelling, in which less bone is reformed than resorbed. Yet, this dysregulation of bone remodelling does not occur equally in all bone regions. Loss of bone is more pronounced near the endocortex, leading to cortical wall thinning and medullary cavity expansion, a process sometimes referred to as "trabecularisation" or "cancellisation". Cortical wall thinning is of primary concern in osteoporosis due to the strong reduction in bone mechanical properties that it is associated with. In this paper, we examine the possibility that the nonuniformity of microscopic bone surface availability could explain the nonuniformity of bone loss in osteoporosis. We use a simple computational model of bone remodelling, in which microscopic bone surface availability influences bone turnover rate, to simulate the evolution of the bone volume fraction profile across the midshaft of a long bone. We find that bone loss is accelerated near the endocortica...

  6. Correlating mechanical properties of cancellous bone in the rat with various density measures 

    E-Print Network [OSTI]

    Ramaswamy, Ramya

    2004-09-30T23:59:59.000Z

    , and to correlate the mechanical properties of the rodent cancellous bone with the various density measures. Analytical studies were made to assess the effect of the size and shape of the platen based on the values from mechanical testing of the cancellous bone...

  7. Char crystalline transformations during coal combustion and their implications for carbon burnout. Semiannual technical progress report, July 1, 1995--January 1, 1996

    SciTech Connect (OSTI)

    Hurt, R.H.

    1996-05-01T23:59:59.000Z

    Recent work at Sandia National Laboratories, Imperial College, and the U.K. utility PowerGen, has identified an important mechanism believed to have a large influence on unburned carbon levels from pulverized coal fired boilers. That mechanism is char carbon crystalline rearrangements on subsecond times scales at temperatures of 1,800--2,500 K, which lead to char deactivation in the flame zones of furnaces. The so-called thermal annealing of carbons is a well known phenomenon, but its key role in carbon burnout has only recently been appreciated, and there is a lack of quantitative data in this time/temperature range. In addition, a new fundamental tool has recently become available to study crystalline transformations, namely high resolution transmission electron microscopy (HRTEM) fringe imaging, which provides a wealth of information on the nature and degree of crystallinity in carbon materials such as coal chars. Motivated by these new developments, this University Coal Research project has been initiated with the following three goals: to determine transient, high-temperature, thermal deactivation kinetics as a function of parent coal and temperature history; and to characterize the effect of this thermal treatment on carbon crystalline structure through high-resolution transmission electron microscopy and specialized, quantitative image analysis. Work is currently underway on the following three tasks: experimental technique development; thermal deactivation kinetics; and crystal structure characterization. This report discusses the development of the transient heat treatment apparatus, and new algorithms for HRTEM image analysis.

  8. Production and use of activated char for combined SO{sub 2}/NO{sub x} removal. [Quarterly] technical report, September 1--November 30, 1994

    SciTech Connect (OSTI)

    Lizzio, A.A.; DeBarr, J.A.; Donnals, G.L.; Feizoulof, C.A.; Kruse, C.W.; Lytle, J.M. [Illinois State Geological Survey (United States); Rood, M.J. [Illinois Univ., Urbana, IL (United States); Gangwal, S.K. [Research Triangle Inst., Research Triangle Park, NC (United States); Honea, F. [Illinois Clean Coal Inst., Carterville, IL (United States)

    1994-12-31T23:59:59.000Z

    Carbon adsorbents have been shown to remove sulfur oxides from flue gas, and also serve as a catalyst for reduction of nitrogen oxides at temperatures between 80 and 150{degree}C. The overall objective of this project is to determine whether Illinois coal is a suitable feedstock for the production of activated char which could be used as a catalyst for combined SO{sub 2}/NO{sub x} removal, and to evaluate the potential application of the products in flue gas cleanup. During this quarter, further analyses of SO{sub 2} adsorption and TPD data revealed that SO{sub 2} adsorption was directly proportional to the number of unoccuppied (free) adsorption sites on the carbon surface. The SO{sub 2} capacity of a series of prepared IBC-102 chars and commercial activated carbons normalized with respect to the number of free sites varied by less than a factor of two, which indicated an excellent correlation. Based on these results, a mechanism for SO{sub 2} adsorption on carbon and conversion to H{sub 2}SO{sub 4} was proposed. To study NO{sub x} reduction by activated char, a packed bed flow through system was designed and constructed. A quadrupole mass spectrometer was installed to monitor the [NO] and [NO{sub 2}]; NO breakthrough curves were obtained for a commercial activated carbon at various [NO].

  9. Understanding the Interactions of Collagen with Mineral in Bone: Working Towards Developing a Realistic Composite

    E-Print Network [OSTI]

    Greenaway, Alan

    . · Mini-project on bone nodule formation. · Neutron scattering on whole bone. · Analysis of bone explants

  10. Mechanical bone strength in the proximal tibia 

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    KNEE REPLACEMENT 3 2. 1 Mechanics of the Knee 2. 1. 1 knee Structure. 2. 1. 2 Bone Strength of Proximal Tibia. 2. 2 Total Knee Replacement. '2. 3 Research Prospective III MECHANICS OF MATERIALS. . 3 3 5 7 8 10 3. 1 Normal Stress and Strain... Specimens. 4. 1. 2 Mechanical Test. . 4. 2 Statistical Analysis. . . . . . . . . . . . . 18 18 18 19 V RESULTS AND CONCLUSIONS. 20 5. 1 Results. . 20 5. 2 Discussion and Conclusions. Page 24 REFERENCES. 27 VITA. 29 LIST OF FIGURES FIGURE 2. 1...

  11. Regulation of thrombopoietin in bone marrow

    E-Print Network [OSTI]

    McIntosh, Bryan James

    2007-01-01T23:59:59.000Z

    R: gacagagttagtcttgccactgcaa Prb: actgatttgctcctggcggccatMutant prb: tggagctgactgatttactactagcagcaatgc Cyclophilin (L: tggcacatgaatcctggaata Prb: ttcgagctctgagcactggagaga Bone

  12. The effects of eccentric training on muscle-bone function 

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    , mechanical testing at this site showed greater tibiae stiffness in the exercised bone than that of the OVX group (+28.5%). No significant differences were found in tibial ultimate load to fracture, ultimate strength or modulus of elasticity. In summary...

  13. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity 

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    of the series was conducted at Brookhaven National Laboratory. To quantify the impact of the abovementioned countermeasures and space radiation on bone, mechanical testing, peripheral quantitative computed tomography, micro-computed tomography, histomorphometry...

  14. Self-assembling peptide hydrogels modulate in vitro chondrogenesis of bovine bone marrow stromal cells

    E-Print Network [OSTI]

    Kopesky, Paul Wayne

    Our objective was to test the hypothesis that self-assembling peptide hydrogel scaffolds provide cues that enhance the chondrogenic differentiation of bone marrow stromal cells (BMSCs). BMSCs were encapsulated within two ...

  15. Mechanical loading attenuates loss of bone mass and bone strength induced by immobilization and calcium-deficiency 

    E-Print Network [OSTI]

    Inman, Cynthia Lynn

    1996-01-01T23:59:59.000Z

    mechanically loaded by a unique four-point loading machine three times per week. After six weeks of treatment, all animals were sacrificed, both tibia removed and tested for bone mineral density (BMD) by dual energy X-ray absorptiometry, stiffness and ultimate...

  16. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, J; Shoback, DMA; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01T23:59:59.000Z

    Mun˜oz-Torres M, et al. Bone mineral density, serum insulin-et al. Osteoporosis and bone mineral metabolism disorders in1069-9. 11. George J. Bone mineral density and disorders of

  17. Development of high strength hydroxyapatite for bone tissue regeneration using nanobioactive glass composites

    SciTech Connect (OSTI)

    Shrivastava, Pragya; Dalai, Sridhar; Vijayalakshmi, S. [Centre for Research in Nanotechnology and Science, IIT Bombay (India); Sudera, Prerna; Sivam, Santosh Param [Amity Institute of Nanotechnology, Amity University, Noida, Uttar Pradesh-201303 (India); Sharma, Pratibha [Dept of Energy Science and Engineering, IIT Bombay (India)

    2013-02-05T23:59:59.000Z

    With an increasing demand of biocompatible bone substitutes for the treatment of bone diseases and bone tissue regeneration, bioactive glass composites are being tested to improvise the osteoconductive as well as osteoinductive properties. Nanobioactive glass (nBG) composites, having composition of SiO{sub 2} 70 mol%, CaO 26 mol % and P{sub 2}O{sub 5} 4 mol% were prepared by Freeze drying method using PEG-PPG-PEG co-polymer. Polymer addition improves the mechanical strength and porosity of the scaffold of nBG. Nano Bioactive glass composites upon implantation undergo specific reactions leading to the formation of crystalline hydroxyapatite (HA). This is tested in vitro using Simulated Body Fluid (SBF). This high strength hydroxyapatite (HA) layer acts as osteoconductive in cellular environment, by acting as mineral base of bones, onto which new bone cells proliferate leading to new bone formation. Strength of the nBG composites as well as HA is in the range of cortical and cancellous bone, thus proving significant for bone tissue regeneration substitutes.

  18. Biomimetic hydroxyapatite as a new consolidating agent for archaeological bone

    E-Print Network [OSTI]

    North, Alexis

    2014-01-01T23:59:59.000Z

    R.E.M.  2002.  “Bone  Diagenesis:  An  Overview  of  2000.  “Patterns  of  Diagenesis  in  Bone  I:  The  element  Studies  of  Diagenesis  in  Prehistoric  Bone. ”  

  19. Char crystalline transformations during coal combustion and their implications for carbon burnout. Semiannual technical progress report, 1 January 1996--1 July 1996

    SciTech Connect (OSTI)

    Hurt, R.H.

    1996-11-01T23:59:59.000Z

    Recent work at Sandia National Laboratories, Imperial College, and the U.K. utility PowerGen, has identified an important mechanism believed to have a large influence on unburned carbon levels from pulverized coal fired boilers. That mechanism is char carbon crystalline rearrangements on subsecond times scales at temperatures of 1800 - 2500 K, which lead to char deactivation in the flame zones of furnaces. The so-called thermal annealing of carbons is a well known phenomenon, but its key role in carbon burnout has only recently been appreciated, and there is a lack of quantitative data in this time/temperature range. In addition, a new fundamental tool has recently become available to study crystalline transformations, namely high resolution transmission electron microscopy (HRTEM) fringe imaging, which provides a wealth of information on the nature and degree of crystallinity in carbon materials such as coal chars. Motivated by these new developments, this University Coal Research project has been initiated with the following three goals: to determine transient, high-temperature thermal deactivation kinetics as a function of parent coal and temperature history; and to characterize the effect of this thermal treatment on carbon crystalline structure through high-resolution transmission electron microscopy and specialized, quantitative image analysis. Work is currently underway on the following three tasks: (1) experimental technique development; (2) thermal deactivation kinetics; and (3) crystal structure characterization. In this second project period, progress was made on subtasks 1 and 3, in both cases in the areas of equipment and technique development. These activities are discussed in detail in this report.

  20. Leonardite char adsorbents

    DOE Patents [OSTI]

    Knudson, C.L.

    1993-10-19T23:59:59.000Z

    A process of preparing lignite (low rank) coal filter material, suitable for use in lieu of more expensive activated carbon filter materials, is disclosed. The process comprises size reducing Leonardite coal material to a suitable filtering effective size, and thereafter heating the size reduced Leonardite preferably to at least 750 C in the presence of a flow of an inert gas. 1 figure.

  1. Leonardite char adsorbents

    DOE Patents [OSTI]

    Knudson, Curtis L. (Grand Forks, ND)

    1993-01-01T23:59:59.000Z

    A process of preparing lignite (low rank) coal filter material, suitable for use in lieu of more expensive activated carbon filter materials, is disclosed. The process comprises size reducing Leonardite coal material to a suitable filtering effective size, and thereafter heating the size reduced Leonardite preferably to at least 750.degree. C. in the presence of a flow of an inert gas.

  2. PULSE COMBUSTOR DESIGN QUALIFICATION TEST AND CLEAN COAL FEEDSTOCK TEST - VOLUME I AND VOLUME II

    SciTech Connect (OSTI)

    Unknown

    2002-02-08T23:59:59.000Z

    For this Cooperative Agreement, the pulse heater module is the technology envelope for an indirectly heated steam reformer. The field of use of the steam reformer pursuant to this Cooperative Agreement with DOE is for the processing of sub-bituminous coals and lignite. The main focus is the mild gasification of such coals for the generation of both fuel gas and char--for the steel industry is the main focus. An alternate market application for the substitution of metallurgical coke is also presented. This project was devoted to qualification of a 253-tube pulse heater module. This module was designed, fabricated, installed, instrumented and tested in a fluidized bed test facility. Several test campaigns were conducted. This larger heater is a 3.5 times scale-up of the previous pulse heaters that had 72 tubes each. The smaller heater has been part of previous pilot field testing of the steam reformer at New Bern, North Carolina. The project also included collection and reduction of mild gasification process data from operation of the process development unit (PDU). The operation of the PDU was aimed at conditions required to produce char (and gas) for the Northshore Steel Operations. Northshore Steel supplied the coal for the process unit tests.

  3. Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone D. Farlay, G. Panczer, C. Rey, P. D. Delmas

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Mineral Maturity and Crystallinity Index Are Distinct Characteristics of Bone Mineral D. Farlay, G in "Journal of Bone and Mineral Metabolism 2010;28(4):433-45" DOI : 10.1007/s00774-009-0146-7 #12;Abstract The purpose of this study was to test the hypothesis that mineral maturity and crystallinity index are two

  4. Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair Compared to the Trochlea in a

    E-Print Network [OSTI]

    Buschmann, Michael

    Bone Marrow Stimulation of the Medial Femoral Condyle Produces Inferior Cartilage and Bone Repair femoral condylar (MFC) versus femoral trochlear (TR) defects 3 months after bone marrow stimulation: cartilage repair; medial femoral condyle; trochlea; bone marrow stimulation; meniscus degeneration Articular

  5. Positive modulator of bone morphogenic protein-2

    DOE Patents [OSTI]

    Zamora, Paul O. (Gaithersburg, MD); Pena, Louis A. (Poquott, NY); Lin, Xinhua (Plainview, NY); Takahashi, Kazuyuki (Germantown, MD)

    2009-01-27T23:59:59.000Z

    Compounds of the present invention of formula I and formula II are disclosed in the specification and wherein the compounds are modulators of Bone Morphogenic Protein activity. Compounds are synthetic peptides having a non-growth factor heparin binding region, a linker, and sequences that bind specifically to a receptor for Bone Morphogenic Protein. Uses of compounds of the present invention in the treatment of bone lesions, degenerative joint disease and to enhance bone formation are disclosed.

  6. BONE CARE FOR THE POSTMENOPAUSAL WOMAN

    E-Print Network [OSTI]

    Shihadeh, Alan

    Osteoporosis is a disease characterized by low bone mass and deterioration in the microarchitecture of bone tissue, leading to an increased risk of fracture. Osteoporosis occurs when the bone mass decreases more fracture). Osteoporosis has no signs or symptoms until a fracture occurs ­ this is why it is often called

  7. Changing the Mechanical Properties of PMMA Bone Cement with Nano and Micro Particles Ricardo F. Pinto, Brandon J. Johnson, L. D. Timmie Topoleski

    E-Print Network [OSTI]

    Alonso, Juan J.

    in the vacuum mixer. During the exothermic polymerization of the bone cement, the liquid rubber should testing. Specimens were then retrieved and tested individually in three point bending quasi-static loading

  8. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    x ORIGINAL ARTICLE Bone mineral density and fractures inwas associated with lower bone mineral density (BMD) at theKeywords Bone loss . Bone mineral density . Elderly .

  9. Sex Differences in Long Bone Fatigue Using a Rat Model Luisa D. Moreno,1

    E-Print Network [OSTI]

    Waldman, Stephen D.

    response to fatigue, we also determined the creep that occurred during the fatigue test. From the creep progress (Fig. 1). Caler and Carter32 studied cortical bone creep behavior during fatigue testing. When adaptation. From these results, we hypothesized that creep was the underlying mechanism that accounted

  10. Digital electronic bone growth stimulator

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-01-01T23:59:59.000Z

    The present invention relates to the electrical treatment of biological tissue. In particular, the present invention discloses a device that produces discrete electrical pulse trains for treating osteoporosis and accelerating bone growth. According to its major aspects and broadly stated, the present invention consists of an electrical circuit configuration capable of generating Bassett-type waveforms shown with alternative signals provide for the treatment of either fractured bones or osteoporosis. The signal generator comprises a quartz clock, an oscillator circuit, a binary divider chain, and a plurality of simple, digital logic gates. Signals are delivered efficiently, with little or no distortion, and uniformly distributed throughout the area of injury. Perferably, power is furnished by widely available and inexpensive radio batteries, needing replacement only once in several days. The present invention can be affixed to a medical cast without a great increase in either weight or bulk. Also, the disclosed stimulator can be used to treat osteoporosis or to strengthen a healing bone after the cast has been removed by attaching the device to the patient`s skin or clothing.

  11. Test Automation Test Automation

    E-Print Network [OSTI]

    Mousavi, Mohammad

    Test Automation Test Automation Mohammad Mousavi Eindhoven University of Technology, The Netherlands Software Testing 2013 Mousavi: Test Automation #12;Test Automation Outline Test Automation Mousavi: Test Automation #12;Test Automation Why? Challenges of Manual Testing Test-case design: Choosing inputs

  12. WRITTEN IN BONE: Bone Biographer's Casebook Douglas Owsley and Karin Bruwelheide

    E-Print Network [OSTI]

    Mathis, Wayne N.

    afflictions that would have made daily life miserable. In addition to dental disease and gout, his bones were

  13. J Bone Miner Metab . Author manuscript Mineral maturity and crystallinity index are distinct characteristics of bone

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    J Bone Miner Metab . Author manuscript Page /1 13 Mineral maturity and crystallinity index are distinct characteristics of bone mineral Delphine Farlay 1 * , G rard Panczeré 2 , Christian Rey 3 , Pierre the hypothesis that mineral maturity and crystallinity index are two different characteristics of bone mineral

  14. PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism

    E-Print Network [OSTI]

    Toledo, University of

    PPARs in Bone: The Role in Bone Cell Differentiation and Regulation of Energy Metabolism Beata regulating systemic energy homeostasis. In this article, we review current knowledge on the role of PPARs of bone marrow microenvironment and its possible contribution to the systemic regulation of energy

  15. A quantification strategy for missing bone mass in case of osteolytic bone lesions

    SciTech Connect (OSTI)

    Fränzle, Andrea, E-mail: a.fraenzle@dkfz.de; Giske, Kristina [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Bretschi, Maren; Bäuerle, Tobias [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Department of Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Hillengass, Jens [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany)] [Department of Internal Medicine V, University of Heidelberg, Im Neuenheimer Feld 410, 69120 Heidelberg (Germany); Bendl, Rolf [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Informatics, Heilbronn University, Max-Planck-Strasse 39, 74081 Heilbronn, Germany and Department of Medical Physics in Radiation Oncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)

    2013-12-15T23:59:59.000Z

    Purpose: Most of the patients who died of breast cancer have developed bone metastases. To understand the pathogenesis of bone metastases and to analyze treatment response of different bone remodeling therapies, preclinical animal models are examined. In breast cancer, bone metastases are often bone destructive. To assess treatment response of bone remodeling therapies, the volumes of these lesions have to be determined during the therapy process. The manual delineation of missing structures, especially if large parts are missing, is very time-consuming and not reproducible. Reproducibility is highly important to have comparable results during the therapy process. Therefore, a computerized approach is needed. Also for the preclinical research, a reproducible measurement of the lesions is essential. Here, the authors present an automated segmentation method for the measurement of missing bone mass in a preclinical rat model with bone metastases in the hind leg bones based on 3D CT scans. Methods: The affected bone structure is compared to a healthy model. Since in this preclinical rat trial the metastasis only occurs on the right hind legs, which is assured by using vessel clips, the authors use the left body side as a healthy model. The left femur is segmented with a statistical shape model which is initialised using the automatically segmented medullary cavity. The left tibia and fibula are segmented using volume growing starting at the tibia medullary cavity and stopping at the femur boundary. Masked images of both segmentations are mirrored along the median plane and transferred manually to the position of the affected bone by rigid registration. Affected bone and healthy model are compared based on their gray values. If the gray value of a voxel indicates bone mass in the healthy model and no bone in the affected bone, this voxel is considered to be osteolytic. Results: The lesion segmentations complete the missing bone structures in a reasonable way. The mean ratiov{sub r}/v{sub m} of the reconstructed bone volume v{sub r} and the healthy model bone volume v{sub m} is 1.07, which indicates a good reconstruction of the modified bone. Conclusions: The qualitative and quantitative comparison of manual and semi-automated segmentation results have shown that comparing a modified bone structure with a healthy model can be used to identify and measure missing bone mass in a reproducible way.

  16. A Novel Method for the Evaluation of Mechanical Properties of Cancellous Bone in the Rat Distal Femur 

    E-Print Network [OSTI]

    Lucas, Matthew W.

    2010-01-14T23:59:59.000Z

    .................................................................................................................. 35 3.7.1 Analysis of Mechanical Testing Data .............................................................. 35 3.7.2 Material Properties ........................................................................................... 37 3.7.3 Core....2 Osteoporosis and the Ovariectomized Rat Model .................................................... 5 2.3 Mechanical Testing of Cancellous Bone in Rats ..................................................... 5 2.3.1 Femoral Neck Testing...

  17. Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor is enhanced by compressive

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Title Ex vivo bone formation in bovine trabecular bone cultured in a dynamic 3D bioreactor la Santé et de la Recherche Médicale Running title Cancellous bone culture in a dynamic 3D bioreactor

  18. Curr Pharm Des . Author manuscript Bisphosphonates and bone diseases: past, present and future

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget s disease of bone

  19. Shell Formation and Bone Strength Laying Hens

    E-Print Network [OSTI]

    Shell Formation and Bone Strength in Laying Hens Effects of Age, Daidzein and Exogenous Estrogen Cover aquarelle: E. Spörndly-Nees #12;Shell Formation and Bone Strength in Laying Hens Effects of Age eggshells as shell quality declines with age during the laying period. This is a concern for food safety

  20. Mechanical bone strength in the proximal tibia

    E-Print Network [OSTI]

    Prommin, Danu

    2000-01-01T23:59:59.000Z

    . These findings were a pilot study of the technique, which will subsequently be used for human tibial bone. Such data is relevant in the human with respect to the ability of the bone at various distances from the condyle to support the "flat-plate" loading...

  1. Ibuprofen Administered Pre- or Post- Simulated Resistance Exercise Training Does Not Diminsh Gains in Bone Formation or Bone Mass

    E-Print Network [OSTI]

    Cunningham, David

    2012-02-14T23:59:59.000Z

    IBUPROFEN ADMINSTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINISH GAINS IN BONE FORMATION OR BONE MASS A Thesis by DAVID ARTHUR CUNNINGHAM Submitted to the Office of Graduate Studies of Texas A... Training Does Not Diminish Gains in Bone Formation or Bone Mass Copyright 2011 David Arthur Cunningham IBUPROFEN ADMINISTERED PRE- OR POST- SIMULATED RESISTANCE EXERCISE TRAINING DOES NOT DIMINSH GAINS IN BONE FORMATION OR BONE MASS A Thesis...

  2. Think of your bones as a "bank" where

    E-Print Network [OSTI]

    Baker, Chris I.

    can get osteoporosis (ah-stee-oh-puh- ROH-sis) when you get older. Osteoporosis is a disease in which the bones become weak and more likely to break (fracture). People with osteoporosis most often break bones in the hip, spine, and wrist. 1 #12;Normal bone Bone with osteoporosis Reprinted from The Surgeon General

  3. 1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling of Bones

    E-Print Network [OSTI]

    Gefen, Amit

    1174 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 53, NO. 6, JUNE 2006 Microwave Drilling*, Member, IEEE Abstract--This paper presents a feasibility study of drilling in fresh wet bone tissue in vitro using the microwave drill method [Jerby et al., 2002], toward testing its applicability

  4. Application of synchrotron radiation computed microtomography for quantification of bone microstructure in human and rat bones

    SciTech Connect (OSTI)

    Parreiras Nogueira, Liebert; Barroso, Regina Cely; Pereira de Almeida, Andre; Braz, Delson; Almeida, Carlos Eduardo de; Borba de Andrade, Cherley; Tromba, Giuliana [Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Physics Institute / State University of Rio de Janeiro, 20550-900, Rio de Janeiro (Brazil); Nuclear Instrumentation Laboratory / COPPE / UFRJ, P.O. Box 68509, 21945-970, Rio de Janeiro (Brazil); Laboratory of Radiological Sciences / State University of Rio de Janeiro, Rio de Janeiro (Brazil); Sincrotrone Trieste SCpA, Strada Statale S.S. 14 km 163.5, 34012 Basovizza, Trieste (Italy)

    2012-05-17T23:59:59.000Z

    This work aims to evaluate histomorphometric quantification by synchrotron radiation computed microto-mography in bones of human and rat specimens. Bones specimens are classified as normal and pathological (for human samples) and irradiated and non-irradiated samples (for rat ones). Human bones are specimens which were affected by some injury, or not. Rat bones are specimens which were irradiated, simulating radiotherapy procedures, or not. Images were obtained on SYRMEP beamline at the Elettra Synchrotron Laboratory in Trieste, Italy. The system generated 14 {mu}m tomographic images. The quantification of bone structures were performed directly by the 3D rendered images using a home-made software. Resolution yielded was excellent what facilitate quantification of bone microstructures.

  5. Microdamage accumulation in bovine trabecular bone

    E-Print Network [OSTI]

    Moore, Tara L. Arthur (Tara Lee Arthur), 1972-

    2001-01-01T23:59:59.000Z

    When bone is loaded beyond its failure point, it develops damage in the form of microcracks. Normally, microcracks are repaired by the remodeling process, limiting the number of in vivo microcracks. However, if the rate ...

  6. CORTICAL BONE FRACTURE R. O. RITCHIE

    E-Print Network [OSTI]

    Ritchie, Robert

    with menopause in aging women, can lead to osteoporosis, a condition of low bone mass associated the therapeutic benefits of antiresorptive agents in treating osteoporosis (6,7) has re-emphasized the ne- cessity

  7. Composite gelatin delivery system for bone regeneration

    E-Print Network [OSTI]

    Hager, Elizabeth A. (Elizabeth Ann)

    2005-01-01T23:59:59.000Z

    In this thesis, the chemical/mechanical properties and biocompatibility of gelatin were investigated to produce a gelatin scaffold for the release of bone morphogenetic proteins (BMPs) from composite particles. This delivery ...

  8. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Bone Growth, Maintenance and Loss in the Neolithic CommunityThe examination of bone maintenance and loss is another wellchanging patterns of bone maintenance typically observed in

  9. Photoplethysmography for non-invasive measurement of bone hemodynamic responses to changes in external pressure

    E-Print Network [OSTI]

    Mateus, Jaime (Pereira de Mateus Silva)

    2011-01-01T23:59:59.000Z

    Adequate blood supply and circulation in bones is required to maintain a healthy skeleton, and inadequate blood perfusion is associated with numerous bone pathologies and a decrease in bone mineral density (BMD). Bone ...

  10. The effect of three hemostatic agents on early bone healing in an animal model

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    B, Sjogren S: Effects of bone wax on rabbit cranial boneRR: The effect of bone wax on the healing of experimentaland healing using bone wax and a soluble polymer material.

  11. Bisphosphonates and Bone diseases: past, present and future Bisphosphonates are stable analogues of the naturally-occuring inorganic

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    involving excessive bone resorption which include post-menopausal osteoporosis, Paget's disease of bone

  12. Engineered nanomedicine for myeloma and bone microenvironment targeting

    E-Print Network [OSTI]

    Swami, Archana

    Bone is a favorable microenvironment for tumor growth and a frequent destination for metastatic cancer cells. Targeting cancers within the bone marrow remains a crucial oncologic challenge due to issues of drug availability ...

  13. Cellular and molecular immunotherapeutics derived from the bone marrow stroma

    E-Print Network [OSTI]

    Parekkadan, Biju

    2008-01-01T23:59:59.000Z

    The bone marrow contains a multipotent stromal cell, commonly referred to as a mesenchymal stem cell (MSC). There has been recent interest in the clinical use of MSCs for cell-based therapy because: (1) bone marrow aspiration ...

  14. Original article Analysis of muscle and bone weight variation

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . The commonalities ranged from 0.76 (drumstick muscle) to 0.92 (neck bone) and the uniqueness (special size factors and drumstick bone factors. The correlation coefficient between the first factor score and carcass muscle was 0

  15. Two-dimensional ultrasonic computed tomography of growing bones.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Two-dimensional ultrasonic computed tomography of growing bones. P. Lasaygues, E. Franceschini, R: Ultrasonic Computed Tomography, Bone imaging, Born approximation, iterative distorted method I. INTRODUCTION imaging process, using ultrasonic computed tomography. Although this method is known to provide

  16. Mechanistic fracture criteria for the failure of human cortical bone

    SciTech Connect (OSTI)

    Nalla, Ravi K.; Kinney, John H.; Ritchie, Robert O.

    2002-12-13T23:59:59.000Z

    A mechanistic understanding of fracture in human bone is critical to predicting fracture risk associated with age and disease. Despite extensive work, a mechanistic framework for describing how the underlying microstructure affects the failure mode in bone is lacking.

  17. SciChar Workshop | JCESR

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Priority Research Direction Examples Roger Falcone, Advanced Light Source Hector Abruna, Cornell University, In Operando Studies of Energy Materials Dan Steingart, Princeton...

  18. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August 2001)

  19. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August 2001)0a.

  20. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August

  1. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August2a.

  2. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August2a.a.

  3. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August2a.a.2a.

  4. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I 1August2a.a.2a.3a.

  5. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I

  6. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I5a. Household

  7. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I5a. Household6a.

  8. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I5a.

  9. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I5a.8a. Household

  10. char_household2001.pdf

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at Commercial andSeptember 25, 20123 (Million13) I5a.8a. Household9a.

  11. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.2001

  12. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a. Household

  13. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a. Household1a.

  14. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a.

  15. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a.a. Household

  16. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a.a.

  17. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a.a.3a.

  18. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a.a.3a.5a.

  19. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million U.S.20010a.a.3a.5a.6a.

  20. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million

  1. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million8a. Household

  2. char_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTownDells,1Stocksa. Appliances by Climate Zone, Million8a. Household9a.

  3. Three-dimensional terahertz computed tomography of human bones

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    spectroscopy cannot rival with dual energy x-ray absorptiometry (DEXA) to identify the bone mineral density

  4. Dynamic Behavior and Microstructural Properties of Cancellous Bone.

    E-Print Network [OSTI]

    Boyer, Edmond

    A total of 15 distal parts of bovine femoral bones were used for this study (72 hours post mortemDynamic Behavior and Microstructural Properties of Cancellous Bone. S. Laporte1 , F. David1 , V of the cancellous bone and to identify the link between this mechanical behavior and the microstructural properties

  5. Prediction and Informative Risk Factor Selection of Bone Diseases

    E-Print Network [OSTI]

    Zhang, Aidong

    data and use these integrated features to effectively predict osteoporosis and bone fractures. We; disease memory; osteoporosis; bone fracture. ! 1 INTRODUCTION Risk factor (RF) analysis based on patients on the study of osteoporosis and bone fracture prediction. Over the past few decades, osteoporosis has been

  6. vol. 163, no. 6 the american naturalist june 2004 Testing Small Clutch Size Models with Daphnia

    E-Print Network [OSTI]

    West, Stuart

    - hower 1995; Charnov et al. 1995; Downhower and Char- nov 1998; West et al. 2001). A novel and useful

  7. INVEST IN YOUR BONES Daily Activities

    E-Print Network [OSTI]

    INVEST IN YOUR BONES Daily Activities Leaflet 3 Another osteoporosis prevention step to decrease lifestyle. Let's see how you can do that. If you have osteoporosis, follow carefully the activity program. Remember the following about osteoporosis: is largely preventable and treatable is a serious

  8. Nanoscale Surface Topography to Guide Bone Growth

    E-Print Network [OSTI]

    Nanoscale Surface Topography to Guide Bone Growth P R O J E C T L E A D E R : Jirun Sun (American T S Designed and fabricated devices with nanoscale surface topography. Controlled cell alignment by varying the height and aspect ratio of the surface features. R E F E R E N C E Exploring cellular contact guidance

  9. Interactions between microenvironment and cancer cells in two animal models of bone metastasis

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Interactions between microenvironment and cancer cells in two animal models of bone metastasis of characteristics leading to osteoclastogenesis only in the bone microenvironment. Key words: Bone metastasis;3 INTRODUCTION Bone is a preferential site for metastasis in different types of cancer. Bone metastases induce

  10. BONE LOSS IN RELATION TO HYPOTHALAMIC ATROPHY IN ALZHEIMER'S DISEASE

    E-Print Network [OSTI]

    Loskutova, Natalia Y.

    2011-05-12T23:59:59.000Z

    considerable burden on the health system, patients, and caregivers. 1.2 Alzheimer’s Disease and Bone Loss Bone health is an important issue in aging and AD. Osteoporosis–related fractures are among the major health and socioeconomic concerns in aging... of bone fractures, and a determining factor in clinical diagnosis of osteoporosis (Ammann and Rizzoli 2003). Several studies in women suggest that low BMD is associated with poorer cognitive function and subsequent cognitive decline (Yaffe, Browner et al...

  11. allowing normal bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    assays. Correlations of fluoride levels between normal bone near the Nancy Medina; Chester W. Douglass; Gary M. Whitford; Robert N. Hoover; Thomas R. Fears 6 Differential...

  12. Research Finds Vitamin D Deficiency Affects Bone Quality

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    their results, the researchers recommended that vitamin D levels be checked and kept on well--balanced levels to maintain the structural integrity of bones and avoid...

  13. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

  14. ancient human bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reich, David 159 OsteoConduct: Wireless Body-Area Communication based on Bone Conduction Energy Storage, Conversion and Utilization Websites Summary: , Measurement, Human Factors....

  15. Physiological Stress, Bone Growth and Development in Imperial Rome

    E-Print Network [OSTI]

    Beauchesne, Patrick Denis

    2012-01-01T23:59:59.000Z

    present and that diagenesis (chemical exchange between therisk assessment. Diagenesis, or the chemical exchangeto assess the level of diagenesis in a bone without chemical

  16. arm bones: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TO ENSURE HUMAN SAFETY Lingqi Zeng and Gary M. Bone Engineering Websites Summary: , and robot and human velocities. The impact experiments are performed with an apparatus...

  17. Treatment of Extraspinal Painful Bone Metastases with Percutaneous Cementoplasty: A Prospective Study of 50 Patients

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment, Interventional Radiology Unit (Italy); Ortega, Cinzia; Grignani, Giovanni [Institute for Cancer Research and Treatment, Oncology Unit (Italy); DeBernardi, Felicino [Institute for Cancer Research and Treatment, Anesthesiology Unit (Italy); Regge, Daniele [Institute for Cancer Research and Treatment, Radiology Unit (Italy)

    2008-11-15T23:59:59.000Z

    The aim of this study was to assess the efficacy of percutaneous cementoplasty (PC) with polymethylmethacrylate (PMMA) in painful extravertebral lytic bone metastases not responding to conventional therapy. Fifty patients (25 females), mean age 64.7 {+-} 11.2 years, underwent PC after giving informed consent. Procedures were performed under fluoroscopy (1/50) or combined fluoroscopy-CT (49/50) guidance in local anesthesia or under deep sedation in 7 patients with large metastases who underwent radiofrequency thermoablation (RFA) in the same session. Seventy lesions were treated (1-6 per patient; average, 1.4 {+-} 0.9), arranging in size from 1 to 10 cm (average, 3.6 {+-} 2.1 cm). Mean volume of PMMA per lesion was 5.9 {+-} 3.2 ml (range, 1.5-15.0 ml). Pain was prospectively evaluated on an 11-point visual analog scale (VAS) before and after the procedure (follow-up, 15 to 36 months). Mean VAS score dropped from 9.1 {+-} 1.2 (range: 6-10) to 2.1 {+-} 2.5 (range: 0-9). Mean VAS difference was 7.0 {+-} 2.3 (range, 1-10; p < 0.0001, Wilcoxon signed rank test). Forty-seven of the 50 patients (94%) suspended narcotic drugs, in 22 (44%) pain was controlled with a nonsteroidal anti-inflammatory drug, in 25 (50%) analgesic therapy was suspended, and 13 of 50 (26%) had complete pain regression. In 3 of the 50 patients (6%) pain was not improved. No statistical difference between osteoplasty and osteoplasty plus RFA was found (p = 0.8338, Mann-Whitney test). No complications arose during the procedure. Two patients with metastases in the femoral diaphysis reported a fracture 1 month after treatment. PC is effective to obtain pain regression in painful bone metastases not responding to conventional analgesic therapy; bone consolidation cannot be obtained in the diaphysis of long weight-bearing bones.

  18. Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Bala Krishnamoorthy, Department of Mathematics, Washington State University

    E-Print Network [OSTI]

    Krishnamoorthy, Bala

    1 Bone Mineral Density and Donor Age are Not Predictive of Allograft Bone Mechanical Strength Bala to failure in axial compression. Predictive variables included age, gender, bone mineral density (BMD mineral density, spine surgery. #12;3 Introduction The allograft bone industry is guided by practices

  19. Osteopontin deficiency increases bone fragility but preserves bone mass Philipp J. Thurner a,b

    E-Print Network [OSTI]

    Ritchie, Robert

    density (BMD) is the most common diagnostic used to assess fracture risk [1,2], yet less than half of non to osteopontin in bone, many of which have the potential to impact material properties. To elucidate the role role for OPN in preventing crack propagation. This significant decline in fracture toughness

  20. Quantity and Quality of Trabecular Bone in the Femur Are Enhanced by a Strongly Anabolic, Noninvasive

    E-Print Network [OSTI]

    serve as the basis for a biomechanically based intervention for osteoporosis. To evaluate intervention for osteoporosis. (J Bone Miner Res 2002;17:349­357) Key words: osteoporosis, osteogenic, anabolic, bone formation, bone quality, osteogenic INTRODUCTION OSTEOPOROSIS, A disease characterized

  1. Structural Analysis of Human and Bovine Bone for Development of Synthetic Materials 

    E-Print Network [OSTI]

    Jang, Eunhwa

    2012-10-19T23:59:59.000Z

    With increasing demands in bone repair and replacement, this research investigates the microstructure, properties and performance of bovine bone, human bone, and synthetic materials. Doing so, experimental approaches were used to exam and compare...

  2. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    E-Print Network [OSTI]

    Aliotta, Jason M.

    2008-01-01T23:59:59.000Z

    Bone marrow production of lung cells: the impact of G-CSF,bone marrow to reconstitute lung epithelium. Am. J. Respirof Bone Marrow Cells into Lung Cells Mark S. Dooner 1 *,

  3. Role of middle-ear inertial component of bone conduction in chinchilla

    E-Print Network [OSTI]

    Chhan, David

    2013-01-01T23:59:59.000Z

    Bone conduction describes the mechanisms that produce a hearing sensation when the skull bones are subjected to vibration. Multiple components and pathways have been suggested to contribute to total bone-conducted sound. ...

  4. WOMEN'S GLOBAL HEALTH INSTITUTE NUTR59000/BMS59800: WOMEN'SHEALTH:BONE

    E-Print Network [OSTI]

    /remodeling, mechanics;Tools of assessment Epidemiology of osteoporosis Development of peak bone mass ­ nutrition/exercise Adult Bone: Women's reproductive choices ­ oral contraceptives, pregnancy, lactation Menopause: Biology

  5. Novel Techniques for High-Resolution Functional Imaging of Trabecular Bone

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    associated with osteoporosis (1, 2). Osteoporosis results in bone loss and deterioration in trabecular a primary endpoint in osteoporosis diagnosis and monitoring. Where strong correlations between bone density

  6. Bone Growth, Maintenance and Loss in the Neolithic Community of Çatalhöyük, Turkey: Preliminary Results

    E-Print Network [OSTI]

    Agarwal, Sabrina; Glencross, Bonnie; Beauchesne, Patrick

    2011-01-01T23:59:59.000Z

    Interpreting Bone Loss and Osteoporosis in Past Populations.2005. How many women have osteoporosis? Journal of Bone and1987. Postmenopausal osteoporosis: single screening method

  7. In Vivo Evaluation of the Presence of Bone Marrow in Cortical Porosity in Postmenopausal Osteopenic Women

    E-Print Network [OSTI]

    Goldenstein, Janet; Kazakia, Galateia; Majumdar, Sharmila

    2010-01-01T23:59:59.000Z

    bone resorption in osteoporosis. Calcif. Tissue Int. Augat,Porosity in Women with Osteoporosis. Vienna, Austria:porosity in women with osteoporosis. J. Bone Miner. Res.

  8. Verrucous carcinoma of the foot affecting the bone: Utility of the computed tomography scanner

    E-Print Network [OSTI]

    García-Gavín, J; González-Vilas, D; Rodríguez-Pazos, L; Sánchez-Aguilar, D; Toribio, J

    2010-01-01T23:59:59.000Z

    Frassica FJ, Fishman EK. Computed tomography of the bones ofbone: Utility of the computed tomography scanner J García-of bone invasion. Computed tomography (CT) showed a lytic

  9. Controlling the Bone Marrow Dynamics in Cancer Chemotherapy

    E-Print Network [OSTI]

    Ledzewicz, Urszula

    Professor Award 1 #12;find optimal strategies for chemotherapy treatments of the cancer, where Controlling the Bone Marrow Dynamics in Cancer Chemotherapy Urszula Ledzewicz1 and Heinz Sch In the paper a mathematical model for the growth of the bone marrow under cell-cycle specific cancer

  10. Microcapsule-Induced Toughening of Bone Cement Gina M. Miller

    E-Print Network [OSTI]

    Sottos, Nancy R.

    27 Microcapsule-Induced Toughening of Bone Cement Gina M. Miller Senior in Aerospace Engineering R. White, and TAM Prof. Nancy R. Sottos Acrylic bone cement is the primary material used cement, it may be possible to extend the lifetime of the implant, thus reducing the occurrence

  11. Therapeutic Agents for the Prevention and Restoration of Bone Mass

    E-Print Network [OSTI]

    Slatton, Clint

    osteoporosis-related bone loss. According to the National Osteoporosis Foundation, osteoporosis is a major osteoporosis Advantages · Selectively blocks osteoclastic bone resorption by a novel mechanism, providing in post-menopausal women. This ultimately leads to fractures resulting from minimal falls and accidents

  12. Bone motion analysis from dynamic MRI: acquisition and tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    overload, impingement or femoral head instability. For both the diagnosis and the surgical planningBone motion analysis from dynamic MRI: acquisition and tracking Benjamin Gilles1 , Rosalind Perrin2 methods in order to auto- matically extract active bone kinematics from multi-slice real-time dy- namic

  13. Biomechanics in bone tissue engineering Dominique P. Pioletti*

    E-Print Network [OSTI]

    Guerraoui, Rachid

    such a procedure truly is, we report, in Figure 1(a), the particular case of a posterior surgical approachBiomechanics in bone tissue engineering Dominique P. Pioletti* Laboratory of Biomechanical 18 January 2010) Biomechanics may be considered as central in the development of bone tissue

  14. Protocadherin-7 induces bone metastasis of breast cancer

    SciTech Connect (OSTI)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China)] [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China)] [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)] [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China) [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05T23:59:59.000Z

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  15. On the Estimation of Bone Status Rasmus Paulsen

    E-Print Network [OSTI]

    Osteoporosis Diagnostics. The subject of this thesis is medical image analysis with special attention to X Reinhold Paulsen Keywords Osteoporosis, bone status, radius, contact radiographs, cortical geometry, en algorithm developed by Torsana Osteoporosis Diagnostics. A simulated bone is made by simulated x

  16. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly; Zimmermann, Elizabeth; Schaible, Eric; Tang, Simon; Alliston, Tamara; Ritchie, Robert

    2011-08-19T23:59:59.000Z

    Bone comprises a complex structure of primarily collagen, hydroxyapatite and water, where each hierarchical structural level contributes to its strength, ductility and toughness. These properties, however, are degraded by irradiation, arising from medical therapy or bone-allograft sterilization. We provide here a mechanistic framework for how irradiation affects the nature and properties of human cortical bone over a range of characteristic (nano to macro) length-scales, following x-­ray exposures up to 630 kGy. Macroscopically, bone strength, ductility and fracture resistance are seen to be progressively degraded with increasing irradiation levels. At the micron-­scale, fracture properties, evaluated using in-situ scanning electron microscopy and synchrotron x-ray computed micro-tomography, provide mechanistic information on how cracks interact with the bone-matrix structure. At sub-micron scales, strength properties are evaluated with in-situ tensile tests in the synchrotron using small-/wide-angle x-ray scattering/diffraction, where strains are simultaneously measured in the macroscopic tissue, collagen fibrils and mineral. Compared to healthy bone, results show that the fibrillar strain is decreased by ~40% following 70 kGy exposures, consistent with significant stiffening and degradation of the collagen. We attribute the irradiation-­induced deterioration in mechanical properties to mechanisms at multiple length-scales, including changes in crack paths at micron-­scales, loss of plasticity from suppressed fibrillar sliding at sub-­micron scales, and the loss and damage of collagen at the nano-­scales, the latter being assessed using Raman and Fourier-Transform-Infrared spectroscopy and a fluorometric assay.

  17. RMOTC - Testing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sale of Equipment and Materials DOE to Sell NPR-3 Testing Tomorrow's Technology Today RMOTC - Testing - From Lab to Industry, Moving Your Ideas Forward RMOTC provides a neutral,...

  18. Essential requirement of I-A region-identical host bone marrow or bone marrow-derived cells for tumor neutralization by primed L3T4+ T cells

    SciTech Connect (OSTI)

    Ozawa, H.; Iwaguchi, T.; Kataoka, T.

    1987-12-01T23:59:59.000Z

    The antitumor activity of Meth A-hyperimmunized BALB/c mouse spleen cells (Meth A-Im-SPL) was assayed by the Winn test in H-2 incompatible bone marrow chimeras in closed colony CD-1 (nu/nu), inbred DDD/1(nu/nu) (H-2s), or inbred BALB/c(nu/nu) (H-2d) mice as recipients. We found that Meth A-Im-SPL suppressed Meth A growth in the chimera nude mice which were reconstituted with bone marrow cells of the H-2d haplotype (i.e., BALB/c, DBA/2 and B10.D2), but not in the chimeras which were reconstituted with bone marrow cells of the H-2a, H-2b, or H-2k haplotype (i.e., B10.A, B10, and B10.BR). These results suggested that H-2 restriction occurred between Meth A-Im-SPL and bone marrow or bone marrow-derived cells in tumor neutralization. Furthermore, Meth A-Im-SPL did not suppress Meth 1 tumors (antigenically distinct from Meth A tumors) in the presence or absence of mitomycin C-treated Meth A in a Winn assay. These results suggested that there is tumor specificity in the effector phase as well as in the induction phase. The phenotype of the effectors in the Meth A-Im-SPL was Thy-1.2+ and L3T4+, because Meth A-Im-SPL lost their antitumor activity with pretreatment with anti-Thy-1.2 monoclonal antibody (mAb) and complement or anti-L3T4 mAb and complement, but not with anti-Lyt-2.2 mAb and complement or complement alone. Positively purified L3T4+ T cells from Meth A-Im-SPL (Meth A-Im-L3T4), obtained by the panning method, suppressed the tumor growth in the chimera nude mice which were reconstituted with bone marrow cells of B10.KEA2 mice (that were I-A region-identical with Meth A-Im-L3T4 cells but not others in H-2) as well as B10.D2 cells (that were fully identical with Meth A-Im-L3T4 cells in H-2). We conclude that Meth A-Im-SPL (L3T4+) neutralized the tumors in collaboration with I-A region-identical host bone marrow or bone marrow-derived cells, and the neutralization was not accompanied by the bystander effect.

  19. Development of a high-performance coal-fired power generating system with pyrolysis gas and char-fired high temperature furnace (HITAF). Volume 1, Final report

    SciTech Connect (OSTI)

    NONE

    1996-02-01T23:59:59.000Z

    A major objective of the coal-fired high performance power systems (HIPPS) program is to achieve significant increases in the thermodynamic efficiency of coal use for electric power generation. Through increased efficiency, all airborne emissions can be decreased, including emissions of carbon dioxide. High Performance power systems as defined for this program are coal-fired, high efficiency systems where the combustion products from coal do not contact the gas turbine. Typically, this type of a system will involve some indirect heating of gas turbine inlet air and then topping combustion with a cleaner fuel. The topping combustion fuel can be natural gas or another relatively clean fuel. Fuel gas derived from coal is an acceptable fuel for the topping combustion. The ultimate goal for HIPPS is to, have a system that has 95 percent of its heat input from coal. Interim systems that have at least 65 percent heat input from coal are acceptable, but these systems are required to have a clear development path to a system that is 95 percent coal-fired. A three phase program has been planned for the development of HIPPS. Phase 1, reported herein, includes the development of a conceptual design for a commercial plant. Technical and economic feasibility have been analysed for this plant. Preliminary R&D on some aspects of the system were also done in Phase 1, and a Research, Development and Test plan was developed for Phase 2. Work in Phase 2 include s the testing and analysis that is required to develop the technology base for a prototype plant. This work includes pilot plant testing at a scale of around 50 MMBtu/hr heat input. The culmination of the Phase 2 effort will be a site-specific design and test plan for a prototype plant. Phase 3 is the construction and testing of this plant.

  20. Relation between hydrogen isotopic ratios of bone collagen and rain

    SciTech Connect (OSTI)

    Cormie, A.B.; Schwarcz, H.P. (McMaster Univ., Hamilton, Ontario (Canada)); Gray, J. (Univ. of Alberta, Edmonton (Canada))

    1994-01-01T23:59:59.000Z

    The hydrogen isotopic value ([delta]D) of deer bone collagen is related to both [delta]D of rain during the growing season and growing season relative humidity (RH). With correction for the effects of RH, bone [delta]D is related to growing season rain [delta]D in a simple manner with a slope of 1.0. This indicates that, with RH correction, there are no additional sources of bias in the [delta]D of bone due to unaccounted for biologic or climatic effects. Due to a low sensitivity of bone [delta]D to RH effects, both yearly and growing season rain [delta]D can be estimated with considerable accuracy (R = 0.97 and R = 0.96) from bone collagen [delta]D and [delta][sup 15]N. Here, [delta][sup 15]N is used to correct bone [delta]D for the effects of RH. From these estimates of rain [delta]D, it may then be possible to evaluate temperature since the [delta]D of rain primarily reflects local temperature. Therefore, the measurement of bone collagen [delta]D has good potential for evaluating paleoclimates.

  1. The effects of low environmental cadmium exposure on bone density

    SciTech Connect (OSTI)

    Trzcinka-Ochocka, M., E-mail: ochocka@imp.lodz.pl [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Jakubowski, M. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland); Szymczak, W. [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland) [Department of Environmental Epidemiology, Nofer Institute of Occupational Medicine, Lodz (Poland); Insitute of Psychology, University of Lodz (Poland); Janasik, B.; Brodzka, R. [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)] [Department of Chemical Hazards, Laboratory of Biomonitoring, Nofer Institute of Occupational Medicine, Lodz (Poland)

    2010-04-15T23:59:59.000Z

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction ({beta}{sub 2}M-U RBP, NAG), glomerular dysfunction (Alb-U and {beta}{sub 2}M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  2. Processing of hydroxylapatite coatings on titanium alloy bone prostheses

    DOE Patents [OSTI]

    Nastasi, Michael A. (Espanola, NM); Levine, Timothy E. (Santa Clara, CA); Mayer, James W. (Phoenix, AZ); Pizziconi, Vincent B. (Phoenix, AZ)

    1998-01-01T23:59:59.000Z

    Processing of hydroxylapatite sol-gel films on titanium alloy bone prostheses. A method utilizing non-line-of-sight ion beam implantation and/or rapid thermal processing to provide improved bonding of layers of hydroxylapatite to titanium alloy substrates while encouraging bone ingrowth into the hydroxylapatite layers located away from the substrate, is described for the fabrication of prostheses. The first layer of hydroxylapatite is mixed into the substrate by the ions or rapidly thermally annealed, while subsequent layers are heat treated or densified using ion implantation to form layers of decreasing density and larger crystallization, with the outermost layers being suitable for bone ingrowth.

  3. ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone

    E-Print Network [OSTI]

    Price, Paul A.

    ORIGINAL RESEARCH Minerals Form a Continuum Phase in Mature Cancellous Bone Po-Yu Chen · Damon the hierarchical structure of mineral in mature bone. A method to completely deproteinize bone without altering of mineral and protein constituents. SEM revealed that bone minerals are fused together and form a sheet

  4. Interactive Separation of Segmented Bones in CT Volumes Using Graph Cut

    E-Print Network [OSTI]

    Ju, Tao

    mask customized to the shape of the bone, such as the femoral head. However, creat- ing masks for bones of different methodology have been reported for bone segmen- tation (see a recent survey in [1]). DueInteractive Separation of Segmented Bones in CT Volumes Using Graph Cut Lu Liu, David Raber, David

  5. Bone density and geometry in juvenile racehorses fed differing amounts of minerals

    E-Print Network [OSTI]

    Nolan, Meghan Muire

    2002-01-01T23:59:59.000Z

    designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

  6. Computer modeling approach for microsphere-packed bone scaffold Pallavi Lal, Wei Sun*

    E-Print Network [OSTI]

    Sun, Wei

    bone graft [5,6], for structural and human cellular assessment of scaffolds for bone repair [7 modeling approach for constructing a three-dimensional microsphere-packed bone graft structure is presented packing model to determine the number of microspheres packed in a synthesized bone graft. The pore size

  7. Prediction of the elastic modulus of the trabecular bone based on X-ray computed tomography

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . INTRODUCTION The investigation of the mechanical properties of trabe- cular bone presents a major challenge

  8. Test quality

    SciTech Connect (OSTI)

    Hartley, R.S. [EG and G Idaho, Inc., Idaho Falls, ID (United States); Keller, A.E. [Nuclear Regulatory Commission, Washington, DC (United States)

    1992-09-01T23:59:59.000Z

    This document discusses inservice testing of safety-related components at nuclear power plants which is performed under the American Society of Mechanical Engineers Boiler and Pressure Vessel Code (the Code). Subsections IWP and IWV of Section XI of the Code state test method and frequency requirements for pumps and valves respectively. Tests vary greatly in quality and frequency. This paper explores the concept of test quality and its relationship with operational readiness and preventive maintenance. This paper also considers the frequencies of component testing. Test quality is related to a test`s ability to detect degradation that can cause component failure. The quality of the test depends on several factors, including specific parameters measured, system or component conditions, and instrument accuracy. The quality of some currently required tests for check valves, motor-operated valves, and pumps is also discussed. Suggestions are made to improve test quality by measuring different parameters, testing valves under load, and testing positive displacement pumps at high pressure and centrifugal pumps at high flow rate conditions. These suggestions can help to improve the level of assurance of component operational readiness gained from testing.

  9. Evaluation of radionuclide bone-imaging for the early detection of sepsis in a model of equine neonatal osteomyelitis

    E-Print Network [OSTI]

    Taylor, James Rutledge

    1986-01-01T23:59:59.000Z

    method of detecting bone abnormalities. The two main factors determining the degree of radiopharmaceutical uptake in bones, and thereby assessing the functional integrity of bone, have been identified as bone blood flow and bone turnover rates.... The resultant infection and induced metabolic changes should produce a positive Technetium-99m MDP ( Tc-MDP) 99m bone scan, a positive scan using Indium-111-oxine labeled leukocytes and radiographic changes characterized by decreased bone density . Seven...

  10. autotaxin controls bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bykowski; Johnny Huard, Ph.D.; Lee E. Weiss, Ph.D.; Joseph E. Losee; Phil G. Campbell, Ph.D. 3 Akt1 in Osteoblasts and Osteoclasts Controls Bone Remodeling University of Kansas -...

  11. On the Mechanistic Origins of Toughness in Bone

    E-Print Network [OSTI]

    Launey, Maximilien E.

    One of the most intriguing protein materials found in nature is bone, a material composed of assemblies of tropocollagen molecules and tiny hydroxyapatite mineral crystals that form an extremely tough, yet lightweight, ...

  12. Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis MSC Thesis, Applied Mathematics E.M.van Aken 1107895 of the joint and to relieve the pain, a prosthesis to replace the glenoid of the shoulder joint is an option

  13. affects bone tissue: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  14. acute bone marrow: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  15. abnormal bone growth: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  16. abnormally high bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  17. acute bone crises: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  18. anorganic bone clinical: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  19. abnormal bone development: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  20. absorptiometry bone densitometer: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  1. alveolar bone cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  2. acute bone infarcts: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in damaged, inflamed, neoplastic or necrotic tissues may be due to dystrophic...

  3. acellular bone explants: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    hepatotoxicity is considered to be the cause of the diffuse liver uptake of 99m Tc-MDP. The mechanism of extraskeletal uptake of bone-seeking radiopharmaceuticals in...

  4. adverse events bone: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    marrow disease Daldrup-Link, H E; Henning, T; Link, T M 2007-01-01 316 Bone loss during energy restriction: mechanistic role of leptin Texas A&M University - TxSpace Summary:...

  5. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, James W. (108 Independent Blvd., Aiken, SC 29801)

    1993-01-01T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  6. Compact biomedical pulsed signal generator for bone tissue stimulation

    DOE Patents [OSTI]

    Kronberg, J.W.

    1993-06-08T23:59:59.000Z

    An apparatus for stimulating bone tissue for stimulating bone growth or treating osteoporosis by applying directly to the skin of the patient an alternating current electrical signal comprising wave forms known to simulate the piezoelectric constituents in bone. The apparatus may, by moving a switch, stimulate bone growth or treat osteoporosis, as desired. Based on low-power CMOS technology and enclosed in a moisture-resistant case shaped to fit comfortably, two astable multivibrators produce the desired waveforms. The amplitude, pulse width and pulse frequency, and the subpulse width and subpulse frequency of the waveforms are adjustable. The apparatus, preferably powered by a standard 9-volt battery, includes signal amplitude sensors and warning signals indicate an output is being produced and the battery needs to be replaced.

  7. ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone

    E-Print Network [OSTI]

    Ritchie, Robert

    ORIGINAL ARTICLE Effects of sequential osteoporosis treatments on trabecular bone in adult rats /Accepted: 3 September 2013 /Published online: 11 April 2014 # International Osteoporosis Foundation and National Osteoporosis Foundation 2014 Abstract Summary We used an osteopenic adult ovariectomized (OVX) rat

  8. areal bone mineral: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2.2.4 Risk factors 22 2.2.5 Morbidity and mortality 23 2.3 Units Laughlin, Robert B. 103 Rare earth element systematics of fossil bone revealed by LA-ICPMS analysis Environmental...

  9. Modular ‘Click-in-Emulsion’ Bone-Targeted Nanogels

    E-Print Network [OSTI]

    Heller, Daniel A.

    A new class of nanogel demonstrates modular biodistribution and affinity for bone. Nanogels, ~70 nm in diameter and synthesized via an astoichiometric click-chemistry in-emulsion method, controllably display residual, free ...

  10. Children cortical bone characterisation: the ultrasonic J.-P. Berteaua

    E-Print Network [OSTI]

    Boyer, Edmond

    infantile osteo-pathologies. That is why there is a strong interest in the characterisation of the growing specific location (close to cancerous cells) or cadaveric bone. They indicate a lower Young's modulus

  11. Test quality

    SciTech Connect (OSTI)

    Hartley, R.S. (EG and G Idaho, Inc., Idaho Falls, ID (United States)); Keller, A.E. (Nuclear Regulatory Commission, Washington, DC (United States))

    1992-01-01T23:59:59.000Z

    This document discusses inservice testing of safety-related components at nuclear power plants which is performed under the American Society of Mechanical Engineers Boiler and Pressure Vessel Code (the Code). Subsections IWP and IWV of Section XI of the Code state test method and frequency requirements for pumps and valves respectively. Tests vary greatly in quality and frequency. This paper explores the concept of test quality and its relationship with operational readiness and preventive maintenance. This paper also considers the frequencies of component testing. Test quality is related to a test's ability to detect degradation that can cause component failure. The quality of the test depends on several factors, including specific parameters measured, system or component conditions, and instrument accuracy. The quality of some currently required tests for check valves, motor-operated valves, and pumps is also discussed. Suggestions are made to improve test quality by measuring different parameters, testing valves under load, and testing positive displacement pumps at high pressure and centrifugal pumps at high flow rate conditions. These suggestions can help to improve the level of assurance of component operational readiness gained from testing.

  12. Trabecular bone dosimetry using a Monte Carlo code

    E-Print Network [OSTI]

    Zuzarte de Mendonca, Anne

    1993-01-01T23:59:59.000Z

    The nuclear medicine community needs radiation ~ dose estimates to patients who are administered radiopharmaceuticals for therapy or diagnosis. These estimates should be as accurate as possible for any organ, and especially for the bone since the bone... of Nuclear Medicine formed a committee to fulfill the needs of the nuclear medicine community to determine the radiation absorbed dose to patients who are athninistered radiopharmaceuticals. The objectives of the Medical Internal Radiation Dose Committee...

  13. Test Images

    E-Print Network [OSTI]

    Test Images. I hope to have a set of test images for the course soon. Some images are available now; some will have to wait until I can find another 100-200

  14. On the effect of x-ray irradiation on the deformation and fracture behavior of human cortical bone

    SciTech Connect (OSTI)

    Barth, Holly D.; Launey, Maximilien E.; McDowell, Alastair A.; Ager III, Joel W.; Ritchie, Robert O.

    2010-01-10T23:59:59.000Z

    In situ mechanical testing coupled with imaging using high-energy synchrotron x-ray diffraction or tomography imaging is gaining in popularity as a technique to investigate micrometer and even sub-micrometer deformation and fracture mechanisms in mineralized tissues, such as bone and teeth. However, the role of the irradiation in affecting the nature and properties of the tissue is not always taken into account. Accordingly, we examine here the effect of x-ray synchrotron-source irradiation on the mechanistic aspects of deformation and fracture in human cortical bone. Specifically, the strength, ductility and fracture resistance (both work-of-fracture and resistance-curve fracture toughness) of human femoral bone in the transverse (breaking) orientation were evaluated following exposures to 0.05, 70, 210 and 630 kGy irradiation. Our results show that the radiation typically used in tomography imaging can have a major and deleterious impact on the strength, post-yield behavior and fracture toughness of cortical bone, with the severity of the effect progressively increasing with higher doses of radiation. Plasticity was essentially suppressed after as little as 70 kGy of radiation; the fracture toughness was decreased by a factor of five after 210 kGy of radiation. Mechanistically, the irradiation was found to alter the salient toughening mechanisms, manifest by the progressive elimination of the bone's capacity for plastic deformation which restricts the intrinsic toughening from the formation 'plastic zones' around crack-like defects. Deep-ultraviolet Raman spectroscopy indicated that this behavior could be related to degradation in the collagen integrity.

  15. Temperature Measurement During Polymerization of Bone Cement in Percutaneous Vertebroplasty: An In Vivo Study in Humans

    SciTech Connect (OSTI)

    Anselmetti, Giovanni Carlo, E-mail: giovanni.anselmetti@ircc.it; Manca, Antonio [Institute for Cancer Research and Treatment (IRCC), Interventional Radiology Unit (Italy); Kanika, Khanna; Murphy, Kieran [Johns Hopkins Hospital, Radiology and Radiological Science (United States); Eminefendic, Haris [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy); Masala, Salvatore ['Tor Vergata' University General Hospital, Department of Diagnostic Imaging, Molecular Imaging, Interventional Radiology and Radiotherapy (Italy); Regge, Daniele [Institute for Cancer Research and Treatment (IRCC), Radiology Unit (Italy)

    2009-05-15T23:59:59.000Z

    Aim of the study was to 'in vivo' measure temperature, during percutaneous vertebroplasty (PV), within a vertebral body injected with different bone cements. According to the declaration of Helsinki, 22 women (60-80 years; mean, 75 years) with painful osteoporotic vertebral collapse underwent bilateral transpedicular PV on 22 lumbar vertebrae. Two 10-G vertebroplasty needles were introduced into the vertebra under digital fluoroscopy; a 16-G radiofrequency thermoablation needle (Starburst XL; RITA Medical System Inc., USA), carrying five thermocouples, was than coaxially inserted. Eleven different bone cements were injected and temperatures were measured every 30 s until temperatures dropped under 45{sup o}C. After the thermocouple needle was withdrawn, bilateral PV was completed with cement injection through the vertebroplasty needle. Unpaired Student's t-tests, Kruskal-Wallis test, and Wilcoxon signed rank test were used to evaluate significant differences (p < 0.05) in peak temperatures, variations between cements, and clinical outcome. All procedures were completed without complications, achieving good clinical outcomes (p < 0.0001). Regarding average peak temperature, cements were divided into three groups: A (over 60{sup o}C), B (from 50{sup o} to 60{sup o}C), and C (below 50{sup o}C). Peak temperature in Group A (86.7 {+-} 10.7{sup o}C) was significantly higher (p = 0.0172) than that in Groups B (60.5 {+-} 3.7{sup o}C) and C (44.8 {+-} 2.6{sup o}C). The average of all thermocouples showed an extremely significant difference (p = 0.0002) between groups. None of the tested cements maintained a temperature {>=}45{sup o}C for more than 30 min. These data suggest that back-pain improvement is obtained not by thermal necrosis but by mechanical consolidation only. The relative necrotic thermal effect in vertebral metastases seems to confirm that analgesia must be considered the main intent of PV.

  16. Development of a high-performance coal-fired power generating system with pyrolysis gas and char-fired high temperature furnace (HITAF). Quarterly progress report No. 7, July--September 1993

    SciTech Connect (OSTI)

    Not Available

    1993-11-01T23:59:59.000Z

    A concept for an advanced coal-fired combined-cycle power generating system is currently being developed. The first phase of this three-phase program consists of conducting the necessary research and development to define the system, evaluating the economic and technical feasibility of the concept, and preparing an R&D plan to develop the concept further. Foster Wheeler Development Corporation (FWDC) is leading a team of companies involved in this effort. The power generating system being developed in this project will be an improvement over current coal-fired systems. Goals have been specified that relate to the efficiency, emissions, costs, and general operation of the system. The system proposed to meet these goals is a combined-cycle system where air for a gas turbine is indirectly heated to approximately 1800{degrees}F in furnaces fired with coal-derived fuels and then directly heated in a natural-gas-fired combustor to about 2400{degrees}F. The system is based on a pyrolyzing process that converts the coal into a low-Btu fuel gas and char. The fuel gas is relatively clean, and it is fired to heat tube surfaces that are susceptible to corrosion and problems from ash deposition. In particular, the high-temperature air heater tubes, which will need to be a ceramic material, will be located in a separate furnace or region of a furnace that is exposed to combustion products from the low-Btu fuel gas only. A simplified process flow diagram is shown in Figure 1.

  17. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    and the epiphysis are wider than the diaphysis. Cortical bone is denser than trabecular bone as shown in Fig. 2.1b. In the overall adult human skeleton, the skeletal mass is 80% cortical bone and 20% trabecular bone (4). However, the distribution of cortical... surfaces. Moreover, they did not use the volume 6 Table 2.1. Summary of experimental results on trabecular bone from previous research Source Type of bone Size of specimen Carter & Hayes (3) Bovine, Human ?20.6x5mm Cylinder E =3790? 0.06 ? 3 , ? c...

  18. Monitoring of saline tracer movement with vertically distributed self-potential measurements at the HOBE agricultural test site, Voulund, Denmark

    E-Print Network [OSTI]

    Jougnot, Damien; Haarder, Eline B; Looms, Majken C

    2015-01-01T23:59:59.000Z

    The self-potential (SP) method is sensitive to water fluxes in saturated and partially saturated porous media, such as those associated with rainwater infiltration and groundwater recharge. We present a field-based study at the Voulund agricultural test site, Denmark, that is, to the best of our knowledge, the first to focus on the vertical self-potential distribution prior to and during a saline tracer test. A coupled hydrogeophysical modeling framework is used to simulate the SP response to precipitation and saline tracer infiltration. A layered hydrological model is first obtained by inverting dielectric and matric potential data. The resulting model that compares favorably with electrical resistance tomography models is subsequently used to predict the SP response. The electrokinetic contribution (caused by water fluxes in a charged porous soil) is modeled by an effective excess charge approach that considers both water saturation and pore water salinity. Our results suggest that the effective excess char...

  19. Common variants in the region around Osterix are associated with bone mineral density and growth in childhood

    E-Print Network [OSTI]

    Peltonen, Leena

    Peak bone mass achieved in adolescence is a determinant of bone mass in later life. In order to identify genetic variants affecting bone mineral density (BMD), we performed a genome-wide association study of BMD and related ...

  20. FFTF (Fast Flux Test Facility) cobalt test assembly results

    SciTech Connect (OSTI)

    Rawlins, J.A.; Wootan, D.W.; Carter, L.L.; Brager, H.R.; Schenter, R.E.

    1987-10-01T23:59:59.000Z

    A cobalt test assembly containing yttrium hydride pins for neutron moderation was irradiated in the Fast Flux Test Facility during Cycle 9A for 137.7 equivalent full power days at a power level of 291 MW. The 36 test pins consisted of a batch of 32 pins containing cobalt metal to produce Co-60, and a set of 4 pins with europium oxide to produce Gd-153, a radioisotope used in detection of the bone disease Osteoporosis. Post-irradiation examination of the cobalt pins determined the Co-60 produced with an accuracy of about 5%. The measured Co-60 spatially distributed concentrations were within 20% of the calculated concentrations. The assembly average Co-60 measured activity was 4% less than the calculated value. The europium oxide pins were gamma scanned for the europium isotopes Eu-152 and Eu-154 to an absolute accuracy of about 10%. The measured europium radioisotope and Gd-153 concentrations were within 20% of calculated values. In conclusion, the hydride assembly performed well and is an excellent vehicle for many Fast Flux Test Facility isotope production applications. The results also demonstrate that the calculational methods developed by the Westinghouse Hanford Company are very accurate. 4 refs., 3 figs., 1 tab.

  1. Pricetown I underground coal gasification field test: operations report

    SciTech Connect (OSTI)

    Agarwal, A.K.; Seabaugh, P.W.; Zielinski, R.E.

    1981-01-01T23:59:59.000Z

    An Underground Coal Gasification (UCG) field test in bituminous coal was successfully completed near Pricetown, West Virginia. The primary objective of this field test was to determine the viability of the linked vertical well (LVV) technology to recover the 900 foot deep, 6 foot thick coal seam. A methane rich product gas with an average heating value of approximately 250 Btu/SCF was produced at low air injection flow rates during the reverse combustion linkage phase. Heating value of the gas produced during the linkage enhancement phase was 221 Btu/SCF with air injection. The high methane formation has been attributed to the thermal and hydrocracking of tars and oils along with hydropyrolysis and hydrogasification of coal char. The high heating value of the gas was the combined effect of residence time, flow pattern, injection flow rate, injection pressure, and back pressure. During the gasification phase, a gas with an average heating value of 125 Btu/SCF was produced with only air injection, which resulted in an average energy production of 362 MMBtu/day.

  2. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  3. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    properties of proximal tibia were measured using in vivo peripheral quantitative CT. Bone formation rate was quantified on the periosteal the surface by standard bone histomorphometry after intraperitoneal injections of calcein. There was a significant main...

  4. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces 

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to bone surfaces. Although only plutonium was used in the evaluation of this model, any bone surface-seeking, alpha-emitting nuclide, and any class compound, can be used with this model....

  5. Apatite-polymer composites for the controlled delivery of bone morphogenetic proteins

    E-Print Network [OSTI]

    Yong, Tseh-Hwan

    2005-01-01T23:59:59.000Z

    Current treatment of bone defects due to trauma, cancer, or degenerative spine diseases involves the implantation of a bone graft. Autografts, which are harvested from the patient's own body, are associated with problems ...

  6. Bone Canonical WNT/B-Catenin Signaling in Models of Reduced Microgravity

    E-Print Network [OSTI]

    Macias, Brandon 1979-

    2012-10-25T23:59:59.000Z

    translates into molecular osteogenic signals in bone cells is unknown. Radiation exposure is another potent inducer of bone loss, namely observed on Earth in the clinical setting following radiotherapy procedures. It is expected that long duration space...

  7. Impact of Omega-3 Polyunsaturated Fatty Acids on Bone Adaptations to Simulated Resistance Training 

    E-Print Network [OSTI]

    Camp, Kaleigh Ann

    2013-04-30T23:59:59.000Z

    Young and ovariectomized animals eating diets rich in omega-3 polyunsaturated fatty acids (n-3 PUFAs) exhibit enhanced bone formation and decrease bone loss, respectively. Eicosapentaenoic acid, an n-3 PUFA found in fish ...

  8. Detection of bone disease in dogs by radioisotope scanning

    E-Print Network [OSTI]

    Morris, Earl Louis

    1971-01-01T23:59:59.000Z

    f = fractional abundance 6 = cross section thermal neutron f1~ &t (1-e ) = decay factor The usual method of administration of radio- isotopes is intravenously but some have been given orally. 4 high bone to tissue ratio must be achieved... is limited by their availability because they must be produced close to where they will be used. MATERIALS AND METHODS The use of 2 radioactive isotopes for bone scanning in dogs was studied. Sr and Sr were 85 87m selected as the isotopes to be studied...

  9. Measurement of bone mineral content in caged and active cats 

    E-Print Network [OSTI]

    Tveter, Diane Ellen

    1988-01-01T23:59:59.000Z

    errors but these can be reduced by using two different x-ray energies. Dual energy CT operates on a basis similar to dual photon absorptiometry (explained below). The difference in attenuation between tissue and bone is greater for a lower energy... to act as a soft tissue equivalent (35). Effects of fat and soft tissue are decreased when dual energy CT is used (33). Data from each of the two different photon energies are combined and result in images of soft tissue and bone mineral regions. Beam...

  10. The effects of eccentric training on muscle-bone function

    E-Print Network [OSTI]

    Hubal, Monica Jeanne

    1999-01-01T23:59:59.000Z

    THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... December 1999 Major Subject: Kinesiology THE EFFECTS OF ECCENTRIC TRAINING ON MUSCLE-BONE FUNCTION A Thesis by MONICA JEANNE HUBAL Subinitted to the Office of Graduate Studies of Texas A8iM University in partial fulfillment of the requirements...

  11. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    . While we cannot measure bone stress in vivo, we can visualize bone metabolic activity using 18 F NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate whether subjects. Published by Wiley Periodicals, Inc. J Orthop Res Keywords: patellofemoral pain; 18 F NaF PET/CT; bone

  12. Is decreased bone mineral density associated with development of scoliosis? A bipedal osteopenic rat model

    E-Print Network [OSTI]

    Dede, Ozgur; Akel, Ibrahim; Demirkiran, Gokhan; Yalcin, Nadir; Marcucio, Ralph; Acaroglu, Emre

    2011-01-01T23:59:59.000Z

    more time standing erect. Dual energy X-ray absorbtiometry (acid; DEXA: Dual energy X-ray absorptiometry; BMD: Bone

  13. 3D Bone Microarchitecture Modeling and Fracture Risk Department of Computer

    E-Print Network [OSTI]

    Buffalo, State University of New York

    technique for the diagnosis of osteoporosis is Bone Mineral Density (BMD) measurement based on dual energy X

  14. Test Comparability

    E-Print Network [OSTI]

    Keller, Christine; Shulenburger, David E.

    2010-01-01T23:59:59.000Z

    KU ScholarWorks | http://kuscholarworks.ku.edu Test Comparability 2010 by Christine Keller and David Shulenburger This work has been made available by the University of Kansas Libraries’ Office of Scholarly Communication and Copyright. Please... and Shulenburger, David. “Test comparability,” with Christine Keller in the Letters section of Change, September/October 2010, p. 6. Published version: http://www.changemag.org/Archives/Back%20 Issues/September-October%202010/letters-to-editor.html Terms of Use...

  15. Test Automation Ant JUnit Test Automation

    E-Print Network [OSTI]

    Mousavi, Mohammad

    Test Automation Ant JUnit Test Automation Mohammad Mousavi Eindhoven University of Technology, The Netherlands Software Testing 2012 Mousavi: Test Automation #12;Test Automation Ant JUnit Outline Test Automation Ant JUnit Mousavi: Test Automation #12;Test Automation Ant JUnit Why? Challenges of Manual Testing

  16. Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence of cortical fixation

    E-Print Network [OSTI]

    Guerraoui, Rachid

    Calcium phosphate cement augmentation of cancellous bone screws can compensate for the absence Keywords: Screw fixation Pullout force Calcium phosphate cement Osteoporotic bone a b s t r a c with cement. Previous studies have shown that bone augmentation with Calcium Phosphate (CaP) cement

  17. Augmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep

    E-Print Network [OSTI]

    Guerraoui, Rachid

    replacement, where significant bone loss can be found either under the tibial tray or in the femoral partAugmentation of bone defect healing using a new biocomposite scaffold: An in vivo study in sheep U March 2010 Keywords: Biocomposite Bone substitute In vivo Poly(L-lactic acid) b-Tricalcium phosphate a b

  18. Design and validation of automated femoral bone morphology measurements in cerebral palsy

    E-Print Network [OSTI]

    Lee, Jehee

    Design and validation of automated femoral bone morphology measurements in cerebral palsy Noyeol, Seoul, South Korea #12;Abstract Accurate quantification of bone morphology is important for monitoring an automatic bone morphology measurement method using one or two radiographs. The study focused on 4

  19. A method for calibration of bone driver transducers to measure the mastoid impedance Reggie Weecea

    E-Print Network [OSTI]

    Allen, Jont

    bone vibrator transducers for clinical measurements, the transfer of energy from the bone driver by known masses. This absolute calibration is based upon a circuit model of the driver, describing specialized equipment not available in the clinic, and a refined bone driver circuit model is proposed

  20. Modelling by percolation theory of the behaviour of natural coral used as bone substitute.

    E-Print Network [OSTI]

    Boyer, Edmond

    Modelling by percolation theory of the behaviour of natural coral used as bone substitute. Y the resorption and ossification of natural coral implanted in bones. The first step of the process.barbotteau@qse.tohoku.ac.jp) #12;Modelling by percolation theory of the behaviour of natural coral used as bone substitute.2 1

  1. Histologic Comparison of Regenerate Bone Produced from Dentate Versus Edentulous Transport Discs in Bone Transport Distraction Osteogenesis

    E-Print Network [OSTI]

    Sevilla Gaitan, Carlos

    2013-12-10T23:59:59.000Z

    and the recipient bone segment (Nagashima, Rondon-Newby et al. 2012). Histologic examination of the midline tissues was performed in the present study to establish whether or not bony union has occurred. Main Goal The main goal of this study was to analyze... emphasis on characteristics related to the quality and quantity of the new regenerate bone formed (Zapata, Halvachs et al. 2011; Zapata, Opperman et al. 2011; Nagashima, Rondon-Newby et al. 2012). Nagashima et al. concluded that after four weeks...

  2. Evolution of Matrix and Bone -Carboxyglutamic Acid Proteins in Vertebrates*

    E-Print Network [OSTI]

    Price, Paul A.

    or reconstructed through the use of comparative genomics and data mining. These sequences were compared with available annotated sequences (a total of 48 complete or nearly complete sequences, 28 BGPs and 20 MGPs of biological functions such as skeletogenesis and bone maintenance (BGP and MGP), hemostasis (prothrombin, clot

  3. FSH Directly Regulates Bone Mass Yuanzhen Peng,1

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    .01.051 SUMMARY Postmenopausal osteoporosis, a global public health problem, has for decades been attributed and function. We suggest that high circulating FSH causes hypogonadal bone loss. INTRODUCTION Osteoporosis., 1993; Manolagas and Jilka, 1995). After menopause, resorption significantly exceeds formation

  4. Invest in Your Bones Osteoporosis--The Silent Disease

    E-Print Network [OSTI]

    Invest in Your Bones Osteoporosis--The Silent Disease Leaflet 2 Osteoporosis, a painful of State Health Services, 2008). Osteoporosis is preventable and/or treatable. Accordingly, osteoporosis of height, and chronic back pain. Hip fracture, the most serious consequence of osteoporosis, threatens one

  5. Spectral Analysis and Connectivity of Porous Microstructures in Bone

    E-Print Network [OSTI]

    Golden, Kenneth M.

    that quantifies brine connectivity and its thermal evolution can also help assess the impact of osteoporosis on trabecular structure. Central to our approach is the spectral measure of a composite material, which contains, in dense cortical bone the pores can be sparse and disconnected, yet exhibit increasing volume fraction

  6. Splenic concentration of bone imaging agents in functional asplenia

    SciTech Connect (OSTI)

    Dhekne, R.D.

    1981-07-01T23:59:59.000Z

    Three cases of sickle cell disease associated with functional asplenia are described. The spleen was not visualized on routine Tc-99m-sulfur colloid scan. The bone scan performed with Tc-99m-phosphate compounds revealed abnormal splenic activity in all three cases. The previous case reports and the literature on this subject are reviewed.

  7. Metastatic calcification of the stomach imaged on a bone scan

    SciTech Connect (OSTI)

    Goldstein, R.; Ryo, U.Y.; Pinsky, S.M.

    1984-10-01T23:59:59.000Z

    A whole body bone scan obtained on a 21-year-old woman with sickle cell disease and chronic renal failure showed localization of the radionuclide diffusely in the stomach. The localization of the radionuclide represented metastatic calcification of the stomach caused by secondary hyperparathyroidism.

  8. Random lasing in bone tissue Qinghai Song,1

    E-Print Network [OSTI]

    Kim, Young L.

    of Biomedical Engineering, Purdue University, West Lafayette, Indiana 47907, USA 2 School of Electrical, 2010; posted March 26, 2010 (Doc. ID 122271); published April 28, 2010 Owing to the low-loss and high and deformation mecha- nisms in bone still remain relatively unexplored, in part, due to current technical

  9. A Signal-Inducing Bone Cement for Magnetic Resonance Imaging-Guided Spinal Surgery Based on Hydroxyapatite and Polymethylmethacrylate

    SciTech Connect (OSTI)

    Wichlas, Florian, E-mail: florian.wichlas@charite.de; Seebauer, Christian J.; Schilling, Rene [University Charite, Center for Musculoskeletal Surgery (Germany); Rump, Jens [University Charite, Department of Radiology (Germany); Chopra, Sascha S. [University Charite, Center for Musculoskeletal Surgery (Germany); Walter, Thula; Teichgraeber, Ulf K. M. [University Charite, Department of Radiology (Germany); Bail, Hermann J. [University Charite, Center for Musculoskeletal Surgery (Germany)

    2012-06-15T23:59:59.000Z

    The aim of this study was to develop a signal-inducing bone cement for magnetic resonance imaging (MRI)-guided cementoplasty of the spine. This MRI cement would allow precise and controlled injection of cement into pathologic lesions of the bone. We mixed conventional polymethylmethacrylate bone cement (PMMA; 5 ml methylmethacrylate and 12 g polymethylmethacrylate) with hydroxyapatite (HA) bone substitute (2-4 ml) and a gadolinium-based contrast agent (CA; 0-60 {mu}l). The contrast-to-noise ratio (CNR) of different CA doses was measured in an open 1.0-Tesla scanner for fast T1W Turbo-Spin-Echo (TSE) and T1W TSE pulse sequences to determine the highest signal. We simulated MRI-guided cementoplasty in cadaveric spines. Compressive strength of the cements was tested. The highest CNR was (1) 87.3 (SD 2.9) in fast T1W TSE for cements with 4 {mu}l CA/ml HA (4 ml) and (2) 60.8 (SD 2.4) in T1W TSE for cements with 1 {mu}l CA/ml HA (4 ml). MRI-guided cementoplasty in cadaveric spine was feasible. Compressive strength decreased with increasing amounts of HA from 46.7 MPa (2 ml HA) to 28.0 MPa (4 ml HA). An MRI-compatible cement based on PMMA, HA, and CA is feasible and clearly visible on MRI images. MRI-guided spinal cementoplasty using this cement would permit direct visualization of the cement, the pathologic process, and the anatomical surroundings.

  10. A multiscale mechanobiological model of bone remodelling predicts site-specific bone loss in the femur during osteoporosis and mechanical disuse

    E-Print Network [OSTI]

    Lerebours, C; Scheiner, S; Pivonka, P

    2015-01-01T23:59:59.000Z

    We propose a multiscale mechanobiological model of bone remodelling to investigate the site-specific evolution of bone volume fraction across the midshaft of a femur. The model includes hormonal regulation and biochemical coupling of bone cell populations, the influence of the microstructure on bone turnover rate, and mechanical adaptation of the tissue. Both microscopic and tissue-scale stress/strain states of the tissue are calculated from macroscopic loads by a combination of beam theory and micromechanical homogenisation. This model is applied to simulate the spatio-temporal evolution of a human midshaft femur scan subjected to two deregulating circumstances: (i) osteoporosis and (ii) mechanical disuse. Both simulated deregulations led to endocortical bone loss, cortical wall thinning and expansion of the medullary cavity, in accordance with experimental findings. Our model suggests that these observations are attributable to a large extent to the influence of the microstructure on bone turnover rate. Mec...

  11. Liquid-Solid Phase Transition Alloy as Reversible and Rapid Molding Bone Cement

    E-Print Network [OSTI]

    Yi, Liting; Liu, Jing

    2013-01-01T23:59:59.000Z

    Bone cement has been demonstrated as an essential restorative material in the orthopedic surgery. However current materials often imply unavoidable drawbacks, such as tissue-cement reaction induced thermal injuries and troublesome revision procedure. Here we proposed an injectable alloy cement to address such problems through its liquid-solid phase transition mechanism. The cement is made of a unique alloy BiInSnZn with a specifically designed low melting point 57.5{\\deg}C. This property enables its rapid molding into various shapes with high plasticity. Some fundamental characteristics including mechanical strength behaviors and phase transition-induced thermal features have been measured to demonstrate the competence of alloy as unconventional cement with favorable merits. Further biocompatible tests showed that this material could be safely employed in vivo. In addition, experiments also found the alloy cement capability as an excellent contrast agent for radiation imaging. Particularly, the proposed alloy...

  12. Verification Testing Test Driven Development Testing with JUnit Verification

    E-Print Network [OSTI]

    Peters, Dennis

    Verification Testing Test Driven Development Testing with JUnit Verification Any activity should be verified. #12;Verification Testing Test Driven Development Testing with JUnit Approaches to verification 1 Testing 2 Static Analysis · Peer review · Insepction/Walk-through/Structured review · Formal

  13. Peri-prosthetic fracture vibration testing

    SciTech Connect (OSTI)

    Cruce, Jesse R [Los Alamos National Laboratory; Erwin, Jenny R [Los Alamos National Laboratory; Remick, Kevin R [Los Alamos National Laboratory; Cornwell, Phillip J [Los Alamos National Laboratory; Menegini, R. Michael [INDIANA UNIV.; Racanelli, Joe [STRYKER ORTHOPAEDICS

    2011-01-28T23:59:59.000Z

    The purpose of this study is to establish a test setup and vibration analysis method to predict femoral stem seating and prevent bone fracture using accelerometer or force response data from an instrument stem and impactor. This study builds upon earlier studies to identify a means to supplement a surgeon's tactile and auditory senses by using damage identification techniques normally used for civil and mechanical structures. Testing will be conducted using foam cortical shell sawbones prepared for stems of different geometries. Each stem will be instrumented with an accelerometer. Two impactor designs will be compared: a monolithic impactor with an integrated load cell and accelerometer and a two piece impactor. Acceleration and force measurements will be taken in the direction of impaction. Signal processing techniques will be applied to the acceleration time histories to determine features that can be used to assess device seating and potential fracture. A consistent energy input will be applied using a drop tower. The effect of introducing compliance under the bone support vise will also be investigated. The ultimate goal of this study is to design an integrated portable data acquisition system capable of being used in future cadaveric testing. This paper will discuss the experimental set-up, the signal processing techniques used and the subsequent results.

  14. Estimating cancellous bone properties of the rat from mechanical testing of the femoral neck

    E-Print Network [OSTI]

    Groves, Jennifer Ann

    1998-01-01T23:59:59.000Z

    ), moment can be related to stress by; (2-23) M =f cr?ydA 24 eutral surface Y Figure 2. 10. a. ) Stress distribution through the cross section of an elastic-perfectly plastic material in bending (Crandall et al. 1978). b. ) Stress-strain curvefor... and strain are still linearly related by s = ay/E and by substitution: (2-27) a, K= ? = Also, the yield curvature, Ky call be found from equatloll (2 5) wllel'e M: My so: (2-28) M?2cr, El Eh 26 Combining (2-27) and (2-28) gives: (2-29) h k, 2e Using...

  15. Verifying Test Hypotheses -HOL/TestGen Verifying Test Hypotheses -HOL/TestGen

    E-Print Network [OSTI]

    Verifying Test Hypotheses - HOL/TestGen Verifying Test Hypotheses - HOL/TestGen An Experiment in Test and Proof Thomas Malcher January 20, 2014 1 / 20 #12;Verifying Test Hypotheses - HOL/TestGen HOL/TestGen Outline Introduction Test Hypotheses HOL/TestGen - Demo Verifying Test Hypotheses Conclusion 2 / 20 #12

  16. Measuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT imaging.

    E-Print Network [OSTI]

    Piana, Michele

    ; 7 CNR-SPIN. Genova. Italy Running Head: PET/CT measurement of bone marrow volume AddressMeasuring the whole bone marrow asset in humans by a computational approach to integrated PET/CT to chemotherapy. Keywords: PET/CT; bone marrow imaging; image processing. #12;2 Introduction Bone marrow (BM

  17. Microgrid Testing

    SciTech Connect (OSTI)

    Shirazi, M.; Kroposki, B.

    2012-01-01T23:59:59.000Z

    With the publication of IEEE 1574.4 Guide for Design, Operation, and Integration of Distributed Resource Island Systems with Electric Power Systems, there is an increasing amount of attention on not only the design and operations of microgrids, but also on the proper operation and testing of these systems. This standard provides alternative approaches and good practices for the design, operation, and integration of microgrids. This includes the ability to separate from and reconnect to part of the utility grid while providing power to the islanded power system. This presentation addresses the industry need to develop standardized testing and evaluation procedures for microgrids in order to assure quality operation in the grid connected and islanded modes of operation.

  18. Standardization of test methodology: a comparison between three suture anchors

    E-Print Network [OSTI]

    Jonnalagadda, Silpa P.

    2005-08-29T23:59:59.000Z

    was not the weakest link in the system. Meyer et al.12, however, reported that absorbable suture anchors are made of mechanically weak material and could be the weakest links in the soft tissue-anchor-bone complex. Investigators have also developed various modified... STANDARDIZATION OF TEST METHODOLOGY: A COMPARISON BETWEEN THREE SUTURE ANCHORS A Thesis by SILPA P. JONNALAGADDA Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements...

  19. Identification of a hypoxic population of bone marrow cells

    SciTech Connect (OSTI)

    Allalunis, M.J.; Chapman, J.D.; Turner, A.R.

    1983-02-01T23:59:59.000Z

    A technique using collagenase has been devised to release and separate, with reproducibility, hematopoietic cells (HC) from various microenvironments of mouse femurs. HC were assayed by an in vitro gel culture technique used traditionally to score granulocyte-macrophage precursor cells (CFU-C). CFU-C which resided in the medullary cavity and endosteal regions were sensitive to ionizing radiation and resistant to misonidazole (MISO) cytotoxicity. CFU-C which resided within the compact bone were resistant to ionizing radiation and sensitive to the cytotoxic action of MISO. These results suggest that HC which reside in the bone are hypoxic and retain clonogenic potential. When animals were exposed to various treatments with MISO followed by myelotoxic doses of cyclophosphamide (CTX) or total body irradiation (TBI), the LD/sub 50/ of both agents was significantly reduced. This result suggests that a hypoxic component of HC could be important in the regenerative process within the marrow after such myelotoxic trauma.

  20. Exposure to cadmium and persistent organochlorine pollutants and its association with bone mineral density and markers of bone metabolism on postmenopausal women

    SciTech Connect (OSTI)

    Rignell-Hydbom, A., E-mail: anna.rignell-hydbom@med.lu.se [Department of Occupational and Environmental Medicine, Lund University (Sweden); Skerfving, S.; Lundh, T.; Lindh, C.H. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Elmstahl, S. [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden)] [Division of Geriatric Medicine, Department of Health Sciences, Lund University, Malmue University Hospital (Sweden); Bjellerup, P. [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden)] [Center for Clinical Research, Uppsala University, Department of Clinical Chemistry, Vaesteras (Sweden); Juensson, B.A.G.; Struemberg, U. [Department of Occupational and Environmental Medicine, Lund University (Sweden)] [Department of Occupational and Environmental Medicine, Lund University (Sweden); Akesson, A. [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)] [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden)

    2009-11-15T23:59:59.000Z

    Environmental contaminants such as cadmium and persistent organochlorine pollutants have been proposed as risk factors of osteoporosis, and women may be at an increased risk. To assess associations between exposure to cadmium and two different POPs (2,2',4,4',5,5'-hexachlorobiphenyl CB-153, 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene p,p'-DDE), on one hand, and bone effects, on the other, in a population-based study among postmenopausal (60-70 years) Swedish women with biobanked blood samples. The study included 908 women and was designed to have a large contrast of bone mineral densities, measured with a single photon absorptiometry technique in the non-dominant forearm. Biochemical markers related to bone metabolism were analyzed in serum. Exposure assessment was based on cadmium concentrations in erythrocytes and serum concentrations of CB-153 and p,p'-DDE. Cadmium was negatively associated with bone mineral density and parathyroid hormone, positively with the marker of bone resorption. However, this association disappeared after adjustment for smoking. The major DDT metabolite (p,p'-DDE) was positively associated with bone mineral density, an association which remained after adjustment for confounders, but the effect was weak. There was no evidence that the estrogenic congener (CB-153) was associated with any of the bone markers. In conclusion, no convincing associations were observed between cadmium and POPs, on one hand, and bone metabolism markers and BMD, on the other.

  1. A comparative histological study of fossil and recent bone tissues

    E-Print Network [OSTI]

    Enlow, Donald H.

    1955-01-01T23:59:59.000Z

    ? scopic inspection. A wet section, as viewed during trial grinding examinations, will appear more transparent than the dried, finished mount. Any of the standard laboratory abrasives, such as finely powdered carborundum, polishing alumina, or powdered... by hand with the bone section in direct contact with the revolving surface of a power-driven lap wheel. Finely powdered abrasive, such as carborundum or cleansing pov/der, is applied in the form of water paste to the wheel. Periodic inspection under a...

  2. Effects of hyperparathyroidism and calcium on bone healing

    E-Print Network [OSTI]

    Hubbard, Gene Borden

    1975-01-01T23:59:59.000Z

    lesions, blood chemistry data and microscopic examination of bone, The citations on the following pages follow the style of the Sutrnaf. 0$ She. Amuck'. can Vetenanacq Medx. caf. Ass acL aX&0n. CHAPTER II LITERATURE REVIEW Trauma has traditionally...- parathyroidism; however, lameness disappeared in horses fed a standard ration containing 0. 52; calcium and 0. 45+ phosphorus. The case history of a man with hyperparathyroidism in which the main clinical feature was multiple nonuniting 7 fractures has been...

  3. Porous coatings from wire mesh for bone implants

    DOE Patents [OSTI]

    Sump, Kenneth R. (Richland, WA)

    1986-01-01T23:59:59.000Z

    A method of coating areas of bone implant elements and the resulting implant having a porous coating are described. Preselected surface areas are covered by a preform made from continuous woven lengths of wire. The preform is compressed and heated to assure that diffusion bonding occurs between the wire surfaces and between the surface boundaries of the implant element and the wire surfaces in contact with it. Porosity is achieved by control of the resulting voids between the bonded wire portions.

  4. Aging and Fracture of Human Cortical Bone and Tooth Dentin

    SciTech Connect (OSTI)

    Ager, Joel; Koester, Kurt J.; Ager III, Joel W.; Ritchie, Robert O.

    2008-05-07T23:59:59.000Z

    Mineralized tissues, such as bone and tooth dentin, serve as structural materials in the human body and, as such, have evolved to resist fracture. In assessing their quantitative fracture resistance or toughness, it is important to distinguish between intrinsic toughening mechanisms which function ahead of the crack tip, such as plasticity in metals, and extrinsic mechanisms which function primarily behind the tip, such as crack bridging in ceramics. Bone and dentin derive their resistance to fracture principally from extrinsic toughening mechanisms which have their origins in the hierarchical microstructure of these mineralized tissues. Experimentally, quantification of these toughening mechanisms requires a crack-growth resistance approach, which can be achieved by measuring the crack-driving force, e.g., the stress intensity, as a function of crack extension ("R-curve approach"). Here this methodology is used to study of the effect of aging on the fracture properties of human cortical bone and human dentin in order to discern the microstructural origins of toughness in these materials.

  5. Prototype to Test WHY prototype to test

    E-Print Network [OSTI]

    Prinz, Friedrich B.

    Prototype to Test METHOD WHY prototype to test HOW to prototype to test Prototyping to test or design space. The fundamental way you test your prototypes is by letting users experience them and react to them. In creating prototypes to test with users you have the opportunity to examine your solution

  6. Adaptive differentiation of H-2- and Igh-restricted B lymphocyte in tetraparental bone marrow chimera

    SciTech Connect (OSTI)

    Yamamoto, H.; Bitoh, S.; Fujimoto, S.

    1987-01-15T23:59:59.000Z

    Immunization of BALB/c mice with MOPC-104E myeloma protein induced idiotype-specific enhancing B cells that acted on anti-dextran antibody producing B cells. The enhancing cells have the surface phenotype of B cells. With the use of several H-2 or Igh congenic mice, it was found that the cooperation among B cells was controlled by both the major histocompatibility complex (MHC) and Igh. The capability to generate enhancing B cell activity was analyzed by using tetraparental bone marrow chimeras. (C57BL/6 X BALB/c)F1 mice, for example, were lethally irradiated and were reconstituted with C57BL/6 and BALB/c bone marrow cells. Nine to 12 wk after the reconstitution, the chimeras were immunized with the myeloma protein and were tested for their enhancing B cell activity. After the removal of C57BL/6 origin cells by treatment with anti-H-2b + complement, residual cells exhibited enhancing B cell activity on BALB.B, as well as BALB/c antidextran antibody response. This indicates that the generation of H-2-restricted, idiotype-specific enhancing B cell activity differentiated adaptively so as to recognize foreign MHC as self under chimeric conditions. On the other hand, splenic B cells treated with anti-H-2d + complement did not enhance the responses of BALB/c or BALB.B. Even in a chimeric environment, the B cells of C57BL/6 origin could not obtain the ability to generate enhancing B cell activity upon immunization of the idiotype. The results described here, taken in conjunction with our previous studies, suggest that the Ig heavy chain gene(s) predominantly control the Igh restriction properties of enhancing B cells, and the capability of MHC recognition by B cells is selected under chimeric conditions.

  7. Patients with Patellofemoral Pain Exhibit Elevated Bone Metabolic Activity at the Patellofemoral Joint

    E-Print Network [OSTI]

    Delp, Scott

    NaF PET/CT, which may be related to bone stress. Our goals were to use 18 F NaF PET/CT to evaluate: patellofemoral pain; 18 F NaF PET/CT; bone metabolic activity Patellofemoral pain syndrome is often characterized the specific regions of tracer uptake. 18 F NaF PET/CT is an alter- native to Tc-99m MDP bone scintigraphy

  8. Frontal and orbital bone infarctions causing periorbital swelling in patients with sickle cell anemia

    SciTech Connect (OSTI)

    Garty, I.; Koren, A.; Garzozi, H.

    1984-10-01T23:59:59.000Z

    Two cases of unilateral and bilateral periorbital hematomas occurred in patients with sickle cell anemia. The cause of periorbital swelling in these cases was found to be orbital and frontal bone infarctions, respectively, diagnosed by technetium Tc 99m medronate bone scintigraphy. To our knowledge, periorbital bone infarction, as a part of the differential diagnosis of periorbital hematoma and as part of the possible ocular manifestations in patients with sickle cell anemia, has not previously been described.

  9. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    on Bone During Extended Bed Rest (Human) Only a few long-term bed rest investigations have successfully mitigated bone loss with exercise paradigms. Combined supine flywheel resistive and treadmill exercise during 90-day bed rest in young men... novel rodent resistance exercise device using flywheel technology was used by Fluckey et al (57) to demonstrate the effects of maximal voluntary squats, performed during suspension, on changes in metaphyseal bone mass. The flywheel exercise protocol...

  10. Journal of Biomechanics 41 (2008) 10621068 Nonlinear ultrasound can detect accumulated damage in human bone

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    due to the fact that osteoporosis and bone fragility are increasingly widespread diseases. Fracture increases exponentially with age, with a significant increase corresponding to the beginning of menopause

  11. Preparation and characterization of calcium phosphate ceramics and Composites as bone substitutes

    E-Print Network [OSTI]

    Zhang, Xing

    2007-01-01T23:59:59.000Z

    bone. Natural porous calcium carbonate skeletons, coral andconversion of calcium carbonate marine skeletons in (NH 4 )conversions of calcium carbonate skeletons (e.g. coral,

  12. Bone mineral density and fractures in older men with chronic obstructive pulmonary disease or asthma

    E-Print Network [OSTI]

    Dam, T.-T.; Harrison, S.; Fink, H. A.; Ramsdell, J.; Barrett-Connor, E.

    2010-01-01T23:59:59.000Z

    risk of vertebral osteoporosis compared to men with noto identify patients with osteoporosis. Keywords Bone loss .associated with COPD, osteoporosis is believed to affect 36%

  13. MECHANICAL TEST LAB CAPABILITIES

    E-Print Network [OSTI]

    MECHANICAL TEST LAB CAPABILITIES · Static and cyclic testing (ASTM and non-standard) · Impact drop testing · Slow-cycle fatigue testing · High temperature testing to 2500°F · ASTM/ Boeing/ SACMA standard testing · Ability to design and fabricate non-standard test fixtures and perform non-standard tests

  14. Orion Flight Test Exploration Flight Test-1

    E-Print Network [OSTI]

    Waliser, Duane E.

    Orion Flight Test Exploration Flight Test-1 PRESS KIT/December 2014 www.nasa.gov NP-2014-11-020-JSC National Aeronautics and Space Administration #12;#12;Orion Flight Test December 2014 Contents Section Page ........................................................................................... 28 i #12;Orion Flight Test ii December 2014 #12;Orion Flight Test December 2014 Flight Overview

  15. Test Preparation Options Free Test Prep Websites

    E-Print Network [OSTI]

    Stowell, Michael

    Test Preparation Options Free Test Prep Websites ACT: http: http://www.collegeboard.com/student/testing/sat/prep_one/test.html http://www.number2.com://testprep.princetonreview.com/CourseSearch/Search.aspx?itemCode=17&productType=F&rid=1&zip=803 02 Test Prep Classes Front Range Community College: Classes

  16. Test and Test Equipment Joshua Lottich

    E-Print Network [OSTI]

    Patel, Chintan

    Test and Test Equipment Joshua Lottich CMPE 640 11/23/05 #12;Testing Verifies that manufactured chip meets design specifications. Cannot test for every potential defect. Modeling defects as faults allows for passing and failing of chips. Ideal test would capture all defects and pass only chips

  17. SU-E-J-162: Quality Assurance Procedures for MR Guided Focused Ultrasound Treatment of Bone Metastasis

    SciTech Connect (OSTI)

    Chen, L; Chen, X; Wang, B; Gupta, R; Ma, C [Fox Chase Cancer Center, Philadelphia, PA (United States)

    2014-06-01T23:59:59.000Z

    Purpose: The purpose of this work is to develop and verify our quality assurance (QA) procedures to ensure the safety and efficacy of MR-guided focused ultrasound (MRgFUS) treatment of bone metastases. Methods: A practical QA program was developed. Monthly and daily QA (DQA) procedures were performed. The major QA items included the checks of the machine hardware, software and patient safety features. Briefly, these checks/tests include: 1) the cooling system reservoir and treatment table; 2) power to the treatment table; 3) the MR coil; 4) the transducer position with MRI; 5) image display on the treatment work station; 6) the effective focal spot in 3 directions using MR thermometry; and 7) all the safety devices including a sonication lamp, and the emergency stop-sonication switches. In order to avoid patient skin burn, it is important to remove gas bubbles in the interfaces between the treatment table and the gel pad, and the gel pad and patients skin during the patient setup. Our QA procedures have been verified and evaluated through patient treatments. Seven patients with scapula, humeral head, sacrum, ilium, pubic ramus and acetabular bone metastases were treated using MRgFUS. Results: Our study showed that all seven patients tolerated the MRgFUS treatment well. No skin toxicity or other complications were observed. The pain score (0–10) using the visual analog scale (VAS) was significantly reduced from 8.0 ± 1.1 before treatment to 4.7 ± 3.0, 3.0 ± 1.5, 3.2 ± 2.8 and 3.4 ± 1.5 at one day, one month, two months and three months after the MRgFUS treatment, respectively. Conclusion: We demonstrated that with the appropriate QA procedures, MRgFUS is a safe, effective and noninvasive treatment modality for palliation of bone metastases.

  18. Bone mineral density and blood metals in premenopausal women

    SciTech Connect (OSTI)

    Pollack, A.Z., E-mail: pollacka@mail.nih.gov [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Mumford, S.L. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States); Wactawski-Wende, J. [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States)] [Department of Social and Preventive Medicine, University at Buffalo, State University of New York, Buffalo, NY (United States); Yeung, E.; Mendola, P.; Mattison, D.R.; Schisterman, E.F. [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)] [Epidemiology Branch, Division of Epidemiology, Statistics, and Prevention Research, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD (United States)

    2013-01-15T23:59:59.000Z

    Exposure to metals, specifically cadmium, lead, and mercury, is widespread and is associated with reduced bone mineral density (BMD) in older populations, but the associations among premenopausal women are unclear. Therefore, we evaluated the relationship between these metals in blood and BMD (whole body, total hip, lumbar spine, and non-dominant wrist) quantified by dual energy X-ray absorptiometry in 248 premenopausal women, aged 18-44. Participants were of normal body mass index (mean BMI 24.1), young (mean age 27.4), 60% were white, 20% non-Hispanic black, 15% Asian, and 6% other race group, and were from the Buffalo, New York region. The median (interquartile range) level of cadmium was 0.30 {mu}g/l (0.19-0.43), of lead was 0.86 {mu}g/dl (0.68-1.20), and of mercury was 1.10 {mu}g/l (0.58-2.00). BMD was treated both as a continuous variable in linear regression and dichotomized at the 10th percentile for logistic regression analyses. Mercury was associated with reduced odds of decreased lumbar spine BMD (0.66, 95% confidence interval: 0.44, 0.99), but overall, metals at environmentally relevant levels of exposure were not associated with reduced BMD in this population of healthy, reproductive-aged women. Further research is needed to determine if the blood levels of cadmium, lead, and mercury in this population are sufficiently low that there is no substantive impact on bone, or if effects on bone can be expected only at older ages.

  19. Hydroxyapatite-binding peptides for bone growth and inhibition

    DOE Patents [OSTI]

    Bertozzi, Carolyn R. (Berkeley, CA); Song, Jie (Shrewsbury, MA); Lee, Seung-Wuk (Walnut Creek, CA)

    2011-09-20T23:59:59.000Z

    Hydroxyapatite (HA)-binding peptides are selected using combinatorial phage library display. Pseudo-repetitive consensus amino acid sequences possessing periodic hydroxyl side chains in every two or three amino acid sequences are obtained. These sequences resemble the (Gly-Pro-Hyp).sub.x repeat of human type I collagen, a major component of extracellular matrices of natural bone. A consistent presence of basic amino acid residues is also observed. The peptides are synthesized by the solid-phase synthetic method and then used for template-driven HA-mineralization. Microscopy reveal that the peptides template the growth of polycrystalline HA crystals .about.40 nm in size.

  20. Zhejiang Bone New Material Technology Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit withTianlinPapers HomeXuanenYongzhouYunnanZhangye LonghuiZhejiang Bone New

  1. Sol-Char: Producing Char from Waste using Solar Energy - Energy Innovation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our Instagram Secretary Moniz9MorganYou areInnovation Portal

  2. Bone status in high levels cyclists J Clin Densitom. 2012 Jan-Mar;15(1):103-7. Evaluation of the Bone Status in High-Level Cyclists

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    health Organization has defined osteoporosis in post-menopausal women as a T-score value less than -2) defines a "low bone density". In post-menopausal women as well as in elderly in general, results are more

  3. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    Alcohol consumption is occurring in the younger generation. It has been found that the sooner people started drinking the shorter they are. Alcohol has also been shown to reduce peak bone mass. Alcohol inhibits osteoblastic proliferation which...

  4. The bending and dynamic mechanical properties of cortical bone: the effects of sodium fluoride and the relationship to physical properties 

    E-Print Network [OSTI]

    McCurdy-Rahn, Megan Calista

    1998-01-01T23:59:59.000Z

    Bone is a complex organic composite material. The graphics. interface between the mineral and organic phases of bone is significant both to medicine and to the biokinetics, a field which seeks to create advanced synthetic materials by copying...

  5. The effect of alcohol on the bone growth spurt of rats at a time equivalent to adolescent females

    E-Print Network [OSTI]

    Chaffin, Catherine Lee

    1997-01-01T23:59:59.000Z

    . The trabecular bone that remained was widely separated and reduced in thickness. These changes are similar to those observed in osteoporosis. The cause and mechanism of the reduced bone volume after alcohol abuse remains unclear. Alcohol consumption at an early...

  6. High-speed photography of compressed human trabecular bone correlates whitening to microscopic damage

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of trabecular bone is mainly motivated by the huge impact of osteoporosis in post-menopausal women and the aged is mainly motivated by the reduction of bone strength due to osteoporosis, a systemic skeletal disease [10.elsevier.com/locate/engfracmech #12;comes with a concomitant increase of fracture risk. Post-menopausal women and the elderly

  7. High-Speed Photography of Human Trabecular Bone during Compression Philipp J. Thurner1

    E-Print Network [OSTI]

    Fygenson, Deborah Kuchnir

    of this research is motivated by the immense costs of health care and social impacts due to osteoporosis in post-menopausal women and the aged. Osteoporosis results in bone loss and change of trabecular architecture, causing of osteoporosis, a systemic, skeletal disease2 , which comes with a reduction of bone strength and a concomitant

  8. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival

    E-Print Network [OSTI]

    Brown, Myles

    for post-menopausal osteoporosis (Sambrook and Cooper, 2006). Estrogen and ERs are important for bone and Musculoskeletal Biology, Wyeth Research, Collegeville, PA, USA Estrogen deficiency in menopause is a major cause of osteoporosis in women. Estrogen acts to maintain the appropriate ratio between bone-forming osteoblasts

  9. Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum But Not Cells

    E-Print Network [OSTI]

    Price, Paul A.

    Mineralization of Decalcified Bone Occurs Under Cell Culture Conditions and Requires Bovine Serum mineralization in the absence of cells. For this model, we utilized EDTA- decalcified new-born rat tibias with the cartilaginous ends intact, allowing us to visually determine the spec- ificity of mineralization within the bone

  10. Calcium balance and bone density in immature horses fed a high protein diet

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    . Blood samples, feces, and urine were collected during the 116-day study to determine any diet effect on pH and mineral balance. Radiographs were made of the left third metacarpal (MCIII) to determine bone density via radiographic bone aluminum...

  11. Targeting bone-microenvironment-tumour cell interactions : IGF-1 receptor kinase inhibitors. 

    E-Print Network [OSTI]

    Logan, John Gordon

    2012-11-30T23:59:59.000Z

    Bone metastases are a frequent clinical complication associated with cancer. The aim of this PhD thesis was to set up a model system for the study of tumour cell – bone cell interactions in vitro, ex vivo and in vivo and ...

  12. Bone Motion Analysis From Dynamic MRI: Ac-quisition and Tracking

    E-Print Network [OSTI]

    Gilles, Benjamin

    of mechanical overload, impingement or femoral head instability. For both diagnosis and surgical planning, an acBone Motion Analysis From Dynamic MRI: Ac- quisition and Tracking INTRODUCTION Periacetabular- curate estimate of hip joint bone motion is required. Orthopedists can use animated 3D models, prior

  13. Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1)

    E-Print Network [OSTI]

    Chetverikov, Dmitry

    Bone Surface Reconstruction From CT/MR Images Using Fast Marching and Level Set Methods1) Istv surfaces reconstructed from MR volumes are shown. 1 Outline of the project One of our current projects steps of bone surface reconstruction from CT/MR slice images. 2 Main steps of reconstruction 2.1

  14. Research Paper A method for calibration of bone driver transducers to measure the mastoid

    E-Print Network [OSTI]

    Allen, Jont

    vibrator transducers for clinical measurements, the transfer of energy from the bone driver depends. This absolute calibration is based upon a circuit model of the driver, describing it with three frequency in the clinic, and a refined bone driver circuit model is proposed to better capture the observed behaviors. Ã?

  15. Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent

    E-Print Network [OSTI]

    Butler, Samantha

    Development/Plasticity/Repair The Bone Morphogenetic Protein Roof Plate Chemorepellent Regulates, Toronto, Ontario, Canada M5G 1X8 Commissural spinal axons extend away from the roof plate (RP) in response to the dorsal midline and are generated by the bone morphogenetic proteins (BMPs) in the roof plate (RP) (Liem

  16. Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis

    E-Print Network [OSTI]

    Toledo, University of

    Bone Loss in Diabetes: Use of Antidiabetic Thiazolidinediones and Secondary Osteoporosis Beata secondary osteoporosis. Risk factors for development of TZD-induced secondary osteoporosis are gender (women healing in T2DM patients on TZD therapy. Keywords Diabetes . Thiazolidinediones . Bone . Osteoporosis

  17. A multi-scale bone study to estimate the risk of fracture related to osteoporosis

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A multi-scale bone study to estimate the risk of fracture related to osteoporosis Abdelwahed' Orléans, 8, Rue Léonard de Vinci 45072 Orléans, France Objective: Osteoporosis is a disease marked. Bone fractures caused by the osteoporosis become increasingly important goal for both clinicians

  18. Classification and volumetric analysis of temporal bone pneumatization using cone beam computed tomography

    E-Print Network [OSTI]

    Terasaki, Mark

    bone pneumatization in adults using cone beam computed tomography (CBCT) scans. Study Design. A total Oral Pathol Oral Radiol 2014;117:376-384) The advances in cone beam computed tomography (CBCT) overClassification and volumetric analysis of temporal bone pneumatization using cone beam computed

  19. Finite-Element Analysis of Biting Behavior and Bone Stress in the

    E-Print Network [OSTI]

    Dumont, Elizabeth R.

    Finite-Element Analysis of Biting Behavior and Bone Stress in the Facial Skeletons of Bats biting behavior and bite force data gathered in the field with finite-element (FE) analysis. Our FE words: biting behavior; bone stress; adaptation; finite-ele- ment analysis; Chiroptera Mammal evolution

  20. Bone marrow transplantation after the Chernobyl nuclear accident

    SciTech Connect (OSTI)

    Baranov, A.; Gale, R.P.; Guskova, A.; Piatkin, E.; Selidovkin, G.; Muravyova, L.; Champlin, R.E.; Danilova, N.; Yevseeva, L.; Petrosyan, L. (Institute of Biophysics of the Ministry of Health and Clinical Hospital, Moscow (USSR))

    1989-07-27T23:59:59.000Z

    On April 26, 1986, an accident at the Chernobyl nuclear power station in the Soviet Union exposed about 200 people to large doses of total-body radiation. Thirteen persons exposed to estimated total-body doses of 5.6 to 13.4 Gy received bone marrow transplants. Two transplant recipients, who received estimated doses of radiation of 5.6 and 8.7 Gy, are alive more than three years after the accident. The others died of various causes, including burns (the cause of death in five), interstitial pneumonitis (three), graft-versus-host disease (two), and acute renal failure and adult respiratory distress syndrome (one). There was hematopoietic (granulocytic) recovery in nine transplant recipients who could be evaluated, six of whom had transient partial engraftment before the recovery of their own marrow. Graft-versus-host disease was diagnosed clinically in four persons and suspected in two others. Although the recovery of endogenous hematopoiesis may occur after exposure to radiation doses of 5.6 to 13.4 Gy, we do not know whether it is more likely after the transient engraftment of transplanted stem cells. Because large doses of radiation affect multiple systems, bone marrow recovery does not necessarily ensure survival. Furthermore, the risk of graft-versus-host disease must be considered when the benefits of this treatment are being weighed.

  1. Past Test One

    E-Print Network [OSTI]

    MA 366: Introduction to Di?'erential Equations. Fall 2001, Test One. Instructor: Yip o This test booklet has FIVE QUESTIONS, totaling 50 points for the whole test.

  2. Advanced Vehicle Testing & Evaluation

    Broader source: Energy.gov (indexed) [DOE]

    Vehicle Accelerated Reliability Test Battery Electric Vehicle Fast Charge Test Battery Energy Storage Performance Test For DC Fast Charge Demand Reduction...

  3. Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a

    E-Print Network [OSTI]

    Ariza Moreno, Pilar

    Bone-cement interface micromechanical model under cyclic loading J.A. Sanz-Herrera1, a , H descubrimientos s/n 41092 Seville (Spain) a jsanz@us.es, b helgaem@gmail.com, c mpariza@us.es Keywords: Bone-cement of the last XX century. Normally, implant is fixed to bone by means of a polymer material known as bone cement

  4. Estimation of the 3D self-similarity parameter of trabecular bone from its 2D projection

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of osteoporosis is mainly based on dual energy X-ray absorptiometry which amounts to measuring bone mass

  5. TEST STATION SALE OF PERFORMANCE TESTED BULLS

    E-Print Network [OSTI]

    Tennessee, University of

    in the test had to meet minimum performance requirements. Those were: CREEP NON-CREEP Adj 205 day wt. 560 520AS-B428 U T BULL TEST STATION SALE OF PERFORMANCE TESTED BULLS THURSDAY, MARCH 8, 2012 12:00 NOON IN GREENEVILLE AND KNOXVILLE LIVESTOCK CENTER http://animalscience.ag.utk.edu/ (For video) #12;UT BULL TEST

  6. Advanced Vehicle Testing - Beginning-of-Test Battery Testing...

    Broader source: Energy.gov (indexed) [DOE]

    2.5 V Thermal Mgmt.: Passive, Vacuum-Sealed Unit Pack Weight: 294 kg BATTERY LABORATORY TEST RESULTS SUMMARY Vehicle Mileage and Testing Date Vehicle Odometer: 6,696 mi Date of...

  7. EARLY PREVENTIVE EFFECTS OF RISEDRONATE IN A RAT MODEL WITH MASSIVE BONE LOSS DUE TO ORCHIDECTOMY AND

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and disuse induced osteoporosis. ORX and BTX models were combined to see if their effects were cumulative on trabecular bone mass and bone architecture. KEY WORDS: Osteoporosis Orchidectomy Disuse Risedronate Bone-remodeling rate is observed in women after menopause or surgica

  8. Computational analysis of whole body CT documents a bone structure alteration in adult advanced chronic lymphocytic leukemia

    E-Print Network [OSTI]

    Piana, Michele

    progression. PET/CT images were analyzed using dedicated software, able to recognize an external 2-pixel bone ring whose Hounsfield coefficient served as cut off to recognize trabecular and compact bone. PET/CT of the disease. Keywords: Image Analysis, Bone Marrow, Skeletal Structure, ACLL, PET/CT #12;3 Introduction

  9. Bull Test ID 1118 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1118 2013 Florida Bull Test #12;Bull Test ID 1119 2013 Florida Bull Test #12;Bull Test ID 1120 2013 Florida Bull Test #12;Bull Test ID 1121 2013 Florida Bull Test #12;Bull Test ID 1122 2013 Florida Bull Test #12;Bull Test ID 1123 2013 Florida Bull Test #12;Bull Test ID 1124 2013 Florida

  10. Bull Test ID 1181 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1181 2013 Florida Bull Test #12;Bull Test ID 1182 2013 Florida Bull Test #12;Bull Test ID 1183 2013 Florida Bull Test #12;Bull Test ID 1184 2013 Florida Bull Test #12;Bull Test ID 1185 2013 Florida Bull Test #12;Bull Test ID 1186 2013 Florida Bull Test #12;Bull Test ID 1187 2013 Florida

  11. Bull Test ID 1098 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1098 2013 Florida Bull Test #12;Bull Test ID 1099 2013 Florida Bull Test #12;Bull Test ID 1100 2013 Florida Bull Test #12;Bull Test ID 1101 2013 Florida Bull Test #12;Bull Test ID 1102 2013 Florida Bull Test #12;Bull Test ID 1103 2013 Florida Bull Test #12;Bull Test ID 1104 2013 Florida

  12. Bull Test ID 1160 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1160 2013 Florida Bull Test #12;Bull Test ID 1161 2013 Florida Bull Test #12;Bull Test ID 1162 2013 Florida Bull Test #12;Bull Test ID 1163 2013 Florida Bull Test #12;Bull Test ID 1164 2013 Florida Bull Test #12;Bull Test ID 1165 2013 Florida Bull Test #12;Bull Test ID 1166 2013 Florida

  13. Bull Test ID 1077 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    14th Annual Florida Bull Test #12;Bull Test ID 1077 2013 Florida Bull Test #12;Bull Test ID 1078 2013 Florida Bull Test #12;Bull Test ID 1079 2013 Florida Bull Test #12;Bull Test ID 1080 2013 Florida Bull Test #12;Bull Test ID 1081 2013 Florida Bull Test #12;Bull Test ID 1082 2013 Florida Bull Test #12

  14. Bull Test ID 1140 2013 Florida Bull Test

    E-Print Network [OSTI]

    Jawitz, James W.

    Bull Test ID 1140 2013 Florida Bull Test #12;Bull Test ID 1141 2013 Florida Bull Test #12;Bull Test ID 1142 2013 Florida Bull Test #12;Bull Test ID 1143 2013 Florida Bull Test #12;Bull Test ID 1144 2013 Florida Bull Test #12;Bull Test ID 1145 2013 Florida Bull Test #12;Bull Test ID 1146 2013 Florida

  15. Peri-prosthetic fracture vibration testing

    SciTech Connect (OSTI)

    Cruce, Jesse R [Los Alamos National Laboratory; Erwin, Jenny R [Los Alamos National Laboratory; Remick, Kevin R [Los Alamos National Laboratory; Cornwell, Phillip J [Los Alamos National Laboratory; Menegini, R. Michael [INDIANA UNIV.; Racanelli, Joe [STRYKER ORTHOPARDICS

    2010-11-08T23:59:59.000Z

    The purpose of this study was to establish a test setup and vibration analysis method to predict femoral stem seating and prevent bone fracture using accelerometer and force response data from an instrumented stem and impactor. This study builds upon earlier studies to identify a means to supplement a surgeon's tactile and auditory senses by using damage identification techniques normally used for civil and mechanical structures. Testing was conducted using foam cortical shell sawbones prepared for stems of different geometries. Each stem was instrumented with an accelerometer. Two impactor designs were compared: a monolithic impactor and a two-piece impactor, each with an integrated load cell and accelerometer. Acceleration and force measurements were taken in the direction of impaction. Comparisons between different methods of applying an impacting force were made, including a drop tower and a surgical hammer. The effect of varying compliance on the data was also investigated. The ultimate goal of this study was to assist in the design of an integrated portable data acquisition system capable of being used in future cadaveric testing. This paper will discuss the experimental setup and the subsequent results of the comparisons made between impactors, prosthetic geometries, compliances, and impact methods. The results of this study can be used for both future replicate testing as well as in a cadaveric environment.

  16. Innovative Composites Through Reinforcement Morphology Design - a Bone-Shaped-Short-Fiber Composite

    SciTech Connect (OSTI)

    Zhu, Y.T.; Valdez, J.A.; Beyerlain, I.J.; Stout, M.G.; Zhou, S.; Shi, N.; Lowe, T.C.

    1999-06-29T23:59:59.000Z

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at Los Alamos National Laboratory (LANL). The objective of this project is to improve the strength and toughness of conventional short-fiber composites by using innovative bone-shaped-short (BSS) fibers as reinforcement. We fabricated a model polyethylene BSS fiber-reinforced polyester-matrix composite to prove that fiber morphology, instead of interfacial strength, solves the problem. Experimental tensile and fracture toughness test results show that BSS fibers can bridge matrix cracks more effectively, and consume many times more energy when pulled out, than conventional-straight-short (CSS) fibers. This leads to both higher strength and fracture toughness for the BSS-fiber composites. A computational model was developed to simulate crack propagation in both BSS- and CSS-fiber composites, accounting for stress concentrations, interface debonding, and fiber pullout. Model predictions were validated by experimental results and will be useful in optimizing BSS-fiber morphology and other material system parameters.

  17. Concolic Testing Koushik Sen

    E-Print Network [OSTI]

    Sen, Koushik

    Concolic testing automates test input generation by com­ bining the concrete and symbolic (concolic) execution of the code under test. Traditional test input generation tech­ niques use either (1) concrete test inputs from these constraints. In contrast, concolic testing tightly couples both concrete

  18. Concolic Testing Koushik Sen

    E-Print Network [OSTI]

    Sen, Koushik

    Concolic testing automates test input generation by com- bining the concrete and symbolic (concolic) execution of the code under test. Traditional test input generation tech- niques use either (1) concrete test inputs from these constraints. In contrast, concolic testing tightly couples both concrete

  19. Effect of cryo-induced microcracks on microindentation of hydrated cortical bone tissue

    SciTech Connect (OSTI)

    Yin Ling, E-mail: ling.yin@jcu.edu.au [School of Engineering, James Cook University, Townsville, QLD 4811 (Australia); Venkatesan, Sudharshan [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia); Webb, Daryl [Electron Microscopy Unit, Australian National University, Canberra, ACT 0200 (Australia); Kalyanasundaram, Shankar; Qin Qinghua [Department of Engineering, Australian National University, Canberra, ACT 0200 Australia (Australia)

    2009-08-15T23:59:59.000Z

    Microcracks accumulate in cortical bone tissue as a consequence of everyday cyclic loading. However, it remains unclear to what extent microdamage accumulation contributes to an increase in fracture risk. A cryo-preparation technique was applied to induce microcracks in cortical bone tissue. Microcracks with lengths up to approximately 20 {mu}m, which were initiated mainly on the boundaries of haversian canals, were observed with cryo-scanning electron microscopy. A microindentation technique was applied to study the mechanical loading effect on the microcracked hydrated bone tissue. The microindentation patterns were section-scanned using confocal laser scanning microscopy to understand the deformation and bone damage mechanisms made by mechanical loading. The results show that there was no significant difference with respect to microhardness between the original and microcracked hydrated cortical bone tissues (ANOVA, p > 0.05). The cryo-induced microcracks in the bone tissue were not propagated further under the mechanical loads applied. The deformation mechanism of the microcracked cortical bone tissue was plastic deformation, not brittle fracture.

  20. Test Series 2. 3 detailed test plan

    SciTech Connect (OSTI)

    Not Available

    1983-12-01T23:59:59.000Z

    Test Series 2.3 is chronologically the second of the five sub-series of tests which comprise Test Series 2, the second major Test Series as part of the combustion research phase to be carried out at the Grimethorpe Experimental Pressurised Fluidised Bed Combustion Facility. Test Series 2.3 will consist of 700 data gathering hours which is expected to require some 1035 coal burning hours. The tests will be performed using US supplied coal and dolomite. This will be the first major series of tests on the Facility with other than the UK datum coal and dolomite. The document summarises the background to the facility and the experimental program. Described are modifications which have been made to the facility following Test Series 2.1 and a series of Screening Tests. Detailed test objectives are specified as are the test conditions for the experiments which comprise the test series. The test results will provide information on the effects of the bed temperature, excess air level, Ca/S ratio, number of coal feed lines, and combustion efficiency and sulphur retention. A significant aspect of the test series will be part load tests which will investigate the performance of the facility under conditions of turn down which simulate load following concepts specified for two combined cycle concepts, i.e., their CFCC combined cycle and a turbo charged combined cycle. The material test plan is also presented. The principal feature of the materials programme is the planned exposure of a set of static turbine blade specimens in a cascade test loop to the high temperature, high pressure flue gas. A schedule for the programme is presented as are contingency plans.

  1. Accelerated Stress Testing, Qualification Testing, HAST, Field...

    Office of Environmental Management (EM)

    stress tests beyond the qualification test levels, which are necessary to predict PV module wear-out. The commercial success of PVs is ultimately based on the long-term...

  2. Materials testing at the Hanna-IV and Hoe Creek-III in situ coal-gasification sites

    SciTech Connect (OSTI)

    Loop, R.B.; LaRue, D.M.

    1981-03-01T23:59:59.000Z

    Candidate structural alloys were exposed to the direct product gas stream during three different in situ coal gasification experiments at two sites. Physical appearance and chemical analysis indicate that the coating on the specimens following exposure is typical of condensed hydrocarbons, coal char, coal ash, and mineral particles from the overburden. Deposits on specimens from one test had a fairly high concentration of sulfur (about 8 w/o) while the others had very low sulfur concentrations (0.313 w/o and 0.014 w/o, respectively). Energy-dispersive x-ray spectra indicate that corrosion occurred principally by oxidation, with some sulfidation. Mean penetration rates expressed in millimetres/year were calculated from weight loss data. No material evaluated showed a truly unacceptable degradation. There was no consistent difference in the amount of material removed from specimens with or without welds. Specimens from one test experienced no consistent difference in material removal between different exposure angles; a consistent difference in material loss and dents from particle impact indicated that erosion may have occurred in the other two tests. There was no indication of carburization, decarburization, or severe localized attack in the form of pitting or intergranular corrosion on any of the specimens examined. Results obtained for the flame-sprayed 316 SS specimens and one of the Alonized specimens indicated that use of these processes may be questionable in this environment.

  3. Jefferson Lab Man Donates Bone Marrow to Save 12-Year-Old Boy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to MCV where he was admitted for the overnight procedure. He received a general anesthesia; then the doctors extracted two liters of bone marrow from his body. The life-saving...

  4. Discovery of novel anti-inflammatory proteins inspired by bone marrow mesenchymal stem cell secretions

    E-Print Network [OSTI]

    Milwid, Jack Miles

    2011-01-01T23:59:59.000Z

    Bone marrow mesenchymal stem cells (MSCs) may soon become the first FDA-approved stem cell therapy for autoimmune and inflammatory disease. Our lab originally hypothesized that much of the therapeutic activity of MSCs may ...

  5. Investigation of bone response to implant materials by electron microscopy and computer simulation

    E-Print Network [OSTI]

    Wang, Hao, 1974-

    2004-01-01T23:59:59.000Z

    (cont.) implementation of this scintigraphic method for quantitative studies of osteoblast-mediated mineralization in vitro. A 2-D truss finite element model is used to study the remodeling of trabecular bone. Using strain ...

  6. Immobilized sonic hedgehog N-terminal signaling domain enhances differentiation of bone marrow-derived

    E-Print Network [OSTI]

    Schaffer, David V.

    , and immobilized onto interpenetrating polymer network (IPN) surfaces also grafted with a bone sialoprotein presented to cells using an intrinsically nonfouling interpenetrating polymer network (IPN).12,13 In spite

  7. The effects of alcohol consumption after menopause on bone regulating hormones

    E-Print Network [OSTI]

    Blaschke, Dawn Lewis

    1999-01-01T23:59:59.000Z

    The goal of this project was to determine if the alcohol-associated increase in osteopenia as observed in ovariectomized rats, which simulated human females after menopause, was due to the elect of alcohol on hormones that regulate bone metabolism...

  8. attenuates bone cancer-induced: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2007-01-01 300 MR imaging of therapy-induced changes of bone marrow University of California eScholarship Repository Summary: Treatment effects due to irradiation, chemotherapy...

  9. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, S.C.; Meinken, G.E.; Mausner, L.F.; Atkins, H.L.

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients. 5 figs.

  10. Method for palliation of pain in human bone cancer using therapeutic tin-117m compositions

    DOE Patents [OSTI]

    Srivastava, Suresh C. (Setauket, NY); Meinken, George E. (Middle Island, NY); Mausner, Leonard F. (Stony Brook, NY); Atkins, Harold L. (Setauket, NY)

    1998-12-29T23:59:59.000Z

    The invention provides a method for the palliation of bone pain due to cancer by the administration of a unique dosage of a tin-117m (Sn-117m) stannic chelate complex in a pharmaceutically acceptable composition. In addition, the invention provides a method for simultaneous palliation of bone pain and radiotherapy in cancer patients using compositions containing Sn-117m chelates. The invention also provides a method for palliating bone pain in cancer patients using Sn-117m-containing compositions and monitoring patient status by imaging the distribution of the Sn-117m in the patients. Also provided are pharmaceutically acceptable compositions containing Sn-117m chelate complexes for the palliation of bone pain in cancer patients.

  11. Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone

    E-Print Network [OSTI]

    Yuen, Evelyn P

    2013-04-19T23:59:59.000Z

    (induced by feeding a high iron diet) and gamma radiation exposure would independently increase markers of oxidative stress and markers of oxidative damage and result in loss of bone mass, with the combined treatment having additive or synergistic effects...

  12. Pretreatment levels of bone turnover and the antifracture efficacy of alendronate: The fracture intervention trial

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    in postmenopausal osteoporosis. Cal- cif Tissue Int 65:359–in postmeno- pausal osteoporosis. J Bone Miner Res 12:624–among women without osteoporosis at baseline. Although they

  13. Race/ethnic differences in bone mineral densities in older men

    E-Print Network [OSTI]

    2010-01-01T23:59:59.000Z

    the Baltimore men’s osteoporosis study. J Bone Miner Res 13.center genetic study of osteoporosis. Osteoporos Int 17:125–Leung Jockey Club Centre for Osteoporosis Care and Control,

  14. The harmful effects of late-onset alcohol consumption on cortical bone in aged rats 

    E-Print Network [OSTI]

    Bowlin, Julie Lee

    2001-01-01T23:59:59.000Z

    to determine bone chemistry and morphological parameters. The effects of alcohol consumption, the aging process and caloric restriction were examined after obtaining results from this experiment. From the results found, it is evident that alcohol does have a...

  15. Factors Affecting the Mechanical Behavior of Bone Subrata Saha, Ph.D.

    E-Print Network [OSTI]

    Gilbert, Robert P.

    Factors Affecting the Mechanical Behavior of Bone by Subrata Saha, Ph.D. Research Professor-mail: subrata.saha@downstate.edu ABSTRACT The load carrying capacity of our skeletal system depends

  16. Non-invasive shock wave stimulated periosteum for bone tissue engineering

    E-Print Network [OSTI]

    Kearney, Cathal (Cathal John)

    2011-01-01T23:59:59.000Z

    The cambium cells of the periosteum, which are known osteoprogenitor cells, have limited suitability for clinical applications of bone tissue engineering due to their low cell number (2-5 cells thick). Extracorporeal shock ...

  17. RMOTC - Testing - Geothermal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Geothermal Testing Notice: As of July 1st, 2014, Testing at RMOTC has officially completed. We would like to thank all of our testing partners and everyone who helped make the...

  18. Test Herrera Report Template

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    development are described in detail in the following section. The model was run in six test sites: Test Site 1 is along the Cowlitz River (Segment 3); Test Site 2 includes the...

  19. ZiaTest

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ZiaTest ZiaTest Description This test executes a new proposed standard benchmark method for MPI startup that is intended to provide a realistic assessment of both launch and wireup...

  20. Directed random testing

    E-Print Network [OSTI]

    Pacheco, Carlos, Ph.D. Massachusetts Institute of Technology

    2009-01-01T23:59:59.000Z

    Random testing can quickly generate many tests, is easy to implement, scales to large software applications, and reveals software errors. But it tends to generate many tests that are illegal or that exercise the same parts ...

  1. Analysis of a Fossil Bone from the Archaeological Settlement Malu Rosu, Romania by Accelerator Mass Spectrometry

    E-Print Network [OSTI]

    Agata Olariu; Ion V. Popescu; Ragnar Hellborg; Kristina Stenström; Mikko Faarinen; Per Persson; Bengt Erlandsson; Göran Skog; Emilian Alexandrescu

    2001-03-13T23:59:59.000Z

    A fossil bone from the archaeological site Malu Rosu Giurgiu, in Romania has been analyzed by accelerator mass spectrometry to estimate its age by determining its $^{14}$C content. The radiocarbon age of the bone is in agreement with the date obtained by the method for age determination, based on fluorine content. This is the first radiocarbon dating for the final Neolithic period, for this archaeological settlement in the Romanian region.

  2. Analyzing the effects of alcohol on IGF-I in bone and plasma and on IGF-I mRNA in the liver and bone 

    E-Print Network [OSTI]

    Stine, Christina Nicole

    2001-01-01T23:59:59.000Z

    (Member) John E. Bauer (Chair of Nutrition) Bryan H. Johnson (Department Head) August 2001 Major: Nutrition ABSTRACT Analyzing the Effects of Alcohol on IGF-I in Bone and Plasma and on IGF-I mRNA in the Liver and Bone. (August 2001) Christina... different effector pathways to increase proliferation at the growth plate (Klaus et al. , 1998). Therefore Vitamin D may not have an effect on IGF-I. Alcoholics have decreased plasma 25-hydroxyvitamin D which is an indicator of Vitamin D status (Peris et...

  3. LANSCE | Materials Test Station

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research Facility Training Office Contact Administrative nav background Materials Test Station dotline Testing New Reactor Fuels that Reduce Radioactive Waste Mission Used...

  4. Vendor System Vulnerability Testing Test Plan

    SciTech Connect (OSTI)

    James R. Davidson

    2005-01-01T23:59:59.000Z

    The Idaho National Laboratory (INL) prepared this generic test plan to provide clients (vendors, end users, program sponsors, etc.) with a sense of the scope and depth of vulnerability testing performed at the INL’s Supervisory Control and Data Acquisition (SCADA) Test Bed and to serve as an example of such a plan. Although this test plan specifically addresses vulnerability testing of systems applied to the energy sector (electric/power transmission and distribution and oil and gas systems), it is generic enough to be applied to control systems used in other critical infrastructures such as the transportation sector, water/waste water sector, or hazardous chemical production facilities. The SCADA Test Bed is established at the INL as a testing environment to evaluate the security vulnerabilities of SCADA systems, energy management systems (EMS), and distributed control systems. It now supports multiple programs sponsored by the U.S. Department of Energy, the U.S. Department of Homeland Security, other government agencies, and private sector clients. This particular test plan applies to testing conducted on a SCADA/EMS provided by a vendor. Before performing detailed vulnerability testing of a SCADA/EMS, an as delivered baseline examination of the system is conducted, to establish a starting point for all-subsequent testing. The series of baseline tests document factory delivered defaults, system configuration, and potential configuration changes to aid in the development of a security plan for in depth vulnerability testing. The baseline test document is provided to the System Provider,a who evaluates the baseline report and provides recommendations to the system configuration to enhance the security profile of the baseline system. Vulnerability testing is then conducted at the SCADA Test Bed, which provides an in-depth security analysis of the Vendor’s system.b a. The term System Provider replaces the name of the company/organization providing the system being evaluated. This can be the system manufacturer, a system user, or a third party organization such as a government agency. b. The term Vendor (or Vendor’s) System replaces the name of the specific SCADA/EMS being tested.

  5. Dynamometer Testing (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2010-11-01T23:59:59.000Z

    This fact sheet describes the dynamometer and its testing capabilities at the National Wind Technology Center.

  6. Solderability test system

    DOE Patents [OSTI]

    Yost, F.; Hosking, F.M.; Jellison, J.L.; Short, B.; Giversen, T.; Reed, J.R.

    1998-10-27T23:59:59.000Z

    A new test method to quantify capillary flow solderability on a printed wiring board surface finish. The test is based on solder flow from a pad onto narrow strips or lines. A test procedure and video image analysis technique were developed for conducting the test and evaluating the data. Feasibility tests revealed that the wetted distance was sensitive to the ratio of pad radius to line width (l/r), solder volume, and flux predry time. 11 figs.

  7. Solderability test system

    DOE Patents [OSTI]

    Yost, Fred (Cedar Crest, NM); Hosking, Floyd M. (Albuquerque, NM); Jellison, James L. (Albuquerque, NM); Short, Bruce (Beverly, MA); Giversen, Terri (Beverly, MA); Reed, Jimmy R. (Austin, TX)

    1998-01-01T23:59:59.000Z

    A new test method to quantify capillary flow solderability on a printed wiring board surface finish. The test is based on solder flow from a pad onto narrow strips or lines. A test procedure and video image analysis technique were developed for conducting the test and evaluating the data. Feasibility tests revealed that the wetted distance was sensitive to the ratio of pad radius to line width (l/r), solder volume, and flux predry time.

  8. Check for peroxides every 6 months. opened test 1 test 2 test 3

    E-Print Network [OSTI]

    Pawlowski, Wojtek

    Check for peroxides every 6 months. opened test 1 test 2 test 3 date initials Check for peroxides every 6 months. opened test 1 test 2 test 3 date initials Check for peroxides every 6 months. Test strips can be obtained from EH&S, 5-8200 opened test 1 test 2 test 3 date initials Check for peroxides

  9. Automatic Test Factoring for Java

    E-Print Network [OSTI]

    Saff, David

    2005-06-08T23:59:59.000Z

    Test factoring creates fast, focused unit tests from slow system-widetests; each new unit test exercises only a subset of the functionalityexercised by the system test. Augmenting a test suite with factoredunit tests ...

  10. Entry/Exit Port testing, test report

    SciTech Connect (OSTI)

    Winkelman, R.H.

    1993-05-01T23:59:59.000Z

    The Waste Receiving and Processing Module I (WRAP-1) facility must have the ability to allow 55-gallon drums to enter and exit glovebox enclosures. An Entry/Exit Port (Appendix 1, Figure 1), designed by United Engineers and Constructors (UE&C), is one method chosen for drum transfer. The Entry/Exit Port is to be used for entry of 55-gallon drums into both process entry gloveboxes, exit of 55-gallon drum waste pucks from the low-level waste (LLW) glovebox, and loadout of waste from the restricted waste management glovebox. The Entry/Exit Port relies on capture velocity air flow and a neoprene seal to provide alpha confinement when the Port is in the open and closed positions, respectively. Since the glovebox is in a slight vacuum, air flow is directed into the glovebox through the space between the overpack drum and glovebox floor. The air flow is to direct any airborne contamination into the glovebox. A neoprene seal is used to seal the Port door to the glovebox floor, thus maintaining confinement in the closed position. Entry/Exit Port testing took place February 17, 1993, through April 14, 1993, in the 305 building of Westinghouse Hanford Company. Testing was performed in accordance with the Entry/Exit Port Testing Test Plan, document number WHC-SD-WO26-TP-005. A prototype Entry/Exit Port built at the Hanford Site was tested using fluorescent paint pigment and smoke candles as simulant contaminants. This test report is an interim test report. Further developmental testing is required to test modifications made to the Port as the original design of the Port did not provide complete confinement during all stages of operation.

  11. Automated simulation of areal bone mineral density assessment in the distal radius from high-resolution peripheral quantitative computed tomography

    E-Print Network [OSTI]

    Burghardt, A. J.; Kazakia, G. J.; Link, T. M.; Majumdar, S.

    2009-01-01T23:59:59.000Z

    Bone mineral density . DXA . HR-pQCT . Osteoporosis .Simulation Introduction Osteoporosis is a conditionclinical assessment of osteoporosis status were identified

  12. Characterization of the effects of x-ray irradiation on the hierarchical structure and mechanical properties of human cortical bone

    E-Print Network [OSTI]

    Barth, Holly

    2012-01-01T23:59:59.000Z

    in   bone   strength.   Osteoporosis  Int    2006;17:319-­??fragility   in   aging,   osteoporosis,   and   diabetes  mellitus.  Osteoporosis  Int    2010;21:195-­??214.  

  13. Electron Microscopy and Analytical X-ray Characterization of Compositional and Nanoscale Structural Changes in Fossil Bone

    E-Print Network [OSTI]

    Boatman, Elizabeth

    2012-01-01T23:59:59.000Z

    of questions surrounding the diagenesis and fossilization ofthe consequences of diagenesis for that particular feature (on the concept of bone diagenesis and how it relates to

  14. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    SciTech Connect (OSTI)

    Goodsitt, Mitchell M., E-mail: goodsitt@umich.edu; Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K. [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Shen, Jincheng [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States)] [Department of Biostatistics, University of Michigan, 1415 Washington Heights, Ann Arbor, Michigan 48109 (United States); Schipper, Matthew J. [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Radiation Oncology, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Wilderman, Scott [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States)] [Department of Nuclear Engineering, University of Michigan, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109 (United States); Chun, Se Young [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)] [Ulsan National Institute of Science and Technology (UNIST), School of Electrical and Computer Engineering, Ulsan 689-798 (Korea, Republic of)

    2014-05-15T23:59:59.000Z

    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (?17 × 17 mm) region of interest (ROI), 2 × 2, and 3 × 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.2–1.3 times greater in the medium body than in the small body phantom and 1.3–1.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 × 2 segmented subregions of the ROIs were 1.6–1.9 times greater than for no segmentation, and RMS errors for 3 × 3 segmented subregions were 2.3–2.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 ± 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 ± 0.25. Results for external calibrations exhibited much larger RMS errors than size matched internal calibration. Use of an average body size external-to-internal calibration correction factor reduced the errors to closer to those for internal calibration. RMS errors of less than 30% or about 0.01 for the bone and 0.1 for the red marrow volume fractions would likely be satisfactory for human studies. Such accuracies were achieved for 3 × 3 segmentation of 5 mm slice images for: (a) internal calibration with 4 times dose for all size body phantoms, (b) internal calibration with 2 times dose for the small and medium size body phantoms, and (c) corrected external calibration with 4 times dose and all size body phantoms. Conclusions: Phantom studies are promising and demonstrate the potential to use dual energy quantitative CT to estimate the spatial distributions of red marrow and bone within the vertebral spongiosa.

  15. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, João Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecânica e Gestão Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  16. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    SciTech Connect (OSTI)

    Anne, Jennifer [Univ. of Manchester (United Kingdom); Edwards, Nicholas P. [Univ. of Manchester (United Kingdom); Wogelius, Roy A. [Univ. of Manchester (United Kingdom); Tumarkin-Deratzian, Allison R. [Temple Univ., Philadelphia, PA (United States); Sellers, William I. [Univ. of Manchester (United Kingdom); van Veelen, Arjen [Univ. of Manchester (United Kingdom); Bergmann, Uwe [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Sokaras, Dimosthenis [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Alonso-Mori, Roberto [SLAC National Accelerator Laboratory, Menlo Park, CA (United States); Ignatyev, Konstantin [Diamond Light Source (United Kingdom); Egerton, Victoria M. [Univ. of Manchester (United Kingdom); Manning, Phillip L. [Univ. of Manchester (United Kingdom)

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimens (decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.

  17. Synchrotron imaging reveals bone healing and remodelling strategies in extinct and extant vertebrates

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Anne, Jennifer; Edwards, Nicholas P.; Wogelius, Roy A.; Tumarkin-Deratzian, Allison R.; Sellers, William I.; van Veelen, Arjen; Bergmann, Uwe; Sokaras, Dimosthenis; Alonso-Mori, Roberto; Ignatyev, Konstantin; et al

    2014-04-23T23:59:59.000Z

    Current understanding of bone healing and remodelling strategies in vertebrates has traditionally relied on morphological observations through the histological analysis of thin sections. However, chemical analysis may also be used in such interpretations, as different elements are known to be absorbed and used by bone for different physiological purposes such as growth and healing. These chemical signatures are beyond the detection limit of most laboratory-based analytical techniques (e.g. scanning electron microscopy). However, synchrotron rapid scanning–X-ray fluorescence (SRS–XRF) is an elemental mapping technique that uniquely combines high sensitivity (ppm), excellent sample resolution (20–100 ?m) and the ability to scan large specimensmore »(decimetre scale) approximately 3000 times faster than other mapping techniques. Here, we use SRS–XRF combined with microfocus elemental mapping (2–20 ?m) to determine the distribution and concentration of trace elements within pathological and normal bone of both extant and extinct archosaurs (Cathartes aura and Allosaurus fragilis). Results reveal discrete chemical inventories within different bone tissue types and preservation modes. Chemical inventories also revealed detail of histological features not observable in thin section, including fine structures within the interface between pathological and normal bone as well as woven texture within pathological tissue.« less

  18. I/O Test

    E-Print Network [OSTI]

    Beeler, Michael

    1967-10-01T23:59:59.000Z

    IO TEST is intended as a hardware testing and debugging aid for use with the PDP-6 and its associated input multiplexer (analog to digital converter) and output multiplexer (digital to analog converter). While all characters ...

  19. MA 266 Practice Test

    E-Print Network [OSTI]

    2015-02-26T23:59:59.000Z

    Test 1: March 4, 2015. INSTRUCTIONS in the Test. 1. Do not open this exam booklet until told to do so. 2. There are 6 or 7 problems - one per page. 3. Show all ...

  20. Practice test 2

    E-Print Network [OSTI]

    2015-04-12T23:59:59.000Z

    Spring 2015. Test 2: April 15, 2015. INSTRUCTIONS in the Test. 1. Do not open this exam booklet until told to do so. 2. There are 6 or 7 problems - one per page.

  1. Coaxial test fixture

    DOE Patents [OSTI]

    Praeg, W.F.

    1984-03-30T23:59:59.000Z

    This invention pertains to arrangements for performing electrical tests on contact material samples, and in particular for testing contact material test samples in an evacuated environment under high current loads. Frequently, it is desirable in developing high-current separable contact material, to have at least a preliminary analysis of selected candidate conductor materials. Testing of material samples will hopefully identify materials unsuitable for high current electrical contact without requiring incorporation of the materials into a completed and oftentimes complex structure.

  2. Blade Testing Trends (Presentation)

    SciTech Connect (OSTI)

    Desmond, M.

    2014-08-01T23:59:59.000Z

    As an invited guest speaker, Michael Desmond presented on NREL's NWTC structural testing methods and capabilities at the 2014 Sandia Blade Workshop held on August 26-28, 2014 in Albuquerque, NM. Although dynamometer and field testing capabilities were mentioned, the presentation focused primarily on wind turbine blade testing, including descriptions and capabilities for accredited certification testing, historical methodology and technology deployment, and current research and development activities.

  3. Articles about Testing

    Broader source: Energy.gov [DOE]

    Stories about testing facilities, capabilities, and certification featured by the U.S. Department of Energy (DOE) Wind Program.

  4. Soil Testing and Research

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Soil Testing and Research Analytical Laboratory Copyright © 2014 University of Minnesota Soil Testing and Research Analytical Laboratory Department of Soil, Water and Climate College of Food payable to the University of Minnesota We also accept the following credit cards: Soil Testing

  5. Gas Test Loop Booster Fuel Hydraulic Testing

    SciTech Connect (OSTI)

    Gas Test Loop Hydraulic Testing Staff

    2006-09-01T23:59:59.000Z

    The Gas Test Loop (GTL) project is for the design of an adaptation to the Advanced Test Reactor (ATR) to create a fast-flux test space where fuels and materials for advanced reactor concepts can undergo irradiation testing. Incident to that design, it was found necessary to make use of special booster fuel to enhance the neutron flux in the reactor lobe in which the Gas Test Loop will be installed. Because the booster fuel is of a different composition and configuration from standard ATR fuel, it is necessary to qualify the booster fuel for use in the ATR. Part of that qualification is the determination that required thermal hydraulic criteria will be met under routine operation and under selected accident scenarios. The Hydraulic Testing task in the GTL project facilitates that determination by measuring flow coefficients (pressure drops) over various regions of the booster fuel over a range of primary coolant flow rates. A high-fidelity model of the NW lobe of the ATR with associated flow baffle, in-pile-tube, and below-core flow channels was designed, constructed and located in the Idaho State University Thermal Fluids Laboratory. A circulation loop was designed and constructed by the university to provide reactor-relevant water flow rates to the test system. Models of the four booster fuel elements required for GTL operation were fabricated from aluminum (no uranium or means of heating) and placed in the flow channel. One of these was instrumented with Pitot tubes to measure flow velocities in the channels between the three booster fuel plates and between the innermost and outermost plates and the side walls of the flow annulus. Flow coefficients in the range of 4 to 6.5 were determined from the measurements made for the upper and middle parts of the booster fuel elements. The flow coefficient for the lower end of the booster fuel and the sub-core flow channel was lower at 2.3.

  6. SUPERCRITICAL WATER PARTIAL OXIDATION PHASE I - PILOT-SCALE TESTING/FEASIBILTY SUDIES FINAL REPORT

    SciTech Connect (OSTI)

    SPRITZER.M; HONG,G

    2005-01-01T23:59:59.000Z

    General Atomics (GA) is developing Supercritical Water Partial Oxidation (SWPO) as a means of producing hydrogen from low-grade biomass and other waste feeds. The Phase I Pilot-scale Testing/Feasibility Studies have been successfully completed and the results of that effort are described in this report. The key potential advantage of the SWPO process is the use of partial oxidation in-situ to rapidly heat the gasification medium, resulting in less char formation and improved hydrogen yield. Another major advantage is that the high-pressure, high-density aqueous environment is ideal for reacting and gasifying organics of all types. The high water content of the medium encourages formation of hydrogen and hydrogen-rich products and is especially compatible with high water content feeds such as biomass materials. The high water content of the medium is also effective for gasification of hydrogen-poor materials such as coal. A versatile pilot plant for exploring gasification in supercritical water has been established at GA's facilities in San Diego. The Phase I testing of the SWPO process with wood and ethanol mixtures demonstrated gasification efficiencies of about 90%, comparable to those found in prior laboratory-scale SCW gasification work carried out at the University of Hawaii at Manoa (UHM), as well as other biomass gasification experience with conventional gasifiers. As in the prior work at UHM, a significant amount of the hydrogen found in the gas phase products is derived from the water/steam matrix. The studies at UHM utilized an indirectly heated gasifier with an activated carbon catalyst. In contrast, the GA studies utilized a directly heated gasifier without catalyst, plus a surrogate waste fuel. Attainment of comparable gasification efficiencies without catalysis is an important advancement for the GA process, and opens the way for efficient hydrogen production from low-value, dirty feed materials. The Phase I results indicate that a practical means to overcome limitations on biomass slurry feed concentration and preheat temperature is to coprocess an auxiliary high heating value material. SWPO coprocessing of two high-water content wastes, partially dewatered sewage sludge and trap grease, yields a scenario for the production of hydrogen at highly competitive prices. It is estimated that there are hundreds if not thousands of potential sites for this technology across the US and worldwide. The economics for plants processing 40 tpd sewage sludge solids augmented with grease trap waste are favorable over a significant range of cost parameters such as sludge disposal credit and capital financing. Hydrogen production costs for SWPO plants of this size are projected to be about $3/GJ or less. Economics may be further improved by future developments such as pumping of higher solids content sludges and improved gasifier nozzle designs to reduce char and improve hydrogen yields. The easiest market entry for SWPO is expected to be direct sales to municipal wastewater treatment plants for use with sewage sludge in conjunction with trap grease, as both of these wastes are ubiquitous and have reasonably well-defined negative value (i.e., the process can take credit for reduction of well-defined disposal costs for these streams). Additionally, waste grease is frequently recovered at municipal wastewater treatment plants where it is already contaminated with sewage. SWPO should also be favorable to other market applications in which low or negative value, high water content biomass is available in conjunction with a low or negative value fuel material. For biomass slurries primary candidates are sewage sludge, manure sludge, and shredded and/or composted organic municipal solid waste (MSW) slurries. For the high heating value stream primary candidates are trap grease, waste plastic or rubber slurries, and coal or coke slurries. Phase II of the SWPO program will be focused on verifying process improvements identified during Phase I, and then performing extended duration testing with the GA pilot plant. Tests of at least 1

  7. Human Cementum Protein 1 induces expression of bone and cementum proteins by human gingival fibroblasts

    SciTech Connect (OSTI)

    Carmona-Rodriguez, Bruno [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Alvarez-Perez, Marco Antonio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Narayanan, A. Sampath [Department of Pathology, School of Medicine, UW, Seattle (United States); Zeichner-David, Margarita [Center for Craniofacial Molecular Biology, School of Dentistry, USC, Los Angeles (United States); Reyes-Gasga, Jose [Instituto de Fisica, UNAM (Mexico); Molina-Guarneros, Juan [Facultad de Medicina, UNAM (Mexico); Garcia-Hernandez, Ana Lilia [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Suarez-Franco, Jose Luis [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Chavarria, Ivet Gil [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Villarreal-Ramirez, Eduardo [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico); Arzate, Higinio [Laboratorio de Biologia Celular y Molecular, Facultad de Odontologia, UNAM, Cd. Universitaria, Coyoacan, Mexico, D.F. 04510 (Mexico)]. E-mail: harzate@servidor.unam.mx

    2007-07-06T23:59:59.000Z

    We recently presented evidence showing that a human cementoblastoma-derived protein, named Cementum Protein 1 (CEMP1) may play a role as a local regulator of cementoblast differentiation and cementum-matrix mineralization. This protein was shown to be expressed by cementoblasts and progenitor cells localized in the periodontal ligament. In this study we demonstrate that transfection of CEMP1 into human gingival fibroblasts (HGF) induces mineralization and expression of bone and cementum-matrix proteins. The transfected HGF cells had higher alkaline phosphatase activity and proliferation rate and they expressed genes for alkaline phosphatase, bone sialoprotein, osteocalcin, osteopontin, the transcription factor Runx2/Cbfa1, and cementum attachment protein (CAP). They also produced biological-type hydroxyapatite. These findings indicate that the CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and that it might have a potential function in cementum and bone formation.

  8. Clinical Assessment of Percutaneous Radiofrequency Ablation for Painful Metastatic Bone Tumors

    SciTech Connect (OSTI)

    Kojima, Hiroyuki, E-mail: kojimah@takii.kmu.ac.jp; Tanigawa, Noboru; Kariya, Shuji; Komemushi, Atsushi; Shomura, Yuzo; Sawada, Satoshi [Kansai Medical University Takii Hospital, Department of Radiology (Japan)

    2006-12-15T23:59:59.000Z

    Purpose. To investigate the pain-alleviating effects of radiofrequency ablation (RFA) on metastatic bone tumors in relation to tumor size, combined therapy, and percent tumor necrosis rate following RFA. Methods. Subjects comprised 24 patients with 28 painful metastatic bone tumors. A 17G internally cooled electrode was inserted into the tumor for CT guidance and ablation was performed. Bone cement was injected following RFA for 4 tumors involving a weight-bearing bone, while 5 tumors were treated using combined RFA and external irradiation. Percent necrosis rate of the tumor was measured using contrast-enhanced computed tomography 1 week after RFA. Results. Improvement in the visual analog scale (VAS) score was 4.6 {+-} 2.2 for large tumors (>5 cm, n = 12), 3.7 {+-} 1.8 for medium-sized tumors (3.1-5.0 cm, n = 11), and 3.5 {+-} 1.7 for small tumors ({<=}3 cm, n = 4), with no significant differences noted among tumor sizes. Improvement in the VAS score was 3.5 {+-} 1.3 for the 4 tumors in the RFA + bone cement group, 3.2 {+-} 1.9 for the 5 tumors in the RFA + radiation therapy group, and 4.8 {+-} 2.2 for the 18 tumors in the RFA group. No significant differences were identified between groups. The improvement in the VAS score was 3.8 {+-} 2.3, 4.0 {+-} 1.9, and 4.7 {+-} 2.6 in patients with tumor necrosis rates of 0-49%, 50-74%, and 75-100%, respectively. No significant association was observed among these three groups. Conclusion. Percutaneous RFA therapy was effective in relieving pain due to metastatic bone tumors. No relationships appear to exist between initial response and tumor size, combined therapy, and percent tumor necrosis.

  9. Pendulum detector testing device

    DOE Patents [OSTI]

    Gonsalves, John M. (Modesto, CA)

    1997-01-01T23:59:59.000Z

    A detector testing device which provides consistent, cost-effective, repeatable results. The testing device is primarily constructed of PVC plastic and other non-metallic materials. Sensitivity of a walk-through detector system can be checked by: 1) providing a standard test object simulating the mass, size and material content of a weapon or other contraband, 2) suspending the test object in successive positions, such as head, waist and ankle levels, simulating where the contraband might be concealed on a person walking through the detector system; and 3) swinging the suspended object through each of the positions, while operating the detector system and observing its response. The test object is retained in a holder in which the orientation of the test device or target can be readily changed, to properly complete the testing requirements.

  10. Pendulum detector testing device

    DOE Patents [OSTI]

    Gonsalves, J.M.

    1997-09-30T23:59:59.000Z

    A detector testing device is described which provides consistent, cost-effective, repeatable results. The testing device is primarily constructed of PVC plastic and other non-metallic materials. Sensitivity of a walk-through detector system can be checked by: (1) providing a standard test object simulating the mass, size and material content of a weapon or other contraband, (2) suspending the test object in successive positions, such as head, waist and ankle levels, simulating where the contraband might be concealed on a person walking through the detector system; and (3) swinging the suspended object through each of the positions, while operating the detector system and observing its response. The test object is retained in a holder in which the orientation of the test device or target can be readily changed, to properly complete the testing requirements. 5 figs.

  11. Development of a three-dimensional in vitro model to study the effect of vitamin D on bone metastatic breast cancer

    E-Print Network [OSTI]

    Li, Danda

    2011-08-31T23:59:59.000Z

    Breast cancer has a high prevalence among women and most patients suffer from metastasis to bone. The mechanisms involved in breast cancer bone metastasis are poorly understood. Three-dimensional (3D) tissue culture systems are becoming a focus...

  12. J Bone Miner Res . Author manuscript Fracture risk prediction using BMD and clinical risk factors in early

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ,651 peri- and early post-menopausal women (mean age (± SD): 54 4 yr) with a mean follow-up period of 13 Density ; Female ; Fractures, Bone ; etiology ; Humans ; Middle Aged ; Osteoporosis, Postmenopausal definition of osteoporosis ( ), i.e. a bone mineral density (BMD) value less than 2.5 standard deviations

  13. Wavelet based characterization of ex vivo vertebral trabecular bone structure with 3T MRI compared to microCT

    SciTech Connect (OSTI)

    Krug, R; Carballido-Gamio, J; Burghardt, A; Haase, S; Sedat, J W; Moss, W C; Majumdar, S

    2005-04-11T23:59:59.000Z

    Trabecular bone structure and bone density contribute to the strength of bone and are important in the study of osteoporosis. Wavelets are a powerful tool to characterize and quantify texture in an image. In this study the thickness of trabecular bone was analyzed in 8 cylindrical cores of the vertebral spine. Images were obtained from 3 Tesla (T) magnetic resonance imaging (MRI) and micro-computed tomography ({micro}CT). Results from the wavelet based analysis of trabecular bone were compared with standard two-dimensional structural parameters (analogous to bone histomorphometry) obtained using mean intercept length (MR images) and direct 3D distance transformation methods ({micro}CT images). Additionally, the bone volume fraction was determined from MR images. We conclude that the wavelet based analyses delivers comparable results to the established MR histomorphometric measurements. The average deviation in trabecular thickness was less than one pixel size between the wavelet and the standard approach for both MR and {micro}CT analysis. Since the wavelet based method is less sensitive to image noise, we see an advantage of wavelet analysis of trabecular bone for MR imaging when going to higher resolution.

  14. Revised estimates of electron absorbed fractions and radionuclide S-values in trabecular bone

    E-Print Network [OSTI]

    Parry, Robert Alan

    1995-01-01T23:59:59.000Z

    of trabecular bone in the skeleton. (Adapted from ICRP 1975). 45 Table 5. 3. Relative weights of dry bones as percentages of total skeleton. (Adapted from ICRP 1975), 45 Table 5. 4. Fractional distribution of red marrow in the skeleton. (Adapted from ICRP... Table 6. 3. Average and maximum beta-particle energy for selected radionuclides. 69 Table 6. 4. S-values for sources in the marrow (in mGy'A4Bq 's '). Target: Marrow 7l Table 6. 5. S-values for sources in the marrow (in mGyMBq 's ') Target...

  15. STRUCTURES AND MATERIALS TEST LABORATORY

    E-Print Network [OSTI]

    Russell, Jeffrey S.

    of the test program described here was to measure the shrinkage and creep characteristics of SCC mixes used. Creep tests ................................................. 4 3. Other tests ........................... 13 Shrinkage Test Results ................................... 16 Creep test Results

  16. Fast Pyrolysis Conversion Tests of Forest Concepts’ Crumbles.

    SciTech Connect (OSTI)

    Santosa, Daniel M.; Zacher, Alan H.; Eakin, David E.

    2012-04-02T23:59:59.000Z

    The report describes the work done by PNNL on assessing Forest Concept's engineered feedstock using the bench-scale continuous fast pyrolysis system to produce liquid bio-oil, char and gas. Specifically, bio-oil from the following process were evaluated for its yield and quality to determine impact of varying feed size parameters. Furthermore, the report also describes the handling process of the biomass and the challenges of operating the system with above average particle size.

  17. Dynamic T{sub 2}-mapping during magnetic resonance guided high intensity focused ultrasound ablation of bone marrow

    SciTech Connect (OSTI)

    Waspe, Adam C.; Looi, Thomas; Mougenot, Charles; Amaral, Joao; Temple, Michael; Sivaloganathan, Siv; Drake, James M. [Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Philips Healthcare Canada, Markham, ON, L6C 2S3 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Department of Applied Mathematics, University of Waterloo, Waterloo, ON, N2L 3G1 (Canada); Centre for Image Guided Innovation and Therapeutic Intervention, The Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada)

    2012-11-28T23:59:59.000Z

    Focal bone tumor treatments include amputation, limb-sparing surgical excision with bone reconstruction, and high-dose external-beam radiation therapy. Magnetic resonance guided high intensity focused ultrasound (MR-HIFU) is an effective non-invasive thermotherapy for palliative management of bone metastases pain. MR thermometry (MRT) measures the proton resonance frequency shift (PRFS) of water molecules and produces accurate (<1 Degree-Sign C) and dynamic (<5s) thermal maps in soft tissues. PRFS-MRT is ineffective in fatty tissues such as yellow bone marrow and, since accurate temperature measurements are required in the bone to ensure adequate thermal dose, MR-HIFU is not indicated for primary bone tumor treatments. Magnetic relaxation times are sensitive to lipid temperature and we hypothesize that bone marrow temperature can be determined accurately by measuring changes in T{sub 2}, since T{sub 2} increases linearly in fat during heating. T{sub 2}-mapping using dual echo times during a dynamic turbo spin-echo pulse sequence enabled rapid measurement of T{sub 2}. Calibration of T{sub 2}-based thermal maps involved heating the marrow in a bovine femur and simultaneously measuring T{sub 2} and temperature with a thermocouple. A positive T{sub 2} temperature dependence in bone marrow of 20 ms/ Degree-Sign C was observed. Dynamic T{sub 2}-mapping should enable accurate temperature monitoring during MR-HIFU treatment of bone marrow and shows promise for improving the safety and reducing the invasiveness of pediatric bone tumor treatments.

  18. DU145 human prostate cancer cells express functional Receptor Activator of NF-B: New insights in the prostate cancer bone metastasis process.

    E-Print Network [OSTI]

    Boyer, Edmond

    in the prostate cancer bone metastasis process. Mori K.1, 2, * , Le Goff B. 1, 2 , Charrier C. 1, 2 , Battaglia S cells, thus facilitating prostate cancer metastasis development in bone. We confirm that RANKL is a factor that facilitates metastasis to bone by acting as an activator of both osteoclasts and RANK

  19. IBMS BoneKEy. 2009 April;6(4):132-149 http://www.bonekey-ibms.org/cgi/content/full/ibmske;6/4/132

    E-Print Network [OSTI]

    and osteoporosis, yet uniquely ­ without targeting the resident fat or bone cell. IBMS BoneKEy. 2009 April;6(4):132-149. ©2009 International Bone & Mineral Society Introduction Osteoporosis and obesity, two of the most billion dollars in annual health service costs. (1) Osteoporosis, a disease characterized by diminished

  20. APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO-MECHANICS ON THE IBM SP

    E-Print Network [OSTI]

    California at Berkeley, University of

    APPLICATIONS OF ALGEBRAIC MULTIGRID TO LARGE-SCALE FINITE ELEMENT ANALYSIS OF WHOLE BONE MICRO,5 Abstract. Accurate micro-finite element analyses of whole bones require the solution of large sets architectures. Key words. multigrid, trabecular bone, human vertebral body, finite element method, massively

  1. Summary of Test Results for the Interagency Field Test &Evaluation...

    Broader source: Energy.gov (indexed) [DOE]

    Summary of Test Results for the Interagency Field Test &Evaluation of Wind Turbine - Radar Interference Mitigation Technologies Summary of Test Results for the Interagency Field...

  2. MITG Test Plan

    SciTech Connect (OSTI)

    Eck, Marshall B.

    1981-08-01T23:59:59.000Z

    The plan presented is for the testing of a prototypical slice of the Modular Isotopic Thermoelectric Generator (MITG). Cross Reference T48-1.

  3. RMOTC - Testing - Carbon Management

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    several years of site characterization and baseline studies necessary to advance CO2 injection tests that could yield important EOR and storage findings. Numerous...

  4. Optimum Statistical Test Procedure

    E-Print Network [OSTI]

    Rajesh Singh; Jayant Singh; Florentin Smarandache

    2009-04-10T23:59:59.000Z

    In this paper we obtain a test which minimizes the sum of the two error probabilities irrespective of whether $\\sigma^2$ is known or unknown.

  5. OMB MPI Tests

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI Tests Description The Ohio MicroBenchmark suite is a collection of independent MPI message passing performance microbenchmarks developed and written at The Ohio State...

  6. Test 1 Solutions

    E-Print Network [OSTI]

    Microsoft account

    2015-03-03T23:59:59.000Z

    Mar 1, 2015 ... Test 1. Spring 2015. February 18, 2015. 1. (30 points) Christian has started to work today at Spears Corporation. Today is Christian's 42nd.

  7. RMOTC - Testing - Environmental

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    oilfield activities and facilities offers opportunities for testing new technologies for environmental protection and restoration in a real-world environment. Examples include pit...

  8. Solutions to Test 1

    E-Print Network [OSTI]

    Owner

    2014-03-06T23:59:59.000Z

    Math 373. Spring 2013. Test 1. February 12, 2013. 1. Tracy is receiving an annuity immediate with quarterly payments of 250 for 10 years. Tracy invests each ...

  9. Solutions to Test 1

    E-Print Network [OSTI]

    Microsoft account

    2015-01-14T23:59:59.000Z

    Jan 14, 2015 ... TEST 1. MATH 373. Fall 2014. October 7, 2014. 1. Ralph's Retail Stores have borrowed 100,000. Ralph's will repay the loan with annual ...

  10. Battery Safety Testing

    Broader source: Energy.gov (indexed) [DOE]

    Battery Safety Testing Christopher J. Orendorff, Leigh Anna M. Steele, Josh Lamb, and Scott Spangler Sandia National Laboratories 2014 Energy Storage Annual Merit Review...

  11. RMOTC - Testing - Alternative Energies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    click here. RMOTC provides the opportunity for its partners to field test the latest alternative energy and environmental management technologies which have specific and...

  12. Accelerator Test Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Test Facility Vitaly Yakimenko October 6-7, 2010 ATF User meeting DOE HE, S. Vigdor, ALD - (Contact) T. Ludlam Chair, Physics Department V. Yakimenko Director ATF, Accelerator...

  13. ACCELERATOR TEST FACILITY

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    LABORATORY PHYSICS DEPARTMENT Effective: 04012004 Page 1 of 2 Subject: Accelerator Test Facility - Linear Accelerator General Systems Guide Prepared by: Michael Zarcone...

  14. RMOTC - Library - Test Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Test Reports All non-proprietary project reports that are approved for release are posted here. Many of RMOTC's projects have protection extended through a Cooperative Research and...

  15. Leak test fitting

    DOE Patents [OSTI]

    Pickett, Patrick T. (Kettering, OH)

    1981-01-01T23:59:59.000Z

    A hollow fitting for use in gas spectrometry leak testing of conduit joints is divided into two generally symmetrical halves along the axis of the conduit. A clip may quickly and easily fasten and unfasten the halves around the conduit joint under test. Each end of the fitting is sealable with a yieldable material, such as a piece of foam rubber. An orifice is provided in a wall of the fitting for the insertion or detection of helium during testing. One half of the fitting also may be employed to test joints mounted against a surface.

  16. Flexibility in Testing Configurations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technologies Laboratory and the National Solar Thermal Test Facility to advance the reliability, interconnectivity, and availability of solar technologies in the nation's...

  17. Solutions to Test 1

    E-Print Network [OSTI]

    jeffb_000

    2014-03-04T23:59:59.000Z

    STAT 479. Spring 2014. Test 1. February 18, 2014. 1. You are given the following empirical distribution of losses: 300 500 700 800 1000 1400. An insurance ...

  18. Animal Health Diagnostic Center Test and Fee Schedule Test Name Test Fee Discipline Test Days Lag** Samples Container Coolant Comments

    E-Print Network [OSTI]

    Keinan, Alon

    Animal Health Diagnostic Center Test and Fee Schedule Test Name Test Fee Discipline Test Days Lag** Samples Container Coolant Comments Equine Tests Equine Tests Acid Fast Stain (for bacteria) M-F 1-2 days 1 4 hours for equine. For more information, see Equine Cushing's Tests or AppendixC. For Equine only

  19. School of Architecture, Design and the Built Environment Project Title: Artificial bone for prosthetic hip joints

    E-Print Network [OSTI]

    Evans, Paul

    formation by the Additive Manufacturing (AM) direct printing process. The artificial bone must and the development of new additive manufacturing techniques for medical devices. The group has active links and structural gradients into the prosthesis. It is envisioned this could involve the use of additively

  20. Nonlinear resonant ultrasound spectroscopy (NRUS) applied to damage assessment in bone

    E-Print Network [OSTI]

    Alamos National Laboratory of the University of California, Los Alamos, New Mexico 87545 Received 25 May NRUS is a resonance-based technique exploiting the significant nonlinear behavior of damaged materials obtained through the measurement of bone mineral density BMD obtained from x-ray densitometric techniques.1

  1. In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone

    E-Print Network [OSTI]

    Weiss, Lee E.

    In vitro analysis of biodegradable polymer blend/hydroxyapatite composites for bone tissue engineering Kacey G. Marra,1 Jeffrey W. Szem,2 Prashant N. Kumta,3 Paul A. DiMilla,4 Lee E. Weiss5 1 14 April 1999 Abstract: Blends of biodegradable polymers, poly(capro- lactone) and poly

  2. Estimated number of women likely to benefit from bone mineral density measurement in France

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ; Menopause Introduction The prevalence of osteoporosis is rising, most notably in postmenopausal women years of age with risk factors for osteoporosis likely to lead to bone mineral density measurement, an investigation reimbursed by the French national health insurance system in patients at risk for osteoporosis

  3. Differential Maintenance of Cortical and Cancellous Bone Strength Following Discontinuation of

    E-Print Network [OSTI]

    Ritchie, Robert

    and with combination of osteoporosis medications are needed to improve our treatment of osteoporosis. ß 2011 American; RALOXIFENE Introduction A number of drugs offer some protection against post- menopausal bone loss and nonvertebral fractures in postmenopausal osteoporosis.(3) While bisphosphonates such as ALN may accumulate

  4. Feeding Bone Meal to Range Cattle on the Coastal Plains of Texas : Preliminary Report.

    E-Print Network [OSTI]

    Schmidt, H.

    1926-01-01T23:59:59.000Z

    TO RANGE CATTLE 15 Ullllt deca espc T : (Figure 4), or a piece of old hide that has not yet completely yed. Occasionally an animal may be seen licking on the partially ~sed bones of a foul-smelling carcass. he facts related above have probably been...

  5. 3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views

    E-Print Network [OSTI]

    3D Reconstruction of the Femoral Bone using two X-ray Images from Orthogonal Views B. Nikkhahe of the femur and 97 % of the model femur shaft less than 2 mm from the CT scan. Also the femoral head visualization of the femur including the femoral collumn and condyles is important for the clinician in a number

  6. Changes in bone morphology and composition following long-term alcohol consumption

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 months. The rats were...

  7. Bone ingrowth in a shoulder prosthesis E.M.van Aken

    E-Print Network [OSTI]

    Vuik, Kees

    Bone ingrowth in a shoulder prosthesis E.M.van Aken 1107895 emvanaken@hotmail.com Delft, 2006 and to relief the pain, a prosthesis to replace the glenoid of the shoulder joint is an option. The shoulder. The prosthesis, often made of stainless steal combined with polyethylene, re- #12;4 places this glenoid cavity

  8. A method for calibration of bone driver transducers to measure the mastoid Reggie Weece a

    E-Print Network [OSTI]

    Allen, Jont

    2010 Available online xxxx a b s t r a c t When using bone vibrator transducers for clinical a circuit model of the driver, describing it with three frequency-dependent parameters. Once these three circuit model is proposed to better capture the observed behaviors. Ã? 2010 Published by Elsevier B.V. 1

  9. The consequence of late-onset alcohol abuse in aged bone: a histomorhometric analysis

    E-Print Network [OSTI]

    Barker, Lisa Setchfield

    2000-01-01T23:59:59.000Z

    The objective of this experiment was to examine the effect of late-onset alcohol abuse on aged bone using the rat model. Thirty female Fischer 344 rats were separated by weights into one of four groups: baseline, alcohol-fed, pair-fed, and pellet...

  10. Calcium balance and bone density in immature horses fed a high protein diet 

    E-Print Network [OSTI]

    Spooner, Holly Sue

    2006-10-30T23:59:59.000Z

    is easy and non-invasive, the variability among horses is quite high, and thus it is best used for observations of changes in bone density over time for a specific animal. Computer assisted tomography (CAT scan) and dual energy x-ray 7...

  11. From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia

    E-Print Network [OSTI]

    From a Dry Bone to a Genetic Portrait: A Case Study of Sickle Cell Anemia MARINA FAERMAN,1* ALMUT identification; Y chromosome polymorphic markers; sickle cell anemia ABSTRACT The potential and reliability sample, which represented a documented case of sickle cell anemia. -globin gene sequences obtained from

  12. Correlation of mechanical viscoelastic properties to microstructure of equine cortical bone tissue

    E-Print Network [OSTI]

    Ayers, Andrew Kerr

    1995-01-01T23:59:59.000Z

    , there is a fair amount of subjectivity that is involved when deciding borderline grid points The current investigation used a diff'erent method in which an image analysis program, Optimas 4 2, is used to threshold the image of the bone In this procedure...

  13. Microfluidic purification and analysis of hematopoietic stem cells from bone Romana Schirhagl,a

    E-Print Network [OSTI]

    Zare, Richard N.

    Microfluidic purification and analysis of hematopoietic stem cells from bone marrow Romana to separate them from a whole-marrow sample. A microfluidic device was fabricated using an integrated membrane are restricted by the limited availability of stem cell sources.2,3 We believe that microfluidics can be used

  14. BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA AND CT

    E-Print Network [OSTI]

    Valero-Cuevas, Francisco

    BONE DENSITOMETRY IN PEDIATRIC POPULATIONS: DISCREPANCIES IN THE DIAGNOSIS OF OSTEOPOROSIS BY DXA, osteoporosis is frequently overdiagnosed in children when using dual-energy x-ray absorptiometry (DXA osteoporosis in pediatric populations. (J Pediatr 2005;146:776-9) D ual-energy x-ray absorptiometry (DXA

  15. On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone

    E-Print Network [OSTI]

    Frey, Pascal

    On Smoothing Surfaces in Voxel Based Finite Element Analysis of Trabecular Bone Peter Arbenz on complicated domains composed of often hundreds of millions of voxel elements. The finite element analysis finite element (FE) analysis. The approach based on the FE analysis leads to linear systems of equations

  16. Metabolic modeling for the deposition of transuranic nuclides on bone surfaces

    E-Print Network [OSTI]

    Halter, Donald Anthony

    1997-01-01T23:59:59.000Z

    to recalculate integrated activity over fifty years, U, values, as a function of intake for use in dose calculations for plutonium deposit on bone surfaces. These values were compared with those in ICRP-30 and showed a substantial decrease in the estimated dose...

  17. Mitigating Disuse Bone Loss: Role of Resistance Exercise and Beta-Adrenergic Signaling 

    E-Print Network [OSTI]

    Swift, Joshua Michael

    2011-08-08T23:59:59.000Z

    . Recent data gathered from crew members on the International Space Station (ISS) illustrates the significant losses of bone mineral density (BMD) and geometry of the femoral neck (15). Dual-energy x-ray absorptiometry (DXA) and QCT scans were taken...

  18. Changes in bone morphology and composition following long-term alcohol consumption 

    E-Print Network [OSTI]

    Hebert, Valerie Anne

    1998-01-01T23:59:59.000Z

    The objective of this study is to determine the effect ics. of long-term alcohol consumption on bone morphology and composition. Female Sprague-Dawley rats were fed one of three diets (alcohol, pair-fed, or chow) for 18 ...

  19. A 3D Statistical Shape Model Of The Pelvic Bone For Segmentation

    E-Print Network [OSTI]

    Andrzejak, Artur

    patient models from 3D image data. Within the setting of a hybrid system (applicator plus MR tomograph. Left: hybrid system (MRT plus applicator), Right: MRT slice image from the abdomen with pelvic bone. 1 on heating up affected tissue compartments to temperatures above 42 degree Celsius without damaging

  20. Randomized, Double-Blinded, Placebo-Controlled, Trial of Risedronate for the Prevention of Bone Mineral Density Loss in Nonmetastatic Prostate Cancer Patients Receiving Radiation Therapy Plus Androgen Deprivation Therapy

    SciTech Connect (OSTI)

    Choo, Richard [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)] [Department of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States); Lukka, Himu [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada)] [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada); Cheung, Patrick [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)] [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada); Corbett, Tom [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada)] [Department of Radiation Oncology, Juravinski Cancer Center, McMaster University, Hamilton (Canada); Briones-Urbina, Rosario [Department of Medicine, Women's College Hospital, University of Toronto, Toronto (Canada)] [Department of Medicine, Women's College Hospital, University of Toronto, Toronto (Canada); Vieth, Reinhold [Departments of Nutritional Sciences and Laboratory Medicine and Pathology, Mount Sinai Hospital, University of Toronto, Toronto (Canada)] [Departments of Nutritional Sciences and Laboratory Medicine and Pathology, Mount Sinai Hospital, University of Toronto, Toronto (Canada); Ehrlich, Lisa [Department of Radiology, Sunnybrook Health Sciences Center, University of Toronto (Canada)] [Department of Radiology, Sunnybrook Health Sciences Center, University of Toronto (Canada); Kiss, Alex [Department of Health Policy, Management, and Evaluation, Sunnybrook Health Sciences Center, University of Toronto, Toronto (Canada)] [Department of Health Policy, Management, and Evaluation, Sunnybrook Health Sciences Center, University of Toronto, Toronto (Canada); Danjoux, Cyril, E-mail: Cyril.danjoux@sunnybrook.ca [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)] [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto (Canada)

    2013-04-01T23:59:59.000Z

    Purpose: Androgen deprivation therapy (ADT) has been used as an adjuvant treatment to radiation therapy (RT) for the management of locally advanced prostate carcinoma. Long-term ADT decreases bone mineral density (BMD) and increases the risk of osteoporosis. The objective of this clinical trial was to evaluate the efficacy of risedronate for the prevention of BMD loss in nonmetastatic prostate cancer patients undergoing RT plus 2 to 3 years of ADT. Methods and Materials: A double-blinded, placebo-controlled, randomized trial was conducted for nonmetastatic prostate cancer patients receiving RT plus 2 to 3 years of ADT. All had T scores > ?2.5 on dual energy x-ray absorptiometry at baseline. Patients were randomized 1:1 between risedronate and placebo for 2 years. The primary endpoints were the percent changes in the BMD of the lumbar spine at 1 and 2 years from baseline, measured by dual energy x-ray absorptiometry. Analyses of the changes in BMD and bone turnover biomarkers were carried out by comparing mean values of the intrapatient changes between the 2 arms, using standard t tests. Results: One hundred four patients were accrued between 2004 and 2007, with 52 in each arm. Mean age was 66.8 and 67.5 years for the placebo and risedronate, respectively. At 1 and 2 years, mean (±SE) BMD of the lumbar spine decreased by 5.77% ± 4.66% and 13.55% ± 6.33%, respectively, in the placebo, compared with 0.12% ± 1.29% at 1 year (P=.2485) and 0.85% ± 1.56% (P=.0583) at 2 years in the risedronate. The placebo had a significant increase in serum bone turnover biomarkers compared with the risedronate. Conclusions: Weekly oral risedronate prevented BMD loss at 2 years and resulted in significant suppression of bone turnover biomarkers for 24 months for patients receiving RT plus 2 to 3 years of ADT.

  1. Standard Test Method for Sandwich Corrosion Test

    E-Print Network [OSTI]

    American Society for Testing and Materials. Philadelphia

    2009-01-01T23:59:59.000Z

    1.1 This test method defines the procedure for evaluating the corrosivity of aircraft maintenance chemicals, when present between faying surfaces (sandwich) of aluminum alloys commonly used for aircraft structures. This test method is intended to be used in the qualification and approval of compounds employed in aircraft maintenance operations. 1.2 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information. 1.3 This standard may involve hazardous materials, operations, and equipment. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. Specific hazard statements appear in Section 9.

  2. Testing of the structural evaluation test unit

    SciTech Connect (OSTI)

    Ammerman, D.J.; Bobbe, J.G.

    1995-12-31T23:59:59.000Z

    In the evaluation of the safety of radioactive material transportation it is important to consider the response of Type B packages to environments more severe than that prescribed by the hypothetical accident sequence in Title 10 Part 71 of the Code of Federal Regulations (NRC 1995). The impact event in this sequence is a 9-meter drop onto an essentially unyielding target, resulting in an impact velocity of 13.4 m/s. The behavior of 9 packages when subjected to impacts more severe than this is not well known. It is the purpose of this program to evaluate the structural response of a test package to these environments. Several types of structural response are considered. Of primary importance is the behavior of the package containment boundary, including the bolted closure and 0-rings. Other areas of concern are loss of shielding capability due to lead slump and the deceleration loading of package contents, that may cause damage to them. This type of information is essential for conducting accurate risk assessments on the transportation of radioactive materials. Currently very conservative estimates of the loss of package protection are used in these assessments. This paper will summarize the results of a regulatory impact test and three extra-regulatory impact tests on a sample package.

  3. RESULTS OF FIELD TESTING DOE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    FIELD TESTING AT THE DEPARTMENT OF ENERGY, ROCKY MOUNTAIN OILFIELD TESTING CENTER May through September of 2011 RMOTC is an energy testing center that partners with industry to...

  4. A dual model HU conversion from MRI intensity values within and outside of bone segment for MRI-based radiotherapy treatment planning of prostate cancer

    SciTech Connect (OSTI)

    Korhonen, Juha, E-mail: juha.p.korhonen@hus.fi [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland) [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland); Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland); Kapanen, Mika [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland) [Clinical Research Institute Helsinki University Central Hospital Ltd., POB-700, 00029 HUS (Finland); Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland); Department of Medical Physics, Tampere University Hospital, POB-2000, 33521 Tampere (Finland); Keyriläinen, Jani; Seppälä, Tiina; Tenhunen, Mikko [Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland)] [Department of Oncology, Helsinki University Central Hospital, POB-180, 00029 HUS (Finland)

    2014-01-15T23:59:59.000Z

    Purpose: The lack of electron density information in magnetic resonance images (MRI) poses a major challenge for MRI-based radiotherapy treatment planning (RTP). In this study the authors convert MRI intensity values into Hounsfield units (HUs) in the male pelvis and thus enable accurate MRI-based RTP for prostate cancer patients with varying tissue anatomy and body fat contents. Methods: T{sub 1}/T{sub 2}*-weighted MRI intensity values and standard computed tomography (CT) image HUs in the male pelvis were analyzed using image data of 10 prostate cancer patients. The collected data were utilized to generate a dual model HU conversion technique from MRI intensity values of the single image set separately within and outside of contoured pelvic bones. Within the bone segment local MRI intensity values were converted to HUs by applying a second-order polynomial model. This model was tuned for each patient by two patient-specific adjustments: MR signal normalization to correct shifts in absolute intensity level and application of a cutoff value to accurately represent low density bony tissue HUs. For soft tissues, such as fat and muscle, located outside of the bone contours, a threshold-based segmentation method without requirements for any patient-specific adjustments was introduced to convert MRI intensity values into HUs. The dual model HU conversion technique was implemented by constructing pseudo-CT images for 10 other prostate cancer patients. The feasibility of these images for RTP was evaluated by comparing HUs in the generated pseudo-CT images with those in standard CT images, and by determining deviations in MRI-based dose distributions compared to those in CT images with 7-field intensity modulated radiation therapy (IMRT) with the anisotropic analytical algorithm and 360° volumetric-modulated arc therapy (VMAT) with the Voxel Monte Carlo algorithm. Results: The average HU differences between the constructed pseudo-CT images and standard CT images of each test patient ranged from ?2 to 5 HUs and from 22 to 78 HUs in soft and bony tissues, respectively. The average local absolute value differences were 11 HUs in soft tissues and 99 HUs in bones. The planning target volume doses (volumes 95%, 50%, 5%) in the pseudo-CT images were within 0.8% compared to those in CT images in all of the 20 treatment plans. The average deviation was 0.3%. With all the test patients over 94% (IMRT) and 92% (VMAT) of dose points within body (lower than 10% of maximum dose suppressed) passed the 1 mm and 1% 2D gamma index criterion. The statistical tests (t- and F-tests) showed significantly improved (p ? 0.05) HU and dose calculation accuracies with the soft tissue conversion method instead of homogeneous representation of these tissues in MRI-based RTP images. Conclusions: This study indicates that it is possible to construct high quality pseudo-CT images by converting the intensity values of a single MRI series into HUs in the male pelvis, and to use these images for accurate MRI-based prostate RTP dose calculations.

  5. Advanced Test Reactor Tour

    SciTech Connect (OSTI)

    Miley, Don

    2011-01-01T23:59:59.000Z

    The Advanced Test Reactor at Idaho National Laboratory is the foremost nuclear materials test reactor in the world. This virtual tour describes the reactor, how experiments are conducted, and how spent nuclear fuel is handled and stored. For more information about INL research, visit http://www.facebook.com/idahonationallaboratory.

  6. Advanced Test Reactor Tour

    ScienceCinema (OSTI)

    Miley, Don

    2013-05-28T23:59:59.000Z

    The Advanced Test Reactor at Idaho National Laboratory is the foremost nuclear materials test reactor in the world. This virtual tour describes the reactor, how experiments are conducted, and how spent nuclear fuel is handled and stored. For more information about INL research, visit http://www.facebook.com/idahonationallaboratory.

  7. Cooperative Testing and Analysis

    E-Print Network [OSTI]

    Xie, Tao

    Cooperative Testing and Analysis: Tao Xie Peking University, China (2011-2012) North Carolina State Account for even half the total cost of software development [Beizer 90] Automated testing reduces manual to the user to get her help? Tool Human How does the user help the tool based on the info? Iterations

  8. Tests for Convergence Clubs

    E-Print Network [OSTI]

    Corrado, Luisa; Weeks, Melvyn

    2011-01-26T23:59:59.000Z

    In many applications common in testing for convergence the number of cross-sectional units is large and the number of time periods are few. In these situations tests which are founded upon an omnibus null hypothesis are characterised by a number...

  9. Nanomechanical testing system

    DOE Patents [OSTI]

    Vodnick, David James; Dwivedi, Arpit; Keranen, Lucas Paul; Okerlund, Michael David; Schmitz, Roger William; Warren, Oden Lee; Young, Christopher David

    2014-07-08T23:59:59.000Z

    An automated testing system includes systems and methods to facilitate inline production testing of samples at a micro (multiple microns) or less scale with a mechanical testing instrument. In an example, the system includes a probe changing assembly for coupling and decoupling a probe of the instrument. The probe changing assembly includes a probe change unit configured to grasp one of a plurality of probes in a probe magazine and couple one of the probes with an instrument probe receptacle. An actuator is coupled with the probe change unit, and the actuator is configured to move and align the probe change unit with the probe magazine and the instrument probe receptacle. In another example, the automated testing system includes a multiple degree of freedom stage for aligning a sample testing location with the instrument. The stage includes a sample stage and a stage actuator assembly including translational and rotational actuators.

  10. Air gun test evaluation

    SciTech Connect (OSTI)

    Carleton, J.J. II; Fox, L.; Rudy, C.R.

    1992-01-15T23:59:59.000Z

    A mechanical shock testing apparatus is used for testing the response of components subject to large accelerations in hostile environments. The test acceleration is provided by the impact of a bullet against a plate on which the component to be tested is mounted. This report describes a series of experiments that were performed to determine the dependence of the air gun test apparatus performance on incremental changes in the hardware configurations, changes in the pressure used to drive the bullet, and different accelerometers. The effect of variation of these experimental factors on the measured acceleration was determined using a Taguchi screening experimental design. Experimental settings were determined that can be used to operate the tester with a measured output within acceleration specifications.

  11. Cylinder Test Specification

    SciTech Connect (OSTI)

    Richard Catanach; Larry Hill; Herbert Harry; Ernest Aragon; Don Murk

    1999-10-01T23:59:59.000Z

    The purpose of the cylinder testis two-fold: (1) to characterize the metal-pushing ability of an explosive relative to that of other explosives as evaluated by the E{sub 19} cylinder energy and the G{sub 19} Gurney energy and (2) to help establish the explosive product equation-of-state (historically, the Jones-Wilkins-Lee (JWL) equation). This specification details the material requirements and procedures necessary to assemble and fire a typical Los Alamos National Laboratory (LANL) cylinder test. Strict adherence to the cylinder. material properties, machining tolerances, material heat-treatment and etching processes, and high explosive machining tolerances is essential for test-to-test consistency and to maximize radial wall expansions. Assembly and setup of the cylinder test require precise attention to detail, especially when placing intricate pin wires on the cylinder wall. The cylinder test is typically fired outdoors and at ambient temperature.

  12. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    SciTech Connect (OSTI)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17T23:59:59.000Z

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates ?-catenin and RUNX2. -- Abstract: Wnt/?-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of ?-catenin and RUNX2, as well as inhibiting the nuclear translocation of ?-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  13. Edit Test Options Page 1 Edit Test Options

    E-Print Network [OSTI]

    Xu, Shouhuai

    Edit Test Options Page 1 Edit Test Options Format Test Information 1. Enter a Name for the Test. 2. Choose a color for the title text of the Test. (Optional) 3. Enter a Description in the Text Box. The description is visible to Students before they click on the link to take the Test. (Optional) 4. If you want

  14. Advancing Toward Test Automation through Effective Manual Testing

    E-Print Network [OSTI]

    . This paper will walk through a best practice scenario for using Manual Tester to more naturally organize test Automation through Effective Manual Testing Bob Levy, Lead Product Manager ­ Functional Test Dennis ElenburgAdvancing Toward Test Automation through Effective Manual Testing May 2005 Advancing Toward Test

  15. Graphitized-carbon fiber/carbon char fuel

    DOE Patents [OSTI]

    Cooper, John F. (Oakland, CA)

    2007-08-28T23:59:59.000Z

    A method for recovery of intact graphitic fibers from fiber/polymer composites is described. The method comprises first pyrolyzing the graphite fiber/polymer composite mixture and then separating the graphite fibers by molten salt electrochemical oxidation.

  16. Structure-Based Predictive model for Coal Char Combustion.

    SciTech Connect (OSTI)

    Hurt, R.; Calo, J. [Brown Univ., Providence, RI (United States). Div. of Engineering; Essenhigh, R.; Hadad, C [Ohio State Univ., Columbus, OH (United States). Dept. of Chemistry; Stanley, E. [Boston Univ., MA (United States). Dept. of Physics

    1997-03-28T23:59:59.000Z

    The first quarter of this project was used to carry out a detailed planning process to coordinate the various aspects of this collaborative effort. A workshop was held at Brown University on December 4, 1996, attended by all project participants and key visitors, in which presentations were given by the principal investigators on their respective subtasks. The planning process culminated in the completion of a comprehensive document submitted to DOE / FETC under separate cover. Following the planning exercise, research work was initiated and will be continued in the second project quarter.

  17. arctic char salvelinus: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    have raised concern over potential responses of Arctic charr, Salvelinus alpinus, a cold-adapted freshwateranadromous fish species in (more) Sinnatamby, Ramila Niloshini...

  18. CSC 2400: Computer Systems Using char for Charactersg

    E-Print Network [OSTI]

    13 14 15 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 16 DLE DC1 DC2 DC3 DC4 NAK SYN ETB

  19. EnergySource formerly Char LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model,DOEHazel Crest,EnergySerranopolis JumpESL Jump

  20. Thermal test options

    SciTech Connect (OSTI)

    Koski, J.A.; Keltner, N.R.; Sobolik, K.B.

    1993-02-01T23:59:59.000Z

    Shipping containers for radioactive materials must be qualified to meet a thermal accident environment specified in regulations, such at Title 10, Code of Federal Regulations, Part 71. Aimed primarily at the shipping container design, this report discusses the thermal testing options available for meeting the regulatory requirements, and states the advantages and disadvantages of each approach. The principal options considered are testing with radiant heat, furnaces, and open pool fires. The report also identifies some of the facilities available and current contacts. Finally, the report makes some recommendations on the appropriate use of these different testing methods.

  1. Solutions to Test 2

    E-Print Network [OSTI]

    Test 2. Spring 2013. March 5, 2013. 1. Jana purchased a 20 year zero coupon bond for 20,000. The bond matures for 70,000. Christian borrowed 50,000 to be ...

  2. Solutions to Test 3

    E-Print Network [OSTI]

    Microsoft account

    2015-04-02T23:59:59.000Z

    Apr 2, 2015 ... Test 3. Fall 2014. November 18, 2014. 1. The preferred stock of Oldham Company pays a quarterly dividend of 8. The next dividend is due in 1 ...

  3. Solutions to Test 2

    E-Print Network [OSTI]

    Microsoft account

    2015-01-14T23:59:59.000Z

    Jan 14, 2015 ... Test 2. Fall 2014. October 28, 2014. 1. Joon is going to buy a 10 year callable bond. The bond matures for 15,000 and pays semi-annual.

  4. Solutions to Test 3

    E-Print Network [OSTI]

    jeffb_000

    2014-08-16T23:59:59.000Z

    Math 373. Test 3. Spring 2014. April 8, 2014. 1. Yujin can buy each of the following bonds for a price of P . The bonds are: a. A 10 year zero coupon bond ...

  5. Solutions to Test 1

    E-Print Network [OSTI]

    jeffb_000

    2014-08-16T23:59:59.000Z

    MATH 373. Spring 2014. Test 1. February 18, 2013. 1. Amar wants to accumulate 1 million (1,000,000) by the time that he is 50 years old. Amar is currently 20 ...

  6. Solutions to Test 2

    E-Print Network [OSTI]

    jeffb_000

    2014-04-14T23:59:59.000Z

    STAT 479. Test 2. Spring 2014. April 1, 2014. 1. (5 points) You are given the following grouped data: Amount of claims. Number of Claims. 0 to 1000. 8. 1000 to ...

  7. Final focus test beam

    SciTech Connect (OSTI)

    Not Available

    1991-03-01T23:59:59.000Z

    This report discusses the following: the Final Focus Test Beam Project; optical design; magnets; instrumentation; magnetic measurement and BPM calibration; mechanical alignment and stabilization; vacuum system; power supplies; control system; radiation shielding and personnel protection; infrastructure; and administration.

  8. Solutions to Test 1

    E-Print Network [OSTI]

    Microsoft account

    2014-10-24T23:59:59.000Z

    Test 1. STAT 47201. Fall 2014. October 7, 2014. 1. You are given: i. Mortality follows the illustrative life table ii. 6% i = Calculate: a. The actuarial present value

  9. RMOTC TEST REPORT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    896PT15 RMOTC TEST REPORT Bull Dog Auger Bull Dog Tool, Inc 243 W. County Road P.O. Box 5961 Hobbs, New Mexico 88241-5961 Leo Gianfiacomo, Project Manager Rocky Mountain Oilfield...

  10. Accelerated Testing Validation

    E-Print Network [OSTI]

    Mukundan, Rangachary

    2013-01-01T23:59:59.000Z

    used in the HD6 MEA. Failure analysis of these MEAs has beenpotential hold test. The failure analysis from these stacksbe validated with the failure analysis from both the AST and

  11. RMOTC TEST REPORT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    conducted a field test on the MUD DEVIL - Deaerator Mixer (MDDM), at the Naval Oil Shale Reserve No. 3 (NOSR-3) located west of Rifle, Colorado. Industrial Screen and...

  12. Duct Tape Durability Testing

    SciTech Connect (OSTI)

    Sherman, Max H.; Walker, Iain S.

    2004-04-01T23:59:59.000Z

    Duct leakage is a major source of energy loss in residential buildings. Most duct leakage occurs at the connections to registers, plenums, or branches in the duct system. At each of these connections, a method of sealing the duct system is required. Typical sealing methods include tapes or mastics applied around the joints in the system. Field examinations of duct systems have shown that taped seals tend to fail over extended periods of time. The Lawrence Berkeley National Laboratory (LBNL) has been testing sealant durability for several years using accelerated test methods and found that typical duct tape (i.e., cloth-backed tapes with natural rubber adhesives) fails more rapidly than other duct sealants. This report summarizes the results of duct sealant durability testing over two years for four UL 181B-FX listed duct tapes (two cloth tapes, a foil tape and an Oriented Polypropylene (OPP) tape). One of the cloth tapes was specifically developed in collaboration with a tape manufacturer to perform better in our durability testing. The tests involved the aging of common ''core-to-collar joints'' of flexible duct to sheet metal collars. Periodic air leakage tests and visual inspection were used to document changes in sealant performance. After two years of testing, the flex-to-collar connections showed little change in air leakage, but substantial visual degradation from some products. A surprising experimental result was failure of most of the clamps used to mechanically fasten the connections. This indicates that the durability of clamps also need to be addressed ensure longevity of the duct connection. An accelerated test method developed during this study has been used as the basis for an ASTM standard (E2342-03).

  13. Diesel Engine Idling Test

    SciTech Connect (OSTI)

    Larry Zirker; James Francfort; Jordon Fielding

    2006-02-01T23:59:59.000Z

    In support of the Department of Energy’s FreedomCAR and Vehicle Technology Program Office goal to minimize diesel engine idling and reduce the consumption of millions of gallons of diesel fuel consumed during heavy vehicle idling periods, the Idaho National Laboratory (INL) conducted tests to characterize diesel engine wear rates caused by extended periods of idling. INL idled two fleet buses equipped with Detroit Diesel Series 50 engines, each for 1,000 hours. Engine wear metals were characterized from weekly oil analysis samples and destructive filter analyses. Full-flow and the bypass filter cartridges were removed at four stages of the testing and sent to an oil analysis laboratory for destructive analysis to ascertain the metals captured in the filters and to establish wear rate trends. Weekly samples were sent to two independent oil analysis laboratories. Concurrent with the filter analysis, a comprehensive array of other laboratory tests ascertained the condition of the oil, wear particle types, and ferrous particles. Extensive ferrogram testing physically showed the concentration of iron particles and associated debris in the oil. The tests results did not show the dramatic results anticipated but did show wear trends. New West Technologies, LLC, a DOE support company, supplied technical support and data analysis throughout the idle test.

  14. Country Canada Type Blend (corn in oak + rye in charred oak + barley in medium-charred oak)

    E-Print Network [OSTI]

    Izzard, Rob

    ) Distillery Forty Creek Name Double barrel reserve ABV 40% Cask Bourbon and sherry Colour Golden Bottle volume 750ml Price e/cl e0.53 (bottle price $59.95 = e40) bought by Rob (Lot 249, #08173) Place of purchase BC liquor store, Westbrook Mall, Vancouver Nose When I brought the glass to my nose I received

  15. Architectures of Test Automation 1 High Volume Test AutomationHigh Volume Test Automation

    E-Print Network [OSTI]

    Architectures of Test Automation 1 High Volume Test AutomationHigh Volume Test Automation Cem Kaner Institute of Technology October 2003 #12;Architectures of Test Automation 2 Acknowledgements developed a course on test automation architecture, and in the Los Altos Workshops on Software Testing

  16. Jim Duckworth, WPI Verilog for Testing -Module 61 Test Benches (Test Fixtures)

    E-Print Network [OSTI]

    Huang, Xinming

    Jim Duckworth, WPI Verilog for Testing - Module 61 Test Benches (Test Fixtures) Verilog for Testing #12;Jim Duckworth, WPI Verilog for Testing - Module 62 Overview · We have concentrated on Verilog for synthesis · Can also use Verilog as a test language · Very important to conduct comprehensive verification

  17. The Modified Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions

    E-Print Network [OSTI]

    The Modified Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions Francis for Nondestructive Evaluation Iowa State University Ames, IA 50011 ABSTRACT: We present modified sudden death test (MSDT) plans to address the problem of limited testing positions in life tests. A single MSDT involves

  18. The Modi ed Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions

    E-Print Network [OSTI]

    The Modi ed Sudden Death Test: Planning Life Tests with a Limited Number of Test Positions Francis for Nondestructive Evaluation Iowa State University Ames, IA 50011 ABSTRACT: We present modi ed sudden death test (MSDT) plans to address the problem of limited testing positions in life tests. A single MSDT involves

  19. Adult equine bone-marrow stromal cells produce a cartilage-like ECM superior to animal-matched adult chondrocytes

    E-Print Network [OSTI]

    Kisiday, John D.

    Our objective was to evaluate the age-dependent mechanical phenotype of bone marrow stromal cell- (BMSC-) and chondrocyte-produced cartilage-like neo-tissue and to elucidate the matrix-associated mechanisms which generate ...

  20. Rational design to control multipotent stromal cell migration for applications in bone tissue engineering and injury repair

    E-Print Network [OSTI]

    Wu, Shan, Ph. D. Massachusetts Institute of Technology

    2011-01-01T23:59:59.000Z

    Multipotent stromal cells derived from bone marrow hold great potential for tissue engineering applications because of their ability to home to injury sites and to differentiate along mesodermal lineages to become osteocytes, ...