Powered by Deep Web Technologies
Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Adding Up Photons with a TES  

Science Conference Proceedings (OSTI)

... made by different devices at different power levels more ... the TES to shed its heat and return ... converted to two photons whose combined energy and ...

2011-11-10T23:59:59.000Z

2

Current TES Capabilities in TRNSYS (Presentation)  

DOE Green Energy (OSTI)

This presentation includes: a brief overview of TRNSYS, a review of current SolarPaces models, potential of other models appropriate for CSP TES, and a review of a project proposal.

Price, H.; Blair, N.

2003-02-01T23:59:59.000Z

3

Thermal Energy Storage (TES): Past, Present and Future  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Energy Storage (TES): Past, Present and Future Thermal Energy Storage (TES): Past, Present and Future Speaker(s): Klaus Schiess Date: June 10, 2011 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Sila Kiliccote Thermal Energy Storage (TES) is a technology that stores "cooling" energy in a thermal storage mass. In the eighties and early nineties the utilities in California incentivised this technology to shift electrical on-peak power to off-peak. Thereafter, for various reasons TES became the most neglected permanent load shifting opportunity. It is only now with the challenges that the renewables provide that TES may have a come- back because it is basically the best and most economical AC battery available with a round trip efficiency of 100% or even better. This presentation gives some background to this development and shows the interdependence of

4

NE-20  

Office of Legacy Management (LM)

hi v. !&-2:. hi v. !&-2:. /qL lo 1 OCT 2 9 1984 NE-20 -. Authorization for Remedial Action of the Ashland 2 Site, Tonawanda, New York f! Joe LaGrone, Manager Oak Ridge Operations Office Based on the Aerial Radiological Survey (Attachment 1) and a "walk-on" radiologlcal survey (Attachment 2 , excerpted from the ORNL draft report "Ground-Level Investigation of Anomalous Gamma Radiation Levels in the Tonawanda, New York, Area," January 1980), the property identified as Ashland 2 is authorized for remedial action. It should be noted that the attached survey data are for designation purposes only and Bechtel National, Inc. (EM), should conduct appropriate comprehensive characterization surveys to determine the extent and magnitude of the

5

NE-23,  

Office of Legacy Management (LM)

t:"'. ? - ' t:"'. ? - ' y5 NE-23, wk$& Dr. Joseph A. Warburton Chainnan, Radiological and Toxicological Safety Board University of Nevada System DRI/ASC, P.O. Box 60220 Reno, Nevada 89506 Dear Dr. Warburton: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on the Mackay School of M ines facility at the University of Nevada, Reno, Nevada, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Atomic Energy Commission (a predecessor to DOE). A radiological survey indicated that the radiation levels at the involved portion of the facility are at or near background levtrls. Therefore, no remedial action is required, and DGE is eliminating

6

NE-24  

Office of Legacy Management (LM)

VW- VW- 50 "id AU6 3 1983 NE-24 .' . _ : ' : R&D Decontamination Projects Under the Formerly Utilized Sites Remedial Actlon Program (FUSRAP) '_ F .- ,: 'J,.LaGrone, Manager . Oak Ridge Operations Office As a result of the House-Senate Conference Report and the Energy and Water Appropriations Act for FY 1984, and based on the data in the attached reports indicating radioactive contamination in excess of acceptable guidelines, the sites listed in the attachment and their respective vicinity properties (contaminated with radioactive materials from these sites) are being designated as decontamination research and development projects under the FUSRAP. Each site and the associated vicinity properties should be treated as a separate project. The objective of each project is to decontaminate the vicinity properties

7

Validation of TES Temperature and Water Vapor Retrievals with ARM  

NLE Websites -- All DOE Office Websites (Extended Search)

Validation of TES Temperature and Water Vapor Retrievals with ARM Validation of TES Temperature and Water Vapor Retrievals with ARM Observations Cady-Pereira, Karen Atmospheric and Environmental Research, Inc. Shephard, Mark Atmospheric and Environmental Research, Inc. Clough, Shepard Atmospheric and Environmental Research Mlawer, Eli Atmospheric & Environmental Research, Inc. Turner, David University of Wisconsin-Madison Category: Atmospheric State and Surface The primary objective of the TES (Tropospheric Emission Spectrometer) instrument on the Aura spacecraft is the retrieval of trace gases, especially water vapor and ozone. The TES retrievals extremely useful for global monitoring of the atmospheric state, but they must be validated. The ARM sites are well instrumented and provide continuous measurements, which

8

TES imaging array technology for CLOVER  

E-Print Network (OSTI)

CLOVER is an experiment which aims to detect the signature of gravitational waves from inflation by measuring the B-mode polarization of the cosmic microwave background. CLOVER consists of three telescopes operating at 97, 150, and 220 GHz. The 97-GHz telescope has 160 horns in its focal plane while the 150 and 220-GHz telescopes have 256 horns each. The horns are arranged in a hexagonal array and feed a polarimeter which uses finline-coupled TES bolometers as detectors. To detect the two polarizations the 97-GHz telescope has 320 detectors while the 150 and 220-GHz telescopes have 512 detectors each. To achieve the required NEPs the detectors are cooled to 100 mK for the 97 and 150-GHz polarimeters and 230 mK for the 220-GHz polarimeter. Each detector is fabricated as a single chip to guarantee fully functioning focal planes. The detectors are contained in linear modules made of copper which form split-block waveguides. The detector modules contain 16 or 20 detectors each for compatibility with the hexagonal arrays of horns in the telescopes' focal planes. Each detector module contains a time-division SQUID multiplexer to read out the detectors. Further amplification of the multiplexed signals is provided by SQUID series arrays. The first prototype detectors for CLOVER operate with a bath temperature of 230 mK and are used to validate the detector design as well as the polarimeter technology. We describe the design of the CLOVER detectors, detector blocks, and readout, and give an update on the detector development.

Michael D. Audley; Robert W. Barker; Michael Crane; Roger Dace; Dorota Glowacka; David J. Goldie; Anthony N. Lasenby; Howard M. Stevenson; Vassilka Tsaneva; Stafford Withington; Paul Grimes; Bradley Johnson; Ghassan Yassin; Lucio Piccirillo; Giampaolo Pisano; William D. Duncan; Gene C. Hilton; Kent D. Irwin; Carl D. Reintsema; Mark Halpern

2006-07-05T23:59:59.000Z

9

NE Blog Archive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ne/blog-archive 1000 Independence Ave. SWWashington DC ne/blog-archive 1000 Independence Ave. SWWashington DC 20585202-586-5000 en Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration http://energy.gov/ne/articles/generation-iv-international-forum-updates-technology-roadmap-and-builds-future ne/articles/generation-iv-international-forum-updates-technology-roadmap-and-builds-future" class="title-link">Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration

10

Single media thermocline TES studies at Sandia National Laboratories  

SciTech Connect

The status of thermocline thermal energy storage (TES) development at Sandia National Laboratories is summarized. The work centers around testing in the 1200 gal engineering prototype thermocline test facility. The results of heat loss, charge, discharge and static tests in the prototype tank are described. Also described are analytical work and a supportive laboratory-scale program which is investigating diffusers to inhibit mixing in the tank.

Gross, R.J.

1981-01-01T23:59:59.000Z

11

MHK Projects/Ocean Trials Ver 2 | Open Energy Information  

Open Energy Info (EERE)

Ocean Trials Ver 2 Ocean Trials Ver 2 < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

12

ProMoVer: modular verification of temporal safety properties  

Science Conference Proceedings (OSTI)

This paper describes ProMoVer, a tool for fully automated procedure-modular verification of Java programs equipped with method-local and global assertions that specify safety properties of sequences of method invocations. Modularity at the procedure-level ...

Siavash Soleimanifard; Dilian Gurov; Marieke Huisman

2011-11-01T23:59:59.000Z

13

MiniBooNE  

SciTech Connect

To begin, we examine the relationship between MiniBooNE and the neutrino beam geometry at Fermilab. In Figure 1, a schematic representation is shown of the plan view of the location of MiniBooNE relative to SciBooNE and the NuMI target, where it can be seen that SciBooNE and MiniBooNE share the same beamline and neutrino flux, and therefore share some of the same systematic effects -- A combined analysis between the two experimental groups could yield a superior result compared to segregated individual analysis. MiniBooNE makes an angle of 6.3 degrees with the NuMI beamline, an off-axis measurement if you will, that provides a relatively high yield of electron neutrinos from kaon decay. Furthermore, the proton beam incident on the MiniBooNE target possesses a 53 MHz structure that will be important in timing studies related to the low energy excess. Let's review of the results of the MiniBooNE: As is well known, MiniBooNE, a test of the LSND effect [1], adds experimental inspiration to the possible existence of new phenomena; although two neutrino-family oscillations were shown to be an unlikely candidate to explain the LSND effect, a low energy excess of 3.0 sigma in the neutrino sector at energies between 200 to 475 MeV [2] - an effect that appears to have no counterpart in the antineutrino sector [3], combined with the 3.8 sigma LSND result - at roughly 50 MeV - strains phenomenology for insight. Miniboones continues to run and collect antineutrino data; will combine disappearance analysis with SciBooNE; take data from the NuMI target, an unusual source with a potentially new look at the low energy anomaly; and use beam timing techniques to further constrain phenomenological models. In this paper we will review current topics related to MiniBooNE and other associated experiments and phenomenology.

Stefanski, Ray; /Fermilab

2009-10-01T23:59:59.000Z

14

Actes JFPC 2005 Une autre conversion de SAT vers CSP  

E-Print Network (OSTI)

Actes JFPC 2005 Une autre conversion de SAT vers CSP Olivier ROUSSEL CRIL - CNRS FRE 2499 rue de l tour, peut être di- rectement transformée en un problème CSP binaire. Cette transformation est basée. Nous montrons également que le maintien de la k-consistance sur le problème CSP est équivalent à l

Paris-Sud XI, Université de

15

Web Based Training (WEB BT) TES employees can get free training on applications within  

E-Print Network (OSTI)

Web Based Training (WEB BT) TES employees can get free training on applications within office, and Internet/Intranet skills. WEB BT allows you to conduct self-directed tutorials from any of the above for one tutorial per month. Hours WEB BT is available to temporary employees, in the TES Office, for up

Russell, Lynn

16

technology offer SandTES -High Temperature Sand Thermal Energy Storage  

E-Print Network (OSTI)

technology offer SandTES - High Temperature Sand Thermal Energy Storage key words: High Temperature together with Dr. Eisl of ENRAG GmbH. Background Thermal energy storage (TES) systems are essential Energy Storage | Fluidized Bed | Sand | The invention consists of a fluidized bed with internal heat

Szmolyan, Peter

17

Eliyahu Ne'eman  

NLE Websites -- All DOE Office Websites (Extended Search)

Eliyahu Ne'eman Eliyahu Ne'eman Consulting Engineer on Lighting and Daylighting Lawrence Berkeley National Laboratory This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Eliyahu Ne'eman is a leading international expert on lighting and daylighting. He has been involved in education, research and practice for over 40 years while working in Israel, UK, Germany and the US(LBNL). He has worked extensively in the area of occupant response in luminous spaces and he has been leading the CIE Task Group that has revised the CIE Museum Lighting Guide. This Speaker's Seminars Control of Damage to Museum Objects by Optical Radiation

18

Case studies of thermal energy storage (TES) systems: Evaluation and verification of system performance. Final report  

Science Conference Proceedings (OSTI)

We have developed two case studies to review and analyze energy performance of thermal energy storage CMS systems in commercial buildings. Our case studies considered two partial ice storage systems in Northern California. For each case, we compiled historical data on TES design, installation, and operation. This information was further enhanced by data obtained through interviews with the building owners and operators. The performance and historical data of the TES systems and their components were grouped into issues related to design, installation, operation, and maintenance of the systems. Our analysis indicated that (1) almost all problems related to the operation of TES and non-TES systems could be traced back to the design of the system, and (2) the identified problems were not unique to the TES systems. There were as many original problems with ``conventional`` HVAC systems and components as with TES systems. Judging from the problems related to non-TES components identified in these two case studies, it is reasonable to conclude that conventional systems have as many problems as TES systems, but a failure, in a TES system may have a more dramatic impact on thermal comfort and electricity charges. The objective of the designers of the TES systems in the case-study buildings was to design just-the-right-size systems so that both the initial investment and operating costs would be minimized. Given such criteria, a system is typically designed only for normal and steady-state operating conditions-which often precludes due consideration to factors such as maintenance, growth in the needed capacity, ease of the operation, and modularity of the systems. Therefore, it is not surprising to find that these systems, at least initially, did not perform to the design intent and expectation and that they had to go through extended periods of trouble-shooting.

Akbari, H.; Sezgen, O.

1992-01-01T23:59:59.000Z

19

Case studies of thermal energy storage (TES) systems: Evaluation and verification of system performance  

DOE Green Energy (OSTI)

We have developed two case studies to review and analyze energy performance of thermal energy storage CMS systems in commercial buildings. Our case studies considered two partial ice storage systems in Northern California. For each case, we compiled historical data on TES design, installation, and operation. This information was further enhanced by data obtained through interviews with the building owners and operators. The performance and historical data of the TES systems and their components were grouped into issues related to design, installation, operation, and maintenance of the systems. Our analysis indicated that (1) almost all problems related to the operation of TES and non-TES systems could be traced back to the design of the system, and (2) the identified problems were not unique to the TES systems. There were as many original problems with conventional'' HVAC systems and components as with TES systems. Judging from the problems related to non-TES components identified in these two case studies, it is reasonable to conclude that conventional systems have as many problems as TES systems, but a failure, in a TES system may have a more dramatic impact on thermal comfort and electricity charges. The objective of the designers of the TES systems in the case-study buildings was to design just-the-right-size systems so that both the initial investment and operating costs would be minimized. Given such criteria, a system is typically designed only for normal and steady-state operating conditions-which often precludes due consideration to factors such as maintenance, growth in the needed capacity, ease of the operation, and modularity of the systems. Therefore, it is not surprising to find that these systems, at least initially, did not perform to the design intent and expectation and that they had to go through extended periods of trouble-shooting.

Akbari, H.; Sezgen, O.

1992-01-01T23:59:59.000Z

20

Synthse et ractivit des disilanes : applications vers la synthse de la 10-silatestostrone.  

E-Print Network (OSTI)

??Les travaux rapports dans ce mmoire concernent la synthse et la ractivit des disilanes, en vue de leur application vers la synthse de la 10-silatestostrone. (more)

Giros, Audrey

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Technology Potential of Thermal Energy Storage (TES) Systems in Federal Facilities  

DOE Green Energy (OSTI)

Thermal energy storage (TES) reduces electric costs by shifting chilling activities to off-peak times. Water is chilled or ice is made during the night to either replace or augment operation of cooling equipment during the day. Off-peak demand and consumption rates produce significant dollar savings. TES requires favorable electric rate structures, available space to house the associated equipment, and either variation in buildings cooling loads or favorable climatic conditions. TES can be implemented anywhere cooling loads can be shifted to off-peak housrs with the best applications being office buildings, hospitals, and schools. Most TES projects are implemented inconjunction with an existing cooling system expansion, replacement of older cooling equipment, or new construction, thus reducing energy costs, consumption, and demand.

Chvala, William D.

2002-07-08T23:59:59.000Z

22

Technology Potential of Thermal Energy Storage (TES) Systems in Federal Facilities  

Science Conference Proceedings (OSTI)

Thermal energy storage reduces electric costs by shifting chilling activities to off-peak times. Water is chilled or ice is made during the night to either replace or augment operation of cooling equipment during the day. Off-peak demand and consumption rates produce significant dollar savings. TES requires favorable electric rate structures, available space to house the associated equipment, and either variation in buildings cooling loads or favorable climatic conditions. TES can be implemented anywhere cooling loads can be shifted to off-peak hours with the best applications being office buildings, hospitals, and schools. Most TES projects are implemented in conjunction with an existing cooling system expansion, replacement of older cooling equipment, or new construction, thus reducing energy costs, consumption, and demand. Various options are available for funding TES projects in Federal facilities, including direct agency funding, capital improvement funds, utility financing, and alternative financing. The Federal Energy Management Program (FEMP) should promote TES through demonstrations, success stories, and by distributing the FEMP Technology Alert (March 2000). Federal Facilities should, as standard practice, evaluate TES options whenever a chiller retrofit or replacement is performed.

Chvala, William D.

2002-01-01T23:59:59.000Z

23

Category:Omaha, NE | Open Energy Information  

Open Energy Info (EERE)

Omaha, NE Omaha, NE Jump to: navigation, search Go Back to PV Economics By Location Media in category "Omaha, NE" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Omaha NE Omaha Public Power District.png SVFullServiceRestauran... 63 KB SVHospital Omaha NE Omaha Public Power District.png SVHospital Omaha NE Om... 61 KB SVLargeHotel Omaha NE Omaha Public Power District.png SVLargeHotel Omaha NE ... 61 KB SVLargeOffice Omaha NE Omaha Public Power District.png SVLargeOffice Omaha NE... 63 KB SVMediumOffice Omaha NE Omaha Public Power District.png SVMediumOffice Omaha N... 65 KB SVMidriseApartment Omaha NE Omaha Public Power District.png SVMidriseApartment Oma... 62 KB SVOutPatient Omaha NE Omaha Public Power District.png SVOutPatient Omaha NE ...

24

Prototype finline-coupled TES bolometers for CLOVER  

E-Print Network (OSTI)

CLOVER is an experiment which aims to detect the signature of gravitational waves from inflation by measuring the B-mode polarization of the cosmic microwave background. CLOVER consists of three telescopes operating at 97, 150, and 220 GHz. The 97-GHz telescope has 160 feedhorns in its focal plane while the 150 and 220-GHz telescopes have 256 horns each. The horns are arranged in a hexagonal array and feed a polarimeter which uses finline-coupled TES bolometers as detectors. To detect the two polarizations the 97-GHz telescope has 320 detectors while the 150 and 220-GHz telescopes have 512 detectors each. To achieve the target NEPs (1.5, 2.5, and 4.5x10^-17 W/rtHz) the detectors are cooled to 100 mK for the 97 and 150-GHz polarimeters and 230 mK for the 220-GHz polarimeter. Each detector is fabricated as a single chip to ensure a 100% operational focal plane. The detectors are contained in linear modules made of copper which form split-block waveguides. The detector modules contain 16 or 20 detectors each for compatibility with the hexagonal arrays of horns in the telescopes' focal planes. Each detector module contains a time-division SQUID multiplexer to read out the detectors. Further amplification of the multiplexed signals is provided by SQUID series arrays. The first prototype detectors for CLOVER operate with a bath temperature of 230 mK and are used to validate the detector design as well as the polarimeter technology. We describe the design of the CLOVER detectors, detector blocks, and readout, and present preliminary measurements of the prototype detectors performance.

Michael D. Audley; Robert W. Barker; Michael Crane; Roger Dace; Dorota Glowacka; David J. Goldie; Anthony N. Lasenby; Howard M. Stevenson; Vassilka Tsaneva; Stafford Withington; Paul Grimes; Bradley Johnson; Ghassan Yassin; Lucio Piccirillo; Giampaolo Pisano; William D. Duncan; Gene C. Hilton; Kent D. Irwin; Carl D. Reintsema; Mark Halpern

2006-08-14T23:59:59.000Z

25

NE-23 W  

Office of Legacy Management (LM)

>:-1. ,- '"CC3 >:-1. ,- '"CC3 . ' NE-23 .+ W h itm~ l-l& Mr. Victor 3. Canilov, Director Museum of Science and Industry East 57th Street and Lake Shore Drive Chicago, Illinois 60037 Dear kr. Danilov: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSPSIP), has reviewed information on the Museum cf Science and Industry, Chicago, Illinois, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Manhattan Engineer District or the Atomic Energy C o m m ission (predecessors to DOE). A radiological survey indicated that the radiation levels are equal to natural background. Therefore, no remedial action is required, ant DOE is eliminating the Museum of Science and Industry from further

26

Comparison of improved Aura Tropospheric Emission Spectrometer (TES) CO2 with HIPPO and SGP aircraft profile measurements  

E-Print Network (OSTI)

Aircraft observation of carbon dioxide at 8-13km altitudedecade, measurements of carbon dioxide (CO ) from space haveEmission Spectrome- ter (TES) carbon dioxide (CO ) satellite

Kulawik, S.S.

2013-01-01T23:59:59.000Z

27

tude exprimentale de l'coulement gaz-liquide dans un canal ouvert vers le bas.  

E-Print Network (OSTI)

??Les travaux prsents ici ont pour objet l'tude fondamentale de l'coulement gaz-liquide dans un canal ouvert vers le bas. Cette tude permettra de mieux comprendre (more)

Toulouse, Dominic

2007-01-01T23:59:59.000Z

28

Comparison of improved Aura Tropospheric Emission Spectrometer (TES) CO{sub 2} with HIPPO and SGP aircraft profile measurements  

SciTech Connect

Comparisons are made between mid-tropospheric Tropospheric Emission Spectrometer (TES) carbon dioxide (CO{sub 2}) satellite measurements and ocean profiles from three Hiaper Pole-to-Pole Observations (HIPPO) campaigns and land aircraft profiles from the United States Southern Great Plains (SGP) Atmospheric Radiation Measurement (ARM) site over a 4-yr period. These comparisons are used to characterize the bias in the TES CO{sub 2} estimates and to assess whether calculated and actual uncertainties and sensitivities are consistent. The HIPPO dataset is one of the few datasets spanning the altitude range where TES CO{sub 2} estimates are sensitive, which is especially important for characterization of biases. We find that TES CO{sub 2} estimates capture the seasonal and latitudinal gradients observed by HIPPO CO{sub 2} measurements; actual errors range from 0.81.2 ppm, depending on the campaign, and are approximately 1.4 times larger than the predicted errors. The bias of TES versus HIPPO is within 0.85 ppm for each of the 3 campaigns; however several of the sub-tropical TES CO{sub 2} estimates are lower than expected based on the calculated errors. Comparisons of aircraft flask profiles, which are measured from the surface to 5 km, to TES CO{sub 2} at the SGP ARM site show good agreement with an overall bias of 0.1 ppm and rms of 1.0 ppm. We also find that the predicted sensitivity of the TES CO{sub 2} estimates is too high, which results from using a multi-step retrieval for CO{sub 2} and temperature. We find that the averaging kernel in the TES product corrected by a pressure-dependent factor accurately reflects the sensitivity of the TES CO{sub 2} product.

Kulawik, S. S.; Worden, J. R.; Wofsy, S. C.; Biraud, S. C.; Nassar, R.; Jones, D. B.A.; Olsen, E. T.; Osterman, G. B.

2012-02-01T23:59:59.000Z

29

External review of the thermal energy storage (TES) cogeneration study assumptions. Final report  

DOE Green Energy (OSTI)

This report is to provide a detailed review of the basic assumptions made in the design, sizing, performance, and economic models used in the thermal energy storage (TES)/cogeneration feasibility studies conducted by Pacific Northwest Laboratory (PNL) staff. This report is the deliverable required under the contract.

Lai, B.Y.; Poirier, R.N. [Chicago Bridge and Iron Technical Services Co., Plainfield, IL (United States)

1996-08-01T23:59:59.000Z

30

US NE MA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher

31

US NE MA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher

32

Demand-Side and Supply-Side Load Management: Optimizing with Thermal Energy Storage (TES) for the Restructuring Energy Marketplace  

E-Print Network (OSTI)

The current and future restructuring energy marketplace represents a number of challenges and opportunities to maximize value through the management of peak power. This is true both on the demand-side regarding peak power use and on the supply-side regarding power generation. Thermal Energy Storage (TES) can provide the flexibility essential to the economical management of power. In large industrial applications, the added value of TES has been demonstrated, not only in managing operating costs, but also in delivering a net saving in capital cost versus conventional, non-storage approaches. This capital cost saving is often realized in situations where investments in chiller plant capacity, or in on-site power generating capacity, are required. On the demand-side, TES has long been used to shift air-conditioning loads and process cooling loads from on-peak to off-peak periods. In today's and tomorrow's restructuring energy markets, price spikes are increasingly likely during periods of peak power demand. TES is performing an important role, especially when coupled with a proper understanding of modern TES technology options. The inherent advantages and limitations of the available TES technology options are briefly reviewed and discussed. Examples of existing large TES installations are presented, identifying the TES technology types they utilize. The applications include industrial facilities, as well as universities, hospitals, government, and District Cooling utility systems. The power management impact and the economic benefits of TES are illustrated through a review of several TES case studies. Combustion Turbines (CTs) are a common choice for modern on-site and utility power generation facilities. Inlet air cooling of CTs enhances their hot weather performance and has been successfully accomplished for many years, using a variety of technologies. In many instances, TES can and does provide a uniquely advantageous method of optimizing the economics of CT Inlet Cooling (CTIC) systems. TES systems can achieve low inlet air temperatures, with resulting high levels of power augmentation. The TES approach also minimizes the installed capacity (and capital cost) of cooling systems, as well as limiting the parasitic loads occurring during periods of peak power demand and peak power value. Chilled water, ice, and low temperature fluid TES systems are all applicable to CTIC. The inherent pros and cons of each TES type are discussed. Sensitivity analyses are presented to explore the impact of cooling hours per day on capital cost per kW of power enhancement. Case histories illustrate the beneficial impact of TES-based CTIC on both capital cost and operating cost of CT power plants. TES-based CTIC is advantageous as an economical, peaking power enhancement for either peaking or base-load plants. It is applied to both new and existing CTs. TES is projected to have even greater value in future restructuring energy markets.

Andrepont, J. S.

2002-04-01T23:59:59.000Z

33

High-Temperature Phase Change Materials (PCM) Candidates for Thermal Energy Storage (TES) Applications  

DOE Green Energy (OSTI)

It is clearly understood that lower overall costs are a key factor to make renewable energy technologies competitive with traditional energy sources. Energy storage technology is one path to increase the value and reduce the cost of all renewable energy supplies. Concentrating solar power (CSP) technologies have the ability to dispatch electrical output to match peak demand periods by employing thermal energy storage (TES). Energy storage technologies require efficient materials with high energy density. Latent heat TES systems using phase change material (PCM) are useful because of their ability to charge and discharge a large amount of heat from a small mass at constant temperature during a phase transformation like melting-solidification. PCM technology relies on the energy absorption/liberation of the latent heat during a physical transformation. The main objective of this report is to provide an assessment of molten salts and metallic alloys proposed as candidate PCMs for TES applications, particularly in solar parabolic trough electrical power plants at a temperature range from 300..deg..C to 500..deg.. C. The physical properties most relevant for PCMs service were reviewed from the candidate selection list. Some of the PCM candidates were characterized for: chemical stability with some container materials; phase change transformation temperatures; and latent heats.

Gomez, J. C.

2011-09-01T23:59:59.000Z

34

TESLA Report 2005-05 Software Layer for SIMCON ver. 1.1.  

E-Print Network (OSTI)

TESLA Report 2005-05 Software Layer for SIMCON ver. 1.1. FPGA-based TESLA Cavity Control System to control FPGA-based LLRF electronic equipment for TESLA. There is presented a universal solution (SIMCON) for TESLA experiment (Test Facility) in DESY. The examples of the build and tested software

35

Reducing Energy Costs And Minimizing Capital Requirements: Case Studies of Thermal Energy Storage (TES)  

E-Print Network (OSTI)

Large cooling systems typically represent substantial capital investments and incur high operating energy costs. Cooling loads tend to peak during times of year and times of day when high ambient temperatures create a maximum demand for power, and thus during those times when power has its highest cost or value. Thermal Energy Storage (TES) provides a means of de-coupling the generation of cooling from the provision of cooling to the peak cooling loads. In this manner, peak power demand is reduced, time-of day energy costs can be minimized, and real-time variations in power value can be used to the advantage of the energy consumer.

Andrepont, J. S.

2007-01-01T23:59:59.000Z

36

Overview of NE Research Programs  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Research Programs NE Research Programs Sue Lesica Office of Nuclear Energy U.S. Department of Energy July 31, 2013 2 R&D Budgets FY 2013 FY 2014 Congressional Request House Mark Senate Mark SMR Licensing Technical Support 62,999 70,000 110,000 70,000 Small Modular Reactor R&D 23,958 20,000 20,000 20,000 Next Generation Nuclear Plant 38,720 0 0 0 LWR Sustainability 24,218 21,500 21,500 21,500 Advanced Reactor Concepts 21,178 31,000 45,000 21,000 Reactor Concepts RD&D 108,075 72,500 86,500 62,500 Modeling and Simulation Hub 24,588 24,300 24,300 24,300 Crosscutting Technology Development 17,242 13,901 27,885 25,437 NEAMS 13,646 9,536 National Scientific Users Facility 14,563 14,563 14,563 14,563 Nuclear Energy Enabling Technologies 70,040 62,300 66,748 62,300

37

UCR Chemical Hygiene Plan, ver 2012.09.10 page 1 of 55 UCR Chemistry Department Chemical Hygiene Plan  

E-Print Network (OSTI)

UCR Chemical Hygiene Plan, ver 2012.09.10 page 1 of 55 UCR Chemistry Department Chemical Hygiene Plan UCR CHEMISTRY DEPARTMENT CHEMICAL HYGIENE PLAN.................................... 4 Responsibilities of All Personnel Who Handle Hazardous Chemicals

Reed, Christopher A.

38

Optimisation de Smart Grid: d'un modle intgratif vers une simulation multi-agents autonomique  

E-Print Network (OSTI)

Optimisation de Smart Grid: d'un modèle intégratif vers une simulation multi-agents autonomique-agents intégrative de Smart Grid pour répondre aux besoins de simulation, d'analyse et d'optimisa- tion de tels systèmes. Mots-clés : Modélisation, simulation, multi- agents, smart grid Abstract Multi

39

NE - Nuclear Energy - Energy Conservation Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NUCLEAR ENERGY (NE) NUCLEAR ENERGY (NE) ENERGY CONSERVATION PLAN NE has heavily emphasized the use of flexiplace, both regular and situational. Since approximately 56 percent of NE staff use flexiplace, our plan is based on the Forrestal/Germantown (FORS/GTN) office spaces, and flexiplace office space. There are other common sense actions and policies that will be used to improve energy efficiency in the offices at both FORS and GTN. In the FORS/GTN office space: 1. Use flexiplace to the maximum extent possible. Saving an average of 1.5 gallons of gasoline per day per person (e.g., 13 miles per work x 2 = 26 miles, an average of 17 mpg), on a normal workday, NE employees save (56 percent of 145 = 71 times 1.2 days per pay period = 85.2 workdays x 1.5 gals = 127.8 gallons/pay

40

SIGNATURE OF THIS MEMORAND TES A RECORD OF THIS DECISION. NEPA Compliance Officer Signature:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MEMORAND MEMORAND TES A RECORD OF THIS DECISION. NEPA Compliance Officer Signature: EPA Compliance Officer Date: (93 Page 1 of 2 INIC*EF2a U.S. DEPARTI\ LENT OF ENERGY F.ERE PROJECT MANAGEMENT CENTER NFPA DETERI\ 11-NATION RECIPIENT:Tennessee Tech University STATE: TN PROJECT TITLE : Recovery Act: Multi-level Energy Storage and Controls for Large-scale Wind Energy Integration Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-09G099009 DE-EE0001 383 GF0-10-010 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

THE NRC HAS ISSUED Ati ACTION PLAN FOR CLEANUP OF 46 SfTES that;;ece  

Office of Legacy Management (LM)

NRC HAS ISSUED Ati ACTION PLAN FOR CLEANUP OF 46 SfTES that;;ece NRC HAS ISSUED Ati ACTION PLAN FOR CLEANUP OF 46 SfTES that;;ece :: ~,: : ..,.... ..,:y... included in the agency' s Site Decommissioning Managem&t Pian (SDMP) in.1990. The ., ,.;' -,; ;.L..z,. sites are all radioactive materials handling facilities in various stages of decommission- ~' ... ,' . .-_.... ..,: ,,~ ..,. -c : -: ing; some of them are slill under active Nuclear Regulatory Commission licenses,~some .~. . . . . . ...i.~ ,;::,: ' :-&-:' . -1.: : ;: _ :: .,,. >.r"!.-<,z...;::.~ ? ~' .._ .' l...' -i:i -::;.. c : of them were under licenses that are now terminated, and some were never licensed~, ,~: ,.~. ~~.. .,_. .i ' . In the Action Plan, which was published in the April 16 Federal Register, the NRC says' ;; *_: ._.:, :-.~:i:r~'

42

Inverse modeling of CO2 sources and sinks using satellite observations of CO2 from TES and surface flask measurements  

SciTech Connect

We infer CO2 surface fluxes using satellite observations of mid-tropospheric CO2 from the Tropospheric Emission Spectrometer (TES) and measurements of CO2 from surface flasks in a time-independent inversion analysis based on the GEOS-Chem model. Using TES CO2 observations over oceans, spanning 40 S 40 N, we find that the horizontal and vertical coverage of the TES and flask data are complementary. This complementarity is demonstrated by combining the datasets in a joint inversion, which provides better constraints than from either dataset alone, when a posteriori CO2 distributions are evaluated against independent ship and aircraft CO2 data. In particular, the joint inversion offers improved constraints in the tropics where surface measurements are sparse, such as the tropical forests of South America. Aggregating the annual surface-to-atmosphere fluxes from the joint inversion for the year 2006 yields 1.13 0.21 PgC for the global ocean, 2.77 0.20 PgC for the global land biosphere and 3.90 0.29 PgC for the total global natural flux (defined as the sum of all biospheric, oceanic, and biomass burning contributions but excluding CO2 emissions from fossil fuel combustion). These global ocean and global land fluxes are shown to be near the median of the broad range of values from other inversion results for 2006. To achieve these results, a bias in TES CO2 in the Southern Hemisphere was assessed and corrected using aircraft flask data, and we demonstrate that our results have low sensitivity to variations in the bias correction approach. Overall, this analysis suggests that future carbon data assimilation systems can benefit by integrating in situ and satellite observations of CO2 and that the vertical information provided by satellite observations of mid-tropospheric CO2 combined with measurements of surface CO2, provides an important additional constraint for flux inversions.

Nassar, Ray [University of Toronto; Jones, DBA [University of Toronto; Kulawik, SS [Jet Propulsion Laboratory, Pasadena, CA; Worden, JR [Jet Propulsion Laboratory, Pasadena, CA; Bowman, K [Jet Propulsion Laboratory, Pasadena, CA; Andres, Robert Joseph [ORNL; Suntharalingam, P [University of East Anglia, Norwich, United Kingdom; Chen, j. [University of Toronto; Brenninkmeijer, CAM [Max Planck Institut fur Chemie, Mainz; Schuck, TJ [Max Planck Institut fur Chemie, Mainz; Conway, T.J. [NOAA, Boulder, CO; Worthy, DE [Environment Canada

2011-01-01T23:59:59.000Z

43

Interatomic Coulombic decay following Ne 1s Auger decay in NeAr  

SciTech Connect

Using momentum-resolved electron-ion multicoincidence spectroscopy, we have investigated interatomic Coulombic decay (ICD) in the heteronuclear NeAr dimer following Ne 1s Auger decay. The measured intensity ratio for the three ICD transitions Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 1}S)-Ar{sup +}(3p{sup -1}), Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 1}D)-Ar{sup +}(3p{sup -1}), and Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 3}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 3}P)-Ar{sup +}(3p{sup -1}) reasonably agree with predictions. The kinetic energy release distribution for the fragmentation to Ne{sup 2+}(2p{sup -2} {sup 1}D)-Ar{sup +}(3p{sup -1}) after the ICD transition from singlet Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar state, which is a mirror image of the kinetic energy distribution of the emitted ICD electrons, suggests that the corresponding ICD rate is roughly two times lower than predicted by ab initio calculations.

Ouchi, T.; Sakai, K.; Fukuzawa, H.; Ueda, K. [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Higuchi, I.; Tamenori, Y. [Japan Synchrotron Radiation Research Institute, Sayo, Hyogo 679-5198 (Japan); Demekhin, Ph. V.; Chiang, Y.-C.; Stoychev, S. D.; Kuleff, A. I. [Theoretische Chemie, Universitaet Heidelberg, D-69120 Heidelberg (Germany); Mazza, T. [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Cimaina and Dipartimento di Fisica, Universita degli Studi di Milano, via Celoria 16, I-20133 Milano (Italy); Schoeffler, M. [Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Nagaya, K.; Yao, M. [Department of Physics, Kyoto University, Kyoto 606-8502 (Japan); Saito, N. [National Institute of Advanced Industrial Science and Technology, National Meteorology Institute of Japan, Tsukuba 305-8568 (Japan)

2011-05-15T23:59:59.000Z

44

Preprint Lawrence Berkeley Laboratory U N I VERS ITY 0 F CALI FOR N I A  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 LBL-2378 1 Preprint Lawrence Berkeley Laboratory U N I VERS ITY 0 F CALI FOR N I A Physics Division Submitted to Astrophysical Journal SEP e 8 1987 An Analysis of Recent Measurements of the Temperature of the Cosmic Microwave Background Radiation G. Smoot, S.M Levin, C. Witebsky, G. De Amici, and Y. Rephaeli July 1987 TWO-WEEK LOAN COPY t This is a Library Circulating Copy which may be borrowed for two weeks, Prepared for the U.S. Department of Energy under Contract DE-AC03-76SF00098 An Analysis of Recent Measurements of the Temperature of the Cosmic Microwave Background Radiation George Smoot, Steven M. Levin, Chris Witebsky, Giovanni De Amici Space Sciences and Lawrence Berkeley Laboratories University of California, Berkeley Yoel Rephaeli

45

NE SARE Arbuscular Mycorrhiza Research following canola  

E-Print Network (OSTI)

NE SARE Arbuscular Mycorrhiza Research Corn grown following canola Corn grown following soybeans The planting of canola, a non-mycorrhizal crop, has been shown to reduce arbuscular mycorrhizal fungi following canola. To address this problem, we intercropped canola with oats, a mycorrhizal crop

Kaye, Jason P.

46

Bifurcation vers l'etat d'Abrikosov et diagramme des phases  

E-Print Network (OSTI)

Nous \\'etudions dans cette th\\`ese la fonctionnelle de Ginzburg-Landau dans $\\R^3$ sur des couples de fonctions $(\\phi, \\overrightarrow{A})$ qui v\\'erifient des conditions de p\\'eriodicit\\'e de jauge en $x_3$ et selon un r\\'eseau discret de $(x_1,x_2)$. Nous montrons que le probl\\`eme variationnel est \\'equivalent au probl\\`eme de la minimisation d'une autre fonctionnelle sur un tore. Dans le cadre de la d\\'emonstration, un fibr\\'e vectoriel non trivial appara\\^it. On se limite alors pour la suite \\`a une quantification de 1. On montre ensuite que la fonctionnelle admet un minimum sur l'espace fonctionnel $H^{1}$ qui v\\'erifie un syst\\`eme d'\\'equations aux d\\'eriv\\'ees partielles appel\\'e syst\\`eme de Ginzburg-Landau. Le minimum est $C^{\\infty}$ par l'ellipticit\\'e du syst\\`eme d'\\'equations de Ginzburg-Landau. On montre qu'il y a une bifurcation du couple $(0,0)$ pour le champ critique $H_{ext}=k$ o\\`u $k$ est un param\\`etre caract\\'eristique du syst\\`eme. On \\'etudie alors la stabilit\\'e de la solution bifurqu\\'ee. On \\'etudie la d\\'ependance de l'\\'energie minimale \\`a l'\\'egard de la g\\'eom\\'etrie du tore. Enfin nous d\\'ecrivons toutes les solutions du syst\\`eme d'\\'equations de Ginzburg-Landau dans la limite $k$ tend vers l'infini. Dans le dernier chapitre, nous donnons pour notre mod\\`ele la structure du diagramme des phases en pr\\'ecisant quelles r\\'egions sont normales, supraconductrices pure, mixte.

Mathieu Dutour

1999-12-15T23:59:59.000Z

47

NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Blog Archive Blog Archive NE Blog Archive RSS December 31, 2013 GIF Policy Group Meeting in Brussels, Belgium, November 2013 Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration The Generation IV International Forum (GIF) held its 36th Policy Group (PG) meeting on November 21-22 in Brussels, Belgium. The PG reviewed progress on a number of on-going actions and received progress reports from the GIF Experts Group (EG) and the GIF Senior Industry Advisory Panel (SIAP). December 12, 2013 The basics of small modular reactor technology explained. | Infographic by Sarah Gerrity, Energy Department. Advancing Small Modular Reactors: How We're Supporting Next-Gen Nuclear

48

Microsoft PowerPoint - NE- Milton  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

University University Program (NEUP) Presentation to Vice Presidents of Research and Development of Historically Black Colleges and Universities Ingrid M. Milton Department of Energy Office of Nuclear Energy July 9, 2009 195725 (2) Overview The Office of Nuclear Energy (NE) is committed to strengthening the Nation's educational programs in nuclear science and engineering. * Established the Nuclear Energy University Program (NEUP). * Award grants and contracts through competitive selection process. NEUP enables universities to maintain and expand their nuclear science curriculum and programs to ensure future availability of technical experts for U.S. nuclear programs. * NEUP is managed by the Center for Advanced Energy Studies (CAES). 2 195725 (3) Nuclear Energy University Program -

49

SeTES: A self-teaching expert system for the analysis, design, and prediction of gas production from unconventional gas resources  

Science Conference Proceedings (OSTI)

SeTES is a self-teaching expert system that (a) can incorporate evolving databases involving any type and amount of relevant data (geological, geophysical, geomechanical, stimulation, petrophysical, reservoir, production, etc.) originating from unconventional ... Keywords: Bayesian networks, Expert system, Machine learning, Optimization, Simulation, Unconventional gas

George J. Moridis, Matthew T. Reagan, Heidi Anderson Kuzma, Thomas A. Blasingame, Y. Wayne Huang, Ralph Santos, Katie L. Boyle, Craig M. Freeman, Dilhan Ilk, Manuel Cossio, Srimoyee Bhattacharya, Michael Nikolaou

2013-08-01T23:59:59.000Z

50

Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

9% L'Enfam Plaza, S, W.. Warhin@on, D.C. 2002ijl74j Tekphow (202) 488ddO 9% L'Enfam Plaza, S, W.. Warhin@on, D.C. 2002ijl74j Tekphow (202) 488ddO 7117-03.87.cdy.'i3 23 September 1967 ~ s ~ Mr. Andrew Wallo, III, NE-23 Oivision of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND IJNIVFRSITIES , The attached elimination reconnnendation was prepar!ad in accordance with your suggestion during our meeting on 22 September! The recommendation includes 26 colleges and universities identified,in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated 27 May 1987; three institutions (Tufts College, University of Virginia, and the University of Washington) currently identified!on ithe FUSRAP list of sites under consideration; and six institutions recently iden-

51

REPLY TO ATTN OF NE-301  

Office of Legacy Management (LM)

N\I&?' d,' g N\I&?' d,' g 4 DATE. fdov 2 5 1980 REPLY TO ATTN OF NE-301 .* - memoraadu SUBJECT Remedial Action for Linde Air Products Plant, Tonawanda, New York TO W. E. Mott, EV In view of the General Counsel's reconsideration of the authority to proceed with remedial action on this site and your determination that remedial action is needed to protect the public health and safety, we will include this site in our program for remedial action. of this memorandum. Oak Ridge is requested to do so by copy I am somewhat surprised at the urgency of remedial action which you implied in your memorandum since your previous memorandum designating this site stated that it has a low priority. The site radiological survey report DOE/EV-005/5 concludes that air and water contamination were below the non-occupational

52

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Press Releases Press Releases NE Press Releases RSS December 12, 2013 Energy Department Announces New Investment in Innovative Small Modular Reactor The Energy Department tannounced an award to NuScale Power LLC to support a new project to design, certify and help commercialize innovative small modular reactors in the United States. November 12, 2013 Public Invited to Comment on Draft Environmental Assessment for the Resumption of Transient Testing of Nuclear Fuels and Materials The U.S. Department of Energy invites the public to read and comment on a draft environmental assessment it has prepared for a proposal to resume transient testing of nuclear fuels and materials at either Idaho National Laboratory (INL) or Sandia National Laboratories (SNL). November 4, 2013 Factsheet: Second Meeting of the United States-Japan Bilateral Commission

53

Notices 888 First Street, NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 Federal Register 11 Federal Register / Vol. 76, No. 122 / Friday, June 24, 2011 / Notices 888 First Street, NE., Washington, DC 20426. The filings in the above-referenced proceeding are accessible in the Commission's eLibrary system by clicking on the appropriate link in the above list. They are also available for review in the Commission's Public Reference Room in Washington, DC. There is an eSubscription link on the Web site that enables subscribers to receive e-mail notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please e-mail FERCOnlineSupport@ferc.gov or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Dated: June 20, 2011. Kimberly D. Bose, Secretary. [FR Doc. 2011-15859 Filed 6-23-11; 8:45 am]

54

Notices 888 First Street NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

53 Federal Register 53 Federal Register / Vol. 78, No. 56 / Friday, March 22, 2013 / Notices 888 First Street NE., Washington, DC 20426. This filing is accessible on-line at http://www.ferc.gov, using the ''eLibrary'' link and is available for review in the Commission's Public Reference Room in Washington, DC. There is an ''eSubscription'' link on the Web site that enables subscribers to receive email notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please email FERCOnlineSupport@ferc.gov, or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Comment Date: 5:00 p.m. Eastern Time on April 2, 2013. Dated: March 15, 2013. Kimberly D. Bose, Secretary. [FR Doc. 2013-06602 Filed 3-21-13; 8:45 am] BILLING CODE 6717-01-P

55

Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

suite 7900,955 L%l/onr Plaza, S. W., Washingion, D.C. 20024.?174,, Telephone: (202) 488.~ suite 7900,955 L%l/onr Plaza, S. W., Washingion, D.C. 20024.?174,, Telephone: (202) 488.~ Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 7117~03.87.dy.43 23 September 1987 I j / Dear Mr. Wallo: I ELIMINATION RECOMMENDATION -- COLLEGES AND UN&ITIES I . The attached elimination recommendation was prepared in accordance with your suggestion during our meeting on 22 September!. The recommend includes 26 colleges and universities identified,in Enclosure 4 to Aerospace letter subject: Status of Actions 27 May 1987; three institutions (Tufts and the University of Washington) currently list of sites under consideration; and six institutions tified during a search of Hanford records.

56

M r. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

300.955 L*Enfom Plaza, S. Iv.. Washrhington. D.C. 200242174, Tekphonc (202) 300.955 L*Enfom Plaza, S. Iv.. Washrhington. D.C. 200242174, Tekphonc (202) 7117-03.87.cdy.43 23 September 1987 M r. Andrew Wallo, III, NE-23 Division of Facility & Site Deconnnissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear M r. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES The attached elimination recommendation was prepared in accordi with your suggestion during our meeting on 22 September. The reconu includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Sites List, da: 27 May 1987; three institutions.(Tufts College, University of Virgil and the University of Washington) currently identified'on the FUSFN list of sites under consideration; and six.institutions recently idI

57

MiniBooNE Oscillation Results 2011  

SciTech Connect

The MiniBooNE neutrino oscillation search experiment at Fermilab has recently updated results from a search for {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations, using a data sample corresponding to 8.58 x 10{sup 20} protons on target in anti-neutrino mode. This high statistics result represent an increase in statistics of 52% compared to result published in 2010. An excess of 57.7 {+-} 28.5 events is observed in the energy range 200 MeV < E{sub {nu}} < 3000 MeV. The data favor LSND-like {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations over a background only hypothesis at 91.1% confidence level in the energy range 475 < E{sub {nu}} < 3000 MeV.

Djurcic, Zelimir

2012-01-01T23:59:59.000Z

58

NE-23 List of California Sites NE-23 Hattie Car-well, SAN/NSQA Division  

Office of Legacy Management (LM)

NE-23 NE-23 Hattie Car-well, SAN/NSQA Division Attached for your information is the list of California sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified"fbr'FUSRAP:'~- The only site in California,that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Prcgram are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on the list, please call me at FTS 233-5439. /ct( Andrew Walls III. Desiynation and Certification Manager

59

Version 1.0 Lithium hyper ne splitting  

E-Print Network (OSTI)

Version 1.0 Lithium hyper#12;ne splitting Krzysztof Pachucki #3; Institute of Theoretical Physics approach for the calculation of relativistic m#11; 6 corrections to the lithium ground state hyper#12;ne problem. We will concentrate on lithium as the simplest alkali-metal atom, for which several precise

Pachucki, Krzysztof

60

Traffic Flow Measurement: Experiences with NeTraMet  

Science Conference Proceedings (OSTI)

This memo records experiences in implementing and using the Traffic Flow Measurement Architecture and Meter MIB. It discusses the implementation of NeTraMet (a traffic meter) and NeMaC (a combined manager and meter reader), considers the writing of ...

N. Brownlee

1997-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Nuclear deformation of {sup 20}Ne from {sup 20}Ne(105 MeV)+{sup 208}Pb scattering  

Science Conference Proceedings (OSTI)

We have measured differential cross section for quasielastic scattering of {sup 20}Ne+{sup 208}Pb at a lab energy of 105 MeV. The data are analyzed by a rotational-model coupled-channels calculation including the 0{sup +} ground state, 2{sup +} and 4{sup +} states of {sup 20}Ne.

Strojek, I.; Czarnacki, W.; Keeley, N. [Department of Nuclear Reaction, The Andrzej Soltan Institute for Nuclear Studies, 00681 Warsaw (Poland); Kisielinski, M.; Piasecki, E.; Rusek, K. [Department of Nuclear Reaction, The Andrzej Soltan Institute for Nuclear Studies, 00681 Warsaw (Poland); Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Kliczewski, S.; Siudak, R. [Niewodniczanski Institute of Nuclear Physics PAN, 31342 Cracow (Poland); Kordiasz, A.; Trzcinska, A. [Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Koshchiy, E. [V. N. Karazin Kharkiv National University, 61077 Kharkiv (Ukraine); Kowalczyk, M. [Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Faculty of Physics, Warsaw University, 00681 Warsaw (Poland); Piorkowska, A.; Stuad, A. [University of Silesia, 40007 Katowice (Poland)

2010-04-26T23:59:59.000Z

62

CA Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

?9OQ, 95.5 L'E&nt Plaza, SW.. W.ashin@.m, D.C. 20024.2174, Tekphone: (202) 488AQOO ?9OQ, 95.5 L'E&nt Plaza, SW.. W.ashin@.m, D.C. 20024.2174, Tekphone: (202) 488AQOO 7117-03.B7.cdy.43 23 September 1987 CA Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Oepartment of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES zh/ ! o-01 lM!tl5 ML)!o-05 PI 77!0> The attached elimination recoannendation was prepared in accordance . -1 rlL.0~ with your suggestion during our meeting on 22 September. The recommendation flD.o-02 includes 26 colleges and universities identified~in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated MO.07. 27 May 1987; three institutions (Tufts College, University of Virginia, UCIIOJ and the University of Washington) currently identified on the FUSRAP

63

Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

300, 955 L'E~~MI Phm.SW.:. Washin@on. LX. 200242174, T~kphonc(202)48ll. 5 300, 955 L'E~~MI Phm.SW.:. Washin@on. LX. 200242174, T~kphonc(202)48ll. 5 7117-03.87.cdy.43 23 September 1987 cA Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES M/).0-05 pl 0.0% The attached elimination recommendation was prepared in accordance ML.05 with your suggestion during our meeting on 22 September. The recommendation flD.o-02 includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated NO.03. 27 May 1987; three institutions (Tufts College, University of Virginia, rJc..of and the University of Washington) currently identified on the FUSRAP

64

Pion inelastic scattering from sup 20 Ne  

SciTech Connect

Angular distributions for {sup 20}Ne({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime}) were measured on the Energetic Pion Channel and Spectrometer (EPICS) at the Clinton P. Anderson Meson Physics Facility (LAMPF). Data were taken with both {pi}{sup {plus}} and {pi}{sup {minus}} over an angular range of 12{degree} to 90{degree} for T{sub {pi}}=180 MeV and with {pi}{sup +} from 15{degree} to 90{degree} for T{sub {pi}}=120 MeV. The data were analyzed using both the distorted-wave impulse approximation (DWIA) and the coupled-channels impulse approximation (CCIA) with collective transition densities. In addition, microscopic transition densities were used in the DWIA analysis for states in the lowest rotational bands. The transitions to the 6.73-MeV 0{sup +} and several 1{sup {minus}} states, including the states at 5.79 MeV and 8.71 MeV, were studied using several models for the transition density. Strong evidence for the importance of two-step routes in pion inelastic scattering was seen in several angular distributions, including the 5.79-MeV 1{sup {minus}}, the first three 4{sup +} states, and the 8.78-MeV 6{sup +}. 100 refs., 81 figs., 33 tabs.

Burlein, M. (Pennsylvania Univ., Philadelphia, PA (USA). Dept. of Physics)

1989-12-01T23:59:59.000Z

65

Property:EIA/861/IsoNe | Open Energy Information  

Open Energy Info (EERE)

IsoNe IsoNe Jump to: navigation, search Property Name ISO_NE Property Type Boolean Description Indicates that the organization conducts operations in the New England ISO region [1] References ↑ "EIA Form EIA-861 Final Data File for 2010 - 861 Webfile Layout for 2010.doc" Pages using the property "EIA/861/IsoNe" Showing 25 pages using this property. (previous 25) (next 25) B Bangor Hydro-Electric Co + true + Barton Village, Inc (Utility Company) + true + Bozrah Light & Power Company + true + C Central Maine Power Co + true + Central Vermont Pub Serv Corp + true + CinCap IV, LLC + true + CinCap V LLC + true + Cinergy Capital & Trading, Inc + true + City of Chicopee, Massachusetts (Utility Company) + true + City of Holyoke, Massachusetts (Utility Company) + true +

66

Neutral Current Elastic Interactions in MiniBooNE  

SciTech Connect

Neutral Current Elastic (NCE) interactions in MiniBooNE are discussed. In the neutrino mode MiniBooNE reported: the flux averaged NCE differential cross section as a function of four-momentum transferred squared, an axial mass (M{sub A}) measurement, and a measurement of the strange quark spin content of the nucleon, {Delta}s. In the antineutrino mode we present the background-subtracted data which is compared with the Monte Carlo predictions.

Dharmapalan, Ranjan; /Alabama U.

2011-10-01T23:59:59.000Z

67

D:\NE WEB Sites\NE\nerac\nov2001minutes.wpd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 5-6, 2001, DoubleTree Hotel, Arlington, Virginia November 5-6, 2001, DoubleTree Hotel, Arlington, Virginia NERAC members present: John Ahearne Robert Long Joseph Comfort Warren F. Miller, Jr. Michael L. Corradini Benjamin F. Montoya Jose Luis Cortez Sekazi Mtingwa Allen Croff Lura Powell James Duderstadt (Chair) Richard Reba Marvin Fertel Joy Rempe Beverly Hartline John Taylor Andrew Klein Charles E. Till Dale Klein (Monday only) Neil Todreas NERAC members absent: Thomas Cochran Allen Sessoms Maureen S. Crandall Daniel C. Sullivan Steve Fetter C. Bruce Tarter Leslie Hartz Ashok Thadani (ad hoc) J. Bennett Johnston Joan Woodard Linda C. Knight Also present: Robert Card, Under Secretary, USDOE Nancy Carder, NERAC Staff Charles Forsberg, Researcher, Oak Ridge National Laboratory Norton Haberman, Senior Technical Advisor, NE, USDOE

68

An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne  

Open Energy Info (EERE)

Page Page Edit History Facebook icon Twitter icon » An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne Portugal) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne Portugal) Details Activities (0) Areas (0) Regions (0) Abstract: In an attempt to define the resistivity model of the Chaves geothermal field in NE Portugal, a detailed survey with scalar audiomagnetotelluric measurements was performed. The soundings were made in the frequency range from 2300 to 4.1 Hz. Electrical resistivity models were derived from the application of 1-D inversion, 2-D trial and error modeling and 2-D inversion procedures. The resistivities inside the geothermal field are low, reaching not more than 30 Ωm and increasing up to 60-150 Ωm

69

Municipal Energy Agency of NE | Open Energy Information  

Open Energy Info (EERE)

Municipal Energy Agency of NE Municipal Energy Agency of NE Jump to: navigation, search Name Municipal Energy Agency of NE Place Nebraska Utility Id 21352 Utility Location Yes Ownership P NERC Location MRO NERC MRO Yes NERC SPP Yes NERC WECC Yes RTO SPP Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from

70

19Ne levels studied with the 18F(d,n)19Ne*(18F+p) reaction  

Science Conference Proceedings (OSTI)

A good understanding of the level structure of 19Ne around the proton threshold is critical to estimating the destruction of long-lived 18F in novae. Here we report the properties of levels in 19Ne in the excitation energy range of 6.9 Ex 8.4 MeV studied via the proton-transfer 18F(d, n)Ne reaction at the Holifield Radioactive Ion Beam Facility. The populated 19Ne levels decay by breakup into p + 18F and + 15O particles. The results presented in this manuscript are those of levels that are simultaneously observed from the breakup into both channels. An s-wave state is observed at 1468 keV above the proton threshold, which is a potential candidate for a predicted broad J = 1/2+ state. The proton and partial widths are deduced to be p = 228 50 keV and = 130 30 keV for this state.

Adekola, A. S. [Ohio University, Athens; Brune, C. R. [Ohio University; Bardayan, Daniel W [ORNL; Blackmon, Jeffery C [Louisiana State University; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Cizewski, J. A. [Rutgers University; Jones, K. L. [University of Tennessee, Knoxville (UTK); Kozub, R. L. [Tennessee Technological University; Massey, T. [Ohio University; Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; ShrinerJr., J. F. [Tennessee Technological University; Smith, Michael Scott [ORNL; Thomas, J. S. [Rutgers University

2012-01-01T23:59:59.000Z

71

MiniBooNE "Windows on the Universe"  

Science Conference Proceedings (OSTI)

Progress in the last few decades has left neutrino physics with several vexing issues. Among them are the following questions: (1) Why are lepton mixing angles so different from those in the quark sector? (2) What is the most probable range of the reactor mixing angle? (3) Is the atmospheric mixing angle maximal? (4) What is the number of fermion generations? These are some of the issues that neutrino science hopes to study; this article will explore these questions as part of a more general scientific landscape, and will discuss the part MiniBooNE might play in this exploration. We discuss the current state of measurements taken by MiniBooNE, and emphasize the uniqueness of neutrino oscillations as an important probe into the 'Windows on the Universe.'

Stefanski, Ray; /Fermilab

2010-12-09T23:59:59.000Z

72

File:EIA-Williston-NE-Gas.pdf | Open Energy Information  

Open Energy Info (EERE)

Williston-NE-Gas.pdf Williston-NE-Gas.pdf Jump to: navigation, search File File history File usage Williston Basin, Northeast Part By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.95 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

73

Overview of DOE-NE Proliferation and Terrorism Risk Assessment  

SciTech Connect

Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism. The goal is to enable the use of risk information to inform NE R&D program planning. The PTRA program supports DOE-NE's goal of using risk information to inform R&D program planning. The FY12 PTRA program is focused on terrorism risk. The program includes a mix of innovative methods that support the general practice of risk assessments, and selected applications.

Sadasivan, Pratap [Los Alamos National Laboratory

2012-08-24T23:59:59.000Z

74

Neutrino and Antineutrino Cross sections at MiniBooNE  

SciTech Connect

The MiniBooNE experiment has reported a number of high statistics neutrino and anti-neutrino cross sections -among which are the charged current quasi-elastic (CCQE) and neutral current elastic (NCE) neutrino scattering on mineral oil (CH2). Recently a study of the neutrino contamination of the anti-neutrino beam has concluded and the analysis of the anti-neutrino CCQE and NCE scattering is ongoing.

Dharmapalan, Ranjan; /Alabama U.

2011-10-01T23:59:59.000Z

75

Ne IX emission-line ratios in solar active regions  

Science Conference Proceedings (OSTI)

Emission-line ratios for Ne IX are derived and compared with observational data for solar active regions obtained with the SOLEX B spectrometer on the P78-1 satellite. Excellent agreement is obtained, providing support for the atomic data adopted in the calculations and resolving discrepancies between existing theoretical calculations and solar data. The calculated R-ratio for the low-density limit agrees well with the SOLEX observations. 47 references.

Keenan, F.P.; Mccann, S.M.; Kingston, A.E.; Mckenzie, D.L.

1987-07-01T23:59:59.000Z

76

Vanishing N=20 Shell Gap: Study of Excited States in {sup 27,28}Ne  

Science Conference Proceedings (OSTI)

This Letter reports on the {sup 1}H({sup 28}Ne,{sup 28}Ne) and {sup 1}H({sup 28}Ne,{sup 27}Ne) reactions studied at intermediate energy using a liquid hydrogen target. From the cross section populating the first 2{sup +} excited state of {sup 28}Ne, and using the previously determined B(E2) value, the neutron quadrupole transition matrix element has been calculated to be M{sub n}=13.8{+-}3.7 fm{sup 2}. In the neutron knockout reaction, two low-lying excited states were populated in {sup 27}Ne. Only one of them can be interpreted by the sd shell model while the additional state may intrude from the fp shell. These experimental observations are consistent with the presence of fp shell configurations at low excitation energy in {sup 27,28}Ne nuclei caused by a vanishing N=20 shell gap at Z=10.

Dombradi, Zs.; Fueloep, Zs. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, Debrecen, H-4001 (Hungary); Elekes, Z. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, Debrecen, H-4001 (Hungary); Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Saito, A.; Baba, H.; Demichi, K.; Gomi, T.; Hasegawa, H.; Kanno, S.; Kawai, S.; Kurita, K.; Matsuyama, Y.; Sakai, H.K.; Takeshita, E.; Togano, Y.; Yamada, K. [Rikkyo University, 3 Nishi-Ikebukuro, Toshima, Tokyo 171 (Japan); Aoi, N.; Ishihara, M.; Kishida, T.; Kubo, T. [Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)] (and others)

2006-05-12T23:59:59.000Z

77

2013 Annual DOE-NE Materials Research Coordination Meeting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting The Reactor Materials element of the Nuclear Energy Enabling Technologies (NEET) program conducted its FY 2013 coordination meeting as a series of four web-conferences to act as a forum for the nuclear materials research community. The purpose of this meeting was to report on current and planned nuclear materials research, identify new areas of collaboration and promote greater coordination among the various Office of Nuclear Energy (NE) programs. Currently, materials research is performed in several NE programs, including NE Advanced Modeling and Simulation (NEAMS), Fuel Cycle Research and Development (FCRD), Advanced Reactor Technologies

78

2013 Annual DOE-NE Materials Research Coordination Meeting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting The Reactor Materials element of the Nuclear Energy Enabling Technologies (NEET) program conducted its FY 2013 coordination meeting as a series of four web-conferences to act as a forum for the nuclear materials research community. The purpose of this meeting was to report on current and planned nuclear materials research, identify new areas of collaboration and promote greater coordination among the various Office of Nuclear Energy (NE) programs. Currently, materials research is performed in several NE programs, including NE Advanced Modeling and Simulation (NEAMS), Fuel Cycle Research and Development (FCRD), Advanced Reactor Technologies

79

R-Process in Collapsing O/Ne/Mg Cores  

E-Print Network (OSTI)

Several circumstantial arguments point to the formation of the third r-process peak at A about 190, near platinum, in stars of mass of about 8-10 solar masses: 1) The delayed production of europium with respect to iron imposes a time scale that restricts the progenitor stars to less than about 10 solar masses; 2) the r-process demands a dominant robust mechanism at least for barium and above, since the relative abundance pattern of those r-process elements in low-metallicity stars is consistent with the solar pattern; 3) stars of about 8-10 solar masses produce nearly identical degenerate O/Ne/Mg cores that collapse due to electron capture; and 4) the resulting low-mass cores may produce both an r-process in a prompt explosion and a subsequent r-process in a neutrino driven wind. The prompt explosion of an O/Ne/Mg core yields low entropy and low electron fraction, and hence may produce a reasonable r-process peak at A about 190 as well as all of the r-process elements with Z greater than 56. The possible diff...

Wheeler, J C; Hillebrandt, W; Cowan, John J.; Hillebrandt, Wolfgang

1997-01-01T23:59:59.000Z

80

R-Process in Collapsing O/Ne/Mg Cores  

E-Print Network (OSTI)

Several circumstantial arguments point to the formation of the third r-process peak at A about 190, near platinum, in stars of mass of about 8-10 solar masses: 1) The delayed production of europium with respect to iron imposes a time scale that restricts the progenitor stars to less than about 10 solar masses; 2) the r-process demands a dominant robust mechanism at least for barium and above, since the relative abundance pattern of those r-process elements in low-metallicity stars is consistent with the solar pattern; 3) stars of about 8-10 solar masses produce nearly identical degenerate O/Ne/Mg cores that collapse due to electron capture; and 4) the resulting low-mass cores may produce both an r-process in a prompt explosion and a subsequent r-process in a neutrino driven wind. The prompt explosion of an O/Ne/Mg core yields low entropy and low electron fraction, and hence may produce a reasonable r-process peak at A about 190 as well as all of the r-process elements with Z greater than 56. The possible differences in the neutrino-driven wind and associated r-process due to the low-mass neutron stars expected in this mass range are also discussed.

J. Craig Wheeler; John J. Cowan; Wolfgang Hillebrandt

1997-11-22T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

A Case Study For Geothermal Exploration In The Ne German Basin...  

Open Energy Info (EERE)

icon Twitter icon A Case Study For Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And...

82

Idaho National Laboratory DOE-NE's National Nuclear Capability-  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4-2023 4-2023 Idaho National Laboratory DOE-NE's National Nuclear Capability- Developing and Maintaining the INL Infrastructure TEN-YEAR SITE PLAN DOE/ID-11474 Final June 2012 Sustainable INL continues to exceed DOE goals for reduction in the use of petroleum fuels - running its entire bus fleet on biodiesel while converting 75% of its light-duty fleet to E85 fuel. The Energy Systems Laboratory (ESL), slated for completion this year, will be a state-of-the-art laboratory with high-bay lab space where leading bioenergy feedstock processing, advanced battery testing, and hybrid energy systems integration research will be conducted. The Advanced Test Reactor is the world's most advanced nuclear research capability - crucial to (1) the ongoing development of safe, efficient

83

NE-24 Unlverslty of Chicayo Remedial Action Plan  

Office of Legacy Management (LM)

(YJ 4 tlsj .?I2 (YJ 4 tlsj .?I2 416 17 1983 NE-24 Unlverslty of Chicayo Remedial Action Plan 22&d 7 IA +-- E. I.. Keller, Director Technical Services Division Oak Ridge Operations Ufflce In response to your memorandum dated July 29, 1983, the Field Task Proposal/Agreement (FTP/A) received frw Aryonne National Laboratory (ANL) appears to be satisfactory, and this office concurs in the use of ANL to provide the decontamination effort as noted in the FTP/A. The final decontaminatton report should Include the data needed for certiff- cation of the cleanup and any contamination left In place, e.g., sewer lines should be so documented in the permanent records of the University as well as the certification documents and reports. The remedial action to be conducted appears to be clearly InsIgnifIcant from an environmental

84

Participants: William Naughton, COHMED Bill Sherman, NE HLRW Task Force  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

conference call May 27, 1998 conference call May 27, 1998 Participants: William Naughton, COHMED Bill Sherman, NE HLRW Task Force Bob Fronczak, AAR Mike Butler, UETC Ray English, DOE-NR George Ruberg, UETC Kevin Blackwell, FRA Markus Popa, DOE-RW Sandy Covi, UP The Rail Topic Group is currently in a transitional mode, moving simultaneously toward closure of the two rail information matrices, Comparison of CVSA Recommended National Procedures and Out-Of-Service Criteria for the Enhanced Safety Inspection of Commercial Highway Vehicles Transporting Transuranics, Spent Nuclear Fuel, and High Level Waste to Rail Inspection Standards, and Rail and Highway Regulations Relative to the Transportation of Radioactive Materials and their Applicability to States, Tribes, Shippers, and Carriers, (both

85

EG&G SURVEY REPORT NE-F-003  

Office of Legacy Management (LM)

EBJG EBJG -ENERGY MEASUREMENTS GROUP EG&G SURVEY REPORT NE-F-003 FEBRUARY 1983 NJT& THE REMOTE SENSING lRtlORlllORY OF THE UNITED STATES DEPARTMENT OF ENERGY AN AERIAL RADIOLOGICAL SURVEY OF AN AREA SURROUNDING THE FORMER M IDDLESEX SAMPLING PLANT IN M IDDLESEX, N E W JERSEY DATE OF SURVEY: M A Y 1978 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or

86

PNM Resources 2401 Aztec NE, MS-Z100  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PNM Resources PNM Resources 2401 Aztec NE, MS-Z100 Albuquerque, NM 87107 505-241-2025 Fax 505 241-2384 PNMResources.com October 29, 2013 Mr. Christopher Lawrence Office of Electricity Delivery and Energy Reliability (OE-20) U.S. Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Submitted electronically via email to: Christopher.Lawrence@hq.doe.gov Dear Mr. Lawrence: Subject: Department of Energy (DOE)- Improving Performance of Federal Permitting and Review of Infrastructure Projects, Request for Information, 78 Fed. Reg. 53436 (Aug. 29, 2013) PNM Resources (PNMR) is an energy holding company with 2012 consolidated operating revenues of $1.3 billion. Through its regulated utilities, PNM and TNMP, PNMR serves electricity to more than 739,000 homes and businesses in New

87

CA M r. Andrew Wallo, III. NE-23  

Office of Legacy Management (LM)

i5W 95.5 L' i5W 95.5 L' E&nt plom. S. W.:. Washingr on. D.C. ZOOX2i74, Tekphm: (202) 488-6OGb 7II7-03.87.cdy.43 23 September 1987. Ii CA M r. Andrew Wallo, III. NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear M r. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES pqq.0' 05 PI ;p.03- The attached elimination recommendation was prepared in accordance ,I ML.05 with your suggestion during our meeting on 22 September. The recommendation flO.O-02 includes 26 colleges and universities identified in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated 27 May 1987; three institutions (Tufts College, University of Virginia, and the University of Washington) currently identified on the FUSRAP

88

The DA{Phi}NE beam position monitors  

SciTech Connect

The beam diagnostics network of DA{Phi}NE, the Frascati {Phi}-factory, includes more than 110 beam position monitors divided between button monitors and striplines. The shape of the vacuum chamber changes along the accelerator implying several different geometries for these monitors. Moreover, in the two interaction regions of the collider where the electron and positron beams pass into the same chamber, a six-button configuration has been used. A bench calibration of each family of BPMs and striplines is being performed. A polynomial correction function has been derived by fitting the calibration results. An analytical-numerical analysis of the buttons` geometry has been done in order to compare the experimental with the theoretical results. {copyright} {ital 1997 American Institute of Physics.}

Ghigo, A.; Sannibale, F.; Serio, M.; Vaccarezza, C. [INFN Laboratori Nazionali di Frascati-00044 Frascati (Roma)-Italy

1997-01-01T23:59:59.000Z

89

Charged-Current Interaction Measurements in MiniBooNE  

SciTech Connect

Neutrino oscillation is the only known phenomenon for physics beyond the standard model. To investigate this phenomenon, the understanding of low energy neutrino scattering (200NE finds that a simple Fermi gas model, with appropriate adjustments, accurately characterizes the CCQE events on carbon. The extracted parameters include an effective axial mass, MA=1.23 {+-} 0.20 GeV, and a Pauli-blocking parameter, kappa = 1.019 {+-} 0.011.

Katori, Teppei; /Indiana U.

2007-09-01T23:59:59.000Z

90

Microsoft PowerPoint - NEAC Battelle NE Capabilities 062408.ppt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R&D Facility Requirements NEAC Meeting Progress Report June 24, 2008 2 Facilitization of U.S. Nuclear R&D Infrastructure Three-step study process: * First, ASNE requested Battelle Memorial Institute to develop Industry- and-University-supported list of capabilities and facilities necessary to conduct a comprehensive nuclear R&D program. (Draft, June 12, 2008) * Second, INL, using input from all DOE and other sources, will determine current facilities and their condition and availability to support next 20 years of nuclear R&D. (Draft, June 30, 2008) * Third, recommendations will be made on priorities and on existing facilities to be maintained/preserved or otherwise supported by NE regardless of location or ownership. (Executive Team Meeting, July 1, 2008)

91

EA-1909: South Table Wind Project, Kimball County, NE | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

09: South Table Wind Project, Kimball County, NE 09: South Table Wind Project, Kimball County, NE EA-1909: South Table Wind Project, Kimball County, NE Summary DOE's Western Area Power Administration is preparing this EA to evaluate the environmental impacts of interconnecting the proposed South Table Wind Project, which would generate approximately 60 megawatts from about 40 turbines, to Western's existing Archer-Sidney 115-kV Transmission Line in Kimball County, Nebraska. Public Comment Opportunities None available at this time. Documents Available for Download August 28, 2012 EA-1909: Finding of No Significant Impact South Table Wind Project, Kimball County, NE July 16, 2012 EA-1909: Final Environmental Assessment South Table Wind Project, Kimball County, NE February 29, 2012 EA-1909: Draft Environmental Assessment

92

The MiniBooNE detector technical design report  

SciTech Connect

The MiniBooNE experiment [1] is motivated by the LSND observation, [2] which has been interpreted as {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, and by the atmospheric neutrino deficit, [3,4,5] which may be ascribed to {nu}{sub {mu}} oscillations into another type of neutrino. MiniBooNE is a single-detector experiment designed to: obtain {approx} 1000 {nu}{sub {mu}} {yields} {nu}{sub e} events if the LSND signal is due to {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, establishing the oscillation signal at the > 5{sigma} level as shown in Fig. 1.1; extend the search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations significantly beyond what has been studied previously if no signal is observed; search for {nu}{sub {mu}} disappearance to address the atmospheric neutrino deficit with a signal that is a suppression of the rate of {nu}{sub {mu}}C {yields} {mu}N events from the expected 600,000 per year; measure the oscillation parameters as shown in Fig. 1.2 if oscillations are observed; and test CP conservation in the lepton sector if oscillations are observed by running with separate {nu}{sub {mu}} and {bar {nu}}{sub {mu}} beams. The detector will consist of a spherical tank 6.1 m (20 feet) in radius, as shown in Fig. 1.3, that stands in a 45-foot diameter cylindrical vault. An inner tank structure at 5.75 m radius will support 1280 8-inch phototubes (10% coverage) pointed inward and optically isolated from the outer region of the tank. The tank will be filled with 807 t of mineral oil, resulting in a 445 t fiducial volume. The outer tank volume will serve as a veto shield for identifying particles both entering and leaving the detector with 240 phototubes mounted on the tank wall. Above the detector tank will be an electronics enclosure that houses the fast electronics and data acquisition system and a utilities enclosure that houses the plumbing, overflow tank, and calibration laser. The detector will be located {approx} 550 m from the Booster neutrino source. The neutrino beam, produced using 8 GeV protons from the Booster at FNAL, will consist of a target within a focusing system, followed by a {approx}50 m long pion decay volume. The low energy, high intensity and 1 {micro}s time-structure of a neutrino beam produced from the Booster beam are ideal for this experiment. We assume that the Booster can reliably deliver protons for a typical run which is two-thirds of a calendar year. The sensitivities discussed above assume the experiment receives 5 x 10{sup 20} protons per year. This Booster experiment is compatible with the Fermilab collider and MI programs. The Booster must run at 7.5 Hz to accommodate the MiniBooNE and collider programs simultaneously. The current schedule calls for data-taking to begin by the end of calendar year 2001.

I. Stancu et al.

2003-04-18T23:59:59.000Z

93

CA CAIOlf Mr. Andrew Wallo. III, NE-23  

Office of Legacy Management (LM)

kire 7900. 955 L*E,,fa,u PLUG S. W.. Washin@ on. D.C. 20024-2174, Tekphme: (202) 488-6000 kire 7900. 955 L*E,,fa,u PLUG S. W.. Washin@ on. D.C. 20024-2174, Tekphme: (202) 488-6000 7117-03.87.cdy.43 23 September 1987 CA CAIOlf Mr. Andrew Wallo. III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 CT.05 FL .0-o/ lti.Ob id.Or Dear Mr. Wallo: In/. O-01 flA.05 ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES Mbj.o-03 I4 v.o+ The attached elimination recommendation was prepared in accordance ML.o= with your suggestion during our meeting on 22 September. The recommendation nO.O-02 includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated N0.63' 27 May 1987; three institutions (Tufts College, University of Virginia, kfC900

94

{sup 17}O({alpha},{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne for the weak s process  

Science Conference Proceedings (OSTI)

The ratio of the reaction rates of the competing channels {sup 17}O({alpha}{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne determines the efficiency of {sup 16}O as a neutron poison in the s process in low metallicity rotating stars. It has a large impact on the element production, either producing elements to the mass range of A=90 in case of a significant poisoning effect or extending the mass range up to the region of A=150 if the {gamma} channel is of negligible strength. We present an improved study of the reaction {sup 17}O({alpha},n){sup 20}Ne, including an independent measurement of the {sup 17}O({alpha},n{sub 1}){sup 20}Ne channel. A simultaneous R-Matrix fit to both the n{sub 0} and the n{sub 1} channels has been performed. New reaction rates, including recent data on the {sup 17}O({alpha},{gamma}){sup 21}Ne reaction, have been calculated and used as input for stellar network calculations and their impact on the s process in rotating massive stars is discussed.

Best, A.; Goerres, J.; Beard, M.; Couder, M.; Boer, R. de; Falahat, S.; Gueray, R. T.; Kontos, A.; Kratz, K.-L.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Oezkan, N.; Pignatari, M.; Sonnabend, K.; Talwar, R.; Tan, W.; Uberseder, E.; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States) and Department for Biogeochemistry, Max-Planck-Institute for Chemistry, 55020 Mainz (Germany); Department of Physics, Kacaeli University, Umuttepe 41380, Kocaeli (Turkey); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department for Biogeochemistry, Max-Planck-Institute for Chemistry, 55020 Mainz (Germany); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department of Physics, Kacaeli University, Umuttepe 41380, Kocaeli (Turkey); Department of Physics, University of Basel, Basel 4056 (Switzerland); Institute for Applied Physics, Goethe-University Frankfurt, 60325 Frankfurt (Germany); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States)

2012-11-20T23:59:59.000Z

95

Level-resolved R-matrix calculations for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}  

SciTech Connect

Large-scale R-matrix calculations are carried out for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}. For Ne{sup 3+}, a 581-LSJ-level R-matrix intermediate coupling frame transformation calculation is made for excitations up to the n=4 shell. For some transitions, large effective collision strength differences are found with current 23-jKJ-level Breit-Pauli R-matrix and earlier 22-LSJ-level R-matrix jj omega (JAJOM) calculations. For Ne{sup 6+}, a 171-jKJ-level Breit-Pauli R-matrix calculation is made for excitations up to the n=5 shell. For some transitions, large effective collision strength differences are found with current 46-jKJ-level Breit-Pauli R-matrix and earlier 46-LSJ-level R-matrix JAJOM calculations. Together with existing R-matrix calculations for other ion stages, high-quality excitation data are now available for astrophysical and laboratory plasma modeling along the entire Ne isonuclear sequence.

Ludlow, J. A.; Lee, T. G.; Ballance, C. P.; Loch, S. D.; Pindzola, M. S. [Department of Physics, Auburn University, Auburn, Alabama 36849 (United States)

2011-08-15T23:59:59.000Z

96

STATEM!NT''OF CONSIDEAAT10NS REQUEST n:~!:)lHi/",!!,'fCORPORArIQN FO~ ANADVANClWA1VER OF DOMESTIC AND FOREIGN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STATEM!NT''OF CONSIDEAAT10NS STATEM!NT''OF CONSIDEAAT10NS REQUEST n:~!:)lHi/",!!,'fCORPORArIQN FO~ ANADVANClWA1VER OF DOMESTIC AND FOREIGN DOE PROPOSAL NO.OE-EE0000412 W(A} 2009-:060 The OhlipC1'!ve of this project Is the and comt'nercialization of a two-phase soluttofrfQf USe with The 1 lM,C'l_""""P H'tn(;lPI'" PJJ1'l.nn""". refrig1':'rant tooling solution provides certain improvements compared to conventional air-<:ooling syslems and water-cooling systems, The totalantfetpated cost the is $901,678 with the Petitl(};l)er approximately 19.% cost sm:tre, $262,191. Thiswaive(is contingent upo.n the Petitioner rrH~intaining the foregoing cost over tneCQUfse the grant As in its wai'\l\;f petition, the ~etitfoner isa leading global supplier of air conditioning and

97

A Case Study For Geothermal Exploration In The Ne German Basin- Integrated  

Open Energy Info (EERE)

Geothermal Exploration In The Ne German Basin- Integrated Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: A Case Study For Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Details Activities (0) Areas (0) Regions (0) Abstract: Unavailable Author(s): K. Bauer, I. Moeck, B. Norden, A. Schulze, M. H. Weber Published: Publisher Unknown, 2009 Document Number: Unavailable DOI: Unavailable Retrieved from "http://en.openei.org/w/index.php?title=A_Case_Study_For_Geothermal_Exploration_In_The_Ne_German_Basin-_Integrated_Interpretation_Of_Seismic_Tomography,_Litho-Stratigraphy,_Salt_Tectonics,_And_Thermal_Structure&oldid=390106"

98

EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge May 18, 2010 - 7:30am Addthis While most college students' experience with vehicles goes no further than the beater they picked up for a few thousand dollars, students participating in the EcoCAR: The NeXT Challenge competition get to experience the cutting-edge of driving technology. The competition, which was established by the U.S. Department of Energy and General Motors, is a three year advanced vehicle engineering contest. Yesterday, May 17, was the first day of their Year 2 judging sessions. In EcoCAR, students from 16 universities across North America are competing against each other to build the most environmentally sustainable and practical vehicle. This year's teams have adopted a number of advanced

99

Towards a study of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction at LUNA  

SciTech Connect

The {sup 22}Ne(p,{gamma}){sup 23}Na reaction is a part of the hydrogen burning NeNa cycle. In second-generation stars hydrogen burning may proceed via this cycle. The rate of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction depends on the strength of several resonances in the energy range of the LUNA 400 kV accelerator which have never been observed in direct experiments. A related study is under preparation at LUNA.

Cavanna, Francesca; Depalo, Rosanna; Menzel, Marie-Luise [Dipartimento di fisica, Universita di Genova, and INFN Sezione di Genova, Genova (Italy); Dipartimento di fisica, Universita di Padova, and INFN Sezione di Padova, Padova (Italy); Helmholtz Zentrum Dresden-Rossendorf, Dresden (Germany); Collaboration: LUNA Collaboration

2012-11-20T23:59:59.000Z

100

Analysis of ISO NE Balancing Requirements: Uncertainty-based Secure Ranges for ISO New England Dynamic Inerchange Adjustments  

SciTech Connect

The document describes detailed uncertainty quantification (UQ) methodology developed by PNNL to estimate secure ranges of potential dynamic intra-hour interchange adjustments in the ISO-NE system and provides description of the dynamic interchange adjustment (DINA) tool developed under the same contract. The overall system ramping up and down capability, spinning reserve requirements, interchange schedules, load variations and uncertainties from various sources that are relevant to the ISO-NE system are incorporated into the methodology and the tool. The DINA tool has been tested by PNNL and ISO-NE staff engineers using ISO-NE data.

Etingov, Pavel V.; Makarov, Yuri V.; Wu, Di; Hou, Zhangshuan; Sun, Yannan; Maslennikov, S.; Luo, X.; Zheng, T.; George, S.; Knowland, T.; Litvinov, E.; Weaver, S.; Sanchez, E.

2013-01-31T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Microsoft PowerPoint - Freeze.NE PA Overview_052511.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Used Fuel Disposition Campaign Used Fuel Disposition Campaign Summary of DOE-NE PA Modeling for Storage and Disposal of Used Nuclear Fuel (UNF), High-Level Radioactive Waste (HLW), and Low-Level Waste (LLW) Geoff Freeze Sandia National Laboratories PA Community of Practice Technical Exchange May 25-26, 2011 Print Close Used Fuel Disposition 2 DOE-Nuclear Energy (NE) - PA Modeling Activities NE Advanced Modeling and Simulation (NEAMS) Waste Integrated Performance and Safety Codes (Waste IPSC) Used Fuel Disposition (UFD) Generic Performance Assessment Model (GPAM) *** Initial modeling focus in both campaigns in on UNF/HLW disposal Print Close Used Fuel Disposition 3  UFD GPAM  Short time horizon (2-3 yrs) - Simplified generic system models (i.e., PA-fidelity using GoldSim) - Current computing capabilities

102

Skåne County, Sweden: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Skåne County, Sweden: Energy Resources Skåne County, Sweden: Energy Resources Jump to: navigation, search Name Skåne County, Sweden Equivalent URI DBpedia GeoNames ID 3337385 Coordinates 55.98333°, 13.5° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.98333,"lon":13.5,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

103

DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE-NE Light Water Reactor Sustainability Program and EPRI DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's

104

DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE-NE Light Water Reactor Sustainability Program and EPRI DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's

105

ARM - Field Campaign - 1996 NARSTO Northeast Field Study (NARSTO-NE)  

NLE Websites -- All DOE Office Websites (Extended Search)

6 NARSTO Northeast Field Study (NARSTO-NE) 6 NARSTO Northeast Field Study (NARSTO-NE) Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : 1996 NARSTO Northeast Field Study (NARSTO-NE) 1996.07.01 - 1996.07.28 Lead Scientist : Larry Kleinman For data sets, see below. Description The DOE G-1 aircraft was deployed in the New York City metropolitan area as part of the North American Research Strategy for Tropospheric Ozone-Northeast effort to determine the causes of elevated ozone levels in the northeastern United States. Measurements of ozone, ozone precursors, and other photochemically active trace gases were made upwind and downwind of New York City with the objective of characterizing the ozone formation process and its dependence on ambient levels of NOx and volatile organic

106

Charged-Current Neutral Pion production at SciBooNE  

SciTech Connect

SciBooNE, located in the Booster Neutrino Beam at Fermilab, collected data from June 2007 to August 2008 to accurately measure muon neutrino and anti-neutrino cross sections on carbon below 1 GeV neutrino energy. SciBooNE is studying charged current interactions. Among them, neutral pion production interactions will be the focus of this poster. The experimental signature of neutrino-induced neutral pion production is constituted by two electromagnetic cascades initiated by the conversion of the {pi}{sup 0} decay photons, with an additional muon in the final state for CC processes. In this poster, I will present how we reconstruct and select charged-current muon neutrino interactions producing {pi}{sup 0}'s in SciBooNE.

Catala-Perez, J.; /Valencia U., IFIC

2009-10-01T23:59:59.000Z

107

First Direct Measurement of the {sup 17}F(p,{gamma}){sup 18}Ne Cross Section  

SciTech Connect

The rate of the {sup 17}F(p,{gamma}){sup 18}Ne reaction is important in various astrophysical events. A previous {sup 17}F(p,p){sup 17}F measurement identified a 3{sup +} state providing the strongest resonance contribution, but the resonance strength was unknown. We have directly measured the {sup 17}F(p,{gamma}){sup 18}Ne reaction using a mixed beam of {sup 17}F and {sup 17}O at ORNL. The resonance strength for the 3{sup +} resonance in {sup 18}Ne was found to be {omega}{gamma}=33{+-}14(stat){+-}17(syst) meV, corresponding to a {gamma} width of {gamma}{sub {gamma}}=56{+-}24(stat){+-}30(syst) meV. An upper limit on the direct capture of S(E){<=}65 keV b was determined at an energy of 800 keV.

Chipps, K. A.; Greife, U. [Colorado School of Mines, Golden, Colorado 80401 (United States); Bardayan, D. W.; Smith, M. S. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Blackmon, J. C. [Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Chae, K. Y.; Moazen, B. H.; Pittman, S. T. [University of Tennessee, Knoxville, Tennessee 37996 (United States); Hatarik, R.; Peters, W. A. [Rutgers University, New Brunswick, New Jersey 08901 (United States); Kozub, R. L.; Shriner, J. F. Jr. [Tennessee Technological University, Cookeville, Tennessee 38505 (United States); Matei, C. [Oak Ridge Associated Universities, Oak Ridge, Tennessee 37830 (United States); Nesaraja, C. D.; Pain, S. D. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); University of Tennessee, Knoxville, Tennessee 37996 (United States)

2009-04-17T23:59:59.000Z

108

N NE EX XT T G GE EN NE ER RA AT TI IO ON N S SA AF FE EG  

NLE Websites -- All DOE Office Websites (Extended Search)

NE NE EX XT T G GE EN NE ER RA AT TI IO ON N S SA AF FE EG GU UA AR RD DS S I IN NI IT TI IA AT TI IV VE E ( (N NG GS SI I) ) O OP PP PO OR RT TU UN NI IT TI IE ES S F FO OR R S ST TU UD DE EN NT TS S A AN ND D Y YO OU UN NG G P PR RO OF FE ES SS SI IO ON NA AL LS S I IN NT TE ER RE ES ST TE ED D I IN N S SA AF FE EG GU UA AR RD DS S/ /N NO ON NP PR RO OL LI IF FE ER RA AT TI IO ON N The Next Generation Safeguards Initiative (NGSI) was launched by the National Nuclear Security Administration (NNSA) in FY 2008 to develop the policies, concepts, technologies, expertise, and infrastructure necessary to strengthen and sustain the international safeguards system as it evolves to meet new challenges over the next 25 years. NGSI's Human Capital Development subprogram 1 aims to revitalize and expand the international safeguards human capital base in the United States by attracting, educating, training, and retaining

109

MiniBooNE as related to Windows on the Universe  

SciTech Connect

The measurement of absolute neutrino and anti-neutrino cross-sections, the observation of a 'low energy anomaly' in the neutrino sector, the constraints placed on the LSND effect by a non-observation of neutrino oscillations, the search for neutrino and anti-neutrino appearance, and for the possible existence of new heavy particles makes MiniBooNE a major contributor to the current view of the Universe. This paper addresses specific model constraints set by the MiniBooNE data, and explores expectations for further remaining analysis of the data.

Stefanski, Ray; /Fermilab

2009-12-01T23:59:59.000Z

110

apsdpp07_ver1.eps  

NLE Websites -- All DOE Office Websites (Extended Search)

Diagnostics using a Visible Transmission Grating Spectrometer at the Alcator C-Mod Tokamak Diagnostics using a Visible Transmission Grating Spectrometer at the Alcator C-Mod Tokamak 1 A. Graf, 2 M. May, 2 P. Beiersdorfer and 3 D. Whyte, 3 B. Labombard, 3 N. Smick, 3 K. Marr 1 University of California at Davis, One Shields Ave., Davis, CA; 2 Lawrence Livermore National Laboratory, 7000 East Ave., Livermore, CA 3 Plasma Science and Fusion Center, Massachusetts Institute of Technology, 190 Albany Ave. Cambridge, MA Abstract UCRL-POST-203859 Spectrometer Views A high throughput, f/# ~3.5, transmission grating spectrometer for visible light (3450-6700 Å) is being used to make localized measurements of bulk flow velocities and temperatures of impurity ions and deuterium atoms, in the edge and scrape of layer of the Alcator C-Mod tokamak. The flows and temperatures of the

111

S?paration, Relaxation, Approximation  

E-Print Network (OSTI)

... machine-produit ne soient. telles que les artes correspondantes se croisent. Si l'on num?rote les sommets de. haut en bas, c'est le cas des artes: (v. 2;v. 0.

112

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY  

E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew

113

Charged current single pion cross section measurement at MiniBooNE  

SciTech Connect

We present MiniBooNE's preliminary {nu}{sub {mu}} CC1{pi}{sup +} cross section measurement, calculated using the ratio of CC1{pi}{sup +} to CCQE events. We find the inclusive CC1{pi}{sup +} measurement to be below the nuance [1] and NEUGEN [2] expectations.

Wascko, M.O.; /Louisiana State U.

2006-02-01T23:59:59.000Z

114

A generic network interface architecture for a networked processor array (NePA)  

Science Conference Proceedings (OSTI)

Recently Network-on-Chip (NoC) technique has been proposed as a promising solution for on-chip interconnection network. However, different interface specification of integrated components raises a considerable difficulty for adopting NoC techniques. ... Keywords: interconnection network, multiprocessor systemon-chip (MPSoC), network interface, network-on-chip (NoC), networked processor array (NePA)

Seung Eun Lee; Jun Ho Bahn; Yoon Seok Yang; Nader Bagherzadeh

2008-02-01T23:59:59.000Z

115

THERMALIZATION OF THE ION KINETIC ENERGY IN A Ne GAS PUFF PINCH MODEL*  

E-Print Network (OSTI)

THERMALIZATION OF THE ION KINETIC ENERGY IN A Ne GAS PUFF PINCH MODEL* J. L. Giuliani, J. W Department of Energy/NNSA, Washington DC USA Full understanding of the dynamics, population kinetics, and energy budget of a K-shell radiating Z-pinch remains a challenging problem in high energy density plasma

116

Km3NeT, a Deep Sea Challenge for Neutrino Astronomy  

Science Conference Proceedings (OSTI)

The groups presently pursuing neutrino telescope projects in the Mediterranean Sea; ANTARES, NEMO, and NESTOR, have formed the new KM3NeT consortium to study the construction of a cubic kilometre-scale neutrino telescope for the Northern hemisphere. ...

Ciro Bigongiari

2007-10-01T23:59:59.000Z

117

Nonuniformity of CBF response to NE-or ANG II-induced hypertension in rabbits  

SciTech Connect

The regional response of brain vasculature to moderate hypertension was investigated using two hypertensive drugs, norepinephrine (NE) and angiotensin II (ANG II), infused intravenously at low concentrations (increase in blood pressure 15-40 mmHg). Regional cerebral blood flow (rCBF) was measured in unanesthetized and anesthetized rabbits using the (/sup 14/C)ethanol saturation technique. (1) In both groups of animals, NE and ANG II induced regional differences in the flow changes as compared with controls, confirming a regional (or segmental) heterogeneity in the regulatory mechanisms to hypertension. (2) The responses to identical rises in blood pressure (BP) in most of the structures analyzed depended on the drug used. In the unanesthetized rabbits, the increase in vascular resistance induced by NE was greater than that induced by ANG II. (3) With the two drugs, there was no correlation between the flow changes in any of the structures considered and either the BP increase or the BP level in unanesthetized animals. However, these flow changes were correlated with the BP increase in anesthetized animals, although differences between the effects of NE and ANG II were again observed. This study suggests that cerebrovascular regulatory mechanisms in hypertension are probably more complex than a simple myogenic reaction. Their heterogeneity and their dependence both on the cause of hypertension and on the presence of anesthetics suggest the intervention of an integrating pathway.

Reynier-Rebuffel, A.M.; Aubineau, P.; Issertial, O.; Seylaz, J.

1987-07-01T23:59:59.000Z

118

NE-Rank: A Novel Graph-Based Keyphrase Extraction in Twitter  

Science Conference Proceedings (OSTI)

The massive growth of the micro-blogging service Twitter has shed the light on the challenging problem of summarizing a collection of large number of tweets. This paper attempts to extract topical key phrases that would represent topics in tweets. Due ... Keywords: Keyphrase Extraction, Graph-based Ranking, Hashtag, Twitter, PageRank, TextRank, NE-Rank

Abdelghani Bellaachia; Mohammed Al-Dhelaan

2012-12-01T23:59:59.000Z

119

Zwischenbericht zum DFG-Forschungsvorhaben NE 902/2-1 SCHR 570/6-1  

E-Print Network (OSTI)

.3 Anwendungsperspektiven. . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 4 Arbeits- und Ergebnisbericht 10 4.3 Wissenschaftliche Mitarbeiter/in Dipl.-Ing. Vera Ebbing Besch¨aftigungszeitraum: seit 1. Oktober 2006 1.4 Fachgebiet;Zwischenbericht zum DFG-Forschungsvorhaben NE 902/2-1 SCHR 570/6-1 10 4 Arbeits- und Ergebnisbericht Basierend auf

Neff, Patrizio

120

Searches for New Physics at MiniBooNE: Sterile Neutrinos and Mixing Freedom  

SciTech Connect

The MiniBooNE experiment was designed to perform a search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations in a region of {Delta}m{sup 2} and sin{sup 2} 2{theta} very different from that allowed by standard, three-neutrino oscillations, as determined by solar and atmospheric neutrino experiments. This search was motivated by the LSND experimental observation of an excess of {bar {nu}}{sub e} events in a {bar {nu}}{sub {mu}} beam which was found compatible with two-neutrino oscillations at {Delta}m{sup 2} {approx} 1 eV{sup 2} and sin{sup 2} 2{theta} < 1%. If confirmed, such oscillation signature could be attributed to the existence of a light, mostly-sterile neutrino, containing small admixtures of weak neutrino eigenstates. In addition to a search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, MiniBooNE has also performed a search for {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations, which provides a test of the LSND two-neutrino oscillation interpretation that is independent of CP or CPT violation assumptions. This dissertation presents the MiniBooNE {nu}{sub {mu}} {yields} {nu}{sub e} and {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} analyses and results, with emphasis on the latter. While the neutrino search excludes the two-neutrino oscillation interpretation of LSND at 98% C.L., the antineutrino search shows an excess of events which is in agreement with the two-neutrino {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillation interpretation of LSND, and excludes the no oscillations hypothesis at 96% C.L. Even though the neutrino and antineutrino oscillation results from MiniBooNE disagree under the single sterile neutrino oscillation hypothesis, a simple extension to the model to include additional sterile neutrino states and the possibility of CP violation allows for differences between neutrino and antineutrino oscillation signatures. In view of that, the viability of oscillation models with one or two sterile neutrinos is investigated in global fits to MiniBooNE and LSND data, with and without constraints from other oscillation experiments with similar sensitivities to those models. A general search for new physics scenarios which would lead to effective non-unitarity of the standard 3 x 3 neutrino mixing matrix, or mixing freedom, is also performed using neutrino and antineutrino data available from MiniBooNE.

Karagiorgi, Georgia S.; /MIT

2010-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

The Nuclear Energy Computational Fluid Dynamics Advanced Modeling and Simulation (NE-CAMS) system is being developed at the Idaho National Laboratory (INL) in collaboration with Bettis Laboratory, Sandia National Laboratory (SNL), Argonne National Laboratory (ANL), Utah State University (USU), and other interested parties with the objective of developing and implementing a comprehensive and readily accessible data and information management system for computational fluid dynamics (CFD) verification and validation (V&V) in support of nuclear energy systems design and safety analysis. The two key objectives of the NE-CAMS effort are to identify, collect, assess, store and maintain high resolution and high quality experimental data and related expert knowledge (metadata) for use in CFD V&V assessments specific to the nuclear energy field and to establish a working relationship with the U.S. Nuclear Regulatory Commission (NRC) to develop a CFD V&V database, including benchmark cases, that addresses and supports the associated NRC regulations and policies on the use of CFD analysis. In particular, the NE-CAMS system will support the Department of Energy Office of Nuclear Energy Advanced Modeling and Simulation (NEAMS) Program, which aims to develop and deploy advanced modeling and simulation methods and computational tools for reliable numerical simulation of nuclear reactor systems for design and safety analysis. Primary NE-CAMS Elements There are four primary elements of the NE-CAMS knowledge base designed to support computer modeling and simulation in the nuclear energy arena as listed below. Element 1. The database will contain experimental data that can be used for CFD validation that is relevant to nuclear reactor and plant processes, particularly those important to the nuclear industry and the NRC. Element 2. Qualification standards for data evaluation and classification will be incorporated and applied such that validation data sets will result in well-defined, well-characterized data. Element 3. Standards will be established for the design and operation of experiments for the generation of new validation data sets that are to be submitted to NE-CAMS that addresses the completeness and characterization of the dataset. Element 4. Standards will be developed for performing verification and validation (V&V) to establish confidence levels in CFD analyses of nuclear reactor processes; such processes will be acceptable and recognized by both CFD experts and the NRC.

Kimberlyn C. Mousseau

2011-10-01T23:59:59.000Z

122

ANL/NE-13/9 SHARP Assembly-Scale Multiphysics Demonstration  

NLE Websites -- All DOE Office Websites (Extended Search)

NE-13/9 NE-13/9 SHARP Assembly-Scale Multiphysics Demonstration Simulations Mathematics and Computation Division & Nuclear Engineering Division About Argonne National Laboratory Argonne is a U.S. Department of Energy laboratory managed by UChicago Argonne, LLC under contract DE-AC02-06CH11357. The Laboratory's main facility is outside Chicago, at 9700 South Cass Avenue, Argonne, Illinois 60439. For information about Argonne and its pioneering science and technology programs, see www.anl.gov. Availability of This Report This report is available, at no cost, at http://www.osti.gov/bridge. It is also available on paper to the U.S. Department of Energy and its contractors, for a processing fee, from: U.S. Department of Energy Office of Scientific and Technical Information

123

Ronald E. Gill (NE), Scoville, ID - Level I Curtis Roth (EM), Idaho  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

E. Gill (NE), E. Gill (NE), Scoville, ID - Level I Curtis Roth (EM), Idaho Falls, ID - Level I Jared T. Howerton (NNSA), Oak Ridge, TN - Level I Richard L. Person (NNSA), DOE HQ - Level I Phillip (Tony) A. Polk (EM), Aiken, SC (Savannah River) - Level IV Jane Powell-Dolan (LM), Cincinnati, OH - Level I Eric M. Thompson (NNSA), Oak Ridge, TN - Level II Congratulations to our newly certified FPDs! The Certification Review Board (CRB or 'the Board') convened on Friday, Sep- tember 24 to review certifi- cation candidates and dis- cuss several topics. The Department of Energy (DOE) met the FY2010 tar- gets for the Root Cause Analysis, Corrective Action Plan metrics 7 and 8, as fol- lows: DOE surpassed the target for Metric #7 (95% of pro-

124

DOE-NE-STD-1004-92; Root Cause Analysis Guidance Document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE-STD-1004-92 NE-STD-1004-92 DOE GUIDELINE ROOT CAUSE ANALYSIS GUIDANCE DOCUMENT February 1992 U.S. Department of Energy Office of Nuclear Energy Office of Nuclear Safety Policy and Standards Washington, D.C. 20585 ii ABSTRACT DOE Order 5000.3A, "Occurrence Reporting and Processing of Operations Information," investigation and reporting of occurrences (including the performance of root cause analysis) requires the and the selection, implementation, and follow-up of corrective actions. The level of effort expended should be based on the significance attached to the occurrence. Most off-normal occurrences need only a scaled- down effort while most emergency occurrences should be investigated using one or more of the formal analytical models. A discussion of methodologies, instructions, and worksheets in this document guides

125

File:USDA-CE-Production-GIFmaps-NE.pdf | Open Energy Information  

Open Energy Info (EERE)

NE.pdf NE.pdf Jump to: navigation, search File File history File usage Nebraska Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 278 KB, MIME type: application/pdf) Description Nebraska Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Nebraska External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:18, 27 December 2010 Thumbnail for version as of 16:18, 27 December 2010 1,650 × 1,275 (278 KB) MapBot (Talk | contribs) Automated bot upload

126

NE-23 Disposal of Offsite-Generated Defense Radioactive Waste, Ventron  

Office of Legacy Management (LM)

pi/L +3 pi/L +3 *3L 52. NE-23 Disposal of Offsite-Generated Defense Radioactive Waste, Ventron FUSRAP Site Jill E. Lytle, DP-12 NE-23 The Office of Remedial Action and Waste Technology has received a request from the Technical Services Division, DOE-Oak Ridge Operations Office, for a determination of the appropriate disposal location for the material which will result from remedial action of the Ventron site in Beverly, Massachusetts. The Ventron site was used from 1942 to 1948 under contract to the ME0 and AEC for converting uranium oxide to uranium metal powder, as well as later operations involving recovery of uranium from scrap uranium and turnings from the fuel fabrication plant at Hanford, Washington. Full-scale remedial action, anticipated to result in approximately 5,000

127

Neutron Transfer Studied with a Radioactive beam of 24Ne, using TIARA at SPIRAL  

E-Print Network (OSTI)

A general experimental technique for high resolution studies of nucleon transfer reactions using radioactive beams is briefly described, together with the first new physics results that have been obtained with the new TIARA array. These first results from TIARA are for the reaction 24Ne(d,p)25Ne, studied in inverse kinematics with a pure radioactive beam of 100,000 pps from the SPIRAL facility at GANIL. The reaction probes the energies of neutron orbitals relevant to very neutron rich nuclei in this mass region and the results highlight the emergence of the N=16 magic number for neutrons and the associated disappearance of the N=20 neutron magic number for the very neutron rich neon isotopes.

W. N. Catford; C. N. Timis; R. C. Lemmon; M. Labiche; N. A. Orr; L. Caballero; R. Chapman; M. Chartier; M. Rejmund; H. Savajols; for the TIARA Collaboration

2009-12-20T23:59:59.000Z

128

A combined muon-neutrino and electron-neutrino oscillation search at MiniBooNE  

SciTech Connect

MiniBooNE seeks to corroborate or refute the unconfirmed oscillation result from the LSND experiment. If correct, the result implies that a new kind of massive neutrino, with no weak interactions, participates in neutrino oscillations. MiniBooNE searches for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations with the Fermi National Accelerator Laboratory 8 GeV beam line, which produces a {nu}{sub {mu}} beam with an average energy of {approx} 0.8 GeV and an intrinsic {nu}{sub e} content of 0.4%. The neutrino detector is a 6.1 m radius sphere filled with CH{sub 2}, viewed by 1540 photo-multiplier tubes, and located 541 m downstream from the source. This work focuses on the estimation of systematic errors associated with the neutrino flux and neutrino interaction cross section predictions, and in particular, on constraining these uncertainties using in-situ MiniBooNE {nu}{sub {mu}} charged current quasielastic (CCQE) scattering data. A data set with {approx} 100,000 events is identified, with 91% CCQE purity. This data set is used to measure several parameters of the CCQE cross section: the axial mass, the Fermi momentum, the binding energy, and the functional dependence of the axial form factor on four-momentum transfer squared. Constraints on the {nu}{sub {mu}} and {nu}{sub e} fluxes are derived using the {nu}{sub {mu}} CCQE data set. A Monte Carlo study of a combined {nu}{sub {mu}} disappearance and {nu}{sub e} appearance oscillation fit is presented, which improves the {nu}{sub {mu}} {yields} {nu}{sub e} oscillation sensitivity of MiniBooNE with respect to a {nu}{sub e} appearance-only fit by 1.2-1.5{sigma}, depending on the value of {Delta}m{sup 2}.

Monroe, Jocelyn R.; /Columbia U.

2006-07-01T23:59:59.000Z

129

Constraints on electromagnetic properties of sterile neutrinos from MiniBooNE results  

E-Print Network (OSTI)

Among the class of models with small mixing angles between sterile and active neutrinos, we place constraints on the effective muon-to-sterile neutrino magnetic and electric dipole transition moments from the combined MiniBooNE results for the sterile neutrino mass range of $10\\;\\mathrm{MeV}distribution as a function of polar angle. However, good agreement with the anomalous event distribution in reconstructed energy can be achieved for some values of magnetic and electric moments.

Alexander Radionov

2013-03-19T23:59:59.000Z

130

Collapse and expansion in the bright-rimmed cloud SFO 11NE  

E-Print Network (OSTI)

We report the results of a search for the double-peaked blue-skewed infall signature in the bright-rimmed cloud core SFO 11NE SMM1. Observations of the optically thick HCO$^{+}$ and optically thin H$^{13}$CO$^{+}$ J=3--2 lines reveal that there is indeed a characteristic double-peaked line profile, but skewed to the red rather than the blue. Modelling of the dust continuum emission and line profiles show that the motions within SFO 11NE SMM1 are consistent with a collapsing central core surrounded by an expanding outer envelope. We show that the collapse is occurring at a similar rate to that expected onto a single solar-mass protostar and is unlikely to represent the large-scale collapse of gas onto the infrared cluster seen at the heart of SFO 11NE SMM1. The outer envelope is expanding at a much greater rate than that expected for a photoevaporated flow from the cloud surface. The modelled expansion is consistent with the bulk cloud re-expansion phase predicted by radiative-driven implosion models of cometary clouds.

M. A Thompson; G. J. White

2004-02-24T23:59:59.000Z

131

The Sound Emission Board of the KM3NeT Acoustic Positioning System  

E-Print Network (OSTI)

We describe the sound emission board proposed for installation in the acoustic positioning system of the future KM3NeT underwater neutrino telescope. The KM3NeT European consortium aims to build a multi-cubic kilometre underwater neutrino telescope in the deep Mediterranean Sea. In this kind of telescope the mechanical structures holding the optical sensors, which detect the Cherenkov radiation produced by muons emanating from neutrino interactions, are not completely rigid and can move up to dozens of meters in undersea currents. Knowledge of the position of the optical sensors to an accuracy of about 10 cm is needed for adequate muon track reconstruction. A positioning system based on the acoustic triangulation of sound transit time differences between fixed seabed emitters and receiving hydrophones attached to the kilometre-scale vertical flexible structures carrying the optical sensors is being developed. In this paper, we describe the sound emission board developed in the framework of KM3NeT project, whi...

Llorens, C D; Sogorb, T; Bou--Cabo, M; Martnez-Mora, J A; Larosa, G; Adrin-Martnez, S

2012-01-01T23:59:59.000Z

132

Benthic biological and biogeochemical patterns and processes across an oxygen minimum zone (Pakistan margin, NE Arabian Sea)  

E-Print Network (OSTI)

(Pakistan margin, NE Arabian Sea) Gregory L. Cowie a,?, Lisa A. Levin b a The Sir John Murray Laboratories), and organic matter (OM) availability on benthic communities and processes across the Pakistan Margin

Levin, Lisa

133

Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

NE-KAMS knowledge base will assist computational analysts, physics model developers, experimentalists, nuclear reactor designers, and federal regulators by: (1) Establishing accepted standards, requirements and best practices for V&V and UQ of computational models and simulations, (2) Establishing accepted standards and procedures for qualifying and classifying experimental and numerical benchmark data, (3) Providing readily accessible databases for nuclear energy related experimental and numerical benchmark data that can be used in V&V assessments and computational methods development, (4) Providing a searchable knowledge base of information, documents and data on V&V and UQ, and (5) Providing web-enabled applications, tools and utilities for V&V and UQ activities, data assessment and processing, and information and data searches. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the Consortium for Advanced Simulation of Light Water Reactors (CASL), the Nuclear Energy Advanced Modeling and Simulation (NEAMS), the Light Water Reactor Sustainability (LWRS), the Small Modular Reactors (SMR), and the Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve computational modeling and simulation (M&S) of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs. In addition, from the outset, NE-KAMS will support the use of computational M&S in the nuclear industry by developing guidelines and recommended practices aimed at quantifying the uncertainty and assessing the applicability of existing analysis models and methods. The NE-KAMS effort will initially focus on supporting the use of computational fluid dynamics (CFD) and thermal hydraulics (T/H) analysis for M&S of nuclear reactor systems, components and processes, and will later expand to include materials, fuel system performance and other areas of M&S as time and funding allow.

Rich Johnson; Kimberlyn C. Mousseau; Hyung Lee

2011-09-01T23:59:59.000Z

134

Astrophysically Important 19Ne States Studied with the 2H(18F,alpha+15O)n Reaction  

Science Conference Proceedings (OSTI)

The nuclear structure of {sup 19}Ne near the proton threshold is of interest for understanding the rates of proton-induced reactions on {sup 18}F in novae. Analogues for several states in the mirror nucleus {sup 19}F have not yet been identified in {sup 19}Ne indicating the level structure of {sup 19}Ne in this region is incomplete. The {sup 18}F(d;n){sup 19}Ne and {sup 18}F(d,p){sup 19}F reactions have been measured simultaneously at E{sub c.m.} = 14.9 MeV. The experiments were performed at the Holifield Radioactive Ion Beam Facility (HRIBF) of Oak Ridge National Laboratory (ORNL) by bombarding a 720-mg/cm{sub 2} CD{sub 2} target with a radioactive {sup 18}F beam. The {sup 19}Ne states of interest near the proton threshold decay by breakup into a and {sup 15}O particles. These decay products were detected in coincidence with position-sensitive E-{Delta}E silicon telescopes. The {alpha} and {sup 15}N particles from the break up of the mirror nucleus {sup 19}F were also measured with these detectors. Particle identification, coincidence, and Q-value requirements enable us to distinguish the reaction of interest from other reactions. The reconstruction of relative energy of the detected particles reveals the excited states of {sup 19}Ne and {sup 19}F which are populated. The neutron (proton) angular distributions for states in {sup 19}Ne ({sup 19}F) were extracted using momentum conservation. The observed states in {sup 19}Ne and {sup 19}F will be presented.

Adekola, Aderemi S [ORNL; Bardayan, Daniel W [ORNL; Blackmon, Jeff C [ORNL; Brune, C. [Ohio University; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Champagne, A. E. [University of North Carolina, Chapel Hill; Domizioli, Carlo P [ORNL; Greife, U. [Colorado School of Mines, Golden; Heinen, Z. [Ohio University; Hornish, M. [Ohio University; Johnson, Micah [ORNL; Jones, K. L. [University of Tennessee, Knoxville (UTK); Kapler, R. [University of Tennessee, Knoxville (UTK); Livesay, Jake [ORNL; Ma, Zhanwen [ORNL; Massey, T. [Ohio University; Moazen, Brian [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; ShrinerJr., J. F. [Tennessee Technological University; Thomas, J. S. [Rutgers University; Smith, Nathan A [ORNL; Smith, Michael Scott [ORNL; Visser, D. W. [University of North Carolina, Chapel Hill; Voinov, A. [Ohio University

2009-01-01T23:59:59.000Z

135

NE-24  

Office of Legacy Management (LM)

the Bureau of Hines Site at Albany, Oregon, for Remedial the Bureau of Hines Site at Albany, Oregon, for Remedial Action Under the Formerly Utilized Sites Remedial Action Program I L@ _I' J.-La&one, Manager Oak Ridge Operations Office Based on the data in the attached draft reports, it has been determined that the subject site is contaminated with residual radioactive material ' as a result of Manhattan Engineer District/Atomic Energy Commission operations P * at this site. The contamination is in excess of the acceptable guidelines and warrants some form of remedial action under the Fornlerly Utilized Sites Reriledial Action Program. It should be noted that the attached reports are draft reports and although subject to change, the changes expected will not effect the designation of the site; therefore, the reports are Suitable for -

136

NE-23  

Office of Legacy Management (LM)

s,' s,' Whidd Pk. Yilljam West West Orange Tennis Club, Inc. 200 Pleasant Valley Way West Orange, New Jersey 07052 Dear Mr. West: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on Vitro Laboratories, formerly located on what is now property of the West Orange Tennis Club, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Atomic Energy Commission (a predecessor to DOE). A radiological survey indicated that the radiation levels and radionuclide concentrations are at or near natural background levels. Therefore, no remedial action is required, and DOE is eliminating the former Vitro site from further consideration under FL&RAP.

137

1 Summary: NE cod FSP survey 2003-08 The trawler Abbie Lee was  

E-Print Network (OSTI)

chartered in October/November 2008 to carry out the sixth in a series of FSP surveys of cod and other gadoids off the NE coast of England. Surveys since 2005 have utilised tows spread out over the survey area, with additional tows in defined areas with coarser seabed types (hard ground) where cod abundance is expected to be greatest. As in previous FSP surveys, cod were most abundant on or near the hard ground, whereas haddock were mainly on the softer seabed sediments offshore. Whiting distribution showed no clear relationship with seabed type. 6 5

Jos De Oliveira; Guy Pasco; Mike Armstrong; Peter Randall; Cefas Lowestoft

2009-01-01T23:59:59.000Z

138

Temperature Effects on the Perturber Induced Shift of Dopant Ionization Energies in He and Ne  

SciTech Connect

In this Letter, temperature effects on the perturber induced shift {Delta}{sub D}({rho}{sub P}) [{rho}{sub P} {equivalent_to} perturber number density] of the dopant ionization energy in the repulsive gases Ne and He are investigated at low to medium perturber densities (i.e., {rho}{sub P} {<=} 6.0 x 10{sup 21} cm{sup -3}). We show that these effects arise form changes in the ensemble averaged dopant/perturber polarization energy rather than from changes in the energy of the quasi-free electron.

C Evans; Y Lushtak; X Shi; L Li; G Findley

2011-12-31T23:59:59.000Z

139

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

140

DOE-NE Proliferation and Terrorism Risk Assessment: FY12 Plans Update  

SciTech Connect

This presentation provides background information on FY12 plans for the DOE Office of Nuclear Energy Proliferation and Terrorism Risk Assessment program. Program plans, organization, and individual project elements are described. Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism - Goal is to enable the use of risk information to inform NE R&D program planning.

Sadasivan, Pratap [Los Alamos National Laboratory

2012-06-21T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Radiative rates and electron impact excitation rate coefficients for Ne-like selenium, Se XXV  

Science Conference Proceedings (OSTI)

In this article we report calculations of energy levels, radiative rates, electron impact collision strengths, and effective collision strengths for transitions among the 241 fine-structure levels arising from 2l{sup 8} and 2l{sup 7}n{sup '}l{sup '} (n{sup '{241 levels. The effective collision strengths are reported for all 28920 transitions among the 241 levels over a wide temperature range up to 10 keV. To assess the reliability and accuracy of the present collisional data, we have performed a 27-state close-coupling calculation, employing the Dirac R-matrix theory. The results from the close-coupling calculation and the independent-process calculation for the identical target states are found to be in good agreement. - Highlights: {yields} Radiative and collisional atomic data are presented for the lowest 241 fine-structure levels in Ne-like Se. {yields} Calculations are performed using the FAC package. {yields} Resonances enhance significantly a large amount of transitions. {yields} Radiative damping effects are significant for many transitions. {yields} Close-coupling effects are small in Ne-like Se.

Wang, K.; Chen, C.Y., E-mail: chychen@fudan.edu.cn; Huang, M.; Wang, Y.S.; Zou, Y.M.

2011-07-15T23:59:59.000Z

142

Photoionization-pumped, Ne II, x-ray laser studies project. Final report  

SciTech Connect

The energetics of this pumping scheme are shown. Short-pulse (50 to 100 ps) laser irradiation of an appropriate x-ray flashlamp medium generates broad-band emission in the range of 300 to 800 eV which preferentially photoionizes Ne to the /sup 2/S state of Ne II creating an inversion at approximately 27 eV. Although this approach does not depend on precise spectral overlap between the x-ray pump radiation and the medium to be pumped, it does require that the x-ray medium remain un-ionized prior to photoionization by the soft x-ray emission. Well-controlled focus conditions are required to ensure that the x-ray medium is not subjected to electron or x-ray preheat prior to irradiation by the soft x-ray source. The magnitude of the population inversion is predicted to be critically dependent upon rapid photoionization of the two states; therefore, ultra-short pulse irradiation of the laser flashlamps is required.

Richardson, M.C.; Hagelstein, P.L.; Eckart, M.J.; Forsyth, J.M.; Gerrassimenko, M.; Soures, J.M.

1984-01-01T23:59:59.000Z

143

Helioseismic Constraints on the Solar Ne/O Ratio and Heavy Element Abundances  

E-Print Network (OSTI)

We examine the constraints imposed by helioseismic data on the solar heavy element abundances. In prior work we argued that the measured depth of the surface convection zone R_CZ and the surface helium abundance Y_surf were good metallicity indicators which placed separable constraints on light metals (CNONe) and the heavier species with good relative meteoritic abundances. The resulting interiors-based abundance scale was higher than some published studies based on 3D model atmospheres at a highly significant level. In this paper we explore the usage of the solar sound speed in the radiative interior as an additional diagnostic, and find that it is sensitive to changes in the Ne/O ratio even for models constructed to have the same R_CZ and Y_surf. Three distinct helioseismic tests (opacity in the radiative core, ionization in the convection zone, and the core mean molecular weight) yield consistent results. Our preferred O, Ne and Fe abundances are 8.86 +/-0.04, 8.15 +/-0.17 and 7.50 +/-0.05 respectively. Th...

Delahaye, F; Pinsonneault, L; Zeippen, C J

2010-01-01T23:59:59.000Z

144

Light charged particle emission from hot $^{32}$S$^{*}$ formed in $^{20}$Ne + $^{12}$C reaction  

E-Print Network (OSTI)

Inclusive energy distributions for light charged particles ($p, d, t$ and $\\alpha$) have been measured in the $^{20}$Ne (158, 170, 180, 200 MeV) + $^{12}$C reactions in the angular range 10$^{o}$ -- 50$^{o}$. Exclusive light charged particle energy distribution measurements were also done for the same system at 158 MeV bombarding energy by in-plane light charged particle -- fragment coincidence. Pre-equilibrium components have been separated out from proton energy spectra using moving source model considering two sources. The data have been compared with the predictions of the statistical model code CASCADE. It has been observed that significant deformation effects were needed to be introduced in the compound nucleus in order to explain the shape of the evaporated $d, t$ energy spectra. For protons, evaporated energy spectra were rather insensitive to nuclear deformation, though angular distributions could not be explained without deformation. Decay sequence of the hot $^{32}$S nucleus has been investigated through exclusive light charged particle measurements using the $^{20}$Ne (158 MeV) + $^{12}$C reaction. Information on the sequential decay chain has been extracted through comparison of the experimental data with the predictions of the statistical model. It is observed from the present analysis that exclusive light charged particle data may be used as a powerful tool to probe the decay sequence of hot light compound systems.

Aparajita Dey; S. Bhattacharya; C. Bhattacharya; K. Banerjee; T. K. Rana; S. Kundu; S. R. Banerjee; S. Mukhopadhyay; D. Gupta; R. Saha

2008-07-01T23:59:59.000Z

145

Characterization of nonthermal Ne-N{sub 2} mixture radio frequency discharge  

Science Conference Proceedings (OSTI)

This paper deals with optical emission spectroscopic studies of low pressure (p=0.1{yields}0.5 mbar) Ne-N{sub 2} capacitively coupled radio frequency (rf) plasma that can be used for plasma nitriding, etc. It reports the methods to calculate the electron temperature (T{sub e}) in nonthermal plasmas. Since, the selected Ne I lines, used to calculate electron temperature, are found in corona balance; therefore, it allows us to use modified Boltzmann technique to calculate electron temperature. Langmuir probe is also used to calculate electron temperature and electron energy distribution functions (EEDFs). The measurements are worked out for different discharge parameters like neon percentage, filling pressure and RF power. It is found that electron temperature increases with the increase in neon percentage and decreases with the increase in pressure, whereas excitation temperature (T{sub exc}) increases with power, neon percentage, and decreases with pressure. It is also observed that electron temperature measured by Langmuir probe technique is slightly greater than the one measured via modified Boltzmann plot method. The tails of the EEDFs gain height and extend toward the higher energy with the increase in neon percentage in the mixture.

Rehman, N. U.; Zakaullah, M. [Department of Physics, Quaid-i-Azam University, 45320 Islamabad (Pakistan); Khan, F. U. [Department of Physics, Gomal University, 29050 D.I. Khan (Pakistan); Naseer, S. [Department of Physics, Peshawar University, 25120 Peshawar (Pakistan)

2008-12-15T23:59:59.000Z

146

Measurement of the nu(mu)-CCQE cross-section in the SciBooNE experiment  

SciTech Connect

SciBooNE is a neutrino and anti-neutrino cross-section experiment at Fermilab, USA. The SciBooNE experiment is summarized and two independent CCQE analyses are described. For one of the analyses, an absolute {nu}{sub {mu}}-CCQE cross section in the neutrino energy region (0.6-1.6) GeV is shown and the technique developed for such a purpose is also explained. The total cross section measured over this energy range agrees well with expectations, based on the NEUT event generator and using a value of 1.21 GeV for the CCQE axial mass.

Alcaraz-Aunion, Jose Luis; /Barcelona, IFAE; Walding, Joseph; /Imperial Coll., London

2009-09-01T23:59:59.000Z

147

New Results from MiniBooNE Charged-Current Quasi-Elastic Anti-Neutrino Data  

SciTech Connect

MiniBooNE anti-neutrino charged-current quasi-elastic (CCQE) data is compared to model predictions. The main background of neutrino-induced events is examined first, where three independent techniques are employed. Results indicate the neutrino flux is consistent with a uniform reduction of {approx}20% relative to the largely uncertain prediction. After background subtraction, the Q{sup 2} shape of {bar v}{sub {mu}} CCQE events is consistent with the model parameter MA = 1.35 GeV determined from MiniBooNE v{sub {mu}} CCQE data, while the normalization is {approx} 20% high compared to the same prediction.

Grange, Joseph

2011-07-01T23:59:59.000Z

148

Laser Rock Drilling on the History Channel - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

Departments > System Technologies & Diagnostics > Videos Departments > System Technologies & Diagnostics > Videos Laser Oil & Gas Well Drilling: Laser Rock Drilling on the History Channel Argonne's Laser Applications Lab and researcher Claude Reed (NE) appeared in the History Channel program "Modern Marvels: Drilling" (May 10, 2006). "Modern Marvels" relates the ingenuity, invention and imagination behind everyday items, technological breakthroughs and man-made wonders. :: Please wait until video loads completely :: Argonne Experts Dr. Claude B. Reed is one of the Experts featured in the Argonne Experts Guide. The video is in mp4 format. Closed Captioning Transcript Live Closed captioning of the video is not available; however -as an alternative- we provide a transcript of the audio portion of this video as a separate web page.

149

Markus Popa, DOE (OCRWM) Bill Sherman, NE HLRW Task Force Robert Holden, NCAI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minutes Monday, November 3rd 2:00-3:00 p.m. (EST) Minutes Monday, November 3rd 2:00-3:00 p.m. (EST) Participants included: Markus Popa, DOE (OCRWM) Bill Sherman, NE HLRW Task Force Robert Holden, NCAI Mike Butler, UETC Bob Fronczak, AAR Kevin Blackwell, FRA Mike Butler (UETC) greeted participants and informed the group of previous notification by Robert Light (Mescalero Apache Tribe), Robert Centracco (FRA), and Mike Calhoun (FRA) that they would be unable to join the call. Mr. Butler began the call with a brief update on the status of Matrix 1, now entitled "Summary of Rail and Highway Regulations and their Applicability to States, Tribes, Shippers, and Carriers." He informed the group that he had completed an initial draft of the matrix, but that he was making substantial revisions to it and therefore he had not distributed it to the entire group for

150

NE-24 R&D Decontamination Projects Under the Formerly Utilized Sites Remedial  

Office of Legacy Management (LM)

" _ ,' ,:.' : " _ ,' ,:.' : NE-24 R&D Decontamination Projects Under the Formerly Utilized Sites Remedial Action Program (FUSRAP) '. * * ,~~'.'J.' L.aGrone, Manager Oak Ridge Operations O fffce As a result of the House-Senate Conference Report and the Energy and W a ter Appropriations Act for FY 1984, and based on the data in the attached reports indicating radioactive contamination In excess of acceptable guidelines, the sites listed In the attachment and their respectfve vicinity properties (contaminated with radioactive materials from these sites) are being designated as decontamination research and development projects under the FUSRAP. Each site and the associated vicinity properties should be treated as a separate project. . . -_ The objectjve of each project is to decontaminate the vicinity properties

151

NE-23 Elimination of the Chupadera Mesa and Los Alamos County Industrial Waste  

Office of Legacy Management (LM)

AM? 2 2 1986 AM? 2 2 1986 NE-23 Elimination of the Chupadera Mesa and Los Alamos County Industrial Waste Line Sites from Further Consideration for FUSRAP Inclusion Carlos E. Garcia, Director Environmental Safety and Health Division Albuquerque Operations Office The enclosed material is being provided to you to document the final actions taken under the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP) for the Chupadera Mesa area and the Los Alamos County Industrial Waste Lines, New Mexico. Copies of designation/ elimination reviews for each of the sites are enclosed for your records. We have determined that neither site warrants inclusion in the remedial action program. Primary sources of data for this determination were two survey reports prepared through your Division, LA-10256-MS, "Radiological

152

K-SHELL PHOTOIONIZATION AND PHOTOABSORPTION OF Ne, Mg, Si, S, Ar, AND Ca  

Science Conference Proceedings (OSTI)

We present extensive computations of photoabsorption and photoionization cross sections across the K-edge of Ne, Mg, Si, S, Ar, and Ca ions with less than 11 electrons. The calculations are performed using the Breit-Pauli R-matrix method and include the effects of radiative and Auger damping by means of an optical potential. The wave functions are constructed from single-electron orbital bases obtained using a Thomas-Fermi-Dirac statistical model potential. Configuration interaction is considered among all fine-structure levels within the n = 2 complex. The damping processes affect the resonances converging to the K thresholds causing them to display symmetric profiles of constant width that smear the otherwise sharp edge at the photoionization thresholds.

Witthoeft, M. C.; Kallman, T. R. [NASA Goddard Space Flight Center, Code 662, Greenbelt, MD 20771 (United States); Bautista, M. A. [Department of Physics, Virginia Polytechnic and State University, Blacksburg, VA 24061 (United States); Mendoza, C. [Centro de Fisica, Instituto Venezolano de Investigaciones CientIficas (IVIC), Caracas 1020A (Venezuela, Bolivarian Republic of); Palmeri, P.; Quinet, P. [Astrophysique et Spectroscopie, Universite de Mons-Hainaut, B-7000 Mons (Belgium)], E-mail: bautista@vt.edu

2009-05-15T23:59:59.000Z

153

Effect of supplementation on vitamin A and zinc nutriture of children in northeast (NE) Thailand  

SciTech Connect

Previous surveys of the nutritional status of young children in NE Thailand suggested that they may benefit from vitamin A (VA) and/or zinc (Zn) supplementation. 140 children, with low plasma retinol concentrations were entered in a double-blind study. They were randomized and supplemented with either VA, Zn, VA + Zn or placebo each weekday for 6 mos. All subjects consumed their usual diet that provided adequate protein, less than recommended calories, fat, Zn and VA. Biochemical indices of VA and Zn status increased significantly. The children had adequate VA liver stores as assessed by relative dose response. Zn supplementation resulted in improvement of vision restoration time in dim light using rapid dark adaptometry. VA and Zn synergistically normalized conjunctival epithelium after a 6 mo supplementation. Data suggest that functional improvements of populations with suboptimal VA and Zn nutriture can be accomplished by supplementation with {lt}2 times of RDA of these nutrients.

Udomkesmalee, E.; Dhanamitta, S.; Charoenklatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Kramer, T.R.; Smith, J.C. Jr. (Mahidol Univ., Nakhon Pathom (Thailand) USDA, Beltsville, MD (United States))

1991-03-11T23:59:59.000Z

154

First direct measurement of resonance strengths in {sup 17}O({alpha},{gamma}){sup 21}Ne  

SciTech Connect

The reaction {sup 17}O({alpha},{gamma}){sup 21}Ne has been measured by in-beam {gamma} spectroscopy for the first time in the energy range E{sub {alpha}=}750-1650 keV using highly enriched anodized Ta{sub 2}({sup 17}O){sub 5} targets. Resonances were found at E{sub {alpha}=} 1002, 1386, and 1619 keV. Their strengths and primary {gamma}-ray branchings are given. The new results exclude the low reaction rate of Descouvemont and support the rate of Caughlan and Fowler. Implications for the neutron poisoning efficiency of {sup 16}O in the weak s-process are discussed.

Best, A.; Goerres, J.; Couder, M.; Boer, R. de; Falahat, S.; Kontos, A.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Sonnabend, K.; Talwar, R.; Uberseder, E.; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)

2011-05-15T23:59:59.000Z

155

KM3NeT:a large underwater neutrino telescope in the Mediterranean Sea  

E-Print Network (OSTI)

High energy neutrinos produced in astrophysical processes will allow for a new way of studying the universe. In order to detect the expected flux of high energy neutrinos from specific astrophysical sources, neutrino telescopes of a scale of a km^3 of water will be needed. A Northern Hemisphere detector is being proposed to be sited in a deep area of the Mediterranean Sea. This detector will provide complimentary sky coverage to the IceCube detector being built at the South Pole. The three neutrino telescope projects in the Mediterranean (ANTARES, NEMO and NESTOR) are partners in an effort to design, and build such a km^3 size neutrino telescope, the KM3NeT. The EU is funding a 3-year Design Study; the status of the Design Study is presented and some technical issues are discussed.

P. A. Rapidis; for the KM3NeT consortium

2008-03-17T23:59:59.000Z

156

Office of Technology Transfer TES MICROBOLOMETER IMPROVED  

E-Print Network (OSTI)

in key areas for UW TechTransfer. UW researchers, faculty and staff reported 335 innovations, which TechTransfer programs like the Technology Gap Innovation Fund and LaunchPad continue to demonstrate and dedication of an exceptional team assembled at UW TechTransfer. This past year we have added staff in key

Kemner, Ken

157

BP Studentship* in the Department of Earth Sciences of the University of Oxford Tectonic evolution of the Parnaiba cratonic basin, NE Brazil  

E-Print Network (OSTI)

of the Parnaiba cratonic basin, NE Brazil Supervisors: Prof. A. B. Watts and Dr. M. Daly (BP) * Subject to funding structure and petroleum play. The focus will be on the Parnaiba basin in NE Brazil, one of the world in Brazil and the UK, will involve the acquisition of seismic reflection and refraction profile data along

158

Using MiniBooNE neutral current elastic cross section results to constrain 3+1 sterile neutrino models  

E-Print Network (OSTI)

The MiniBooNE Neutral Current Elastic (NCEL) cross section results are used to extract limits in the $\\Delta m^{2}-\\sin^{2}\\vartheta_{\\mu s}$ plane for a 3+1 sterile neutrino model with a mass splitting $0.1 \\leq \\Delta m^{2} \\leq 10.0$ eV$^{2}$. GENIE is used with a cross section model close to the one employed by MiniBooNE to make event rate predictions using simulations on the MiniBooNE target material CH$_{2}$. The axial mass is a free parameter in all fits. Sterile modifications to the flux and changes to the cross section in the simulation relate the two and allow limits to be set on sterile neutrino mixing using cross section results. The large axial mass problem makes it necessary for experiments to perform their own axial mass fits, but a prior fit to the same dataset could mask a sterile oscillation signal. Results are given with and without a penalty term on the axial mass from a prior fit. We find that a simultaneous fit to the axial mass and the sterile neutrino parameters favours very high axial mass values. The general problems that the current uncertainty on charged-current quasi-elastic (CCQE) cross sections at MiniBooNE energies pose for sterile neutrino measurements are discussed.

Callum Wilkinson; Susan Cartwright; Lee Thompson

2013-09-04T23:59:59.000Z

159

Measurements of nuclear $?$-ray line emission in interactions of protons and $?$ particles with N, O, Ne and Si  

E-Print Network (OSTI)

$\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very interesting for constraining nuclear reaction models. In particular the agreement of cross section calculations in the nuclear reaction code TALYS with the measured data could be improved by adjusting the coupling schemes of collective levels in the target nuclei $^{14}$N, $^{20,22}$Ne and $^{28}$Si. The importance of these results for the modeling of nuclear $\\gamma$-ray line emission in astrophysical sites is discussed.

H. Benhabiles-Mezhoud; J. Kiener; J. -P. Thibaud; V. Tatischeff; I. Deloncle; A. Coc; J. Duprat; C. Hamadache; A. Lefebvre-Schuhl; J. -C. Dalouzy; F. De Grancey; F. De Oliveira; F. Dayras; N. De Srville; M. -G. Pellegriti; L. Lamia; S. Ouichaoui

2010-11-11T23:59:59.000Z

160

First Direct Measurement of the 17F(p,gamma)18Ne Cross Section  

SciTech Connect

The rate of the 17F(p,gamma)18Ne reaction is of significant importance in astrophysical events like novae and x-ray bursts. A previous 17F(p,p)17F measurement identified the 3+ state in 18Ne predicted to dominate the rate above 0.2 GK at a center of mass energy of 599.8 keV, but the resonance strength for proton capture was unknown. We have directly measured the 17F(p,gamma)18Ne reaction with the Daresbury Recoil Separator, using a mixed beam of radioactive 17F and stable 17O from the HRIBF at ORNL. The resonance strength for the 599.8 keV resonance in 18Ne was found to be = 33 14(stat) 17(sys) meV, corresponding to a width of = 56 24(stat) 30(sys) meV. Additionally, an upper limit on the direct capture S factor of S(E) < 65 keV b was determined at an intermediate energy of 800 keV.

Chipps, K. [Colorado School of Mines, Golden; Bardayan, Daniel W [ORNL; Blackmon, Jeff C [ORNL; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Greife, U. [Colorado School of Mines, Golden; Hatarik, Robert [Rutgers University; Kozub, R. L. [Tennessee Technological University; Matei, Catalin [Oak Ridge Associated Universities (ORAU); Moazen, Brian [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; Peters, W. A. [Rutgers University; Pittman, S. T. [University of Tennessee, Knoxville (UTK); ShrinerJr., J. F. [Tennessee Technological University; Smith, Michael Scott [ORNL

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Demonstration Assessment of LED Roadway Lighting: NE Cully Boulevard Portland, OR  

Science Conference Proceedings (OSTI)

A new roadway lighting demonstration project was initiated in late 2010, which was planned in conjunction with other upgrades to NE Cully Boulevard, a residential collector road in the northeast area of Portland, OR. With the NE Cully Boulevard project, the Portland Bureau of Transportation hoped to demonstrate different light source technologies and different luminaires side-by-side. This report documents the initial performance of six different newly installed luminaires, including three LED products, one induction product, one ceramic metal halide product, and one high-pressure sodium (HPS) product that represented the baseline solution. It includes reported, calculated, and measured performance; evaluates the economic feasibility of each of the alternative luminaires; and documents user feedback collected from a group of local Illuminating Engineering Society (IES) members that toured the site. This report does not contain any long-term performance evaluations or laboratory measurements of luminaire performance. Although not all of the installed products performed equally, the alternative luminaires generally offered higher efficacy, more appropriate luminous intensity distributions, and favorable color quality when compared to the baseline HPS luminaire. However, some products did not provide sufficient illumination to all areasvehicular drive lanes, bicycle lanes, and sidewalksor would likely fail to meet design criteria over the life of the installation due to expected depreciation in lumen output. While the overall performance of the alternative luminaires was generally better than the baseline HPS luminaire, cost remains a significant barrier to widespread adoption. Based on the cost of the small quantity of luminaires purchased for this demonstration, the shortest calculated payback period for one of the alternative luminaire types was 17.3 years. The luminaire prices were notably higher than typical prices for currently available luminaires purchased in larger quantities. At prices that are more typical, the payback would be less than 10 years. In addition to the demonstration luminaires, a networked control system was installed for additional evaluation and demonstration purposes. The capability of control system to measure luminaire input power was explored in this study. A more exhaustive demonstration and evaluation of the control system will be the subject of future GATEWAY report(s).

Royer, Michael P.; Poplawski, Michael E.; Tuenge, Jason R.

2012-06-29T23:59:59.000Z

162

Fine structure collision strengths and line ratios for [Ne V] in infrared and optical sources  

E-Print Network (OSTI)

Improved collisions strengths for the mid-infrared and optical transitions in Ne V are presented. Breit-Pauli R-Matrix calculations for electron impact excitation are carried out with fully resolved near-threshold resonances at very low energies. In particular, the fine structure lines at 14 micron and 24 micron due to transitions among the ground state levels 1s^22s^22p^3 (^3P_{0,1,2}), and the optical/near-UV lines at 2973, 3346 and 3426 Angstrom transitions among the ^3P_{0,1,2}, ^1D_2, ^1S_0 levels are described. Maxwellian averaged collision strengths are tabulated for all forbidden transistion within the ground configuration. Significant differences are found in the low temperature range Te < 10000 K for both the FIR and the opitcal transitions compared to previous results. An analysis of the 14/24 line ratio in low-energy-density (LED) plasma conditions reveals considerable variation; the effective rate coefficient may be dominated by the very low-energy behaviour rather than the maxwellian averaged...

Dance, Michael; Nahar, Sultana N; Pradhan, Anil K

2013-01-01T23:59:59.000Z

163

Particle decay branching ratios for states of astrophysical importance in 19Ne  

E-Print Network (OSTI)

We have measured proton and alpha-particle branching ratios of excited states in 19Ne formed using the 19F(3He,t) reaction at a beam energy of 25 MeV. These ratios have a large impact on the astrophysical reaction rates of 15O(alpha,gamma), 18F(p,gamma) and 18F(p,alpha), which are of interest in understanding energy generation in x-ray bursts and in interpreting anticipated gamma-ray observations of novae. We detect decay protons and alpha-particles using a silicon detector array in coincidence with tritons measured in the focal plane detector of our Enge split-pole spectrograph. The silicon array consists of five strip detectors of the type used in the Louvain-Edinburgh Detector Array, subtending angles from 130 degrees to 165 degrees with approximately 14% lab efficiency. The correlation angular distributions give additional confidence in some prior spin-parity assignments that were based on gamma branchings. We measure Gamma_p/Gamma=0.387+-0.016 for the 665 keV proton resonance, which agrees well with the direct measurement of Bardayan et al.

D. W. Visser; J. A. Caggiano; R. Lewis; W. B. Handler; A. Parikh; P. D. Parker

2003-08-08T23:59:59.000Z

164

Color transparency after the NE18 and E665 experiments: Outllok and perspectives at CEBAF  

E-Print Network (OSTI)

CEBAF is a high-luminocity factory of virtual photons with variable virtuality $Q^{2}$ and transverse size. This makes CEBAF, in particular after the energy upgrade to (8-12)GeV, an ideal facility for uncovering new phenomena, and opening new windows, at the interface of the perturbative and nonperturbative QCD. We discuss color transparency as the case for a broad program on electroproduction of vector mesons $\\rho^{0},\\,\\omega^{0},\\,\\phi^{0}$ and their radial excitations $\\rho',\\,\\omega',\\,\\phi'$ at CEBAF. We also comment on the second generation of experiments on color transparency in $^{4}He(e,e'p)$ scattering, which are also feasible at CEBAF. In 1994, we can make more reliable projections into future because our understanding of the onset of color transparency has greatly been augmented by two experiments completed in 1993:\\\\ i) no effect of CT was seen in the SLAC NE18 experiment on $A(e,e'p)$ scattering at virtualities of the exchanged photon $Q^{2} \\lsim 7$ GeV$^{2}$, \\\\ ii) strong signal of CT was observed in the FNAL E665 experiment on exclusive $\\rho^{0}$- meson production in deep inelastic scattering in the same range of $Q^{2}$. \\\\ We discuss the impact of these observations on the CEBAF experimental program. We argue they both are good news, both were anticipated theoretically, and both rule in the correct QCD mechanism of the onset of CT.

J. Nemchik; N. N. Nikolaev; B. G. Zakharov

1994-06-06T23:59:59.000Z

165

An intensity-modulated dual-wavelength He-Ne laser for remote sensing of methane  

SciTech Connect

The differential absorption laser radar for methane sensing detects a leakage of methane gas by emitting into the atmosphere the light of a wavelength absorbable by methane, receiving the light returning after being reflected or scattered on a road or wall surface, etc., and measuring the light intensity lost during the travel. This methane detection system is highly practicable as it makes an instantaneous remote detection possible. The authors have developed a new He-Ne laser that could be used as the light source for the above system. This device emits a two-wavelength laser beam (one wavelength absorbable by methane and the other not absorbable by methane but used for referential purposes) from a single plasma tube, and there is no possibility of the axes of the two-wavelength component deviating from each other. Further, using this laser, they have developed a vehicle-mounted type differential absorption laser radar system which has successfully detected low density methane leakage while the vehicle was moving.

Ueki, T.; Tanaka, H.; Uehara, K.

1988-01-01T23:59:59.000Z

166

Controlling the nonlinear intracavity dynamics of large He-Ne laser gyroscopes  

E-Print Network (OSTI)

A model based on Lamb's theory of gas lasers is applied to a He-Ne ring laser gyroscope in order to estimate and remove the laser dynamics contribution from the rotation measurements. The intensities of the counter-propagating laser beams exiting one cavity mirror are continuously observed together with a monitor of the laser population inversion. These observables, once properly calibrated with a dedicated procedure, allow us to estimate cold cavity and active medium parameters driving the main part of the nonlinearities of the system. The parameters identification and noise subtraction procedure has been verified by means of a Monte Carlo study of the system, and experimentally tested on the G-Pisa ring laser oriented with the normal to the ring plane almost parallel to the Earth rotation axis. In this configuration the Earth rotation-rate provides the maximum Sagnac effect while the contribution of the orientation error is reduced at minimum. After the subtraction of laser dynamics by a Kalman filter, the ...

Cuccato, Davide; Belfi, Jacopo; Beverini, Nicol; Ortolan, Antonello; Di Virgilio, Angela

2013-01-01T23:59:59.000Z

167

A Measurement of the Neutrino Neutral Current Pi0 Cross Section at MiniBooNE  

SciTech Connect

The MiniBooNE neutrino beam and detector at Fermilab are used to study the production of neutral current {pi}{sup 0} events. The cross sections for neutrino interactions with mineral oil (CH{sub 2}) are reported for resonantly produced and coherently produced single {pi}{sup 0} events. We measure a resonant single {pi}{sup 0} cross section of {sigma}({nu}{sub {mu}} N {pi}{sup 0}) = (0.0129 {+-} 0.0011(stat.) {+-} 0.0043(syst.)) x 10{sup -36} cm{sup 2}/CH{sub 2} at a mean neutrino energy of 1.26 GeV. We measure a coherent single {pi}{sup 0} cross section of {sigma}({nu}{sub {mu}} A {yields} {nu}{sub {mu}} A {pi}{sup 0}) = (0.00077 {+-} 0.00016 (stat.) {+-} 0.00036 (syst.)) x 10{sup -36} cm{sup 2}/CH{sub 2} at mean neutrino energy 1.12 GeV.

Raaf, Jennifer Lynne; /Cincinnati U.

2005-05-01T23:59:59.000Z

168

High Level Requirements for the Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

Science Conference Proceedings (OSTI)

The US Department of Energy, Office of Nuclear Energy (DOE-NE), has been tasked with the important mission of ensuring that nuclear energy remains a compelling and viable energy source in the U.S. The motivations behind this mission include cost-effectively meeting the expected increases in the power needs of the country, reducing carbon emissions and reducing dependence on foreign energy sources. In the near term, to ensure that nuclear power remains a key element of U.S. energy strategy and portfolio, the DOE-NE will be working with the nuclear industry to support safe and efficient operations of existing nuclear power plants. In the long term, to meet the increasing energy needs of the U.S., the DOE-NE will be investing in research and development (R&D) and working in concert with the nuclear industry to build and deploy new, safer and more efficient nuclear power plants. The safe and efficient operations of existing nuclear power plants and designing, licensing and deploying new reactor designs, however, will require focused R&D programs as well as the extensive use and leveraging of advanced modeling and simulation (M&S). M&S will play a key role in ensuring safe and efficient operations of existing and new nuclear reactors. The DOE-NE has been actively developing and promoting the use of advanced M&S in reactor design and analysis through its R&D programs, e.g., the Nuclear Energy Advanced Modeling and Simulation (NEAMS) and Consortium for Advanced Simulation of Light Water Reactors (CASL) programs. Also, nuclear reactor vendors are already using CFD and CSM, for design, analysis, and licensing. However, these M&S tools cannot be used with confidence for nuclear reactor applications unless accompanied and supported by verification and validation (V&V) and uncertainty quantification (UQ) processes and procedures which provide quantitative measures of uncertainty for specific applications. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base that will provide technical services and resources for V&V and UQ of M&S in nuclear energy sciences and engineering. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear reactor design, analysis and licensing. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the CASL, NEAMS, Light Water Reactor Sustainability (LWRS), Small Modular Reactors (SMR), and Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve M&S of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs.

Rich Johnson; Hyung Lee; Kimberlyn C. Mousseau

2011-09-01T23:59:59.000Z

169

The Search for Meterorites with Complex Exposure Histories Amoung Ordinary Chondrites with Low 3HE/21NE Ratios  

DOE Green Energy (OSTI)

In calculating cosmic-ray exposure ages of meteorites it is generally assumed that the meteoroids were expelled from a shielded position within their parent body and then experienced a single stage exposure before colliding with Earth. The combination of noble gas and radionuclide measurements in several large meteorites, such as Jilin and Bur Ghelaui, have revealed complex exposure histories: i.e. an initial exposure on the surface of an asteroid (or within meter-sized meteoroid), followed by a second exposure as a smaller object. In fact, orbital dynamics calculations predicted that at least 30% of the meteorites arriving on Earth experienced two- or multiple-stage exposure histories [1]. More recently, after the recognition that the Yarkovsky effect plays an important role in delivering meteorites from the asteroid belt to Earth-crossing orbits, it was confirmed that complex exposure histories should be common [2]. Nevertheless, despite the ability to measure a wide range of radionuclides with accelerator mass spectrometry (AMS), only a few meteorites with complex exposure histories have been identified [e.g. 3,4]. The question is whether the relatively paucity of complex exposure histories is real or have we simply overlooked complex-exposure histories. In this work we focus on meteorites with low {sup 3}He/{sup 21}Ne ratios, since it is known that most meteorites with complex exposure histories have relatively low {sup 3}He/{sup 21}Ne ratios, i.e. the {sup 3}He/{sup 21}Ne ratio is below the ''Bern-line''. Several hypotheses have been suggested for these low {sup 3}He/{sup 21}Ne ratios, including solar heating in low-perihelion orbits, shock-related diffusion of He during the collision that ejected the meteoroid, or an artifact of high shielding conditions [4]. The first two hypotheses seem to be supported by low radiogenic {sup 4}He concentrations in samples with low {sup 3}He, whereas Monte Carlo calculations have shown that some of the low {sup 3}He/{sup 21}Ne ratios may be due to high shielding conditions in objects with radii > 1m [5]. To elucidate these issues, we selected 15 samples with known noble gas concentrations [6] for radionuclide studies and obtained aliquots of the samples adjacent to those measured for noble gases. The specific goal is the identification of complex exposure histories among samples having low {sup 3}He/{sup 21}Ne ratios. All samples have {sup 3}He deficiencies of >20% relative to the ''Bern-line'' (Table 1). Most of the selected samples also have low {sup 22}Ne/{sup 21}Ne ratios ({le}1.1), indicative of high shielding during most of their cosmic-ray exposure (Table 1), whereas one sample (Suizhou) was selected because of its relatively low {sup 81}Kr concentration [7]. In addition, we selected QUE 93021, for which initial radionuclide results suggested a short exposure age. Here we present cosmogenic {sup 10}Be, {sup 26}Al and {sup 36}Cl in stone and metal fractions for the 16 ordinary chondrites listed in Table 1.

Welton, K C; Nishiizumi, K; Caffee, M W

2001-04-30T23:59:59.000Z

170

A measurement of the neutral current neutrino-nucleon elastic cross section at MiniBooNE  

SciTech Connect

The neutral current neutrino-nucleon elastic interaction {nu} N {yields} {nu} N is a fundamental process of the weak interaction ideally suited for characterizing the structure of the nucleon neutral weak current. This process comprises {approx}18% of neutrino events in the neutrino oscillation experiment, MiniBooNE, ranking it as the experiment's third largest process. Using {approx}10% of MiniBooNE's available neutrino data, a sample of these events were identified and analyzed to determine the differential cross section as a function of the momentum transfer of the interaction, Q{sup 2}. This is the first measurement of a differential cross section with MiniBooNE data. From this analysis, a value for the nucleon axial mass M{sub A} was extracted to be 1.34 {+-} 0.25 GeV consistent with previous measurements. The integrated cross section for the Q{sup 2} range 0.189 {yields} 1.13 GeV{sup 2} was calculated to be (8.8 {+-} 0.6(stat) {+-} 0.2(syst)) x 10{sup -40} cm{sup 2}.

Cox, David Christopher; /Indiana U.

2008-02-01T23:59:59.000Z

171

C:\DOCS\NEW-VER.FRM  

NLE Websites -- All DOE Office Websites (Extended Search)

Verification Report Verification Report This form, or a similar form, is used to maintain quality assurance over the Statistical Analysis System (SAS ) or comparable program used to calculate excess cancer risks or hazard quotients for the ® Department of Energy Oak Ridge Operations (DOE-ORO) Environmental Management (EM) Program. Specifically, this form verifies the use of correct exposure equations, exposure parameters, and toxicity values (or ecotoxicological benchmarks) and verifies the correct calculation of exposures, excess cancer risks, and hazard quotients for all human health or ecological risk assessments that involve risk calculations or the development of Preliminary Remediation Goals (PRGs). In addition, this form presents issues identified during the verification and their resolutions.

172

aps2007posterVer6_dgw  

NLE Websites -- All DOE Office Websites (Extended Search)

Hall coefficient ~ 2 Hall coefficient ~ 2 throughput ~ 0.4 Pa*m 3 /s EXPERIMENT Surface Science Station (S 3 ): a real-time diagnostic of boronization in Alcator C-Mod R. Ochoukov 1), B. Lipschultz 1), D.G. Whyte 1) N. Gierse 2), S. Harrison 3) 1) MIT Plasma Science and Fusion Center, Cambridge, MA, 02139, USA 2) University of Cologne, Cologne, Germany 3) University of Wisconsin - Madison, WI 53711, USA Figure 2: Deposition rate profile as a function of the gas throughput. Figure 3: Deposition rate and I sat profile as a function of the radial distance to EC resonance. Figure 7: MC simulation results of boron deposition as a function of the surface orientation to the B field and comparison with the experiment. (a) MC simulation and (b) experimental results. Figure 6: MC simulation results of boron deposition on

173

2001 IG Report WEB Ver..pub  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department Department of Energy Office of Inspector General Semiannual Report to Congress October 1, 2000 to March 31, 2001 Inspector General's Message Inspector General Testifies on Top 10 Management Challenges Management Challenges and Significant Accomplishments Reports Statistical Data Page 1 Page 1 Page 3 Page 31 Page 35 DOE/IG-0022 April 2001 Did You Know? "The Department of Energy has installed two low-sulfur light bulbs as a test at its Forrestal building headquarters in Washington, D.C." (See front cover) Source: National Energy Policy, Report of the National Energy Policy Group, May 2001. 43 Dear Secretary Abraham: I am pleased to submit the Office of Inspector General's (OIG) Semiannual Report to Congress. The Report summarizes significant OIG activities and accomplishments during the 6-month period ending March 31, 2001. The Inspector General Act, as amended, requires you to forward

174

2012 Workshop Agenda_Ver_25.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tuesday, April 3 Tuesday, April 3 7:00 AM 8:00 AM 60 Workshop Registration 8:00 AM 8:05 AM 5 Welcome and Workshop Logistics John Makepeace, Office of Engineering and Construction Management 8:05 AM 8:20 AM 15 Opening Remarks Ingrid Kolb, Director, Office of Management 8:20 AM 8:40 AM 20 Achieving Management and Operational Excellence Melvin G. Williams, Associate Deputy Secretary 8:40 AM 8:55 AM 15 Break 8:55 AM 9:45 AM 50 Project Management Success: Are We There Yet? Paul Bosco, Director, Office of Procurement and Assistance Management & Acting Director, Office of Engineering and Construction Management 9:45 AM 10:35 AM 50 Building an Owner's Cost Engineering Organizational Capability Tim Mitchell, Cost Engineering Manager, Chevron Project Resources Company 10:35 AM 10:50 AM 15 Break 10:50 AM

175

2011 Workshop Agenda_Ver_19.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

& Construction Management 11:15 AM 11:30 AM 15 Break 11:30 AM 12:00 PM 30 EERE's new LEED "Platinum" Facility Jeff Baker, Director, Office of Laboratory Operations, Office of...

176

real_property_asset_ver_10.indd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOEME-0060 Editors Notes: This Real Property Asset Management Plan covers the Department of Energy including the National Nuclear Security Administration, the Energy Information...

177

2011 Workshop Agenda_Ver_21.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Federal Procurement Policy, Office of Management & Budget 10:25 AM 11:15 AM 50 The New DOE O 413.3B Paul Bosco, Director, Office of Engineering & Construction Management 11:15...

178

real_property_asset_ver_10.indd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management, Budget and Evaluation. The point of contact for this document is Eduard A. Dailide, P Management, Budget and Evaluation. The point of contact for this document is Eduard A. Dailide, P .E. who can be reached at (202) 586-5422 or by e-mail to ed.dailide@hq.doe.gov. Cover Photo: Night, in the form of a crescent moon, overtakes the fading light of day beyond Wilson Hall at Fermi National Accelerator Laboratory. i DEPUTY SECRETARY'S MESSAGE I am proud to present the Department of Energy's 2005 Real Property Asset Management Plan. The success of the Department of Energy in meet- ing its mission is directly linked to the effi cient and effective management of its real property portfolio. The portfolio is comprised of diverse, technically complex, and one-of-a-kind facilities with a value of over $77 billion. It is a mission enabler not only

179

2011 Workshop Agenda_Ver_9.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2011 DOE Project Management Workshop 2011 DOE Project Management Workshop Aligning Success: Contract and Project Management START STOP DUR. (min.) TOPIC SPEAKER Tuesday, March 15, General Session 7:00 AM 8:00 AM 60 Workshop Registration Day #1 8:00 AM 8:05 AM 5 Welcome and Workshop Logistics John Makepeace, Office of Engineering and Construction Management (OECM) 8:05 AM 8:20 AM 15 Opening Remarks Ingrid Kolb, Director, Office of Management (MA) 8:20 AM 8:50 AM 30 Project Management Sucesses Daniel Poneman, Deputy Secretary of Energy (pending) 8:50 AM 9:20 AM 30 Project Management Challenges Ms. Madelyn R. Creedon, Senate Staff (Pending) 9:20 AM 9:35 AM 15 Break 9:35 AM 10:25 AM 50 The New DOE O 413.3B Paul Bosco, Director, Office of Engineering & Construction Management (OECM) 10:25 AM 10:55 AM 30 EERE's new LEED "Platinum" Facility

180

Determination of the {sup 22}Ne{sub nucl}/{sup 4}He{sub rad} ratio in natural uranium-rich fluorite by mass spectrometry  

Science Conference Proceedings (OSTI)

A determination by noble gas mass spectrometry of {sup 22}Ne production through the combined reactions {sup 19}F({alpha},n){sup 22}Na({beta}{sup +}){sup 22}Ne and {sup 19}F({alpha},p){sup 22}Ne on natural calcium fluoride is made for the first time. Six samples of U-rich fluorite from a fluorspar deposit in Mexico were used to determine the {sup 22}Ne{sub nucl}/{sup 4}He{sub rad} ratio generated by the spontaneous decay of U during the last 32 Ma. The obtained ratio (1.33 {+-} 0.11) x10{sup -5} (95% confidence), is compared to other experimental data on natural uranium oxides and theoretical values.

Sole, Jesus; Pi, Teresa [Instituto de Geologia, Universidad Nacional Autonoma de Mexico, Cd. Universitaria, Coyoacan, 04510 Mexico D.F. (Mexico)

2006-10-15T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Measurement of the reaction O-17(?,n)Ne-20 and its impact on the s process in massive stars  

E-Print Network (OSTI)

The ratio between the rates of the reactions O-17(\\alpha,n)Ne-20 and O-17(\\alpha,\\gamma)Ne-21 determines whether O-16 is an efficient neutron poison for the s process in massive stars, or if most of the neutrons captured by O-16(n,\\gamma) are recycled into the stellar environment. This ratio is of particular relevance to constrain the s process yields of fast rotating massive stars at low metallicity. Recent results on the (\\alpha,\\gamma) channel have made it necessary to measure the (\\alpha,n) reaction more precisely and investigate the effect of the new data on s process nucleosynthesis in massive stars. We present a new measurement of the O-17(\\alpha, n) reaction using a moderating neutron detector. In addition, the (\\alpha, n_1) channel has been measured independently by observation of the characteristic 1633 keV \\gamma-transition in Ne-20. The reaction cross section was determined with a simultaneous R-matrix fit to both channels. (\\alpha,n) and (\\alpha, \\gamma) resonance strengths of states lying below the covered energy range were estimated using their known properties from the literature. A new O-17(\\alpha,n) reaction rate was deduced for the temperature range 0.1 GK to 10 GK. It was found that in He burning conditions the (\\alpha,\\gamma) channel is strong enough to compete with the neutron channel. This leads to a less efficient neutron recycling compared to a previous suggestion of a very weak (\\alpha,\\gamma) channel. S process calculations using our rates confirm that massive rotating stars do play a significant role in the production of elements up to Sr, but they strongly reduce the s process contribution to heavier elements.

A. Best; M. Beard; J. Grres; M. Couder; R. deBoer; S. Falahat; R. T. Gray; A. Kontos; K. -L. Kratz; P. J. LeBlanc; Q. Li; S. O'Brien; N. zkan; M. Pignatari; K. Sonnabend; R. Talwar; W. Tan; E. Uberseder; M. Wiescher

2013-04-23T23:59:59.000Z

182

A Measurement of the muon neutrino charged current quasielastic interaction and a test of Lorentz violation with the MiniBooNE experiment  

SciTech Connect

The Mini-Booster neutrino experiment (MiniBooNE) at Fermi National Accelerator Laboratory (Fermilab) is designed to search for {nu}{sub {mu}} {yields} {nu}{sub e} appearance neutrino oscillations. Muon neutrino charged-current quasi-elastic (CCQE) interactions ({nu}{sub {mu}} + n {yields} {mu} + p) make up roughly 40% of our data sample, and it is used to constrain the background and cross sections for the oscillation analysis. Using high-statistics MiniBooNE CCQE data, the muon-neutrino CCQE cross section is measured. The nuclear model is tuned precisely using the MiniBooNE data. The measured total cross section is {sigma} = (1.058 {+-} 0.003 (stat) {+-} 0.111 (syst)) x 10{sup -38} cm{sup 2} at the MiniBooNE muon neutrino beam energy (700-800 MeV). {nu}{sub e} appearance candidate data is also used to search for Lorentz violation. Lorentz symmetry is one of the most fundamental symmetries in modern physics. Neutrino oscillations offer a new method to test it. We found that the MiniBooNE result is not well-described using Lorentz violation, however further investigation is required for a more conclusive result.

Katori, Teppei; /Indiana U.

2008-12-01T23:59:59.000Z

183

The Uncertainties in the 22Ne + alpha-capture Reaction Rates and the Production of the Heavy Magnesium Isotopes in Asymptotic Giant Branch Stars of Intermediate Mass  

E-Print Network (OSTI)

We present new rates for the 22Ne(alpha, n)25Mg and 22Ne(alpha,gamma)26Mg reactions, with uncertainties that have been considerably reduced compared to previous estimates, and we study how these new rates affect the production of the heavy magnesium isotopes in models of intermediate mass Asymptotic Giant Branch (AGB) stars of different initial compositions. All the models have deep third dredge-up, hot bottom burning and mass loss. Calculations have been performed using the two most commonly used estimates of the 22Ne + alpha rates as well as the new recommended rates, and with combinations of their upper and lower limits. The main result of the present study is that with the new rates, uncertainties on the production of isotopes from Mg to P coming from the 22Ne + alpha-capture rates have been considerably reduced. We have therefore removed one of the important sources of uncertainty to effect models of AGB stars. We have studied the effects of varying the mass-loss rate on nucleosynthesis and discuss other uncertainties related to the physics employed in the computation of stellar structure, such as the modeling of convection, the inclusion of a partial mixing zone and the definition of convective borders. These uncertainties are found to be much larger than those coming from 22Ne + alpha-capture rates, when using our new estimates. Much effort is needed to improve the situation for AGB models.

A. Karakas; M. Lugaro; M. Wiescher; J. Goerres; C. Ugalde

2006-01-27T23:59:59.000Z

184

Measuring the speed of light using beating longitudinal modes in an open-cavity HeNe laser  

E-Print Network (OSTI)

We describe an undergraduate laboratory that combines an accurate measurement of the speed of light, a fundamental investigation of a basic laser system, and a nontrivial use of statistical analysis. Students grapple with the existence of longitudinal modes in a laser cavity as they change the cavity length of an adjustable-cavity HeNe laser and tune the cavity to produce lasing in the TEM$_{00}$ mode. For appropriate laser cavity lengths, the laser gain curve of a HeNe laser allows simultaneous operation of multiple longitudinal modes. The difference frequency between the modes is measured using a self-heterodyne detection with a diode photodetector and a radio frequency spectrum analyzer. Asymmetric effects due to frequency pushing and frequency pulling, as well as transverse modes, are minimized by simultaneously monitoring and adjusting the mode structure as viewed with a Fabry-Perot interferometer. The frequency spacing of longitudinal modes is proportional to the inverse of the cavity length with a prop...

D'Orazio, Daniel J; Schultz, Justin T; Sidor, Daniel; Best, Micheal; Goodfellow, Kenneth; Scholten, Robert E; White, James D; 10.1119/1.3299281

2010-01-01T23:59:59.000Z

185

Direct Total Cross Section Measurement of the 16O(?,?)20Ne Reaction at Ec.m. = 2.26 MeV  

Science Conference Proceedings (OSTI)

In stellar helium burning, (16)O represents the endpoint of the helium-burning sequence due to the low rate of (16)O(alpha,gamma)(20)Ne. We present a new direct measurement of the total capture reaction rate of (16)O(alpha,gamma)(20)Ne at E(c.m.) = 2.26MeV employing the DRAGON recoil separator. For the first time, the total S factor and its contributing direct capture transitions could be determined in one experiment.

Hager, Ulrike; Brown, James R.; Buchmann, Lothar R.; Carmona-Gallardo, Mariano; Erikson, Luke E.; Fallis, Jennifer S.; Greife, Uwe; Hutcheon, Dave; Ottewell, Dave; Ruiz, Chris; Sjue, Sky; Vockenhuber, Cristof

2011-08-23T23:59:59.000Z

186

35 COFibE, Series A. U. S. ATOXIC ENERGY CCMMISSION r'C Cj NE# YORK OPERATIONS OFFICE  

Office of Legacy Management (LM)

COFibE, Series A. COFibE, Series A. - U. S. ATOXIC ENERGY CCMMISSION r'C Cj NE# YORK OPERATIONS OFFICE HEkLTH AND SAFETY DIVISION (Merril Eicsnbud, Dirsator) MONTHLY REPORT OF FIELD ACTIVITIES (This report%v,rs%~~~nth period) Indusorial Ii~iene Branoh m a . . 0 . . c . . . o W. B. Harris, Chief Radiation Branch . y y e 0e . e . e . . . . e . . . Hanson Blatz, Chief Fi:e and Accident Branch D e a o o . . . ..s . . B. J. Kehoe, Chief Medical Advioer, Dr. J. A. Quiglsy Siometrician, Dr. A. E. Brandt TABLF OF COEpTmS PRODUCTION COWTRACTORS ._ Feed Nabrlals Production Centor '$iiddlcsexSampling Plnnt Harshaw ChuoicalCompa~ Wlin&rodt Chen!icrl Works tie. Ontario Storage Area b Vit*o Mnufacturing CompaW B4ikhem Steel F'lrnt - IpcknuMnr Clifton Roducts CompvIy Drush Bcx@.Uun~ Company - Luckcy

187

REP&V TO ATTNJF: NE-23 SUWECC Commercial Facilities Used by National Lead Company of Ohio in Support  

Office of Legacy Management (LM)

REP&V TO REP&V TO ATTNJF: NE-23 SUWECC Commercial Facilities Used by National Lead Company of Ohio in Support 'of FMPC Operations TO: Robert E. Lynch Procuresnent and CorXracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decormnissioning Projects (DFSP) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (NED) and Atomic Energy Commission (AEC) which may have been radioactively contaminated as a result of these operations, (2) to determine if the facilities require remedial action, and (3) where DOE has authority, to conduct the remedial action. Authority for remedial action under FUSRAP is

188

REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support  

Office of Legacy Management (LM)

x:Y" x:Y" . .' 3023 I\ \ 'a' '. Unita? -&&s Coverament , ,Q,.l. ),&, ,(>.. Department of Energy riGmorandum / d6a 2/. $3 DATE: JL(L 2 8 ;;$5 co. /3 .-J/ co,/3 REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decommissioning Projects (DFSD) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FuSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (NED) and Atomic Energy Commission (AEC) which may have been radioactively contaminated as a result of these operations, (2) to determine if the

189

Using the X-FEL to photo-pump X-ray laser transitions in He-like Ne  

SciTech Connect

Nearly four decades ago H-like and He-like resonantly photo-pumped laser schemes were proposed for producing X-ray lasers. However, demonstrating these schemes in the laboratory has proved to be elusive because of the difficulty of finding a strong resonant pump line. With the advent of the X-ray free electron laser (X-FEL) at the SLAC Linac Coherent Light Source (LCLS) we now have a tunable X-ray laser source that can be used to replace the pump line in previously proposed laser schemes and allow researchers to study the physics and feasibility of resonantly photo-pumped laser schemes. In this paper we use the X-FEL at 1174 eV to photo-pump the singly excited 1s2p state of He-like Ne to the doubly excited 2p3p state and model gain on the 2p3p-2p2s transition at 175 eV and the 2p3p-1s3p transition at 1017 eV. One motivation for studying this scheme is to explore possible quenching of the gain due to strong non-linear coupling effects from the intense X-FEL beam We compare this scheme with photo-pumping the He-like Ne ground state to the 1s3p singly excited state followed by lasing on the 3p-2s and 3d-2p transitions at 158 and 151 eV. Experiments are being planned at LCLS to study these laser processes and coherent quantum effects.

Nilsen, J; Rohringer, N

2011-08-30T23:59:59.000Z

190

PETROPHYSICAL INVESTIGATION OF THE SECONDARY RECOVERY POTENTIAL IN THE CHERRY CANYON FORMATION NE LEA FIELD LEA COUNTY, NEW MEXICO  

Science Conference Proceedings (OSTI)

Read and Stevens has proposed the evaluation of the waterflood potential from the Cherry Canyon formation in the NE Lea Field in lea County, New Mexico. Much of the development in this area is approaching primary recovery limitations; additional recovery of remaining oil reserves by waterflood needs to be evaluated. The Cherry Canyon formation is composed of fine grained sandstone, containing clay material which results in high water saturation, and also has the tendency to swell and reduce reservoir permeability--the ability of fluid to flow through the rock pores and fractures. There are also abundant organic materials that interfere with obtaining reliable well logs. These complications have limited oil in place calculations and identification of net pay zones, presenting a challenge to the planned waterflood. Core analysis of the Cherry Canyon should improve the understanding of existing well logs and possibly indicate secondary recovery measures, such as waterflood, to enhance field recovery. Lacking truly representative core to provide accurate analyses, Read and Stevens will obtain and preserve fresh core. The consulting firm of T. Scott Hickman and Associates will then collaborate on special core analyses and obtain additional well logs for a more detailed analysis of reservoir properties. The log interpretation will be compared to the core analysis results, and the entire collected data set will be used to assess the potential and economic viability of successfully waterflooding the identified oil zones. Successful results from the project will improve accuracy of log interpretation and establish a methodology for evaluating secondary recovery by waterflood.

T. Scott Hickman

2002-06-01T23:59:59.000Z

191

Measurements of nuclear $\\gamma$-ray line emission in interactions of protons and $\\alpha$ particles with N, O, Ne and Si  

E-Print Network (OSTI)

$\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very in...

Benhabiles-Mezhoud, H; Thibaud, J -P; Tatischeff, V; Deloncle, I; Coc, A; Duprat, J; Hamadache, C; Lefebvre-Schuhl, A; Dalouzy, J -C; De Grancey, F; De Oliveira, F; Dayras, F; De Srville, N; Pellegriti, M -G; Lamia, L; Ouichaoui, S

2010-01-01T23:59:59.000Z

192

THE INFLUENCE OF UNCERTAINTIES IN THE {sup 15}O({alpha}, {gamma}){sup 19}Ne REACTION RATE ON MODELS OF TYPE I X-RAY BURSTS  

SciTech Connect

We present a Monte Carlo calculation of the astrophysical rate of the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction based on an evaluation of published experimental data. By considering the likelihood distributions of individual resonance parameters derived from measurements, estimates of upper and lower limits on the reaction rate at the 99.73% confidence level are derived in addition to the recommended, median value. These three reaction rates are used as input for three separate calculations of Type I X-ray bursts (XRBs) using spherically symmetric, hydrodynamic simulations of an accreting neutron star. In this way the influence of the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction rate on the peak luminosity, recurrence time, and associated nucleosynthesis in models of Type I XRBs is studied. Contrary to previous findings, no substantial effect on any of these quantities is observed in a sequence of four bursts when varying the reaction rate between its lower and upper limits. Rather, the differences in these quantities are comparable to the burst-to-burst variations with a fixed reaction rate, indicating that uncertainties in the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction rate do not strongly affect the predictions of this Type I XRB model.

Davids, Barry [TRIUMF, Vancouver, BC V6T 2A3 (Canada); Cyburt, Richard H. [Joint Institute for Nuclear Astrophysics and National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI (United States); Jose, Jordi [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya and Institut d'Estudis Espacials de Catalunya, Barcelona (Spain); Mythili, Subramanian [Physics Department, George Mason University, Fairfax, VA (United States)

2011-07-01T23:59:59.000Z

193

Measurement of Neutrino-Nucleon Neutral-Current Elastic Scattering Cross-section at SciBooNE  

SciTech Connect

In this thesis, results of neutrino-nucleon neutral current (NC) elastic scattering analysis are presented. Neutrinos interact with other particles only with weak force. Measurement of cross-section for neutrino-nucleon reactions at various neutrino energy are important for the study of nucleon structure. It also provides data to be used for beam flux monitor in neutrino oscillation experiments. The cross-section for neutrino-nucleon NC elastic scattering contains the axial vector form factor G{sub A}(Q{sup 2}) as well as electromagnetic form factors unlike electromagnetic interaction. G{sub A} is propotional to strange part of nucleon spin ({Delta}s) in Q{sup 2} {yields} 0 limit. Measurement of NC elastic cross-section with smaller Q{sup 2} enables us to access {Delta}s. NC elastic cross-sections of neutrino-nucleon and antineutrino-nucleon were measured earlier by E734 experiment at Brookheaven National Laboratory (BNL) in 1987. In this experiment, cross-sections were measured in Q{sup 2} > 0.4 GeV{sup 2} region. Result from this experiment was the only published data for NC elastic scattering cross-section published before our experiment. SciBooNE is an experiment for the measurement of neutrino-nucleon scattering cross-secitons using Booster Neutrino Beam (BNB) at FNAL. BNB has energy peak at 0.7 GeV. In this energy region, NC elastic scattering, charged current elastic scattering, charged current pion production, and neutral current pion production are the major reaction branches. SciBar, electromagnetic calorimeter, and Muon Range Detector are the detectors for SciBooNE. The SciBar consists of finely segmented scintillators and 14336 channels of PMTs. It has a capability to reconstruct particle track longer than 8 cm and separate proton from muons and pions using energy deposit information. Signal of NC elastic scattering is a single proton track. In {nu}p {yields} {nu}p process, the recoil proton is detected. On the other hand, most of {nu}n {yields} {nu}n is invisible because there are only neutral particles in final state, but sometimes recoil neutron is scattered by proton and recoil proton is detected. Signal of this event is also single proton track. Event selection for the single proton track events using geometrical and dE/dx information of reconstructed track is performed. After the event selection, NC elastic scattering data sample is obtained. They includes {nu}p {yields} {nu}p and {nu}n {yields} {nu}n is obtained. Absolute cross-section as a function of Q{sup 2} is evaluated from this NC elastic scattering data sample.

Takei, Hideyuki; /Tokyo Inst. Tech.

2009-02-01T23:59:59.000Z

194

NE Press Releases  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

press-releases 1000 Independence Ave. SWWashington DC press-releases 1000 Independence Ave. SWWashington DC 20585202-586-5000 en Energy Department Announces New Investment in Innovative Small Modular Reactor http://energy.gov/articles/energy-department-announces-new-investment-innovative-small-modular-reactor Energy Department Announces New Investment in Innovative Small Modular Reactor

195

NE photo galleries  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis (11) Programs: Advanced Fuel Cycle Initiative (6) Engineering and Structural Mechanics (3) Heat Transfer and Fluid Mechanics (6) Risk Methodology and Evaluation (2)...

196

A survey of Existing V&V, UQ and M&S Data and Knowledge Bases in Support of the Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

The Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Oak Ridge National Laboratory, Utah State University and others. The objective of this consortium is to establish a comprehensive knowledge base to provide Verification and Validation (V&V) and Uncertainty Quantification (UQ) and other resources for advanced modeling and simulation (M&S) in nuclear reactor design and analysis. NE-KAMS will become a valuable resource for the nuclear industry, the national laboratories, the U.S. NRC and the public to help ensure the safe operation of existing and future nuclear reactors. A survey and evaluation of the state-of-the-art of existing V&V and M&S databases, including the Department of Energy and commercial databases, has been performed to ensure that the NE-KAMS effort will not be duplicating existing resources and capabilities and to assess the scope of the effort required to develop and implement NE-KAMS. The survey and evaluation have indeed highlighted the unique set of value-added functionality and services that NE-KAMS will provide to its users. Additionally, the survey has helped develop a better understanding of the architecture and functionality of these data and knowledge bases that can be used to leverage the development of NE-KAMS.

Hyung Lee; Rich Johnson, Ph.D.; Kimberlyn C. Moussesau

2011-12-01T23:59:59.000Z

197

Real-WoRld Technology TesTs  

NLE Websites -- All DOE Office Websites (Extended Search)

drillbit is used for seismic while drilling, enabling real-time imaging in deep HPHT wells. Robert P. Radtke, Technology International, Inc.; and Mandy Cepeda, RMOTC An...

198

Real-WoRld Technology TesTs  

NLE Websites -- All DOE Office Websites (Extended Search)

Electric submersible pumps (ESPs) are a versatile means of Electric submersible pumps (ESPs) are a versatile means of artificial lift used in oil and water wells. A drawback to an ESP installation is that it is a complex operation with considerable equipment, personnel and time required. When a remove/re- pair/replace operation is necessary, the same considerations are required. The conventional methodology requires a service rig and crew to pull and re-install the tubing; a cable spooler for the electric cable; and banding personnel and equipment. In addition to the time and expense, there are safety and risk is- sues associated with handling the tubing and cable. Zeitecs Inc. developed a technology consisting of a perma- nent component installed at the bottom of the tubing and a retrievable component. The pump, seal and motor of the ESP

199

Real-WoRld Technology TesTs  

NLE Websites -- All DOE Office Websites (Extended Search)

strong, semi-permeable membrane that removes, under pressure, dissolved salts including fluoride, chlorine, calcium and magnesium. RO filters also remove some bacteria and...

200

Real-WoRld Technology TesTs  

NLE Websites -- All DOE Office Websites (Extended Search)

The efficiency of the cleaning pro- cess. The equipment configuration is shown in Fig. 2. Weather and field con- ditions on the days of the test varied among cold, mild, windy,...

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Real-WoRld Technology TesTs  

NLE Websites -- All DOE Office Websites (Extended Search)

near Casper, Wyoming. INTRODUCTION Considering that the majority of US land oil wells are produced through artifi- cial lift, there is an increasing need to eas- ily...

202

SEI-TES system testing, evaluation and simulation  

SciTech Connect

The South Dakota State University solar energy intensifier-thermal energy storage unit was mathematically simulated using basic heat transfer and fluid flow equations. The system was field tested for in-storage grain drying and ventilation air pre-heating. A comparison between actual output data and modeled output shows good correlation.

Van Zweden, J.; Christianson, L.L.; Hellickson, M.A.

1982-12-01T23:59:59.000Z

203

Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009  

SciTech Connect

Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'

None

2009-06-08T23:59:59.000Z

204

Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009  

SciTech Connect

Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'

2009-06-08T23:59:59.000Z

205

Direct total cross section measurement of the {sup 16}O({alpha}, {gamma}){sup 20}Ne reaction at E{sub c.m.}=2.26 MeV  

Science Conference Proceedings (OSTI)

In stellar helium burning, {sup 16}O represents the endpoint of the helium-burning sequence due to the low rate of {sup 16}O({alpha},{gamma}){sup 20}Ne. We present a new direct measurement of the total capture reaction rate of {sup 16}O({alpha},{gamma}){sup 20}Ne at E{sub c.m.}=2.26 MeV employing the DRAGON recoil separator. For the first time, the total S factor and its contributing direct capture transitions could be determined in one experiment.

Hager, U.; Greife, U. [Colorado School of Mines, Golden, Colorado (United States); Brown, J. R. [Department of Physics, University of York, York, YO10 5DD (United Kingdom); Buchmann, L.; Fallis, J.; Hutcheon, D.; Ottewell, D.; Ruiz, C.; Sjue, S. [TRIUMF, Vancouver, Canada V6T 2A3 (Canada); Carmona-Gallardo, M. [Instituto de Estructura de la Materia, CSIC E-28006 Madrid (Spain); Erikson, L. [Pacific Northwest National Laboratory, Richland, WA (United States); Vockenhuber, C. [ETH Zurich, Zurich (Switzerland)

2011-08-15T23:59:59.000Z

206

LCLS-scheduling-run_V_Ver9c.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

Tue Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Day Com Com Com Com Com L421 Coffee Night L477 Robinson Gruebel (L304, run 4) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Thur Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Day L498 Yachandra L487 Sokoloswski-Tinten IH Bozek L447 Harmand Night IH Lemke L396 Scherz L396 Scherz L409 Boeglin 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Day L399/433 Fromme/Neutze L467 Madsen Night Com Com Com L467 Mad L399/433 Fromme Com Com 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri

207

Ver. EN2011-06-16 Program description  

E-Print Network (OSTI)

and Systems Biology, Medical Imaging, Medical Technology, Molecular Science and Technology, or Medical Experimental Methods in Molecular Biophysics Biological and Biomedical Physics 7.5 Fiber-optical Communication Physics 10.5 Photonic Materials and Processing Technology Optics and Photonics 10.5 Photo Counting Systems

Haviland, David

208

Secure View 3 (Ver. 3.9.1)  

Science Conference Proceedings (OSTI)

... 1,265938 title Popular plumbing problem solving and remodeling DIY discuss ion advice forum site. visit Count 1 http://www ...

2012-10-24T23:59:59.000Z

209

Market Design Simulations with Variable Energy Resources (VERs) (Presentation)  

Science Conference Proceedings (OSTI)

Presented at the FERC Technical Conference, 29 June 2011, Washington, D.C. This presentation describes NREL research regarding variable generation resources, operating reserves, unit commitment, economic dispatch, and introduces a new and novel modeling tool called 'FESTIV.'

Ela, E.

2011-06-01T23:59:59.000Z

210

UniGuide: vers un guide dynamique pour Unistroke  

Science Conference Proceedings (OSTI)

UniGuide is a support system to use the Unistroke gesture keyboard. It is based on dynamic guides to help the user to perform the gesture associated with the character he wants. To enhance the visual feedback, the guides are spread over several pages ... Keywords: dynamic guides, text entry, unistroke

Jrmy Thimont; Benot Martin

2010-09-01T23:59:59.000Z

211

Microsoft Word - Final AEP EA, October 2010 ver 2  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ASSESSMENT DOE/EA-1727 DEPARTMENT OF ENERGY LOAN GUARANTEE TO AE POLYSILICON CORPORATION FOR CONSTRUCTION AND STARTUP OF THEIR PHASE 2 POLYSILICON PRODUCTION FACILITY IN FAIRLESS HILLS, PENNSYLVANIA U.S. Department of Energy Loan Guarantee Program Office Washington, DC 20585 November, 2010 TABLE OF CONTENTS Section Page November 2010 Final Environmental Assessment i EXECUTIVE SUMMARY ........................................................................................................... ES-1 1. PURPOSE AND NEED 1.1 Purpose and Need ................................................................................................................. 1-1 1.2 Background ............................................................................................................................ 1-1

212

Microsoft Word - US_Japan_REE_agenda_ver7.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agenda
 Agenda
 
 U.S.
-
Japan
Roundtable
on
Rare
Earth
Elements
Research
and
 Development
for
Clean
Energy
Technologies
 
 Thursday-Friday,
November
18-19,
2010
 Building
453,
Black
Diamond
Conference
Room
1012
 
 U.S.
Department
of
Energy
 Lawrence
Livermore
National
Laboratory
 
 THURSDAY,
November
18,
2010
 7:30

 Badging
Westgate
Badge
Office
 
 Met
by
Evelyn
Laurant
 
 8:30
-
9:00
 Welcome
and
Introduction
to
the
Roundtable
 
 Al
Ramponi,
Lawrence
Livermore
National
Laboratory
 
 Kay
Thompson
and
Diana
Bauer,
Department
of
Energy
 
 9:00
-
9:30
 A
Brief
Overview
of
the
Rare
Earths
Crisis


213

DISTRIBUTION - ver2 - Matlock AISI Workshop Feb2012  

Science Conference Proceedings (OSTI)

... (% ) 600 - Conventional HSS First Generation AHSS ISO ... Baosteel's Special Flexible HSS Line Opened March 2009 Multi-purpose processing ...

2012-10-09T23:59:59.000Z

214

NIST: Electron-Impact Cross Section Database - Ver. History  

Science Conference Proceedings (OSTI)

... date]. Version 3.0 August 2004, Electron-impact cross section data has been added for many molecules and atoms. Version ...

215

LCLS-scheduling-run_6_Ver4.xlsx  

NLE Websites -- All DOE Office Websites (Extended Search)

9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon Tue Wed Thu Fri Sat Sun Mon...

216

University of Calgary Design Standards 2013 Ver. 1.1  

E-Print Network (OSTI)

Sustainability 4.2 Room Acoustics 4.3 Accessibility 4.4 Building & Site Safety 5.0 Product and System Requirements 5.1 Basic Construction Materials & Systems 5.2 Exterior Wall Systems 5.3 Roofing 5.4 Reserved for Future 5.5 Doors & Hardware 5.6 Glazing Systems 5.7 Flooring 5.8 Ceilings 5.9 Interior Wall Types

Maurer, Frank

217

University of Calgary Design Standards 2013 Ver. 1.0  

E-Print Network (OSTI)

Sustainability 4.2 Room Acoustics 4.3 Accessibility 4.4 Building & Site Safety 5.0 Product and System Requirements 5.1 Basic Construction Materials & Systems 5.2 Exterior Wall Systems 5.3 Roofing 5.4 Reserved for Future 5.5 Doors & Hardware 5.6 Glazing Systems 5.7 Flooring 5.8 Ceilings 5.9 Interior Wall Types

Maurer, Frank

218

Clouds, Aerosols and Precipitation in the Marine Boundary Layer (CAP-MBL) AMF Deployment Graciosa Island, Azores, NE Atlantic Ocean May 2009-December 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

the Marine Boundary Layer (CAP-MBL) Graciosa Island, Azores, NE Atlantic Ocean May 2009-December 2010 Rob Wood, University of Washington CAP-MBL Proposal Team AMF Deployment Team Thanks to Mark Miller: AMF Site Scientist Kim Nitschke: AMF Site Manager Importance of Low-Clouds for Climate Imperative that we understand the processes controlling the formation, maintenance and dissipation of low clouds in order to improve their representation in climate models. Which clouds matter for climate sensitivity? Climate Feedbacks Model Intercomparison Project (CFMIP) 12 slab ocean models 2xCO 2 - control Correlation of global mean CRF with local values Mark Webb, Hadley Center 90 N 45 N 0 45 S 90S 0 90 E 180 90 W 0

219

REP&" TO A~NOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio iin Support  

Office of Legacy Management (LM)

tifr'itG!'l' &i&s Coverament tifr'itG!'l' &i&s Coverament --_ , ,&,.i +.&r, ,' ,T.L ' Department of Energy / REP&" TO A~NOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio iin Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office , / I I The Division of Facility and Site Oecomnissioning Projects (OF%) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (WED) and Atomic Energy Commission (AEC) which may have been'radioactively contaminated as a result of these operations, (5) to determine if the

220

Enhanced T-lymphocyte blastogenic response to tuberculin (PPD) in children of northeast (NE) Thailand supplemented with vitamin A (VA) and zinc (Zn)  

SciTech Connect

Beneficial effects of Va and/or Zn supplementation of children in NE Thailand are described in a companion abstract. In the same study, blastogenic response (BR) of T-lymphocytes to concanavalin-A (ConA) and PPD were assayed in cultures containing mononuclear cells (MNC) or whole blood (WB). Methods were previously described. Children were previously vaccinated with BCG. BR to ConA of MNC or WB from children supplemented with VA, Zn, VA + Zn or placebo were similar. BR to PPD of MNC was higher in children receiving VA + Zn than placebo, but not in children supplemented with VA or Zn alone. Data indicate that children with suboptimal VA and Zn nutriture supplemented with < 2 times RDA of these nutrients showed enhanced cellular immunity to PPD. This observation is relevant to BCG immunization program and thus may benefit public health.

Kramer, T.R.; Udomkesmalee, E.; Dhanamitta, S.; Sirisinha, S.; Charoenkiatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Smith, J.C. Jr. (Dept. of Agriculture, Beltsville, MD (United States) Mahidol Univ., Nakhon Pathom (Thailand))

1991-03-15T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Idaho National Laboratory Ten-year Site Plan (2012 through 2021) -- DOE-NE's National Nuclear Capability -- Developing and Maintaining the INL Infrastructure  

Science Conference Proceedings (OSTI)

To meet long-term objectives to transform the Idaho National Laboratory (INL), we are providing an integrated, long-term vision of infrastructure requirements that support research, development and demonstration (RD&D) goals outlined in the DOE strategic plans, including the NE Roadmap and reports such as Facilities for the Future of Nuclear Energy Research: A Twenty-year Outlook. The goal of the INL Ten-year Site Plan (TYSP) is to clearly link RD&D mission goals and INL core capabilities with infrastructure requirements (single and multi-program), establish the 10-year end-state vision for INL complexes, identify and prioritize infrastructure and capability gaps, as well as the most efficient and economic approaches to closing those gaps.

Cal Ozaki

2010-06-01T23:59:59.000Z

222

Ne{sup +} ion sputtering effect on amorphous Ga-In-Zn-O thin-film surface investigated by high-resolution XPS  

Science Conference Proceedings (OSTI)

The effect of Ne{sup +} ion sputtering on amorphous Ga-In-Zn-O (a-GIZO) thin films was investigated by using surface-sensitive, synchrotron-radiation-based, high-resolution X-ray photoelectron spectroscopy (XPS). a-GIZO thin films having different compositions (Ga{sub 2}O{sub 3}:In{sub 2}O{sub 3}:ZnO = 1:1:1, 2:2:1, 3:2:1, 4:2:1) were investigated. It was found out that the amounts of the In and Zn contents relative to that of Ga decreased noticeably after sufficient sputtering, and that there occurred a subgap state above the valence band maximum and metallic states at the In 3d and 4d core levels as well as at the Fermi edge.

Kang, Se-Jun; Lee, Mi Ji [Department of Physics, POSTECH, Pohang 790-784 (Korea, Republic of); Baik, Jae Yoon; Kim, Hyeong-Do; Thakur, Anup [Pohang Accelerator Laboratory, POSTECH, Pohang 790-784 (Korea, Republic of); Shin, Hyun-Joon [Department of Physics, POSTECH, Pohang 790-784 (Korea, Republic of); Pohang Accelerator Laboratory, POSTECH, Pohang 790-784 (Korea, Republic of); Chung, JaeGwan; Lee, Eunha; Lee, Jaecheol; Lee, JaeHak [A E Group, Samsung Advanced Institute of Technology, Yongin-si 440-712 (Korea, Republic of)

2011-12-23T23:59:59.000Z

223

Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS) Code Verification and Validation Data Standards and Requirements: Fluid Dynamics Version 1.0  

SciTech Connect

V&V and UQ are the primary means to assess the accuracy and reliability of M&S and, hence, to establish confidence in M&S. Though other industries are establishing standards and requirements for the performance of V&V and UQ, at present, the nuclear industry has not established such standards or requirements. However, the nuclear industry is beginning to recognize that such standards are needed and that the resources needed to support V&V and UQ will be very significant. In fact, no single organization has sufficient resources or expertise required to organize, conduct and maintain a comprehensive V&V and UQ program. What is needed is a systematic and standardized approach to establish and provide V&V and UQ resources at a national or even international level, with a consortium of partners from government, academia and industry. Specifically, what is needed is a structured and cost-effective knowledge base that collects, evaluates and stores verification and validation data, and shows how it can be used to perform V&V and UQ, leveraging collaboration and sharing of resources to support existing engineering and licensing procedures as well as science-based V&V and UQ processes. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base to provide V&V and UQ resources for M&S for nuclear reactor design, analysis and licensing. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear power. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors.

Greg Weirs; Hyung Lee

2011-09-01T23:59:59.000Z

224

A confirmative spin-parity assignment for the key 6.15 MeV state in $^{18}$Ne of astrophysical importance  

E-Print Network (OSTI)

Proton resonant states in $^{18}$Ne have been investigated by the resonant elastic scattering of $^{17}$F+$p$. The $^{17}$F beam was separated by the CNS radioactive ion beam separator (CRIB), and bombarded a thick H$_2$ gas target at 3.6 MeV/nucleon. The recoiled light particles were measured by using three sets of ${\\Delta}$E-E Si telescope at scattering angles of $\\theta$$_{lab}$$\\approx 3^\\circ$, 10$^\\circ$ and 18$^\\circ$, respectively. Four resonances, {\\it i.e.}, at $E_{x}$=6.15, 6.30, 6.85, and 7.05 MeV, were observed clearly. By $R$-matrix analysis of the excitation functions, $J^{\\pi}$=1$^-$ was firmly assigned to the 6.15 MeV state which is a key state in calculating the reaction rate of $^{14}$O($\\alpha$,$p$)$^{17}$F reaction. This reaction was thought to be one of the most probable key reactions for the breakout from the hot-CNO cycle to the $rp$-process in type I x-ray bursts In addition, a new excited state observed at $E_{x}$=6.85 MeV was tentatively assigned as 0$^{-}$, which could be the analog state of 6.880 MeV, 0$^{-}$ in mirror $^{18}$O.

J. Hu; J. J. He; S. W. Xu; H. Yamaguchi; K. David; P. Ma; J. Su; H. W. Wang; T. Nakao; Y. Wakabayashi; T. Teranishi; J. Y. Moon; H. S. Jung; T. Hashimoto; A. Chen; D. Irvine; S. Kubono

2013-06-17T23:59:59.000Z

225

Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy  

E-Print Network (OSTI)

Energy for the future ­ with Risø from nuclear power to sustainable energy Risø NatioNal laboRatoRy foR sustaiNable eNeRgy edited by MoRteN JastRup #12;Energy for the future #12;Energy for the future ­ with Risø from nuclear power to sustainable energy Translated from 'Energi til fremtiden ­ med Risø fra

226

Research Needs for Fusion-Fission Hybrid Systems. Report of the Research Needs Workshop (ReNeW) Gaithersburg, Maryland, September 30 - October 2, 2009  

Science Conference Proceedings (OSTI)

Largely in anticipation of a possible nuclear renaissance, there has been an enthusiastic renewal of interest in the fusion-fission hybrid concept, driven primarily by some members of the fusion community. A fusion-fission hybrid consists of a neutron-producing fusion core surrounded by a fission blanket. Hybrids are of interest because of their potential to address the main long-term sustainability issues related to nuclear power: fuel supply, energy production, and waste management. As a result of this renewed interest, the U.S. Department of Energy (DOE), with the participation of the Office of Fusion Energy Sciences (OFES), Office of Nuclear Energy (NE), and National Nuclear Security Administration (NNSA), organized a three-day workshop in Gaithersburg, Maryland, from September 30 through October 2, 2009. Participants identified several goals. At the highest level, it was recognized that DOE does not currently support any R&D in the area of fusion-fission hybrids. The question to be addressed was whether or not hybrids offer sufficient promise to motivate DOE to initiate an R&D program in this area. At the next level, the workshop participants were asked to define the research needs and resources required to move the fusion-fission concept forward. The answer to the high-level question was given in two ways. On the one hand, when viewed as a standalone concept, the fusion-fission hybrid does indeed offer the promise of being able to address the sustainability issues associated with conventional nuclear power. On the other hand, when participants were asked whether these hybrid solutions are potentially more attractive than contemplated pure fission solutions (that is, fast burners and fast breeders), there was general consensus that this question could not be quantitatively answered based on the known technical information. Pure fission solutions are based largely on existing both fusion and nuclear technology, thereby prohibiting a fair side-by-side comparison. Another important issue addressed at the conference was the time scale on which long-term sustainability issues must be solved. There was a wide diversity of opinion and no consensus was possible. One group, primarily composed of members of the fission community, argued that the present strategies with respect to waste management (on-site storage) and fuel supply (from natural uranium) would suffice for at least 50 years, with the main short-term problem being the economics of light water reactors (LWRs). Many from the fusion community believed that the problems, particularly waste management, were of a more urgent nature and that we needed to address them sooner rather than later. There was rigorous debate on all the issues before, during, and after the workshop. Based on this debate, the workshop participants developed a set of high-level Findings and Research Needs and a companion set of Technical Findings and Research Needs. In the context of the Executive Summary it is sufficient to focus on the high-level findings which are summarized.

None

2009-09-30T23:59:59.000Z

227

Examination and experimental constraints of the stellar reaction rate factor $N_A $ of the $^{18}$Ne($?$,$p$)$^{21}$Na reaction at temperatures of X-Ray Bursts  

E-Print Network (OSTI)

The $^{18}$Ne($\\alpha$,$p$)$^{21}$Na reaction is one key for the break-out from the hot CNO-cycles to the $rp$-process. Recent papers have provided reaction rate factors $N_A $ which are discrepant by at least one order of magnitude. The compatibility of the latest experimental results is tested, and a partial explanation for the discrepant $N_A$ is given. A new rate factor is derived from the combined analysis of all available data. The new rate factor is located slightly below the higher rate factor by Matic {\\it et al.}\\ at low temperatures and significantly below at higher temperatures whereas it is about a factor of five higher than the lower rate factor recently published by Salter {\\it et al.}

P. Mohr; A. Matic

2013-03-06T23:59:59.000Z

228

Heavy isotope production by multinucleon transfer reactions with /sup 254/Es. [101 MeV /sup 16/O, 98 MeV /sup 18/O, 127 MeV /sup 22/Ne  

Science Conference Proceedings (OSTI)

Fast automated on-line and quasi-on-line radiochemical techniques were applied to search for new isotopes, to measure their decay characteristics, and to study the cross sections of the heaviest, most neutron-rich actinide isotopes in reactions of /sup 16,18/O and /sup 22/Ne projectiles with /sup 254/Es as a target. The measured yields for isotopes up to Lr-260 are three or more orders of magnitude higher than in any other reaction used so far. A comparison with data for similar transfers from /sup 248/Cm targets is made. Transfer cross sections are extrapolated for the production of unknown, neutron-rich isotopes of elements 101 through 105, and the unique potential of /sup 254/Es as a target to make these exoctic nuclei accessible is demonstrated. 18 refs., 2 figs., 1 tab.

Schaedel, M.; Bruechle, W.; Bruegger, M.; Gaeggeler, H.; Moody, K.J.; Schardt, D.; Suemmerer, K.; Hulet, E.K.; Douran, A.D.; Dougan, R.J.

1985-01-01T23:59:59.000Z

229

Please cite this article in press as: Gilfillan, S.M.V., et al., He and Ne as tracers of natural CO2 migration up a fault from a deep reservoir. Int. J. Greenhouse Gas Control (2011), doi:10.1016/j.ijggc.2011.08.008  

E-Print Network (OSTI)

of Greenhouse Gas Control journal homepage: www.elsevier.com/locate/ijggc He and Ne as tracers of natural CO22 Noble gases Carbon isotopes Geological storage of CO2 Natural analogues a b s t r a c t Capture that could arise from a diffuse leakage of CO2 from a storage site. This is because there are many natural

230

KINEMATICS AND METALLICITIES IN THE BOOeTES III STELLAR OVERDENSITY: A DISRUPTED DWARF GALAXY?  

Science Conference Proceedings (OSTI)

We report the results of a spectroscopic study of the Booetes III (BooIII) stellar overdensity carried out with the Hectospec multifiber spectrograph on the MMT telescope. Radial velocities have been measured for 193 BooIII candidate stars selected to have magnitudes and colors consistent with its upper main sequence and lower red giant branch, as well as a number of horizontal-branch candidates. From 20 identified candidate BooIII members, we measure a systemic velocity of V {sub sun} = 197.5 {+-} 3.8 km s{sup -1} and a velocity dispersion of {sigma}{sub o} = 14.0 {+-} 3.2 km s{sup -1}. We use the somewhat large velocity dispersion and the implied highly radial orbit, along with morphological evidence from Grillmair and stellar abundances, to argue that BooIII is likely the first known object observed in a transitional state between being a bound dwarf galaxy and a completely unbound tidal stream.

Carlin, Jeffrey L.; Nidever, David L.; Majewski, Steven R. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904-4325 (United States); Grillmair, Carl J. [Spitzer Science Center, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Munoz, Ricardo R. [Yale University, Astronomy Department, P.O. Box 208101, New Haven, CT 06520-8101 (United States)], E-mail: jcarlin@virginia.edu, E-mail: dln5q@virginia.edu, E-mail: srm4n@virginia.edu, E-mail: carl@ipac.caltech.edu, E-mail: ricardo.munoz@yale.edu

2009-09-01T23:59:59.000Z

231

(Bi, Sb)2(Te,S)3 System for Thermoelectric Applications  

Science Conference Proceedings (OSTI)

... Ferroelectrics with Giant Electrocaloric Effect for Dielectric Refrigeration ... Processes during Sintering: Establishing a Tool Kit for Materials Design in PZT.

232

Measuring two-millimeter radiation with a prototype multiplexed TES receiver for ACT  

E-Print Network (OSTI)

, Norm Jarosik, Joe Fowler, Suzanne Staggs, and Lyman Page contributed substantially to the CCam Astronomy Review 47, pp. 939­943, 2003. 2. J. Fowler for the ACT Collaboration, "The Atacama Cosmology. Fowler, T. Marriage, L. Page, J. Leong, E. Wishnow, R. Henry, E. Wollack, M. Halpern, D. Mars- den, and G

233

Mesoscale Spectra of Marss Atmosphere Derived from MGS TES Infrared Radiances  

Science Conference Proceedings (OSTI)

Wavenumber spectra of the atmospheric potential energy of Mars at mesoscales (wavelengths of 64957 km) were obtained as a function of latitude, season, and Martian year using infrared radiance data obtained by the Thermal Emission Spectrometer (...

Takeshi Imamura; Yasuhiro Kawasaki; Tetsuya Fukuhara

2007-05-01T23:59:59.000Z

234

Science with Micro-X: the TES Microcalorimeter X-ray Imaging Rocket  

DOE Green Energy (OSTI)

Micro-X is a proposed sounding rocket experiment that will combine a transition-edge-sensor X-ray-microcalorimeter array with a conical imaging mirror to obtain high-spectral-resolution images of extended and point X-ray sources. We describe the payload and the science targeted by this mission including the discussion of three possible Micro-X targets: the Puppis A supernova remnant, the Virgo Cluster, and Circinus X-1. For example, a Micro-X observation of the bright eastern knot of Puppis A will obtain a line-dominated spectrum with 90,000 counts collected in 300 seconds at 2 eV resolution across the 0.3-2.5 keV band. Micro-X will utilize plasma diagnostics to determine the thermodynamic and ionization state of the plasma, to search for line shifts and broadening associated with dynamical processes, and seek evidence of ejecta enhancement. For clusters of galaxies, Micro-X can uniquely study turbulence and the temperature distribution function. For binaries, Micro-X's high resolution spectra will separate the different processes contributing to the Fe K lines at 6 keV and give a clear view of the geometry of the gas flows and circumstellar gas.

Figueroa-Feliciano, E; Bandler, S R; Bautz, M; Boyce, K R; Brown, G V; Deiker, S; Doriese, W B; Flanagan, K; Galeazzi, M; Hilton, G C; Hwang, U; Irwin, K D; Kallman, T; Kelley, R L; Kilbourne, C A; Kissel, S; Levine, A; Loewenstein, M; Martinez-Galarce, D; McCammon, D; Mushotzky, R; Petre, R; Porter, F S; Reistema, C D; Saab, T; Serlemitsos, P; Schulz, N; Smith, R; Ullom, J N

2006-05-16T23:59:59.000Z

235

Research and Development for Novel Thermal Energy Storage Systems (TES) for Concentrating Solar Power (CSP)  

SciTech Connect

The overall objective was to develop innovative heat transfer devices and methodologies for novel thermal energy storage systems for concentrating solar power generation involving phase change materials (PCMs). Specific objectives included embedding thermosyphons and/or heat pipes (TS/HPs) within appropriate phase change materials to significantly reduce thermal resistances within the thermal energy storage system of a large-scale concentrating solar power plant and, in turn, improve performance of the plant. Experimental, system level and detailed comprehensive modeling approaches were taken to investigate the effect of adding TS/HPs on the performance of latent heat thermal energy storage (LHTES) systems.

Faghri, Amir; Bergman, Theodore L; Pitchumani, Ranga

2013-09-26T23:59:59.000Z

236

BASIN VER DE GREAT ER ANETH BU G BAR KER DOME HOR SESH OE UTE DOME  

U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class 0 20 40 10 30 Miles ± The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and Nature of Restrictions to Their Development", prepared by the US Departments of Interior, Agriculture and Energy. Unnamed fields and fields generically named "wildcat" were renamed to a concatenate of their basin and state of occurrence,

237

BASIN VER DE GREAT ER ANETH BU G BAR KER DOME HOR SESH OE UTE DOME  

U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class 0 20 40 10 30 Miles ± The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and Nature of Restrictions to Their Development", prepared by the US Departments of Interior, Agriculture and Energy. Unnamed fields and fields generically named "wildcat" were renamed to a concatenate of their basin and state of occurrence,

238

Ver. SV2011-06-16 Subject study plan at doctoral level  

E-Print Network (OSTI)

at international accelerator facilities, with the use of large gamma-ray and particle detector system. Detector of phase transitions, critical phenomena and strongly correlated systems. The research aims to provide phase transitions, exotic quantum fluids, complex systems, nano-systems, disordered systems, soft matter

Haviland, David

239

fall/winter 2010 | VOl 27 | no 3 UniVerSitYMaGaZine  

E-Print Network (OSTI)

-setting public-private collaboration that naturally builds on Say yes, we unveiled 2+2 joint admission agreements

Raina, Ramesh

240

Run05 Proton Beam Polarization Measurements by pC-Polarimeter (ver. 1.1)  

DOE Green Energy (OSTI)

The polarization of the proton beams [1, 2] at the Relativistic Heavy Ion Collider (RHIC)[3] RHIC ring. The H-Jet polarimeter is located at the collision point allowing measurements of absolute normalization is provided by the hydrogen polarimeter, which measures over 1 {approx} 2 another measurement rather than measuring the absolute polarization. both beams. Two identical pC-polarimeters are equipped in the yellow and blue rings, where carbon ribbon target, providing fast feedback to beam operations and experiments. The days to obtain {approx} 5% statistical uncertainty (in Run05). Thus, the operation of the carbon is measured using both an atomic beam source hydrogen gas jet (H-Jet)[4, 5] and proton-carbon polarimeters was focused on better control of relative stability between one measurement to statistical accuracy within 20 to 30 seconds using an ultra-thin (typically 6 {approx} 8 {micro}g/cm{sup 2}) the rings are separated. The pC-polarimeter measures relative polarization to a few percent.

Nakagawa,I.; Alekseev, I.; Bazilevsky, A.; Bravar, A.; Bunce, G.; Dhawan, S.; Eyser, K.O.; Gill, R.; Haeberli, W.; Huang, H.; Makdisi, Y.; Nass, A.; Okada, H.; Stephenson, E.; Svirida, D.N.; Wise, T.; Wood, J.; Yip, K.; Zelenski, A.

2008-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

BASIN VER DE GREAT ER ANETH BU G BAR KER DOME HOR SESH OE UTE DOME  

U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class 0 20 40 10 30 Miles ± The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by Section 604 of the Energy Policy and Conservation Act Amendments of 2000 (P.L. 106-469). The boundaries are not informed by subsurface structural information. The data and methods used in their creation are detailed in a report, "Scientific Inventory of Onshore Federal Lands' Oil and Gas Resources and Reserves and the Extent and Nature of Restrictions to Their Development", prepared by the US Departments of Interior, Agriculture and Energy. Unnamed fields and fields generically named "wildcat" were renamed to a concatenate of their basin and state of occurrence,

242

Microsoft Word - 802.11i Rec Practices _KM-BL final edit ver 10_.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Securing WLANs Securing WLANs using 802.11i Draft Recommended Practice February 2007 Securing WLANs using 802.11i Draft Author: Ken Masica, Lawrence Livermore National Laboratory February 2007 for Idaho National Laboratory Critical Infrastructure Protection Center Idaho Falls, Idaho 83415 Prepared by Lawrence Livermore National Laboratory Recommended Practices Guide Securing WLANs using 802.11i Ken Masica Vulnerability & Risk Assessment Program (VRAP) Lawrence Livermore National Laboratory (LLNL) for DHS US CERT Control Systems Security Program (CSSP) October 2006 This work was performed under the auspices of the U.S. Department of Energy by University of California, Lawrence Livermore National Laboratory under Contract W- 7405-Eng-48.

243

Microsoft PowerPoint - CERTS OMS Mani June 2013 ver1 [Compatibility Mode]  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

System System Mani V. Venkatasubramanian Washington State University, Pullman, WA mani@eecs.wsu.edu 28 June 2013 Washington, DC DOE/OE Transmission Reliability Program Project Objectives Oscillation Monitoring System for WECC and Entergy Monitoring hundreds of PMUs simultaneously System modes are changing - adaptive engines Interactions with power electronics Damping Monitor Engine - ambient data analysis Event Analysis Engine - detection and analysis of ringdowns and oscillations Real-time engines and off-line engines Project Background for Entergy SGIG project: Damping Monitor Engine - Real-time (DMR) based on FDD. Implemented since July 2011 Can handle up to 30 PMUs simultaneously CERTS project: Extending the capability of real-time DME, Verification of results and follow-up

244

1 BWeb for Modeling the Environment Limnology, March 2012 Ver 5 Andrew Ford Andrew Ford  

E-Print Network (OSTI)

. The simulations show growth in biomass in the lake, and the pattern of growth looks somewhat like the S-shaped growth described in Chapter 7 of the book. Perhaps the dynamics of biomass growth is governed by feedback? If so, label the loop as (+) or (-). biomass P biomass P death detritus P detritus P decay nutrient P

Ford, Andrew

245

Physics 121 Common Exam 1, Spring 2012, Ver A Name (Print): _______________________________ 4 Digit ID:________ Section: ______  

E-Print Network (OSTI)

zlargeforaxisdipoleon z p E 3 0 1 2 ++++ #12;Page of 78 ANSWER KEY: Spring 2012 Physics 121 Common Exam 1, Version A 1 angle does the electric field vector at the center of the square make with the x -axis? The angle. For the square configuration of the preceding problem, find the magnitude of the electric field in the center

Janow, Rich

246

SeisTool Ver. 2.1 User`s Guide  

DOE Green Energy (OSTI)

SeisTool is an interactive graphical tool that allows you to analyse seismograms. It runs under the X window environment. The current version employs an OpenLook graphical user interface. It is designed for convenient display of seismograms and handling of events for routine analysis. It also allows phase picking to be done smoothly. A number of time-series analysis operations have also been implemented. Here, is a brief guide to the operation of SeisTool. The intention of this User`s Guide is not to guide you through SeisTool step by step, (The best way of learning how to use SeisTool is run the program and experiment with it.) but, to present a few basic concepts behind SeisTool to acquaint you with the program. The goal of this prototype is to make analysing seismograms as easy and convenient as browsing a file with a text editor. Think of SeisTool as nothing more than a seismogram data file browser.

Yu, A.K.

1993-08-01T23:59:59.000Z

247

Se trans-corporer Vers une auto-transformation de l'humain ?  

E-Print Network (OSTI)

(contamination OGM, Clonage humain, neurobiologie du comportement). Le risque d'une police totale par les RIFD et Peter 3 Pièces et main d'oeuvre, 2008, RIFD : la police totale. Puces intelligente et mouchardage

Paris-Sud XI, Université de

248

Microsoft PowerPoint - TextVerSPE-ATCE-MHT-FutureAsGivenRev1...  

NLE Websites -- All DOE Office Websites (Extended Search)

Slimhole vs. Microhole: Future of E&P National Energy Technology Laboratory-SCNGO Office of Fossil Energy 2005 SPE ATCE Slimhole Drilling Session Roy Long Oil E&P Technology...

249

Vers une commande sans mod\\`ele pour am\\'enagements hydro\\'electriques en cascade  

E-Print Network (OSTI)

A new concept called "Model-Free Control" is applied to hydroelectric run-of-the river power plants, with severe constraints and operating conditions. Numerous computer simulations display excellent results, which are obtained thanks to simple and robust algorithms.

Join, Cdric; Fliess, Michel

2010-01-01T23:59:59.000Z

250

ver the last few years, the helical mirror or "spinner" has become a popular decora-  

E-Print Network (OSTI)

is a good teaching tool. To facilitate student exploration, we suggest some questions and provide brief is for the convex (concave) cross section. For distant objects (dobj >> f ), the magnitudes of both magnifications in the denominator means that more distant objects are less magnified, which also occurs for other magnifying mirrors

DeWeerd, Alan

251

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 23, 2010 March 23, 2010 DOE Announces Cooperative Agreement with USEC for American Centrifuge Demonstration Project The U.S. Department of Energy today announced that it finalized a cost-shared $90 million cooperative agreement with USEC Inc. to provide support for the continued development and demonstration of the American Centrifuge technology. March 17, 2010 U.S. and India hold the Third Meeting of the Indo-United States Civil Nuclear Energy Working Group India hosted the third meeting of the Indo-United States Civil Nuclear Energy Working Group in Mumbai, on Feb. 3-4, 2010. March 17, 2010 INL User Facility welcomes three new experiments The number of universities conducting nuclear energy experiments in Idaho National Laboratory's one-of-a-kind research reactor has now reached an

252

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 17, 2010 February 17, 2010 Deputy Secretary Poneman Addresses Nuclear Deterrence Summit Alexandria, VA - U.S. Deputy Secretary of Energy Daniel Poneman today addressed the opening session of the second annual Nuclear Deterrence Summit and discussed the Department of Energy's commitment to helping achieve the President's goals of reducing nuclear dangers and expanding the use of nuclear energy in a manner that minimizes the risks of proliferation. The Deputy Secretary also spoke about the Department's commitment to management excellence. February 16, 2010 Obama Administration Announces Loan Guarantees to Construct New Nuclear Power Reactors in Georgia President Obama today announced that the Department of Energy has offered conditional commitments for a total of $8.33 billion in loan guarantees for

253

NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

June 1, 2012 June 1, 2012 Navy personnel stationed in Idaho Falls, Idaho, in the mid 1950s learn how to operate the Nautilus S1W, the prototype of the Navy's first nuclear-powered submarine. | Photo courtesy of Idaho National Laboratory Veteran Leadership Strong at Idaho's Laboratory Idaho National Lab has played a large role in building fission reactors for Navy vessels - and then training those military personnel on how to use the equipment. February 15, 2012 Secretary Chu traveled to Waynesboro, Georgia, to visit the Vogtle nuclear power plant, the site of what will be the first new nuclear reactors to be built in the United States in three decades. | Image credit: Southern Company. Secretary Chu Visits Vogtle Nuclear Power Plant Secretary Chu traveled to Waynesboro, Georgia, to visit the Vogtle nuclear

254

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

April 15, 2011 April 15, 2011 Dr. Peter B. Lyons Confirmed as Assistant Secretary for Nuclear Energy Washington, D.C. - Dr. Peter B. Lyons was confirmed by the Senate on Thursday, April 14, as the Department of Energy's Assistant Secretary for Nuclear Energy. February 28, 2011 U.S. Department of Energy Issues Fiscal Year 2011 Funding Opportunity Announcements to Enhance Nuclear Energy Education Infrastructure The U.S. Department of Energy today announced two new fiscal year 2011 Funding Opportunity Announcements to support university and college efforts to build or expand their school's nuclear science and engineering basic research or education capabilities. February 18, 2011 Department of Energy Issues Call for Proposals to U.S. Universities for Nuclear Energy-Related Integrated Research Project Proposals

255

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 27, 2012 Energy Department Announces New Investments in University-Led Nuclear Energy Innovation Three University-Led Projects to Develop Next Generation Technologies,...

256

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

next generation of nuclear scientists and engineers. May 6, 2009 Secretary Chu Announces Funding for 71 University-Led Nuclear Research and Development Projects U.S. Energy...

257

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 8, 2010 July 8, 2010 Department of Energy Announces more than $18 Million to Strengthen Nuclear Education at U.S. Universities and Colleges Awards $5 million for 117 scholarships and fellowships, and $13.2 million for infrastructure upgrades for university nuclear programs June 21, 2010 Global Nuclear Energy Partnership Steering Group Members Approve Transformation to the International Framework for Nuclear Energy Cooperation The Global Nuclear Energy Partnership Steering Group met in Accra, Ghana on June 16-17, 2010, and approved unanimously several transformative changes to reflect global developments that have occurred since the Partnership was established in 2007. June 2, 2010 International Working Group Meeting Focuses on Nuclear Power Infrastructure Development and Needs

258

NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 30, 2008 January 30, 2008 Artist's concept of the New Horizons spacecraft during its planned encounter with Pluto and its moon, Charon. The craft's miniature cameras, radio science experiment, ultraviolet and infrared spectrometers and space plasma experiments are run by the Department of Energy's Radioisotope Thermoelectric Generator (RTG). | Photo courtesy of Johns Hopkins University Applied Physics Laboratory/Southwest Research Institute (JHUAPL/SwRI) New Horizons Mission Powered by Space Radioisotope Power Systems The New Horizons spacecraft utilized a Radioisotope Thermoelectric Generator (RTG) to provide electricity and heat to the science instruments and other spacecraft components. January 29, 2008 Mars Science Laboratory, aka Curiosity, is part of NASA's Mars Exploration Program, a long-term program of robotic exploration of the Red Planet. It's powered by the Multi-Mission Radioisotope Thermoelectric Generator (MMRTG). Photo courtesy of NASA/JPL-Caltech.

259

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 29, 2011 September 29, 2011 United States and Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts PRAGUE, Czech Republic - The U.S. Department of Energy recently joined with the Řež Nuclear Research Institute, the U.S. September 28, 2011 Department of Energy Issues FY 2012 Request for Pre-Applications from U.S. Universities for Nuclear Energy Research and Development Proposals The U.S. Department of Energy today announced that its Nuclear Energy University Programs is now accepting pre-applications from universities interested in conducting nuclear energy research and development projects. September 21, 2011 Department of Energy Announces $17 Million to Bolster University-Led Nuclear Energy Research and Development

260

LLNL's NeMS: Network Mapping System  

High Performance Computing Innovation Center (Building 6475)located in LLNL's Livermore Valley Open Campus (LVOC) Seating is limited, Pre-registration ...

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

BASELINE IE-NE EXPERIMENTSUSING THE SPRACH ...  

Science Conference Proceedings (OSTI)

... Scott"; "Bloomberg News Service", later just "Bloomberg").The broadcast news transcriptions are not segmented into discourse units in any clearly ...

2011-08-22T23:59:59.000Z

262

COURSE NOTES: Nuclear Materials (NE120)  

Science Conference Proceedings (OSTI)

Feb 10, 2007 ... This resource provides PDF lecture notes and readings for an undergraduate course covering materials issues in nuclear power systems.

263

NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 20, 2012 January 20, 2012 Energy Department Takes First Step to Spur U.S. Manufacturing of Small Modular Nuclear Reactors Through the draft Funding Opportunity Announcement announced today, the Department will establish cost-shared agreements with private industry to support the design and licensing of SMRs. January 20, 2012 Energy Department Takes First Step to Spur U.S. Manufacturing of Small Modular Nuclear Reactors New Funding Opportunity Announcement Will Support SMR Design and Licensing for Widespread Commercial Use December 22, 2011 Secretary Chu Statement on AP1000 Reactor Design Certification U.S. Energy Secretary Steven Chu issued the following statement today in support of the Nuclear Regulatory Commission's (NRC) decision to certify Westinghouse Electric's AP1000 nuclear reactor design, a significant step

264

Comparison of improved Aura Tropospheric Emission Spectrometer (TES) CO2 with HIPPO and SGP aircraft profile measurements  

E-Print Network (OSTI)

Propulsion Laboratory, California Institute of Technology, was performed under a contract with the National Aeronautics and Space

Kulawik, S.S.

2013-01-01T23:59:59.000Z

265

Key Institutional Design Considerations and Resources Required to Develop a Federal Greenhouse Gas Offsets Program in the United Sta tes  

Science Conference Proceedings (OSTI)

Greenhouse gas (GHG) emissions offsets have emerged as a critical element of evolving U.S. climate policy and a critical factor in determining the future price of CO2 emissions and the economic costs of proposed policies. This report evaluates the governmental institutional requirements and resources needed to develop a large-scale national domestic GHG emissions offset program. It also describes potential institutional barriers that might limit the ability of the evolving carbon market to generate signi...

2011-05-25T23:59:59.000Z

266

Numerical and Experimental Investigation of Inorganic Nanomaterials for Thermal Energy Storage (TES) and Concentrated Solar Power (CSP) Applications  

E-Print Network (OSTI)

The objective of this study is to synthesize nanomaterials by mixing molten salt (alkali nitrate salt eutectics) with inorganic nanoparticles. The thermo-physical properties of the synthesized nanomaterials were characterized experimentally. Experimental results allude to the existence of a distinct compressed phase even for the solid phase (i.e., in the nanocomposite samples). For example, the specific heat capacity of the nanocomposites was observed to be enhanced after melting and re-solidification - immediately after their synthesis; than those of the nanocomposites that were not subjected to melting and re-solidification. This shows that melting and re-solidification induced molecular reordering (i.e., formation of a compressed phase on the nanoparticle surface) even in the solid phase - leading to enhancement in the specific heat capacity. Numerical models (using analytical and computational approaches) were developed to simulate the fundamental transport mechanisms and the energy storage mechanisms responsible for the observed enhancements in the thermo-physical properties. In this study, a simple analytical model was proposed for predicting the specific heat capacity of nanoparticle suspensions in a solvent. The model explores the effect of the compressed phase that is induced from the solvent molecules - at the interface with individual nanoparticles in the mixture. The results from the numerical simulations indicate that depending on the properties and morphology of the compressed phase it can cause significant enhancement in the specific heat capacity of nanofluids and nanocomposites. The interfacial thermal resistance (also known as Kapitza resistance, or Rk) between a nanoparticle and the surrounding solvent molecules (for these molten salt based nanomaterials) is estimated using Molecular Dynamics (MD) simulations. This exercise is relevant for the design optimization of nanomaterials (nanoparticle size, shape, material, concentration, etc.). The design trade-off is between maximizing the thermal conductivity of the nanomaterial (which typically occurs for nanoparticle size varying between ~ 20-30nm) and maximizing the specific heat capacity (which typically occurs for nanoparticle size less than 5nm), while simultaneously minimizing the viscosity of the nanofluid. The specific heat capacity of nitrate salt-based nanomaterials was measured both for the nanocomposites (solid phase) and nanofluids (liquid phase). The neat salt sample was composed of a mixture of KNO3: NaNO3 (60:40 molar ratio). The enhancement of specific heat capacity of the nanomaterials obtained from the salt samples was found to be very sensitive to minor variations in the synthesis protocol. The measurements for the variation of the specific heat capacity with the mass concentration of nanoparticles were compared to the predictions from the analytical model. Materials characterization was performed using electron microscopy techniques (SEM and TEM). The rheological behavior of nanofluids can be non-Newtonian (e.g., shear thinning) even at very low mass concentrations of nanoparticles, while (in contrast) the pure undoped (neat) molten salt may be a Newtonian fluid. Such viscosity enhancements and change in rheological properties of nanofluids can be detrimental to the operational efficiencies for thermal management as well as energy storage applications (which can effectively lead to higher costs for energy conversion). Hence, the rheological behavior of the nanofluid samples was measured experimentally and compared to that of the neat solvent (pure molten salt eutectic). The viscosity measurements were performed for the nitrate based molten salt samples as a function of temperature, shear rate and the mass concentration of the nanoparticles. The experimental measurements for the rheological behavior were compared with analytical models proposed in the literature. The results from the analytical and computational investigations as well as the experimental measurements performed in this proposed study were used to formul

Jung, Seunghwan

2012-05-01T23:59:59.000Z

267

Application of Non-Gapped Transmission Line Surge Arresters: Review of Disconnector Specifications and Development of Mechanical Tes t Plan  

Science Conference Proceedings (OSTI)

This report presents the results of a survey to obtain information on industry issues related to steel crossarm degradation and failures, and utility practices regarding inspection, life assessment, and mitigation. Survey results will help improve understanding of crossarm issues to be addressed, and provide guidance for further research on degradation modes, inspection technologies, and mitigation techniques.A web-based survey tool was used to construct a set of focused questions to ...

2012-12-14T23:59:59.000Z

268

Microsoft Word - Lab call doc TEMPLATE ver 11.3 _may 3rd due date_.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

RESEARCH CALL TO DOE/FEDERAL LABORATORIES RESEARCH CALL TO DOE/FEDERAL LABORATORIES Technical Support for Interconnection-Level Electric Infrastructure Planning RC-BM-2010 CONTACT: Brian Mollohan, Project Manager TELEPHONE NUMBER: (304) 285-1367 FAX NUMBER: (304) 285-4403 E-MAIL: brian.mollohan@netl.doe.gov ISSUING OFFICE: U.S. DEPARTMENT OF ENERGY National Energy Technology Laboratory 3610 Collins Ferry Road, P. O. Box 880 Morgantown, WV 26507-0880 ISSUE DATE: April 1, 2010 DUE DATE: May 3, 2010 This Research Call uses funding from "The American Recovery and Reinvestment Act of 2009" and will be subject to special reporting requirements. The reporting requirements and other details will be provided later. 2 TABLE OF CONTENTS SECTION I - GENERAL INFORMATION

269

Microsoft Word - Lab call doc TEMPLATE ver 11.3 _may 3rd due date_.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RESEARCH CALL TO DOE/FEDERAL LABORATORIES RESEARCH CALL TO DOE/FEDERAL LABORATORIES Technical Support for Interconnection-Level Electric Infrastructure Planning RC-BM-2010 CONTACT: Brian Mollohan, Project Manager TELEPHONE NUMBER: (304) 285-1367 FAX NUMBER: (304) 285-4403 E-MAIL: brian.mollohan@netl.doe.gov ISSUING OFFICE: U.S. DEPARTMENT OF ENERGY National Energy Technology Laboratory 3610 Collins Ferry Road, P. O. Box 880 Morgantown, WV 26507-0880 ISSUE DATE: April 1, 2010 DUE DATE: May 3, 2010 This Research Call uses funding from "The American Recovery and Reinvestment Act of 2009" and will be subject to special reporting requirements. The reporting requirements and other details will be provided later. 2 TABLE OF CONTENTS SECTION I - GENERAL INFORMATION

270

V  

NLE Websites -- All DOE Office Websites (Extended Search)

. 1.1 I . COO-30.72-25 11 t 1 Hadronic Form Factors in Asymptotically Free Field Theories David J. Gross and S.B. Treiman Joseph Henry Labor atorie s of Physics -NOTICE- Pri nce ton Uni ver sit y 1 1 This repor t was prep ared as an acco unt of work 1 Pri nce ton , New Jer sey 1 spons ored by the Unite d State s Gove rnme nt. Neith er 1 1 the Un ited Sta tes nor the Un ited Sta tes Ato mic Ene rgy I 08 54 0 1 j Comm issi on, nor any of thei r empl oyee s, nor any of I the ir con trac tors , sub con trac tors , or the ir em plo yee s, 111 »tti' R'111 wou ld not infr inge priv ate ly own ed righ ts. 1 - .3 ABSTRACT The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q2 behavior of nucleon form factors.

271

Microsoft Word - 2.8.12 NE Final Testimony  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Peter Lyons Peter Lyons Assistant Secretary for Nuclear Energy U.S. Department of Energy Before the Committee on Science, Space, and Technology U.S. House of Representatives Assessing America's Nuclear Future- A review of the Blue Ribbon Commission's Report to the Secretary of Energy February 8, 2012 Chairman Hall, Ranking Member Johnson, and Members of the Committee, thank you for the opportunity to appear before you today to discuss the Blue Ribbon Commission's (BRC) Report to the Secretary of Energy. The Commissioners worked collaboratively and constructively - through a public, open and transparent process - on recommendations to support a new strategy for the back end of the nuclear fuel cycle. The Administration commends the Commission for its

272

NE-24 Designation of Universal Cyclops, Inc., Titusville Plant  

Office of Legacy Management (LM)

Universal Cyclops, Inc., Titusville Plant Universal Cyclops, Inc., Titusville Plant Pennsylvania, for Remedial iiction under the Formerly Uti Remedial Action Program (FUSRAP) J. LaGrone, Manager Oak Ridge Operations Office Aliquippa, iized Sites pg!. " * 1 ' j---' R , 7. Based on the data in the attached report, it has been determined that the subject site is contaminated with radioactive residues as a result of Manhattan Engineer District/Atomic Energy Commission operations at the site. The contamination is in excess of acceptable guidelines and warrants designation for remedial action under the FUSRAP, Although the contamirta- tion levels exceed guidelines, the risk of exposure and associated health effects are low under current use and/or potential future use of the site; therefore, the site is designated as a low priority site for remedial -

273

Aussie LNG players target NE Asia in expansion bid  

SciTech Connect

Australia's natural gas players, keen to increase their presence in world liquefied natural gas trade, see Asia as their major LNG market in the decades to come. That's despite the fact that two spot cargoes of Australian Northwest Shelf LNG were shipped to Europe during the last 12 months and more are likely in 1994. Opportunities for growth are foreseen within the confines of the existing Northwest Shelf gas project for the rest of the 1990s. But the main focus for potential new grassroots project developers and expansions of the existing LNG plant in Australia is the expected shortfall in contract volumes of LNG to Japan, South Korea, and Taiwan during 2000--2010. Traditionally the price of crude oil has been used as a basis for calculating LNG prices. This means the economics of any new 21st century supply arrangements are delicately poised because of the current low world oil prices, a trend the market believes is likely to continue. In a bid to lessen the effect of high initial capital outlays and still meet projected demand using LNG from new projects and expansion of the existing plant, Australia's gas producers are working toward greater cooperation with prospective Asian buyers.

Not Available

1994-02-28T23:59:59.000Z

274

Nuclear Engineering (NE) and the Energy Engineering and Systems...  

NLE Websites -- All DOE Office Websites (Extended Search)

Achievements Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and...

275

Microsoft Word - N01221_NE Site IRAP final.doc  

Office of Legacy Management (LM)

Northeast Site Northeast Site August 2008 Office of Legacy Management LMS/PIN/N01221 Work Performed Under DOE Contract No. for the U.S. Department of Energy Office of Legacy Management. DE-AM01-07LM00060 Approved for public release; distribution is unlimited. Office of Legacy Management Office of Legacy Management Office of Legacy Management U.S. Department of Energy This page intentionally left blank LMS/PIN/N01221 Pinellas Environmental Restoration Project Interim Remedial Action Plan for Source Removal at the Northeast Site August 2008 This page intentionally left blank U.S. Department of Energy Interim Remedial Action Plan for Source Removal at the Northeast Site August 2008 Doc. No. N0122100 Page iii Contents Acronyms and Abbreviations .........................................................................................................

276

NE-20 ACTION: SSDP Project Charter Revision CONCURRENCES RTG SYMBOL  

Office of Legacy Management (LM)

0 0 ACTION: SSDP Project Charter Revision CONCURRENCES RTG SYMBOL James W. Vaughan, Jr. N-923 Acting Assistant Secretary . for Nuclear Energy Murphi Attached for your signature is a revised Project Charter for the 1/ 86 Shippingport Station Decommissioning Project (SSDP). Since our original M determination in July that there was a need to revise the SSDP Charter, we N K23 have been in discussion with the Richland Operations Field Office (RL). INe Significant differences in management philosophy surfaced between RL and DeLaney Headquarters that required discussions up to and including the RL Manager DAE/86 and myself. I now feel that the revised Charter reflects a mutually acceptable working arrangement between the appropriate organizations. The RTGSYMBOL general roles and responsibilities defined in this Charter will facilitate

277

File:EIA-Williston-NE-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Northeast Part By 2001 BOE Reserve Class Northeast Part By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.94 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 18:49, 20 December 2010 Thumbnail for version as of 18:49, 20 December 2010 6,600 × 5,100 (5.94 MB) MapBot (Talk | contribs) Automated bot upload

278

File:EIA-Williston-NE-Liquids.pdf | Open Energy Information  

Open Energy Info (EERE)

Liquids.pdf Liquids.pdf Jump to: navigation, search File File history File usage Williston Basin, Northeast Part By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.95 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

279

NE-24 Gilman Hall, University of California, Certification Documentation  

Office of Legacy Management (LM)

Gilman Hall, University of California, Gilman Hall, University of California, Certification Documentation Berkeley, California, Conditional Verlette Gatlin, MA-232 I am attaching for entry into the Public Document Room, two copies of the subject documentation. These documents are the backup data for the conditional certification that the site is radiologically acceptable for restricted use as noted in the certification statement published in the Federal Register. Inasmuch as the conditional certification is made public through the Federal Register, it is prudent that the attached backup documentation also be available to the public. The docket consists of: 1. Introduction: Introduction to the certification docket for Gilman Hall, University of California, Berkeley, California. 2. Exhibit I: Summary of activities at Gilman Hall, University of

280

Ne?gali? asmen? ?sidarbinimo galimyb?s aptarnavimo sferoje.  

E-Print Network (OSTI)

??There are choice aspects of disabled people, of them profession territory in the post graduate. There are introduced with resolve and possibility of disabled (more)

Ivanauskait?,; Irma

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

CCpi0 Event Reconstruction at MiniBooNE  

SciTech Connect

We describe the development of a fitter to reconstruct {nu}{sub {mu}} induced Charged-Current single {pi}{sup 0} (CC{pi}{sup 0}) events in an oil Cerenkov detector (CH{sub 2}). These events are fit using a generic muon and two photon extended track hypothesis from a common event vertex. The development of ring finding and particle identification are described. Comparisons between data and Monte Carlo are presented for a few kinematic distributions.

Nelson, Robert H.; /Colorado U.

2009-09-01T23:59:59.000Z

282

Microsoft PowerPoint - NEAC Battelle NE Capabilities 062408.ppt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R&D Facility Requirements NEAC Meeting Progress Report June 24, 2008 2 Facilitization of U.S. Nuclear R&D Infrastructure Three-step study process: * First, ASNE requested Battelle...

283

Status of conversion of NE standards to national consensus standards  

SciTech Connect

This report is a summary of the activities that have evolved to effect conversion of nuclear energy standards to national consensus standards, and the status of current conversion activities.

Hudson, R.C.; McKee, R.O.

1989-03-01T23:59:59.000Z

284

Laser glazing of flat steel surface - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

flat steel surface Laser glazing of flat surface of steel parts is shown in the movie clip by moving the required beam over the surface at a constant speed...

285

Laser Rock Drilling Demo - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

Demo A high power pulsed Nd:YAG laser beam at Argonne's Laser Applications Lab is being shown in this movie to drill oil reservoir rock, a potential application in gas and oil well...

286

Laser Rock Perforation Demo - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

rock perforation demo High power laser beam can be used in oil well completion application for perforating oil reservoir rock and increasing rock's permeability for high oil...

287

Microsoft Word - NE Brief#70 Summary (10-12)  

NLE Websites -- All DOE Office Websites (Extended Search)

nuclear engineering or in an option program equivalent to a major. Thirty-two academic programs reported having nuclear engineering programs during 2011, and data was received from...

288

NE researchers win two R&D 100 Awards  

NLE Websites -- All DOE Office Websites (Extended Search)

Nuclear Safety Materials Disposition Decontamination & Decommissioning Nuclear Criticality Safety Nuclear Data Program Nuclear Waste Form Modeling Departments Engineering...

289

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

290

2010 Annual Planning Summary for Nuclear Energy (NE) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Annual Planning Summary for National Nuclear Security Administration Service Center (NNSA-SC) 2010 Annual Planning Summary for Defense Nuclear Nonproliferation (NA-20) 2010 Annual...

291

BASELINE IE-NE EXPERIMENTS USING THE SPRACH ...  

Science Conference Proceedings (OSTI)

... in which a limited set of entities is introduced and then re- ferred to in various ways (eg, Winston Scott, later just Scott; Bloomberg News Service ...

2011-08-22T23:59:59.000Z

292

ne Minute Guide to ... COMPENDEX on EiVillage  

E-Print Network (OSTI)

(*), Autostemming AND, OR, NOT (OR inserted between terms by default) "Author Affiliation" searches only the refine results feature. Click on Easy Search tab, enter keyword. * Refine results by clicking on the links under the listed subject headings. Under Search Results click the to delete the term SEARCH

California at Los Angeles, University of

293

CA CAIOlf Mr. Andrew Wallo. III, NE-23  

Office of Legacy Management (LM)

sites under consideration; and six institutions recently iden- q J-05 tified during a search of Hanford records. py&m I ;y. 2 8 The attached was prepared to document the...

294

CA M r. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

sites under consideration; and six institutions recently iden- hy .0-q tified during a search of Hanford records. ply&D r.'y. 2. g The attached was prepared to document the...

295

Confronting mass-varying neutrinos with MiniBooNE  

E-Print Network (OSTI)

We study the proposal that mass-varying neutrinos could provide an explanation for the LSND signal for \\bar\

V. Barger; D. Marfatia; K. Whisnant

2005-09-16T23:59:59.000Z

296

Development of Energy Management Strategies for Automated Real- Time Pricing: Control System Enhancements for Thermal Energy Storage (TES) and Modulating Building Loads  

Science Conference Proceedings (OSTI)

Many prominent electric utilities throughout the United States are currently investigating real-time pricing rate structures (RTP) as a means of giving their large customers an economic incentive to reduce their electricity usage during periods when the utility's cost of providing power is high. This report summarizes the results of an engineering study of the technical approach and potential benefits of optimizing thermal energy storage in response to real-time pricing of electricity. The program is com...

1996-06-18T23:59:59.000Z

297

The Sixth Risk-Informed Inservice Inspection (RI-ISI) Workshop: Living Requirements, Lessons Learned, and New Initiatives Meeting No tes  

Science Conference Proceedings (OSTI)

The Sixth Risk-Informed Inservice Inspection (RI-ISI) Workshop was held in Hilton Head, South Carolina, USA, on July 29 and 30, 2004. It consisted of two days of training, presentations, a discussion forum, and evaluation of plant-specific results. Attendees included representatives from domestic and international utilities and support organizations. This workshop provided training to personnel investigating the feasibility of implementing RI-ISI methodologies, lessons learned in the development and impl...

2004-11-09T23:59:59.000Z

298

Microsoft Word - PARS II CPP Upload Requirements.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U U C (C Pro U.S. D Contrac CPP) U oject A S Phon Depart ctor Pr Upload Assessm System Vers Ap Su Energy E 20440 Cent German ne 301-916- ww tment roject P d Requ ment a m (PAR sion 1.4 Dr pril 9, 2010 ubmitted by nterprise So tury Blvd. S ntown, MD -0050 Fax ww.eesllc.ne t of En Perform uireme and Re RS II) raft 0 : olutions Suite 150 20874 301-916-00 et nergy mance ents for eportin 66 y e r ng ii Title Page Document Name: Contractor Project Performance (CPP) Upload Requirements for PARS II, V1.4 Publication Date: April 9, 2010 Contract Number: DE-AT01-06IM00102 Project Number: 1ME07, CLIN 2 Prepared by: Steven Ducharme, PMC, LLC Lenore Morrison, PMC, LLC Judith Bernsen, PMC, LLC Edited by: Dennis Stoner, EES, LLC Reviewed by: Mark Landry, Dekker, LTD

299

CREATED USING THE RSC REPORT TEMPLATE (VER. 3.1) -SEE WWW.RSC.ORG/ELECTRONICFILES FOR DETAILS [journal], [year], [vol], 0000 | 1  

E-Print Network (OSTI)

not been deposited with the Cambridge Crystallographic Data Center). Experimental and simulated X numbers of reference compounds; and the experimental and simulated X-ray powder diffraction patterns. Heterocycles 1997, 45, 2471­2474. (12) Marti, E. E. Thermochim. Acta 1973, 5, 173­220. (13) Roux, M. V.; Da

Harries, Daniel

300

IEEE Network March/April 201140 0890-8044/11/$25.00 2011 IEEE ver the last two decades, wireless and particu-  

E-Print Network (OSTI)

- tion has a direct impact on cost, embodied energy only has an indirect one depending on the pricing are resulting in increased demand for energy consumption in cel- lular networks. Energy Consumption of Cellular-hour) of the total worldwide electrical energy is consumed by information and communication tech- nology (ICT) [1

Chen, Min

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Why perform time-lapse seismic monitoring? Is it to ver-ify the reservoir model? No! We should conduct time-lapse  

E-Print Network (OSTI)

, and that this implies that oil is being lost through the spill point, never to be recovered, even if that reservoir technologies, it has evolved into a test of petrophysics and reservoir models as well. The field of most, HORACIO ACEVEDO, JOSHUA I. HAATAJA, and ANASTASIA MINAEVA, Michigan Technological University, Houghton

302

Synoptic Aerial Surveys and Abundance Estimates for Ice-associated Seals in US and Russian Waters Michael Cameron, Peter Boveng, Erin Moreland and Jay Ver Hoef  

E-Print Network (OSTI)

Synoptic Aerial Surveys and Abundance Estimates for Ice-associated Seals in US and Russian Waters synoptic aerial surveys of the eastern Bering Sea in tandem with Russian researchers employed to survey. Testing a ship-based Unmanned Aerial System (UAS) for surveying the Bering Sea pack ice. AFSC Quarterly

303

The South Pole Telescope bolometer array and the measurement of secondary Cosmic Microwave Background anisotropy at small angular scales  

E-Print Network (OSTI)

poorly coupled excess heat capacity; this extended modelbolometer. The TES, with heat capacity C TES is connectedlumped thermal element with heat capacity C 0 and electrical

Shirokoff, Erik D.

2011-01-01T23:59:59.000Z

304

Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California  

E-Print Network (OSTI)

TES Avg. DA Wholesale Price PV Penetration (% Annual Load) (Generation Sold at Low Prices PV Penetration (% AnnualTES Avg. DA Wholesale Price PV Penetration (% Annual Load) (

Mills, Andrew

2013-01-01T23:59:59.000Z

305

Model Predictive Control of HVAC Systems: Implementation and Testing at the University of California, Merced  

E-Print Network (OSTI)

TOTAL ELECTRICAL AND THERMAL ENERGIES , AND CUMULATIVE COPandparameterestimator Ifthermalenergystorage(TES)isbasis to charge the thermalenergystorage(TES)tank.

Haves, Phillip

2010-01-01T23:59:59.000Z

306

Measured energy performance of a US-China demonstration energy-efficient office building  

E-Print Network (OSTI)

lighting system with efficient fixtures, daylighting,has both daylighting controls and a TES system. Electricity

Xu, Peng; Huang, Joe; Jin, Ruidong; Yang, Guoxiong

2006-01-01T23:59:59.000Z

307

Grji'  

Office of Legacy Management (LM)

Grji' Grji' cd ,-ytE,tes Government w. / -/ I-i' -- -' - ,:' d--z, L, -. m Deparlment of Energy REPLY TO NE-20 ATTN OF. SUGJECT: Designation of Sites for Remedial Action - Metal Hydrides, Beverly, MA; Bridgeport Brass, Adrian, MI and Seymour, Chicago, IL CT; National Guard Amory, TO. Joe LaGrone, Macager Oak Ridge Operations Office 6ased on the attached radiological survey data (Attachments 1 through 3) and an appropriate authority review, the following properties are being authorized for remedial action. It should be noted that the attached survey data are for designation purposes only and that Bechtel National, Inc. (BNI) should conduct appropriate comprehensive characterization studies to determine the extent and magnitude of contamination on these

308

SachbuchAKTUELL Bitte faxen an: +49 (0)6221/345-4229 -Vielen Dank!  

E-Print Network (OSTI)

gelingen kann, Hochschulkarriere und Familie zu ver- einen. Birgit Piechulla (Hrsg.) Professorin und Mutter

Rostock, Universität

309

Microsoft PowerPoint - NE FY2012 Budget, SMR, and BRC 121311.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Update Update Dr. Peter Lyons Assistant Secretary for Nuclear Energy U.S. Department of Energy Nuclear Energy Advisory Committee Washington, DC December 13, 2011 2 Overview of NEAC Rotation Policy NEAC Statistics * Prior to new members being added in 2009, the average term for the Committee was about 10 years * Reappointed all 16 members with 5 rotating out by September 30 th 2012 * Rotating Members: John Ahearne (Vice-Chair), Marv Fertel, Thomas Cochran, Allen Sessoms, and Neil Todreas * Added Members: Matthew Bunn, Margaret Chu, Susan Eisenhower, Mujid Kazimi, Regis Matzie, Richard Meserve, and Alfred Sattelberger * Disciplines of new members include: Applied Physics, Fuel Element Design, Energy Efficiency, National Security, Advanced Reactor Development, and Nuclear Non-proliferation Issues.

310

6-15-2010_NE_Final_Testimony_R-Shane-Johnson.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R. Shane Johnson R. Shane Johnson Chief Operating Officer for Nuclear Energy U.S. Department of Energy before the Subcommittee on Energy Senate Committee on Energy and Natural Resources on S. 3233, the Surplus Uranium Disposition Act of 2010 June 15, 2010 Introduction Thank you, Madam Chairman, Ranking Member Risch, and Members of the Subcommittee. I appreciate this opportunity to appear before you and comment on legislation under consideration by the Committee, as well as to provide information on the Department of Energy's management and disposition of its excess uranium. The Administration continues to view nuclear power as an important element in its strategy to increase energy security and combat climate change. A strong domestic nuclear industry supports the expansion of clean, carbon-free nuclear energy in the

311

NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division  

Office of Legacy Management (LM)

Hattie Carwell. SAN/NSQA Division Hattie Carwell. SAN/NSQA Division Attached for your information is the list Of Callfornia sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified for FUSRAP. The only site in California that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Program are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on th*? list, please call me at FTS 233-5439. Andrew Wallo III, Designation and Certification Manager Division of Facilitv and Site

312

Microsoft Word - N01401_NE and 4-5 Closure Mon Plan.doc  

Office of Legacy Management (LM)

Closure Monitoring Plan for the Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site August 2009 LMS/PIN/N01401 This page intentionally left blank LMS/PIN/N01401 Pinellas Environmental Restoration Project Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site August 2009 This page intentionally left blank U.S. Department of Energy Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site July 2009 Doc. No. N01401 Page i Contents 1.0 Introduction......................................................................................................................... 1 2.0 Summary of Source Removal Activities............................................................................. 1 3.0 Delineation of Contaminant Plumes ...................................................................................

313

Solubility of Gases in Glass. II. He, Ne, and H2 in Fused Silica  

Science Conference Proceedings (OSTI)

The statistical thermodynamics of the gas?in?glass system provides a basic model of both physical and chemical solubility. The physical solubility result is essentially equivalent to that for monatomic solubility. The chemical solubility result is dependent upon the specific system involved. The model was compared with experiment for a variety of systems. Helium and neon in fused silica were examples of the physical solubility of monatomic gases. Variations of the thermal history of the fused silica did not appear to have a measurable effect on physical solubility as evidenced in the helium data. Hydrogen in fused silica was an example of the physical solubility of polyatomic gases. Physical solubility was measured by a modified Seiverts technique and was characterized by a linear dependence on pressure. Binding energies for the physically dissolved species were of the order expected for van der Waals bonding. Vibrational frequencies were on the order of 1013 sec?1 with the heavier species having the lower frequencies. Hydrogen in fused silica was also an example of the chemical solubility of polyatomic gases. The literature gave data for the chemical solution of hydrogen in fused silica

James F. Shackelford; Perry L. Studt; Richard M. Fulrath

1972-01-01T23:59:59.000Z

314

EQUILIBRATION IN THE REACTION OF 175 and 252 MeV~;;20Ne WITH 197Au  

E-Print Network (OSTI)

and J. R. Huizenga, Nuclear Fission, Academic Press, N.Y. ,nuclear properties such as particle emission, and the systematics of fission

Moulton, James Bennett

2011-01-01T23:59:59.000Z

315

Welcome to the second edition of C&W's Energy and Sustainability Task Force Ne  

NLE Websites -- All DOE Office Websites (Extended Search)

second edition of C&W's Energy and Sustainability Task Force Newsletter. This second edition of C&W's Energy and Sustainability Task Force Newsletter. This publication illustrates how C&W is delivering on its commitment to enhance the environmental performance of commercial real estate. C&W Managed Properties Earn LEED Volume Certification In January 2010, 18 properties under C&W management earned LEED (Leadership in Energy and Environmental Design) certification utilizing the U.S. Green Building Council's (USGBC) Portfolio Program and volume certification process. More than half of the properties certified at the Platinum and Gold levels. Working closely with our clients, C&W is

316

Klein-NERAC NE education taskforce report 5-18-04  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Department of Nuclear Engineering & Radiation Health Physics Report of the Nuclear Energy Research Advisory Committee Nuclear Power Engineering Curriculum Task Force April 7, 2004 Department of Nuclear Engineering & Radiation Health Physics Task Force Members * Andrew C. Klein, Chair, Oregon State University * James F. Stubbins, University of Illinois, Champaign-Urbana * Gilbert Brown, University of Massachusetts, Lowell * Harold Ray, Southern California Edison * Eugene S. Grecheck, Dominion Energy Department of Nuclear Engineering & Radiation Health Physics Primary Concern Expressed * Nuclear engineering curricula had changed over recent times * No longer producing engineers with training optimal to the needs of the power industry Department of Nuclear Engineering

317

Ne?gali? asmen? sociokult?rinis ugdymas Utenos miesto bendruomen?je.  

E-Print Network (OSTI)

??After Lithuania has entered the world community not equal position of some social groups in society, especially disabled, came to light. Although disabled people are (more)

Treinien?,; Daiva

2005-01-01T23:59:59.000Z

318

Geophysical imaging methods for analysis of the Krafla Geothermal Field, NE Iceland  

E-Print Network (OSTI)

Joint geophysical imaging techniques have the potential to be reliable methods for characterizing geothermal sites and reservoirs while reducing drilling and production risks. In this study, we applied a finite difference ...

Parker, Beatrice Smith

2012-01-01T23:59:59.000Z

319

Magnetostratigraphy and small mammals of the Late Oligocene Banovii basin in NE Bosnia and Herzegovina  

E-Print Network (OSTI)

(AFEM) Berlin 08/14/61 06/01/63 X X X X X Bosnia and Herzegovina (Joint Endeavor) 11/20/95 12/20/96 X X X X X Bosnia and Herzegovina (Joint Guard) 12/20/96 Present X X X X X Cambodia 03/29/73 08/15/73 X X

Utrecht, Universiteit

320

Microsoft Word - N01357_NE Site Final LDA Report.doc  

Office of Legacy Management (LM)

Florida Statutes, and Rule 62-621.300(4), F.A.C., pursuant to FDEP's federally approved National Pollutant Discharge Elimination System storm water regulatory program. An FDEP...

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

NE Scientists Chien, Sheen, Raptis and Wang win R&D 100 Award  

NLE Websites -- All DOE Office Websites (Extended Search)

environment. The Argonne PAS System can also be used for environmental monitoring, crime scene forensics and cargo and food inspections. Photoacoustic Spectroscopy (PAS)...

322

TransForum v8n1 - EcoCAR: The NeXt Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Mike Wahlstrom and DOEs Steven Boyd perform a safety inspection on U. Tennessees vehicle at the Challenge X Winter Workshop in Los Angeles. EcoCAR logo Argonnes Mike...

323

ANL/NE-12/43 Light Water Reactor Sustainability (LWRS)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ANLNE-1243 Light Water Reactor Sustainability (LWRS) Program - R&D Roadmap for Non-Destructive Evaluation (NDE) of Fatigue Damage in Piping ...

324

Overview of DOE-NE Structural Materials Research, Materials Challenges and Operating Conditions  

Science Conference Proceedings (OSTI)

This presentation summarized materials conditions for application of nanomaterials to reactor components. Material performance is essential to reactor performance, economics, and safety. A modern reactor design utilizes many different materials and material systems to achieve safe and reliable performance. Material performance in these harsh environments is very complex and many different forms of degradation may occur (often together in synergistic fashions). New materials science techniques may also help understand degradation modes and develop new manufacturing and fabrication techniques.

Maloy, Stuart A. [Los Alamos National Laboratory; Busby, Jeremy T. [ORNL

2012-06-12T23:59:59.000Z

325

OMAHA, NE, DISTRICT This district comprises portions of Montana, Wyoming, North Dakota, South Dakota, Minnesota, Colorado,  

E-Print Network (OSTI)

operation and maintenance activities continued. In FY09 an ARRA contract was awarded to perform testing

US Army Corps of Engineers

326

EcoCAR: The NeXt Challenge North America's Premier Collegiate...  

NLE Websites -- All DOE Office Websites (Extended Search)

and demonstration of advanced propulsion and alternative fuel technologies and to train the next generation of engineers to lead the industry in the 21st century. A...

327

Synthetic studies toward palau򡭩ne and enantioselective total synthesis of biogenetically related (+)-phakellin and (+)-monobromophakellin  

E-Print Network (OSTI)

Oroidin alkaloids, also known as pyrrole-imidazole alkaloids, have become a hot area of chemical and biological research due to their diverse and intriguing structural features and biological activities. Palau'amine (i), one of the hexacyclic oroidin-derived secondary metabolites, contains a fully substituted chloro-cyclopentane ring, a piperazinone moiety and two cyclic guanidines. With the uniqueness and complexity of its structure, palauamine has been a synthetic challenge and has not yet succumbed to total synthesis. The overall objective of this work was to explore synthetic pathways toward palauamine and biogenetically related congeners. Most of the work was focused on developing a synthetic pathway for the palauamine structure proposed in its isolation report dated back to 1993. Starting from a Diels-Alder adduct (iii), oxidation/chlorination followed by phakellin (ii) annulation afforded an advanced pentacyclic intermediate possessing all the carbon framework and all but one ring system of palauamine. Recently, however, a series of reports questioned the originally proposed palauamine structure and called for a revision of the stereochemistry of two carbon centers (iv). Now palauamine has an identical chlorocyclopentane core with axinellamine (vi). With the target changed, we devised a new biomimetic pathway toward both natural products via a common intermediate (v), which was synthesized in 12 steps from the Diels-Alder adduct (iii).

Wang, Shaohui

2008-05-01T23:59:59.000Z

328

EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

hybrid electric drives. The teams using plug-in hybrid electric and extended-range electric drives have also adapted their vehicles to run on either E85 (85% ethanol, 15%...

329

Does plant richness influence animal richness? the mammals of Catalonia (NE Spain)  

E-Print Network (OSTI)

B.A. & Porter, E.E. (2003) Does herbivore diversity depend247252 BIODIVERSITY RESEARCH Does plant richness influencenot directly causal. This does not mean that plants do not

Hawkins, Bradford A.; Pausas, J G

2004-01-01T23:59:59.000Z

330

NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division  

Office of Legacy Management (LM)

Attached for your information is the list Of Callfornia sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action...

331

Klein-NERAC NE education taskforce report 5-18-04  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of radiation with matter, radiation protection, reactor physics and theory, reactor thermal hydraulics, nuclear engineering design. * Most also include nuclear reactor...

332

DOE-NE Light Water Reactor Sustainability Program and EPRI Long...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Joint Research and Development Plan April 2013 U.S. Department of Energy Office of Nuclear Energy DISCLAIMER This information was prepared as an account of work sponsored by an...

333

VerDate 112000 15:58 May 15, 2001 Jkt 194001 PO 00000 Frm 00001 Fmt 4717 Sfmt 4717 E:\\FR\\FM\\16MYR2.SGM pfrm10 PsN: 16MYR2 May 16, 2001  

E-Print Network (OSTI)

1986. SWSA 6 is currently undergoing process knowledge, and repackaging activities. RCRA/CERCLA closure. A revised Closure Plan 2.2.1.1 RCRA Assessments, Closures, and Corrective Measures The Hazardous and Solid. At the Y-12 Plant, 26 RCRA units have been certified closed by TDEC since the mid-1980s. Closure

334

96 P U R S U I T A N D P R O M O T I O N O F S C I E N C E ver the last half-a-century activity in  

E-Print Network (OSTI)

were neutral particles from interstellar space which enter the solar system, get ionized raining on the earth from outside the solar system. They comprise mostly atomic nuclei from hydrogen of a few power laws with indices of ~ Ð 2.7, Ð3.2, Ð2.8. The electrons constitute about 1% of the nucleonic

Srinivasan, N.

335

6. Impact of smoke and moisture on shortwave radia7ve hea7ng profile Dynamical and Radia7ve Influences of Smoke Transport on the Southeast Atlan7c Atmospheric Ver7cal Structure  

E-Print Network (OSTI)

Office, United Kingdom Email: aadebiyi@rsmas.miami.edu 1. Introduc7on Seasonal of Miami, Rosens=el School of Marine & Atmospheric Science, Miami, FL; 2UK Met over the southeast Atlan:c ocean, with the peak in aerosol loading occurring

Zuidema, Paquita

336

L'opration populaire d'amnagement de Pointe-Saint-Charles : vers une appropriation du quartier par les citoyens sous l'initiative de la table de concertation action-gardien?.  

E-Print Network (OSTI)

??Dans le contexte de mtropolisation, les grands projets de dveloppement urbains se sont imposs comme une stratgie de revitalisation urbaine privilgie pour positionner les villes (more)

Grenier, Genevive

2009-01-01T23:59:59.000Z

337

Le rle de la presse dans la constitution du littraire au Bas-Canada et au Brsil au cours du premier XIXe sicle : vers la formation d'une culture nationale dans les collectivits neuves des Amriques.  

E-Print Network (OSTI)

??Cette thse envisage la formation des cultures nationales au sein de deux collectivits neuves des Amriques, alors que s'enclenche, au toumant du XIXe sicle, un (more)

Doyon, Nova

2008-01-01T23:59:59.000Z

338

The Concept of Comonotonicity in Actuarial Science and Finance: Applications  

E-Print Network (OSTI)

In an insurance c o text,o ne isoB interested in thedistributio functio o a sum o rando variables. Such a sum appears when coBBthe aggregate claimso f an insurance po rtfo o ver a certain reference perio d. Italso appears when coBdisco ted payments related to a single po licyo a poBat di#erent future po ints in time. Theassumptio o mutual independence between the coB oB ts o the sum is very co venient fro a coB- po int o view, butsoB no a realistico ne. In The Concept of Comonotonicity in Actuarial Science and Finance: Theory, we determined appro ximatio fo sumso f rando variables, when thedistributio o f the coB oB ts are kno wn, but thesto chastic dependence structure between them isunkno wn oto o cumberso to wo rk with. Practical applicatio o f thistheo will becoBin this paper. o. papers are to a large extent ano verviewo recent research resultsos tained by theautho butalso newtheoBand practical results are presented. 1

J. Dhaene; M. Denuit; M.J. Goovaerts; R. Kaas; D. Vyncke

2002-01-01T23:59:59.000Z

339

Model Predictive Control of HVAC Systems: Implementation and Testing at the University of California, Merced  

E-Print Network (OSTI)

IGURE 2.20: T HERMAL ENERGY STORAGE TANK VALIDATION F IGUREestimator Ifthermalenergystorage(TES)iseffectivelycharge the thermalenergystorage(TES)tank. Basedon

Haves, Phillip

2010-01-01T23:59:59.000Z

340

Analysis of a Retrofitted Thermal Energy Storage Air-conditioning System of a Marine Museum.  

E-Print Network (OSTI)

??Thermal energy storage(TES) air-conditioning system is a electrical load management technology with great potential to shift load from peak to off-peak utility periods. TES is (more)

Yu, Po-wen

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Demonstration Development Project: Solar Thermocline Storage Systems: Preliminary Design Study  

Science Conference Proceedings (OSTI)

Solar thermal energy storage (TES) has the potential to significantly increase the operating flexibility of solar power. TES allows solar power plant operators to adjust electricity production to match consumer demand, enabling the sale of electricity during peak demand periods and boosting plant revenues. To date, TES systems have been prohibitively expensive except in certain markets. Two of the most significant capital costs in a TES system are the storage medium (typically molten salt) and the storag...

2010-06-18T23:59:59.000Z

342

Abstracts of Awards for Fiscal Year 2009 NIST SBIR Program  

Science Conference Proceedings (OSTI)

... required for many industrial, research, and homeland security applications. ... TES arrays can uniquely solve to monitor nuclear reactor use), quantum ...

2013-03-12T23:59:59.000Z

343

technology offer Vienna University of Technology | Research and Transfer Support | Claudia Doubek  

E-Print Network (OSTI)

of material handling devices Testing of dynamic system behaviour (rapid changes from loading to unloading Storage (TES) | Sand | Fluidized Bed | Ash Cooler Volatility of renewable energy generation asks for efficient thermal energy storage systems (TES). The novel TES of Vienna University of Technology (VUT

Szmolyan, Peter

344

technology offer Vienna University of Technology | Research and Transfer Support | Claudia Doubek  

E-Print Network (OSTI)

handling devices Testing of dynamic system behaviour (rapid changes from loading to unloading, system Storage (TES) | Sand | Fluidized Bed | Ash Cooler Volatility of renewable energy generation asks for efficient thermal energy storage systems (TES). The novel TES of Vienna University of Technology (VUT

Szmolyan, Peter

345

PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

- integrated emissions, DAQ, CAN, power analyzer 3 Testing Completed - Kokam Hymotion Prius, dedicated test vehicle - EnergyCS Prius ver.1 and ver.2, AVTA vehicle - A123 Hymotion...

346

Static Analyzers in Software Engineering  

Science Conference Proceedings (OSTI)

... Testing also requires artifacts that are complete enough to be executable, possibly with supporting dri- vers, stubs, or simulated components. ...

2013-05-07T23:59:59.000Z

347

Environmental Protection Agency 61.193 (3) The date and time identifying  

E-Print Network (OSTI)

Emissions From Phosphogypsum Stacks SOURCE: 57 FR 23317, June 3, 1992, unless otherwise noted. VerDate 11

348

Towards a Theory of Proofs of Classical Logic Habilitation diriger des recherches  

E-Print Network (OSTI)

iii 0 Vers une thorie des preuves pour la logique classique v 0.1 Catgories des preuves.............................. vi

Universit Denis; Diderot Paris; Lutz Straburger; Gilles Dowek; Delia Kesner; Christian Retor

2013-01-01T23:59:59.000Z

349

Time scale of the fission process in the reaction 50A MeV 20Ne + 165Ho  

E-Print Network (OSTI)

The pre-scission time in the de-excitation of highly excited 178W produced in the reaction of 2ONe + 165Ho at 50A MeV was determined as a function of fission fragment mass asymmetry. The techniques employed used the pre-scission and post scission multiplicities of alpha particles, measured in coincidence with the fission fragments, to determine excitation energy of the fissioning nucleus at scission. Then the fission time was evaluated using statistical model calculations. It was found for a compound system of mass 178 amu and excitation energy of 580 MeV that the fission time is [ ] 1 x 10-20 s regardless of the asymmetry.

Mdeiwayeh, Nader

1995-01-01T23:59:59.000Z

350

Superfund Record of Decision (EPA Region 7): Cornhusker Army Ammunition Plant, Operable Unit 2, Hall County, NE, September 30, 1998  

Science Conference Proceedings (OSTI)

This Record of Decision (ROD) document presents the selected remedial action for the six areas of concern (AOCs) located at the Cornhusker Army Ammunition Plant (CHAAP) in Grand Island, Nebraska designated as OU2. The remedial action is chosen in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERLCA), as amended by the Superfund Amendments and Reauthorization Act (SARA) of 1986, and with the National Oil and Hazardous Substances Pollution Contingency Plan (NCP). The information supporting the decisions contained in the remedy is contained in the administrative record.

NONE

1999-03-01T23:59:59.000Z

351

A multiapproach study of soil attributes under land use and cover change at the Cap de Creus Pennsula, NE Spain.  

E-Print Network (OSTI)

??The work presented in this Doctoral Thesis has studied the temporal and spatial patterns of the most relevant soil parameters with special attention posed to (more)

Emran Khaled Abd El Aziz, Mohamed

2012-01-01T23:59:59.000Z

352

CASTELLA FRANCOIS IRISA & IRMAR Ne le 18 Decembre 1971 `a Fontenay-aux-Roses (92) Universite de Rennes I  

E-Print Network (OSTI)

dadantii (Grenier et al., 2006) and Pseudomonas syrin- gae pv. syringae B728a (Stavrinides et al., 2009 several bac- terial Cyt-like toxin genes in aphid pathogenesis (Grenier et al., 2006), and although­pathogen interactions (Lin et al., 1984; Sadosky et al., 1989; Zhao et al., 1993; Hill et al., 1994; Zhao and Hill, 1995

Castella, François

353

CASTELLA FRANCOIS IRISA & IRMAR Ne le 18 Decembre 1971 a FontenayauxRoses (92) Universit e de Rennes I  

E-Print Network (OSTI)

dadantii (Grenier et al., 2006) and Pseudomonas syrin- gae pv. syringae B728a (Stavrinides et al., 2009 several bac- terial Cyt-like toxin genes in aphid pathogenesis (Grenier et al., 2006), and although­pathogen interactions (Lin et al., 1984; Sadosky et al., 1989; Zhao et al., 1993; Hill et al., 1994; Zhao and Hill, 1995

Castella, François

354

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

355

Climatic implications of correlated upper Pleistocene glacial and fluvial deposits on the Cinca and Gallego rivers, NE Spain  

SciTech Connect

We correlate Upper Pleistocene glacial and fluvial deposits of the Cinca and Gallego River valleys (south central Pyrenees and Ebro basin, Spain) using geomorphic position, luminescence dates, and time-related trends in soil development. The ages obtained from glacial deposits indicate glacial periods at 85 {+-} 5 ka, 64 {+-} 11 ka, and 36 {+-} 3 ka (from glacial till) and 20 {+-} 3 ka (from loess). The fluvial drainage system, fed by glaciers in the headwaters, developed extensive terrace systems in the Cinca River valley at 178 {+-} 21 ka, 97 {+-} 16 ka, 61 {+-} 4 ka, 47 {+-} 4 ka, and 11 {+-} 1 ka, and in the Gallego River valley at 151 {+-} 11 ka, 68 {+-} 7 ka, and 45 {+-} 3 ka. The times of maximum geomorphic activity related to cold phases coincide with Late Pleistocene marine isotope stages and heinrich events. The maximum extent of glaciers during the last glacial occurred at 64 {+-} 11 ka, and the terraces correlated with this glacial phase are the most extensive in both the Cinca (61 {+-} 4 ka) and Gallego (68 {+-} 7 ka) valleys, indicating a strong increase in fluvial discharge and availability of sediments related to the transition to deglaciation. The global Last Glacial Maximum is scarcely represented in the south central Pyrenees owing to dominantly dry conditions at that time. Precipitation must be controlled by the position of the Iberian Peninsula with respect to the North Atlantic atmospheric circulation system. The glacial systems and the associated fluvial dynamic seem sensitive to (1) global climate changes controlled by insolation, (2) North Atlantic thermohaline circulation influenced by freshwater pulses into the North Atlantic, and (3) anomalies in atmospheric circulation in the North Atlantic controlling precipitation on the Iberian peninsula. The model of glacial and fluvial evolution during the Late Pleistocene in northern Spain could be extrapolated to other glaciated mountainous areas in southern Europe.

Lewis, Claudia J [Los Alamos National Laboratory; Mcdonald, Eric [NON LANL; Sancho, Carlos [NON LANL; Pena, Jose- Luis [NON LANL

2008-01-01T23:59:59.000Z

356

EXPERIMENTAL STUDY OF RADIATIVE PION CAPTURE ON 13c, 20Ne, 90Zr, 19F AND 12C  

E-Print Network (OSTI)

charged particles. liie event trigger requirement for datasee Section IV.C). An event trigger causes the triggeringsoftware system "Q". The event trigger rate is about 100 per

Martoff, Charles Jeffrey

2010-01-01T23:59:59.000Z

357

DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program Joint Research and Development Plan  

SciTech Connect

Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's electrical generation capability.

Don Williams

2012-04-01T23:59:59.000Z

358

Evaluation Framework and Analyses for Thermal Energy Storage Integrated with Packaged Air Conditioning  

SciTech Connect

Few third-party guidance documents or tools are available for evaluating thermal energy storage (TES) integrated with packaged air conditioning (AC), as this type of TES is relatively new compared to TES integrated with chillers or hot water systems. To address this gap, researchers at the National Renewable Energy Laboratory conducted a project to improve the ability of potential technology adopters to evaluate TES technologies. Major project outcomes included: development of an evaluation framework to describe key metrics, methodologies, and issues to consider when assessing the performance of TES systems integrated with packaged AC; application of multiple concepts from the evaluation framework to analyze performance data from four demonstration sites; and production of a new simulation capability that enables modeling of TES integrated with packaged AC in EnergyPlus. This report includes the evaluation framework and analysis results from the project.

Kung, F.; Deru, M.; Bonnema, E.

2013-10-01T23:59:59.000Z

359

Thermal Energy Storage  

Science Conference Proceedings (OSTI)

This Technology Brief provides an update on the current state of cool thermal energy storage systems (TES) for end-use applications. Because of its ability to shape energy use, TES is strategic technology that allows end-users to reduce their energy costs while simultaneously providing benefits for electric utilities through persistent peak demand reduction and peak shifting. In addition to discussing the concepts of thermal energy storage, the Brief discusses the current state of TES technologies and dr...

2008-12-16T23:59:59.000Z

360

Consumer thermal energy storage costs for residential hot water, space heating and space cooling systems  

DOE Green Energy (OSTI)

The cost of household thermal energy storage (TES) in four utility service areas that are representative for hot water, space heating, and space cooling systems in the United States is presented. There are two major sections of the report: Section 2.0 is a technology characterization of commercially available and developmental/conceptual TES systems; Section 3.0 is an evaluation of the consumer cost of the three TES systems based on typical designs in four utility service areas.

None

1976-11-30T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Technology Partnerships Office  

Science Conference Proceedings (OSTI)

... metal strips or banks along the edges of its superconducting and normal metal layers. TES provide a total power rate or energy deposition by ...

362

Simulating the Value of Concentrating Solar Power with Thermal Energy Storage in a Production Cost Model  

SciTech Connect

Concentrating solar power (CSP) deployed with thermal energy storage (TES) provides a dispatchable source of renewable energy. The value of CSP with TES, as with other potential generation resources, needs to be established using traditional utility planning tools. Production cost models, which simulate the operation of grid, are often used to estimate the operational value of different generation mixes. CSP with TES has historically had limited analysis in commercial production simulations. This document describes the implementation of CSP with TES in a commercial production cost model. It also describes the simulation of grid operations with CSP in a test system consisting of two balancing areas located primarily in Colorado.

Denholm, P.; Hummon, M.

2012-11-01T23:59:59.000Z

363

Publications Portal  

Science Conference Proceedings (OSTI)

... in pop-in events, which are sudden displacement-burst excursions d ... High resolution gamma-ray spectroscopy with a microwave-multiplexed TES ...

2013-12-19T23:59:59.000Z

364

Thermal energy storage technical progress report, April 1990--March 1991  

DOE Green Energy (OSTI)

The Department of Energy (DOE) is supporting development of thermal energy storage (TES) as a means of efficiently coupling energy supplies to variable heating or cooling demands. Uses of TES include electrical demand-side management in buildings and industry, extending the utilization of renewable energy resources such as solar, and recovery of waste heat from periodic industrial processes. Technical progress to develop TES for specific diurnal and industrial applications under Oak Ridge National Laboratory`s TES program from April 1990 to March 1992 is reported and covers research in the areas of low temperature sorption, direct contact ice making, latent heat storage plasterboard and latent/sensible heat regenerator technology development.

Tomlinson, J.J.

1992-03-01T23:59:59.000Z

365

Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California  

E-Print Network (OSTI)

Solar Power and Thermal Energy Storage. Technical ReportCSP) with and without thermal energy storage (TES) are addedwith or without thermal energy storage at low penetration,

Mills, Andrew

2013-01-01T23:59:59.000Z

366

Cold Air Distribution in Office Buildings: Technology Assessment for California  

E-Print Network (OSTI)

the application of thermal energy storage for off-peakbuildings that combine thermal energy ice storage with coldair distribution without thermal energy storage; and (3) TES

Bauman, F.S.

2008-01-01T23:59:59.000Z

367

Thermal energy storage technical progress report, April 1990--March 1991  

DOE Green Energy (OSTI)

The Department of Energy (DOE) is supporting development of thermal energy storage (TES) as a means of efficiently coupling energy supplies to variable heating or cooling demands. Uses of TES include electrical demand-side management in buildings and industry, extending the utilization of renewable energy resources such as solar, and recovery of waste heat from periodic industrial processes. Technical progress to develop TES for specific diurnal and industrial applications under Oak Ridge National Laboratory's TES program from April 1990 to March 1992 is reported and covers research in the areas of low temperature sorption, direct contact ice making, latent heat storage plasterboard and latent/sensible heat regenerator technology development.

Tomlinson, J.J.

1992-03-01T23:59:59.000Z

368

Browse wiki | Open Energy Information  

Open Energy Info (EERE)

and equipment on the electric system as a whole, an individual electric circuit or substation.individual electric circuit or substation. OpenEIUtilityRateName TES Electric...

369

Simulation of diurnal thermal energy storage systems: Preliminary results  

DOE Green Energy (OSTI)

This report describes the results of a simulation of thermal energy storage (TES) integrated with a simple-cycle gas turbine cogeneration system. Integrating TES with cogeneration can serve the electrical and thermal loads independently while firing all fuel in the gas turbine. The detailed engineering and economic feasibility of diurnal TES systems integrated with cogeneration systems has been described in two previous PNL reports. The objective of this study was to lay the ground work for optimization of the TES system designs using a simulation tool called TRNSYS (TRaNsient SYstem Simulation). TRNSYS is a transient simulation program with a sequential-modular structure developed at the Solar Energy Laboratory, University of Wisconsin-Madison. The two TES systems selected for the base-case simulations were: (1) a one-tank storage model to represent the oil/rock TES system, and (2) a two-tank storage model to represent the molten nitrate salt TES system. Results of the study clearly indicate that an engineering optimization of the TES system using TRNSYS is possible. The one-tank stratified oil/rock storage model described here is a good starting point for parametric studies of a TES system. Further developments to the TRNSYS library of available models (economizer, evaporator, gas turbine, etc.) are recommended so that the phase-change processes is accurately treated.

Katipamula, S.; Somasundaram, S. [Pacific Northwest Lab., Richland, WA (United States); Williams, H.R. [Univ. of Alaska, Fairbanks, AK (United States). Dept. of Mechanical Engineering

1994-12-01T23:59:59.000Z

370

Potential benefits of thermal energy storage in the proposed Twin Cities district heating-cogeneration system. Final report  

DOE Green Energy (OSTI)

A new, large, cogeneration-district heating system has been proposed for the Twin Cities area, using hot water in a closed-loop system. The proposed system, as described by Studsvik Energiteknik AB of Sweden, does not employ thermal energy storage (TES). Four cases have been developed, describing system configurations which would employ TES, to evaluate the potential benefits of incorporating annual-cycle TES into the Twin Cities system. The potential benefits are found to be substantial, confirming results of earlier, generic studies of aquifer TES. The reference (Studsvik) system employs oil-fired boilers to supplement cogenerated heat, for handling peak loads and providing standby reserve. TES can serve the same function, with net energy savings in spite of heat losses during storage, by making it possible to operate the cogeneration equipment at higher capacity factors. Coal replaces oil as the fuel consumed. Energy savings of the reference system are impressive; energy savings with TES are 2 to 22% better. Capital cost requirements for boilers, cogeneration equipment, and pipelines are reduced by $66 to $258 million. The breakeven capital cost of TES is estimated to range from $43 to $76 per kilowatt peak thermal input to or withdrawal from aquifer TES. A factor in evaluating the breakeven operating cost of TES is the $14 to $31 million per year saving in cost of fuel. Abatement of air pollution and thermal pollution are concomitant benefits.

Meyer, C.F.

1979-10-01T23:59:59.000Z

371

Quantum Electrical Measurements Programs and Projects  

Science Conference Proceedings (OSTI)

... This project provides the basis for a new definition of mass, based on ... Energy Determination of X-Ray Transition Energies Using the NIST TES ...

2010-05-24T23:59:59.000Z

372

Summary of: Simulating the Value of Concentrating Solar Power with Thermal Energy Storage in a Production Cost Model (Presentation)  

DOE Green Energy (OSTI)

Concentrating solar power (CSP) deployed with thermal energy storage (TES) provides a dispatchable source of renewable energy. The value of CSP with TES, as with other potential generation resources, needs to be established using traditional utility planning tools. Production cost models, which simulate the operation of grid, are often used to estimate the operational value of different generation mixes. CSP with TES has historically had limited analysis in commercial production simulations. This document describes the implementation of CSP with TES in a commercial production cost model. It also describes the simulation of grid operations with CSP in a test system consisting of two balancing areas located primarily in Colorado.

Denholm, P.; Hummon, M.

2013-02-01T23:59:59.000Z

373

NIST Pico-Watt ACR  

Science Conference Proceedings (OSTI)

... ACR the equivalence between the electrical and optical ... ACR cavity has significantly lower heat capacity ... Low frequency temperature noise of a TES ...

2013-04-10T23:59:59.000Z

374

Subroutine LENCH  

Science Conference Proceedings (OSTI)

... ne.' ' 1 .and. str(ilench:ilench).ne.tab !Look for trailing tabs as well 1 .and. str(ilench:ilench).ne.nul ) done=.true. END DO ...

375

Test de SCRIP a Spherical Coordinate Remapping  

E-Print Network (OSTI)

transmission d'informations entre deux grilles en g'eom'etrie sph'erique. Il propose quatre m'ethodes : ffl Une 'scrip in' doit contenir : ffl num map, fix'e `a 2 pour calculer le remapping de la grille 1 vers 2 et de la grille 2 vers 1, 1 pour un seul remapping, necessairement de 1 vers 2. ffl grid file, les noms des

376

Document  

NLE Websites -- All DOE Office Websites (Extended Search)

Transmission Project, the Pacific Alternating Current Intertie, and Information on the Path 15 Transmission Upgrade-Rate Order No. WAPA-156; Notice VerDate...

377

7/9 IDN  

Science Conference Proceedings (OSTI)

... Unlike other forms of identification (such as a passive printed dri- ver's license), a smart card does not expose all of an individual's personal ...

378

AVALIAO DE IMPACTO LEGISLATIVO NO BRASIL  

E-Print Network (OSTI)

Legislativa/Senado Federal. Brass, C.T. ; Williams, E.D. ;Research Service. Ver Brass, Williams e Nuez-Neto (2006)

Meneguin, Fernando B.

2010-01-01T23:59:59.000Z

379

Employing Two Question Answering Systems in TREC-2005  

Science Conference Proceedings (OSTI)

... nec- essary linguistic knowledge for COGEX to accurately ver- ify that the losing team is entailed by Padres, and not Yankees, the statistically ...

2006-02-21T23:59:59.000Z

380

McMinnville Cottage Grove  

E-Print Network (OSTI)

a River R oaring R iver S alm o n b e r r y River Fall R iv C ultus River ver CollawashRiver Breitenbush

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Commercial Building Technology Evaluation Process  

NLE Websites -- All DOE Office Websites (Extended Search)

Flow 4 Proposed Program Elements Building Technologies Program 2 2 commercialbuildings.energy.gov ver ew Program Overview * Program Objective: - Evaluate emerging and underutilized...

382

Teil IV: Von der Satzung der Europischen Gemeinschaft ... - Springer  

Science Conference Proceedings (OSTI)

begriffenes Volk zuerst einen Gemeinsinn haben sollte, bevor es sich eine Ver- ... dermaen: Damit ein werdendes Volk die gesunden Grundstze der Politik.

383

Structure validation in the submission, review and  

E-Print Network (OSTI)

­ Release of powder CIF dictionary (ver. 1.0) · 1998 ­ Automated submission by email ­ use of the VRF

Magee, Joseph W.

384

FI 6 -7 JUILLET 98 flash informatique  

E-Print Network (OSTI)

de McKinsey qui vont à di- vers degrés développer, adapter, tester, évaluer les machines prototypes

385

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

386

ASMA 74 -CENTRE DE HAUTE MONTAGNE Plateau de Rochebrune  

E-Print Network (OSTI)

navette vers le téléphérique de Rochebrune. En voiture depuis Albertville : Ugine, Flumet, Praz sur Arly

Chamroukhi, Faicel

387

Computer Applications in Directional Solidification Processing  

Science Conference Proceedings (OSTI)

load at high temperature were pointed out by. VerSnyder in 1959 .... In the analysis, the temperature profiles on the external mold .... sistances and the electrical.

388

August 2011 Curriculum Vita  

E-Print Network (OSTI)

Energiewirtschaft, 1 (1989), 36-50. (34) "Les Frontières des Entreprises: Vers une Théorie de la Cohérence de la

Kammen, Daniel M.

389

CA.0  

Office of Legacy Management (LM)

James J. Fiore. Director Division of Facility and Site Decommissioning Projects Office of Nuclear Energy NE-23 5+%7 NE-23 Fiore 5%7 3 Enclosures bee: Aerospace NE-20 RF NE-23 RF...

390

Weights and Measures State Directors N  

Science Conference Proceedings (OSTI)

... Information. NE Division of Weights & Measures 301 Centennial Mall South Box #94757 Lincoln, NE 68509-4757. ... North Dakota. Mailing ...

2013-05-09T23:59:59.000Z

391

VerDate Aug2005 15:58 Nov 01, 2007 Jkt 214001 PO 00000 Frm 00009 Fmt 4703 Sfmt 4703 E:\\FR\\FM\\02NON1.SGM 02NON1 pwalkeronPROD1PC71withNOTICES  

E-Print Network (OSTI)

along the eastern portion of the Aleutian Island Arc and is similar in eruption style to the slightly

Magee, Joseph W.

392

VerDate Mar2010 19:05 Jul 27, 2010 Jkt 220001 PO 00000 Frm 00003 Fmt 4703 Sfmt 4703 E:\\FR\\FM\\28JYN1.SGM 28JYN1 srobertsonDSKD5P82C1PRODwithNOTICES  

E-Print Network (OSTI)

works with public and private stakeholders to protect critical infrastructure and key resources (CIKR).3, including those supporting CIKR sectors and their customers. The Task Force's report may include options, and citizens outside the CIKR sectors. Activities involving government systems, other critical infrastructures

Magee, Joseph W.

393

VerDate Mar2010 19:12 Mar 07, 2011 Jkt 223001 PO 00000 Frm 00022 Fmt 4703 Sfmt 4703 E:\\FR\\FM\\08MRN1.SGM 08MRN1 srobinsononDSKHWCL6B1PRODwithNOTICES  

E-Print Network (OSTI)

on the Smart Grid Web site at http://www.nist.gov/ smartgrid. DATES: The SGAC will hold a meeting on Thursday information on the Committee is available at http:// www.nist.gov/smartgrid/committee.cfm. Pursuant will be posted on the Smart Grid Web site at http://www.nist.gov/smartgrid. Individuals and representatives

394

Hybrid Electrical Energy Storage Systems Massoud Pedram, Naehyuck Chang, Younghyun Kim, and Yanzhi Wang  

E-Print Network (OSTI)

, and iii) energy management, load leveling, and peak shaving techniques depend- ing on the power usage, thermal energy storage (TES) and cryo- genic energy storage (CES), typically have long cycle lives the highest energy density (typically 1000 Wh/kg). Batteries, TES and CES have medium energy density, while

Pedram, Massoud

395

CN He Ne Ar Kr Xe 4 0.90 :t 0.06 1.18 :t 0.02  

E-Print Network (OSTI)

t in understanding glass structures (e.g., Shackelford and Masaryk, 1978; Shackelford and Brown, 1981

Zhang, Youxue

396

General P-T fit construction for He, N sub 2 , Ar, H sub 2 and Ne VPT used at Fermilab  

DOE Green Energy (OSTI)

Polynomial fits are constructed for Fermilab Tevatron vapor pressure thermometers (VPT) for use with ACNET database. Fit coefficients and P-T graphs are included. Fits cover the VPT saturation region and the gas region. The thermodynamic analysis of VPT bulb is used to define transition points for each cryogenic VPT with given geometry and charge'' conditions. The methodology is described to repeat fit construction calculations for any geometry and charge'' conditions if required.

Geynisman, M.; Makara, J.

1992-01-01T23:59:59.000Z

397

Materials Reliability Program: Effect of Defects in an Alloy 600/82 Weld on Stress Corrosion Cracking in Testing of Heat Affected Zo ne Specimens (MRP-254)  

Science Conference Proceedings (OSTI)

Primary water stress corrosion cracking (PWSCC) data for heat affected zones (HAZs) in thick-walled components of both Alloy 600 and Alloy 690TT are needed to support the Materials Reliability Program, MRP-55 crack growth rate (CGR) disposition relationship for Alloy 600 (EPRI report 1006695). Such data are also needed to ensure that welding of Alloy 690TT does not deleteriously affect its inherent resistance to PWSCC. CGR experiments to obtain data in the HAZ of Alloy 600 plates welded with Alloy 82 and...

2008-11-26T23:59:59.000Z

398

Petrochemical and Mineralogical Constraints on the Source and Processes of Uranium Mineralisation in the Granitoids of Zing-Monkin Area, Adamawa Massif, NE Nigeria  

Science Conference Proceedings (OSTI)

Zing-Monkin area, located in the northern part of Adamawa Massif, is underlain by extensive exposures of moderately radioactive granodiorites, anatectic migmatites, equigranular granites, porphyritic granites and highly radioactive fine-grained granites with minor pegmatites. Selected major and trace element petrochemical investigations of the rocks show that a progression from granodiorite through migmatite to granites is characterised by depletion of MgO, CaO, Fe{sub 2}O{sub 3,} Sr, Ba, and Zr, and enrichment of SiO{sub 2} and Rb. This trend is associated with uranium enrichment and shows a chemical gradation from the more primitive granodiorite to the more evolved granites. Electron microprobe analysis shows that the uranium is content in uranothorite and in accessories, such as monazite, titanite, apatite, epidote and zircon. Based on petrochemical and mineralogical data, the more differentiated granitoids (e.g., fine-grained granite) bordering the Benue Trough are the immediate source of the uranium prospect in Bima Sandstone within the Trough. Uranium was derived from the granitoids by weathering and erosion. Transportation and subsequent interaction with organic matter within the Bima Sandstone led to precipitation of insoluble secondary uranium minerals in the Benue Trough.

Haruna, I. V., E-mail: vela_hi@yahoo.co.uk [Federal University of Technology, Geology Department (Nigeria); Orazulike, D. M. [Abubakar Tafawa Balewa University, Geology Programme (Nigeria); Ofulume, A. B. [Federal University of Technology, Geosciences Department (Nigeria); Mamman, Y. D. [Federal University of Technology, Geology Department (Nigeria)

2011-12-15T23:59:59.000Z

399

I ERPO NE 2007 04 a 06 de junho de 2007 Recife / PE AVALIAO E CORREO DE VIS NO MODELO DE REGRESSO DE COX  

E-Print Network (OSTI)

31270-901 - Belo Horizonte ­ MG E-mail: {jangiovani,fcruz,enricoc}@ufmg.br Resumo O modelo de riscos viés de segunda ordem do EMVP. As simulações Monte Carlo indicam viés menor, sem aumento de variância present computational results for second-order bias evaluation and correction of MPLE's. Monte Carlos

Cruz, Frederico

400

Accurate correlation consistent basis sets for molecular core-valence correlation effects: The second row atoms Al-Ar and the first row atoms B-Ne revisited  

Science Conference Proceedings (OSTI)

Correlation consistent basis sets for accurately describing core-core and core-valence correlation effects in atoms and molecules have been developed for the second row atoms Al - Ar. Two different optimization strategies were investigated, which led to two families of core-valence basis sets when the optimized functions were added to the standard correlation consistent basis sets (cc-pVnZ). In the first case, the exponents of the augmenting primitive Gaussian functions were optimized with respect to the difference between all-electron and valence-electron correlated calculations, i.e., for the core-core plus core-valence correlation energy. This yielded the cc-pCVnZ family of basis sets, which are analogous to the sets developed previously for the first row atoms[D.E. Woon and T.H. Dunning, Jr., J. Chem. Phys. 103, 4572 (1995)]. Although the cc-pCVnZ sets exhibit systematic convergence to the all-electron correlation energy at the complete basis set limit, the intershell (core-valence ) correlation energy converges more slowly than the intrashell (core-core) correlation energy. Since the effect of including the core electrons on the calculation of molecular properties tends to be dominated by core-valence correlation effects, a second scheme for determining the augmenting functions was investigated. In this approach, the exponents of the functions to be added to the cc-pVnZ sets were optimized with respect to just the core-valence (intershell) correlation energy, except that a small amount of core-core correlation energy was included in order to ensure systematic convergence to the complete basis set limit. These new sets, denoted weighted core-valence basis sets (cc-pwCVnZ), significantly improve the convergence of many molecular properties with n. Optimum cc-pwCVnZ sets for the first-row atoms were also developed and show similar advantages.

Peterson, Kirk A. (WASHINGTON STATE UNIV TC); Dunning, Thom H. (BATTELLE (PACIFIC NW LAB))

2002-12-15T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

2 | engineering neWs | spring 2010 coluMBia engineering | spring 2010 | 3 his issue of Columbia Engineering magazine focuses on engineering  

E-Print Network (OSTI)

alumni whose work has left its mark on our daily lives. If you have information about other alumni Hankow to Canton (a line still in use today), built docks in Cuba, and was instrumental 15,000 people world-wide. Our School today has more than 24,000 living alumni, each of them leaders

Hone, James

402

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

403

Nuclear Engineering (NE) is one of the divisions within the Applied Science and Technology directorate of Argonne National Laboratory. The Division and its precursors  

E-Print Network (OSTI)

completion. However, the Project was awaiting a response from the Nuclear Decommissioning Authority over DECOMMISSIONING PLANNING PROJECT 13. The College Secretary presented the Second Annual Report on the Reactor Decommissioning Planning Project (RDPP). He reported that the Project had made significant progress in its task

Kemner, Ken

404

Quantum-fluid-dynamics approach for strong-field processes: Application to the study of multiphoton ionization and high-order harmonic generation of He and Ne atoms  

E-Print Network (OSTI)

Wigner cor- relation energy functionals are used. QUANTUM-FLUID-DYNAMICS APPROACH FOR STRONGQuantum-fluid-dynamics approach for strong-field processes: Application to the study of multiphoton; published 18 March 2002 We explore the feasibility of extending the quantum-fluid dynamics QFD approach

Chu, Shih-I

405

Nuclear engineering recruitment effort program, DE-FG02-00NE22797.A000. Report for grant issued July 1, 2000 - September 30, 2000  

SciTech Connect

Report on status of program to raise awareness and heighten interest in nuclear engineering and nuclear science, particularly among 7th through 12th grade students and pre-college freshmen.

Kerrick, Sharon

2000-12-21T23:59:59.000Z

406

RE SONANT PHO NON -A 8 8 IS TE D 6E NE HA TION. . . not observed, presumably because either the  

E-Print Network (OSTI)

,2' in the rotational position of the crystal. This separation agrees closely with the expected separation of & p of Vacancies and Rare-Gas Crystal Mixtures H. R. Glyde Chalk Riser +unclear «boratories, ~topi@ Energy of Canada Iimited, Chalk River, Ontario, Canada (Received 21 December 1970) The Gibbs-Bogolyubov variational

Glyde, Henry R.

407

1995-2011 | LS-LAMP IMPACT REPORT uniVersity of neW orLeAns | new orleans, la  

E-Print Network (OSTI)

.S., mathematics, michigan State University, East Lansing, mI m.S., Statistical Science, Baylor University, waco was the second place winner of the 2010 Joint statistical meetings (Jsm) stat Bowl. she was also named oustanding Graduate stu- dent (2010) by Baylor university's Department of statistical sciences. she has also

Kulp, Mark

408

Spectral linewidth of a Ne-like Ar capillary discharge soft x-ray laser and its dependence on amplification beyond gain-saturation  

Science Conference Proceedings (OSTI)

We report the measurement of the linewidth and temporal coherence of a = 46.9 nm neon-like argon capillary discharge soft x-ray laser and its variation with plasma column length. A wavefront division interferometer was used to resolve the 3p 1S0-3s 1P1 laser line, resulting in a measured relative linewidths of / = 3-4 10 -5. The measurements do not observe saturation re-broadening as this clearly dominantly Doppler-broadened inhomogeneous line is amplified beyond the intensity corresponding to gain saturation. Model simulations indicate that this is the result of comparatively small collisional broadening that homogenizes the line profile to practically eliminate inhomogeneous saturation re-broadening. Collisional re-distribution is computed to only play a minor role in homogenizing the line profile.

Urbanski, Lukasz [Colorado State University, Fort Collins; Marconi, Mario [Colorado State University, Fort Collins; Meng, L. M. [Colorado State University, Fort Collins; Berrill, Mark A [ORNL; Guilbaud, O. [Universite Paris Sud, Orsay, France; Klisnick, Annie [Universite Paris Sud, Orsay, France; Rocca, Jorge [Colorado State University, Fort Collins

2012-01-01T23:59:59.000Z

409

Bell L a b s , NE C Re s e ar ch I n stit u t e a nd Telco r d ia ... - CECM  

E-Print Network (OSTI)

i nfo r m ation doe s no t t ell u s t he loc ation of t he co rr e sp ond i ng f ra gmen t on t he tar ge t D N A , only s ome t h i ng a bou t t he r el ative o r de r of t he...

410

Graduate Handbook Energy Science and Engineering Program  

E-Print Network (OSTI)

- Transport Processes in Nuclear Engineering NE 571 - Reactor Theory and Design NE 572 - Nuclear Systems - Nuclear Systems Dynamics and Control NE 522 - Experimental Methods in Reactor Dynamics NE 550 - Radiation Advanced (6 credits) Reactor Design and Modeling emphasis NE 611 - Selected Topics in Reactor Theory NE 640

Tennessee, University of

411

Funding for state, city, and county governments in the state includes:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Nebraska Total Sum City, County, and SEO Allocations NE Nebraska Total Sum City, County, and SEO Allocations All $18,810,300 NE Nebraska State Energy Office $9,593,500 NE Bellevue City $194,200 NE Fremont City $106,400 NE Grand Island City $199,000 NE Hastings City $109,900 NE Kearney City $131,100 NE Lincoln City $2,401,000 NE Norfolk City $101,500 NE North Platte City $105,300 NE Omaha City $4,331,500 NE Papillion City $91,300 NE Cass County $99,900 NE Dakota County $87,300 NE Dawson County $106,300 NE Douglas County $255,800 NE Gage County $98,000 NE Lancaster County $110,300 NE Platte County $139,200 NE Sarpy County $312,600 NE Saunders County $80,600 NE Scotts Bluff County $155,600 In addition, today's announcement includes funding for the following Tribal

412

Richard Gerber!  

NLE Websites -- All DOE Office Websites (Extended Search)

1 2x o ver n ext 3 y ears * Sequencer c ost d eceasing b y 1 0 o ver s ame p eriod Compu>ng * Simulaons a t S cale a nd a t H igh V olume a lready p roduce P etabytes o f data a...

413

Potential industrial applications for composite phase-change materials as thermal energy storage media  

Science Conference Proceedings (OSTI)

Considerable effort has been spent by the US Department of Energy and its contractors over the last few years to develop composite phase-change materials (CPCMs) for thermal energy storage (TES). This patented TES medium consists of a phase-change material (typically a salt or metal alloy) that is retained within the porous structure of a supporting material (typically a ceramic). The objectives of this study were to (1) introduce CPCMs to industries that may not otherwise be aware of them, (2) identify potentially attractive applications for CPCM in industry, (3) determine technical requirements that will affect the design of CPCM's for specific applications, and (4) generate interest among industrial firms for employing CPCM TES in their processes. The approach in this study was to examine a wide variety of industries using a series of screens to select those industries that would be most likely to adopt CPCM TES in their processes. The screens used in this study were process temperature, presence of time-varying energy flows, energy intensity of the industry, and economic growth prospects over the next 5 years. After identifying industries that passed all of the screens, representatives of each industry were interviewed by telephone to introduce them to CPCM TES, assess technical requirements for CPCM TES in their industry, and determine their interest in pursuing applications for CPCM TES. 11 refs., 4 tabs.

Spanner, G.E.; Wilfert, G.L.

1989-07-01T23:59:59.000Z

414

Characterization of Transposable Elements in the Ectomycorrhizal Fungus Laccaria bicolor  

Science Conference Proceedings (OSTI)

Background: The publicly available Laccaria bicolor genome sequence has provided a considerable genomic resource allowing systematic identification of transposable elements (TEs) in this symbiotic ectomycorrhizal fungus. Using a TEspecific annotation pipeline we have characterized and analyzed TEs in the L. bicolor S238N-H82 genome. Methodology/Principal Findings: TEs occupy 24% of the 60 Mb L. bicolor genome and represent 25,787 full-length and partial copy elements distributed within 171 families. The most abundant elements were the Copia-like. TEs are not randomly distributed across the genome, but are tightly nested or clustered. The majority of TEs exhibits signs of ancient transposition except some intact copies of terminal inverted repeats (TIRS), long terminal repeats (LTRs) and a large retrotransposon derivative (LARD) element. There were three main periods of TE expansion in L. bicolor: the first from 57 to 10 Mya, the second from 5 to 1 Mya and the most recent from 0.5 Mya ago until now. LTR retrotransposons are closely related to retrotransposons found in another basidiomycete, Coprinopsis cinerea. Conclusions: This analysis 1) represents an initial characterization of TEs in the L. bicolor genome, 2) contributes to improve genome annotation and a greater understanding of the role TEs played in genome organization and evolution and 3) provides a valuable resource for future research on the genome evolution within the Laccaria genus.

Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Tuskan, Gerald A [ORNL; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

2012-01-01T23:59:59.000Z

415

Field test and assessment of thermal energy storage for residential heating  

SciTech Connect

Thermal energy storage (TES) heating units can be connected to the utility grid to accept electricity only during utility off-peak periods and yet provide round-the-clock comfort heating. Their use by an increasingly larger part of the electric-heat market could provide economic and oil-saving benefits. A field test was carried out over two full heating seasons in Vermont and Maine at 45 TES sites and 30 control sites heated by electric baseboard heaters. The TES users were billed under applicable time-of-day (TOD) rates. All sites were instrumented, and measurements of inside and outside temperatures and electrical energy consumption for heating were made and recorded every 15 min. Analysis of the data has led to the following findings and conclusions: Overall technical performance of the TES units was good under extreme weather conditions. Annualized energy use was the same for the TES and the control households. Proper sizing of the storage systems is much more important for storage heaters than for nonstorage heaters. TES users were satisfied with performance. Electric-heat bills were much lower for TES users. Occupancy effects were large and caused wide variations in energy consumption on days that had the same number of heating degree-days. The individual building heat loss determined experimentally from an analysis of the actual energy consumption per heating degreeday was 30% to 50% smaller than that determined by a walkthrough energy audit.

Hersh, H.

1983-12-01T23:59:59.000Z

416

Innovative Phase Change Thermal Energy Storage Solution for Baseload Power Phase 1 Final Report  

SciTech Connect

The primary purpose of this project is to develop and validate an innovative, scalable phase change salt thermal energy storage (TES) system that can interface with Infinias family of free-piston Stirling engines (FPSE). This TES technology is also appropriate for Rankine and Brayton power converters. Solar TES systems based on latent heat of fusion rather than molten salt temperature differences, have many advantages that include up to an order of magnitude higher energy storage density, much higher temperature operation, and elimination of pumped loops for most of Infinias design options. DOE has funded four different concepts for solar phase change TES, including one other Infinia awarded project using heat pipes to transfer heat to and from the salt. The unique innovation in this project is an integrated TES/pool boiler heat transfer system that is the simplest approach identified to date and arguably has the best potential for minimizing the levelized cost of energy (LCOE). The Phase 1 objectives are to design, build and test a 1-hour TES proof-of-concept lab demonstrator integrated with an Infinia 3 kW Stirling engine, and to conduct a preliminary design of a 12-hour TES on-sun prototype.

Qiu, Songgang

2013-05-15T23:59:59.000Z

417

Monte Carlo Comparisons to a Cryogenic Dark Matter Search Detector with Low Transition-Edge-Sensor Transition Temperature  

Science Conference Proceedings (OSTI)

We present results on phonon quasidiffusion and Transition Edge Sensor (TES) studies in a large, 3-inch diameter, 1-inch thick [100] high purity germanium crystal, cooled to 50 mK in the vacuum of a dilution refrigerator, and exposed with 59.5 keV gamma-rays from an Am-241 calibration source. We compare calibration data with results from a Monte Carlo which includes phonon quasidiffusion and the generation of phonons created by charge carriers as they are drifted across the detector by ionization readout channels. The phonon energy is then parsed into TES based phonon readout channels and input into a TES simulator.

Leman, S.W.; McCarthy, K.A.; /MIT, MKI; Brink, P.L.; Cabrera, B.; Cherry, M.; /Stanford U., Phys. Dept.; Silva, E.Do Couto E; /SLAC; Figueroa-Feliciano, E.; /MIT, MKI; Kim, P.; /SLAC; Mirabolfathi, N.; /UC, Berkeley; Pyle, M.; /Stanford U., Phys. Dept.; Resch, R.; /SLAC; Sadoulet, B.; Serfass, B.; Sundqvist, K.M.; /UC, Berkeley; Tomada, A.; /Stanford U., Phys. Dept.; Young, B.A.; /Santa Clara U.

2012-06-05T23:59:59.000Z

418

(Thermal energy storage technologies for heating and cooling applications)  

DOE Green Energy (OSTI)

Recent results from selected TES research activities in Germany and Sweden under an associated IEA annex are discussed. In addition, several new technologies for heating and cooling of buildings and automobiles were reviewed and found to benefit similar efforts in the United states. Details of a meeting with Didier-Werke AG, a leading German ceramics manufacturer who will provide TES media necessary for the United States to complete field tests of an advanced high temperature latent heat storage material, are presented. Finally, an overview of the December 1990 IEA Executive Committee deliberations on TES is presented.

Tomlinson, J.J.

1990-12-19T23:59:59.000Z

419

Tomorrow`s energy today for cities and counties - keep it cool with thermal energy storage  

DOE Green Energy (OSTI)

Cool thermal energy storage (TES) is described as a means for electric utilities to provide electricity from off-peak times, particularly in the summer when air-conditioning accounts for 50% or more of electricity consumption. Cool TES uses off-peak power to provide cooling capacity by extracting heat from a storage medium such as ice or other phase change material. A refrigeration system may may be utilized at night to provide a reservoir of cold material. During the day, the reservoir is tapped to provide cooling capacity. The advantages of TES are discussed.

NONE

1995-07-01T23:59:59.000Z

420

FY 1977 Progress report, Compressed air energy storage advanced systems analysis.  

DOE Green Energy (OSTI)

The goal of the Compressed Air Energy Storage (CAES) Advanced Systems Analysis task is to accelerate the development of new technologies that will reduce the consumption of natural gas and oil. The immediate overall objectives of this program are to: (1) provide a screening cost assessment for thermal energy storage (TES) systems that are suitable for CAES applications; (2) establish the potential fuel savings of hybrid CAES cycles that incorporate TES for recovery of the heat of compression and estimate the economic incentive for using TES in CAES systems; and (3) investigate modified CAES cycles that eliminate the use of gas and oil by the use of alternative fuels.

Kreid, D.K.; McKinnon, M.A.

1978-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

,"Nebraska Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050NE3","N3010NE3","N3020NE3","N3035NE3","N3045NE3" "Date","Natural Gas Citygate Price in Nebraska (Dollars per Thousand Cubic Feet)","Nebraska Price of...

422

DOE/EIS-0285; Transmission System Vegetation Management Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

data from U.S. Geological Survey, EROS Data Center, 1-km land cover characteristics data set, 1990 WASHINGTON OREGON CALIFORNIA NEV ADA UT AH WYO. IDAHO MONT ANA UNITED ST A TES...

423

Variables et categories grammaticales dans un modele ariane  

Science Conference Proceedings (OSTI)

Toutes tes catgories grammaticales utilises dans un modle de traduction ariane sont formalises et codes de fa mnmonique en tant que variables et valeurs de variables. L'ensemble des variables d'un ...

Jean-Phillippe Guilbaud

1986-08-01T23:59:59.000Z

424

NREL: Concentrating Solar Power Research - Collector R&D  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Energy Storage R&D Thermal Energy Storage R&D Featured Resource Learn more about NREL's capabilities in thermal storage and advanced heat transfer fluids. Thermal energy storage (TES) research at NREL focuses on reducing the costs of thermal storage and electricity from concentrating solar power (CSP) plants. NREL's TES effort contributes to these goals through materials and systems development, analysis, and modeling. CSP systems may include TES-a means of storing thermal energy for later use-to generate electricity any time when it is most needed and valuable, whether during the day, night, or cloudy intervals. Opportunities and Potential Impact TES usually reduces the levelized cost of electricity (LCOE) compared to a system without storage because of better utilization of the power block.

425

Thermal energy storage for cogeneration applications  

SciTech Connect

Cogeneration is playing an increasingly important role in providing energy efficient power generation and thermal energy for space heating and industrial process heat applications. However, the range of applications for cogeneration could be further increased if the generation of electricity could be coupled from the generation of process heat. Thermal energy storage (TES) can decouple power generation from the production of process heat, allowing the production of dispatchable power while fully utilizing the thermal energy available from the prime mover. The Pacific Northwest Laboratory (PNL) leads the US Department of Energy's Thermal Energy Storage Program. The program focuses on developing TES for daily cycling (diurnal storage), annual cycling (seasonal storage), and utility applications (utility thermal energy storage (UTES)). Several of these technologies can be used in a cogeneration facility. This paper discusses TES concepts relevant to cogeneration and describes the current status of these TES systems.

Drost, M.K.; Antoniak, Z.I.

1992-04-01T23:59:59.000Z

426

34 The Aquatic Gardener Volume 22 Number 4 35 leaved and emergent species all being  

E-Print Network (OSTI)

of temporary wetland (such as peat-lands and sump-lands) in Western Austra- lia, along with many cosmopolitan species. Examples of the cosmopolitan flora include species from Aponogeton, Isoëtes, Marsilea

Andersen, Frede ?.

427

2.1E Supplement  

E-Print Network (OSTI)

see "Ice and Eutectic Thermal Energy-Storage", p.4.15). TheP Care must be taken with Thermal Energy Storage systems toand eutectic-salt thermal energy storage (TES) systems.

Winkelmann, F.C.

2010-01-01T23:59:59.000Z

428

Sr:s I  

Office of Legacy Management (LM)

1.: rg , ili k: ".,I k,, i,:. rji i:iii ".' . , F, iir il' ?:, 'i:' ir: *, Fr, i.r |ir :y. ri FoRMERLYUTIL|ZEDMEDAEcS|TES REMEDIAL ACTION PROGRAM POST,REMEDIAL.AGTION...

429

AOCS Official Method Ja 13-91  

Science Conference Proceedings (OSTI)

Determination of Tocopherols in Lecithin by HPLC AOCS Official Method Ja 13-91 Methods Downloads Methods Downloads DEFINITION This method quantitates the individual tocopherols in lecithin by HPLC, utilizing a tes

430

A thermal energy storage system for adsorbent low-pressure natural gas storage  

SciTech Connect

Thermal energy storage (TES) was previously demonstrated to be a potentially promising technique to mitigate heat effects associated with low-pressure carbon adsorption systems for natural gas storage. Further investigations were conducted to develop information for the design of an optimized adsorption system that incorporates TES heat management. The selection of appropriate phase-change materials and nucleating agents, encapsulant materials, and corrosion inhibitors for a TES heat management system are discussed and the results of extended thermal cyclic behavior are presented. Engineering analyses and finite element analyses are employed to calculate adsorption rates, heat generation, temperatures, and heat transfer within the adsorbent bed. The size, volume, and arrangement of components for an operational TES system designed to accommodate fast-fill within a defined time limit is presented.

Jasionowski, W.J.; Kountz, K.J.; Blazek, C.F.; Tiller, A.J. (Institute of Gas Technology, Chicago, IL (United States)); Gauthier, S.W.; Takagishi, S.K. (Gas Research Inst., Chicago, IL (United States))

1992-01-01T23:59:59.000Z

431

A thermal energy storage system for adsorbent low-pressure natural gas storage  

SciTech Connect

Carbon-based adsorbents were determined to be the best enhanced storage media that would store more natural gas at low pressures than achieved with compression only. Thermal energy storage (TES) was previously demonstrated to be a potentially promising technique to mitigate heat effects associated with low-pressure carbon adsorption systems for natural gas storage. Further investigations were conducted to develop information for the design of an optimized adsorption system that incorporates TES heat management. The selection of appropriate phase-change materials and nucleating agents, encapsulant materials, and corrosion inhibitors for a TES heat management system are discussed and the results of extended thermal cyclic behavior are presented. Engineering analyses and finite element analyses are employed to calculate adsorption rates, heat generation, temperatures, and heat transfer within the adsorbent bed. The size, volume, and arrangement of components for an operational TES system designed to accommodate fast-fill within a defined time limit is presented.

Blazek, C.F.; Jasionowski, W.J.; Kountz, K.J.; Tiller, A.J. [Institute of Gas Technology, Chicago, IL (United States); Gauthier, S.W.; Takagishi, S.K. [Gas Research Inst., Chicago, IL (United States)

1992-12-31T23:59:59.000Z

432

Analysis and Documentation of Roadway Incident Using Software and Photogrammetric Techniques  

E-Print Network (OSTI)

curve_02.html 4. Definition of a B-Spline Curve : http://CAGDNo tes/B-Spline-Curve-Definition.pdf+what+is+a+b-spline%3F&hl=en&ie=UTF-8 5. B-Spline Curves :

Su, Ray J.; Chan, Ching-Yao

2004-01-01T23:59:59.000Z

433

AOCS Official Method S 2-64  

Science Conference Proceedings (OSTI)

Methods for Testing Drying Oils AOCS Official Method S 2-64 Methods Downloads Methods Downloads DEFINITION SCOPE This method covers the selection and use of procedures for tes

434

Thermal energy storage for cogeneration applications  

DOE Green Energy (OSTI)

Cogeneration is playing an increasingly important role in providing energy efficient power generation and thermal energy for space heating and industrial process heat applications. However, the range of applications for cogeneration could be further increased if the generation of electricity could be coupled from the generation of process heat. Thermal energy storage (TES) can decouple power generation from the production of process heat, allowing the production of dispatchable power while fully utilizing the thermal energy available from the prime mover. The Pacific Northwest Laboratory (PNL) leads the US Department of Energy's Thermal Energy Storage Program. The program focuses on developing TES for daily cycling (diurnal storage), annual cycling (seasonal storage), and utility applications (utility thermal energy storage (UTES)). Several of these technologies can be used in a cogeneration facility. This paper discusses TES concepts relevant to cogeneration and describes the current status of these TES systems.

Drost, M.K.; Antoniak, Z.I.

1992-04-01T23:59:59.000Z

435

Thermal energy storage for cogeneration applications  

DOE Green Energy (OSTI)

Cogeneration is playing an increasingly important role in providing energy efficient power generation and thermal energy for space heating and industrial process heat applications. However, the range of applications for cogeneration could be further increased if the generation of electricity could be coupled from the generation of process heat. Thermal energy storage (TES) can decouple power generation from the production of process heat, allowing the production of dispatchable power while fully utilizing the thermal energy available from the prime mover. The Pacific Northwest Laboratory (PNL) leads the US Department of Energy`s Thermal Energy Storage Program. The program focuses on developing TES for daily cycling (diurnal storage), annual cycling (seasonal storage), and utility applications (utility thermal energy storage (UTES)). Several of these technologies can be used in a cogeneration facility. This paper discusses TES concepts relevant to cogeneration and describes the current status of these TES systems.

Drost, M.K.; Antoniak, Z.I.

1992-04-01T23:59:59.000Z

436

STATUS OF THE LBL/LLL DEVELOPMENT PROGRAM  

E-Print Network (OSTI)

how it will phase into fusion reactor fueling experiments.of the application will be fusion reactor fueling, The workf or the Tokamak Fusion Tes t Reactor (TFTR), l20-keV D

Berkner, K.H.

2010-01-01T23:59:59.000Z

437

Technical and economic feasibility of thermal energy storage. Thermal energy storage application to the brick/ceramic industry. Final report  

DOE Green Energy (OSTI)

An initial project to study the technical and economic feasibility of thermal energy storage (TES) in the three major consumer markets, namely, the residential, commercial and industrial sectors is described. A major objective of the study was to identify viable TES applications from which a more concise study could be launched, leading to a conceptual design and in-depth validation of the TES energy impacts. This report documents one such program. The brick/ceramic industries commonly use periodic kilns which by their operating cycle require time-variant energy supply and consequently variable heat rejection. This application was one of the numerous TES opportunities that emerged from the first study, now available from the ERDA Technical Information Center, Oak Ridge, Tennessee, identified as Report No. COO-2558-1.

Glenn, D.R.

1976-10-01T23:59:59.000Z

438

Thermal energy storage technical progress report, April 1992--March 1993  

Science Conference Proceedings (OSTI)

The Department of Energy (DOE) is supporting development of thermal energy storage (TES) as a means of efficiently coupling energy supplies to variable heating or cooling demands. Uses of TES include electrical demand-side management in buildings and industry, extending the utilization of renewable energy resources such as solar, and recovery of waste heat from periodic industrial processes. Technical progress to develop TES for specific diurnal and industrial applications under the Oak Ridge National Laboratory`s TES program from April 1992 to March 1993 is reported and covers research in the areas of low temperature sorption, thermal energy storage water heater, latent heat storage wallboard and latent/sensible heat regenerator technology development.

Olszewski, M.

1993-05-01T23:59:59.000Z

439

An assessment methodology for thermal energy storage evaluation  

DOE Green Energy (OSTI)

This report documents an assessment methodology for evaluating the cost, performance, and overall economic feasibility of thermal energy storage (TES) concepts. The methodology was developed by Thermal Energy Storage Evaluation Program personnel at Pacific Northwest Laboratory (PNL) for use by PNL and other TES concept evaluators. The methodology is generically applicable to all TES concepts; however, specific analyses may require additional or more detailed definition of the ground rules, assumptions, and analytical approach. The overall objective of the assessment methodology is to assist in preparing equitable and proper evaluations of TES concepts that will allow developers and end-users to make valid decisions about research and development (R and D) and implementation. The methodology meets this objective by establishing standard approaches, ground rules, assumptions, and definitions that are analytically correct and can be consistently applied by concept evaluators. 15 refs., 4 figs., 13 tabs.

Brown, D.R.; Dirks, J.A.; Drost, M.K.; Spanner, G.E.; Williams, T.A.

1987-11-01T23:59:59.000Z

440

DOE_EE0003592_HEL-SR-PR-0027 Rev 1 20130227 Final Report_Public Release  

SciTech Connect

To develop a high temperature Thermal Storage System (TES) based on graphite and able to provide both economical and technical advantages with respect to existing solutions contributing to increase the share of Concentrated Solar Plants (CSP).

Eduardo Villarroel, Carlos Fernandez-Pello, Jeff Lenartz, Karen Parysek

2013-02-27T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Corrective Actin Tracking System CATS User's Guide for Direct Web Access, Version 4.0  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CATS CATS Corrective Action Tracking System The United States Department of Energy Office of Environment, Safety and Health EH-33-2004-09-0001.Ver.4.0 09/07/2004 Corrective Action Tracking System (CATS) User's Guide for Direct Web Access Document Number EH-33-2004-09-0001.Ver.4.0 The United States Department of Energy Office of Environment, Safety and Health Prepared by Highland Technology Services, Inc. September 2004 CATS User Guide i Document # EH-33-2004-09-0001.Ver.4.0 Table of Contents 1.0 Overview ....................................................................................................................................3 1.1 CATS Database Access Control Overview ........................................................................

442

Comparison of Firm Commitments by Pipeline Company  

U.S. Energy Information Administration (EIA)

CNG Transmission Corp. 22 NE 3,736,840 4,750,112 Columbia Gas Transmission Corporation 21 NE 5,183,990 8,911,651 Columbia Gulf Transmission Company 70 NE 1,277,200 ...

443

Thermal energy storage market-oriented background paper  

DOE Green Energy (OSTI)

Thermal energy storage (TES) technologies and their applications are discussed. The markets and commercialization status and potential are explored. ERDA TES program plans are presented. It is concluded that the only TES systems ready for immediate commercialization are storage water heating and space heating charged with off-peak electricity. All that is needed for commercialization to occur is the introduction of appropriate split electricity rates or load management contracts. In the near-term, solar water heating and space heating, electric utility TES and TES space cooling with off-peak electricity may prove economic. Technology for these systems is available now or will be soon. The most promising of these is TES space cooling for commercial buildings where the economies of scale may make the systems very attractive. Again, electric rate structures must be altered for commercialization to occur. Increasing energy costs and tax incentives will help commercialize solar systems. The systems also must be proven reliable and performance accurately predicted for general market acceptance to occur. More research must be done on seasonal storage, industrial uses of TES, heat battery powered vehicles and solar thermal power for electrical generation to determine their commercial potential. Of these, current estimates for heat vehicles are the most promising, although a prototype has not yet been built and the concept must await development of the Stirling engine. If industrial and agricultural use of TES are shown to be economic, there should be no problems with commercialization as this sector is very cost conscious and tends to have available capital. Solar thermal power for electrical generation does not look economical currently, but needs further study as an inexhaustible energy source.

None

1977-06-15T23:59:59.000Z

444

Thermal energy storage in utility-scale applications  

DOE Green Energy (OSTI)

The Thermal Energy Storage (TES) Progran focuses on developing TES for daily cycling (diurnal storage), annual cycling (seasonal storage), and utility-scale applications [utility thermal energy storage (UTES)]. TES technology can be used in a new or an existing power generation facility to increase its efficiency and promote the use of this technology within the utility and the industrial sectors. The UTES project has included studies of both heat and cool storage systems for different, utility-scale applications. For example, one study showed that a molten salt TES system can substantially reduce the cost of coal-fired peak and intermediate load power production in an integrated gasification combined-cycle (IGCC) plant. The levelized energy cost (LEC) of an IGCC/TES plant can be reduced by as much as 20% over the LEC of a conventional IGCC plant. This concept produces lower-cost power than the natural-gas-fired alternative if significant escalation rates in the fuel price are assumed. In another study, an oil/rock diurnal TES system when integrated with a simple gas turbine cogeneration system was shown to produce on-peak power,for $0.045 to $0.06/kWh while supplying a 24-hour process steam load. The molten salt storage system was found to be less suitable for simple as well as combined-cycle cogeneration applications. However, in both the IGCC and the cogeneration plant applications, advanced TES concepts could substantially improve performance and economic benefits. An evaluation of TES options for precooling gas turbine inlet air showed that an ice storage system could be used to effectively increase the peak generating capacity of gas turbines when operating in hot ambient conditions.

Somasundaram, S.; Drost, M.K.; Brown, D.R.; Antoniak, Z.I.

1994-08-01T23:59:59.000Z

445

Incremental cost analysis of advanced concept CAES systems  

SciTech Connect

The costs of compressed air energy storage (CAES) systems using thermal energy storage (TES) are compared to the costs of CAES systems without TES and simple cycle gas turbine systems. Comparisons are made in terms of the system energy costs levelized over the operating life of the systems. These are in 1985 price levels which is the assumed first year of operation for the systems.

Knutsen, C.A.

1979-09-01T23:59:59.000Z

446

A MULTI-COUNTRY ANALYSIS OF LIFECYCLE EMISSIONS FROM TRANSPORTATION FUELS AND MOTOR VEHICLES  

E-Print Network (OSTI)

oil n.e. ULSD oil n.e. FTD NG n.e. Fuel oil Still gas oiln.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. CH2 water CH2 NGMeOH NG n.e. MeOH coal n.e. MeOH Ethanol Ethanol wood n.e.

Delucchi, Mark

2005-01-01T23:59:59.000Z

447

A Multi-Country Analysis of Lifecycle Emissions From Transportation Fuels and Motor Vehicles  

E-Print Network (OSTI)

oil n.e. ULSD oil n.e. FTD NG n.e. Fuel oil Still gas oiln.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. CH2 water CH2 NGMeOH NG n.e. MeOH coal n.e. MeOH Ethanol Ethanol wood n.e.

Delucchi, Mark

2005-01-01T23:59:59.000Z

448

Preliminary survey and evaluation of nonaquifer thermal energy storage concepts for seasonal storage  

DOE Green Energy (OSTI)

Thermal energy storage enables the capture and retention of heat energy (or cold) during one time period for use during another. Seasonal thermal energy storage (STES) involves a period of months between the input and recovery of energy. The purpose of this study was to make a preliminary investigation and evaluation of potential nonaquifer STES systems. Current literature was surveyed to determine the state of the art of thermal energy storage (TES) systems such as hot water pond storage, hot rock storage, cool ice storage, and other more sophisticated concepts which might have potential for future STES programs. The main energy sources for TES principally waste heat, and the main uses of the stored thermal energy, i.e., heating, cooling, and steam generation are described. This report reviews the development of sensible, latent, and thermochemical TES technologies, presents a preliminary evaluation of the TES methods most applicable to seasonal storage uses, outlines preliminary conclusions drawn from the review of current TES literature, and recommends further research based on these conclusions. A bibliography of the nonaquifer STES literature review, and examples of 53 different TES concepts drawn from the literature are provided. (LCL)

Blahnik, D.E.

1980-11-01T23:59:59.000Z

449

Expected benefits of federally-funded thermal energy storage research  

DOE Green Energy (OSTI)

Pacific Northwest Laboratory (PNL) conducted this study for the Office of Advanced Utility Concepts of the US Department of Energy (DOE). The objective of this study was to develop a series of graphs that depict the long-term benefits of continuing DOE's thermal energy storage (TES) research program in four sectors: building heating, building cooling, utility power production, and transportation. The study was conducted in three steps- The first step was to assess the maximum possible benefits technically achievable in each sector. In some sectors, the maximum benefit was determined by a supply side'' limitation, and in other sectors, the maximum benefit is determined by a demand side'' limitation. The second step was to apply economic cost and diffusion models to estimate the benefits that are likely to be achieved by TES under two scenarios: (1) with continuing DOE funding of TES research, and (2) without continued funding. The models all cover the 20-year period from 1990 to 2010. The third step was to prepare graphs that show the maximum technical benefits achievable, the estimated benefits with TES research funding, and the estimated benefits in the absence of TES research funding. The benefits of federally-funded TES research are largely in four areas: displacement of primary energy, displacement of oil and natural gas, reduction in peak electric loads, and emissions reductions.

Spanner, G E; Daellenbach, K K; Hughes, K R; Brown, D R; Drost, M K

1992-09-01T23:59:59.000Z

450

Expected benefits of federally-funded thermal energy storage research  

DOE Green Energy (OSTI)

Pacific Northwest Laboratory (PNL) conducted this study for the Office of Advanced Utility Concepts of the US Department of Energy (DOE). The objective of this study was to develop a series of graphs that depict the long-term benefits of continuing DOE`s thermal energy storage (TES) research program in four sectors: building heating, building cooling, utility power production, and transportation. The study was conducted in three steps- The first step was to assess the maximum possible benefits technically achievable in each sector. In some sectors, the maximum benefit was determined by a ``supply side`` limitation, and in other sectors, the maximum benefit is determined by a ``demand side`` limitation. The second step was to apply economic cost and diffusion models to estimate the benefits that are likely to be achieved by TES under two scenarios: (1) with continuing DOE funding of TES research, and (2) without continued funding. The models all cover the 20-year period from 1990 to 2010. The third step was to prepare graphs that show the maximum technical benefits achievable, the estimated benefits with TES research funding, and the estimated benefits in the absence of TES research funding. The benefits of federally-funded TES research are largely in four areas: displacement of primary energy, displacement of oil and natural gas, reduction in peak electric loads, and emissions reductions.

Spanner, G.E.; Daellenbach, K.K.; Hughes, K.R.; Brown, D.R.; Drost, M.K.

1992-09-01T23:59:59.000Z

451

Applications of cogeneration with thermal energy storage technologies  

DOE Green Energy (OSTI)

The Pacific Northwest Laboratory (PNL) leads the U.S. Department of Energy`s Thermal Energy Storage (TES) Program. The program focuses on developing TES for daily cycling (diurnal storage), annual cycling (seasonal storage), and utility-scale applications [utility thermal energy storage (UTES)]. Several of these storage technologies can be used in a new or an existing power generation facility to increase its efficiency and promote the use of the TES technology within the utility and the industrial sectors. The UTES project has included a study of both heat storage and cool storage systems for different utility-scale applications. The study reported here has shown that an oil/rock diurnal TES system, when integrated with a simple gas turbine cogeneration system, can produce on-peak power for $0.045 to $0.06 /kWh, while supplying a 24-hour process steam load. The molten salt storage system was found to be less suitable for simple as well as combined-cycle cogeneration applications. However, certain advanced TES concepts and storage media could substantially improve the performance and economic benefits. In related study of a chill TES system was evaluated for precooling gas turbine inlet air, which showed that an ice storage system could be used to effectively increase the peak generating capacity of gas turbines when operating in hot ambient conditions.

Somasundaram, S.; Katipamula, S.; Williams, H.R.

1995-03-01T23:59:59.000Z

452

Technical and economic feasibility of thermal energy storage. Annual report  

DOE Green Energy (OSTI)

This study provides a first-look at the system elements involved in: (1) creating a market; (2) understanding and deriving the requirements; (3) performing analytical effort; (4) specifying equipment; and (5) synthesizing applications for a thermal energy storage (TES) function. The work reviews implicated markets, energy consumption patterns, TES technologies, and applications. Further, several concepts are developed and evaluated in some detail. Key findings are: (1) there are numerous technical opportunities for TES in the residential and industrial market sectors; (2) apart from sensible heat storage and transfer, significant R and D is required to fully exploit the superior heat densities of latent heat-based TES systems, particularly at temperatures above 600/sup 0/F; (3) industrial energy conservation can be favorably impacted by TES where periodic or batch-operated unit functions characterize product manufacturing processes, i.e. bricks, steel, and ceramics; and (4) a severe data shortage exists for describing energy consumption rates in real time as related to plant process operations--a needed element in designing TES systems.

Glenn, D.R.

1976-02-01T23:59:59.000Z

453

Final Technical Report  

SciTech Connect

Design, validate at prototype level, and then demonstrate a full size, 800 MWht Thermal Energy Storage (TES) system based on Phase Changing Material (PCM) TES modules with round trip efficiency in excess of 93%. The PCM TES module would be the building block of a TES system which can be deployed at costs inline with the DOE benchmark of 2020. The development of a reliable, unsophisticated, modular, and scalable TES system designed to be massmanufactured utilizing advanced automated fabrication and assembly processes and field installed in the most cost-effective configuration could facilitate the attainment of a Levelized Cost of Energy (LCOE) of $.07/kWh by 2015. It was believed that the DOE targets can be attained by finding the best combinationTES module size, its optimal integration in the power cycle, and readily available PCM. Work under this project ultimately focused on the development and performance evaluation of a 100kWht prototype heat exchanger. The design utilizes a commercially available heat exchanger product to create a unique latent heat PCM storage module. The novel ideal associated with this technology is the inclusion of an agitation mechanism that is activated during the discharge process to improve heat transfer. The prototype unit did not meet the performance goals estimated through modeling, nor did the estimated costs of the system fall in line with the goals established by DOE.

Newmarker, Marc; Campbell, Mark

2012-03-16T23:59:59.000Z

454

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1209 - 1213 Omaha, NE Midwest Region Alternative Fuels Project NEPA Approval for 1 CNG Vehicle Refueling Appliance to be installed in Omaha, NE. Grant funded by Solicitation...

455

DOE - Office of Legacy Management -- Hallam Nuclear Power Facility...  

Office of Legacy Management (LM)

Hallam Nuclear Power Facility - NE 01 FUSRAP Considered Sites Site: Hallam Nuclear Power Facility (NE.01 ) Designated Name: Alternate Name: Location: Evaluation Year: Site...

456

U.S. Department of Energy Amerian Indian Policy | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Amerian Indian Policy U.S. Department of Energy Amerian Indian Policy DOE Indian Policy Rev January 2006- Vers 3.pdf More Documents & Publications DOE...

457

CRIMES VIOLENTOS E DESENVOLVIMENTO SOCIOECONMICO: UM ESTUDO PARA O ESTADO DO PARAN  

E-Print Network (OSTI)

a questo das travas do crime, ver: Shikida et al. (2005).G. A teoria econmica do crime. Revista Leader, Edio n.35.desenvolvimento socioeconmico e crime. In: HENRIQUE, R. (

Assis Shikida, Pery Francisco

2009-01-01T23:59:59.000Z

458

Universitt Rostock PRESSE + KOMMUNIKATION  

E-Print Network (OSTI)

bereits fertig gebauten Atom- kraftwerks Zwentendorf. In den bei- den Jahren vor der Abstimmung ha- be er Volksbegehren unter seinem Namen gegen das Kraftwerk Hainburg 1988 Veröffentlichung von ,,Hier bin ich ­ wo bist

Rostock, Universität

459

Precios de Gasolina  

NLE Websites -- All DOE Office Websites (Extended Search)

Precios de Gasolina para Ciudades en EEUU Pulse en el mapa para ver los precios de la gasolina en diferentes ciudades de su estado. AK VT ME NH NH MA MA RI CT CT DC NJ DE DE NY WV...

460

Trends in the Health of Older Californians  

E-Print Network (OSTI)

Hing E, Burt CW, Hall MJ. Trend Data On Medical Encounters:Ver5-C.1 TRENDS IN THE HEALTH OF OLDER CALIFORNIANS: DataSurveys November 2008 TRENDS IN THE HEALTH OF OLDER

Wallace, Steven P.; Lee, Jennifer H.; Jawad, May Aydin

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

The Atmospheric Chemistry of Iodine Monoxide  

Science Conference Proceedings (OSTI)

... of I, and C1, or by reaction of 0 with a mixture of IC1 and CIO,. ... Stein, SE; Rukkers, JM; Brown, RM NIST Structures & Properties Database; ver. ...

2011-10-18T23:59:59.000Z

462

A spatial location-allocation GIS framework for managing water resources in a savanna nature reserve  

E-Print Network (OSTI)

dry season. Ryan & Getz: GIS framework for managing waterpolygons ver 2.6 for ArcView GIS. Avenue script available atspatial locationallocation GIS framework for managing water

Ryan, Sadie

2006-01-01T23:59:59.000Z

463

A spatial location-allocation GIS framework for managing water sources in a savanna nature reserve  

E-Print Network (OSTI)

dry season. Ryan & Getz: GIS framework for managing waterpolygons ver 2.6 for ArcView GIS. Avenue script available atspatial locationallocation GIS framework for managing water

Ryan, Sadie J.; Getz, W M

2005-01-01T23:59:59.000Z

464

Microsoft Word - Document1  

Science Conference Proceedings (OSTI)

Professional Educators Common Interest Group AOCS Annual Meeting/Seattle, Washington Tuesday, May 20, 2008 Participants: Andy Proctor (University of Arkansas, aproctor@uark.edu) Roland Verhe (Ghent University, roland.ver

465

NOTIFICATION AND FEDERAL EMPLOYEE ANTIDISCRIMINATION AND RETALIATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7-174-MAY 15, 2002 NOTIFICATION AND FEDERAL EMPLOYEE ANTIDISCRIMINATION AND RETALIATION ACT OF 2002 VerDate 11-MAY-2000 09:01 May 20, 2002 Jkt 099139 PO 00174 Frm 00001 Fmt 6579...

466

Introduction On the Fault Resilience Metric  

E-Print Network (OSTI)

, Fl´avia Maristela2, Ver^onica Lima3 gmlima@ufba.br, flaviamsn@ifba.edu.br, cadena@ufba.br 1Department of Computer Science ­ Distributed Systems Lab (UFBA) 2Department Technology in Electro-electronics (IFBA) 3 and Real-time Systems George Lima, Fl´avia Maristela, Ver^onica Lima gmlima@ufba.br, flaviamsn@ifba

Lipari, Giuseppe

467

peu de radium D. En outre, la liqueur contient encore la plus grande partie du radium D ;  

E-Print Network (OSTI)

ajoute ensuite un peu d'eau oxygénée. Au bout d'une heurte on a déjà un léger précipité dhy peroxyde d'uranium déter- mine sont déplacées aussi bien vers les petites que vers les grandes longueurs d'onde. Au

Paris-Sud XI, Université de

468

Corona driven air propulsion for cooling of electronics F. Yang, N.E. Jewell-Larsen, D.L. Brown, K. Pendergrass, D.A. Parker, I.A. Krichtafovitch*, A.V. Mamishev  

E-Print Network (OSTI)

generation with low noise, static filtration [5], air sterilization [6], and no moving parts. These ideal Abstract: The possibility of building a high voltage electrostatic air pump for cooling of microelectronics is investigated. Existing cooling technology no longer provides adequate heat dissipation due to excessive heat

Mamishev, Alexander

469

9432 Alamo Ct NE, Blaine, MN 55449 (612) 625-0519(O) (505) 270-0316(C) dagao2008@gmail.com http://www-users.cs.umn.edu/dagao  

E-Print Network (OSTI)

and developed the test suite for the Culgi multiscale modeling software using Tcl/Tk and C++ #12;Idaho National

Minnesota, University of

470

P LUS: A DVENT URES I N VET ERI NA RY M EDI CI NE s T RA NSF O R MI N G D A I RY FA R MS Boosting the  

E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University

471

P2JW323012-0-A01900-1--------XA AZ,EE,MW,NE,NY,SC,SW,WB,WE P2JW323012-0-A01900-1--------XA  

E-Print Network (OSTI)

/11 Status after 9/11 CTBT Comprehensive Test Ban Treaty Not supported by administration. No change. NPT Non-ProliferationPutting the Genie Back in the Bottle: Nuclear Non-Proliferation in the New Millennium G by an adversary could have a devastating influence on US security and non-proliferation. One of the highest

Deutch, John

472

Evaluation of diurnal thermal energy storage combined with cogeneration systems  

DOE Green Energy (OSTI)

This report describes the results of an evaluation of thermal energy storage (TES) integrated with simple gas turbine cogeneration systems. The TES system captures and stores thermal energy from the gas turbine exhaust for immediate or future generation of process heat. Integrating thermal energy storage with conventional cogeneration equipment increases the initial cost of the combined system; but, by decoupling electric power and process heat production, the system offers the following two significant advantages: (1) Electric power can be generated on demand, irrespective of the process heat load profile, thus increasing the value of the power produced; (2) Although supplementary firing could be used to serve independently varying electric and process heat loads, this approach is inefficient. Integrating TES with cogeneration can serve the two independent loads while firing all fuel in the gas turbine. The study evaluated the cost of power produced by cogeneration and cogeneration/TES systems designed to serve a fixed process steam load. The value of the process steam was set at the levelized cost estimated for the steam from a conventional stand-alone boiler. Power costs for combustion turbine and combined-cycle power plants were also calculated for comparison. The results indicated that peak power production costs for the cogeneration/TES systems were between 25% and 40% lower than peak power costs estimated for a combustion turbine and between 15% and 35% lower than peak power costs estimated for a combined-cycle plant. The ranges reflect differences in the daily power production schedule and process steam pressure/temperature assumptions for the cases evaluated. Further cost reductions may result from optimization of current cogeneration/TES system designs and improvement in TES technology through future research and development.

Somasundaram, S.; Brown, D.R.; Drost, M.K.

1992-11-01T23:59:59.000Z

473

A High Performance Pneumatic Force Actuator System Part 1 - Nonlinear Mathematical Model  

E-Print Network (OSTI)

In this pap er we developed a detailed mathematical model of dual action pneumatic actuator contr16 with pr2 or2520 spool valves. E#ects of nonlinear flowthr35 the valve,air compr6T430035 y incylinder chamber2 leakage between chamber6 end of str1 e inactive volume, and time delay and attenuation in the pneumatic lines wercar14T4 consider6 System identification, numer4T simulation and model validation experT11 ts wer conducted for two types of air cylinder and di#er4 t connecting tubes length, showing ver goodagr552T t. This mathematical model will be used in the development of high per35T423 nonlinear for3 contr330T with applications in teleopereopT1 haptic inter164T and rT otics. 1 Introducti Mode) forceIP(k)fiXe tek## e ration, haptic inte#kP9kX andothe applications in robotics recsX( high pefifiP6XIP# force actuators, with highforce output pe r unit wefi9 t. It is also important to have line96 fast andaccurate reu onse as we# as low friction and me hanical impe dance Traditional gekk9 e lek9#6XI motors can not provide the characteP#BfiBXe Fe w ne## de#(#XI motors may have spek)fi dire)XIB(# e actuators, with no intefi)BB9XI # This ar116 has appear in the September 2000 issue of ASME Jour3 of Dynamic Systems Measur2 ment and ContrT1 Vol. 122, No.3, pp. 416-425 1 me hanisms. YeP applications such astek9( ek9(P maste arms with gravitational compe nsation, rePPfi# long duration, static highforce output. In the6 caseB direB drive e levXfi)(6 actuators nekBB6XI9k speXPB cooling syste) todissipate the e xceipa e hei We be lie e thatpneXP96# cylinde# can o#e a be tte alte9BkXI e toefik)6(XI9 or hydraulic actuators forceXP#B type s of applications. PneP966X actuators provide the preBfifi)XI e umeBfifi) qualitie at low cost. The are alsosuitable forcle# e nvironme ts ands...

Edmond Richer; Yildirim Hurmuzlu

2001-01-01T23:59:59.000Z

474

Office of Nuclear Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Human Capital Plan Revised August 2006 U. S. Department of Energy NE Human Capital Plan i August 2006 Office of Nuclear Energy Table of Contents Executive Summary...................................................................................................................................1 Background .................................................................................................................................................2 NE Human Capital Strategy.....................................................................................................................2 NE Human Capital Plan: At-A-Glance ..................................................................................................3

475

1 Managed by UT-Battelle for the U.S. Department of Energy  

E-Print Network (OSTI)

Gleason NE-Instrumentation Program Dwight Clayton Sensors and Controls Programs Peter Fuhr USEC CRADA

476

SunShot Initiative: High-Efficiency Thermal Energy Storage System for CSP  

NLE Websites -- All DOE Office Websites (Extended Search)

High-Efficiency Thermal Energy Storage System for CSP High-Efficiency Thermal Energy Storage System for CSP ANL logo Photo of a black and white porous material magnified 50 times by a microscope. Microstructure of the highly thermal conductive foam that will be used for the prototype TES system. Image from ANL Argonne National Laboratory and project partner Ohio Aerospace Institute, under the National Laboratory R&D competitive funding opportunity, will design, develop, and test a prototype high-temperature and high-efficiency thermal energy storage (TES) system with rapid charging and discharging times. By increasing the efficiency of TES systems, this project aims to lower the capital costs of concentrating solar power (CSP) systems. Approach The research team is developing and evaluating a novel approach for TES at temperatures greater than 700˚C for CSP systems. The approach uses high thermal conductivity and high-porosity graphite foams infiltrated with a phase change material (PCM) to provide TES in the form of latent heat.

477

Integrated heat pipe-thermal storage system performance evaluation  

SciTech Connect

Performance verification tests of an integrated heat pipe-thermal energy storage system have been conducted. This system is being developed as a part of an Organic Rankine Cycle-Solar Dynamic Power System (ORC-SDPS) receiver for future space stations. The integrated system consists of potassium heat pipe elements that incorporate thermal energy storage (TES) canisters within the vapor space along with an organic fluid (toluene) heater tube used as the condenser region of the heat pipe. During the insolation period of the earth orbit, solar energy is delivered to the surface of the heat pipe elements of the ORC-SDPS receiver and is internally transferred by the potassium vapor for use and storage. Part of the thermal energy is delivered to the heater tube and the balance is stored in the TES units. During the eclipse period of the orbit, the stored energy in the TES units is transferred by the potassium vapor to the toluene heater tube. A developmental heat pipe element was fabricated that employs axial arteries and a distribution wick connecting the wicked TES units and the heater to the solar insolation surface of the heat pipe. Tests were conducted to verify the heat pipe operation and to evaluate the heat pipe/TES units/heater tube operation by interfacing the heater unit to a heat exchanger.

Keddy, E.; Sena, J.T.; Merrigan, M.

1987-01-01T23:59:59.000Z

478

Thermal energy storage for building heating and cooling applications. Quarterly progress report, April--June 1976  

DOE Green Energy (OSTI)

This is the first in a series of quarterly progress reports covering activities at ORNL to develop thermal energy storage (TES) technology applicable to building heating and cooling. Studies to be carried out will emphasize latent heat storage in that sensible heat storage is held to be an essentially existing technology. Development of a time-dependent analytical model of a TES system charged with a phase-change material was started. A report on TES subsystems for application to solar energy sources is nearing completion. Studies into the physical chemistry of TES materials were initiated. Preliminary data were obtained on the melt-freeze cycle behavior and viscosities of sodium thiosulfate pentahydrate and a mixture of Glauber's salt and Borax; limited melt-freeze data were obtained on two paraffin waxes. A subcontract was signed with Monsanto Research Corporation for studies on form-stable crystalline polymer pellets for TES; subcontracts are being negotiated with four other organizations (Clemson University, Dow Chemical Company, Franklin Institute, and Suntek Research Associates). Review of 10 of 13 unsolicited proposals received was completed by the end of June 1976.

Hoffman, H.W.; Kedl, R.J.

1976-11-01T23:59:59.000Z

479

Worker health and safety in solar thermal power systems. III. Thermal energy storage subsystems  

DOE Green Energy (OSTI)

The effects of the use of thermal energy storage (TES) subsystems in solar thermal power systems (STPS) on operating failures and on worker health and safety are examined. Revelant near- and medium-term designs for TES subsystems are reviewed. Generic failure events are considered by an event tree methodology. Three generic categories of initiating events are identified which can lead to release of storage fluids and other hazards. Three TES subsystem designs are selected for, and subjected to, analysis. A fluid release event tree for a sensible heat TES subsystem using mixed media organic oil/crushed rock and sand, designed for the Barstow, CA, 10 MWe pilot plant, is developed. Toxicology and flammability hazards are considered. The effect of component failures, including ullage and fluid maintenance units, on subsystem safety is considered. A latent heat subsystem using NaNO/sub 3//NaOH as the working medium is studied, and relevant failure events delineated. Mechanical equipment failures including the scraped wall heat exchangers, are examined. Lastly, a thermochemical TES subsystem using SO/sub 2//SO/sub 3/ interconversion is considered. Principle hazards identified include mechanical failures and storage fluid release. The integrity of the system is found to depend on catalyst and heat exchanger reliability. Dynamic response to off-normal system events is considered.

Ullman, A.Z.; Sokolow, B.B.; Daniels, J.; Hurt, P.

1979-10-01T23:59:59.000Z

480

Low-temperature thermal energy storage quarterly progress report for period July--September 1976. [Phase-change materials  

DOE Green Energy (OSTI)

The document is the second in a series of quarterly progress reports covering activities funded at ORNL by the ERDA Division of Energy Storage Systems to develop low-temperature thermal energy storage (TES) technology. These systems will be based on either sensible or latent heat storage at temperatures up to approximately 250/sup 0/C. At ORNL, research efforts were continued to (a) develop a time-dependent analytical model that will describe a TES system charged with a phase-change material, (b) measure thermophysical properties and melt-freeze cyclic behavior of interesting PCM's and (c) determine crystal lattice structures of hydrated salts and their nucleators. A report on TES subsystems for application to solar energy sources was completed and is being reviewed. In the area of program management, subcontracts were signed with Clemson University, Dow Chemical Company, Suntek Research Associates, and The Franklin Institute. Detailed reviews were completed for ten unsolicited proposals related to TES. Industries, research institutions, universities, and other national laboratory participation in the TES program, for which ORNL has management responsibilities, are listed.

Hoffman, H. W.; Kedi, R. J.

1977-01-31T23:59:59.000Z

Note: This page contains sample records for the topic "tes ver ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

U.S. Department of Energy thermal energy storage research activities review: 1989 Proceedings  

SciTech Connect

Thermal Energy Storage (TES) offers the opportunity for the recovery and re-use of heat currently rejected to the ambient environment. Further, through the ability of TES to match an energy supply with a thermal energy demand, TES increases efficiencies of energy systems and improves capacity factors of power plants. The US Department of Energy has been the leader in TES research, development, and demonstration since recognition in 1976 of the need for fostering energy conservation as a component of the national energy budget. The federal program on TES R and D is the responsibility of the Office of Energy Storage and Distribution within the US Department of Energy (DOE). The overall program is organized into three program areas: diurnal--relating primarily to lower temperature heat for use in residential and commercial buildings on a daily cycle; industrial--relating primarily to higher temperature heat for use in industrial and utility processes on an hourly to daily cycle; seasonal--relating primarily to lower temperature heat or chill for use in residential complexes (central supply as for apartments or housing developments), commercial (light manufacturing, processing, or retail), and industrial (space conditioning) on a seasonal to annual cycle. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

Hoffman, H.W. [ed.] [PAI Corp., Oak Ridge, TN (United States); Tomlinson, J.J. [ed.] [Oak Ridge National Lab., TN (United States)

1989-03-01T23:59:59.000Z

482

Value of Concentrating Solar Power and Thermal Energy Storage  

SciTech Connect

This paper examines the value of concentrating solar power (CSP) and thermal energy storage (TES) in four regions in the southwestern United States. Our analysis shows that TES can increase the value of CSP by allowing more thermal energy from a CSP plant?s solar field to be used, by allowing a CSP plant to accommodate a larger solar field, and by allowing CSP generation to be shifted to hours with higher energy prices. We analyze the sensitivity of CSP value to a number of factors, including the optimization period, price and solar forecasting, ancillary service sales, capacity value and dry cooling of the CSP plant. We also discuss the value of CSP plants and TES net of capital costs.

Sioshansi, R.; Denholm, P.

2010-02-01T23:59:59.000Z

483

The Role of Thermal Energy Storage in Industrial Energy Conservation  

E-Print Network (OSTI)

Thermal Energy Storage for Industrial Applications is a major thrust of the Department of Energy's Thermal Energy Storage Program. Utilizing Thermal Energy Storage (TES) with process or reject heat recovery systems has been shown to be extremely beneficial for several applications. Recent system studies resulting from contracts awarded by the Department of Energy (DOE) have identified four especially; significant industries where TES appears attractive - food processing, paper and pulp, iron and steel, and cement. Potential annual fuel savings with large scale implementation of near term TES systems for these industries is over 9 x 106 bbl of oil. This savings is due to recuperation and storage in the food processing industry, direct fuel substitution in the paper and pulp industry and reduction in electric utility peak fuel use through in-plant production of electricity from utilization of reject heat in the steel and cement industries.

Duscha, R. A.; Masica, W. J.

1979-01-01T23:59:59.000Z

484

Evaluation and assessment of thermal-energy storage for residential heating  

DOE Green Energy (OSTI)

In a field test in Maine and Vermont involving 75 households, 45 of which used off-peak electricity for heating, the overall technical performance and user acceptance of thermal-energy storage (TES) heaters were found to be satisfactory. Annual energy consumption for households using TES heaters was the same as for control households using conventional electric baseboard heaters. Proper sizing is more critical for TES systems than for conventional heaters. Barriers to rapid market penetration include high capital cost, uncertainties about the long-term availability of incentive rates, and competition from bivalent heating systems and nonstorage heating units that take better advantage of time-of-day rates. Actual building heat losses were 30% to 50% less than estimated by walk-through audits.

Hersh, H.; Mirchandani, G.; Rowe, R.

1982-04-01T23:59:59.000Z

485

Electric rate structures for thermal energy storage evaluation  

DOE Green Energy (OSTI)

Future electric rate structures are critical to thermal energy storage (TES) technologies that are specifically designed to take advantage of electric energy costs that vary depending on the magnitude, duration, and timing of power demand (e.g., cool storage). In fact, rate structure characteristics may affect the TES system design and operating approach as well as economic feasibility. The objective of this study, conducted by the Pacific Northwest Laboratory for the US Department of Energy, was to define reference electric utility rate structures to be used in technical assessments of TES technologies. Electric rate structures were characterized for residential, commercial and industrial sectors. A range of conditions for several alternative rate structures was identified for each sector to capture the variability of likely conditions. Individual rate structure characteristics include demand charges and energy charges applicable during different months of the year, days of the week, and hours of the day. 7 refs., 21 tabs.

Brown, D R; Garrett, S M; Sedgewick, J M

1991-05-01T23:59:59.000Z

486

Longitudinal Proximity Effects in Superconducting Transition-Edge Sensors  

SciTech Connect

We have found experimentally that the critical current of a square thin-film superconducting transition-edge sensor (TES) depends exponentially upon the side length L and the square root of the temperature T, a behavior that has a natural theoretical explanation in terms of longitudinal proximity effects if the TES is regarded as a weak link between superconducting leads. As a consequence, the effective transition temperature T{sub c} of the TES is current dependent and at fixed current scales as 1/L{sup 2}. We have also found that the critical current can show clear Fraunhofer-like oscillations in an applied magnetic field, similar to those found in Josephson junctions. We have observed the longitudinal proximity effect in these devices over extraordinarily long lengths up to 290 {micro}m, 1450 times the mean-free path.

Sadleir, John E.; Smith, Stephen J.; Bandler, Simon R.; Chervenak, James A.; Clem, John R.

2010-01-29T23:59:59.000Z

487

Gas Turbine/Solar Parabolic Trough Hybrid Design Using Molten Salt Heat Transfer Fluid: Preprint  

DOE Green Energy (OSTI)

Parabolic trough power plants can provide reliable power by incorporating either thermal energy storage (TES) or backup heat from fossil fuels. This paper describes a gas turbine / parabolic trough hybrid design that combines a solar contribution greater than 50% with gas heat rates that rival those of natural gas combined-cycle plants. Previous work illustrated benefits of integrating gas turbines with conventional oil heat-transfer-fluid (HTF) troughs running at 390?C. This work extends that analysis to examine the integration of gas turbines with salt-HTF troughs running at 450 degrees C and including TES. Using gas turbine waste heat to supplement the TES system provides greater operating flexibility while enhancing the efficiency of gas utilization. The analysis indicates that the hybrid plant design produces solar-derived electricity and gas-derived electricity at lower cost than either system operating alone.

Turchi, C. S.; Ma, Z.

2011-08-01T23:59:59.000Z

488

Microsoft PowerPoint - handout.pptx [Read-Only]  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Energy Nuclear Energy Get in Contact with Argonne's Nuclear Engineering Division Visit our website: http://www.ne.anl.gov NE Division research programs: http://www.ne.anl.gov/capabilities NE Division Outreach Committee: e-mail us at neoutreach@anl.gov Like us on Facebook: NuclearEngineeringAtArgonne Follow us on @ArgonneNE Nuclear Energy Learning Resources http://students.ne.anl.gov/schools * Middle school students * High school students * Teacher resources Student/Postdoc Nuclear Energy Opportunities at Argonne * Graduating high school seniors: http://students.ne.anl.gov/students * Undergraduate and graduate internships: http://students.ne.anl.gov/students * Postdoc appointments: http://students.ne.anl.gov/postdocs Commercial nuclear energy technology began at Argonne

489

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Reorganization and NE Reorganization and FY 2011 Budget Request Pete Lyons Principal Deputy Assistant Secretary Office of Nuclear Energy U.S. Department of Energy NEAC Meeting April 29, 2010 2 April 29, 2010 NEAC Meeting Current Official NE Organization 3 April 29, 2010 NEAC Meeting NE-3 Deputy Assistant Secretary for Nuclear Facility Operations Dennis Miotla NE-7 Deputy Assistant Secretary for Nuclear Reactor Technologies Shane Johnson, Acting NE-5 Deputy Assistant Secretary for Fuel Cycle Technologies Buzz Savage, Acting NE-6 Deputy Assistant Secretary for International Nuclear Energy Policy and Cooperation Ed McGinnis NE-4 Deputy Assistant Secretary for Business and Technical Support Bob Lange, Acting NE-21 Office of Policy, Integration & Communication Tim Frazier, Acting Assistant Secretary for

490

Evaluation of diurnal thermal energy storage combined with cogeneration systems. Phase 2  

DOE Green Energy (OSTI)

This report describes the results of a study of thermal energy storage (TES) systems integrated with combined-cycle gas turbine cogeneration systems. Integrating thermal energy storage with conventional cogeneration equipment increases the initial cost of the combined system; but, by decoupling electric power and process heat production, the system offers two significant advantages. First, electric power can be generated on demand, irrespective of the process heat load profile, thus increasing the value of the power produced. Sec