Powered by Deep Web Technologies
Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Dear Mayor Riley: I  

Office of Legacy Management (LM)

~. ~. Washington, DC 20585 ' . . aaAq 3 .A , Tbs %z;y;bl& &r& Ri!ey !llll Brookshire Avenue Downey, California 90247 ' Dear Mayor Riley: I Secretary of.Energy Hazel O!.Leary has announced a new approach, to openness in the Department of Energy (DOE) and its communications with the pubTic. In support of this initiative, we are pleased to forward the enclosed 'info'rmation related to:the former North American Aviation site in your jurisdiction that performed work for DOE or its predecessor agencies. This information is provided foryour information, use, and retention. \ DOE's Formerly Utilized Sites Remedial,Action Program is responsible for identification of sites used by DOE's predecessor agencies, determining their current radiological condition and, where it has authority, performing

2

The Sorghum Webworm (Celama sorghiella Riley).  

E-Print Network [OSTI]

. 1.-Dyar, 1891, Psyche, Vol. 6, p. 110. Nola portoricensis Moeschler, 1890, Abh. Senck Ges., Vol. 16, p. 118. Roeselia sorghiella (Riley) Dyar, 1899, Can. Ent., Vol. 31, p. 61. Celama sorghielln (Riley) Hampson, 1900, Cat. Lep. Phal., Vol. 2, p.... 1.-Dyar, 1891, Psyche, Vol. 6, p. 110. Nola portoricensis Moeschler, 1890, Abh. Senck Ges., Vol. 16, p. 118. Roeselia sorghiella (Riley) Dyar, 1899, Can. Ent., Vol. 31, p. 61. Celama sorghielln (Riley) Hampson, 1900, Cat. Lep. Phal., Vol. 2, p...

Reinhard, H. J. (Henry Jonathan)

1938-01-01T23:59:59.000Z

3

Wood/coal cofiring in industrial stoker boilers  

SciTech Connect (OSTI)

Realizing that a significant reduction in the global emissions of fossil carbon dioxide may require the installation of a wide variety of control technologies, options for large and small boilers are receiving attention. With over 1,500 coal-fired stoker boilers in the US, biomass co-firing is of interest, which would also open markets for waste wood which is presently landfilled at significant costs ranging from $20--200/ton. While much cofiring occurs inside the fence, where industrial firms burn wastes in their site boilers, other opportunities exist. Emphasis has been placed on stoker boilers in the northeastern US, where abundant supplies of urban wood waste are generally known to exist. Broken pallets form a significant fraction of this waste. In 1997, the cofiring of a volumetric mixture of 30% ground broken pallet material and 70% coal was demonstrated successfully at the traveling-grate stoker boilerplant of the Pittsburgh Brewing Company. Fourteen test periods, with various wood/coal mixtures blended on site, and two extended test periods, using wood/coal mixtures blended at the coal terminal and transported by truck to the brewery, were conducted. The 30% wood/70% coal fuel was conveyed through the feed system without difficulty, and combusted properly on the grate while meeting opacity requirements with low SO{sub 2} and NO{sub x} emissions. Efforts are underway to commercialize a wood/coal blend at the brewery, to identify specific urban wood supplies in the Pittsburgh region and to conduct a demonstration at a spreader stoker.

Cobb, J.T. Jr.; Elder, W.W.; Freeman, M.C.

1999-07-01T23:59:59.000Z

4

Riley County, Kansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Riley County, Kansas: Energy Resources Riley County, Kansas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.3686475°, -96.8350999° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.3686475,"lon":-96.8350999,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

5

Gas cofiring in coal-fired stokers for emissions reduction and performance improvement  

SciTech Connect (OSTI)

Adding gas burners above the grate of a coal-fired stoker can be an economical method of reducing gaseous and particulate emissions and improving efficiency and operational flexibility. With this cofiring configuration, the improved heat distribution and mixing with the stoker combustion products can give reduced opacity, reduced emissions of particulate, NO{sub x} and SO{sub 2}, improved carbon burnout and lower overall ash, reduced excess air, faster load response, cleaner and quicker lightoffs, improved turndown at both lower and upper capacity limits, and improved performance with problematic coals. To develop and validate the cofiring technology, three cofire field experiments have been conducted. A 165,000 lb/hr spreader stoker and mass feed chain grate stokers rated at 40,000 and 75,000 lb/hr have been retrofit with gas burners and tested in the field. The two larger units used dual, opposed burners, while the smaller unit was retrofit with a single burner. With the spreader stoker, the primary benefits of gas cofire was reduction in opacity episodes with coal quality variability and recovery of lost derate. With the larger chain grate unit, the primary benefit was reduction of NO{sub x} and SO{sub 2} to within Title V limits and elimination of opacity episodes during startup and load swings. With the smaller chain grate, the primary benefit was ability to operate at low loads without unacceptable opacity excursions which had previously required a backup boiler. In all cases, the economics justified the capital burner system retrofit cost and incremental fuel costs.

Mason, H.B.; Drennan, S.; Chan, I.; Kinney, W.L.; Borland, D.

1996-12-31T23:59:59.000Z

6

Experimental Investigation of Hydrogen Chloride Bonding with Calcium Hydroxide in the Furnace of a Stoker-Fired Boiler  

Science Journals Connector (OSTI)

The paper presents the results of experimental technical investigations to limit the mobility of chlorine released in the form of hydrogen chloride from the fuel in a stoker-fired boiler furnace. In the combustion process, hydrated lime was used as the ...

S?awomir Poskrobko; Jan ?ach; Danuta Krl

2010-03-04T23:59:59.000Z

7

Latest developments and application of DB Riley`s low NOx CCV{reg_sign} burner technology  

SciTech Connect (OSTI)

Recent developments in DB Riley (DBR) low NO{sub x} burner technology and the application of this technology in coal fired utility boilers are discussed. Since the promulgation of the Clean Air Act Amendment in 1990, DBR has sold nearly 1500 Controlled Combustion Venturi (CCV{reg_sign}) burners on pulverized coal fired utility boilers reducing NOx emissions 50 - 70% from uncontrolled levels. This technology has been retrofitted on boiler designs ranging in size and type from 50 MW front wall fired boilers to 1300 MW opposed fired cell type boilers. In DBR`s latest version of the CCV{reg_sign} burner, a second controlled flow air zone was added to enhance NO{sub x} control capability. Other developments included improved burner air flow measurement accuracy and several mechanical design upgrades such as new coal spreader designs for 3 year wear life. Test results of the CCV{reg_sign} dual air zone burner in DBR`s 100 million Btu/hr (29 MW) coal burner test facility are presented. In the test program, coals from four utility boiler sites were fired to provide a range of coal properties. A baseline high volatile bituminous coal was also fired to provide a comparison with 1992 test data for the CCV{reg_sign} single register burner. The test results showed that the second air zone enhanced NO{sub x} reduction capability by an additional 20% over the single register design. Computational fluid dynamic (CFD) modeling results of the CCV{reg_sign} dual air zone burner are also presented showing near field mixing patterns conducive to low NO{sub x} firing.

Penterson, C.; Ake, T. [DB Riley, Inc., Worcester, MA (United States)

1998-04-01T23:59:59.000Z

8

The MacBain/Riley International Fund The Frank McKenna Centre for Leadership  

E-Print Network [OSTI]

opportunity e) Total budget for the proposed global engagement opportunity and budget for the MacThe MacBain/Riley International Fund ­ The Frank McKenna Centre for Leadership Global Engagement global engagement opportunities for undergraduate students. The fund's purpose reflects the belief

9

Biodiesel Sim: Crowdsourcing Simulations for Complex Model Analysis Derek Riley, Xiaowei Zhang, Xenofon Koutsoukos  

E-Print Network [OSTI]

Biodiesel Sim: Crowdsourcing Simulations for Complex Model Analysis Derek Riley, Xiaowei Zhang Computation, Biodiesel Abstract Biodiesel is an alternative fuel source that can be easily made by novices of the proces- sor. A biodiesel processor is a complex system that can be modeled and simulated using formal

Koutsoukos, Xenofon D.

10

Facilities management: the development of a model for building condition assessment surveys conducted at Fort Riley, Kansas  

E-Print Network [OSTI]

of inspection condition criteria and scoring for each sub-component (by visual inspection techniques) . The system was used by multiple inspectors to assess the buildings at Fort Riley. The inspectors received training in the system scoring and methodology...

Riblett, Carl Olin

2012-06-07T23:59:59.000Z

11

Plume opacity investigation at a stoker-fired power generating station  

SciTech Connect (OSTI)

A public utility contacted the Conoco Coal Research Division through Consolidation Coal Company and requested technical assistance in determining the cause of a high plume opacity at one of their stoker-fired power generating stations. The sporadic occurrence of a high opacity plume (>20%) had been reported for several years. Although the utility was burning low sulfur coal, sulfuric acid mist had been suspected as the cause of the plume opacity; therefore, anhydrous ammonia had been injected into the flue gas at the ESP inlet plenums to control the plume opacity with some degree of success. However, for the last two years, the high plume opacity has occurred more frequently. The possible causes of the high plume opacity investigated were: 1) organic species emissions, 2) particulate mass loading, 3) particle size distribution, and 4) sulfuric acid emissions. The investigation included detailed sampling inside the boiler, stack, and plume areas. It was determined that the major cause of the high plume opacity was submicron particle growth at the stack exit due to sulfuric acid/water condensation. The larger particles more efficiently scattered light which resulted in the visible plume at the stack exit. The organic emissions and particulate mass loading in the stack flue gas had minimal effect on the high plume opacity. The fly ash size distribution would also have had minimal effect if the sulfuric acid had not been present.

Lewis, G.H.

1987-01-01T23:59:59.000Z

12

formation at the Riley Ridge Unit on the LaBarge Platform in Southwest  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

formation at the Riley Ridge Unit on the LaBarge Platform in Southwest formation at the Riley Ridge Unit on the LaBarge Platform in Southwest Wyoming. The test will demonstrate the ability of a geological formation to safely, permanently, and economically store more than 2 million tons of carbon dioxide (CO 2 ); examine the entire CO 2 injection process from pre-injection characterization, injection process monitoring, and post-injection monitoring; and provide the groundwork for future carbon capture and storage (CCS) opportunities in the region. The eolian sandstone formations present throughout the region offer the opportunity to store more than 100 years of CO 2 emissions from regional point sources. BSCSP plans to drill a CO 2 injection well and inject up to 1 million tons of CO 2 per year into the Nugget Sandstone

13

A field test using coal:DRDF blends in spreader stoker-fired boilers. Final report, June 1976-July 1978  

SciTech Connect (OSTI)

This program was conducted to characterize and demonstrate the technical, economic, and environmental feasibility of combustion densified forms of refuse derived fuel (dRDF) blended with coal in spreader stoker-fired boilers. A total of 258.5 Mg (285 tons) of pelletized 1/2-inch-diameter x 3/4-inch-long dRDF was co-fired with coal in 2.7 x 7.5 kg/sec (60,000 lb/hr) and 3.6 x 10 kg/sec (75,000 lb/hr) of 1.03 MPa (150 psig) saturated steam. The results indicate that coal:dRDF blends up to 1:2 can be handled and burned in conventional spreader stoker-fired boilers without major equipment modification. As more dRDF was substituted for coal, the flame volume increased, the opacity decreased, the fly ash carbon burnout improved, and the turndown ratio of boiler operation increased. The emissions from the blend firing decreased slightly in mass flux, dropped significantly in particulate size and stack opacity, and had satisfactory particulate resistivities.

Degler, G.H.; Rigo, H.G.; Riley, B.T. Jr.

1980-08-01T23:59:59.000Z

14

Very high energy neutrino expectation from Fanaroff-Riley I sources  

E-Print Network [OSTI]

Fanaroff-Riley I radiogalaxies have been observed in TeV gamma-rays during the last decades. The origin of the emission processes related with this energy band is still under debate. Here we consider the case of the two closest Fanaroff-Riley I objects: Centaurus A and M87. Their entire broadband spectral energy distributions and variability fluxes show evidences that leptonic models are not sufficient to explain their fluxes above 100 GeV. Indeed, both objects have been imaged by LAT instrument aboard of Fermi telescope with measured spectra well connected with one-zone leptonic models. However, to explain the TeV spectra obtained with campaigns by H.E.S.S., for Centaurus A, and by VERITAS, MAGIC and H.E.S.S. for M87, different emission processes must be introduced. In this work we evoke hadronic scenarios to describe the TeV gamma-ray fluxes observed and to obtain the expected neutrino counterparts for each considered TeV campaign. With the obtained neutrino spectra we calculate, through Monte Carlo simulat...

Marinelli, A

2014-01-01T23:59:59.000Z

15

Julia Riley  

Broader source: Energy.gov [DOE]

Julia is a student representative to the board for FY 2013-14. She is a senior at Hardin Valley Academy, where she participates in the National Honor Society, Leo Club, a Lions Club organization,...

16

Emission reduction of NOx and CO by optimization of the automatic control system in a coal-fired stoker boiler  

SciTech Connect (OSTI)

To date research on NO, and CO emission reduction in stoker-fired boilers has been devoted to combustion modification to the overfire air, diverting air to a selected set of burners, using modified low-NOx, burners, using flue gas recirculation or flue gas treatment with specially controlled catalyst and additives. This study introduces a concept that focuses on the dynamics of the boiler and the automatic control system. The objective of this study was to reduce the NO and CO emissions by restructuring the automatic control system and then tuning the control system with parameters that have been optimized with emission reduction as the objective. Dynamic data were obtained from a step-input test of either the underfire air or the overfire air. These data were used to model the boiler with a transfer function describing the emissions. The analyzer dynamic response was included in the overall model. The control parameters were determined from this overall emissions transfer function by mathematical optimization. These control parameters constituted the initial values in the automatic control system used for the final tests in the boiler. Additional adjustments to reduce the emissions were carried out during boiler operation. A low controller gain and a fast reset time were found to be the most suitable setting for the control system. The NO emissions controlled by the overfire air and CO emissions controlled by the underfire air produced the best results.

Schnelle, K.B.; Laungphairojana, A.; Debelak, K.A. [Vanderbilt University, Nashville, TN (United States). Dept. of Chemical Engineering

2006-07-15T23:59:59.000Z

17

GRS 1915+105 AS A GALACTIC ANALOG OF A FANAROFF-RILEY II QUASAR  

SciTech Connect (OSTI)

We study the long-term time-averaged kinetic luminosity, Q-bar , of the major flares of the Galactic microquasar GRS 1915+105 and the relationship to the intrinsic X-ray (bolometric) luminosity, L{sub bol}, and scale it to that of a complete sample of SDSS/FIRST Fanaroff-Riley (FR) II quasars. If the scale invariance hypothesis for black holes (BHs) holds then we show that the expected distribution in the Q-bar -L{sub bol} scatter plane of GRS 1915+105 is consistent with FR II quasars for distances D = 10.7-11 kpc. We compare the specific values of kinetic luminosity and L{sub bol} during flares of GRS 1915+105 to that predicted by several three-dimensional MHD simulations of BH accretion flows with relativistic ejections. If FR II quasars are a scaled up version of GRS 1915+105, the data are consistent with numerical models when they contain an ergospheric disk jet and the BH spin is a/M = 0.99 or a/M = 0.998 (we estimate a/M > 0.984). In the framework of scale invariance of BHs, our results may imply that FR II quasars also hold rapidly rotating BHs.

Punsly, Brian [1415 Granvia Altamira, Palos Verdes Estates, CA 90274 (United States); Rodriguez, Jerome, E-mail: brian.punsly1@verizon.net, E-mail: brian.punsly@comdev-usa.com [Laboratoire AIM, CEA/DSM-CNRS-Universite Paris Diderot, IRFU SAp, F-91191 Gif-sur-Yvette (France)

2013-06-20T23:59:59.000Z

18

Latest developments and application of DB Riley's low NOx CCV{reg{underscore}sign} burner technology  

SciTech Connect (OSTI)

Recent developments in DB Riley (DBR) low NOx burner technology and the application of this technology in coal fired utility boilers are discussed. Since the promulgation of the Clean Air Act Amendment in 1990, DBR has sold nearly 1,500 Controlled Combustion Venturi (CCV{reg{underscore}sign}) burners on pulverized coal fired utility boilers reducing NOx emissions 50--70% from uncontrolled levels. This technology has been retrofitted on boiler designs ranging in size and type from 50 MW front wall fired boilers to 1,300 MW opposed fired cell type boilers. In DBR's latest version of the CCV{reg{underscore}sign} burner, a second controlled flow air zone was added to enhance NOx control capability. Other developments included improved burner air flow measurement accuracy and several mechanical design upgrades such as new coal spreader designs for 3 year wear life. Test results of the CCV{reg{underscore}sign} dual air zone burner in DBR's 100 million Btu/hr (29 MW) coal burner test facility are presented. In the test program, coals from four utility boiler sites were fired to provide a range of coal properties. A baseline high volatile bituminous coal was also fired to provide a comparison with 1992 test data for the CCV{reg{underscore}sign} single register burner. The tests results showed that the second air zone enhanced NOx reduction capability by an additional 20% over the single register design. Computational fluid dynamic (DFD) modeling results of the CCV{reg{underscore}sign} dual air zone burner are also presented showing near field mixing patterns conducive to low NOx firing. DBR was recently awarded Phase IV of the Low Emission Boiler System (LEBS) program by the US Department of Energy to build a proof of concept facility representing the next major advancement in pulverized coal burning technology. A key part of winning that award were test results of the CCV{reg{underscore}sign} dual air zone burner with advanced air staging and coal reburning in a 100 million Btu/hr (20 MW) U-fired slagging combustor test facility. These results showed NOx emissions of less than 0.2 lb/million Btu (0.086 g/MJ) while converting the coal ash into an inert, non-leachable solid. This results is an 80% reduction in NOx emissions from currently operating U-fired slagging boilers.

Penterson, C.; Ake, T.

1998-07-01T23:59:59.000Z

19

THE {gamma}-RAY EMISSION REGION IN THE FANAROFF-RILEY II RADIO GALAXY 3C 111  

SciTech Connect (OSTI)

The broad-line radio galaxy 3C 111, characterized by a Fanaroff-Riley II (FRII) radio morphology, is one of the sources of the misaligned active galactic nucleus sample, consisting of radio galaxies and steep spectrum radio quasars, recently detected by the Fermi Large Area Telescope (LAT). Our analysis of the 24 month {gamma}-ray light curve shows that 3C 111 was only occasionally detected at high energies. It was bright at the end of 2008 and faint, below the Fermi-LAT sensitivity threshold, for the rest of the time. A multifrequency campaign of 3C 111, ongoing in the same period, revealed an increase of the millimeter, optical, and X-ray fluxes in 2008 September-November, interpreted by Chatterjee et al. as due to the passage of a superluminal knot through the jet core. The temporal coincidence of the millimeter-optical-X-ray outburst with the GeV activity suggests a cospatiality of the events, allowing, for the first time, the localization of the {gamma}-ray dissipative zone in an FRII jet. We argue that the GeV photons of 3C 111 are produced in a compact region confined within 0.1 pc and at a distance of about 0.3 pc from the black hole.

Grandi, P.; Torresi, E. [Istituto Nazionale di Astrofisica-IASFBO, Via Gobetti 101, I-40129, Bologna (Italy); Stanghellini, C., E-mail: grandi@iasfbo.inaf.it, E-mail: torresi@iasfbo.inaf.it, E-mail: cstan@ira.inaf.it [Istituto Nazionale di Astrofisica-IRA, Via Gobetti 101, I-40129, Bologna (Italy)

2012-05-20T23:59:59.000Z

20

Naam: dhr. prof. dr. R.S. Kahn Leeropdracht Psychiatrie  

E-Print Network [OSTI]

, Collier DA, St Clair D, Stefansson K, Kahn RS, Linszen DH, van Os J, Wiersma D, Bruggeman R, Cahn W, de

Utrecht, Universiteit

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Symmetrical pitting edema resembling RS3PE in gout  

Science Journals Connector (OSTI)

Remitting seronegative symmetrical synovitis with pitting edema (RS3PE) was first described in 1985 by McCarty [1], as an isolated syndrome. Subsequently, a similar picture was reported as a clinical manifestatio...

C. Palazzi; I. Olivieri; E. DAmico; V. Pace-Palitti; A. Petricca

2003-12-01T23:59:59.000Z

22

NEWS & VIEWS nEutRon StaRS  

E-Print Network [OSTI]

NEWS & VIEWS nEutRon StaRS a magnetar by another name Fernando Camilo is at the Columbia core, held stable by neutron degeneracy pressure -- with more mass than the Sun within a 10 km radius -- has central densities comparable to those of nuclei. What does the neutron star sky look like, made

Loss, Daniel

23

A Java implementation of the RS1 algorithm using SQL  

E-Print Network [OSTI]

implementation of the RS1 Rough Sets algorithm, that leverages the use of a Data Base Management System (DBMS is implemented within a single Java class, making it ideal not only for Rough Set research, but as an add-on to non Rough Set projects. Keywords Java, Rough Set Implementation, Database Management Sys- tem 1 #12; 1

Regina, University of

24

E-Print Network 3.0 - alegre rs brasil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

brasil Search Powered by Explorit Topic List Advanced Search Sample search results for: alegre rs brasil Page: << < 1 2 3 4 5 > >> 1 Ensino -RS segundo em ranking da Capes http:...

25

Saturday Workshop 2/7/2009 RS: Molly Burke CT's: Roy Center & Lee Kelly  

E-Print Network [OSTI]

Saturday Workshop 2/7/2009 RS: Molly Burke CT's: Roy Center & Lee Kelly Drosophila Handbook page 1 2/7/2009 RS: Molly Burke CT's: Roy Center & Lee Kelly Drosophila Handbook page 2 Table of Contents Standards 22 #12;Saturday Workshop 2/7/2009 RS: Molly Burke CT's: Roy Center & Lee Kelly Drosophila Handbook

Rose, Michael R.

26

Learning about social threats in RS Learning biases underlying individual differences in sensitivity to social rejection  

E-Print Network [OSTI]

Learning about social threats in RS 1 Learning biases underlying individual differences. Ochsner, Department of Psychology, Columbia University Running Head: Learning about social threats in RS University, Northwest Science Bldg 290, Cambridge, MA 0213. #12;Learning about social threats in RS 2

Ochsner, Kevin

27

Evolved expendable launch vehicle system: RS-68 main engine development  

Science Journals Connector (OSTI)

Delta IV is one of two competing Evolved Expendable Launch Vehicle (EELV) systems being developed in an industry/United States Government partnership to meet the needs of the new era of space launch for the early decades of the 21st Century. The Rocketdyne Division of The Boeing Company and the United States Air Force have developed a 650 Klbf sea-level (2.9 MN) class liquid hydrogen/liquid oxygen main engine for the Delta IV family of EELV. The purpose of this paper is to present the innovative approach to the design, development, testing and certification of the RS-68 engine.

David Conley; Norman Y. Lee; Peter L. Portanova; Byron K. Wood

2003-01-01T23:59:59.000Z

28

954ER4 Specification 4 ports RS-232 PCI-Express Serial cards  

E-Print Network [OSTI]

954ER4 Specification 4 ports RS-232 PCI-Express Serial cards FEATURES 4 independent RS-232 serial ports with communication speeds up to 230 921 ­­­­Kbps Designed to meet PCI-Express Base Specification PC system. Majority of today's motherboard no longer come with serial ports or only have one port

Berns, Hans-Gerd

29

The association between the polymorphism rs2231142 in the ABCG2 gene and gout risk: a meta-analysis  

Science Journals Connector (OSTI)

Gout is a common metabolic disorder with high ... tried to explore the association between rs2231142 and gout. We searched rs2231142 or Q141K and gout in four databases and scholar searching website ... T allel...

Xiaofei Lv; Yuan Zhang; Fangfang Zeng; Aihua Yin; Ning Ye

2014-12-01T23:59:59.000Z

30

E-Print Network 3.0 - adulta pelotas rs Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Muriel, R. y Patio, J. 2010. Fenologa del Coscoroba (Coscoroba coscoroba) en el sur de Brasil y sus Summary: de Rio Grande do Sul (RS); pero por falta de recapturas de animales...

31

E-Print Network 3.0 - alegre rs brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Sample search results for: alegre rs brazil Page: << < 1 2 3 4 5 > >> 1 Curriculum Vitae Ana M. R. Liedke Summary: Mdio "Dolores Alcaraz Caldas" - 2004 , Porto Alegre,...

32

Power Flattening in ARIES-RS Fusion Breeder Reactor Using Mixed Fuels  

Science Journals Connector (OSTI)

This study presents the possibility of the power flattening in the ARIES-RS breeder reactor using mixed (Th,U)C or (Th,U)N fuels. Two different types of mixing, namely, homogeneous mixing (HM) and linear mixin...

Mustafa beyli

2004-12-01T23:59:59.000Z

33

Utilization of Ceramic Uranium Fuels in ARIES-RS Fusion Reactor  

Science Journals Connector (OSTI)

This study presents the neutronic performance of the ARIES-RS fusion reactor design using different natural ceramic uranium fuels,...2, UN or U3Si2..., dispersed in graphite matrix. These fissionable fuels insert...

Mustafa beyli

2004-03-01T23:59:59.000Z

34

A suite of RS/1 procedures for chemical laboratory statistical quality control and Shewhart control charting  

SciTech Connect (OSTI)

A suite of RS/1 procedures for Shewhart control charting in chemical laboratories is described. The suite uses the RS series product QCA (Quality Control Analysis) for chart construction and analysis. The suite prompts users for data in a user friendly fashion and adds the data to or creates the control charts. All activities are time stamped. Facilities for generating monthly or contiguous time segment summary charts are included. The suite is currently in use at Westinghouse Savannah River Company.

Shanahan, K.L.

1990-09-01T23:59:59.000Z

35

USA RS Basic Contract - Contract No.: DE-RW0000005 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

USA RS Basic Contract - Contract No.: DE-RW0000005 USA RS Basic Contract - Contract No.: DE-RW0000005 USA RS Basic Contract - Contract No.: DE-RW0000005 This document describes the Statement of Work (SOW) of the Management and Operating Contractor (M&O) Contract for the U.S. Department of Energy (DOE), Office of Civilian Radioactive Waste Management (OCRWM) Program's Yucca Mountain Project (YMP). An M&O contract is defined at Federal Acquisition Regulation (FAR) 17.6 and Department of Energy Acquisition Regulation (DEAR) 970. Inasmuch as the assigned mission of OCRWM YMP is dynamic, this SOW is not intended to be exclusive or restrictive, but is intended to provide a broad framework and general scope of work to be performed by the M&O. This SOW does not represent a commitment to, or imply funding for, specific projects

36

Improved Yield and Diverse Finished Bacterial Genomes using Pacific Biosciences RS II SMRT Sequencing  

E-Print Network [OSTI]

Improved Yield and Diverse Finished Bacterial Genomes using Pacific Biosciences RS II SMRT-Cruz, Alvaro Godinez, Luke J. Tallon Institute for Genome Sciences, University of Maryland School of Medicine, effective, and highly accurate platform for generation of complete microbial genome sequences. As early

Weber, David J.

37

Fusion Engineering and Design 38 (1997) 87113 Configuration and engineering design of the ARIES-RS  

E-Print Network [OSTI]

a significant role in the future energy market. The design is a 1000 MWe, DT-burning fusion power plant based 0417, La Jolla, CA 92093-0417, USA Abstract ARIES-RS is a conceptual design study which has examined the potential of an advanced tokamak-based power plant to compete with future energy sources and play

California at San Diego, University of

38

Impact of the new solar abundances on the calibration of the PMS binary system RS Cha  

E-Print Network [OSTI]

Context: In a recent work, we tried to obtain a calibration of the two components of the pre-main sequence binary system RS Cha by means of theoretical stellar models. We found that the only way to reproduce the observational parameters of RS Cha with standard stellar models is to decrease the initial abundances of carbon and nitrogen derived from the GN93 solar mixture of heavy elements by a few tenths of dex. Aims: In this work, we aim to reproduce the observational properties of the RS Cha stars with stellar evolution models based on the new AGS05 solar mixture recently derived from a three-dimensional solar model atmosphere. The AGS05 mixture is depleted in carbon, nitrogen and oxygen with respect to the GN93 mixture. Methods: We calculated new stellar models of the RS Cha components using the AGS05 mixture and appropriate opacity tables. We sought models that simultaneously satisfy the observations of the two components (masses, radii, luminosities, effective temperatures and metallicity). Results: We fi...

Alecian, E; Goupil, M-J; Dupret, M-A; Catala, C

2007-01-01T23:59:59.000Z

39

Remote Sens. 2013, 5, 5173-5192; doi:10.3390/rs5105173 Remote Sensing  

E-Print Network [OSTI]

Remote Sens. 2013, 5, 5173-5192; doi:10.3390/rs5105173 Remote Sensing ISSN 2072-4292 www for a geosynchronous OPEN ACCESS #12;Remote Sens. 2013, 5 5174 satellite with modern imaging detectors, software, and algorithms able to detect heat from early and small fires, and yield minute-scale detection times. Keywords

Stephens, Scott L.

40

Remote Sens. 2013, 5, 5969-5998; doi:10.3390/rs5115969 Remote Sensing  

E-Print Network [OSTI]

Remote Sens. 2013, 5, 5969-5998; doi:10.3390/rs5115969 Remote Sensing ISSN 2072-4292 www, the technique presented in this paper would help them to quantify the impacts of OPEN ACCESS #12;Remote Sens; urban heat island effect; NDVI; artificial neural network; Markov chain; Dhaka 1. Introduction Urban

Crawford, Ian

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Calibration of the pre-main sequence RS Cha binary system  

E-Print Network [OSTI]

Context: The calibration of binary systems with accurately known masses and/or radii provides powerful tools to test stellar structure and evolution theory and to determine the age and helium content of stars. We study the eclipsing double-lined spectroscopic binary system RS Cha, for which we have accurate observations of the parameters of both stars (masses, radii, luminosities, effective temperatures and metallicity). Aims: We have calculated several sets of stellar models for the components of the RS Cha system, with the aim of reproducing simultaneously the available observational constraints and to estimate the age and initial helium abundance of the system. Methods: Using the CESAM stellar evolution code, we model both components starting from the initial mass and metallicity and adjusting the input parameters and physics in order to satisfy the observational constraints. Results: We find that the observations cannot be reproduced if we assume that the abundance ratios are solar but they are satisfied ...

Alecian, E; Lebreton, Y; Dupret, M A; Catala, C

2006-01-01T23:59:59.000Z

42

JP RILEY, AND G. SKIRROW [Eds.].  

Science Journals Connector (OSTI)

come dated rather rapidly; if it does not, it will not have ... brary of every department that does research or ... A practical handbook of seawater analysis. Bull. Fish.

2000-01-04T23:59:59.000Z

43

HI and CO in the circumstellar environment of the S-type star RS Cnc  

E-Print Network [OSTI]

This paper presents interferometric and single-dish CO observations along with HI data obtained for the oxygen-rich semi-regular variable RS Cnc, in order to probe its circumstellar environment at different scales. With the Plateau de Bure Interferometer and the IRAM 30-m telescope, we detect both the CO(1-0) and the CO(2-1) rotational lines from RS Cnc. The line profiles are composite, with two components of half-width ~2 km/s and ~8 km/s respectively. Whereas the narrow velocity component seems to originate from an equatorial disk in the central part of the CO envelope, the broad component reveals a bipolar structure, with a north-south velocity gradient. In addition, we obtain new HI data on the source and around it in a field of almost 1 square degree. The HI line is centered at v_LSR = 7 km/s in agreement with CO observations. A new reduction process reveals a complex extended structure in the northwest direction, of estimated size ~18 arcmin, with a PA (~310 degrees) opposite to the direction of the ste...

Libert, Yannick; Bertre, Thibaut Le; Grard, Eric; Matthews, Lynn D

2010-01-01T23:59:59.000Z

44

The multi-scale environment of RS Cnc from CO and HI observations  

E-Print Network [OSTI]

We present a detailed study of the circumstellar gas distribution and kinematics of the semi-regular variable star RS Cnc on spatial scales ranging from ~1" (~150 AU) to ~6' (~0.25 pc). New modeling of CO1-0 and CO2-1 imaging observations leads to a revised characterization of RS Cnc's previously identified axisymmetric molecular outflow. Rather than a simple disk-outflow picture, we find that a gradient in velocity as a function of latitude is needed to fit the spatially resolved spectra, and in our preferred model, the density and the velocity vary smoothly from the equatorial plane to the polar axis. In terms of density, the source appears quasi-spherical, whereas in terms of velocity the source is axi-symmetric with a low expansion velocity in the equatorial plane and faster outflows in the polar directions. The flux of matter is also larger in the polar directions than in the equatorial plane. An implication of our model is that the stellar wind is still accelerated at radii larger than a few hundred AU,...

Hoai, D T; Winters, J M; Nhung, P T; Grard, E; Libert, Y; Bertre, T Le

2014-01-01T23:59:59.000Z

45

Optimal dimensions minimizing expected travel time of a single machine flow rack AS/RS  

Science Journals Connector (OSTI)

Abstract In this paper, the aim is to determine the optimal dimensions of a flow rack automated storage and retrieval system (AS/RS) using a single machine for storage and retrieval operations. These optimal dimensions are evaluated for minimum expected travel times of the storage and retrieval machine. An enumeration technique is used on a large range of system configurations going from 100 to 20,000 storage segments. Initially, optimization is carried out on six travel time expressions dealing with single and dual cycle travel times considering two dwell point positions. The results are then studied to investigate the influence of travel time expressions on both optimal dimensions and the shape factor of the system rack. Secondly, a new generalized mathematical model was developed by introducing an occurrence proportion parameter, relative to dual cycles, in order to determine the influence of the system functioning (proportion of dual cycles and load rate) on optimal dimensions.

Mohammed Adel Hamzaoui; Zaki Sari

2014-01-01T23:59:59.000Z

46

Analysis of cloud layer structure in Shouxian, China using RS92 radiosonde aided by 95 GHz cloud radar  

E-Print Network [OSTI]

Analysis of cloud layer structure in Shouxian, China using RS92 radiosonde aided by 95 GHz cloud to analyze cloud vertical structure over this area by taking advantage of the first direct measurements of cloud vertical layers from the 95 GHz radar. Singlelayer, twolayer, and threelayer clouds account for 28

Li, Zhanqing

47

1Edmund R.S. Kunji, Medical Research Council, Mitochondrial Biology Unit The Mitochondrial Carrier Family I  

E-Print Network [OSTI]

in metabolism #12;4 Role of mitochondrial carriers in energy conversion #12;5 Role of mitochondrial carriers of mitochondrial carriers palmitoylcarnitine adenosinetriphosphate arginine glutamate proton #12;15 Energy coupling1Edmund R.S. Kunji, Medical Research Council, Mitochondrial Biology Unit The Mitochondrial Carrier

Schnaufer, Achim

48

1 -SUBTIDAL 2 -INTERTIDAL RB ROCK UB UNCONSOLIDATED AB AQUATIC BED RF -REEF OW -OPEN WATER/ AB AQUATIC BED RF REEF RS ROCKY SHORE US -UNCONSOLIDATED  

E-Print Network [OSTI]

M - MARINE 1 - SUBTIDAL 2 - INTERTIDAL RB ­ ROCK UB ­ UNCONSOLIDATED AB ­ AQUATIC BED RF - REEF OW - OPEN WATER/ AB ­ AQUATIC BED RF­ REEF RS ­ ROCKY SHORE US - UNCONSOLIDATED BOTTOM BOTTOM Unknown Bottom ­ UNCONSOLIDATED AB ­ AQUATIC RF ­ REEF OW - OPEN WATER/ AB ­ AQUATIC RF­ REEF SB ­ STREAMBED RS - ROCKY US

Gray, Matthew

49

On the central symmetry of the circumstellar envelope of RS Cnc  

E-Print Network [OSTI]

We present a phenomenological study of CO(1-0) and CO(2-1) emission from the circumstellar envelope (CSE) of the Asymptotic Giant Branch (AGB) star RS\\,Cnc. It reveals departures from central symmetry that turn out to be efficient tools for the exploration of some of the CSE properties. We use a wind model including a bipolar flow with a typical wind velocity of $\\sim$8 km\\,s$^{-1}$ decreasing to $\\sim$2 km\\,s$^{-1}$ near the equator to describe Doppler velocity spectral maps obtained by merging data collected at the IRAM Plateau de Bure Interferometer and Pico Veleta single dish radio telescope. Parameters describing the wind morphology and kinematics are obtained, together with the radial dependence of the gas temperature in the domain of the circumstellar envelope probed by the CO observations. Significant north-south central asymmetries are revealed by the analysis, which we quantify using a simple phenomenological description. The origin of such asymmetries is unclear.

Nhung, Pham Tuyet; Winters, Jan Martin; Darriulat, Pierre; Grard, Eric; Bertre, Thibaut Le

2014-01-01T23:59:59.000Z

50

Methodologies of preparing erosion features map by using RS and GIS  

Science Journals Connector (OSTI)

The erosion features map is one of the basic maps in erosion and sediment studies and watershed management programs. Some methodologies of preparing erosion features map by using RS and GIS were compared in research which took place in the Jajrood sub-basin in north-east Tehran, Iran. In the first phase, four working units' maps were prepared by integration a) plant cover, geology and slope b) land use, geology and slope c) land use, rocks sensitivity to erosion and slope and d) land use, rocks sensitivity to erosion and land units' layers. In addition to these four working units' maps, three more maps were also evaluated in separating erosion features including e) land units f) sensitivity of rocks to erosion and g) image photomorphic units. The efficiency of these seven working units' maps was evaluated by 314 control points. For this purpose, by using erosion features of control points regarding field views, surface, rill, gully and channel erosion maps were prepared and compared by crossing them with working units' maps. Results showed that method d was better than a, b and c in providing soil erosion features regarding economic and executive considerations. The accuracy of methods e and f was 53.0 and 42.9% and their Root Mean Squared Error was more than method g and methods a to d. The coefficient of variation was highest for methods e and f and the least for method e and the greatest precision was related to image interpretation.

Torkashvand Ali Mohammadi; Davood Nikkami

2008-01-01T23:59:59.000Z

51

The long-period Galactic Cepheid RS Puppis - III. A geometric distance from HST polarimetric imaging of its light echoes  

E-Print Network [OSTI]

As one of the most luminous Cepheids in the Milky Way, the 41.5-day RS Puppis is an analog of the long-period Cepheids used to measure extragalactic distances. An accurate distance to this star would therefore help anchor the zero-point of the bright end of the period-luminosity relation. But, at a distance of about 2 kpc, RS Pup is too far away for measuring a direct trigonometric parallax with a precision of a few percent with existing instrumentation. RS Pup is unique in being surrounded by a reflection nebula, whose brightness varies as pulses of light from the Cepheid propagate outwards. We present new polarimetric imaging of the nebula obtained with HST/ACS. The derived map of the degree of linear polarization pL allows us to reconstruct the three-dimensional structure of the dust distribution. To retrieve the scattering angle from the pL value, we consider two different polarization models, one based on a Milky Way dust mixture and one assuming Rayleigh scattering. Considering the derived dust distribu...

Kervella, P; Cracraft, M; Szabados, L; Breitfelder, J; Mrand, A; Sparks, W B; Gallenne, A; Bersier, D; Fouqu, P; Anderson, R I

2014-01-01T23:59:59.000Z

52

4 Jornada de Educao em Sensoriamento Remoto no mbito do Mercosul 11 a 13 de agosto de 2004 So Leopoldo, RS, Brasil UTILIZAO DE SENSORIAMENTO REMOTO COMO  

E-Print Network [OSTI]

­ São Leopoldo, RS, Brasil UTILIZA??O DE SENSORIAMENTO REMOTO COMO FERRAMENTA DE TRABALHO NO ENSINO BRITO" R. Antonio Eras, n° 107 Jardim Colinas Cep 12.242-190 São José dos Campos ­ SP, Brasil Tel (12 agosto de 2004 ­ São Leopoldo, RS, Brasil tempo de vida útil, se existe um local proposto para

53

10 Carbon Capture and Storage in the UK Bushby Y.E., Gilfillan S.M.V. and Haszeldine R.S.  

E-Print Network [OSTI]

10 Carbon Capture and Storage in the UK Bushby Y.E., Gilfillan S.M.V. and Haszeldine R.S. Scottish emissions. Carbon Capture and Storage can reduce UK emissions rapidly, whilst renewable energy and low-carbon generation technologies are developed and built. 2. Capture of carbon dioxide is most beneficial at large

Haszeldine, Stuart

54

MAGNETIZATION ESTIMATION FROM MFM IMAGES Chi-Chun Hsu, Clayton T. Miller, R.S. Indeck, J.A. O'Sullivan, M.W. Muller  

E-Print Network [OSTI]

MAGNETIZATION ESTIMATION FROM MFM IMAGES Chi-Chun Hsu, Clayton T. Miller, R.S. Indeck, J.A. O'Sullivan, M.W. Muller Magnetics and Information Science Center, Washington University, St. Louis, MO 63130 Tel: (314) 935-4767; Fax (314) 935-7500; email: rsi@ee.wustl.edu Magnetic force microscopy (MFM

O'Sullivan, Joseph A.

55

Preclinical Translation: A Partnership between USC Stevens, CHLA OTT and CSCTSI The SC CTSI Preclinical Translation and Regulatory Support Program (PCT RS) helps biomedical  

E-Print Network [OSTI]

development (2) project opportunityrisk analysis including review of data, markets and IP (3) a project plan.), (4) regulatory requirements for market approval, (5) project planning where project needs are mapped Preclinical Translation and Regulatory Support Program (PCT RS) helps biomedical researchers

Zhou, Chongwu

56

H.F. Diaz and R.S. Bradley (eds.), The Hadley Circulation: Present, Past and Future, 121152. 2005 Kluwer Academic Publishers. Printed in the Netherlands  

E-Print Network [OSTI]

121 H.F. Diaz and R.S. Bradley (eds.), The Hadley Circulation: Present, Past and Future, 121-SEA INTERACTION, AND THE RISING BRANCH OF THE HADLEY CIRCULATION Shang-Ping Xie International Pacific Research in the meridional direction is the ul- timate drive for the global Hadley circulation, dictating that its rising

Xie, Shang-Ping

57

Refractory experience in circulating fluidized bed combustors, Task 7  

SciTech Connect (OSTI)

This report describes the results of an investigation into the status of the design and selection of refractory materials for coal-fueled circulating fluidized-bed combustors. The survey concentrated on operating units in the United States manufactured by six different boiler vendors: Babcock and Wilcox, Combustion Engineering, Foster Wheeler, Keeler Dorr-Oliver, Pyropower, and Riley Stoker. Information was obtained from the boiler vendors, refractory suppliers and installers, and the owners/operators of over forty units. This work is in support of DOE's Clean Coal Technology program, which includes circulating fluidized-bed technology as one of the selected concepts being evaluated.

Vincent, R.Q.

1989-11-01T23:59:59.000Z

58

Refractory experience in circulating fluidized bed combustors, Task 7. Final report  

SciTech Connect (OSTI)

This report describes the results of an investigation into the status of the design and selection of refractory materials for coal-fueled circulating fluidized-bed combustors. The survey concentrated on operating units in the United States manufactured by six different boiler vendors: Babcock and Wilcox, Combustion Engineering, Foster Wheeler, Keeler Dorr-Oliver, Pyropower, and Riley Stoker. Information was obtained from the boiler vendors, refractory suppliers and installers, and the owners/operators of over forty units. This work is in support of DOE`s Clean Coal Technology program, which includes circulating fluidized-bed technology as one of the selected concepts being evaluated.

Vincent, R.Q.

1989-11-01T23:59:59.000Z

59

Design and development for a low emission boiler system  

SciTech Connect (OSTI)

The Department of Energy initiated the Combustion 2000 program to develop the next generation of coal-fired power plants. Sargent & Lundy (S&L) is working on the Low Emission Boiler System (LEBS) portion of the program led by Riley Stoker Corporation, with support from Textron Defense Systems, Tecogen, and Reaction Engineering International. Together these organizations form {open_quotes}the Riley Team.{close_quotes} There are four phases of the LEBS development program. Currently, we are working in Phase I, which involves the design of a 400 MWe unit. Phase II through IV will involve pilot scale component testing and a Proof-of-Concept facility ({approximately}40MWe) design, construction, and operation. This document comprises the Design and Development Report for the LEBS. The report describes the design basis, design uncertainties and development plan for each of the major LEBS subsystems.

Not Available

1994-06-01T23:59:59.000Z

60

HANWEI ZHANG 19 Riley Ct. Skillman, NJ 08558  

E-Print Network [OSTI]

3, Pages 277-298 [6]. Klein, A., Zhang, H. & Themelis, N. J. (2003). A Waste-To-Energy Power Plant.zhang@gmail.com Research Interests Thermal conversion of municipal solid waste to energy; Numerical Analysis of High (2007). Process Simulation of a large Mass Burn Waste-To-Energy boiler by the combination of CFD

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Curriculum Vitae: Michael Riley Brown Department of Physics and Astronomy  

E-Print Network [OSTI]

- ids; dynamos; self-organization in turbulent systems; magnetic confinement fusion (spheromak and field of a spheromak accelerator for the purposes of tokamak refueling and current drive on the ENCORE tokamak for spheromak research. (6/87-5/89) Fellowship at Dartmouth College to study compressible MHD turbulence theory

Brown, Michael R.

62

Curriculum Vitae: Michael Riley Brown Department of Physics and Astronomy  

E-Print Network [OSTI]

; dy- namos; self-organization in turbulent systems; magnetic confinement fusion (spheromak and field. Bellan. Work included the design, construction and operation of a spheromak accelerator for the purposes voltage (10 kV), high current (100 kA), rapidly switched discharges for spheromak research. (6

Brown, Michael R.

63

The long-period Galactic Cepheid RS Puppis - II. 3D structure and mass of the nebula from VLT/FORS polarimetry  

E-Print Network [OSTI]

The long-period Cepheid RS Pup is surrounded by a large dusty nebula reflecting the light from the central star. Due to the changing luminosity of the central source, light echoes propagate into the nebula. This remarkable phenomenon was the subject of Paper I.The origin and physical properties of the nebula are however uncertain: it may have been created through mass loss from the star itself, or it could be the remnant of a pre-existing interstellar cloud. Our goal is to determine the 3D structure of the nebula, and estimate its mass. Knowing the geometrical shape of the nebula will also allow us to retrieve the distance of RS Pup in an unambiguous manner using a model of its light echoes (in a forthcoming work). The scattering angle of the Cepheid light in the circumstellar nebula can be recovered from its degree of linear polarization. We thus observed the nebula surrounding RS Pup using the polarimetric imaging mode of the VLT/FORS instrument, and obtained a map of the degree and position angle of linear...

Kervella, P; Szabados, L; Sparks, W B; Havlen, R J; Bond, H E; Pompei, E; Fouqu, P; Bersier, D; Cracraft, M

2012-01-01T23:59:59.000Z

64

RS-Historian  

Broader source: Energy.gov (indexed) [DOE]

REQUEST FOR RECORDS DISPOSITION AUTHORITY REQUEST FOR RECORDS DISPOSITION AUTHORITY L E A V E B U N K (NARA us0 onty) (sue lnsrrrrctions on r e v e r s r . ~ Nji37734 - 72 -/ NATIONAL ARCKIVES and RECORDS ADMIMSTRAT~ON DATE RECEIVED \.YASHINGTON, DC 20408 1 FROM (Agency or eslnMlshrnent) /I -6 -9 / NOTlFlCATION TO AGENCY Department o f Energy ( l i e a d q u a r t e r s ) - 2 MLUOR SUBD~VISION O f f i c e o f A d m i n i s t r a t i o n & Human Resource Management 3 MlNOR S u B O l V l s l o ~ O f f i c e o f E x e c u t i v e S e c r e t a r i a t , H i s t o r y D i v i s i o n N DATE A Maria Vignone I hereby certify that I am authorized to act for this and that the records roposed for disposal on the P of this agency or wil not be needed after the retention the General Accounting Office, under the provisions o Agenaes, &) is not required; a is attached; or a has been requested.

65

RS-WEAPONS Records  

Broader source: Energy.gov (indexed) [DOE]

~ ~ o c tnstructions o n r e v e r s e ) ' T O NATIONAL ARCHIVES and RECORDS ADMINISTRATION (NIR) \$'ASHINGTON. DC 20108 ' 1 FROM (Agency or establishment) U. S . De~artment of E ~ r n v 2 MAJOR SUBDIVISION 3 MINOR SUBDlVlSlOtJ I hereby certify that I am authorized to act for this agency in matters pertaining to the disposition of its records and that the records roposed for disposal on the attached 38 page(s) are not noJv needed for the business of t h ~ s agency or wi f not be needed after the retention erlods s ecified; and that wrritten concurrence from ,4eencies, P P the General A c c o u ~ t ~ n g Offlce, u n d e r the p r o v ~ s i o n s o Title 8 o the G A O M a n u a l for Guidance of Federal L t A V E BLANK (NARA use only) 'JOB NUMBER h / / - 4 3 C t ~ 7 6 -- 3 - DATE Z - 2 3 - 7 6 NOTIFICATIONTO AGENCY

66

Ge~~?srE~~rs~anSJla~~~l!u~?a~!L:Ya~~ld and Mariant:H. Marchand  

E-Print Network [OSTI]

Ge~~?srE~~rs~anSJla~~~l!u~?a~!L:Ya~~ld and Mariant:H. Marchand Gender in a Global/Local World c

Brody, James P.

67

In Situ Validation of a Correction for Time-Lag and Bias Errors in Vaisala RS80-H Radiosonde Humidity Measurements  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In Situ Validation of a Correction for Time-Lag and In Situ Validation of a Correction for Time-Lag and Bias Errors in Vaisala RS80-H Radiosonde Humidity Measurements L. M. Miloshevich National Center for Atmospheric Research Boulder, Colorado H. Vömel and S. J. Oltmans National Oceanic and Atmospheric Administration Boulder, Colorado A. Paukkunen Vaisala Oy Helsinki, Finland Introduction Radiosonde relative humidity (RH) measurements are fundamentally important to Atmospheric Radiation Measurement (ARM) Program goals because they are used in a wide variety of both operational and research applications, including initialization of numerical models and evaluation of model results, validation of remote-sensor water vapor retrievals, construction of water vapor climatologies and studies of climate trends, parameterization of cloud processes, and as input to

68

NIU Recreation Services (RS) adopted a t-shirt and sleeve policy on Monday, August 30th Student Recreation Center and the Chick Evans Field House. Full-back shirts with sleeves (i.e.  

E-Print Network [OSTI]

NIU Recreation Services (RS) adopted a t-shirt and sleeve policy on Monday, August 30th for the Student Recreation Center and the Chick Evans Field House. Full-back shirts with sleeves (i.e. no cut-Fitted Shirts that cover the arm pit area are acceptable. A zero tolerance policy will be enforced. Recreation

Kostic, Milivoje M.

69

Understanding the Rate of Clean Up for Oil Zones after a Gel Treatment R.S. Seright, SPE, New Mexico Petroleum Recovery Research Center, W. Brent Lindquist, SPE, and Rong Cai,  

E-Print Network [OSTI]

SPE 112976 Understanding the Rate of Clean Up for Oil Zones after a Gel Treatment R.S. Seright, SPE, New Mexico Petroleum Recovery Research Center, W. Brent Lindquist, SPE, and Rong Cai, Stony Brook at the 2008 SPE Improved Oil Recovery Symposium held in Tulsa, Oklahoma, U.S.A., 19­23 April 2008. This paper

New York at Stoney Brook, State University of

70

Reply to Comment [arXiv:0810.3244v1] by R.S. Decca et al. on "Contribution of drifting carriers to the Casimir-Lifshitz and Casimir-Polder interactions with semiconductor materials"  

E-Print Network [OSTI]

We show that the claims expressed in the Comment arXiv:0810.3244v1 by R.S. Decca et al against our paper, D.A.R. Dalvit and S.K. Lamoreaux, Phys. Rev. Lett. {\\bf 101}, 163203 (2008), are wrong and manifestly inconsistent with basic principles of statistical physics.

Diego A. R. Dalvit; Steve K. Lamoreaux

2008-12-05T23:59:59.000Z

71

Please cite this article in press as: R.S. Colbert, W.G. Sawyer, Thermal dependence of the wear of molybdenum disulphide coatings, Wear (2010), doi:10.1016/j.wear.2010.07.008  

E-Print Network [OSTI]

Temperature dependent wear15 MoS216 a b s t r a c t Molybdenum disulphide (MoS2) is a common constituentPlease cite this article in press as: R.S. Colbert, W.G. Sawyer, Thermal dependence of the wear of molybdenum disulphide coatings, Wear (2010), doi:10.1016/j.wear.2010.07.008 ARTICLE IN PRESS GModel WEA 99557

Sawyer, Wallace

72

RS- External Correspondence-RFETS  

Broader source: Energy.gov (indexed) [DOE]

JOB NUMBER JOB NUMBER R E Q U E S T F O R R E C O R D S D I S P O S I T I O N A U T H O R I T Y (See Instructions on reverse) TO NATIONAL ARCHIVES and RECORDS ADMINISTRATION (NIR) WASHINGTON, DC 20408 1 FROM (Agency or establ~shment) Department o f Energy 2 MAJOR SUBDIVISION Kaiser-Hill, RFETS 3 MINOR SUBDIVISION Records Management In accordance w ~ t h the provlslons of 44 U S C 3303a rne olsposlrlon request. I includ~ng amendments, 1 s approved except for items rnai may oe marked 'o~spos~non not approved" or 'wlthdrawn" In column 10 I 4 NAME OF PERSON WITH WHOM TO CONFER David Prochnow, Manager Contractor Records Management, R F E T S \ 1 I hereby certify that 1 am authorized to act for this agency in patters pertaining to the dlsposltlon of its records ard tha: the recolds proposed for disposal on the attached. paag(s) are not now needed for the busmess

73

TAPS Atigun 3Rs project  

SciTech Connect (OSTI)

This paper reports that Alyeska Pipeline Service Co. is managing a comprehensive corrosion monitoring and repair program for the Trans Alaska Pipeline System as it has since pipeline operations began in 1977. The company has recently initiated the largest corrosion project to date, the Atigun Floodplain Pipe Replacement Project. Three major goals of the pipe replacement project are to: Complete the work with the least environmental impact. Incorporate changes in design and procedures to reduce future corrosion and Accomplish the repair with minimum impact on pipeline throughput. The project team consulted with environmental agencies at the outset to ensure compliance with all requisite regulation, and obtained 35 permits. Environmental protection will continue as a major goal throughout the duration of the project.

Starratt, P.F. (Alyeska Pipeline Service Co., Anchorage, AK (US))

1992-03-01T23:59:59.000Z

74

Argonne Leadership Compu2ng Facility www.alcf.anl.gov Katherine Riley  

E-Print Network [OSTI]

* High-risk, high-payoff science aligned with DOE mission Strategic LCF goals 10M - 100M core-hours/yr. 5 - 10 projects 1M ­ 75M core-hours/yr. 100s of projects 10K ­ 1M core-hours Review Process Scien2fic Peer

Kemner, Ken

75

Christopher T. Rapp, Marcus S. Dersch, J. Riley Edwards 2013 Joint Rail Conference  

E-Print Network [OSTI]

of Experimentation · Testing Background ­ Laboratory Experimentation · July 2012 Field Instrumentation ­ TLV Based Tactile Surface Sensors (MBTSS) · Measure magnitude and distribution of pressure at the concrete of Concrete Crosstie Rail Seats MBTSS Testing Background · Proven feasibility for use on concrete crosstie

Barkan, Christopher P.L.

76

Christopher T. Rapp, Marcus S. Dersch, J. Riley Edwards AREMA Committee 30 Fall 2012 Meeting  

E-Print Network [OSTI]

· Chapter 30: Rail Seat Pads · Testing Background · Laboratory Experimentation: Rail Seat Pads · Field Test Objectives of Experimentation with Matrix Based Tactile Surface Sensors (MBTSS) · Measure magnitude from July 2012 Field Testing at TTC MBTSS Testing Background · Proven feasibility for use on concrete

Barkan, Christopher P.L.

77

Permeability characterization of shear zones in the Hickory sandstone member, Riley Formation, Texas  

E-Print Network [OSTI]

. The main objectives of this work are to (1) characterize the geometry and permeability of deformation elements within shear zones; (2) determine permeability anisotropy in shear zones according to fault characteristics and host lithology; and (3) develop... I INTRODUCTION .............................................................................................1 II HICKORY SHEAR ZONES AND DEFORMATION ELEMENTS..............11 2.1 Shear Zones in Hickory Sandstone Member...

Nieto Camargo, Jorge Enrique

2005-02-17T23:59:59.000Z

78

Facies Description and Interpretation of the Upper Lower Hickory Sandstone, Riley Formation, Central Texas  

E-Print Network [OSTI]

Present models suggest that fluvial and marine depositional patterns were distinct from modern patterns prior to the appearance of land plants. Although these models are likely correct, problems exist when one attempts to distinguish between fluvial...

Cook, Timothy D.

2010-01-16T23:59:59.000Z

79

Probabilistic Counter Updates for Predictor Hysteresis and Stratification Nicholas Riley Craig Zilles  

E-Print Network [OSTI]

generator--a linear feedback shift register (LFSR)--whose output determines if a given observation should, but we can classify an instruction based on its likelihood of being critical, allowing us to treat always- imate their operating point. In Section 5, we motivate the utility of such a strat

Bashir, Rashid

80

Chemical oceanography, v. 4 (J. P. Riley and G. Skirrow [eds.] )  

Science Journals Connector (OSTI)

substandard. Half the chapter is about desalination. (primarily distillation) and seems to have been made of little sections cut from various government reports.

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Economic Development and the Structure of the Demand for Commercial Energy Ruth A. Judson, Richard Schmalensee and Thomas M. Stoker*  

E-Print Network [OSTI]

development and energy demand, this study estimates the Engel curves that relate per-capita energy consumption in major economic sectors to per- capita GDP. Panel data covering up to 123 nations are employedEconomic Development and the Structure of the Demand for Commercial Energy Ruth A. Judson, Richard

82

Serine 192 in the tiny RS repeat of the adenoviral L4-33K splicing enhancer protein is essential for function and reorganization of the protein to the periphery of viral replication centers  

SciTech Connect (OSTI)

The adenovirus L4-33K protein is a key regulator involved in the temporal shift from early to late pattern of mRNA expression from the adenovirus major late transcription unit. L4-33K is a virus-encoded alternative splicing factor, which enhances processing of 3 Prime splice sites with a weak sequence context. Here we show that L4-33K expressed from a plasmid is localized at the nuclear margin of uninfected cells. During an infection L4-33K is relocalized to the periphery of E2A-72K containing viral replication centers. We also show that serine 192 in the tiny RS repeat of the conserved carboxy-terminus of L4-33K, which is critical for the splicing enhancer function of L4-33K, is necessary for the nuclear localization and redistribution of the protein to viral replication sites. Collectively, our results show a good correlation between the activity of L4-33K as a splicing enhancer protein and its localization to the periphery of viral replication centers.

Oestberg, Sara, E-mail: sara.ostberg@imbim.uu.se [Department of Medical Biochemistry and Microbiology, Science for Life Laboratory, Uppsala University, 75123 Uppsala (Sweden)] [Department of Medical Biochemistry and Microbiology, Science for Life Laboratory, Uppsala University, 75123 Uppsala (Sweden); Toermaenen Persson, Heidi, E-mail: heidi.tormanen.persson@imbim.uu.se [Department of Medical Biochemistry and Microbiology, Science for Life Laboratory, Uppsala University, 75123 Uppsala (Sweden); Akusjaervi, Goeran, E-mail: goran.akusjarvi@imbim.uu.se [Department of Medical Biochemistry and Microbiology, Science for Life Laboratory, Uppsala University, 75123 Uppsala (Sweden)] [Department of Medical Biochemistry and Microbiology, Science for Life Laboratory, Uppsala University, 75123 Uppsala (Sweden)

2012-11-25T23:59:59.000Z

83

RS-NWPA [National Waste Policy Act]  

Broader source: Energy.gov (indexed) [DOE]

Minning (OCRWM) Minning (OCRWM) I 586-4349 Ed Nugent DOE 586-3288 6. C k K T : F I C A T E O F A G E N C Y R E P R E S E N T A T I V E r - . . REQUEST FOR RECORDS DISPOSITION AUTHORITY (See tnstructions on reverse) GENERAL SERVICES ADMINISTRATION NATIONAL ARCHIVES AND RECORDS SERVICE. WASHINGTON, DC 20408 i F ROha (AECnc? or rstcblishmcnt) a % - e ~ - - - Office of C i v i l f a n R a d i o a c t i v e Naste Mar -gement - 3 M I N O R S U B D l V l S l O N - - 6 N A M E O F P E R S O N W l T P W H O M T O C O N F E R I 5. TELEPHONE E X T . I hereby cert~fy that I am authorized to act for thls agency In ms.ter: perta~ning to the disposal of the aoency's record: that the records proposed for drsposal In this Request of ' 2 ' page(s) are not now needed for the business o f th agency or w ~ i l not be needed after ;he retention per~ods speclf~ed; and that written concurrence from the Gener:

84

RS-Weapons X-Rays  

Broader source: Energy.gov (indexed) [DOE]

and Uperating Con t and Uperating Con t r a c t o r s - - - - - ---- . --... -. - - . --- 3 . M I N O R S U B D I V I S I O N REQUEST FOR RECORDS DISPOSITION AUTHORITY (See Instructions on reverse) To. G E N E R A L SERVICES A D M I N I S T R A T I O N 4 A T I O N A L A R C H I V E S A N D RECORDS SERVICE, N A S H I N O T O N , D C 20408 - - ., 1. F R o b ~ A s s * r r r \ o r r r l a b ~ ~ r h r n s . ~ t l l U.S. Department of Energy 2-.M A J-i- n 3 - " d d D i \ j < I r;c - - - . - . - . -- . ts~,vu: far l r r r n s I h a t r r ~ y t x marked "d~ssos~r.or -I aoprovrd or ..v.,Ind-awn" ~n column '0 I f no r 4 are nrooosed for dispss~l. (he slgnaiure sf the Arch11 L E A V E B L A N K ,.baku,-- - - - - -- - - - D A T E R E C E I V E 0 Lr& ! - - -- NOTIFICATION T O G E ~ C Y . _ _ ._ - _----- - . - In ~ c c o r d a n c e rarllh 1ht1 provts~onr 3f 14 U S C C I I I O e,rDowl r t g u c s ' . ~ t ~ c l u d ~ n q amandrnen ts. 's aUPl

85

Structures of the magnetoionic media around the FanaroffRiley Class I radio galaxies 3C 31 and Hydra A  

Science Journals Connector (OSTI)

......range 1365-8440 MHz to explore the spatial...synchrotron-emitting plasma. We establish that...1636, 4985 and 8440 MHz - with angular resolutions...Magnetized thermal plasma along the line of...2006, Phys. Plasmas, 13, 56501. Scheuer...of the Turbulent Atmosphere on Wave Propagation......

R. A. Laing; A. H. Bridle; P. Parma; M. Murgia

2008-12-01T23:59:59.000Z

86

EECBG Success Story: Resourceful Kansas Puts Energy Efficient...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Benefits June 2, 2011 - 3:45pm Addthis One of Riley County Public Works' new wind turbines. | Courtesy of Riley County Public Works One of Riley County Public Works' new...

87

Resourceful Kansas Puts Energy Efficient Technology on Display...  

Broader source: Energy.gov (indexed) [DOE]

Benefits June 2, 2011 - 3:45pm Addthis One of Riley County Public Works' new wind turbines. | Courtesy of: Riley County Public Works One of Riley County Public Works'...

88

EECBG Success Story: Solar and Energy Efficiency Justice | Department...  

Energy Savers [EERE]

Projects Provide Energy to County Fairgrounds One of Riley County Public Works' new wind turbines. | Courtesy of Riley County Public Works EECBG Success Story: Resourceful Kansas...

89

EECBG Success Story: Milwaukee Reaps Benefits of Wind Energy...  

Energy Savers [EERE]

energy. Learn more. Addthis Related Articles One of Riley County Public Works' new wind turbines. | Courtesy of Riley County Public Works EECBG Success Story: Resourceful Kansas...

90

Microsoft Word - Goodyear_Presentation to DOE on ATVMLP.doc  

Broader source: Energy.gov (indexed) [DOE]

Brain Riley Date: October 31, 2008 U.S. Department of Energy Advanced Technology Vehicle Manufacturing Loan Program 1 GOODYEAR TIRE & RUBBER COMPANY Submitted by: Brain Riley Date:...

91

HORTICULTURAL ENTOMOLOGY Tactics for Management of Thrips (Thysanoptera: Thripidae) and  

E-Print Network [OSTI]

Spotted Wilt Virus in Tomato D. G. RILEY1 AND H. R. PAPPU2 J. Econ. Entomol. 97(5): 1648Ð1658 (2004 fusca (Hinds) (Salguero Navas et al. 1991, Riley and Pappu 2000). Tobacco thrips have been found (Riley and Pappu 2000, Riley 2001b). Some of the primary control tactics available in tomato include

Pappu, Hanu R.

92

RS_Water_and_CCS_Pittsburgh_2012_final-1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spatially---Explicit Spatially---Explicit Impacts of Carbon Capture and on W ater S upply a nd D emand Roger Sathre, Hanna Breunig, Peter Larsen, Eric Masanet, Thomas McKone, Nigel Quinn, Corinne Scown Environmental E nergy T echnologies D ivision Lawrence B erkeley N ational L aboratory Berkeley, C A 9 4720 June 2 012 Disclaimer This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor the Regents of the University of California, nor any of their employees, makes any warranty, express or implied, or assumes any legal responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process

93

(1) tRNA aaRS Woods ( ) Baeck  

E-Print Network [OSTI]

, Nemoto,N., Husimi,Y., Nishigaki,K., Construction of block shuffled libraries of DNA for evolutionary T., Ota M., Husimi Y., An in silico exploration of neutral network in protein sequence space, J.Theor.Biol. 221, in press (2003) (9) Aita T., Husimi Y., Statistical Formulae for Energy Distribution among

Hagiya, Masami

94

(1) tRNA aaRS Woods ( ) Baeck  

E-Print Network [OSTI]

,K., Kinoshita Y., Narasaki, Nemoto,N., Husimi,Y., Nishigaki,K., Construction of block shuffled libraries of DNA)Aita T., Ota M., Husimi Y., An in silico exploration of neutral network in protein sequence space, J.Theor.Biol. 221, in press (2003) (15)Aita T., Husimi Y., Statistical Formulae for Energy Distribution among

Hagiya, Masami

95

COSMO-RS: From Quantum Chemistry to Fluid Phase Thermodynamics...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Computing, Environment, and Life SciencesMaterials Science Seminar Start Date: Nov 12 2014 - 3:00pm BuildingRoom: Building 200Room J183 Location: Argonne National Laboratory...

96

The Combined NVSSFIRST Galaxies (CoNFIG) sample II. Comparison of space densities in the FanaroffRiley dichotomy  

Science Journals Connector (OSTI)

......facility of the National Science Foundation operated under...Institutions, the National Science Foundation, the US Department...Society and the Higher Education Funding Council for England...Administration and the National Science Foundation. REFERENCES...ODea C., eds, Poster Papers from the Space......

M. A. Gendre; P. N. Best; J. V. Wall

2010-06-01T23:59:59.000Z

97

Proof of concept testing of an integrated dry injection system for SO{sub 2}/NO{sub x} control. Final report  

SciTech Connect (OSTI)

The integrated Dry Injection Process (IDIP) consists of combustion modification using low NO{sub x} burners to reduce NO{sub x} emissions, dry injection of hydrated line at economizer temperatures for primary capture of SO{sub 2}, dry injection of a commercial grade sodium bicarbonate at the air heater exit for additional SO{sub 2} and NO{sub x} removal, and humidification for precipitator conditioning. IDIP offers the potential for simultaneously achieving 90% SO{sub 2} removal, and 65% NO{sub x} removal from a high sulfur flue gas. The process is well suited for new or retrofit applications since it can be incorporated within existing economizer and downstream ductwork. Subscale tests were performed in order to identify the best calcium and sodium sorbents. These tests involved the injection of calcium hydroxide and sodium sorbents at various points of the flue gas system downstream of a 0.25 MM BTU/hr. coal fired combustor, and the gas residence times, cooling rates and temperatures were comparable to those found for full-scale utility boilers. These tests verified that a high surface area hydrated lime provides maximum sorbent utilization and identified an alcohol-water hydrated lime as yielding the highest surface area and the best SO{sub 2} removal capability. The tests also identified sodium bicarbonate to be somewhat more effective than sodium sesquicarbonate for SO{sub 2} removal. The proof of concept demonstration was conducted on the large combustor at the Riley Stoker Research Facility in Worcester, MA. When economically compared to conventional limestone slurry scrubbing on a 300 MW plant, the dry injection process shows lower capital cost but higher operating cost. Hydrated lime injection can be less costly than limestone scrubbing when two or more of the following conditions exist: plant is small (less than 100MW); yearly operating hours are small (less than 3000); and the remaining plant lifetime is small (less than 10 years).

Helfritch, D.J.; Bortz, S.J. [Research-Cottrell, Inc., Somerville, NJ (United States); Beittel, R. [Riley Stoker Corp., Worcester, MA (United States)

1994-03-01T23:59:59.000Z

98

Study of utility boilers for a coal-water-slurry demonstration test. Final report. [Selection of oil-fired boiler design for testing; CWS  

SciTech Connect (OSTI)

Commercialization of coal-water slurry (CWS) is within reach, but utilities still require evidence that they can fire CWS in full-scale boilers over the long term. This study lays the groundwork for a one-year CWS demonstration, outlining a test program and calculating retrofit and operating costs for seven typical oil-fired boilers. This report summarizes the work performed by Burns and Roe, Inc., with assistance from Combustion Engineering, Inc., Babcock and Wilcox Co., Foster Wheeler Corp., and Riley Stoker Corp., to assess the extent, performance effects, and costs of utility power plant modifications for a one-year CWS demonstration test. Eighteen utilities participated in this study. They offered 42 boilers ranging in size from 40 to 850 MW. The study was performed in two phases. In the first phase all boilers were preliminarily analyzed to determine the required derating for CWS firing. Seven case study units representative of the population of oil-design boilers were selected for detailed analysis in the second phase. For the seven case study units boilers performance analyses were conducted using common ground rules agreed to by the four major utility boiler manufacturers. Conceptual design for balance of plant systems were developed and the costs for plant modifications were estimated. An outline test plan and schedule was developed to identify test and fuel requirements. The total costs for conducting a one-year CWS utility boiler test at each of the seven case study units was calculated. Although specific boilers were used for the detailed cases studies, the study was directed to providing information in a generally applicable form that can be applied by all study participants or potential utility users. 62 tabs., 63 figs.

Kemeny, P.; Fontana, G.; Lagomarsino, J.; Pinson, M.

1986-03-01T23:59:59.000Z

99

Technical and economic analysis: Gas cofiring in industrial boilers. Final report, November 1995-September 1996  

SciTech Connect (OSTI)

This report presents an analysis of the technical and marketing issues associated with the deployment of natural gas cofiring technology in stoker boilers. As part of the work effort, a composite database of stoker boilers was developed using state and federal emission inventories over the years 1985 - 1995. Information sources included the most recent AIRS Facility Subsystem database, the Ozone Transport Region 1990 database, the 1990 Ohio Permit database and the 1985 NAPAP database--all are electronic databases of facilities with air emission permits. The initial data set included almost 3,000 stokers at about 1,500 locations. Stoker facilities were contacted to verify the operating status, capacity, fuel capability, efficiency and other stoker-specific data. The report presents the current stoker boiler distribution by SIC, industrial groups, primary solid fuel (coal, wood, waste, refuse), operating status, and state. Maps are included.

Potter, F.J.

1996-09-01T23:59:59.000Z

100

Primary productivity of the northwest Gulf of Mexico: shipboard measurements in July 1990, October 1990, and March 1991  

E-Print Network [OSTI]

stimulated the regional biological pmduction was Gordon Riley, who participated in a 1936 expedition to the area on board the research vessel Atlantis (Riley, 1937). Emphasis was placed on surveying phosphorus loads near the river delta, for phosphorus...

Sanchez, Luis Lionel

1992-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

4. OpenFst: An Open-Source, Weighted Finite-State Transducer Library and its Applications to Speech and Language  

E-Print Network [OSTI]

and Language Michael Riley, Cyril Allauzen, and Martin Jansche, Google Inc. Finite-state methods are well

Tomkins, Andrew

102

E-Print Network 3.0 - automatic wood furnaces Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

bagasse. 3. The total cost of the boiler island including stoker, furnace, boiler, economizer... , feeders and bins for handling bark and wood, while experience in dealing with...

103

Use of ValRS-IleRS interparalog distance for the analysis of the phylogenetic relationships between methanopyrus isolates from the atlantic, pacific and indian oceans.  

E-Print Network [OSTI]

??The origin of life is a long-standing mystery which has puzzled many people. This mystery possesses not only philosophical, but also important biological significance. In (more)

Yu, Zhiliang

2007-01-01T23:59:59.000Z

104

MATH 590: Meshfree Methods Chapter 1: Introduction, Scattered Data Interpolation in Rs and  

E-Print Network [OSTI]

590 ­ Chapter 1 8 #12;Introduction Energy renewable energy sector study of single wind turbines data modeling, e.g., fitting of potential energy surfaces in chemistry solution of partial differential.g., image warping statistical learning theory, neural networks and data mining, e.g., kernel approximation

Fasshauer, Greg

105

NimbRo RS: A Low-Cost Autonomous Humanoid Robot for Multi-Agent Research  

E-Print Network [OSTI]

of ideas fosters the development of multi-agent robotic systems. Hence, robotic soccer can be considered. There are two leagues for wheeled robots, and a league for four-legged robots. In these leagues prob- lems, such as self-localization and ball manipulation are investigated. Since 2002 competitions are also hold

Behnke, Sven

106

Role of ?6 nAChRs in Ethanol Modulation of VTA Neurons.  

E-Print Network [OSTI]

??The prevailing view is that enhancement of dopamine (DA) transmission in the mesolimbic system leads to the rewarding properties of alcohol and nicotine (NIC). The (more)

Shin, Samuel Injae

2014-01-01T23:59:59.000Z

107

Role of ?6 nAChRs in Ethanol Modulation of VTA Neurons.  

E-Print Network [OSTI]

?? The prevailing view is that enhancement of dopamine (DA) transmission in the mesolimbic system leads to the rewarding properties of alcohol and nicotine (NIC). (more)

Shin, Samuel Injae

2014-01-01T23:59:59.000Z

108

The Capacity of Matched RS Codes is Zero Over the AWGN Channel  

E-Print Network [OSTI]

, which leads to a -dimensional vector (or signal point) constellation S, i.e. f : A S = {s1, . . . , sq} IR , (1) sl = (sl,1, . . . , sl,); sl,µ IR, l = 1, . . . , q; µ = 1, . . . , . The energy signal points sl and sj is dE(sl, sj) = µ=1 (sl,µ - sj,µ)2. A vector constellation S is characterized

Zerfowski, Detlef

109

Remote Sens. 2014, 6, 2898-2911; doi:10.3390/rs6042898 remote sensing  

E-Print Network [OSTI]

Measurements of ocean wind vectors serve as a basis for marine weather forecasting and offshore wind farms distribution of offshore wind vectors. Representative long-term offshore meteorological time series with high.mdpi.com/journal/remotesensing Article Reconstructed Wind Fields from Multi-Satellite Observations Ruohan Tang 1,2,3, *, Deyou Liu 1

deYoung, Brad

110

As Percepes E Experincias Com A Corrupo No Setor De Obra Rodovirias Do Estado Do RS  

E-Print Network [OSTI]

8.666 de 21 junho de 1993. MAURO , Paolo. Essays on CountryChapter 1, november, 1993. MAURO , Paolo. Corruption anddestes servios, pois cada Mauro (1993) separou a corrupo

Balbinotto Neto, Giacomo; Letizia Garcia, Ricardo

2006-01-01T23:59:59.000Z

111

LeuRS Synthetase: A First-Principles Investigation of the Water-Mediated Editing Reaction  

Science Journals Connector (OSTI)

Mauro Boero * ... Boero, Mauro; Ikeda, Takashi; Ito, Etsuro; Terakura, Kiyoyuki ... Gervasio, Francesco Luigi; Boero, Mauro; Parrinello, Michele ...

Mauro Boero

2011-09-17T23:59:59.000Z

112

GEOPHYSICS & GEODYNAMICS D. McKenzie, J.A. Jackson, R.S. White, A. Deuss,  

E-Print Network [OSTI]

models based on land-, marine- and space-based observations. Theoretical and geophysical analyses. The COMET project on modelling and observation of earthquakes and tectonics has developed further our strong to regional investigations of large continental areas. This effort is coordinated within the COMET group (http://comet

Cambridge, University of

113

Evaluation of Air Pollution Trend Using GIS and RS Applications in South West of Iran  

Science Journals Connector (OSTI)

Air pollution is a matter of concern at all ... The worldwide epidemiological study on the effect of air pollution had revealed that gaseous pollutants and particulate...2013). Air pollution reported by World Hea...

Mostafa Moradi Dashtpagerdi

2014-03-01T23:59:59.000Z

114

35095,"AGWAY PETRO CORP",1,231,"PROPANE/NGL",0712,"CHAMPL-RS...  

U.S. Energy Information Administration (EIA) Indexed Site

REFG CO",1,850,"UNFINISHED OILS, RESIDUUM",1003,"NEWARK, NJ","NEW JERSEY",1,428,"GERMANY",345,0,20.6,"BAYWAY REFG CO","BAYWAY","NJ","NEW JERSEY",1 35095,"BAYWAY REFG...

115

34730,"AGWAY PETRO CORP",1,231,"PROPANE/NGL",0712,"CHAMPL-RS...  

U.S. Energy Information Administration (EIA) Indexed Site

NY INC",1,461,"DISTILLATE, < 0.05% SUL (DOMESTIC)",1001,"NEW YORK, NY","NEW YORK",1,,"GERMANY, FD (W)",130,0,0,,,,, 34730,"BEAR STEARNS NY INC",2,461,"DISTILLATE, < 0.05% SUL...

116

Ti rs bevillinger til et Ingenir-videnskabeligt Center for materiale-  

E-Print Network [OSTI]

samarbejde med LM Glasfiber er blevet løftet til et nyt niveau, se artiklen side 10). Endelig har arbejde i

117

Changes in carbon sink value based on RS and GIS in the Heidaigou opencast coal mine  

Science Journals Connector (OSTI)

The determination of carbon sink value is primarily confined to forest and farmland carbon sinks. Wang and Feng (2000) analyzed Chinas ecosystem carbon storage, Zhou et al. (2000) estimated Chinas forest ecosys...

Jinman Wang; Zezhen Jiao; Zhongke Bai

2014-01-01T23:59:59.000Z

118

(1) tRNA aaRS 5' DNA mRNA 3'  

E-Print Network [OSTI]

in an Evolution Reactor, II, Bulletin of Mathematical Biology, 67(3), 613-661 (2005) (9) Hamamatsu N., Aita T. Skantzos and Y. Kabashima, Security and Reliability of LDPC Based Public-Key Cryptosystems, Prog of the tryptophan synthase alpha-subunit from Thermus thermophilus HB8: X-ray crystallographic analysis

Hagiya, Masami

119

Remote Sens. 2014, 6, 4190-4216; doi:10.3390/rs6054190 remote sensing  

E-Print Network [OSTI]

Brockmann Consult, Max-Planck-Str. 2, 21502 Geesthacht, Germany; E-Mails: tom.block@brockmann-consult.de (T

Myneni, Ranga B.

120

Dry Bias in Vaisala RS90 Radiosonde Humidity Profiles over Antarctica PENNY M. ROWE  

E-Print Network [OSTI]

measurements made by radio- sondes. Some radiosonde humidity sensors experience a dry bias caused by solar were launched in clear skies at solar zenith angles (SZAs) near 83° and 62°. As part of this field) for SZAs near 83°; they are 20% 6% and 24% 5% for SZAs near 62°. Assuming solar heating is minimal at SZAs

Walden, Von P.

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Remote Sens. 2011, 3, 343-361; doi:10.3390/rs3020343 Remote Sensing  

E-Print Network [OSTI]

; solar irradiance; solar exposure; climate; Africa; Europe; Atlantic Ocean; remote sensing; long.mdpi.com/journal/remotesensing Article The HelioClim Project: Surface Solar Irradiance Data for Climate Applications Philippe Blanc, Benoît Gschwind, Mireille Lefèvre and Lucien Wald * Center for Energy and Processes, MINES ParisTech, BP

Paris-Sud XI, Université de

122

2005 Peered Reviewed Archival Publications Ahluwalia, R.S. and S. Govindarajulu*  

E-Print Network [OSTI]

-384. (MAE) Barth, K.E., D.W. White, J.E. Righman, and L. Yang. 2005. Evaluation of web compactness limits

Mohaghegh, Shahab

123

Remote Sens. 2013, 5, 5662-5679; doi:10.3390/rs5115662 Remote Sensing  

E-Print Network [OSTI]

.Weishampel@ucf.edu 5 University Corporation for Atmospheric Research, P.O. Box 3000, Boulder, CO 80307, USA; E such as harmonic resynthesis and water level time series analysis. Based on the flooded/non-flooded coastal areas

Weishampel, John F.

124

Microsoft Word - Chenoweth-Substation-3G-RS-CX.doc  

Broader source: Energy.gov (indexed) [DOE]

4, 2010 4, 2010 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Creig Millen Project Manager - TEC-CSB-1 Proposed Action: Chenoweth Substation 3G Radio Station Project Budget Information: Work Order 00197213, Task 03 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.19 Siting, construction, and operation of microwave and radio communication towers and associated facilities... Location: Wasco County, Oregon (T2N, R13E, Sections 21and 28) Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to construct a 120-foot radio tower and antenna system at BPA's Chenoweth Substation in Wasco County, Oregon. The new tower will require a 20 x 20 foot expansion of the existing substation yard and will replace an existing 50-foot monopole

125

Subjects: Trematoda and Trematode Diseases, Part 7: Supergenera and Genera R-S  

E-Print Network [OSTI]

,D.O. , 1927c, 101.?Price, E. W. , 1940c, 7 (Ratziinae, Opisthorchii- dae).--Travassos, L. P.,1928c,312.-- Skrjabin, K. I. ; & Petrov.A.M., 1950?, 312. species Brumpt, E., 1936c, 560, fig. 284 (Discoglossus pictus). dollfusi B?ttner, A. , 1951c, 144...- guis). ?Baer, J. G., 193 lc, 338; 1932b, 27, 28,fig. 15.?Bittner.H. ;& Sprehn, C.E. W. , 1928a, 2. --Dollfus, R. P. F. , 1939b, 224,225,226,227,23l;1946g, 25,26,51.- Fuhrmann, O. , 1928b, 119.--Leonov, V. A. , [1959a], 203 (key). --Luehe, M. F. L...

Farr, Marion M.; Breen, Virginia L.; Doss, Mildred A.; Roach, Katharine F.

1968-01-01T23:59:59.000Z

126

Zea mays iRS1563: A Comprehensive Genome-Scale Metabolic Reconstruction of Maize Metabolism  

E-Print Network [OSTI]

States Department of Energy (DOE) Grant DE-FG02-05ER25684. The funders had no role in study design, data, commonly known as maize or corn, is a plant organism of paramount importance as a food crop, biofuel]. Maize cultivation led to 12 billion bushels of grain in the USA alone in 2008 worth $47 billion [3

Maranas, Costas

127

E-Print Network 3.0 - aversive therapy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Page: << < 1 2 3 4 5 > >> 1 Anthony L. Riley Personal Information Summary: of Psychology Alcohol Aversion Therapy Augusta, Georgia 1979 Consultant Battelle Research...

128

Klamath and Lake Counties Agricultural Industrial Park  

Broader source: Energy.gov (indexed) [DOE]

Park Betty Riley South Central Oregon Economic Development District Engineered Geothermal Systems Demonstration Projects May 19, 2010 This presentation does not contain any...

129

EV Everywhere Framing Workshop Report Out & Lessons Learned  

Broader source: Energy.gov (indexed) [DOE]

Opportunities * Moderator: John McElroy * Dennis Beal, FedEx * Andrew Brown, Delphi Automotive * Robbie Diamond, The Electrification Coalition * Bart Riley, A123 Systems *...

130

Download  

Science Journals Connector (OSTI)

ductivity of seawater has led to fast, cheap, and precise methods of determining this property. Accordingly, Cox, Culkin, and. Riley ( 1967) determined the...

2000-02-12T23:59:59.000Z

131

E-Print Network 3.0 - abnormal joint torque Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

be employed in future. This will also allow calculation of joint torques in the hip and ankle... . Riley and D. C. Kerrigan, "Torque action of ... Source: Northwestern University,...

132

PREPARATION OF ARTIFICIAL SEAWATER  

Science Journals Connector (OSTI)

Handbook of chem- tion of seawater. J. Marine Res., 3: 134-146. istry and physics, 46th edition. Chemical. RILEY, J. P., AND G. SKIRROW. 1965. Chemical

2000-01-08T23:59:59.000Z

133

Energy Secretary Bodman Tours Alabama Red Cross Facility and...  

Broader source: Energy.gov (indexed) [DOE]

Remembrance Service with Governor Riley September 16, 2005 - 10:24am Addthis MONTGOMERY, AL - Today, Secretary of Energy Samuel W. Bodman traveled to Montgomery, Alabama, to...

134

Download  

Science Journals Connector (OSTI)

veston, Texas 77553. various trace metals. In addition, Riley. ( 1965) found ... goon) on Galveston Island. Each salt- water sample (22.5 liters) was clarified by.

1999-12-26T23:59:59.000Z

135

Sandia National Laboratories: PV Publications  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2014 Papers and Presentations J.E. Quiroz, S. Gonzalez, B. King, D. Riley, J. Johnson, J. Stein, Photovoltaic Microinverter Testbed for Multiple Device Interoperability,...

136

Paleogeographic Setting  

Office of Scientific and Technical Information (OSTI)

Period End Date: September 30, 2005 Principal Authors: Douglas G. Patchen, Taury Smith, Ron Riley, Mark Baranoski, David Harris, John Hickman, John Bocan and Michael Hohn...

137

E-Print Network 3.0 - agn dusty tori Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Galaxies Summary: Croston (U. Herts) 12;Contents Brief review of AGN physics & phenomenology Nuclear X-ray emission... -Riley dichotomy? 12;The Central Engine Accretion...

138

Partners of the MFRC | The Ames Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Police Lawrence Police Department Riley County Police Department Sedgwick Regional Forensic Science Center Kentucky Michigan Oakland County Sheriff's Department Wyoming Police...

139

BARRIER ISSUES TO THE UTILIZATION OF BIOMASS  

SciTech Connect (OSTI)

In summary, stoker-fired boilers that cofire or switch to biomass fuel may potentially have to deal with ash behavior issues such as production of different concentrations and quantities of fine particulate or aerosols and ash-fouling deposition. Stoker boiler operators that are considering switching to biomass and adding potential infrastructure to accommodate the switch may also at the same time be looking into upgrades that will allow for generating additional power for sale on the grid. This is the case for the feasibility study being done currently for a small (<1-MW) stoker facility at the North Dakota State Penitentiary, which is considering not only the incorporation of a lower-cost biomass fuel but also a refurbishing of the stoker boiler to burn slightly hotter with the ability to generate more power and sell excess energy on the grid. These types of fuel and boiler changes can greatly affect ash behavior issues.

Greg F. Weber; Christopher J. Zygarlicke

2001-05-01T23:59:59.000Z

140

Chronic disability trends in elderly United States populations:?19821994  

Science Journals Connector (OSTI)

...antiinflammatory drugs may also reduce the risk of Alzheimers disease...The Annals of the American Academy of Political and Social Science , eds Riley M Riley...69 Board of Trustees, Federal Hospital Insurance Trust Fund ( 1996 ) 1996 Annual Report...

Kenneth G. Manton; Larry Corder; Eric Stallard

1997-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

RESISTANT STARCH FROM NOVEL RS-CONTAINING PREPARATIONS: RESIDUAL SUSCEPTIBILITY TO AMYLOLYSIS AND GROWTH OF BIFIDOBACTERIUM STRAINS.  

E-Print Network [OSTI]

??Starches differ with respect to both digestion rate and digestion extent in the small intestine. The portion of starch not hydrolyzed by pancreatic ?-amylase and (more)

Saibene, Debora

2010-01-01T23:59:59.000Z

142

DETECTION OF ALUMINUM WASTE REACTIONS AND WASTE FIRES Jeffrey W. Martin, M.S., P.G., R.S.  

E-Print Network [OSTI]

-review and possible publication in the ASCE Journal of Hazardous, Toxic, and Radioactive Waste October 24, 2011 #12;[i combustion of the surrounding solid waste. The landfill liner and explosive gas extraction and leachate

143

Anti-phase signature of flare generated transverse loop oscillations R.S. White, E. Verwichte & C. Foullon  

E-Print Network [OSTI]

are analysed by constructing space-time diagrams from cuts made parallel to the projected loop displacements: Magnetohydrodynamics (MHD) - Sun: corona - Sun: oscillations - Sun: UV radiation - Sun: flares 1. INTRODUCTION

144

. SMP IBM RS6000 PowerPC 604e High Node 8 , SPEC95FP 103.su2cor,  

E-Print Network [OSTI]

-grain parallel processing, it is necessary to as- sign the appropriate number of processors, according95FP. 1. , , , , OSCAR 1),2) . , 3) (MTG) . y Dept. of Electrical, Electronics and Computer Engineer://www.apc.waseda.ac.jp/ , , , MTG MTG , . , MTG , . , , , . , , (IPA) . SUIF , 4) , , . , OSCAR 1 #12;5) . , , , . , , , . 2

Kasahara, Hironori

145

The moyamoya disease susceptibility variant RNF213 R4810K (rs112735431) induces genomic instability by mitotic abnormality  

SciTech Connect (OSTI)

Highlights: Overexpression of RNF213 R4810K inhibited cell proliferation. Overexpression of RNF213 R4810K had the time of mitosis 4-fold and mitotic failure. R4810K formed a complex with MAD2 more readily than wild-type. iPSECs from the MMD patients had elevated mitotic failure compared from the control. RNF213 R4810K induced mitotic abnormality and increased risk of aneuploidy. -- Abstract: Moyamoya disease (MMD) is a cerebrovascular disease characterized by occlusive lesions in the Circle of Willis. The RNF213 R4810K polymorphism increases susceptibility to MMD. In the present study, we characterized phenotypes caused by overexpression of RNF213 wild type and R4810K variant in the cell cycle to investigate the mechanism of proliferation inhibition. Overexpression of RNF213 R4810K in HeLa cells inhibited cell proliferation and extended the time of mitosis 4-fold. Ablation of spindle checkpoint by depletion of mitotic arrest deficiency 2 (MAD2) did not shorten the time of mitosis. Mitotic morphology in HeLa cells revealed that MAD2 colocalized with RNF213 R4810K. Immunoprecipitation revealed an RNF213/MAD2 complex: R4810K formed a complex with MAD2 more readily than RNF213 wild-type. Desynchronized localization of MAD2 was observed more frequently during mitosis in fibroblasts from patients (n = 3, 61.0 8.2%) compared with wild-type subjects (n = 6, 13.1 7.7%; p < 0.01). Aneuploidy was observed more frequently in fibroblasts (p < 0.01) and induced pluripotent stem cells (iPSCs) (p < 0.03) from patients than from wild-type subjects. Vascular endothelial cells differentiated from iPSCs (iPSECs) of patients and an unaffected carrier had a longer time from prometaphase to metaphase than those from controls (p < 0.05). iPSECs from the patients and unaffected carrier had significantly increased mitotic failure rates compared with controls (p < 0.05). Thus, RNF213 R4810K induced mitotic abnormalities and increased risk of genomic instability.

Hitomi, Toshiaki [Department of Health and Environmental Sciences, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Health and Environmental Sciences, Graduate School of Medicine, Kyoto University, Kyoto (Japan); Habu, Toshiyuki [Radiation Biology Center, Kyoto University, Kyoto (Japan)] [Radiation Biology Center, Kyoto University, Kyoto (Japan); Kobayashi, Hatasu; Okuda, Hiroko; Harada, Kouji H. [Department of Health and Environmental Sciences, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Health and Environmental Sciences, Graduate School of Medicine, Kyoto University, Kyoto (Japan); Osafune, Kenji [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan)] [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan); Taura, Daisuke; Sone, Masakatsu [Department of Medicine and Clinical Science, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Medicine and Clinical Science, Graduate School of Medicine, Kyoto University, Kyoto (Japan); Asaka, Isao; Ameku, Tomonaga; Watanabe, Akira; Kasahara, Tomoko; Sudo, Tomomi; Shiota, Fumihiko [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan)] [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan); Hashikata, Hirokuni; Takagi, Yasushi [Department of Neurosurgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Neurosurgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan); Morito, Daisuke [Faculty of Life Sciences, Kyoto Sangyo University, Kyoto (Japan)] [Faculty of Life Sciences, Kyoto Sangyo University, Kyoto (Japan); Miyamoto, Susumu [Department of Neurosurgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Neurosurgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan); Nakao, Kazuwa [Department of Medicine and Clinical Science, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Medicine and Clinical Science, Graduate School of Medicine, Kyoto University, Kyoto (Japan); Koizumi, Akio, E-mail: koizumi.akio.5v@kyoto-u.ac.jp [Department of Health and Environmental Sciences, Graduate School of Medicine, Kyoto University, Kyoto (Japan)] [Department of Health and Environmental Sciences, Graduate School of Medicine, Kyoto University, Kyoto (Japan)

2013-10-04T23:59:59.000Z

146

Resourceful Kansas Puts Energy Efficient Technology on Display,  

Broader source: Energy.gov (indexed) [DOE]

Resourceful Kansas Puts Energy Efficient Technology on Display, Resourceful Kansas Puts Energy Efficient Technology on Display, Demonstrates Cost-Saving Benefits Resourceful Kansas Puts Energy Efficient Technology on Display, Demonstrates Cost-Saving Benefits June 2, 2011 - 3:45pm Addthis One of Riley County Public Works' new wind turbines. | Courtesy of: Riley County Public Works One of Riley County Public Works' new wind turbines. | Courtesy of: Riley County Public Works Lindsey Geisler Lindsey Geisler Public Affairs Specialist, Office of Public Affairs It turns out there's more to harvest in Kansas than just the wheat and soybeans. As one of the windiest states in the country, it's a great place to harness wind and solar power. And through the Department of Energy's Energy Efficiency and Conservation Block Grant program, the

147

Resourceful Kansas Puts Energy Efficient Technology on Display,  

Broader source: Energy.gov (indexed) [DOE]

Resourceful Kansas Puts Energy Efficient Technology on Display, Resourceful Kansas Puts Energy Efficient Technology on Display, Demonstrates Cost-Saving Benefits Resourceful Kansas Puts Energy Efficient Technology on Display, Demonstrates Cost-Saving Benefits June 2, 2011 - 3:45pm Addthis One of Riley County Public Works' new wind turbines. | Courtesy of: Riley County Public Works One of Riley County Public Works' new wind turbines. | Courtesy of: Riley County Public Works Lindsey Geisler Lindsey Geisler Public Affairs Specialist, Office of Public Affairs It turns out there's more to harvest in Kansas than just the wheat and soybeans. As one of the windiest states in the country, it's a great place to harness wind and solar power. And through the Department of Energy's Energy Efficiency and Conservation Block Grant program, the

148

Impact of puberty on the evolution of cerebral perfusion during adolescence  

Science Journals Connector (OSTI)

...Jeff Valdez, Raphael Gerraty, Marisa Riley, Jack Keefe, Nick DeLeo, Elliott Yodh, and Rosetta...relying on a T1 model. Another aspect of this approach that merits further consideration is the reliability of using a venous blood...

Theodore D. Satterthwaite; Russell T. Shinohara; Daniel H. Wolf; Ryan D. Hopson; Mark A. Elliott; Simon N. Vandekar; Kosha Ruparel; Monica E. Calkins; David R. Roalf; Efstathios D. Gennatas; Chad Jackson; Guray Erus; Karthik Prabhakaran; Christos Davatzikos; John A. Detre; Hakon Hakonarson; Ruben C. Gur; Raquel E. Gur

2014-01-01T23:59:59.000Z

149

Advisory Board Seats New Student Representatives | Department...  

Office of Environmental Management (EM)

15, 2013 - 12:00pm Addthis The Oak Ridge Site Specific Advisory Board (ORSSAB) welcomed two new student representatives at its May meeting. Gracie Hall and Julia Riley will serve...

150

Argonne Physics Division - ATLAS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

States Naval Academy hartley@usna.edu Mark Riley Florida State University mriley@physics.fsu.edu Alan Wuosmaa (chair) University of Connecticut alan.wuosmaa@uconn.edu The...

151

radiological | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Na8(AlSiO4)6I2, were observed in the 24000 ppm specimen and were verified with micro-XRD and wavelength dispersive spectroscopy. Citation: Riley BJ, MJ Schweiger, DS Kim,...

152

HHaass EEccoocceennttrriissmm AAllrreeaaddyy WWoonn iinn FFrraannccee?? SSoofftt CCoonnsseennssuuss OOnn tthhee EEnnvviirroonnmmeennttaalliisstt GGrraanndd NNaarrrraattiivvee  

E-Print Network [OSTI]

. In the beginnings of the modernity, humanistic and progressive thinking had promoted humankind as central subject the socialist story. Notwithstanding this humanist hegemony, at the end of the seventies, Riley Dunlap and his

Paris-Sud XI, Université de

153

Microsoft Word - Goodyear_Comments on ATVMLP.doc  

Broader source: Energy.gov (indexed) [DOE]

if there is an opportunity under the Regulations to do so simultaneously. GOODYEAR TIRE & RUBBER COMPANY Submitted by: Brian Riley Date: October 31, 2008 U.S. Department of Energy...

154

UNIVERSITY OF SUSSEX SUSS-EX CLUB Steering Group Meeting no.3  

E-Print Network [OSTI]

Christmas Party It was reported that Greg Riley has agreed to make a £500 budget available for the Christmas A list of possibilities for next term will be suggested in the newsletter, and plans made in the light

Sussex, University of

155

Leadership Funding Victoria e. and robert e. Zoellner '54  

E-Print Network [OSTI]

& Maxillofacial Surgery Lehigh Valley Health Network Lehigh Valley Style ichiko M. and Joseph W. Long '88. and Michael J. perrucci '03p The Promenade Shops at Saucon Valley RCN elizabeth g. riley and daniel e. smith

Napier, Terrence

156

Numerical Simulation of Sediment Particles Released at the Edge of the Viscous Sublayer in Steady and Oscillating  

E-Print Network [OSTI]

a flat bed. We used LES to generate the velocity field, while the motion of individual particles was calculated using a modified version of the Maxey and Riley equation. We considered three kinds of flows

Scotti, Alberto

157

The Effects of Behavioral Monitoring Programs on Reading Acquisition of Elementary Students with or At-Risk for Emotional or Behavioral Disorder  

E-Print Network [OSTI]

). The behavioral performance is then recorded at regular and consistent frequencies. The data is compiled and graphed to be used to assess progress and adjust feedback and reinforcement systems. (Riley- Tillman, Chafouleas, & Briesch, 2007). Many applications... the effectiveness of many methods of behavior assessment such as behavior rating scales, permanent products and systematic direct observation (Riley- Tillman, Chafouleas, & Briesch, 2007). Often these methods are unused by practitioners since implementation...

Morgan, Stacy W.

2010-07-14T23:59:59.000Z

158

Effectiveness and Acceptability of a Behavior Monitoring Program for Secondary Students At-risk for Emotional and Behavioral Disorders  

E-Print Network [OSTI]

can decrease disruptive behaviors in schools. In investigating the reliability of daily behavior ratings Chafouleas, Christ, Riley- Tillman, Briesch, and Chanese (2007) found that daily behavior ratings are likely to approximate or exceed..., perception of the intervention?s overall benefit to child, and ratings of the intervention?s ability to handle problems fell in the slightly agree to agree range as well. In a more recent study, Riley-Tillman, Chafouleas, Briesch, and Eckert (2008...

White, Jillian R.

2011-02-22T23:59:59.000Z

159

~24 B:urze Originalmitteilungen Die Natur-wissenschaflen  

E-Print Network [OSTI]

[.CHAKRABARTY and ]3. K. iVh:K- HERJI: Naturwiss. 42, 344 (1955). e) HILDITCH, T.P.: The Chemical Constitution of Natural fats, 3rd edit. London: Chapman & Hall 1956. -- HILBITCH, T.P.,, R.A. MORTONand J.P. RILEY: Analyst 70, 68 (t945). -- HILDI~eH, T.P., C.13. PATEL mad J.P. RILEY: Analyst 76, 81 (t95t). ~) BERTRAM, S

Govindjee

160

UNCORRECTEDPROOF Please cite this article in press as: R.S. Colbert, et al., Edges, clearances, and wear: Little things that make big differences in bushing  

E-Print Network [OSTI]

, and wear: Little things that make big differences in bushing friction, Wear (2009), doi:10.1016/j.wear.2009.06.030 ARTICLE IN PRESSG Model WEA 99236 1­8 Wear xxx (2009) xxx­xxx Contents lists available at ScienceDirect Wear journal homepage: www.elsevier.com/locate/wear Edges, clearances, and wear: Little things

Sawyer, Wallace

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Growth of the IB-RS-2 Pig Kidney Cell Line in Suspension Culture and Its Susceptibility to Foot-and-Mouth Disease Virus  

Science Journals Connector (OSTI)

...fectivity of seven strains of foot-and-mouth disease virus...may be useful for commercial foot-and-mouth disease vaccine...susceptibility of these cultures to foot-and-mouth disease virus...cells were selected under low-power objectives and subjected to...

W. G. Chapman; I. A. Ramshaw

1971-07-01T23:59:59.000Z

162

The Passivity and Breakdown of Beryllium in Aqueous Solutions M.A. Hill, D.P. Butt, and R.S. Lillard  

E-Print Network [OSTI]

.S. Lillard Materials Corrosion and Environmental Effects Laboratory Materials Science and Technology Division, the presence of the fluoride increased the passive current density of beryllium, but had no effect. It is an attractive engineering material for nuclear applications due to its low neutron cross section

163

DETECTION OF THE NEUPERT EFFECT IN THE CORONA OF AN RS CANUM VENATICORUM BINARY SYSTEM BY XMM-NEWTON AND THE VERY LARGE ARRAY  

E-Print Network [OSTI]

¨renlingen und Villigen, CH-5232 Villigen PSI, Switzerland; guedel@astro.phys.ethz.ch, audardth Street, New York, NY 10027; behar@astro.columbia.edu Anthony J. Beasley Owens Valley Radio during a large, long-duration flare simultaneously with XMM-Newton and the Very Large Array. The light

Audard, Marc

164

MTNR1B rs10830963 is associated with fasting plasma glucose, HbA1C and impaired beta-cell function in Chinese Hans from Shanghai  

E-Print Network [OSTI]

of the risk allele adjusting for age, sex, BMI and sleep status (where appropriate). The associations with sleep duration, siesta frequency and self-reported sleep disorder were carried out using nonparametric test (Kruskal-Wallis), ?2 test and logistic... model b, Kruskal-Wallis test c, or logistic regression model under an additive model adjusting for age, sex and BMI. Liu et al. BMC Medical Genetics 2010, 11:59 http://www.biomedcentral.com/1471-2350/11/59 Page 7 of 7 less than 35% power to detect...

Liu, Chen; Wu, Ying; Li, Huaixing; Qi, Qibin; Langenberg, Claudia; Loos, Ruth J F; Lin, Xu

2010-04-14T23:59:59.000Z

165

Thermodynamic Optimization of Finite Time Processes By R.S. Berry, V.A. Kazakov, S. Sieniutycz, Z. Szwast, and A.M. Tsirlin  

E-Print Network [OSTI]

driven by solar energy. These areas have all been significantly impacted by the ideas and methods-time thermodynamics problems including the much-needed disclaimers of exactly what the subject can and cannot do examples of finite-time thermodynamics problems that illustrate the theory as it is developed

Salamon, Peter

166

Development of Web-Based Application for Generating and Publishing Groundwater Quality Maps Using RS/GIS Technology and P. Mapper in Sattenapalle, Mandal, Guntur District, Andhra Pradesh  

Science Journals Connector (OSTI)

Groundwater is an essential source of drinking water for many Indian habitats. Large number of people consumes ground water as it is free from pathogenic bacteria and it is easily available through open well / bo...

Aswini Kumar Das; Prathapani Prakash

2014-01-01T23:59:59.000Z

167

Integrated RS, GIS and GPS approaches to archaeological prospecting in the Hexi Corridor, NW China: a case study of the royal road to ancient Dunhuang  

Science Journals Connector (OSTI)

Abstract According to historic records, the wasteland northeast of modern Dunhuang oasis contains remarkable, undiscovered monuments of medieval courier stations. In this study, statistical analysis of historic records and census data, image processing and interpretation of satellite remote sensing images, GIS analysis, and field surveys were carried out to contribute to the discovery of courier stations and the reconstruction of the medieval royal road system from Guazhou to Shazhou. Firstly, in order to obtain the existence regions of courier stations, historic records and census data were abstracted and digitized, for generating preliminary regions of interest by using GIS tools. Secondly, dried river channels and traces of the Great Wall were extracted from the remote sensing images, and GIS buffer and overlay analyses were applied to the creation of prospective sub-areas. Thirdly, prospective sub-areas were mapped from very high resolution WorldView-2 images, and suspected sites were found based on the human-computer interactive interpretation. Fourthly, suspected sites were investigated on the GPS-based archaeological survey, and were confirmed as two courier stations based on the remains of Han-Tang period observed at sites' surface. Lastly, the royal road to ancient Dunhuang, one of the most important sections of the royal road system in the Hexi Corridor, was discussed and reconstructed with the combined application of remote sensing imagery and ground-truthing.

Lei Luo; Xinyuan Wang; Chuansheng Liu; Huadong Guo; Xiaocui Du

2014-01-01T23:59:59.000Z

168

Mycol. R~s. 97 (7); 889-896 (1993) Prlnled irl Greal Brilain 889 Cylindrocladium parasiticum sp. nov., a new name for  

E-Print Network [OSTI]

to that of Cylindrocladillm crotnlariae.The aim of this study was to compare dried type and other herbarium specimens as well

169

WTE IN ATTICA, Georgia Columbus  

E-Print Network [OSTI]

#12;WTE TECHNOLOGIES Mass Burning · waste is fed into a chute leading to furnace · waste onto stoker.0046.5048.5056.50Organic biowaste 2005 (%)1997 (%)1991 (%)1984-1985 (%)Type of waste Composition MSW IN ATTICA #12;MSW PLANT AT ANO LIOSSIA 1st stage: reception of wastes 2nd stage: mechanical sorting · screening · solids

Columbia University

170

World Energy Consumption and Carbon Dioxide Emissions: 1950 2050  

E-Print Network [OSTI]

-U" relation with a within- sample peak between carbon dioxide emissions (and energy use) per capita and perWorld Energy Consumption and Carbon Dioxide Emissions: 1950 ? 2050 Richard Schmalensee, Thomas M. Stoker, andRuth A. Judson* Emissions of carbon dioxide from combustion of fossil fuels, which may

171

N.J. Themelis Trip to China, October 2007 Trip of Nickolas Themelis, WTERT Chair, to China, October 18-  

E-Print Network [OSTI]

greatly by the Renewable Energy policy of the country: Coal-fired power plants receive 4-6 cents/kWh. WTE was defined as clean and renewable energy. WTE plants in China are of two main types: Stoker grate and Circulating Fluid Bed. The latter are much smaller and they need coal co-firing, up to 20% of the feed

Columbia University

172

A Trust Model for Multiagent Recommendations Fabiana Lorenzi1,2, Gabriel Baldo2, Rafael Costa2, Mara Abel1, Ana Bazzan1, Francesco Ricci3  

E-Print Network [OSTI]

.501-970 Porto Alegre, RS, Brasil 2Universidade Luterana do Brasil Av. Farroupilha, 8001 Canoas, RS, Brasil 3Free

Ricci, Francesco

173

Scaling up Primary Health Services in Rural Tamil Nadu: Public Investment Requirements and Health Sector Reform  

E-Print Network [OSTI]

that it is the capital expenditure in Tamil Nadu that makes the difference. However, Tamil Nadu is yet to implement, this works out to Rs.295, Rs.55 and Rs.79 of combined revenue and capital account expenditures capita basis, it comes to Rs. 133, of which Rs. 78 will be needed to meet the capital costs and Rs. 55

174

The Essence of American Drama: The Short Plays of William Inge  

E-Print Network [OSTI]

complexly, if not more effectively, in the plays of Tennessee Williams; ordinary social settings The Fiesta Room of the Hotel Boomerang in a small town in middle Texas (79) where Bus Rileys Back In Town takes place; and even perhaps especially... the PROPERTY PLOT. Inges theatrical spaces tend to be bare and spare. In THE RAINY AFTERNOON, there are: Nail kegs, barrels, tool chests, 2 dolls, 2 glasses (107). In THE STRAINS OF TRIUMPH, there is only a Cane (142). Although I have said that Inge...

Wolf, Howard R.

2012-04-01T23:59:59.000Z

175

Analysis of coal-firing modes shows pulverized least costly  

SciTech Connect (OSTI)

A plant owner opting to build a new coal-fired facility has several processes from which to choose. Among the most common are the spreader-stoker- and the pulverized-coal-fired boiler. Since pollution control is now an integral part of any coal-fired operation, fluidized-bed combustion (FBC) is becoming increasingly popular. Reason: This process does not require auxiliary equipment to control SO/sub 2/. Comparing the operation and economics of four coal-burning processes can help make this selection a somewhat easier one. This analysis examines four types of combustion: spreader stoker, pulverized coal, bubbling fluidized bed, and circulating fluidized bed. The descriptions are for a 200,000-lb/hr unit operating under like conditions.

Lutwen, R.C.; Fitzpatrick, T.J.

1986-04-01T23:59:59.000Z

176

Common genetic variants in NEFL influence gene expression and neuroblastoma risk  

Science Journals Connector (OSTI)

...Supplementary Table 8. Prediction of mircoRNAs whose binding is affected by the SNPs rs1059111, rs2979704, rs3761 by mrSNP web tool. Supplementary Table 9. Prediction of transcriptional factors whose binding is affected by the SNPs rs1059111, rs2979704...

Mario Capasso; Sharon J. Diskin; Flora Cimmino; Giovanni Acierno; Francesca Totaro; Giuseppe Petrosino; Lucia Pezone; Maura Diamond; Lee McDaniel; Hakon Hakonarson; Achille Iolascon; Marcella Devoto; John M. Maris

177

Special Distribution  

Office of Legacy Management (LM)

Special Distribution Special Distribution Issued: December 1977 ',, Radiological Survey and Decontamination of the Former Main Technical Area (TA-1) at Los Alamos, New Mexico Compiled by A. John Ahlquist Alan K. Stoker Linda K. Trocki c laboratory of, the University of California LOS ALAMOS, NEW MEXICO 87545 An Alfirmdve Action/Equal Opportunity Employer ..-_- .-- .--.-. c T -,--... _ _._-r..l __,.. - .-,_.. ..- _._ -- .--. " . . _ . - . c- - . . . _ -. . _ . - . - . _ - - n - _ _~ ~_. __ _ ~~_ --..&e+ L.';; CONTENTS ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .._____ 1 EXECUTIVE SUMMARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .._... _._ 2 I. BACKGROUND .............................................. 15

178

A hierarchical perspective on the ecology of biological invasions:: impact of red imported fire ants on grassland ecosystems  

E-Print Network [OSTI]

of the requirements for the degree of MASTER OF SCIENCE December 1992 Major Subject: Wildlife and Fisheries Sciences A HIERARCHICAL PERSPECTIVE ON THE ECOLOGY OF BIOLOGICAL INVASIONS: IMPACT OF RED IMPORTED FIRE ANTS ON GRASSLAND ECOSYSTEMS A Thesis Revin Lee...A HIERARCHICAL PERSPECTIVE ON THE ECOLOGY OF BIOLOGICAL INVASIONS: IMPACT OF RED IMPORTED FIRE ANTS ON GRASSLAND ECOSYSTEMS A Thesis REVIN LEE STOKER Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

Stoker, Revin Lee

1992-01-01T23:59:59.000Z

179

Special Publication No. 3, Ticks And Tickborne Diseases, I. Genera And Species Of Ticks, Part 3. Genera O-X  

E-Print Network [OSTI]

dutertreus; Cueva Tenebrosa, Cuba) Skopin, N.G., (1943A), 79-82 (Citellus fulvus, Rhombomys opimus, Pallasiomys meridianus, Hemiechinus auritus, Testudo -horsfieldi; burrows; southern Kazakhstan) Sorokoumov, G. I., (1937A), 85-95 (horse, Rhombomys... opimus; eastern Kazakhstan) Ornithodoros species. --Continued Stiles, G. W. , and Lucker, J. T., (1942A), 295-312 Stoker, M. G. P., & Marmion, ?. P., (1955A), 781-806 (experimentally infected with Rickettsia burneti) Tarpi, ?. A. , and Shebeko, V. L...

Doss, Mildred A.; Farr, Marion M.; Roach, Katharine F.; Anastos, George

1974-01-01T23:59:59.000Z

180

COFIRING BIOMASS WITH LIGNITE COAL  

SciTech Connect (OSTI)

The University of North Dakota Energy & Environmental Research Center, in support of the U.S. Department of Energy's (DOE) biomass cofiring program, completed a Phase 1 feasibility study investigating aspects of cofiring lignite coal with biomass relative to utility-scale systems, specifically focusing on a small stoker system located at the North Dakota State Penitentiary (NDSP) in Bismarck, North Dakota. A complete biomass resource assessment was completed, the stoker was redesigned to accept biomass, fuel characterization and fireside modeling tests were performed, and an engineering economic analysis was completed. In general, municipal wood residue was found to be the most viable fuel choice, and the modeling showed that fireside problems would be minimal. Experimental ash deposits from firing 50% biomass were found to be weaker and more friable compared to baseline lignite coal. Experimental sulfur and NO{sub x} emissions were reduced by up to 46%. The direct costs savings to NDSP, from cogeneration and fuel saving, results in a 15- to 20-year payback on a $1,680,000 investment, while the total benefits to the greater community would include reduced landfill burden, alleviation of fees for disposal by local businesses, and additional jobs created both for the stoker system as well as from the savings spread throughout the community.

Darren D. Schmidt

2002-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Cost Sharing Why and How  

E-Print Network [OSTI]

Cost Sharing Why and How Trudy M. Riley Assistant Provost, Research Administration Susan M. Tkachick Sponsored Research Accountant $ Research Office #12;Research Office AGENDA What is Cost Sharing Why Cost Share What is Allowable Managing Cost Sharing during the life of the project What happens

Firestone, Jeremy

182

NV: Nessus Vulnerability Visualization for the Web Lane Harrison  

E-Print Network [OSTI]

NV: Nessus Vulnerability Visualization for the Web Lane Harrison Oak Ridge National Laboratory Oak Ridge TN, USA harrisonlt@ornl.gov Riley Spahn Oak Ridge National Laboratory Oak Ridge TN, USA spahnrb1@ornl.gov Mike Iannacone Oak Ridge National Laboratory Oak Ridge TN, USA iannaconemd@ornl.gov Evan

Kaiser, Gail E.

183

Cellular and molecular correlates of neural morphallaxis in Lumbriculus variegatus  

E-Print Network [OSTI]

) _____________________________ _______________________________ Sumana Datta Bruce B. Riley (Member) (Member) _______________________________ Vincent M... 2005) Veronica Giselle Martinez, B.A.; B.A., University of St. Thomas Chair of Advisory Committee: Dr. Mark J. Zoran Tissue regeneration has intrigued biologists since the eighteenth century. While regeneration has been studied in many...

Martinez, Veronica Giselle

2006-08-16T23:59:59.000Z

184

Advanced Critical Advanced Energy Retrofit Education and Training and Credentialing- 2014 BTO Peer Review  

Broader source: Energy.gov [DOE]

Presenter: David Riley, Penn State Targeting professionals, employers, and education program leaders in selected advanced energy retrofit (AER) project fields (including energy auditors, building operators, energy managers, and commissioning authorities), this project addresses the need for clearly defined competencies in critical fields supporting AER projects.

185

HonorsConvocation TexasTechUniversity  

E-Print Network [OSTI]

Ethan Miller Depue Joshua Ryan Evans EssamTarek Farag Paige M. Niehues Brian Edward O'Riley Caleb Aubrey Orr James Michael Party Kush J. Patel Corlee Priestly Gilbert Alexander Rivera Melanie Laura Ruegg Cooper Joseph Schilder James Schrock Tanner C. Schulz James Dylan Staton Michael BlaineWalls SUMMA CUM

Gelfond, Michael

186

University Graduate School Academic Bulletin  

E-Print Network [OSTI]

@indiana.edu College of Arts and Sciences Bloomington Director Professor Lois R. Wise* (Public and Environmental and Informatics), David Pace* (His- tory), William Rasch* (Germanic Studies), James Riley* (Emeri- tus, History), Evan Ringquist* (Public and Environmental Affais), Alvin Rosenfeld* (English and Jewish Studies

Indiana University

187

Water resources planning under climate change and variability  

E-Print Network [OSTI]

Environmental Economics and Management 34:207-227 Griffin RC, Mjelde JW (2000) Valuing WaterEnvironmental Economics and Management 40:37-55 Riley JG, Scherer CR (1979) Optimal WaterEnvironmental Economics and Management 26:19-30 Loucks DP, Stedinger JR, Haith DA (1981) Water

O'Hara, Jeffrey Keith

2007-01-01T23:59:59.000Z

188

Genetics or Neurological Compromise in People Who Stutter  

E-Print Network [OSTI]

Genetics or Neurological Compromise in People Who Stutter Edited from Per Alm, 2007 By Glyndon Riley Leading researchers in stuttering over the last 70 years have suggested two types of vulnerability to develop stuttering, (1) a history of stuttering in close relatives and (2) a history of neurological

de Lijser, Peter

189

Functions of the gene products of Escherichia coli.  

Science Journals Connector (OSTI)

...506, 1460 976 998, 1470 1698 209 1079 1079 70, 1428, 1736 111, 1428, 1778 70...765 74, 280 451, 1136 55 842 842, 1089 1015 1269 892 RILEY FUNCTIONS OF E. COLI...Shikimate kinase I 977 aroL Shikimate kinase II 1085 2.7.2.4 lysC Aspartate kinase III...

M Riley

1993-12-01T23:59:59.000Z

190

MASTER OF ENGINEERING Biological and Environmental Engineering  

E-Print Network [OSTI]

Marchewka, Student Services Coordinator Department of Biological and Environmental Engineering 207 RileyMASTER OF ENGINEERING Biological and Environmental Engineering Program Requirements Fall 2014 The Master of Engineering (MEng) is a professional degree program intended for those who have a Bachelors

Walter, M.Todd

191

MASTER OF ENGINEERING Biological and Environmental Engineering  

E-Print Network [OSTI]

Marchewka, Student Services Coordinator Department of Biological and Environmental Engineering 207 RileyMASTER OF ENGINEERING Biological and Environmental Engineering Program Requirements Fall 2013 The Master of Engineering (MEng) is a professional degree program intended for those who have a Bachelors

Walter, M.Todd

192

e-publishing 512345678910111213141523313233  

E-Print Network [OSTI]

% of 100 the strains are colicinogenic. Data on human E. coli iso- 101 lates indicate an even higher (50 bacteriocins. The 95 most well-known types of bacteriocin are the colicins from 96 E. coli (Pugsley 1984 based on the analysis of strains in E. coli col- 99 lections (Riley & Gordon 1992) suggest that ca. 35

Czárán, Tamás

193

Butterfly Gardening in Texas  

E-Print Network [OSTI]

by W.C. Welch, 1989. 5,000 copies, New ENT The authors are grateful for review comments from Mike Arnold, Marvin Harris and Ed Riley. For sale only, $10 per set. Produced by AgriLife Communications and Marketing, The Texas A&M University System...

Drees, Bastiaan M.; Jackman, John A.

1999-07-14T23:59:59.000Z

194

Phase-Trafficking Methods in Natural Products, Modulators of Organic Anion Transporting Polypeptides from Rollinia emarginata, and Pregnane and Cardiac Glycosides from Asclepias spp.  

E-Print Network [OSTI]

-aldosterone, the cardiac glycoside core was built up using a microwave-promoted allylic oxidation using SeO2 (Riley oxidation). In addition, a microwave-promoted Miyaura-Suzuki cross-coupling was utilized to obtain the desired 17?-aryl analogs....

Araya Barrantes, Juan Jose

2012-05-31T23:59:59.000Z

195

World Regional Geography POLI 104 / GEOG 101 Fall 2013  

E-Print Network [OSTI]

and environmental problems...problems that impact us all (including you). War and civil conflict, water pollution Instructor: Jesse Baker, PhD Email: bakerja1@cofc.edu Office: Riley Building, 1st Floor (284 King St) Office and environmental regulations that US citizens have demanded and achieved. The moral of the story here is that US

Young, Paul Thomas

196

Phylogeny of the pollinating yucca moths, with revision of Mexican species (Tegeticula and Parategeticula;  

E-Print Network [OSTI]

­ Manzanillo, Tecomán, Colima, 28100, Mexico 3 Department of Biology, 130 College Place, Syracuse University recognized, increasing the number of described species from four to 20. Based on field surveys in Mexico reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

Althoff, David M.

197

CESIUM SORPTION TO ILLITE AS AFFECTED BY OXALATE LAURA A. WENDLING  

E-Print Network [OSTI]

in shallow soil systems contaminated as a result of nuclear weapons testing, nuclear reactor accidents, and past waste-disposal practices at nuclear facilities. Cesium contributes a major portion of the radio- activity at many sites associated with nuclear weapons production (Riley et al., 1992

Flury, Markus

198

Water accounting for conjunctive groundwater/surface water management: case of the SingkarakOmbilin  

E-Print Network [OSTI]

Water accounting for conjunctive groundwater/surface water management: case of the Singkarak University, 216 Riley-Robb Hall, Ithaca, NY 14853-5701, USA b International Water Management Institute, P 2003 Abstract Because water shortages limit development in many parts of the world, a systematic

Walter, M.Todd

199

Protein Function Prediction Jianlin Cheng, PhD  

E-Print Network [OSTI]

;process function component The gene product inner no outer has transcription factor activity. #12;processProtein Function Prediction Jianlin Cheng, PhD Department of Computer Science Informatics Institute Classification (TC) · Riley scheme: assign prokaryotic gene products to cellular processes · The MIPS Functional

Cheng, Jianlin Jack

200

Protein Function Prediction Jianlin Cheng, PhD  

E-Print Network [OSTI]

no outer has transcription factor activity. #12;process function component The gene product inner no outerProtein Function Prediction Jianlin Cheng, PhD Department of Computer Science Informatics Institute (EC), Transporter Classification (TC) · Riley scheme: assign prokaryotic gene products to cellular

Cheng, Jianlin Jack

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Abstract P1-09-19: Demographic trends in clinical trial withdrawal rate within the bubble study  

Science Journals Connector (OSTI)

...clinical trial withdrawal rate within the bubble study EC Riley D Jain B Kantardzic X Wu SN...originally signed consent and enrolled in the Bubble Study but then withdrew at a later date. The Bubble Study is a non- blinded, prospective observational...

EC Riley; D Jain; B Kantardzic; X Wu; SN Rai

2013-12-15T23:59:59.000Z

202

Propagation of the 12 May 1997 interplanetary coronal mass ejection in evolving solar wind  

E-Print Network [OSTI]

Propagation of the 12 May 1997 interplanetary coronal mass ejection in evolving solar wind wind was determined from the Science Applications International Corporation (SAIC) coronal model (Riley distance between the shock and the driving ejecta and in the inclination of the shock with respect

California at Berkeley, University of

203

A Century of Progress in Smithsonian Biology  

Science Journals Connector (OSTI)

...115,000 specimens. Riley retired in 1894 with the intention...of recent years. James C. Crawford succeeded Ashmead as assistant...Department of Agriculture, Crawford was chiefly occupied with the...for the install-ment of a unit system for the storage of specimens...

Remington Kellogg

1946-08-09T23:59:59.000Z

204

Role of Diacylglycerol in PKD Recruitment to the TGN and Protein Transport to the Plasma Membrane  

Science Journals Connector (OSTI)

...P. Bacon C. W. Riley R. T. Merrill A. H. Jr...93 , 120 ( 1978 ). 15 Pappu A. S. Hauser G. , Neurochem...532 (1985). 18 Davis R. J. Ganong B. R. Bell...1978) . 15. A. S. Pappu and G. Hauser, Neurochem...532-(1985). 18. R. J. Davis, B. R. Ganong...

Carole L. Baron; Vivek Malhotra

205

Filtration plant for drinking water James Tarchala [1  

E-Print Network [OSTI]

Filtration plant for drinking water James Tarchala [1] Alexandre Selhorst [2] Cheny Thao [3] 1 2 3 Riley, Wang, Aaron Nolan (Not Pictured) 12/1/2014 #12;Reclaiming waste HEAT TO PRE- HEAT WATER IN a FACTORY HOT WATER SYSTEM Group 5: Joseph Von Arx(1) Aaron McKeown(2) Kyle Swanson(3) Ian Klecka(4) 1 2 3 4

Kostic, Milivoje M.

206

Characteristics of the upper crust and magma chambers along the spreading centers of the Lau back-arc basin  

E-Print Network [OSTI]

G. , Detrick, R.S. , Sinton, J. , 2002. Crustal thicknessJ.P. , Detrick, R.S. , Sinton, J. , 2004. Constructing the3767-3787. Detrick, R.S. , Sinton, J.M. , Ito, G. , Canales,

Dingler, Allison Maria Jacobs

2007-01-01T23:59:59.000Z

207

O  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Solution domain: 1 Rs to 21.5 Rs Uses NSO Kitt Peak Magnetograms Calculates the solar wind speed on the outer boundary (21.5 Rs) based on: expansion factor magnetic foot...

208

E' convocata la Riunione Straordinaria di tutti i componenti della RS.U. per Marted 12 maggio 2009 alle ore 10,00 presso il salone sindacale con il seguente ordine del giorno  

E-Print Network [OSTI]

'Assemblea RSU su Designati o eletti RLS; 2) Modifiche da effettuare al Regolamento della Sicurezza: aumento del numero degli RLS, aumento del numero delle ore per ogni RLS, fissare la data delle elezioni RLS0111al.it~, -- fl "S~II~COIU.ivano"iva1o.siinconi(cr7tiscali.iP BbJ . 3 ? I c A '

Guidoni, Leonardo

209

Please complete this checklist and forward with this referral form a Consumer History/Summary, Form RS-6, Current Medical Documentation, Vocational/Psychological Evaluation, and ExcEL Application Form.  

E-Print Network [OSTI]

Please complete this checklist and forward with this referral form a Consumer History/Summary, Form. Referral Date: ____________________________ I. CONSUMER INFORMATION Consumer's Name Date of Birth: SSN referral information to: Virginia Gay Young; Training, Resource, and Assistive-Technology Center (TRAC) P

Li, X. Rong

210

&('0)21436587@9 ACBED6BEDGFH5I36PRQTSU'036VW5XFH1`Yacb0'edea fhgi0prqtstuvgwxsyrHCqpwprwywIstgXgw0gIdegfheCpujiIqkXgEdmlonpXq2rs  

E-Print Network [OSTI]

Coughing Fever Headache Working In Factory Smoking Stressful Lifestyle High Fat Diet Flu Bronchitis Lung Cancer Heart Disease Chest Pain Coughing Fever Headache ï ú ù ï©ù Working In Factory Smoking Stressful Lifestyle High Fat Diet Flu Bronchitis Lung Cancer Heart Disease Chest Pain Coughing Fever Headache Working

Tenenbaum, Josh

211

Ionospheric HF pump wave triggering of local auroral activation !"#$&%')(&0121 3 '45678!%'9@&%$(A21 B CDEF8!9GHI21 P B 9GQ$RS22  

E-Print Network [OSTI]

magnetic field (IMF) orientation and solar wind pressure) and involves the direct deposition of solar wind energy into the auroral ionosphere and the symmetric ring currents. The storage-release system pertains

212

Downregulation of Securin by the variant RNF213 R4810K (rs112735431, G>A) reduces angiogenic activity of induced pluripotent stem cell-derived vascular endothelial cells from moyamoya patients  

SciTech Connect (OSTI)

Highlights: Angiogenic activities were reduced in iPSECs from MMD patients. Many mitosis-regulated genes were downregulated in iPSECs from MMD patients. RNF213 R4810K downregulated Securin and inhibited angiogenic activity. Securin suppression by siRNA reduced angiogenic activities of iPSECs and HUVECs. -- Abstract: Moyamoya disease (MMD) is a cerebrovascular disease characterized by occlusive lesions in the circle of Willis. The RNF213 R4810K polymorphism increases susceptibility to MMD. Induced pluripotent stem cells (iPSCs) were established from unaffected fibroblast donors with wild-type RNF213 alleles, and from carriers/patients with one or two RNF213 R4810K alleles. Angiogenic activities of iPSC-derived vascular endothelial cells (iPSECs) from patients and carriers were lower (49.0 19.4%) than from wild-type subjects (p < 0.01). Gene expression profiles in iPSECs showed that Securin was down-regulated (p < 0.01) in carriers and patients. Overexpression of RNF213 R4810K downregulated Securin, inhibited angiogenic activity (36.0 16.9%) and proliferation of humanumbilical vein endothelial cells (HUVECs) while overexpression of RNF213 wild type did not. Securin expression was downregulated using RNA interference techniques, which reduced the level of tube formation in iPSECs and HUVECs without inhibition of proliferation. RNF213 R4810K reduced angiogenic activities of iPSECs from patients with MMD, suggesting that it is a promising in vitro model for MMD.

Hitomi, Toshiaki [Department of Health and Environmental Sciences, Kyoto University, Kyoto (Japan)] [Department of Health and Environmental Sciences, Kyoto University, Kyoto (Japan); Habu, Toshiyuki [Radiation Biology Center, Kyoto University, Kyoto (Japan)] [Radiation Biology Center, Kyoto University, Kyoto (Japan); Kobayashi, Hatasu; Okuda, Hiroko; Harada, Kouji H. [Department of Health and Environmental Sciences, Kyoto University, Kyoto (Japan)] [Department of Health and Environmental Sciences, Kyoto University, Kyoto (Japan); Osafune, Kenji [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan)] [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan); Taura, Daisuke; Sone, Masakatsu [Department of Medicine and Clinical Science, Kyoto University, Kyoto (Japan)] [Department of Medicine and Clinical Science, Kyoto University, Kyoto (Japan); Asaka, Isao; Ameku, Tomonaga; Watanabe, Akira; Kasahara, Tomoko; Sudo, Tomomi; Shiota, Fumihiko [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan)] [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto (Japan); Hashikata, Hirokuni; Takagi, Yasushi [Department of Neurosurgery, Kyoto University,Kyoto (Japan)] [Department of Neurosurgery, Kyoto University,Kyoto (Japan); Morito, Daisuke [Faculty of Life Sciences, Kyoto Sangyo University, Kyoto (Japan)] [Faculty of Life Sciences, Kyoto Sangyo University, Kyoto (Japan); Miyamoto, Susumu [Department of Neurosurgery, Kyoto University,Kyoto (Japan)] [Department of Neurosurgery, Kyoto University,Kyoto (Japan); Nakao, Kazuwa [Department of Medicine and Clinical Science, Kyoto University, Kyoto (Japan)] [Department of Medicine and Clinical Science, Kyoto University, Kyoto (Japan); Koizumi, Akio, E-mail: koizumi.akio.5v@kyoto-u.ac.jp [Department of Health and Environmental Sciences, Kyoto University, Kyoto (Japan)] [Department of Health and Environmental Sciences, Kyoto University, Kyoto (Japan)

2013-08-16T23:59:59.000Z

213

E-Print Network 3.0 - achr deficiency due Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by immunofluorescent staining... immunofluorescence was present at virtually all synap- tic clusters of AChRs and neural agrin. Even microclusters... of AChRs and agrin at...

214

Hiriart-Baer, Vronique P., and Ralph E. H. Smith. Models for ...  

Science Journals Connector (OSTI)

duction, partly because UVR belongs to a continuous solar radiation spectrum that acts ... gineering Research Council (R.S.), Environment Canada (R.S.), and.

2003-12-30T23:59:59.000Z

215

The Karjat Drinking Water Project GISE (CSE)-CTARA  

E-Print Network [OSTI]

/ 11 #12;Analysis Project- since 2008 Rs. 1500 crores in watershed development. Planning of small hydro

Sohoni, Milind

216

Volume 1 Issue 6 www.nasa.gov/centers/stennis June 2006 SSC plays vital role in NASA's Project Constellation  

E-Print Network [OSTI]

's new Cargo Launch Vehicle (left) and Crew Launch Vehicle. Pratt & Whitney Rocketdyne's RS-68 engine

217

BIOLOGICAL SAFETY O N/A Biosafety Cabinets  

E-Print Network [OSTI]

: _________________________________________________ _________________________________________________ _________________________________________________ RADIATION SAFETY O N/A ___RS-1 Radioactive Material Inventory / Use Logs out of date ___RS-2 Radioactive Material waste inventory cards improperly filled out ___RS-3 Stock radioactive material not secure ___RS-4 __Accelerator __PressureVessels __HiReactMaterials __Rad Material __PwIndV / __PwTools __>55g Oil __X

Entekhabi, Dara

218

Control by Estrogen of Genetic Transcription and Translation  

Science Journals Connector (OSTI)

...demon ment of amino acid tivity of ribonucleoprc lated from the target 4 of estrogen action in ness in these studies 'M information on the se acteristics of the ribor NM RS NM RS NM RS NM RS NMR ' 0 1/2 2 4 8 Time after 17, -estradiol (hr) Fig...

Terrell H. Hamilton

1968-08-16T23:59:59.000Z

219

Millard W. Hall, Director Volume 9 Number 2  

E-Print Network [OSTI]

. Pete rs; Harold Rademaker of the Agricultural Stabilization and Conservation Service ; and Benny Martin

Nebraska-Lincoln, University of

220

PHY 305F Electronics Laboratory I, Fall Term 2003 Experiment 2 PHY 305F ELECTRONICS LABORATORY I  

E-Print Network [OSTI]

find the equivalent AC series resistance (Rs) of that inductor. Measure the resistance of the inductor

Strong, Kimberly

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

NETL: Advanced NOx Emissions Control: Control Technology - Optimized Fuel  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Optimized Fuel Injector Design Optimized Fuel Injector Design This project includes fundamental research and engineering development of low NOx burners and reburning fuel injectors. The team of Reaction Engineering International (REI), the University of Utah, Brown University and DB Riley, Inc., will develop fundamental information on low NOx burners. The work has two phases. In the first phase, the University of Utah will examine two-phase mixing and near-field behavior of coal injectors using a 15-million Btu/hr bench-scale furnace, Brown University will examine char deactivation and effectiveness of reburning, and REI will develop a comprehensive burner model using the data produced by the University of Utah and Brown University. In the second phase, an optimized injector design will be tested at the 100-million Btu/hr Riley Coal Burner Test Facility. It is anticipated that this work will provide improved hardware designs and computer simulation models for reduced NOx emissions and minimized carbon loss.

222

Publications  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

16 results: 16 results: BibTex RIS RTF XML Sort by: Author Title Type [ Year (Desc) ] Filters: Author is William J. Riley [Clear All Filters] 2010 Schwalm, C. R., Christopher A. Williams, Kevin Schaefer, Ryan Anderson, Altaf M. Arain, Ian Baker, Alan Barr, Andrew T. Black, Guangsheng Chen, Jing Ming Chen et al. "A model-data intercomparison of CO2 exchange across North America: Results from the North American Carbon Program site synthesis." Journal of Geophysical Research 115, no. G00H05 (2010). 2009 Riley, William J., Sebastien C. Biraud, Margaret S. Torn, Marc L. Fischer, David P. Billesbach, and Joseph A. Berry. "Regional CO2 and latent heat surface fluxes in the Southern Great Plains: Measurements, modeling, and scaling." Journal of Geophysical Research 114 (2009).

223

Energy Secretary Bodman Tours Alabama Red Cross Facility and Attends  

Broader source: Energy.gov (indexed) [DOE]

Tours Alabama Red Cross Facility and Tours Alabama Red Cross Facility and Attends National Day of Prayer and Remembrance Service with Governor Riley Energy Secretary Bodman Tours Alabama Red Cross Facility and Attends National Day of Prayer and Remembrance Service with Governor Riley September 16, 2005 - 10:24am Addthis MONTGOMERY, AL - Today, Secretary of Energy Samuel W. Bodman traveled to Montgomery, Alabama, to commemorate a National Day of Prayer and Remembrance in honor of victims of Hurricane Katrina. "On this day of prayer and remembrance, our thoughts and prayers are with all of the families of victims of this terrible storm," Secretary Bodman said. "On behalf of the Department of Energy, we are committed to carrying our relief efforts through to completion with the confidence that

224

Team Canada Returns to the Solar Decathlon with First Nation Values in Mind  

Broader source: Energy.gov (indexed) [DOE]

Team Canada Returns to the Solar Decathlon with First Nation Values Team Canada Returns to the Solar Decathlon with First Nation Values in Mind Team Canada Returns to the Solar Decathlon with First Nation Values in Mind June 2, 2011 - 5:30pm Addthis A model of Team Canada's TRTL house | Courtest of Riley Brandt, Team Canada A model of Team Canada's TRTL house | Courtest of Riley Brandt, Team Canada April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs What does this project do? Team Canada's 2011 Solar Decathlon house -- which is known as TRTL (Technological Residence that respects Traditional Living.) -- addresses critical housing issues in Alberta, Canada's Aboriginal communities. In honor of the U.S Department of Energy's Solar Decathlon -- which challenges 20 collegiate teams to design, build, and operate solar-powered

225

SCR body May 16  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 May 2005 3 May 2005 Selective Catalytic Reduction (SCR) Technology for the Control of Nitrogen Oxide Emissions from Coal-Fired Boilers An Update of Topical Report Number 9 TOPICAL REPORT NUMBER 23 May 2005 An Update of Topical Report Number 9 Selective Catalytic Reduction (SCR) Technology for the Control of Nitrogen Oxide Emissions from Coal-Fired Boilers Photos on pages 1, 3, 9, 11, and 16 courtesy of Riley Power Inc.,

226

Imperial Standard-Bearers: Nineteenth-Century Army Officers' Wives in British India and the American West  

E-Print Network [OSTI]

life provided by veterans at dances, dinners and parlor visits assisted the newly commissioned men, an invaluable process that Smith terms ?folkways.? Thus, formal 6 and casual instruction created ?nation-builders,? professional officer class who... events. In some instances she commanded a garrison, issued orders to enlisted men , acted as a magistrate in military legal affairs.9 In considering American army officers? wives and their experiences, Glenda Riley acknowledges that ?scores...

McInnis, Verity

2012-07-16T23:59:59.000Z

227

Associations Between Chronic Pain and Use of Pharmacotherapy for Smoking Cessation  

E-Print Network [OSTI]

(e.g., Hahn, Rayens, Kirsh, & Passik, 2006; Riley, Tomar, & Gilbert, 2004; Saag et al., 1997). 1.3.2 Experimental evidence Ditre and Brandon (2008) conducted the first laboratory study designed to test the effects of pain on smoking motivation... be successfully manipulated by invoking social-cognitive 7 constructs (Ditre, Heckman, Butts, & Brandon, 2010). Specifically, pain-induced urge to smoke was attenuated by use of a pain-coping strategy (i.e., distraction), and similar effects were observed...

Zale, Emily

2012-10-19T23:59:59.000Z

228

(12) United States Patent Warmus et al.  

E-Print Network [OSTI]

: This patent issued on a continued pros- ecution application filed under 37 CFR 1.53(d), and is subject,500,083 4,536,176 4,554,044 395!768, 772, 773, 779, 782, 784, 787, 802, 803, 943, 946, 116, 117; 382!. ....................... 493/430 10/1978 Riley et a!. ....................... 270/52.29 7/1983 Gruber eta

Shamos, Michael I.

229

Maternal adrenocorticotropin, cortisol and thyroid hormone responses to chronic binge alcohol exposure throughout gestation: ovine model  

E-Print Network [OSTI]

-axis and thyroid gland to intermittent exposure to different concentrations of alcohol throughout pregnancy as potential indicators of abnormal fetal concentrations of these hormones possibly contributing to ARBD... throughout the worldalthough certain populations seem be more affected than others (Riley and McGee, 2005). There is an ongoing need to educate women about the potential risks associated with drinking during pregnancy, but it is also clear that more...

Tress, Ursula

2009-05-15T23:59:59.000Z

230

Is Capitalism Good for Women?  

E-Print Network [OSTI]

Program 2007/8) The gender related development index (GDI) for traditional countries is much worse than for capitalist ones.7 Women are less likely to be politically powerful. Generally speaking, life for women in traditional societies is nasty, brutish... factors behind these levels. See Riley 2001, p.115. 7 The Gender related Development Index (GDI) takes account of statistics that measure length and health of life, education, and standard of living, and discounts the scores according to the gender...

Cudd, Ann E.

2014-05-21T23:59:59.000Z

231

Heterosis and Heterosis Retention for Reproductive and Maternal Traits in Nellore-Angus Crossbred Cows  

E-Print Network [OSTI]

HETEROSIS AND HETEROSIS RETENTION FOR REPRODUCTIVE AND MATERNAL TRAITS IN NELLORE-ANGUS CROSSBRED COWS A Dissertation by MOHAMMAD DIYA TALAL HAMED OBEIDAT Submitted to the Office of Graduate Studies of Texas A&M University in partial... fulfillment of the requirements hqt the degree of DOCTOR OF PHILOSOPHY Chair of Committee, David G. Riley Committee Members, James O. Sanders Andy D. Herring Jason E. Sawyer Head of Department, H. Russell Cross August 2013 Major...

Obeidat, Mohammad Diya Talal Hamed

2013-07-08T23:59:59.000Z

232

Method of regulating the amount of underfire air for combustion of wood fuels in spreader-stroke boilers  

DOE Patents [OSTI]

A method of metering underfire air for increasing efficiency and reducing particulate emissions from wood-fire, spreader-stoker boilers is disclosed. A portion of the combustion air, approximately one pound of air per pound of wood, is fed through the grate into the fuel bed, while the remainder of the combustion air is distributed above the fuel in the furnace, and the fuel bed is maintained at a depth sufficient to consume all oxygen admitted under fire and to insure a continuous layer of fresh fuel thereover to entrap charred particles inside the fuel bed.

Tuttle, Kenneth L. (Federal Way, WA)

1980-01-01T23:59:59.000Z

233

Improved Combustion of Asphaltite Coals in a Rotating Head Combustor with Various Air Supply Arrangements  

Science Journals Connector (OSTI)

A small amount of ash is drifted via combustion gas in fine particles while great deal of it flow into the ash pit in the form of clinker from the open side of combustion head. ... In this study, it was shown that the swelling coals that were difficult to burn in conventional stokers could be burned using a rotating head combustor in high efficiencies without any ash problem. ... In this work, a rotating head combustor, which has been designed for burning the coking coals effectively, was deployed to burn a range of coals available in Turkey under agitation conditions with secondary air delivery. ...

Cengiz ner; ?ehmus Altun

2014-04-16T23:59:59.000Z

234

Energy from waste via coal/waste co-firing  

SciTech Connect (OSTI)

The paper reviews the feasibility of waste-to-energy plants using the cocombustion of coal with refuse-derived fuels. The paper discusses the types of wastes available: municipal solid wastes, plastics, tires, biomass, and specialized industrial wastes, such as waste oils, post-consumer carpet, auto shredder residues, and petroleum coke. The five most common combustion systems used in co-firing are briefly described. They are the stoker boiler, suspension-fired boilers, cyclone furnaces, fluidized bed boilers, and cement kilns. The paper also discusses the economic incentives for generating electricity from waste.

Winslow, J.; Ekmann, J.; Smouse, S. [Dept. of Energy, Pittsburgh, PA (United States). Pittsburgh Energy Technology Center; Ramezan, M. [Burns and Roe Services Corp., Pittsburgh, PA (United States); Harding, S.

1996-12-31T23:59:59.000Z

235

Evaluation and selection of circulating fluidized bed boilers  

SciTech Connect (OSTI)

The use of circulating fluidized bed (CFB) boilers to generate steam on an industrial scale is increasing. The reasons for this growth include high combustion efficiency, fuel flexibility, and inherent emissions control capability, particularly with regards to control of nitrogen oxides (NO{sub x}) and sulfur oxides (SO{sub x}). However, CFB boiler technology is unique, with operating performance, and construction features that differ significantly from those used in conventional pulverized coal (PC) and stoker-fired boiler technology. An overview of these features is presented by the author.

Marcinek, F.T. (Charles B. Tibbits and Associates, Seattle, WA (US))

1989-05-01T23:59:59.000Z

236

BARRIER ISSUES TO THE UTILIZATION OF BIOMASS  

SciTech Connect (OSTI)

The Energy & Environmental Research Center (EERC) is conducting a project to examine the fundamental issues limiting the use of biomass in small industrial steam/power systems in order to increase the future use of this valuable domestic resource. Specifically, the EERC is attempting to elucidate the ash-related problems--grate clinkering and heat exchange surface fouling--associated with cofiring coal and biomass in grate-fired systems. Utilization of biomass in stoker boilers designed for coal can be a cause of concern for boiler operators. Boilers that were designed for low-volatile fuels with lower reactivities can experience damaging fouling when switched to higher-volatile and more reactive lower-rank fuels, such as when cofiring biomass. Higher heat release rates at the grate can cause more clinkering or slagging at the grate because of higher temperatures. Combustion and loss of volatile matter can start too early with biomass fuels compared to design fuel, vaporizing alkali and chlorides which then condense on rear walls and heat exchange tube banks in the convective pass of the boiler, causing noticeable increases in fouling. In addition, stoker-fired boilers that switch to biomass blends may encounter new chemical species such as potassium sulfates and various chlorides in combination with different flue gas temperatures because of changes in fuel heating value, which can adversely affect ash deposition behavior.

Jay R. Gunderson; Bruce C. Folkedahl; Darren D. Schmidt; Greg F. Weber; Christopher J. Zygarlicke

2002-05-01T23:59:59.000Z

237

Industrial cofiring reaps big rewards  

SciTech Connect (OSTI)

US industry operates over 2,000 coal-fired stoker boilers. They are typically over 30 years old, difficult to maintain, and hard to keep in environmental compliance. Natural gas cofiring of industrial stoker boilers offers a wide range of operational benefits. Boiler efficiency is improved because combustion air requirements are reduced (low excess air of LEA) and carbon burnout is improved (loss on ignition or LOI). On the emissions side, opacity problems are reduced and NO{sub x} and SO{sub 2} emissions reduced as natural gas replaces a percentage of the coal. Further, operation is improved through easier, smoke-free start-up and warm-up, recovered steam generation, increased short-term peaking capacity, improved plant availability and improved low load operation. Fuel flexibility also increases and maintenance decreases. Cofire benefits and economics are, however, very site specific. Important factors include relative coal and gas pricing, coal and gas supply security, boiler capacity factor and seasonal use, and backup boiler capability. These factors are discussed using the example of the Dover Light and Power of Ohio.

NONE

1996-06-01T23:59:59.000Z

238

Heating boilers in Krakow, Poland: Options for improving efficiency and reducing emissions  

SciTech Connect (OSTI)

In Krakow, Poland, coal-fired boilers are used to heat single apartment buildings and local heating districts. Tile population includes 2,930 small, hand-fired boilers and 227 larger traveling grate stoker-fired boilers. These boilers are important contributors to air quality problems in Krakow, and an assessment of their efficiency and emissions characteristics was recently undertaken. For the larger, stoker-fired boilers, efficiency was measured using a stack-loss method In addition to the normal baseline fuel, the effects of coal cleaning and grading were evaluated Testing was done at two selected sites. Boiler efficiencies were found to be low-50% to 67%. These boilers operate without combustion controls or instrumentation for flue gas analysis. As a result, excess air levels are very high (up to 400%) leading to poor performance. Emissions were found to be typical for boilers of this type. Using the improved fuels yields reductions in emissions and improvement in efficiency when combined with proper adjustments. In the case of the hand-fired boilers, one set of cast-iron boilers and one set of steel boilers were tested. Efficiency in this case was measured using an input-output method for sets of three boilers taken together as a system. Emissions from these boilers are lowest when low volatile fuels, such as coke or smokeless briquettes, are used.

Cyklis, P.; Wlodkowski, A.; Butcher, T.; Kowalski, J.; Zaczkowski, A.; Kroll, J.; Boron, J.

1995-08-01T23:59:59.000Z

239

The estimation of N{sub 2}O emissions from municipal solid waste incineration facilities: The Korea case  

SciTech Connect (OSTI)

The greenhouse gases (GHGs) generated in municipal solid waste (MSW) incineration are carbon dioxide (CO{sub 2}), methane (CH{sub 4}), and nitrous oxide (N{sub 2}O). In South Korea case, the total of GHGs from the waste incineration facilities has been increasing at an annual rate 10%. In these view, waste incineration facilities should consider to reduce GHG emissions. This study is designed to estimate the N{sub 2}O emission factors from MSW incineration plants, and calculate the N{sub 2}O emissions based on these factors. The three MSW incinerators examined in this study were either stoker or both stoker and rotary kiln facilities. The N{sub 2}O concentrations from the MSW incinerators were measured using gas chromatography-electron capture detection (GC-ECD) equipment. The average of the N{sub 2}O emission factors for the M01 plant, M02 plant, and M03 plant are 71, 75, and 153 g-N{sub 2}O/ton-waste, respectively. These results showed a significant difference from the default values of the intergovernmental panel on climate change (IPCC), while approaching those values derived in Japan and Germany. Furthermore, comparing the results of this study to the Korea Energy Economics Institute (KEEI) (2007) data on waste incineration, N{sub 2}O emissions from MSW incineration comprised 19% of the total N{sub 2}O emissions.

Park, Sangwon; Choi, Jun-Ho [Department of Chemical and Biomolecular Engineering, Yonsei University, 262 Seongsanno, Seodaemun-gu, Seoul 120-749 (Korea, Republic of); Park, Jinwon, E-mail: jwpark@yonsei.ac.kr [Department of Chemical and Biomolecular Engineering, Yonsei University, 262 Seongsanno, Seodaemun-gu, Seoul 120-749 (Korea, Republic of)

2011-08-15T23:59:59.000Z

240

Modeling Clean and Secure Energy Scenarios for the Indian Power Sector in 2030  

E-Print Network [OSTI]

Solar Thermal (with storage) Solar PV (Rs Cr/MW) (Rs Cr/MW)Thermal (with thermal storage) Solar PV Capacity Utilizationcost of solar thermal projects with storage is assumed to

Abhyankara, Nikit

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Computing Roadmaps of Semi-algebraic Sets (Extended Abstract) 1 ...  

E-Print Network [OSTI]

called the roadmap for the pair (S; M): R(S; M) is a semi-algebraic set of dimension at most one,. satisfying. 1. M R(S; M );. 2. for every semi-algebraically...

242

Sepax SEC C-line columns! The Challenge  

E-Print Network [OSTI]

H 7.0 Rs=1.41, tailing=1.68 2. Buffer 1: 100% IPA = 95%:5% Rs=1.50, tailing= 1.44 3. Buffer 1:100% IPA

Lebendiker, Mario

243

Modeling Clean and Secure Energy Scenarios for the Indian Power Sector in 2030  

E-Print Network [OSTI]

Annual Energy Outlook 2010. Capital cost of solar thermalSolar Thermal (with storage) Solar PV (Rs Cr/MW) (Rs Cr/MW) Change 8.1.4.3 Energy

Abhyankara, Nikit

2014-01-01T23:59:59.000Z

244

E-Print Network 3.0 - atheriniformes atherinopsidae na Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(RS; bp), number of alleles (NA), average observed heterozygosity (HO), and average FIS and FST... This study Primer Sequence (5-3; Feldheim et al. in prep.) TA (C) RN RS...

245

Volume 6 Issue 1 www.nasa.gov/centers/stennis January 2011 Stennis completes initial AJ26 test series  

E-Print Network [OSTI]

partners Pratt & Whit- ney Rocketdyne on the RS-68 engine and with Orbital Sciences/Aerojet on the AJ26

246

RICHARD S. ELLIS PUBLICATIONS  

E-Print Network [OSTI]

. Soc., 177, 499-511 (1976). 5. The Solar Abundance of Titanium, Ellis, R.S., Solar Physics, 50, 261

Greer, Julia R.

248

Pg 1EC1x ver. 0107 ENVIRONMENTALCHAMBER  

E-Print Network [OSTI]

TYPES : chamber _________ user _________ DEFAULT PID HEAT: P= ________________ I= ________________ D ................................................................................................................ 9 REMOTE GPIB OR RS232/422 OPERATION

Wager, John F.

249

Council of Scientific & Industrial Research Human Resource Development Group  

E-Print Network [OSTI]

a consolidated fellowship of Indian Rs. 35,000/- per month plus House Rent Allowance (HRA) as admissible

Jayaram, Bhyravabotla

250

Vulnerabilidade socioeconmica ocorrncia de eventos extremos: proposta metodolgica.  

E-Print Network [OSTI]

- UFSM Av. Roraima, nº 1000 ­ 97105-900 ­ Santa Maria ­ RS, Brasil mariele.furlan@yahoo.com.br 2 Campus Brasil/CRECTEALC Caixa Postal 5021 - 97105-970 - Santa Maria - RS, Brasil lacruz@dsr.inpe.br 3 Instituto Nacional de Pesquisas Espaciais - INPE/CRS Caixa Postal 5021 - 97105-970 - Santa Maria - RS, Brasil tania

251

The Smokies through a New Lens the photographs of herbert m. webster  

E-Print Network [OSTI]

Crisis RS 143: Europe in the 19th Century RS 153: British Art, Diplomacy, and Football in the 18th-19th Century 11:30 ­ 12:30 Session III RS 141: Confronting Colonialism: Andeans and Meoamericans Defying of Confederate Prisoners at Camp Chase and Johnson's Island" Kate Silkowski: "It Always Feels Like Somebody

Wang, Xiaorui "Ray"

252

White Dwarfs in Binary Systems A white dwarf orbiting another star can become active  

E-Print Network [OSTI]

White Dwarfs in Binary Systems A white dwarf orbiting another star can become active when the other becomes incandescent. #12;H and He from the companion build up on the white dwarf's surface. Classical. Explosions from White Dwarf Star RS Oph #12;Classical Novae: RS Ophiuci Recurrent Nova RS Ophiuci Explosions

Barnes, Joshua Edward

253

NIAS PUBLICATIONS 2001-2011 No. REPORTS  

E-Print Network [OSTI]

in International Security: Exploring South Asian Initiatives, July 29-30, 1999 Rs.65/-Rs.65/- R1-03 Socio-Ecological of the Consultation held at NIAS on October 29 and 30, 2007) Rs.90/- R1-09 Iran's Safir Launch Vehicle Rajaram Nagappa

Udgaonkar, Jayant B.

254

Ragam: Bhairavi Talam: Adi (2 kalai)  

E-Print Network [OSTI]

pm G RS || Ba- - - la- go- - - paa- - - la- - - Paa- - - la- ya- - A - su- - - - maam- - - N ; SG R ; GR GM P ; ; ; D P | P ; ; ; dNd DP G G mpdp ,d pm G RS || Ba- - - la- go- - - paa- - - la- - - Paa ,d pp mG, RS || Ba- - - - - la- go- - - paa- - - la- - - Paa- - - la- ya- - A - su-- - - - maam

Kalyanaraman, Shivkumar

257

Infinitely many new partition Greg Warrington  

E-Print Network [OSTI]

(M) = Amax(r, s, n) - vVM v/sNout(v, M); mid(M) = Amax(r, s, n) - v,wVM Ein(v, M)Nin(w, M)(v w); ctot(M) = v homotopy H - H + H - H + x = 0 x = r/s x = r'/s' = = #12;Main Lemma [Loehr-W] For all positive rational r/s and all integers n 0, H+ r/s(n; t) = n t h+ r/s () = n t h- r/s () = H- r/s(n; t). #12;à la J. Sjöstrand

Warrington, Greg

258

BARRIER ISSUES TO THE UTILIZATION OF BIOMASS  

SciTech Connect (OSTI)

The Energy & Environmental Research Center (EERC) has completed a project to examine fundamental issues that could limit the use of biomass in small industrial steam/power systems in order to increase the future use of this valuable domestic resource. Specifically, the EERC attempted to elucidate the ash-related problems--grate clinkering and heat exchange surface fouling--associated with cofiring coal and biomass in grate-fired systems. Utilization of biomass in stoker boilers designed for coal can be a cause of concern for boiler operators. Boilers that were designed for low-volatile fuels with lower reactivities can experience problematic fouling when switched to higher-volatile and more reactive coal-biomass blends. Higher heat release rates at the grate can cause increased clinkering or slagging at the grate due to higher temperatures. Combustion and loss of volatile matter can start much earlier for biomass fuels compared to design fuel, vaporizing alkali and chlorides which then condense on rear walls and heat exchange tube banks in the convective pass of the stoker, causing noticeable increases in fouling. In addition, stoker-fired boilers that switch to biomass blends may encounter new chemical species such as potassium sulfates, various chlorides, and phosphates. These species in combination with different flue gas temperatures, because of changes in fuel heating value, can adversely affect ash deposition behavior. The goal of this project was to identify the primary ash mechanisms related to grate clinkering and heat exchange surface fouling associated with cofiring coal and biomass--specifically wood and agricultural residuals--in grate-fired systems, leading to future mitigation of these problems. The specific technical objectives of the project were: (1) Modification of an existing pilot-scale combustion system to simulate a grate-fired system. (2) Verification testing of the simulator. (3) Laboratory-scale testing and fuel characterization to determine ash formation and potential fouling mechanisms and to optimize activities in the modified pilot-scale system. (4) Pilot-scale testing in the grate-fired system. The resulting data were used to elucidate ash-related problems during coal-biomass cofiring and offer a range of potential solutions.

Bruce C. Folkedahl; Jay R. Gunderson; Darren D. Schmidt; Greg F. Weber; Christopher J. Zygarlicke

2002-09-01T23:59:59.000Z

259

BARRIER ISSUES TO THE UTILIZATION OF BIOMASS  

SciTech Connect (OSTI)

The Energy & Environmental Research Center (EERC) is conducting a project to examine the fundamental issues limiting the use of biomass in small industrial steam/power systems in order to increase the future use of this valuable domestic resource. Specifically, the EERC is attempting to elucidate the ash-related problems--grate clinkering and heat exchange surface fouling--associated with cofiring coal and biomass in grate-fired systems. Utilization of biomass in stoker boilers designed for coal can be a cause of concern for boiler operators. Boilers that were designed for low volatile fuels with lower reactivities can experience damaging fouling when switched to higher volatile and more reactive lower-rank fuels, such as when cofiring biomass. Higher heat release rates at the grate can cause more clinkering or slagging at the grate because of higher temperatures. Combustion and loss of volatile matter can start too early for biomass fuels compared to the design fuel, vaporizing alkali and chlorides which then condense on rear walls and heat exchange tube banks in the convective pass of the stoker, causing noticeable increases in fouling. In addition, stoker-fired boilers that switch to biomass blends may encounter new chemical species such as potassium sulfates and various chlorides, in combination with different flue gas temperatures because of changes in fuel heating value which can adversely affect ash deposition behavior. The goal of this project is to identify the primary ash mechanisms related to grate clinkering and heat exchange surface fouling associated with cofiring coal and biomass--specifically wood and agricultural residuals--in grate-fired systems, leading to future mitigation of these problems. The specific technical objectives of the project are: Modification of an existing EERC pilot-scale combustion system to simulate a grate-fired system; Verification testing of the simulator; Laboratory-scale testing and fuel characterization to determine ash formation and potential fouling mechanisms and to optimize activities in the modified pilot-scale system; and Pilot-scale testing in the grate-fired system. The resulting data will be collected, analyzed, and reported to elucidate ash-related problems during biomass-coal cofiring and offer a range of potential solutions.

Bruce C. Folkedahl; Darren D. Schmidt; Greg F. Weber; Christopher J. Zygarlicke

2001-10-01T23:59:59.000Z

260

PRODUCTION TEAM Team Leader: Julia C. White Publication Director: Dawn Levy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PRODUCTION TEAM PRODUCTION TEAM Team Leader: Julia C. White Publication Director: Dawn Levy Editors: Priscilla Henson, Dawn Levy Contributing Science Writers: Cheryl Drugan, Eric Gedenk, Kathryn Jandeska, Scott Jones, Dawn Levy, Caitlin Rockett, Leo Williams, Laura Wolf Graphic Designer: Jason Smith Reviewers: Arthur Bland, Susan Coghlan, James J. Hack, Bronson Messer, Paul Messina, Michael Papka, Katherine Riley, Julia C. White Advisors: Ashley Barker, Jayson Hines, David Martin CONTACT Julia C. White INCITE Manager Phone: 865-241-8796 whitejc@DOEleadershipcomputing.org The research described herein was made possible through awards of computer time provided through the Innovative and Novel Computational Impact on Theory and Experiment (INCITE) program. The research

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

TREKisM At Length 9: Tales From the Fourth Year Issue 9  

E-Print Network [OSTI]

, Florida ihe /nysTERy How separate the dancer from the dance? ^ Riley was at a loss even to contemplate the question. These paradoxical people had solved the age-old conundrum that Yeats had not dared to answer. In the perfect grace of this mysterious woman... and her acolytes, dancer and dance became one. She sprang between her crouching partners and unfolded toward the ceiling in an acropetal spin, clay on the potter's wheel finding its shape, and stopped the spin cold in mid-air as if the unseen hand from...

Willment, A.C.

1991-01-01T23:59:59.000Z

262

Source and distribution patterns of the Late Pleistocene-Holocene sands on the Central Texas-Louisiana continental shelf  

E-Print Network [OSTI]

COMPlEX Sco C ee 25 Table 1: SAND MINERALOGY, COLORADO RIVER SOURCE TERRANES (from Magenheimer, 1985) CRYSTALLINE ROCKS, LLANO UPLIFT Mq Pq Mica IRF SRF MRF Other Packsaddle Schist (3) Valley Spring Gneiss (3) Town Mountain Granite (4) Younger... Granite (I) 33 32 29 21 33 45 53 44 8 0 0 3 0 0 4 10 0 12 12 0 17 7 11 7 0 2 0 11 Nean, all rocks 30 5 5 0 7 6 CAMBRIAN-TRIASSIC SEDIMENTARY ROCKS, CENTRAL PLAINS Pq F Mica IRF SRF MRF Other Riley Formation (1) Strawn Group (2...

Reutter, David Christian

2012-06-07T23:59:59.000Z

263

METHANE de-NOX for Utility PC Boilers  

SciTech Connect (OSTI)

Large-scale combustion tests with caking bituminous coal has stopped. This stoppage has come about due to limitations in current funding available to continue large scale research and development activities at Riley's Commercial Burner Test Facility (CBTF) of the PC Preheat technology. The CBTF was secured and decommissioned in the previous quarter; work this quarter has focused on disposition of PC Preheat experimental equipment at the CBTF as well as methods for disposal of about 100 tons of residual PRB test coal in storage. GTI was granted a no-cost time extension through September 2005; a final report is due in December 2005.

Bruce Bryan; Joseph Rabovitser; Serguei Nester; Stan Wohadlo

2005-06-30T23:59:59.000Z

264

Fistuliporacean bryozoans of the Wreford megacyclothem (Lower Permian) of Kansas  

E-Print Network [OSTI]

. 279-280, pl. 12, fig. 4; pl. 21, fig. 1: pl. 26, fig. I; pl. 35, fig. 2. L=1:93 E3.63 RILEY & GEARY MORRIS & L [563WABAUNSEEPOTTAWATOMIE NEMAHA & MARSHALL OKLAHOMA 20 bed present bed questionably - present 111111111111111'1'INIVIIMION 11.... Cyclotrypa decora Moore & Dudley, 1944, Kansas Geol. Survey, Bull. 52, pt. 6, p. 275-276, pl. 5, fig. 8; pl. 10, fig. 7; pl. 18, fig. 1; pl. 24, fig. 1, 7; pl. 32, fig. 4. Cyclotrypa nebrascensis (Condra) Moore & Dudley, 1944, Kansas Geol. Survey, Bull. 52...

Warner, D. J.; Cuffey, Roger J.

1973-10-08T23:59:59.000Z

265

Fire and Ice Issue 3  

E-Print Network [OSTI]

,fpl ^1 FIRE AND ICE Available from: Kathleen Resch PO Box 1766 Temple City,CA 91780 III May, 1995 by Kathleen Resch for the contributors. No reprints or reproduction without the written permission of the author/artist. This is an amateur... publication and is not intended to infringe upon the rightsof "Blake's 7" copyright holders.. FIRE AND ICE TABLE OF CONTENTS THE GIFT by Pat Terra 1 "innerspace" by Pat Terra 24 WILD, BEAUTIFUL AND DAMNED by Gemini 25 SET THE NIGHT ON FIRE by Riley Cannon 40...

Multiple Contributors

1995-01-01T23:59:59.000Z

266

"We Shouldn't Be Forgotten": Korean Military Brides and Koreans in Kansas  

E-Print Network [OSTI]

(Lawton, OK), Fort Hood (Killeen, TX), and Fort Bliss (El Paso, TX). Many Koreans in many parts of the Midwest and Southwest in America are Korean women who migrated to the regions through exogamy to U.S. servicemen. 13 It is important to note... and Wichita. 3 Introduction Background On January 2, 1987, the Junction City Daily Union newspaper reported the first baby born during the New Year in the Junction City-Fort Riley area of Kansas. The new-born babys name was Kimberly Marie...

Kim, Sang Jo

2012-08-31T23:59:59.000Z

267

Insects of the Garden, With a Chapter on the Melon Louse and Other Aphids.  

E-Print Network [OSTI]

appear suddenly in great swarms, and in a short FIG. 17-False Chinch Bug (Nysius angustatus) ; a, part of small leaf of potato showing punctures of the bug; b, last stage of nymph; c, adult; a, natural size; b, c, much enlarged. (After Riley, Division... of Entomology). * time lay waste turnips, mustards and other cruciferous plants, and gen- erally disappear as suddenly as they came. We have as yet found no remedy that is practicable. Early in the morning they are in the soil at the base of the plants...

Conradi, Albert F. (Albert Frederick); Sanborn, C. E.

1906-01-01T23:59:59.000Z

268

Exploratory Well At Raft River Geothermal Area (1977) | Open Energy  

Open Energy Info (EERE)

7) 7) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Exploratory Well At Raft River Geothermal Area (1977) Exploration Activity Details Location Raft River Geothermal Area Exploration Technique Exploratory Well Activity Date 1977 Usefulness not indicated DOE-funding Unknown Notes Raft River Geothermal Exploratory Hole No. 4, RRGE-4 drilled. During this time Raft River geothermal exploration well sidetrack-C also completed. References Kunze, J. F.; Stoker, R. C.; Allen, C. A. (14 December 1977) Update on the Raft River Geothermal Reservoir Covington, H.R. (1 January 1978) Deep drilling data, Raft River geothermal area, Idaho-Raft River geothermal exploration well sidetrack-C Retrieved from "http://en.openei.org/w/index.php?title=Exploratory_Well_At_Raft_River_Geothermal_Area_(1977)&oldid=473847"

269

CX-000212: Categorical Exclusion Determination | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

12: Categorical Exclusion Determination 12: Categorical Exclusion Determination CX-000212: Categorical Exclusion Determination Biomass Energy Generation Project CX(s) Applied: B3.6 Date: 11/30/2009 Location(s): Cedar Falls, Iowa Office(s): Energy Efficiency and Renewable Energy, Golden Field Office Cedar Falls Utilities (CFU) will purchase and transport biomass feedstocks to their Cedar Falls Utilities Streeter Station power plant in Cedar Falls, Iowa. The feedstocks will be combusted within an existing electric generation unit. They will conduct a (ten day duration) test burn to determine the compatibility of the combustion of biofuels in a stoker fired Electric Generation Unit originally designed to burn coal. DOCUMENT(S) AVAILABLE FOR DOWNLOAD CX-000212.pdf More Documents & Publications Assessment of Biomass Pelletization Options for Greensburg, Kansas

270

Limestone and Ash Storage Silos and Lime Preparation Equipment, Part  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Limestone and Ash Storage Silos and Lime Preparation Equipment, Part Limestone and Ash Storage Silos and Lime Preparation Equipment, Part of the System to Inject Limestone Sorbent for SO, Control. Nucla, CO Nucla...continued Before being repowered, the plant consisted of three 12 MWe coal stoker- fired units built in 1959, which were taken out of service in 1984 due to low efficiency and high fuel cost. Antici- pating a need for additional power in the early 1990s. and after review of many power generation alternatives, CUEA started constmction of the re- powered Nucla CFB plant in Novem- ber 1984 and completed the project in May 1987. The original boilers were replaced with a new Fympower Corp. CFB bailer, a new high pressure 74 MWe steam turbine generator was installed, the three original 12 MWe steam turbines were

271

NETL Final Report Outline  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sensor Evaluation for a Robotic In Line Inspection Vehicle for Sensor Evaluation for a Robotic In Line Inspection Vehicle for Detection of Natural Gas Pipeline Defects and Leaks Final Report February 2003 Submitted by Michael Hassard and Gerald Stoker Advanced Diagnostics and Production Testing Department Sandia National Laboratories P.O. Box 5800, MS 0555 And Mark Vaughn and Bob Bickerstaff Mobile Robotics Department Sandia National Laboratories P.O. Box 5800, MS1125 Albuquerque, NM 87185 This work was sponsored by The Strategic Center for Natural Gas Natural Gas Infrastructure Reliability Program, Natural Energy Technology Laboratory (NETL), DOE Office of Fossil Energy ABSTRACT When examining the condition of a pipeline, In-Line Inspection (ILI) utilizing various Non-Destructive Testing (NDT) methods is an essential tool and a significant factor in establishing a quality management

272

Review of concurrent mass emission and opacity measurements for coal-burning utility and industrial boilers. Final report Aug 79-Feb 80  

SciTech Connect (OSTI)

The report gives results of concurrent particulate emissions and opacity measurements based on visual observations and/or in-stack transmissometry for more than 400 compliance, acceptance, or experimental tests on coal-fired utility and industrial boilers. The sampling, which includes a capacity range of a few to several hundred megawatts and typical firing methods (pulverized, stoker, and cyclone), in most cases reflects flyash control by electrostatic precipitation, although filters or mechanical collectors were used at a few installations. All opacity measurements were standardized to their equivalent values for a 4 m (13.0 ft) diameter stack before being compared with their corresponding particulate emissions, the latter expressed as actual grams per cubic meter. No discernible correlations applicable to all sources were observed, although some modest (but apparently significant) correlations were noted on an individual source basis. Report findings were sufficiently encouraging to warrant further analyses relating to in-stack transmissometer measurements.

Brennan, R.J.; Dennis, R.; Roeck, D.R.

1980-03-01T23:59:59.000Z

273

Fluidized-bed boiler assessment for Navy applications. Final report, October 1983-September 1985  

SciTech Connect (OSTI)

This report discusses the assessment of one of the most-promising coal-firing technologies - Fluidized-Bed Combustion(FBC) - for Navy stationary boilers. The working principles, physical construction, major and auxiliary components, and system performance of an FBC boiler are described and compared with the conventional stoker and pulverized-coal fired boilers. The advantages of the FBC boiler based on fuel flexibility, operational reliability, economic feasibility, and environmental acceptability are identified, state-of-development and FBC manufacturers are also noted. The problems with the Great Lakes FBC boiler plant were studied and possible remedial measures are given. Considerations for FBC retrofitting have been examined based on boiler size, age, configuration, accessory components, and available space. Recommendations on how to achieve the Navy's goal of coal utilization by the FBC approach are outlined.

Fu, T.T.; Maga, G.F.

1986-11-01T23:59:59.000Z

274

Accomplishments of the American-Polish program for elimination of low emissions in Krakow  

SciTech Connect (OSTI)

Since 1990 the US Department of Energy (DOE) has been involved in a program aimed at reducing air pollution caused by small, coal-fired sources in Poland. The activity is focused on the city of Cracow, Poland with the intention that results will be applicable and extendable to the entire region. The effort under this program has been focused into 5 main areas of interest as follows: (1) energy conservation and extension of central station district heating; (2) replacement of coal- and coke-fired boilers with natural gas-fired boilers; (3) replacement of coal-fired home stoves with electric heating appliances; (4) reduction of emissions from stoker-fired boiler houses; and (5) reduction of emissions from coal-fired home heating stoves.

Butcher, T.A.; Pierce, B.

1998-12-31T23:59:59.000Z

275

Search for the production of single sleptons through R-parity violation in p(p)over-bar collisions at root s=1.8 TeV  

E-Print Network [OSTI]

. Miettinen, 60 D. Mihalcea, 37 C. S. Mishra, 35 N. Mokhov, 35 N. K. Mondal, 17 H. E. Montgomery, 35 R.W. Moore, 49 M. Mostafa, 1 H. da Motta, 2 Y. D. Mutaf, 53 E. Nagy, 10 F. Nang, 28 M. Narain, 46 V. S. Narasimham, 17 N. A. Naumann, 21 H. A. Neal, 48 J. P.... Steinbru?ck, 51 R.W. Stephens, 58 D. Stoker, 32 V. Stolin, 23 A. Stone, 44 D. A. Stoyanova, 25 M. A. Strang, 58 M. Strauss, 56 M. Strovink, 29 L. Stutte, 35 A. Sznajder, 3 M. Talby, 10 W. Taylor, 53 S. Tentindo-Repond, 34 S. M. Tripathi, 30 T. G. Trippe, 29...

Baringer, Philip S.; Bean, Alice; Coppage, Don; Hebert, C.

2002-12-01T23:59:59.000Z

276

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

60,"Monthly","9/2013","1/15/1981" 60,"Monthly","9/2013","1/15/1981" ,"Release Date:","11/27/2013" ,"Next Release Date:","Last Week of December 2013" ,"Excel File Name:","pet_stoc_typ_d_nus_skr_mbbl_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_stoc_typ_d_nus_skr_mbbl_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"11/25/2013 11:41:32 AM" "Back to Contents","Data 1: U.S. Refinery " "Sourcekey","MTTRSUS1","MCRRSUS1","MPERSUS1","MPPRSUS1","MLPRSUS1","METRSUS1","MPRRSUS1","MBNRSUS1","MBIRSUS1","M_EPOOOXH_SKR_NUS_MBBL","M_EPOOXXFE_SKR_NUS_MBBL","MMTRSUS1","MOORSUS1","M_EPOOR_SKR_NUS_MBBL","MFERSUS1","M_EPOORD_SKR_NUS_MBBL","M_EPOORO_SKR_NUS_MBBL","MUORSUS1","MNLRSUS1","MKORSUS1","MH1RSUS1","MRURSUS1","MBCRSUS1","MO1RS_NUS_1","M_EPOBGRR_SKR_NUS_MBBL","MO3RS_NUS_1","MO4RS_NUS_1","MO5RS_NUS_1","MO6RS_NUS_1","MO7RS_NUS_1","MO9RS_NUS_1","MBARSUS1","MGFRSUS1","MGRRSUS1","MG1RS_NUS_1","M_EPM0RO_SKR_NUS_MBBL","MG4RS_NUS_1","MG5RS_NUS_1","M_EPM0CAL55_SKR_NUS_MBBL","MG6RS_NUS_1","MGARSUS1","MKJRSUS1","MKERSUS1","MDIRSUS1","MD0RS_NUS_1","MD1RS_NUS_1","MDGRSUS1","MRERSUS1","MRLRSUS1","MRMRSUS1","MRGRSUS1","MPCRS_NUS_1","MNFRSUS1","MOTRSUS1","MNSRSUS1","MLURSUS1","MWXRSUS1","MCKRSUS1","MAPRSUS1","MMSRSUS1"

277

Coal combustion and cogeneration at New York Institute of Technology, Central Islip campus. Final report. [NYIT CI campus  

SciTech Connect (OSTI)

The purpose of this project is to study the technical and economic feasibility of conversion to coal with possible implementation of cogeneration at the central power plant of the New York Institute of Technology Central Islip (NYIT CI) campus. The existing facility contains five moderate pressure (155 psig) 60,000 pph boilers installed in 1953-1954 which were originally designed for coal firing. Among the several systems assessed, three potential projects were identified as having economic merit and conceptual designs for their implementation were developed. The final decision as to which should be pursued must await a final determination of environmental issues related to sulfur dioxide emissions and manufacturer recommendations on the ability to reconvert one of the existing boilers back to coal. The three projects, in order of economic merit, are as follows: (1) reconversion of one of the existing 60,000 pph stoker boilers back to firing coal; (2) installation of a new 60,000 pph stoker fired, high pressure coal boiler with a 2300 kW backpressure steam turbine, the turbine to provide some cogeneration capability. Compliance, low sulfur, coal is to be burned; (3) installation of a new 50,000 pph, low pressure, firetube, fluidized bed combustion (FBC), boiler burning high sulfur coal but including sulfur dioxide capture. The first two projects are predicated on the burning of a compliance, low sulfur, coal. This may be allowed under ''grandfather'' clauses in the regulations that permit such burning in boilers that once fired coal. If not permitted, the installation of the low pressure FBC boiler would be the only remaining viable coal conversion option. Though it has a smaller payback, it still provides significant savings to the college.

Not Available

1984-04-01T23:59:59.000Z

278

Cofiring waste biofuels and coal for emissions reduction  

SciTech Connect (OSTI)

Combustion tests have been performed in two pilot-scale combustion facilities to evaluate the emissions reduction possible while firing coal blended with several different biofuels. Two different boiler simulations, pulverized coal fired boilers and stoker coal fired boilers, were simulated. The pc-fired studies investigated the use of waste hardwood and softwood with pulverized coal, or using the biofuels as potential reburning fuels. The use of these wood waste is attractive because: wood contains little nitrogen and virtually no sulfur; wood is a regenerable biofuel; and wood utilization results in a net reduction in CO{sub 2} emissions. The wood reburning results indicate a reduction of 50-60% NO with approximately 10% wood heat input. Reburn stoichiometry was the most important variable. The NO reduction was strongly dependent upon initial NO and only slightly dependent upon temperature and wood moisture content. Cofiring of wood with pulverized coal; however, did not lead to significant NO reductions with the current NO{sub x} burner configuration. The stoker program investigated barriers for the successful blending of coal with waste railroad ties. Parameters evaluated included blending firing rate, chip size, optimum feed location, overfire/underfire air ratio, and natural gas addition. The results of this study demonstrate that NO emissions can be reduced by more than 50% without any significant increase in CO or THC emissions by the proper use of zoned reburning. Both programs demonstrated several benefits of biofuel cofiring, including: (1) lower operating costs due to reduced fuel prices; (2) reduced waste disposal; (3) reduced maintenance costs; (4) reduced environmental costs; and (5) extension of the useful life of existing equipment.

Brouwer, J.; Owens, W.D.; Harding, N.S. [Reaction Engineering International, Salt Lake City, UT (United States)] [and others

1995-11-01T23:59:59.000Z

279

Asymptotic dynamics of inertial particles with memory  

E-Print Network [OSTI]

Recent experimental and numerical observations have shown the significance of the Basset--Boussinesq memory term on the dynamics of small spherical rigid particles (or inertial particles) suspended in an ambient fluid flow. These observations suggest an algebraic decay to an asymptotic state, as opposed to the exponential convergence in the absence of the memory term. Here, we prove that the observed algebraic decay is a universal property of the Maxey--Riley equation. Specifically, the particle velocity decays algebraically in time to a limit that is $\\mathcal O(\\epsilon)$-close to the fluid velocity, where $0<\\epsilon\\ll 1$ is proportional to the square of the ratio of the particle radius to the fluid characteristic length-scale. These results follows from a sharp analytic upper bound that we derive for the particle velocity. For completeness, we also present a first proof of existence and uniqueness of global solutions to the Maxey--Riley equation, a nonlinear system of fractional-order differential equations.

Gabriel Provencher Langlois; Mohammad Farazmand; George Haller

2014-09-02T23:59:59.000Z

280

Asymptotic dynamics of inertial particles with memory  

E-Print Network [OSTI]

Recent experimental and numerical observations have shown the significance of the Basset--Boussinesq memory term on the dynamics of small spherical rigid particles (or inertial particles) suspended in an ambient fluid flow. These observations suggest an algebraic decay to an asymptotic state, as opposed to the exponential convergence in the absence of the memory term. Here, we prove that the observed algebraic decay is a universal property of the Maxey--Riley equation. Specifically, the particle velocity decays algebraically in time to a limit that is $\\mathcal O(\\epsilon)$-close to the fluid velocity, where $0<\\epsilon\\ll 1$ is proportional to the square of the ratio of the particle radius to the fluid characteristic length-scale. These results follows from a sharp analytic upper bound that we derive for the particle velocity. For completeness, we also present a first proof of existence and uniqueness of global solutions to the Maxey--Riley equation, a nonlinear system of fractional-order differential equ...

Langlois, Gabriel Provencher; Haller, George

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

A Global Database of Soil Respiration Data, Version 2.0  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Home > Data > Regional/Global > Soil Collections > Guide Document Home > Data > Regional/Global > Soil Collections > Guide Document A Global Database of Soil Respiration Data, Version 2.0 Get Data Revision date: February 24, 2012 Summary This data set provides an updated soil respiration database (SRDB), a near-universal compendium of published soil respiration (RS) data. Soil respiration, the flux of autotrophically- and heterotrophically-generated CO2 from the soil to the atmosphere remains the least well-constrained component of the terrestrial C cycle. The database encompasses all published studies that report at least one of the following data measured in the field (not laboratory): annual RS, mean seasonal RS, a seasonal or annual partitioning of RS into its sources fluxes, RS temperature response (Q10), or RS at 10 degrees C. SRDB's orientation is thus to seasonal and

282

Parallel Linkage Hung-sik Kim1 hungsik@psu eduHung-sik Kim hungsik@psu.edu  

E-Print Network [OSTI]

@psu.edu 1Computer Science and Engineering 2Information Sciences and Technology The Pennsylvania State Set characteristic Clean set o A is clean iff r,s A, r s Dirty set o A is dirty iff r,s A, rs O(|A||B|) CIKM 2007 / Parallel Linkage 5 Input data sets Clean vs. Clean A B Dirty vs. Clean A B Dirty vs. Dirty

Lee, Dongwon

283

Ragam: Vasanta Talam: Rupakam  

E-Print Network [OSTI]

("amma"). Sri Rama is my father ("tandri").] S ; ; M ; M || mM , ; mg R rs || See - tham - ma Maa- - yam- - ma- S ; ; M ; M || gm D M - mg R rs || See - tham - ma Maa- - yam- - ma- S ; ; M ; M || gm dn sn- dm M M || See - tham - ma Maa- - yam- - ma- ; S S ; S S || D ; M ­ gm g ­ rs n || Sri Raa mudu Maa ku

Kalyanaraman, Shivkumar

284

Transmission Information  

E-Print Network [OSTI]

Memoryless source with independent symbols (code each symbol by log 2 q bits is called binary coded decimal (BCD)) mi, pi 1 # i # q # # # # BCD: log 2 q (bits/symbol) symbol rate Rs (symbols/s) data bit rate: Rs/symbol) Information rate R = Rs ·H (bits/s) . How to code symbols to achieve e#ciency (data bit rate = R)? 14 #12

Chen, Sheng

286

Kemiteknik -Vrme-och strmningsteknik Processteknikens grunder (PTG) 2014  

E-Print Network [OSTI]

detta tillstånd återförs gasen till tillstånd "0" genom att utbyta arbete W3 med en annan process. a

Zevenhoven, Ron

287

E-Print Network 3.0 - arqueologicas da bacia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Moreira Procpio Calazans Summary: paisagem da bacia hidrogrfica do rio Forqueta, RS, Brasil 1267 Alessandra Ribeiro de Moraes... similaridade e rea de pixels sobre a tcnica...

288

E-Print Network 3.0 - aptiano superior bacia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Vieira Capobiango... paisagem da bacia hidrogrfica do rio Forqueta, RS, Brasil 1267 Alessandra Ribeiro de Moraes... similaridade e rea de pixels sobre a tcnica...

289

INDIAN INSTITUTE OF TECHNOLOGY BOMBAY NOTICE INVITATING TENDER  

E-Print Network [OSTI]

than Rs.102 Lakhs, and II)one work of any nature(either part of (I) above or a separate one) costing

Narayanan, H.

290

E-Print Network 3.0 - axon terminals contacting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

indicated that axonal spines are contacted by presynaptic gluta... GluRs to enter the axonal domain. Dendritic spines ... Source: Hogan, Brigid L.M. - Department of...

291

Mass and First Law for Static Asymptotically Randall-Sundrum Black Holes  

E-Print Network [OSTI]

We give a new, intrinsic, mass definition for spacetimes asymptotic to the Randall-Sundrum braneworld models, RS1 and RS2. For this mass, we prove a first law for static black holes, including variations of the bulk cosmological constant, brane tensions, and RS1 interbrane distance. Our first law defines a thermodynamic volume and a gravitational tension that are braneworld analogs of the corresponding quantities in asymptotically AdS black hole spacetimes and asymptotically flat compactifications, respectively. This paper is the first in a series on asymptotically RS black holes.

Scott Fraser; Douglas M. Eardley

2014-09-04T23:59:59.000Z

292

manavyAlakinca Ragam: Nalinakanti {27th Melakartha (Sarasangi) Janyam}  

E-Print Network [OSTI]

appeal (manavini) (manavinAlakinca)? 1 2 3 4 5 6 7 8 ; ; ; M M ­ mg R S | G ; ; -rs | G ; ; rs || Ma na vyA - a kin - ca- rA- - da- #12;G ; ,r- M M ­ mg R S | G ; ; -rs | G ; ; rs || tE -- Ma na vyA - a kin - ca- rA- - da- G ; ,r- P M ­ mg gr S | G ; ; -gr | M ; ; gr || tE -- Ma na vyA - - a kin - ca- r

Kalyanaraman, Shivkumar

293

LuIZ ANDR BARROSO & HANDHELD + LANDHELD =  

E-Print Network [OSTI]

16 LuIZ ANDRé BARROSO & uRS HöLZLE HANDHELD + LANDHELD = CLOuD COMPuTING The machinery that powers

Barroso, Luiz André

294

REQUEST FOR RECORDS DISPOSITION AUTHORITY | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

RS-Weapons X-Rays REQUEST FOR RECORDS DISPOSITION AUTHORITY More Documents & Publications REQUEST FOR RECORDS DISPOSITION AUTHORITY REQUEST FOR RECORDS DISPOSITION AUTHORITY...

295

An origin of the radio jet in M87 at the location of the central black hole  

Science Journals Connector (OSTI)

... and the structure of its jet has been probed on a scale of about 100 Schwarzschild radii (Rs, the radius of the event horizon). However, the location of ...

Kazuhiro Hada; Akihiro Doi; Motoki Kino; Hiroshi Nagai; Yoshiaki Hagiwara; Noriyuki Kawaguchi

2011-09-07T23:59:59.000Z

296

E-Print Network 3.0 - access communication datac Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

electronic devices in a general fashion. It allows the devices to communicate... Service RF Radio Frequency RS-232 Interface Between Data Terminal Equipment and Data...

297

E-Print Network 3.0 - akirin gene family Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

two species, apparently due to frequent gene duplication... found to be a family of V1rs (Rodriguez et al., 2002). ... Source: Zhang, Jianzhi - Department of Ecology and...

298

E-Print Network 3.0 - arthroscopic instability repair Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

arthroscopically... of arthroscopic rotator cuff repairs: double-row ... Source: Holzbau, Katherine R.S. - Department of Biomedical Engineering, Wake Forest University Collection:...

299

E-Print Network 3.0 - arthroscopes Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2004. The outcome and repair integrity of completely arthroscopically Source: Holzbau, Katherine R.S. - Department of Biomedical Engineering, Wake Forest University Collection:...

300

E-Print Network 3.0 - arthroscopically repaired rotator Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Surg. Am. 88... 's personal copy Postural dependence of passive ... Source: Holzbau, Katherine R.S. - Department of Biomedical Engineering, Wake Forest University Collection:...

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

E-Print Network 3.0 - alloy plates changing Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solidified (RS) Mg-3Ca alloy Source: Zheng, Yufeng - Department of Advanced Materials and Nanotechnology, Peking University Collection: Materials Science ; Biology and Medicine 7...

302

E-Print Network 3.0 - altitude simulation technologies Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Air Traffic Management Research and Development Seminar (ATM2009) A Comparison of Algorithm Generated Summary: and constrained simulations. Super-high altitude average (r)s are...

303

E-Print Network 3.0 - al alloy matrices Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(RS) Mg-3Ca alloy Source: Zheng, Yufeng - Department of Advanced Materials and Nanotechnology, Peking University Collection: Materials Science ; Biology and Medicine 2 JOURNAL...

304

E-Print Network 3.0 - aminoacyl trna synthetases Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by any endogenous aminoacyl-tRNA synthetase... RS and is not ... Source: Magliery, Thomas J. - Departments of Chemistry & Biochemistry, Ohio State University Collection: Biology...

305

E-Print Network 3.0 - acquired immunologic tolerance Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Martin*,1 Summary: (avoidance, resistance, clearance, tolerance and acquired immunity; (Boots et al. 2009); (ii) why diversity... -Biological Sciences, 270, 1679-1683. Baucom, R.S....

306

HCI Adsorption and Ionization on Amorphous and Crystalline H2O...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

65, 2014041 using synchrotron-based electron spectroscopy Citation: Ayotte P, P Marchand, JL Daschbach, RS Smith, and BD Kay.2011."HCI Adsorption and Ionization on Amorphous...

307

Investment and Upgrade in Distributed Generation under Uncertainty  

E-Print Network [OSTI]

S. Irreversible investment in alternative projects. Economice Dixit, AK, Pindyck, RS. Investment under uncertainty.Maribu, KM, Wangensteen, I. Optimal investment strategies in

Siddiqui, Afzal

2008-01-01T23:59:59.000Z

308

Distributed Generation Investment by a Microgrid under Uncertainty  

E-Print Network [OSTI]

KM. Distributed generation investment and upgrade underin gas fired power plant investments. Review of Financial13] Dixit AK, Pindyck RS. Investment under uncertainty.

Siddiqui, Afzal

2008-01-01T23:59:59.000Z

309

Indigenous Algorithms, Organizations, and Rationality  

E-Print Network [OSTI]

motor and the recharge rate of the well is high enough that he can supply waterfarmer. Rate for water is Rs. 15/hr. 20 hp. motor. One acre

Leaf, Murray

2008-01-01T23:59:59.000Z

310

Approved for Public Release; Further Dissemination Unlimited  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Supported DWF&RS in the procurement of a custom "Firmanite" strong-back and epoxy patch material for temporary repair of the Effluent Treatment Facility evaporator heat...

311

E-Print Network 3.0 - agn accretion disks Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Accretion disk? (pc Rs) 12; Accretion flow surrounded by dusty torus BB... ) The inclination of the accretion ... Source: Evans, Daniel A. - Kavli Institute for...

312

NREL: Biomass Research - Seonah Kim, Ph.D.  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Publications Kim, S.; Sandgren, M.; Sthlberg, J.; Paton, R.S.; Beckham, G.T. (2014). "Quantum mechanical calculations suggest that lytic polysaccharide monooxygenases use...

313

ENERGY-EFFICIENT NEW COMMERCIAL BUILDINGS IN THE NORTHWEST REGION: A COMPILATION OF MEASURED DATA  

E-Print Network [OSTI]

Solar P2: PRIMARY HEATING EQUIPMENT DESCRIPTION: RS Resistance (electric) HP Heat Pump BO Boiler IR Infrared (used in warehouses) FR Furnace

Piette, M.A.

2010-01-01T23:59:59.000Z

314

Photovoltaics at DOE's National Renewable Energy Laboratory License...  

Broader source: Energy.gov (indexed) [DOE]

(PV) power purchase agreement (PPA). nrelpvlicense.pdf More Documents & Publications USA RS Basic Contract - Contract No.: DE-RW0000005 Aligned Partnerships OPAM Policy...

315

Microsoft Word - Cross Reference Matrix Introduction.doc | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Matrix Introduction.doc More Documents & Publications Quality Assurance Requirements USA RS Basic Contract - Contract No.: DE-RW0000005 Office of Civilian Radioactive Waste...

316

E-Print Network 3.0 - arthroscopic suprascapular nerve Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

axillary and suprascapular ... Source: Holzbau, Katherine R.S. - Department of Biomedical Engineering, Wake Forest University Collection: Biology and Medicine ; Engineering 2...

317

King's College London University Of London  

E-Print Network [OSTI]

to 1 0.5 · n log 1 + 0.5 · rs 6nm n = 2 log (1 + 0.5 · rs 6nm) . (1) (b) What is the forward rate f18,6 for the 6-month period beginning in 18 months? Answer: The rate f18,6 is obtained from the equation: 1 + 0.5 · f18,6 = 1 + 0.5 · rs 2y 4 1 + 0.5 · rs 18m 3 (2) (c) What is the value of an FRA that promises

Albanese, Claudio

318

Pr-Reitoria de Pesquisa e Ps-Graduao -PROPPG Programa de Ps-Graduao em Desenvolvimento Regional -PPGDR  

E-Print Network [OSTI]

- Brasil) Prof. Dr. José Cadima Ribeiro (Universidade do Minho - Portugal) Prof. Dr. Jorge Luiz Alves Natal (UFRJ - RJ - Brasil) Prof. Dr. Jose Antonio Fialho Alonso (FEE - RS - Brasil) Prof. Dr. José Eduardo Faria (USP - SP - Brasil) Prof. Dr. Luiz Felipe Nascimento (UFRGS - RS - Brasil) Prof. Dr. Martin Coy

Paris-Sud XI, Université de

319

Concentrations of Ephedra Alkaloids and Caffeine in Commercial Dietary Supplements  

Science Journals Connector (OSTI)

......RippedFuel Twin Labs.Inc. 9CU050 capsule Internet(RS) L3 RippedFuel Twin Labs.Inc...Orange Next Nutr.Inc. 18913902 powder Internet(RS) M3 Ultimate Orange Next Nutr...DA012393(National Institutes on Drug Abuse). References I. Centersfor DiseaseControl......

Christine A. Haller; Minjing Duan; Neal L. Benowitz; Peyton Jacob; III

2004-04-01T23:59:59.000Z

320

Overexpression of the maize Corngrass1 microRNA prevents flowering, improves digestibility, and increases starch content of switchgrass  

Science Journals Connector (OSTI)

...accumulates in stems.Cg1 switchgrass aerial stems store starch and initiate both roots...maize . Plant Cell 6 : 1343 1355 . 28 Fukushima RS Hatfield RD ( 2004 ) Comparison of the acetyl bromide...CAAGTGCTACGGCAAGGAGG CGTGAGGGTCATTGTCTTCTGC 1. Fukushima RS, Hatfield RD (2004) Comparison...

George S. Chuck; Christian Tobias; Lan Sun; Florian Kraemer; Chenlin Li; Dean Dibble; Rohit Arora; Jennifer N. Bragg; John P. Vogel; Seema Singh; Blake A. Simmons; Markus Pauly; Sarah Hake

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

IEEE TRANSACTIONS ON MAGNETICS, VOL. 43, NO. 2, FEBRUARY 2007 721 Design Curves and Information-Theoretic Limits  

E-Print Network [OSTI]

-squared error (MMSE) equalizer, a Viterbi detector, and a Reed­Solomon (RS) code. Our main conclusion et al. [1] proposed a quasi-analytical methodology to optimize the system for a channel model-squared error (MMSE) equalizer, a maximum-likelihood detector, and a Reed­Solomon (RS) error-correcting code

Siegel, Paul H.

322

Lazy Means Smart: Reducing Repair Bandwidth Costs in Erasure-coded Distributed Storage  

E-Print Network [OSTI]

- ditional bandwidth savings. 1. INTRODUCTION Erasure coding schemes, e.g. Reed-Solomon (RS) codes on the example of Reed-Solomon codes, and then explain the repair bandwidth problem. In an RS(n,k) stor- age scheme. 4. EVALUATION METHODOLOGY Evaluating the efficacy of lazy recovery in reducing repair bandwidth

Alvisi, Lorenzo

323

Introduction to special section: Recent Advances in Studies of Schumann Resonances on Earth and Other Planets of the Solar  

E-Print Network [OSTI]

Introduction to special section: Recent Advances in Studies of Schumann Resonances on Earth in Studies of Schumann Resonances on Earth and Other Planets of the Solar System, Radio Sci., 41, RS2S01, doi:10.1029/2006RS003576. [printed 42(2), 2007] [1] Schumann resonances are global electromagnetic

Pasko, Victor

324

Dose characterization of the rad source 2400 x-ray irradiator  

E-Print Network [OSTI]

The RS 2400 irradiator has been looked to as a replacement for discontinued gamma irradiators. The RS 2400 has a cylindrical, rather than point, x-ray source, which yields higher dose rates. The irradiator unit allows the user to set the current...

Wagner, Jennifer Ann Koop

2009-05-15T23:59:59.000Z

325

Simulink Implementation of Induction Machine Model A Modular Approach  

E-Print Network [OSTI]

x R Fv dt dF (3) ( ) ( )-+ - += drmd lr r qr b re drb dr FF x R Fv dt dF (4) vqs vqr Rs Lls=Ls-Lm Llr=Lr-Lm Rr iqs iqr Lm + - +- e ds (e -r )dr vds vdr Rs Lls=Ls-Lm Llr =Lr -Lm Rr ids idr Lm +- + - e

Tolbert, Leon M.

326

OSU-N History Department Faculty: Dr. Russ Coil  

E-Print Network [OSTI]

Schedule Morning ­ OSU-N Student Presentations 9:00 ­ 10:00 Session I RS 141: Cherokee Indians: Removal, Historian: "The Sultana Disaster" #12;Session I: 9:00 ­ 10:00 Cherokee Indians: Removal, Religion, and Justice Room: RS 141 Facilitator: Dr. Lucy Murphy Presenters and Titles: Derek Martin: "The Cherokee Court

Jones, Michelle

327

Laboratory for Advanced Materials Processing University of Maryland http://www.enma.umd.edu/LAMP  

E-Print Network [OSTI]

) = Rs x (L / W), with Rs: sheet resistance of a layer of this material The sheet resistance is expressedLaboratory for Advanced Materials Processing � University of Maryland http Operating Procedure for LAMP four point probe sheet resistance measurements Overview of 4 point probe

Rubloff, Gary W.

328

Formation of the radio jet in M87 at 100 Schwarzschild radii from the central black hole  

Science Journals Connector (OSTI)

... 60 near the centre, with strong collimation of the jet occurring at ?30100 Schwarzschild radii (rS) from the black hole: collimation continues out to ?1,000?rS ... constant, M is the black-hole mass, and c the speed of light; the Schwarzschild radius is the radius of the event horizon, the boundary of a black ...

William Junor; John A. Biretta; Mario Livio

1999-10-28T23:59:59.000Z

329

The application of interferometry to optical astronomical imaging  

Science Journals Connector (OSTI)

...two of the array elements (in this case siderostat-fed two-mirror telescopes) are shown here. CCD, charge-coupled device...compact component, i.e. one located within some number of Schwarzschild radii, Rs, from the central black hole (Rs = 2GM=c2...

2002-01-01T23:59:59.000Z

330

Transformation of point rainfall to areal rainfall by estimating areal reduction factors, using radar data, for Texas  

E-Print Network [OSTI]

Figure 11. Texas Regions Chart TPWD, 2004, Austin..................................................... 80 Figure 12. Region 1 ? Panhandle Plains........................................................................... 81 Figure 13. Region 2 ? Prairies...........119 Figure 33. Variation of RS1 for (a) 1996 (b) 1997 (c) 1998 (d) 1999 (e) 2000 (f) 2001 (g) 2002 (h) 2003 (i) 2004. .......................................................................... 120 Figure 34. Scatter Plots for Region 1 (a) RS1 and RC1 (b...

Gill, Tarun Deep

2005-08-29T23:59:59.000Z

331

volume 3, No.1 WiNter 2009 Dean's message  

E-Print Network [OSTI]

and computer science? In this issue of Engineering Vistas, you'll see how a degree from the UTEP College. And the development of top tier research programs has begun in advanced manufacturing and materials, through ourTRepReneuRs fouR geneRATions of mineRs A passion for flying, along with innovative ideas, led recent graduates

Ward, Karen

332

IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS--II: EXPRESS BRIEFS, VOL. 53, NO. 11, NOVEMBER 2006 1245 Area-Efficient VLSI Design of ReedSolomon  

E-Print Network [OSTI]

architecture of the RS decoder by using a novel just-in-time folding modified Euclidean algorithm (JIT-FMEA). The JIT-FMEA VLSI architecture can greatly reduce the hardware complexity by about 50% compared-in-time folding modified Euclidean algorithm (JIT-FMEA), key equation solver (KES), Reed­Solomon (RS) codec, 10

Hung, Shih-Hao

333

Changes of Land Use and Landscape Pattern in Feicheng Coal Mining Area Based on Remote Sensing  

Science Journals Connector (OSTI)

The spatial changes of landscape pattern of Feicheng Coal Mining Area were analyzed in order to improve landscape and ecological environment quality and to guarantee sustainable development in mining areas. Methods employed include RS, GIS, and landscape ... Keywords: Feicheng Coal Mining Area, landscape pattern, RS, landscape pattern index, dynamics analysis

Lu Yanyan; Li Xinju; Guo Suli; Wang Mei

2011-10-01T23:59:59.000Z

334

Wrapper An Application for Use in Information Searching Studies  

E-Print Network [OSTI]

The Pennsylvania State University Dr. Bernard Jim Jansen #12;Wrapper Application: Part of the AI2 RS Project system Bernard J. Jansen 2 of 12 #12;Wrapper Application: Part of the AI2 RS Project Version: 1.2 User where the tool is used. An appropriate citation is: Jansen, B. J. Forthcoming. Search log analysis: What

Jansen, James

335

Photochemically Induced Ionic Reactions of Cycloalkenes  

Science Journals Connector (OSTI)

...CHEMICAL REVIEWS 69 : 639 ( 1969 ). MULLIKEN, R.S., THE TWISTING FREQUENCY AND THE BARRIER HEIGHT FOR FREE ROTATION IN ETYLENE, CHEMICAL REVIEWS 41 : 219 ( 1947 ). MULLIKEN, R.S., J CHEM PHYS 23 : 1895 ( 1955 ). ROBERTS, J.D., BASIC PRINCIPLES...

James A. Marshall

1970-10-09T23:59:59.000Z

336

4.4 Pass3 42 FIG. 4.9: Momentum distribution of reconstructed events in flfl(2) triggers (after correc  

E-Print Network [OSTI]

and calibrating the measured energy for low­KE particles in the RS. Saturation Only a fraction of the kinetic is the fluorescent energy emitted per unit path length, dE dx is the actual energy loss for the charged particle's analyses and calibrations. In measuring the true kinetic energy E of the particle in the RS

337

ASP Conference Series, Vol. **VOLUME**, **PUBLICATION YEAR** **EDITORS**  

E-Print Network [OSTI]

simulation with Schwarzschild black hole with a free falling corona. The initial sim- ulation results show of the general-relativistic effect below 3rS (rS is the Schwarzschild ra- dius), is strongly decelerated here were made assuming axisymmetry with re- spect to the z-axis and mirror symmetry with respect

Nishikawa, Ken-Ichi

338

ELEC3028 Digital Transmission Overview & Information Theory S Chen Revision of Lecture 2  

E-Print Network [OSTI]

(symbols/s) information rate: R = Rs · H (bits/s) · Code each symbol by log2 q bits (BCD), then data rate Rs · log2 q > R, unless source is equal probable pi = 1/q, 1 i q · How to code symbols is coded ­ For example, samples of speech waveform are correlated; redundancy in samples is first removed

Chen, Sheng

339

Supplemental Data AJHG, Volume 85  

E-Print Network [OSTI]

/A N/A N/A rs16893673 0.028 1.37?10-6 0.3526 6 28187055 N/A N/A N/A rs11803049 0.027 1.48?10-6 0.3526 1

Xu, Shuhua

340

Orange controller for fiber echelle: final report A. Tokovinin, R. Schmidt, M. Bonati  

E-Print Network [OSTI]

, the CCD was tested by RS and MB with Arcon, to get reference performance. Then the temperature control shutter RS-232 Power-supply box ADAM Ethernet control room Rack behind Coude room Telescope systran fiberOrange controller for fiber echelle: final report A. Tokovinin, R. Schmidt, M. Bonati Version 1

Tokovinin, Andrei A.

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

ARM - Publications: Science Team Meeting Documents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Radiosonde Intercomparison During the Fall 2000 Water Vapor IOP Radiosonde Intercomparison During the Fall 2000 Water Vapor IOP Lesht, B.M. (a) and Richardson, S.J. (b), Argonne National Laboratory (a), University of Oklahoma (b) Eleventh Atmospheric Radiation Measurement (ARM) Science Team Meeting We conducted 160 dual-radiosonde soundings during the fall 2000 Water Vapor Intensive Operations Period (WVIOP). The soundings were done every three hours at the SGP/CART site central facility from 1430 on 18 September 2000 through 1130 on 8 October 2000. The dual soundings included Vaisala RH-80H radiosondes from four different calibration lots as well as Vaisala RS-90 radiosondes. The radisondes were distributed during the experiment so as to conduct pairwise comparisons between RS-80s, RS-90s and RS-80s/RS-90s. Prior to the WVIOP we tested the calibration of these types of radiosondes

342

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

56,"Annual",2012,"6/30/1981" 56,"Annual",2012,"6/30/1981" ,"Release Date:","9/27/2013" ,"Next Release Date:","9/26/2014" ,"Excel File Name:","pet_stoc_typ_d_nus_skr_mbbl_a.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_stoc_typ_d_nus_skr_mbbl_a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"11/25/2013 11:41:31 AM" "Back to Contents","Data 1: U.S. Refinery " "Sourcekey","MTTRSUS1","MCRRSUS1","MPERSUS1","MPPRSUS1","MLPRSUS1","METRSUS1","MPRRSUS1","MBNRSUS1","MBIRSUS1","M_EPOOOXH_SKR_NUS_MBBL","M_EPOOXXFE_SKR_NUS_MBBL","MMTRSUS1","MOORSUS1","M_EPOOR_SKR_NUS_MBBL","MFERSUS1","M_EPOORD_SKR_NUS_MBBL","MUORSUS1","MNLRSUS1","MKORSUS1","MH1RSUS1","MRURSUS1","MBCRSUS1","MO1RS_NUS_1","M_EPOBGRR_SKR_NUS_MBBL","MO3RS_NUS_1","MO5RS_NUS_1","MO6RS_NUS_1","MO9RS_NUS_1","MBARSUS1","MGFRSUS1","MGRRSUS1","MG1RS_NUS_1","MG4RS_NUS_1","MG5RS_NUS_1","M_EPM0CAL55_SKR_NUS_MBBL","MG6RS_NUS_1","MGARSUS1","MKJRSUS1","MKERSUS1","MDIRSUS1","MD0RS_NUS_1","MD1RS_NUS_1","MDGRSUS1","MRERSUS1","MRLRSUS1","MRMRSUS1","MRGRSUS1","MPCRS_NUS_1","MNFRSUS1","MOTRSUS1","MNSRSUS1","MLURSUS1","MWXRSUS1","MCKRSUS1","MAPRSUS1","MMSRSUS1"

343

JGI - Scientific Posters  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

News and Publications News and Publications News Releases Science Highlights JGI in the News Notable Scientific Publications Scientific Posters The Primer Templates and Logos Scientific Posters Note: neither these posters nor their contents may be reproduced except by permission of JGI. Illumina Production Sequencing at the DOE Joint Genome Institute - Workflow and Optimizations (Bay Area Illumina User Meeting 2011) Angela Tarver, Alison Fern, Matthew San Diego, Megan Kennedy, Matthew Zane, Christopher Daum, Christopher Hack, Eric Tang, Shweta Deshpande, Jan-Fang Cheng, Simon Roberts, Melanie Alexandre, Miranda Harmon-Smith, Susan Lucas Phylogeny and comparative genome analysis of a Basidiomycete fungi (DOE JGI User Meeting 2011) Robert W. Riley, Asaf Salamov, Igor Grigoriev, David

344

BERAC Meeting September 5 2008 Gaithersburg MD | U.S. DOE Office of Science  

Office of Science (SC) Website

September 5 2008 Gaithersburg MD September 5 2008 Gaithersburg MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 5 2008 Gaithersburg MD Print Text Size: A A A RSS Feeds FeedbackShare Page BER September 5, 2008 Arlington, VA Agenda Presentations Peg Riley .ppt file (357KB), Life and Medical Sciences Division Committee of Visitors Report Patricia Dehmer .ppt file (2.6MB), Report from the Office of Science Todd Anderson .ppt file (1.2MB), Scientific Focus Area (SFA) Rollout & Discussion Robert Dickinson .ppt file (6.1MB), Report on Climate Research Grand Challenges Mike Kuperberg .ppt file (975KB), Climate & Environmental Sciences

345

Microsoft Word - MM5_LSM_JGR.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Impact of Agricultural Practice on Regional Climate in a Coupled Land Impact of Agricultural Practice on Regional Climate in a Coupled Land Surface Mesoscale Model H.S. Cooley Energy and Resources Group, University of California at Berkeley, Berkeley, CA Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA W.J. Riley and M.S. Torn Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA Y. He Computational Research Division, Lawrence Berkeley National Laboratory, Berkeley, CA 2 1. Abstract The land surface has been shown to form strong feedbacks with climate due to linkages between atmospheric conditions and terrestrial ecosystem exchanges of energy, momentum, water, and trace gases. Although often ignored in modeling studies, land management itself may form significant feedbacks. Because crops are harvested earlier

346

NETL: Advanced NOx Emissions Control: Control Technology - Methane de-NOx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

METHANE de-NOx® METHANE de-NOx® The Gas Technology Institute (GTI) is teaming with the All-Russian Thermal Engineering Institute and DB Riley to develop a pulverized-coal (PC)-combustion system that is an extension of IGT's METHANE de-NOx® technology. The technology is composed of a novel PC burner design using natural gas fired coal preheating developed and demonstrated in Russia, LNBs with internal combustion staging, and additional natural gas injection with overfire air. The coal is preheated at elevated temperatures (up to 1500oF) in oxygen deficient conditions prior to combustion. Coal preheat releases fuel-bound nitrogen together with volatiles present in the coal. These conditions promote the conversion of fuel-bound nitrogen to molecular nitrogen rather than to NOx.

347

ARM - Publications: Science Team Meeting Documents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spurious Oscillation in Simulating Boundary-Layer Cumulus Clouds with Spurious Oscillation in Simulating Boundary-Layer Cumulus Clouds with Third-Order Turbulence Closure Models Fischer, M.L.(a), Billesbach, D.P.(b), Riley, W.J.(a), Berry, J.A.(c), and Torn, M.S.(a), E.O. Lawrence Berkeley National Laboratory (a), University of Nebraska (b), Carnegie Institution of Washington (c) Thirteenth Atmospheric Radiation Measurement (ARM) Science Team Meeting Spatial heterogeneity in the mass and energy fluxes in the Southern Great Plains are controlled by a combination of driving variables (e.g. climate, topography and soil, vegetation, and land use and management). Accurate estimation of landscape-averaged ecosystem-atmosphere exchange hence suggests the need for predictive models tested with extensive ground based measurements and/or a measurement method with regional coverage. This is

348

NACP Site-Model and Aggregated Flux Data Published  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Site-Model and Aggregated Flux Data Published Site-Model and Aggregated Flux Data Published The ORNL DAAC is pleased to announce the release of a data set from the North American Carbon Program (NACP): NACP Site: Terrestrial Biosphere Model and Aggregated Flux Data in Standard Format . Data set prepared by D.M. Ricciuto, K. Schaefer, P.E. Thornton, K. Davis, R.B. Cook, Shishi Liu, R. Anderson, M.A. Arain, I. Baker, J.M. Chen, M. Dietze, R. Grant, C. Izaurralde, A.K. Jain, A.W. King, C. Kucharik, Shuguang Liu, E. Lokupitiya, Y. Luo, C. Peng, B. Poulter, D. Price, W. Riley, A. Sahoo, H. Tian, C. Tonitto, and H. Verbeeck. This data set provides standardized output variables for gross primary productivity (GPP), net ecosystem exchange (NEE), leaf area index (LAI), ecosystem respiration (Re), latent heat flux (LE), and sensible heat flux (H) from 24

349

Microsoft Word - EIO-USCP Boiler-4th Quarter 2007-Report-DOE 41175R24.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Organizations Organizations Alstom Power, Inc. 2000 Day Hill Road Windsor, CT 06095 Riley Power Inc. 5 Neponset Street Worcester, MA 01615 Foster Wheeler Development Corp. 12 Peach Tree Hill Road Livingston, NJ 07039 McDermott Technology, Inc./ Babcock & Wilcox Company 1562 Beeson St. Alliance, OH 44601 Electric Power Research Institute (EPRI) 3412 Hillview Avenue Palo Alto, CA 94303 The Energy Industries of Ohio, Inc. Park Center One 6100 Oak Tree Boulevard Independence, OH 44131 Oak Ridge National Labs 1, Bethel Valley Road Oak Ridge, TN 37831 Quarterly Progress Report Doe Award Number: DE-FG26-01NT41175 OCDO Grant Number: D-05-02(A) Project Title: Boiler Materials for Ultrasupercritical Coal Power Plants Project Director: Robert M. Purgert, Energy Industries of Ohio

350

Cool Science on a Hot Day as 3,000 Flock to PPPL's June 1 Open House |  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Cool Science on a Hot Day as 3,000 Flock to PPPL's June 1 Open House Cool Science on a Hot Day as 3,000 Flock to PPPL's June 1 Open House By Jeanne Jackson DeVoe June 5, 2013 Tweet Widget Facebook Like Google Plus One PPPL Science Writer John Greenwald, right, shows off a plasma demonstration machine at PPPL's Open House, as David and Sophia Lu, of West Windsor, and their son Daniel, 6, look on. (Photo by Photo by Elle Starkman, PPPL Office of Communications) PPPL Science Writer John Greenwald, right, shows off a plasma demonstration machine at PPPL's Open House, as David and Sophia Lu, of West Windsor, and their son Daniel, 6, look on. Gallery: Albert Einstein (aka physicist Arturo Dominguez) made an appearance at the Princeton Plasma Physics Laboratory's Open House on June 1. Here, he enjoys a moment with Riley Mastromarino, 5, left, and his brother, Elliott, 8, of Hamilton Township.

351

Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Appalachian Basin, R.E. Burger Plant Appalachian Basin, R.E. Burger Plant Cincinnati Arch, East Bend Plant Presented By: Neeraj Gupta, Battelle Regional Carbon Sequestration Partnerships Initiative Review Meeting October 6-8, 2008, Pittsburgh, PA 2 MRCSP Membership 3 R.E. Burger Field Test Core Team Lynn Brickett Michele Somerday, Danielle Schneider, and others Larry Wickstrom, Doug Mullet, Ron Riley, Ernie Slucher, Mark Baranoski Dave Ball, Neeraj Gupta, Phil Jagucki, Joel Sminchak, Matt Place, Danielle Meggyesy, Judith Bradbury, Jackie Gerst, Diana Bacon, Ioan Feier John Harper, Kristin Carter Lee Avary, Eric Lewis CO 2 Supply System evaluation team includes Rob Steele (EPRI) Additional Contributions by Numerous Other MRCSP Team Members Dwight Peters Al Burgunder 4 East Bend Test Site Core Team Steve Greb, Jim Drahovzal

352

ARM - Publications: Science Team Meeting Documents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spatial Hetergeneity in Mid-Summer Fluxes of Carbon, Water and Energy in Spatial Hetergeneity in Mid-Summer Fluxes of Carbon, Water and Energy in Agriculutural Plots Near the SGP Central Facility Fischer, M.L.(a), Billesbach, D.(b), Berry, J.(c), Riley, W.R.(a), and Torn, M.S.(a), Lawrence Berkeley National Laboratory (a), University of Nebraska (b), Carnegie Institution of Washington (c) Twelfth Atmospheric Radiation Measurement (ARM) Science Team Meeting Patterns of land use and management are likely to dominate the spatial heterogeneity in cycles of energy, carbon, and water in ecosystems of the Southern Great Plains (SGP). We report recent progress on measuring and modeling spatial heterogeneity in land surface-atmosphere exchange for different crops in the footprint of a flux system mounted on the ARM SGP Central Facility 60 m tower. The first phase of our the "Portable Flux

353

Petascale Simulations of Turbulent Nuclear Combustion | Argonne Leadership  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Flame Bubble in an Open Computational Domain for Constant Flame Speed, Gravitational Acceleration, and Changing Density Flame Bubble in an Open Computational Domain for Constant Flame Speed, Gravitational Acceleration, and Changing Density This image is from the simulation "Flame Bubble in an Open Computational Domain for Constant Flame Speed, Gravitational Acceleration, and Changing Density." Science: Ray Bair, Katherine Riley, Argonne National Laboratory; Anshu Dubey, Don Lamb, Dongwook Lee, University of Chicago; Robert Fisher, University of Massachusetts at Dartmouth and Dean Townsley, University of Alabama; Visualization: Jonathan Gallagher, University of Chicago; Randy Hudson, John Norris, and Michael E. Papka, Argonne National Laboratory/University of Chicago Petascale Simulations of Turbulent Nuclear Combustion PI Name: Don Lamb PI Email: lamb@oddjob.uchicago.edu

354

Spatially Distributed CO2, Sensible, and Latent Heat Fluxes Over the  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spatially Distributed CO2, Sensible, and Latent Heat Fluxes Over the Spatially Distributed CO2, Sensible, and Latent Heat Fluxes Over the Southern Great Plains Berry, Joseph Carnegie Inst.of Washington Riley, William Lawrence Berkeley National Laboratory Biraud, Sebastien Lawrence Berkeley National Laboratory Torn, Margaret Lawrence Berkeley National Laboratory Fischer, Marc Lawrence Berkeley National Laboratory Category: Atmospheric State and Surface Vegetation strongly influences the spatial distribution of surface sensible and latent heat fluxes, and also impacts the ecosystem to atmosphere CO2 exchanges. We describe here a methodology to estimate surface energy fluxes and Net Ecosystem Exchange (NEE) of CO2 continuously over the Southern Great Plains, using (1) data from the Atmospheric Radiation Measurement (ARM) program in Oklahoma and Kansas; (2) meteorological forcing data from

355

DOE Solar Decathlon: Penn State: Sustaining Momentum  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Penn State's Solar Decathlon 2007 house outside the university football stadium. Penn State's Solar Decathlon 2007 house outside the university football stadium. Enlarge image MorningStar PA welcomed visitors after every home football game at Beaver Stadium. (Courtesy of Roland Le Roux and David Riley, Penn State) Who: Penn State What: MorningStar PA Where: Penn State Center for Sustainability 104 Eng Unit A University Park, PA 16802 Map This House Public tours: The house is closed until July 2011 for remodeling. Solar Decathlon 2007 Penn State: Sustaining Momentum Originally built for the U.S. Department of Energy Solar Decathlon 2007, Penn State's MorningStar PA house is now located on campus at the Center for Sustainability. The house will be closed to the public until July 2011 while the center adds a basement for office and laboratory space.

356

ARM - Publications: Science Team Meeting Documents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

From Crops to Boundary Layer and Back Down Again: the ARM Carbon Project in From Crops to Boundary Layer and Back Down Again: the ARM Carbon Project in the Southern Great Plains Torn, M.S.(a), Berry, J.(b), Riley, W.J.(a), Fischer, M.L.(a), Billesbach, B.(c), Helliker, B.(b), and Giles, L.(b), Lawrence Berkeley National Laboratory (a), Carnegie Institution of Washington (b), University of Nebraska (c) Twelfth Atmospheric Radiation Measurement (ARM) Science Team Meeting One of the challenges in carbon cycle research is the vast range of scale that must be traversed by measurements and models. Our understanding of carbon cycle processes is being built from studies of enzymes, organisms and plot-scale studies of ecosystems, while our ultimate objective is to understand the mass and isotope balance of earth’s atmosphere. Spanning

357

PowerPoint Presentation  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in the Southern Great Plains during the 2007 CLASIC in the Southern Great Plains during the 2007 CLASIC S.C. Biraud (SCBiraud@lbl.gov), W.J. Riley, M.L. Fischer, M.S. Torn, D. Billesbach, J.A. Berry, A. Hirsch, C. Sweeney, M. Lowenstein, J. Lopez, and R. Avissar Earth Sciences Division, Lawrence Berkeley National Laboratory INTRODUCTION TOP DOWN REGIONAL FLUX ESTIMATE USING LAGRANGIAN FLIGHTS CONCLUSION In addition, CO 2 , water, and energy fluxes were observed with the Duke Helicopter Observation Platform (HOP) at various heights in the boundary layer, including in the surface layer (the few meters near the surface). One aircraft carried precise CO 2 , CO, and CH 4 continuous measurement systems, and 14 C, radon, and NOAA 12-flask (carbon cycle gases and isotopes) packages. Continuous CO 2 , CO, and

358

District of Columbia | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

4, 2011 4, 2011 CX-005940: Categorical Exclusion Determination Clean Start Development of a National Liquid Propane (Autogas) Refueling Network CX(s) Applied: B5.1 Date: 06/04/2011 Location(s): Washington Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory June 3, 2011 EA-1858: Finding of No Significant Impact Nippon Paper Industries USA Company Biomass Cogeneration Project, Port Angeles, Clallam County, Washington June 2, 2011 A model of Team Canada's TRTL house | Courtest of Riley Brandt, Team Canada Team Canada Returns to the Solar Decathlon with First Nation Values in Mind Team Canada's 2011 Solar Decathlon house -- which is known as TRTL (Technological Residence that respects Traditional Living) -- addresses critical housing issues in Alberta, Canada's Aboriginal communities.

359

ARM - Publications: Science Team Meeting Documents: Spatially Distributed  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spatially Distributed CO2, Sensible, and Latent Heat Fluxes over the Spatially Distributed CO2, Sensible, and Latent Heat Fluxes over the Southern Great Plains Biraud, Sebastien Lawrence Berkeley National Laboratory Riley, William Lawrence Berkeley National Laboratory Fischer, Marc Lawrence Berkeley National Laboratory Torn, Margaret Lawrence Berkeley National Laboratoroy Berry, Joseph Carnegie Inst.of Washington Cooley, Heather Lawrence Berkeley National Laboratory Vegetation and vegetation processes strongly influence the spatial distribution of sensible and latent heat fluxes, as well as controlling ecosystem-atmosphere CO2 exchange. Estimating spatially distributed ecosystem fluxes is important for ARM cloud modeling and for the North American Carbon Program. We describe here a methodology to estimate surface energy fluxes and net ecosystem CO2 Exchange (NEE) continuously over the

360

EXTRAGALACTIC VERY HIGH ENERGY GAMMA-RAY BACKGROUND  

SciTech Connect (OSTI)

We study the origin of the extragalactic diffuse gamma-ray background using the data from the Fermi telescope. To estimate the background level, we count photons at high Galactic latitudes |b| > 60 Degree-Sign . Subtracting photons associated with known sources and the residual cosmic-ray and Galactic diffuse backgrounds, we estimate the extragalactic gamma-ray background (EGB) flux. We find that the spectrum of EGB in the very high energy band above 30 GeV follows the stacked spectrum of BL Lac objects. Large Area Telescope data reveal the positive (1 + z) {sup k}, 1 < k < 4 cosmological evolution of the BL Lac source population consistent with that of their parent population, Fanaroff-Riley type I radio galaxies. We show that EGB at E > 30 GeV could be completely explained by emission from unresolved BL Lac objects if k {approx_equal} 3.

Neronov, A. [ISDC Data Center for Astrophysics, Chemin d'Ecogia 16, CH-1290 Versoix (Switzerland); Semikoz, D. V. [APC, 10 rue Alice Domon et Leonie Duquet, F-75205 Paris Cedex 13 (France)

2012-09-20T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Origin and propagation of the highest energy cosmic rays  

E-Print Network [OSTI]

In this lecture I give an overview of shock acceleration, interactions of high energy cosmic rays with, and propagation through, the background radiation, and the resulting electron-photon cascade. I argue that while the origin of the highest energy cosmic rays is still uncertain, it is not necessary to invoke exotic models such as emission by topological defects to explain the existing data. It seems likely that shock acceleration at Fanaroff-Riley Class II radio galaxies can account for the existing data. However, new cosmic ray data, as well as better estimates of the extragalactic radiation fields and magnetic fields will be necessary before we will be certain of the origin of the highest energy particles occurring in nature.

R. J. Protheroe

1996-12-22T23:59:59.000Z

362

Methane de-NOX for Utility PC Boilers  

SciTech Connect (OSTI)

Large-scale combustion tests with caking bituminous coal was on hold this quarter mainly due to Riley's Commercial Burner Test Facility (CBTF) not having adequate weatherproofing to support operation under freezing conditions. The CBTF was secured and decommissioned for the winter season. CBTF bituminous coal tests shall continue to remain on hold now as a result of project funding limitations, however. No further modifications at the CBTF are planned until needed support is obtained. Activities this quarter have concentrated on finding additional support for the project. Currently, GTI has been granted a no-cost time extension through September 2005 and efforts to secure more support will continue in hopes that large-scale preheat caking bituminous combustion tests will be carried out as planned.

Bruce Bryan; Joseph Rabovitser; Serguei Nester; Stan Wohadlo

2005-03-31T23:59:59.000Z

363

HVAC filtration for controlling infectious airborne disease transmission in indoor environments: Predicting risk reductions and operational costs  

Science Journals Connector (OSTI)

Abstract This work describes and applies a methodology for estimating the impact of recirculating heating, ventilating, and air-conditioning (HVAC) particle filters on the control of size-resolved infectious aerosols in indoor environments using a modified version of the Wells-Riley model for predicting risks of infectious disease transmission. Estimates of risk reductions and associated operational costs of both HVAC filtration and equivalent outdoor air ventilation are modeled and compared using a case study of airborne transmission of influenza in a hypothetical office space. Overall, recirculating HVAC filtration was predicted to achieve risk reductions at lower costs of operation than equivalent levels of outdoor air ventilation, particularly for MERV 1316 filters. Medium efficiency filtration products (MERV 711) are also inexpensive to operate but appear less effective in reducing infectious disease risks.

Parham Azimi; Brent Stephens

2013-01-01T23:59:59.000Z

364

Original quartz grain shape characteristics of the recent sediments of the Colorado River drainage basin  

E-Print Network [OSTI]

0 0 0 2 9 35 12 0 12 0 0 0 11 MEAN 30 2 18 27 5 0 5 7 0 0 6 CAMBRIAN TO TRIASSIC ROCK SOURCES, CENTRAL PLAINS Riley Fm. (G ss) L1 004 66 3 Strawn Grp. SS3 ( IP ss) Br 002 70 6 Strawn Grp. SS21 (IP ss) Br 007 81 9 2 2 0 I I 0 10 7 I 0 5 0 0... Midway Group . 0043 . 0027 Eocene Wilcox Group . 0047 . 0030 Carrizo Sd. . 0044 . 0026 13 Reklaw Fm. . 0041 . 0024 Weches Fm. . 0048 . 0030 13 Sparta Sd. Cook Mtn. Fm. Yegua Fm. . 0052 . 0043 . 0046 . 0028 . 0029 14 2a 13 13, 14 Caddell...

Magenheimer, Stewart Jacob

1985-01-01T23:59:59.000Z

365

METHANE de-NOX for Utility PC Boilers  

SciTech Connect (OSTI)

Large-scale combustion tests with caking bituminous coal has stopped. This stoppage has come about due to limitations in current funding available to continue large scale research and development activities at Riley Power's Commercial Burner Test Facility (CBTF) of the PC Preheat technology. The CBTF was secured and decommissioned in the previous quarter; work this quarter work completed the securing the proper disposition of all PC Preheat experimental equipment at the PSCF and CBTF and completing negotiations with AES Westover (a power plant in Johnson City, New York) to accept 130 tons of residual PRB test coal in storage. The coal transport to Westover occurred at the end of August. GTI was granted a no-cost time extension through September 2005; immediate efforts are focused on completing a draft final report, which is due in October 31, 2005 and the final report in December.

Joseph Rabovitser; Serguei Nester; Stan Wohadlo

2005-09-30T23:59:59.000Z

366

ARM - Publications: Science Team Meeting Documents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Characterizing Diurnal CO2 Cycles in the Continental Boundary Layer Using Characterizing Diurnal CO2 Cycles in the Continental Boundary Layer Using Precise Concentration Measurements and a Simple Numerical Model Torn, M.S.(a), Riley, W.(a), Rischer, M.L.(a), Biraud, S.(a), and Berry, J.(b), Lawrence Berkeley National Laboratory (a), Carnegie Institution of Washington (b) Fourteenth Atmospheric Radiation Measurement (ARM) Science Team Meeting In continental regions, atmospheric CO2 profiles are strongly influenced by atmospheric dynamics as well as ecosystem and anthropogenic fluxes. Relating site level measurements or atmospheric profiles to regional CO2 budgets may require methods to represent or evaluate these influences. At the Southern Great Plains ARM-CART, we are measuring precise CO2 concentrations continuously at 2-60 m and weekly at 300 and 3300 m agl. CO2

367

GREENHOUSE GAS EMISSIONS CONTROL BY OXYGEN FIRING IN CIRCULATING FLUIDIZED BED BOILERS: PHASE II--PILOT SCALE TESTING AND UPDATED PERFORMANCE AND ECONOMICS FOR OXYGEN FIRED CFB WITH CO2 CAPTURE  

SciTech Connect (OSTI)

Because fossil fuel fired power plants are among the largest and most concentrated producers of CO{sub 2} emissions, recovery and sequestration of CO{sub 2} from the flue gas of such plants has been identified as one of the primary means for reducing anthropogenic CO{sub 2} emissions. In this Phase II study, ALSTOM Power Inc. (ALSTOM) has investigated one promising near-term coal fired power plant configuration designed to capture CO{sub 2} from effluent gas streams for sequestration. Burning fossil fuels in mixtures of oxygen and recirculated flue gas (made principally of CO{sub 2}) essentially eliminates the presence of atmospheric nitrogen in the flue gas. The resulting flue gas is comprised primarily of CO{sub 2}, along with some moisture, nitrogen, oxygen, and trace gases like SO{sub 2} and NO{sub x}. Oxygen firing in utility scale Pulverized Coal (PC) fired boilers has been shown to be a more economical method for CO{sub 2} capture than amine scrubbing (Bozzuto, et al., 2001). Additionally, oxygen firing in Circulating Fluid Bed Boilers (CFB's) can be more economical than in PC or Stoker firing, because recirculated gas flow can be reduced significantly. Oxygen-fired PC and Stoker units require large quantities of recirculated flue gas to maintain acceptable furnace temperatures. Oxygen-fired CFB units, on the other hand, can accomplish this by additional cooling of recirculated solids. The reduced recirculated gas flow with CFB plants results in significant Boiler Island cost savings resulting from reduced component The overall objective of the Phase II workscope, which is the subject of this report, is to generate a refined technical and economic evaluation of the Oxygen fired CFB case (Case-2 from Phase I) utilizing the information learned from pilot-scale testing of this concept. The objective of the pilot-scale testing was to generate detailed technical data needed to establish advanced CFB design requirements and performance when firing coals and delayed petroleum coke in O{sub 2}/CO{sub 2} mixtures. Firing rates in the pilot test facility ranged from 2.2 to 7.9 MM-Btu/hr. Pilot-scale testing was performed at ALSTOM's Multi-use Test Facility (MTF), located in Windsor, Connecticut.

Nsakala ya Nsakala; Gregory N. Liljedahl; David G. Turek

2004-10-27T23:59:59.000Z

368

URBAN WOOD/COAL CO-FIRING IN THE NIOSH BOILER PLANT  

SciTech Connect (OSTI)

Phase I of this project began by obtaining R&D variances for permits at the NIOSH boilerplant (NBP), Emery Tree Service (ETS) and the J. A. Rutter Company (JARC) for their portions of the project. Wood for the test burn was obtained from the JARC inventory (pallets), Thompson Properties and Seven D Corporation (construction wood), and the Arlington Heights Housing Project (demolition wood). The wood was ground at ETS and JARC, delivered to the Three Rivers Terminal and blended with coal. Three one-day tests using wood/coal blends of 33% wood by volume (both construction wood and demolition wood) were conducted at the NBP. Blends using hammermilled wood were operationally successful. Emissions of SO{sub 2} and NOx decreased and that of CO increased when compared with combusting coal alone. Mercury emissions were measured and evaluated. During the first year of Phase II the principal work focused upon searching for a replacement boilerplant and developing a commercial supply of demolition wood. The NBP withdrew from the project and a search began for another stoker boilerplant in Pennsylvania to replace it on the project. Three potential commercial demolition wood providers were contacted. Two were not be able to supply wood. At the end of the first year of Phase II, discussions were continuing with the third one, a commercial demolition wood provider from northern New Jersey. During the two-and-a-third years of the contract extension it was determined that the demolition wood from northern New Jersey was impractical for use in Pittsburgh, in another power plant in central New Jersey, and in a new wood gasifier being planned in Philadelphia. However, the project team did identify sufficient wood from other sources for the gasifier project. The Principal Investigator of this project assisted a feasibility study of wood gasification in Clarion County, Pennsylvania. As a result of the study, an independent power producer in the county has initiated a small wood gasification project at its site. Throughout much of this total project the Principal Investigator has counseled two small businesses in developing a waxed cardboard pellet business. A recent test burn of this biofuel appears successful and a purchase contract is anticipated soon. During the past two months a major tree-trimming firm has shown an active interest in entering the wood-chip fuel market in the Pittsburgh area and has contacted the NBP, among others, as potential customers. The NBP superintendent is currently in discussion with the facilities management of the Bruceton Research Center about resuming their interest in cofiring this renewable fuel to the stoker there.

James T. Cobb Jr.

2005-02-10T23:59:59.000Z

369

The development of a portable data acquisition system for use in commercial and industrial energy audits  

E-Print Network [OSTI]

above. This approach led to the ERAP system's being segmented into three major components: the Master Station (MS), the Digital Data Recorder (DDR), and the Data Acquisition Board (DAB). The three 16 components would be functionally similar... would be through serial I/O. From the MS to the DDR the serial communications would be via an RS232 serial port. The DDR would corrununicate with the DAB via an RS-485 serial port. Figure 3 is a block diagram of ERAP system. Master Station DDR RS...

Davis, Michael Andrew

2012-06-07T23:59:59.000Z

370

Ragam: Mukhari Composer: Subbaraya Shastri  

E-Print Network [OSTI]

- RS - S N D - S ; rm Pdp M ,p gr R M | P,d M - N , n d d -S N ; | N D P ; mpmd pmG || ma E - - ma - ni Ne Ni - - - Ma hi - - ma De lu - pu du - - - nam - RS - S N D - S ; rm Pdp pm M gmpMp gr R M | P,d M - - ma De lu - pu du - - - nam - RS - S N D - S ; rm Pdp pm M gmpMp gr R M | P,d M - N , n d d -gr S N

Kalyanaraman, Shivkumar

371

Higher curvature gravity at the LHC  

Science Journals Connector (OSTI)

We investigate brane-world models in different viable F(R) gravity theories where the Lagrangian is an arbitrary function of the curvature scalar. Deriving the warped metric for this model, resembling Randal-Sundrum (RS)-like solutions, we determine the graviton KK modes. The recent observations at the LHC, which constrain the RS graviton KK modes to a mass range greater than 3TeV, are incompatible with RS model predictions. It is shown that the models with F(R) gravity in the bulk address the issue, which in turn constrains the F(R) model itself.

Sumanta Chakraborty and Soumitra SenGupta

2014-08-08T23:59:59.000Z

372

Higher curvature gravity at the LHC  

E-Print Network [OSTI]

We investigate brane-world models in different viable $F(R)$ gravity theories where the Lagrangian is an arbitrary function of the curvature scalar. Deriving the warped metric for this model, resembling Randal-Sundrum (RS) like solutions, we determine the graviton KK modes. The recent observations at the LHC, which constrain the RS graviton KK modes to a mass range greater than 3 TeV, are incompatible to RS model predictions. It is shown that the models with $F(R)$ gravity in the bulk address the issue which in turn constrains the $F(R)$ model itself.

Sumanta Chakraborty; Soumitra SenGupta

2014-03-13T23:59:59.000Z

373

LA-9252-MS UC-70a  

Office of Legacy Management (LM)

/p/j ,()i --' /p/j ,()i --' z!- LA-9252-MS UC-70a Issued: May 1982 Environmental Analysis of the Bayo Canyon (TA-10) Site, Los Alamos, New Mexico Roger W. Ferenbaugh Thomas E. Buhl Alan K. Stoker Wayne FL Hansen kos A[am@ Los Alamos,New Mexico 87545 Los Alamos National Laboratory CONTENTS ABSTRACT 1 1.0 INTRODUCTION AND BACKGROUND 1.1 The FUSRAP Program 1.2 Preferred Alternative 2.0 THE BAY0 CANYON SITE 2.1 Summary History and Description of Site 2.1.1 Description of Site 2.1.2 History of Site 2.2 Need for Action 2.2.1 Radiological Risk 2.2.1.1 Method of Estimating Risk 2.2.1.2 Results of Dose Calculations 2.2.1.3 Health Risks from Residual Bayo Canyon Contamination 2.2.2 Criteria upon Which Cleanup Action is Based 2.3 Other Agencies Involved in Implementation of the

374

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

2. Nitrogen Oxides Uncontrolled Emission Factors 2. Nitrogen Oxides Uncontrolled Emission Factors Fuel, Code, Source and Emission Units Combustion System Type / Firing Configuration Cyclone Boiler Fluidized Bed Boiler Opposed Firing Boiler Spreader Stoker Boiler Fuel EIA Fuel Code Source and Tables (As Appropriate) Emissions Units Lbs = Pounds MMCF = Million Cubic Feet MG = Thousand Gallons Dry-Bottom Boilers Dry-Bottom Boilers Dry-Bottom Boilers Wet-Bottom Boilers Dry-Bottom Boilers Agricultural Byproducts AB Source: 1 Lbs per ton 1.20 1.20 1.20 N/A 1.20 Blast Furnace Gas BFG Sources: 1 (including footnote 7 within source); EIA estimates Lbs per MMCF 15.40 15.40 15.40 N/A 15.40 Bituminous Coal BIT Source: 2, Table 1.1-3 Lbs per ton 33.00 5.00 12.00 31.00 11.00 Black Liquor BLQ Source: 1 Lbs per ton ** 1.50 1.50 1.50 N/A 1.50

375

ARCONNE NATIONAL LABORATORY 9700 Soli~h CASS A\ EWE. ARGONNE, I  

Office of Legacy Management (LM)

ARCONNE NATIONAL LABORATORY ARCONNE NATIONAL LABORATORY 9700 Soli~h CASS A\ EWE. ARGONNE, I l l i d s 60439 ATTN: James K. Alexander, DOEIORO Kathleen Harer, DOEIORO Robert L. Rudolph, BNI Roger W . Ferenbaugh, LANLIH-8 Alan K. Stoker, LANLIH-8 W i l l i a m Crismon, DOEILAAO SUBJECT: REVISED A D M FOR A C I D I M I DDLE PUEBLO CANYON REMEDIAL ACTION Madam and S i r s : Enclosed i s a copy o f t h e ADM f o r t h e Acid/Mi ddle Pueblo Canyon remedial a c t i o n . Revisions have been made t o t h e d r a f t ADM o f February 23, 1982 i n reponse t o comments received from y o u r o f f i c e . The proposed a c t i o n has been r e v i s e d t o r e f l e c t t h e agreements reached on 1 A p r i l 1982 d u r i n g a meeting i n Los Alamos among LANL, ANL, BNI, DOEIORO, and DOEILAAO. Mention i s made o f t h e areas o f contamination below t h e mesa t o p i n t h e A

376

Impact of solid fuel combustion technology on valence speciation of chromium in fly ash  

Science Journals Connector (OSTI)

Abstract Fly ash (FA) generated in real furnaces was used to evaluate the impact of the kind of the solid fuel burnt and combustion technology on chromium speciation, particularly the presence of Cr(III) and Cr(VI) forms as well as readily and hardly leachable chromium(VI) species in FAs. The \\{FAs\\} originated from a pulverized coal combustion boiler (PCC boiler), a fluidized bed combustion boiler (FBC boiler), a stoker-fired boiler (SF boiler), a municipal solid waste incinerator (MSWI), a cement rotary kiln (CRK) and a modern domestic boiler (DB). The speciation analysis of chromium was carried out by means of extraction followed by catalytic cathodic stripping voltammetry with adsorption of Cr(III)-DTPA complexes (CCSV-DTPA) for determination of Cr(VI) and AAS was used for determination of Cr content. It has been revealed that the antagonistic action of alkali metal compounds and iron oxides plays a crucial role in shaping valence speciation of chromium. According to the proposed transformation path of oxidation of Cr(III) to Cr(VI), hard coal combustion in an SF boiler, an FBC boiler or a domestic boiler will generate \\{FAs\\} with a low Cr(VI) level. Replacing fuel with biomass should create favorable conditions for generating FA enriched with Cr(VI). Relatively high concentrations of Cr(VI) can also be expected in FA generated in the process of high-temperature combustion of coal in PCC boilers.

Ryszard ?wietlik; Marzena Trojanowska; Monika ?o?y?ska; Artur Molik

2014-01-01T23:59:59.000Z

377

Bio-coal briquette  

SciTech Connect (OSTI)

Some of the developing nations aim to earn foreign currency by exporting oil and/or gas and to increase the domestic consumption of coal to ensure a secure energy supply. Therefore, it is very important to promote effective coal utilization in these nations. Currently, these countries experience problems associated with coal use for household cooking and household industries. For household cooking, coal creates too much smoke and smells unpleasant. In addition, illegally obtained firewood is almost free in local agricultural regions. Coal is also used in household industries; however, simple stoker boilers are inefficient, since unburned coal particles tend to drop through screens during the combustion process. The bio-coal briquette, on the other hand, is an effective and efficient fuel, since it utilizes coal, which is to be used extensively in households and in small and medium-scale industry sectors in some coal-producing countries, as a primary fuel and bamboos (agricultural waste) as a secondary fuel. In addition, the use of bio-coal briquettes will greatly help reduce unburned coal content.

Honda, Hiroshi

1993-12-31T23:59:59.000Z

378

FEASIBILITY ANALYSIS FOR INSTALLING A CIRCULATING FLUIDIZED BED BOILER FOR COFIRING MULTIPLE BIOFUELS AND OTHER WASTES WITH COAL AT PENN STATE UNIVERSITY  

SciTech Connect (OSTI)

The Pennsylvania State University, under contract to the U.S. Department of Energy (DOE), National Energy Technology Laboratory (NETL) is performing a feasibility analysis on installing a state-of-the-art circulating fluidized bed (CFB) boiler and ceramic filter emission control device at Penn State's University Park campus for cofiring multiple biofuels and other wastes with coal, and developing a test program to evaluate cofiring multiple biofuels and coal-based feedstocks. Penn State currently operates an aging stoker-fired steam plant at its University Park campus and has spent considerable resources over the last ten to fifteen years investigating boiler replacements and performing life extension studies. This effort, in combination with a variety of agricultural and other wastes generated at the agricultural-based university and the surrounding rural community, has led Penn State to assemble a team of fluidized bed and cofiring experts to assess the feasibility of installing a CFB boiler for cofiring biomass and other wastes along with coal-based fuels. The objective of the project is being accomplished using a team that includes personnel from Penn State's Energy Institute and the Office of Physical Plant, Foster Wheeler Energy Services, Inc., and Cofiring Alternatives.

Bruce G. Miller; Sharon Falcone Miller; Robert Cooper; Douglas Donovan; John Gaudlip; Matthew Lapinsky; William Serencsits; Neil Raskin; Dale Lamke; Joseph J. Battista

2001-03-31T23:59:59.000Z

379

FEASIBILITY ANALYSIS FOR INSTALLING A CIRCULATING FLUIDIZED BED BOILER FOR COFIRING MULTIPLE BIOFUELS AND OTHER WASTES WITH COAL AT PENN STATE UNIVERSITY  

SciTech Connect (OSTI)

The Pennsylvania State University, under contract to the U.S. Department of Energy (DOE), National Energy Technology Laboratory (NETL) is performing a feasibility analysis on installing a state-of-the-art circulating fluidized bed (CFB) boiler and ceramic filter emission control device at Penn State's University Park campus for cofiring multiple biofuels and other wastes with coal, and developing a test program to evaluate cofiring multiple biofuels and coal-based feedstocks. Penn State currently operates an aging stoker-fired steam plant at its University Park campus and has spent considerable resources over the last ten to fifteen years investigating boiler replacements and performing life extension studies. This effort, in combination with a variety of agricultural and other wastes generated at the agricultural-based university and the surrounding rural community, has led Penn State to assemble a team of fluidized bed and cofiring experts to assess the feasibility of installing a CFB boiler for cofiring biomass and other wastes along with coal-based fuels. The objective of the project is being accomplished using a team that includes personnel from Penn State's Energy Institute, Office of Physical Plant, and College of Agricultural Sciences; Foster Wheeler Energy Services, Inc.; Parsons Energy and Chemicals Group, Inc.; and Cofiring Alternatives.

Bruce G. Miller; Sharon Falcone Miller; Robert Cooper; Douglas Donovan; John Gaudlip; Matthew Lapinsky; William Serencsits; Neil Raskin; Tom Steitz

2002-07-12T23:59:59.000Z

380

FEASIBILITY ANALYSIS FOR INSTALLING A CIRCULATING FLUIDIZED BED BOILER FOR COFIRING MULTIPLE BIOFUELS AND OTHER WASTES WITH COAL AT PENN STATE UNIVERSITY  

SciTech Connect (OSTI)

The Pennsylvania State University, under contract to the U.S. Department of Energy (DOE), National Energy Technology Laboratory (NETL) is performing a feasibility analysis on installing a state-of-the-art circulating fluidized bed (CFB) boiler and ceramic filter emission control device at Penn State's University Park campus for cofiring multiple biofuels and other wastes with coal, and developing a test program to evaluate cofiring multiple biofuels and coal-based feedstocks. Penn State currently operates an aging stoker-fired steam plant at its University Park campus and has spent considerable resources over the last ten to fifteen years investigating boiler replacements and performing life extension studies. This effort, in combination with a variety of agricultural and other wastes generated at the agricultural-based university and the surrounding rural community, has led Penn State to assemble a team of fluidized bed and cofiring experts to assess the feasibility of installing a CFB boiler for cofiring biomass and other wastes along with coal-based fuels.

Bruce G. Miller; Sharon Falcone Miller; Robert Cooper; Douglas Donovan; John Gaudlip; Matthew Lapinsky; William Serencsits; Neil Raskin; Dale Lamke

2001-10-12T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Fluidized-bed retrofit a practical alternative to FGD  

SciTech Connect (OSTI)

When SO/sub 2/ emissions from an existing utility boiler must be reduced, retrofitting for fluidized-bed combustion may be an attractive alternative. In addition to reducing atmospheric pollutants during combustion, FBC retrofits allow simultaneous burning of a wide range of low-cost fuels. Also, since new components are incorporated in the steam generator rather than added on as pollution-control equipment, they extend the use of the plant beyond its normal life expectancy. There are five types of fossil-fuel-fired boilers used by utilities (pulverized coal, cyclone, stoker, oil, and gas), and literally hundreds of designs. Not all of these designs lend themselves to FBC retrofit, and much depends on the size and age of the boiler. Units that are not structurally sound or that have extensive internal corrosion are generally not suitable. Boilers over 150 MW usually have complicated water circuitry and small furnace plan areas, and may not have enough space to accommodate the fluidized bed. Other important considerations are: Water/steam-circulation design, Furnace bottom-to-grade clearance, Air-heater type and arrangement, Boiler support, Type of particulate-control device, Fan capacity, Space available in the boiler island for alterations.

Stringfellow, T.E.; Nolte, F.S.; Sage, W.L.

1984-02-01T23:59:59.000Z

382

ACCOMPLISHMENTS OF THE AMERICAN-POLISH PROGRAM FOR ELIMINATION OF LOW EMISSIONS IN KRAKOW  

SciTech Connect (OSTI)

In 1991, US and Polish officials signed a Memorandum of Understanding formally initiating and directing the Cracow Clean Fossil Fuels and Energy Efficiency Program. Developing a program approach for the most effective use of the available funds required considerable effort on the part of all project participants. The team recognized early that the cost of solving the low emissions problem even in only one city far exceeded the amount of available US funds. Economic conditions in Poland limited availability of local capital funds for environmental projects. Imposing environmental costs on struggling companies or city residents under difficult conditions of the early 1990's required careful consideration of the economic and political impacts. For all of these reasons the program sought to identify technologies for achieving air quality goals which, through improved efficiency and/or reduced fuel cost, could be so attractive economically as to lead to self-sustaining activities beyond the end of the formal project. The effort under this program has been focused into 5 main areas of interest as follows: (1) Energy Conservation and Extension of Central Station District Heating; (2) Replacement of Coal- and Coke-Fired Boilers with Natural Gas-Fired Boilers; (3) Replacement of Coal-Fired Home Stoves with Electric Heating Appliances; (4) Reduction of Emissions from Stoker-Fired Boiler Houses; and (5) Reduction of Emissions from Coal-Fired Home Heating Stoves.

BUTCHER,T.A.; PIERCE,B.

1998-11-05T23:59:59.000Z

383

Krzeslawice (Krakow, Poland) Boilerhouse Refurbishing Study  

SciTech Connect (OSTI)

Krakow, Poland suffers from major air pollution caused by: local uses of coal for space heating, traffic, industry, and that transported from large down wind industrial regions. Space heating is mostly coal-based, but there is some use of natural gas and electricity. Major sources of heating include: district heating, individual apartment house boilers, stoves for heating individual rooms of apartments, and electric heating units. So-called low emissions sources (i.e., low stacks or chimneys) account for about 40% of the emissions of air pollutants in Krakow and for maximum ground level concentrations of pollutants that exceed Polish standards by factors of 2 - 3. Low emissions sources primarily provide space heating and are largely coal-based. They include 2021 hand-fired fixed grate boilers in some of the apartment houses, 100,000 room heating stoves, and 227 overfeed traveling grate stokers (80% with cyclones for particulate control). The latter are associated with the district heating system, and a few also supply industrial steam. President Bush, in 1990, promised U.S. assistance in reduction of air pollution in Krakow. Subsequently, the Krakow Clean Fossil Fuels and Energy Efficiency Program was established by the U.S. Department of Energy (DOE) to assist in air pollution reduction by means of U.S./Polish joint ventures that will function in a free market economy to supply appropriate equipment, materials or services.

Blinn, M.B. [Burns and Roe Services Corp., Pittsburgh, PA (United States); Kemeny, P. [Burns and Roe Co., Oradell, NJ (United States)

1993-12-31T23:59:59.000Z

384

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

1. Sulfur Dioxide Uncontrolled Emission Factors 1. Sulfur Dioxide Uncontrolled Emission Factors Fuel, Code, Source and Emission Units Combustion System Type / Firing Configuration Fuel EIA Fuel Code Source and Tables (As Appropriate) Emissions Units Lbs = Pounds MMCF = Million Cubic Feet MG = Thousand Gallons Cyclone Boiler Fluidized Bed Boiler Opposed Firing Boiler Spreader Stoker Boiler Tangential Boiler All Other Boiler Types Combustion Turbine Internal Combustion Engine Agricultural Byproducts AB Source: 1 Lbs per ton 0.08 0.01 0.08 0.08 0.08 0.08 N/A N/A Blast Furnace Gas BFG Sources: 1 (including footnote 7 within source); 2, Table 1.4-2 (including footnote d within source) Lbs per MMCF 0.60 0.06 0.60 0.60 0.60 0.60 0.60 0.60 Bituminous Coal* BIT Source: 2, Table 1.1-3 Lbs per ton 38.00 3.80 38.00 38.00 38.00 38.00 N/A N/A

385

Kentucky Power Co (Kentucky) | Open Energy Information  

Open Energy Info (EERE)

Kentucky Power Co Kentucky Power Co Place Kentucky Utility Id 22053 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png LGS - Large General Service Secondary Commercial LGS-TOD - Large General Service Time of Day Commercial MGS - Medium General Service Secondary Commercial MGSTOD - Medium General Service Time of Day Commercial QP - Quantity Power Secondary Commercial RS - Residential Service Residential RS-LM-TOD - Residential Service Load management Time of Day Residential RS-TOD - Residential Service Time of Day Residential RS-TOD2 - Residential Service Time of Day 2 Residential

386

Vrme-och strmningsteknik Thermal and Flow Engineering Processteknikens grunder (PTG) 2014  

E-Print Network [OSTI]

/vatten-lösning genom att vatten förs i kontakt med en ammoniak/luft-gasblandning ­ se figuren. Temperaturen är 20 °C

Zevenhoven, Ron

387

Potential economic impact of the 21-gene recurrence score in Brazil.  

Science Journals Connector (OSTI)

...MAMMOGRAPHY SCREENING IN THE STATE OF GOIAS, BRAZIL, 2010 R Freitas-Junior RS Correa J-E...University of Goias, Goiania, Goias, Brazil; Comissao Nacional de Energia Nuclear, Goiania, Goias, Brazil; National Cancer Institute of Brazil...

CE Bacchi; ED Saad; FM Carvalho; EB Ojopi; FE Prisco

2009-01-15T23:59:59.000Z

388

Tariffs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Transmission SP-NW3 Non-firm Point-to-Point Transmission SP-NFT6 Ancillary Services Scheduling, System Control & Dispatch SP-SD3 Reactive Supply & Voltage Control SP-RS3...

389

E-Print Network 3.0 - aplicada ao controle Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Posicao de Servomecanismo com... :www.ee.pucrs.br 90619-900 - Porto Alegre - RS - Brasil Resumo Neste artigo um controle inverso nao-linear com rede... neural artificial foi...

390

Exploring literary negotiations of culture and identity from the journal, Cultura Tropical (?? ??) and how Korean Brazilians construct a hybrid cultural identity  

E-Print Network [OSTI]

a Imigrao Coreana no Brasil. M.A. thesis. University ofE Santas. Porto Alegre, RS, Brasil: L&PM Editores, 2008.Relaces Internacionais Do Brasil: Temas E Agendas. So

Hong, Mirian Lee

2011-01-01T23:59:59.000Z

391

E-Print Network 3.0 - areia preta guarapari Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SP Summary: GuarapariES Caroline Valado de Oliveira Psicologia So PauloSP Lucas Pereira das Neves Souza Lima... GuarapariES 12;Dalva Oliveira Geografia Porto AlegreRS...

392

E-Print Network 3.0 - alegre rio grande Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SP Summary: Tenrio Maia Fisica Rio de JaneiroRJ Octvio Augusto Rodrigues S.A.R Pereira Geografia Porto AlegreRS... SalvadorBA Agnes de Frana Serrano Geografia Porto...

393

Molecular Mechanisms and Inhibition of Transcription Activation by Bacterial AraC Family Activator Proteins  

E-Print Network [OSTI]

for both DNA binding and transcription activation. We propose that transcription activation by Rns involves contacts between RS2 and AS2 region residues and these contacts may impart the structure or dynamics required by Rns to activate transcription...

Koppolu, Veerendra

2013-12-31T23:59:59.000Z

394

Co-evolution in Epistemic Networks -- Reconstructing Social Complex Systems  

E-Print Network [OSTI]

s 2 , s 3 , s 4 and Lng, N S and P rs . . . . . . . . . .by every agent in S. Prs s 1 Lng Concepts (C) s 2 Agents (S)and concepts linguistics (Lng), neuroscience (NS) and

Roth, Camille

2005-01-01T23:59:59.000Z

395

Microcircuits for Night Vision in Mouse Retina Yoshihiko Tsukamoto,1 Katsuko Morigiwa,2 Mika Ueda,1 and Peter Sterling3  

E-Print Network [OSTI]

glutamate receptors (Hack et al., 1999, 2001). We show that this rod­cone bipolar cell sends an axon from rods to processes that express ionotropic glutamate recep- tors (iGluRs) (Hack et al., 1999, 2001

Pennsylvania, University of

396

News & Notes April 7, 2008 The Halcyon Saxophone  

E-Print Network [OSTI]

, Spring '06 from the studio of Mark Barton) studio performed in a tribute to Adolph "Bud" Herseth at Rice Hester) Dudley Recital Hall Friday April 11, 7:30 pm $15/10 RS Moving Pictures: an evening

Azevedo, Ricardo

397

Predicted thermochemistry for chemical conversions of5-hydroxymethylf...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Predicted thermochemistry for chemical conversions of 5-hydroxymethylfurfural Authors: Assary, R.S., Redfernb, P.C., Hammondd, J.R., Greeley, J., Curtiss, L.A. The thermochemistry...

398

Fault Modelling and Error-Control Coding in a Network-on-Chip  

E-Print Network [OSTI]

}@imit.kth.se Stockholm, December 2002 #12;#12;Abstract The Network-on-Chip architecture and design methodology aims . . . . . . . . . . . . . . . . . . . . . . . . . 32 3.4.5 BCH Codes . . . . . . . . . . . . . . . . . . . . . . . . . . 34 3.4.6 RS (Reed-Solomon

Jantsch, Axel

399

Galileo Doppler Measurements of the Deep Zonal Winds at Jupiter  

Science Journals Connector (OSTI)

...overmuch of the atmospheric circulation origi...Jupiter. The atmospheric motions *e...narindicative of deep atmospheric processes...associated with a water condensation rs of the altitude...and the wind recovery ostrophic...

David H. Atkinson; James B. Pollack; Alvin Seiff

1996-05-10T23:59:59.000Z

400

Examples of the Zeroth Theorem of the History of Science  

E-Print Network [OSTI]

development of Schumann resonances, Radio Science 42 RS2S02delta function ?(x); the Schumann resonances of the earth-else could they be? IV. SCHUMANN RESONANCES OF THE EARTH-

Jackson, J.D.

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Volume 5 Issue 12 www.nasa.gov/centers/stennis December 2010 Stennis test fires new AJ26 rocket engine  

E-Print Network [OSTI]

& Whitney Rocketdyne RS-68A engine test series on the B-1 stand. These engines will be delivered NASA Test Operations Group, Pratt & Whitney Rocketdyne, Patriot Technologies (administrative services

402

E-Print Network 3.0 - active intracellular trafficking Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of the tilapia... CaRs point to a juxtamembrane a-helical segment (G protein-mediated PLC and MAPK cascade activation Source: Loretz, Christopher A.- Department of Biological...

403

Rheology of heavy crude oil and viscosity reduction for pipeline transportation.  

E-Print Network [OSTI]

??The rheological properties of heavy crude oil have been investigated using RheoStress RS100 from Haake. The effects of shear rate, temperature and oil concentration on (more)

Hasan, Shadi

2007-01-01T23:59:59.000Z

404

The ELIMINATOR ^^^ ^^^^^^^^^^ NEW !!!!! Multi I/O Card for the ...  

E-Print Network [OSTI]

2 Serial (RS-232C) Ports - 65C52 CMOS Dual ACIA (similar to but not compatible with 6551) - 15 software selectable baud rates from 50 to 38,400 baud - each...

405

Rheological response and dynamics of the amphiphilic diamond phase from kinetic latticeBoltzmann simulations  

Science Journals Connector (OSTI)

...diamond phase from kinetic lattice-Boltzmann simulations R.S. Saksena...are performed using a kinetic lattice-Boltzmann method. Lyotropic liquid crystals...studied previously using our lattice-Boltzmann (LB) approach (Gonzalez-Segredo...

2009-01-01T23:59:59.000Z

406

E-Print Network 3.0 - antitumorais inibidores da Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Pelotas, RS - 5... a 7 de Novembro de 2003 Coordenao Geral Prof. Dr. Ari da Silva dos Santos (UFPel) Prof. Dr. Celso Source: Ferreira, Mrcia M. C. - Instituto de Qumica,...

407

Building America Case Study: Evaluating Through-Wall Air Transfer...  

Energy Savers [EERE]

the performance of market-available through-wall air transfer fans with respect to Air Conditioning Contractors of America (ACCA) Manual RS and ASHRAE Standard 55-2010...

408

Position of the Snake River watershed divide as an indicator of geodynamic processes in the greater Yellowstone region, western North America  

Science Journals Connector (OSTI)

...indices of channel concavity, stream power distribution, and channel slope-basin...S. National Oceanic and Atmospheric Administration, National Geodetic Survey, http...E., 1987, Drainage history of the Bonneville Basin: In Kopp, R.S., and Cohenour...

409

Measurements of the Electron Cloud Density in the PEP-II Low Energy Ring  

E-Print Network [OSTI]

of beam position monito rs (BPM) are available, without thebeampipe, between two sets of BPMs delimiting the regionof beam position monitor BPM buttons located in the long

Byrd, John

2009-01-01T23:59:59.000Z

410

NUCLEAR CHEMISTRY ANNUAL REPORT 1970  

E-Print Network [OSTI]

Letters 24, 1507 (1970); Nuclear Data B4, 663 (1970). 5. R.S. Hager and E. C. Seltzer, Nuclear Data A4, 1 (1968). 6. H.J. Nijgh, and R. Van Lieshout, Nuclear Spectroscopy Tables (

Authors, Various

2011-01-01T23:59:59.000Z

411

From Milroy and Wright (2000) References and Bibliography  

E-Print Network [OSTI]

Arthurton, R.S. 1973. Experimentally produced halite compaed with Triassic layered halite rock from Cheshire of halite (rock-salt) in the Mercia Mudstone Group (mid to late Triassic) in south-west Enaglnd. Geoscience

412

Challenges and Opportunities in Implementing the FDA Default Parametric Tolerance Interval Two One-Sided Test for Delivered Dose Uniformity of Orally Inhaled Products  

Science Journals Connector (OSTI)

In 2009, the International Pharmaceutical Aerosol Consortium on Regulation and Science (IPAC-RS) conducted DDU Seminars in order to discuss with member companies industrys experiences with the PTI-TOST. During t...

Greg Larner; Andrew Cooper; Svetlana Lyapustina; Stefan Leiner

2011-12-01T23:59:59.000Z

413

Indian Health Care Professionals Attitude Towards Spiritual Healing and Its Role in Alleviating Stigma of Psychiatric Services  

Science Journals Connector (OSTI)

Persons with mental illnesses in India and rest of developing world continue to consult religious/spiritual (R/S) healers or traditional, complementary and alternative medicine (TCAM) professionals prior to se...

P. Ramakrishnan; A. Rane; A. Dias; J. Bhat; A. Shukla

2014-12-01T23:59:59.000Z

414

Developing a Knowledge-Based System Using Rough Set Theory and Genetic Algorithms for Substation Fault Diagnosis  

Science Journals Connector (OSTI)

This chapter proposes a novel and hybrid approach using Rough Set Theory and a Genetic Algorithm (RS-GA) indexrough hybrid to extract knowledge from a set of events captured by (microprocessor based) protection, ...

Ching Lai Hor; Peter Crossley; Simon Watson

2009-01-01T23:59:59.000Z

415

Explanatory Factors for the Merger of Political Parties  

E-Print Network [OSTI]

Politieke Partijen. Groningen, pp. 118-150. De Boer, B. ,Politieke Partijen. Groningen, pp. 14-94. Fisher, S.L. (Politieke Partijen. Groningen, pp. 165-197. Katz, R.S. and

Coff, Hilde; Torenvlied, Ren

2008-01-01T23:59:59.000Z

416

E949 Work Plan Appendix A: Detector Closing The closing of the detector will be carried out in three stages.  

E-Print Network [OSTI]

to reach to inner­most RS PMT, coil up excessive fiber length on spool on top of detector, d. position end, check with Boroscope for optical coupling and install screw to adjust spring tension, b. install first

417

The Five Offshore Drilling Rig Markets  

Science Journals Connector (OSTI)

Market valuations are performed by a number of industry consultancies (e.g. Douglas-Westwood, GBI Research, IHS, R.S. Platou, Rystad Energy, Wood Mackenzie). Comparisons across firms depend...7, 18]. Large market...

Mark J. Kaiser; Brian F. Snyder

2013-01-01T23:59:59.000Z

418

Forschung und EU-Hochschulbro, Technologietransfer Februar 2012  

E-Print Network [OSTI]

, Safety and Radiation Protection ­ neuer Aufruf 9 2.9. Allgemeines zum 7. Forschungsrahmenprogramm 9 2: Reliably Secure Software Systems ­ RS3 (SPP 1496) 21 9. Ingenieurwissenschaften 21 9.1.1. EU: Intelligente

Nejdl, Wolfgang

419

E-Print Network 3.0 - arginina em ratos Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DefibulatorStandard First-Aid. Information covers the following:The EMS... COMMUNITIES swimming Pool oPeRAtoRs CoURse This course will be of interest to all persons involved in...

420

Structural Characterization and Catalytic Activity of Nanosized CexM1-xO2 (M = Zr and Hf) Mixed Oxides  

Science Journals Connector (OSTI)

RS measurements suggest a defective structure of the mixed oxides resulting in the formation of oxygen vacancies. ... Improvements in such features are currently in demand for designing better catalytic cartridges for new-generation cleaner cars. ...

Benjaram M. Reddy; Pankaj Bharali; Pranjal Saikia; Sang-Eon Park; Maurits W. E. van den Berg; Martin Muhler; Wolfgang Grnert

2008-07-16T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

"Probes to Saturn and Beyond" Panel Discussion Report IPPW-4, Friday, 30 June 2006  

E-Print Network [OSTI]

that the mission architecture requires flying the spacecraft at 2RS or beyond, which would result in essentially planetary-scale spatial resolution, i.e. only disk-average results from MWR if mounted on the spacecraft

Atreya, Sushil

422

Mathematical Model for Efficient Water Flow Curic Vladimir  

E-Print Network [OSTI]

@uns.ac.rs, supported by Grant No. 144016, Ministry of Science, Republic of Serbia Lappeenranta University of Technology, P.O. Box 20 FIN-53851 Lappeenranta, Finland, e-mail: matti.heilio@lut.fi Faculty of Science

Krejiæ, Nata?a

423

Fluid Hegemony: A Political Ecology of Water, Market Rule, and Insurgence at Bangalore's Frontier  

E-Print Network [OSTI]

Series B, Human Geography Hasan, Arif. 2008. "Financing the20: 1, 109-119. Hasan, M Fazlul. 1970. Bangalore Through thethe time Rs. 20 lakhs 19 (Hasan 1970). A century later, the

Ranganathan, Malini

2010-01-01T23:59:59.000Z

424

Office of Enterprise Assessments Review of the West Valley Demonostrat...  

Energy Savers [EERE]

to ensure that the operators are documenting their rounds properly in accordance with the Conduct of Operations Procedure, SOP 00-52. EA also observed interactions between the RS...

425

Ritu Sahore > Graduate Student - Giannelis Group > Researchers...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ritu Sahore Graduate Student - Giannelis Group rs758@cornell.edu Ritu Sahore grew up in Punjab, India, and recieved her B.Tech.(Hons.) in Metallurgical and Materials Engineering...

426

Organic Photochemistry  

Science Journals Connector (OSTI)

...CHEMICAL SOCIETY 83 : 2789 ( 1961 ). MULLIKEN, R.S., THE TWISTING FREQUENCY AND THE BARRIER HEIGHT FOR FREE ROTATION IN ETYLENE, CHEMICAL REVIEWS 41 : 219 ( 1947 ). MUSTAFA, A, DIMERIZATION REACTIONS IN SUNLIGHT, CHEMICAL REVIEWS 51 : 1 ( 1952...

George S. Hammond; Nicholas J. Turro

1963-12-20T23:59:59.000Z

427

Chemical kinetics on extrasolar planets  

Science Journals Connector (OSTI)

...Jupiter's stratosphere: constraints from ISO observations and comparisons with other...nature09602 ) 118 Shabram, M , JJ Fortney, TP Greene, and RS Freedman. 2011 Transmission...Hydrocarbon chemistry and comparison to ISO observations. Icarus 143, 244-298...

2014-01-01T23:59:59.000Z

428

Microsoft Word - Press Release RECOMP 2-8-08 REV FINAL.doc |...  

Energy Savers [EERE]

& Publications USA RS Basic Contract - Contract No.: DE-RW0000005 Microsoft Word - AL-Consolidated Approps FY 2008 as of feb 21 2008 final.doc Root Cause Analysis Report In...

429

Throwback Thursdays Celebrate Scientific Supercomputing  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

an IBM RS6000 SP supercomputer-called Seaborg, in honor of Berkeley Lab Nobel Laureate Glenn Seaborg. Over the years, the system expanded to 6,656 processors. It performed about...

430

Measurement of sound speed vs. depth in South Pole ice: pressure waves and shear waves  

E-Print Network [OSTI]

Price, Attenuation of acoustic waves in glacial ice and saltacoustics, South Pole, sound speed, pressure waves,shear waves PACS: 47.35.De, 47.35.Rs, 62.65. +k, 92.40.Vq,

Klein, Spencer

2010-01-01T23:59:59.000Z

431

Comparative Transcriptome Atlases Reveal Altered Gene Expression Modules between Two Cleomaceae C3 and C4 Plant Species  

Science Journals Connector (OSTI)

...data analysis and experimental design. R.S. assisted in data discussion. L.D.V. assisted in ploidy determination. A.B. analyzed data...efficiency with which photosynthesis can convert solar energy into biomass? Curr. Opin. Biotechnol...

Canan Külahoglu; Alisandra K. Denton; Manuel Sommer; Janina Ma?; Simon Schliesky; Thomas J. Wrobel; Barbara Berckmans; Elsa Gongora-Castillo; C. Robin Buell; Rüdiger Simon; Lieven De Veylder; Andrea Bräutigam; Andreas P.M. Weber

2014-08-08T23:59:59.000Z

432

Field and office methods in the preparation of geological reports; discussion  

Science Journals Connector (OSTI)

...scaleand that of 2 inches= mile canbeallowedfor in the adjustmentalwaysnecessitatedby the imperfectaccuracyof the method. F. C. C2u.x rs. SOME SUGGESTIONS AS TO FIELD METHODS. Sir: Every well-trained geologistwill recognizethat field methodsemployedin...

Frank Cathcart Calkins; D. W. Ohern; Lionel C. Ball; F. C. Smith; R. D. Crawford; George W. Stose; Philip S. Smith

433

Ornamental Fish Industry in Sri Lanka: Present Status and Future Trends  

Science Journals Connector (OSTI)

The aquarium fish industry in Sri Lanka has become a valuable foreign exchange ... , earning Rs. 530 million in 1998. Sri Lankan ornamental fish exports for the international market include locally wild caught ma...

R.G.S. Wijesekara; A. Yakupitiyage

434

Modeling Clean and Secure Energy Scenarios for the Indian Power Sector in 2030  

E-Print Network [OSTI]

2010. Capital cost of solar thermal projects with storage isWaste to Power Solar Thermal (with storage) Solar PV (Rs Cr/Waste to Power Solar Thermal (with thermal storage) Solar PV

Abhyankara, Nikit

2014-01-01T23:59:59.000Z

435

Detection of Physiologically Relevant Alcohol Concentrations Using Raman Spectroscopy  

E-Print Network [OSTI]

This is the first step in a series of studies to test the feasibility of using Raman Spectroscopy (RS) to non-invasively detect physiologically relevant blood alcohol concentrations. Blood tests, urine tests, and the breathalyzer are currently...

McKay, Joshua L.

2006-08-16T23:59:59.000Z

436

E-Print Network 3.0 - acidos graxos em Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

da Regio Sul (XI SBQSUL) Pelotas, RS 5 a 7 de Novembro de 2003 Summary: : boldo do Chile, AES-ICP, mtodos quimiomtricos. Introduo O ch uma das bebidas mais consumidas...

437

ATF Video Frame Grabber Subsystems - Frequently Asked Questions  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

eofg.private.atf.net, videofg2.private.atf.net Video type : Analog, RS-170 Hardware manufacturer: Imaging Technology, Inc. Model : IM-PCI (PCI card) Digitization : 8-bit (fixed)...

438

E-Print Network 3.0 - aquatic organisms submitted Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ecology ; Physics ; Biology and Medicine 99 1 -SUBTIDAL 2 -INTERTIDAL RB ROCK UB UNCONSOLIDATED AB AQUATIC BED RF -REEF OW -OPEN WATER AB AQUATIC BED RF REEF RS ROCKY SHORE US...

439

Protein sequences classification by means of feature extraction with substitution matrices  

E-Print Network [OSTI]

Rabie Saidi1,3 , Mondher Maddouri 2 , Engelbert Mephu Nguifo3§ 1 URPAH / FSJ - University of Jendouba-Ferrand 2, France § Corresponding author Email addresses: RS: saidi@isima.fr MM: mondher

Paris-Sud XI, Université de

440

Applied Statistical Physics Molecular Engineering Conference Puerto Vallarta, Mexico, 24-29 August 2003  

E-Print Network [OSTI]

of the sessions: Complex Fluids: Equilibrium and Dynamics, Nano-biotechnology, Nanoscience, Quantum EngineeringFOREWORD Applied Statistical Physics Molecular Engineering Conference Puerto Vallarta, Mexico, 24, RS, Brazil The Second International Conference on `Applied Statistical Physics: Molecular Engineering

Barbosa, Marcia C. B.

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Water Vapor Experiment Concludes  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(Holger Voemel, NOAA and University of Colorado). November 2003 2 first North American launch of the new Vaisala RS92 radiosonde on November 5, 2003. NASA also deployed a...

442

AREAS OF GROUND SUBSIDENCE DUE TO GEO-FLUID WITHDRAWAL  

E-Print Network [OSTI]

here, and the Raft River geothermal wells a r e located t oPROPERTIES OF RAFT RIVER GEOTHERMAL WELL CORES (from Stokerin the area of Geothermal wells rs a 9 square mile area with

Grimsrud, G. Paul

2011-01-01T23:59:59.000Z

443

DOE O 412.1 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

& Publications Policy Flash 2014-30 DOE Order 412.1a, Work Authorization System Administrative Change Work Authorization System USA RS Basic Contract - Contract No.: DE-RW0000005...

444

E-Print Network 3.0 - af forbrug og Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de nationale og inter- nationale EU- og EFP-stttede aktivite- ter for off... sekunders vind- std er p basis af 2 rs mledata bereg- net til ... Source: Ris National...

445

Visiting a farm farmers' mar  

E-Print Network [OSTI]

Buy othe wast Sto The afte Stor due ng ods. In Texa eggs, honey, ity to interac n out of di ns, potatoes en on the cou avocados, k rs, and plum 't keep them wn the ripeni ecay. nd

446

Interpreting Horizontal Well Flow Profiles and Optimizing Well Performance by Downhole Temperature and Pressure Data  

E-Print Network [OSTI]

, Rs = 0.1 0F...................... 118 Fig. 5.39 May identify high inflow sections at 2 days, Rs = 0.1 0F............................. 119 Fig. 5.40 Identify high inflow sections at initial, ? = 0.033 0F ................................... 120 Fig... sections at 5 day, ? = 0.1 0F ........................ 121 Fig. 5.44 Reservoir geometry and 2D permeability distribution used in example 2...

Li, Zhuoyi

2011-02-22T23:59:59.000Z

447

1. MEMBERSHIP 1.1 Membership of the Institute will be restricted to persons with Post-graduate or  

E-Print Network [OSTI]

have to pay a fee of Rs. 2500.00 less a rebate of Rs. 50.00 for each year for which ordinary annual have to pay a fee of US$ 800.00 less a rebate of US$ 20.00 for each year for which ordinary annual subscription may have been given, subject to a maximum rebate of US$300.00 after continuing membership

Rodriguez, Carlos

448

c Copyright 2010. W. Marshall Leach, Jr., Professor, Georgia Institute of Technology, School of Electrical and Computer Engineering.  

E-Print Network [OSTI]

of Electrical and Computer Engineering. The Common-Base Amplifier Basic Circuit Fig. 1 shows the circuit diagram circuits as shown in Fig. 4. vtb = 0 Rtb = 0 vte = vs RE Rs + RE Rte = RskRE Figure 4: Signal circuit(sc) ? - (rickRCkRL) (g) The flow graph is show in Figure 6. The voltage gain is given by Av = vo vs = RE Rs + RE

Leach Jr.,W. Marshall

449

Determination of total dietary fiber and resistant starch in processed corn and rice products  

E-Print Network [OSTI]

), and probably, Maillard reaction products. Values of TDF for rice products decreased up to 50% during milling, but remained unchanged with parboiling. Formation of RS around 1% in corn was found when consecutive heat treatments were applied (alkaline... starch" (RS) was first used by Englyst and Cummings in 1982 to describe starch that was resistant to pancreatic amylase. During heat treatments (boiling or baking), intermolecular hydrogen bonds between the starch granules are formed (crystallization...

Corujo Martinez, Juan Ignacio

2012-06-07T23:59:59.000Z

450

Solar system constraints on f(G) gravity models  

E-Print Network [OSTI]

We discuss solar system constraints on f(G) gravity models, where f is a function of the Gauss-Bonnet term G. We focus on cosmologically viable f(G) models that can be responsible for late-time cosmic acceleration. These models generally give rise to corrections of the form epsilon*(r/rs)^p to the vacuum Schwarzschild solution, where epsilon = H^2 rs^2 solar system constraints for a wide range of model parameters.

Antonio De Felice; Shinji Tsujikawa

2009-07-10T23:59:59.000Z

451

The inner edge of the accretion disk around a supermassive black hole  

Science Journals Connector (OSTI)

... material giving rise to the line is within 2.6 0.3 times the Schwarzschild radiusthe event horizon of a non-rotating black holeat the 95% confidence ... of the disk is within a few Rs (where Rs ? 2GM/c2 is the Schwarzschild radius) of an object of mass M. Unfortunately, the inner radius inferred from ...

B. C. Bromley; W. A. Miller; V. I. Pariev

1998-01-01T23:59:59.000Z

452

The Role of Postintervention Pullback Pressure Gradient in Percutaneous Transluminal Angioplasty for Central Vein Stenosis in Dialysis Patients  

SciTech Connect (OSTI)

Purpose: The severity of residual stenosis (RS) sometimes cannot be accurately measured by angiography during central vein intervention. This study evaluated the role of pullback pressure measurement during central vein stenosis (CVS) intervention. Methods: A retrospective review enrolled 94 consecutive dialysis patients who underwent CVS interventions but not stenting procedures. Patients were classified into 2 groups by either angiography or pressure gradient (PG) criteria, respectively. Groups divided by angiographic result were successful group (RS {<=}30 %) and acceptable group (50 % {>=} RS > 30 %), while groups divided by PG were low PG group (PG {<=}5 mmHg) and high PG group (PG >5 mmHg). Baseline characteristics and 12-month patency rates between the groups were analyzed. Results: The angiography results placed 63 patients in the successful group and 31 patients in the acceptable group. The patency rate at 12 month was not statistically different (P = 0.167). When the patients were reclassified by the postintervention pullback PG, the patency rate at 12 months was significant (P = 0.048). Further analysis in groups redivided by different combinations of RS and PG criteria identified significant differences in the group with both RS {<=}30 % and PG {<=}5 mmHg compared with those with either RS >30 % (P = 0.047) or PG >5 mmHg (P = 0.027). In addition, there was a significant difference between those with both RS {<=}30 % and PG {<=}5 mmHg compared with those with both RS >30 % and PG >5 mmHg (P = 0.027). Conclusion: Postintervention PG can better predict long-term outcomes after angioplasty for CVS in nonstented dialysis patients than angiography.

Lin, Yu-Sheng, E-mail: dissertlin@yahoo.com.tw [Chang Gung Memorial Hospital, Chiayi, Chang Gung Institute of Technology, Division of Cardiology (China)] [Chang Gung Memorial Hospital, Chiayi, Chang Gung Institute of Technology, Division of Cardiology (China); Yang, Cheng-Hsu, E-mail: yangch@adm.cgmh.org.tw [Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Division of Cardiology and Department of Internal Medicine (China)] [Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Division of Cardiology and Department of Internal Medicine (China); Chu, Chi-Ming, E-mail: chuchiming@ndmctsgh.edu.tw [National Defense Medical Center and University, Section of Health Informatics, Institute of Public Health (China)] [National Defense Medical Center and University, Section of Health Informatics, Institute of Public Health (China); Fang, Chi-Yung, E-mail: cyfang@seed.net.tw; Chen, Chien-Jen, E-mail: cjchen@adm.cgmh.org.tw [Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Division of Cardiology and Department of Internal Medicine (China)] [Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Division of Cardiology and Department of Internal Medicine (China); Hsu, Jen-Te, E-mail: hsujente@gmail.com; Yang, Teng-Yao, E-mail: 2859@adm.cgmh.org.tw [Chang Gung Memorial Hospital, Chiayi, Chang Gung Institute of Technology, Division of Cardiology (China)] [Chang Gung Memorial Hospital, Chiayi, Chang Gung Institute of Technology, Division of Cardiology (China); Hang, Chi-Ling, E-mail: samuelhang@hotmail.com; Wu, Chiung-Jen, E-mail: cvcjwu@adm.cgmh.org.tw [Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Division of Cardiology and Department of Internal Medicine (China)] [Chang Gung Memorial Hospital-Kaohsiung Medical Center, Chang Gung University College of Medicine, Division of Cardiology and Department of Internal Medicine (China)

2013-10-15T23:59:59.000Z

453

Host genes that influence transposition in yeast: the abundance of a rare tRNA regulates Ty1 transposition frequency.  

Science Journals Connector (OSTI)

...3-kb genomic insert containing tRNAAc4u in pRS315 4.3% (11/258) YH117 pX117, 0.3-kb genomic insert containing tRNA^c2u in pRS315 4.4% (11/250) *All the strains listed here were derivatives of YH82 (MATa ura3-52 trpJA63 Ieu2AI his4-539...

H Xu; J D Boeke

1990-01-01T23:59:59.000Z

454

ELEC3028 Digital Transmission Overview & Information Theory S Chen Revision of Lecture 1  

E-Print Network [OSTI]

.04 Average codeword length is 3 bits for BCD · For equiprobable case, H = log2 8 = 3 bits/symbol, and coding Memoryless source with independent symbols (code each symbol by log2 q bits is called binary coded decimal (BCD)) mi, pi 1 i q E BCD: log2 q (bits/symbol) symbol rate Rs (symbols/s) data bit rate: Rs

Chen, Sheng

455

Transmission Information  

E-Print Network [OSTI]

(symbols/s) information rate: R = Rs ·H (bits/s) . Code each symbol by log 2 q bits (BCD), then data rate Rs · log 2 q > R, unless source is equal probable pi = 1/q, 1 # i # q . How to code symbols in an e that the signal exhibits some form of redundancy, which should be exploited when the signal is coded

Chen, Sheng

456

Kodanda Ramam Ragam: Kokilaaravam (11th  

E-Print Network [OSTI]

N , S ; | S S , r G , r- rr S ; || Pada ja Paa - - mshu paa- li ta - - gal - - yam- - - ; p d , n - dp ; dN , S ; | S S rs ­rG , , r- S ; ; || Pada ja Paa - - mshu paa- li ta - - gal - - yam- - - ; p d , n - dp ; dN , S ; | S S rs ­pm G R S ; || Pada ja Paa - - mshu paa- li ta - - gal - - yam- - - [He is endearing ("vatsalyam

Kalyanaraman, Shivkumar

457

A Year in the Works: A Record of Engineering and Management Experience at Freese and Nichols, Inc.  

E-Print Network [OSTI]

the internship, the ROS, and the defense of the internship objectives. 1 2. FNI ORGANIZATIONAL SETTING This sRecior sRdfRs co SRseditR chR ofRduyy od(uriOucioruy scd)ec)dR uc vdRRsR urS ni ehoysl aich u ?dimudg xoe)s or chR eod?oducR scd)ec)dRl chR (do...)? tusRS scd)ec)dR eRrcRdRS or cRehrieuy RpeRyyRreRl urS miedoFyRfRy scd)ec)dR aichir chR (do)?N ,ise)ssior is oxxRdRS eoreRdrir( chR s?Reixie (do)? aich ahieh I aod.RS us u ,w ircRdr qurS eorcir)R co aod. us u x)yyFcimR Rm?yogRRDl mg doyRs urS d...

Hann, Tyson Orion

2012-02-14T23:59:59.000Z

458

Rough sets determined by tolerances  

Science Journals Connector (OSTI)

Abstract We show that for any tolerance R on U, the ordered sets of lower and upper rough approximations determined by R form ortholattices. These ortholattices are completely distributive, thus forming atomistic Boolean lattices, if and only if R is induced by an irredundant covering of U, and in such a case, the atoms of these Boolean lattices are described. We prove that the ordered set RS of rough sets determined by a tolerance R on U is a complete lattice if and only if it is a complete subdirect product of the complete lattices of lower and upper rough approximations. We show that R is a tolerance induced by an irredundant covering of U if and only if RS is an algebraic completely distributive lattice, and in such a situation a quasi-Nelson algebra can be defined on RS. We present necessary and sufficient conditions which guarantee that for a tolerance R on U, the ordered set RS X is a lattice for all X ? U , where R X denotes the restriction of R to the set X and RS X is the corresponding set of rough sets. We introduce the disjoint representation and the formal concept representation of rough sets, and show that they are DedekindMacNeille completions of RS.

Jouni Jrvinen; Sndor Radeleczki

2014-01-01T23:59:59.000Z

459

Theoretical evidence for random variation of series resistance of elementary diodes in inhomogeneous Schottky contacts  

Science Journals Connector (OSTI)

The currentvoltage (IV) characteristics of Schottky diodes measured at low temperature shows an abnormal behavior, which is attributed to the presence of spatial variation of barrier heights of Gaussian type at metalsemiconductor interface. The simulation studies assuming Gaussian distribution of barrier heights also show similar temperature dependence of diode parameters as observed in real Schottky contacts fabricated on various metalsemiconductor systems. The simulation studies performed so far on inhomogeneous Schottky contacts assumes constant series resistance (RS) to all elementary diodes because of the complexity in programming. We have simulated IV characteristics of inhomogeneous Schottky diodes with Gaussian distribution of Barrier heights (BHs) assuming different RS for different elementary diodes in the distribution. It is found that the simulation performed using randomly varying RS having Gaussian distribution yields IV characteristics similar to those obtained using constant RS with its value about which variation in RS is considered for all elementary diodes. The simulation results provide theoretical evidence about the occurrence of random fluctuation of RS of Gaussian type in elementary diodes in inhomogeneous Schottky contact.

Subhash Chand

2006-01-01T23:59:59.000Z

460

GREENHOUSE GAS EMISSIONS CONTROL BY OXYGEN FIRING IN CIRCULATING FLUIDIZED BED BOILERS  

SciTech Connect (OSTI)

Given that fossil fuel fired power plants are among the largest and most concentrated producers of CO{sub 2} emissions, recovery and sequestration of CO{sub 2} from the flue gas of such plants has been identified as one of the primary means for reducing anthropogenic CO{sub 2} emissions. In this study, ALSTOM Power Inc. (ALSTOM) has investigated several coal fired power plant configurations designed to capture CO{sub 2} from effluent gas streams for use or sequestration. Burning fossil fuels in mixtures of oxygen and recirculated flue gas (made principally of CO{sub 2}) essentially eliminates the presence of atmospheric nitrogen in the flue gas. The resulting flue gas is comprised primarily of CO{sub 2}. Oxygen firing in utility scale Pulverized Coal (PC) fired boilers has been shown to be a more economical method for CO{sub 2} capture than amine scrubbing (Bozzuto, et al., 2001). Additionally, oxygen firing in Circulating Fluid Bed Boilers (CFB's) can be more economical than in PC or Stoker firing, because recirculated gas flow can be reduced significantly. Oxygen-fired PC and Stoker units require large quantities of recirculated flue gas to maintain acceptable furnace temperatures. Oxygen-fired CFB units, on the other hand, can accomplish this by additional cooling of recirculated solids. The reduced recirculated gas flow with CFB units results in significant Boiler Island cost savings. Additionally, ALSTOM has identified several advanced/novel plant configurations, which improve the efficiency and cost of the CO{sub 2} product cleanup and compression process. These advanced/novel concepts require long development efforts. An economic analysis indicates that the proposed oxygen-firing technology in circulating fluidized boilers could be developed and deployed economically in the near future in enhanced oil recovery (EOR) applications or enhanced gas recovery (EGR), such as coal bed methane recovery. ALSTOM received a Cooperative Agreement from the US Department of Energy National Energy Technology Laboratory (DOE) in 2001 to carry out a project entitled ''Greenhouse Gas Emissions Control by Oxygen Firing in Circulating Fluidized Bed Boilers.'' This two-phased project is in effect from September 28, 2001, to October 27, 2004. (U.S. DOE NETL Cooperative Agreement No. DE-FC26-01NT41146). Phase I consisted of an evaluation of the technical feasibility and economics of alternate CO{sub 2} capture technologies applied to Greenfield US coal-fired electric generation power plants, and supporting bench-scale testing. And Phase II consists of pilot-scale testing, supporting a refined performance and economic evaluation of the oxygen-fired AFC concept. Phase I, detailed in this report, entails a comprehensive study evaluating the technical feasibility and economics of alternate CO{sub 2} capture technologies applied to Greenfield US coal-fired electric generation power plants. Thirteen separate but related cases (listed below), representing various levels of technology development, were evaluated as described herein. The first seven cases represent coal combustion cases in CFB type equipment. The next four cases represent Integrated Gasification Combined Cycle (IGCC) systems. The last two cases represent advanced Chemical Looping systems, which were completely paid for by ALSTOM and included herein for completeness.

Nsakala ya Nsakala; Gregory N. Liljedahl

2003-05-15T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

High-resolution diffraction for residual stress determination in the NiCrMoV wheel of an axial compressor for a heavy-duty gas turbine  

Science Journals Connector (OSTI)

The wheel of an axial compressor for a heavy-duty gas turbine has been investigated for residual stresses (RS) evaluation of the teeth-section where SANS measurements have previously been performed. Such a component can contain internal RS, either due to the manufacturing process, or to the operating cycles fatigue. The constitutive material is a NiCrMoV steel to ASTM A 471 (type 2) norms (equivalent to B50A420B10); this material is usually adopted in the manufacturing of forged components for gas turbines. Internal radial and hoop RS have been determined, whose values are under the limit of 200kPa. Hoop RS, in general, resulted in higher value than the radial ones. The present experiment represents a particularly important step in the RS determination for gas turbine components, since the measurements reveal that the fatigue of the wheel is also a lifetime limiting factor although, in the same technological field, the available data in the actual neutron techniques literature mainly concern turbine buckets.

M Rogante; G Trk; G.F Ceschini; L Tognarelli; I Fzesy; L Rosta

2004-01-01T23:59:59.000Z

462

Pilot-scale Limestone Emission Control (LEC) process: A development project. Volume 1, Main report and appendices A, B, C, and D: Final report  

SciTech Connect (OSTI)

ETS, Inc., a pollution consulting firm with headquarters in Roanoke, Virginia, has developed a dry, limestone-based flue gas desulfurization (FGD) system. This SO{sub 2} removal system, called Limestone Emission Control (LEC), can be designed for installation on either new or existing coal-fired boilers. In the LEC process, the SO{sub 2} in the flue gas reacts with wetted granular limestone that is contained in a moving bed. A surface layer of principally calcium sulfate (CaSO{sub 4}) is formed on the limestone. Periodic removal of this surface layer by mechanical agitation allows high utilization of the limestone granules. A nominal 5,000 acfm LEC pilot plant has been designed, fabricated and installed on the slipstream of a 70,000 pph stoker boiler providing steam to Ohio University`s Athens, Ohio campus. A total of over 90 experimental trials have been performed using the pilot-scale moving-bed LEC dry scrubber as a part of this research project with run times ranging up to a high of 125 hours. SO{sub 2} removal efficiencies as high as 99.9% were achievable for all experimental conditions studied during which sufficient humidification was added to the LEC bed. The LEC process and conventional limestone scrubbing have been compared on an equatable basis using flue gas conditions that would be expected at the outlet of the electrostatic precipitator (ESP) of a 500 MW coal-fired power plant. The LEC was found to have a definite economic advantage in both direct capital costs and operating costs. Based on the success and findings of the present project, the next step in LEC process development will be a full-scale commercial demonstration unit.

Prudich, M.E. [Ohio Univ., Athens, OH (United States); Appell, K.W.; McKenna, J.D. [ETS, Inc., Roanoke, VA (United States)

1994-03-01T23:59:59.000Z

463

The fluidized bed combustion ash management puzzle  

SciTech Connect (OSTI)

As the electric and industrial power generation industry upgrades and expands, the amount of coal and other solid fuels also expands. With increased environmental controls, the introduction of a competitive market for power, and the increased interest in opportunity fuels will increase the usage of Fluidized Bed Combustion (FBC) boilers in the power industry. The combustion of these solid fuels will generate combustion ashes. Power generators, including FBC boilers owners, have traditionally looked to landfills for the disposal of their ash. With the tighter environmental controls being placed on landfills at the federal and state level, power generators are beginning to see constantly escalating tipping fees which now make the landfill option less attractive. In some instances, landfills are beginning to refuse to accept ash regardless of the tipping fee. In view of this, the power generators are now struggling to find a place to store or dispose of the ash that is produced by their power boiler. Other disposal alternatives such as backhaul to the mine and beneficial reuse are now being considered. Either alternative presents its own set of technical and environmental variables to be considered in developing an effective ash management plan. To be effective, these plans need to incorporate an aggressive, yet realistic, role to support beneficial reuse of the ash. Many applications exist for reuse of the various types of ash. The applications for conventional ashes such as those from pulverized coal boilers and stoker fired boilers are mature and more commonplace. The uses for FBC ash are not as well researched and demonstrated and therefore the marketing opportunities for FBC ash continue to require development. FBC boiler owners and operators must be willing to accept the challenges posed in developing these reuse applications for FBC ash for the market to accept the applications for FBC ash and allow the full value of the FBC ash to be realized.

Fitzgerald, H.B. [ReUse Technology, Inc., Kennesaw, GA (United States)

1996-12-31T23:59:59.000Z

464

ARM_Science Team_42x48_poster_March21.ppt  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Land Surface Forcing in the and Land Surface Forcing in the Southern Great Plains during CLASIC and NACP intensives Torn, M.S. 1 , W.J. Riley 1 , M.L. Fischer 1 , T. J. Jackson 2 , R. Avissar 3 , S.C. Biraud 1 , D. Billesbach 4 , C. Sweeney 5 , P. Tans 5 , M. Lowenstein 6 , J. Lopez 6 , and J.A. Berry 7 1 Lawrence Berkeley National Laboratory, mstorn@lbl.gov, 510-495-2223; 2 USDA-ARS, 3 Duke University, 4 University of Nebraska, Lincoln, 5 NOAA-ESRL; 6 NASA AMES, 7 Carnegie Institution ABSTRACT In June 2007, a regional campaign will take place in the U.S. Southern Great Plains (SGP) to estimate surface fluxes of CO 2 , water, and energy at 1 to 100 km scales. The goal of this campaign is to understand the influence of land cover, moisture gradients, and atmospheric transport on these fluxes and their estimation. As part of the North American

465

Forensic analyses of explosion debris from the January 2, 1992 Pd/D{sub 2}O electrochemistry incident at SRI International  

SciTech Connect (OSTI)

The January 2, 1992 explosion in an electrochemistry laboratory at SRI International (SRI) resulted in the death of scientist Andrew Riley, and gained some notoriety due to its association with experimental work in the controversial field of cold fusion research. Selected components of explosion debris were subjected to forensic analyses at LLNL to elucidate potential causes of, or contributing factors to, the explosion. Interrogation of the debris by LLNL encompassed nuclear, chemical, physical, and materials investigations. Nuclear studies for the determination of tritium and neutron-activation products in stainless steel and brass were negative. No evidence of signature species indicative of orthodox nuclear events was detected. The inorganic and particulate analyses were likewise negative with respect to residues of unexpected chemical species. Such target compounds included conventional explosives, accelerants, propellants, or any exceptional industrial chemicals. The GC-MS analyses of trace organic components in the explosion debris provided perhaps the most interesting results obtained at LLNL. Although no evidence of organic explosives, oxidizers, or other unusual compounds was detected, the presence of a hydrocarbon oil in the interior of the electrochemical cell was established. It is likely that its source was lubricating fluid from the machining of the metal cell components. If residues of organic oils are present during electrolysis experiments, the potential exists for an explosive reaction in the increasingly enriched oxygen atmosphere within the headspace of a metal cell.

Andresen, B.; Whipple, R.; Vandervoort, D.; Grant, P.

1992-08-15T23:59:59.000Z

466

System approach to reducing NO{sub x} emissions on a three cell high burner, heavy oil-fired boiler  

SciTech Connect (OSTI)

This paper documents the installation of plug-in low NO{sub x} burners on a utility boiler with cell burners. The original rapid mix burners and typical close burner centerline spacing produced a very hot furnace environment resulting in extremely high NO{sub x} emissions, in this case as high as 1.0 lbs/MMBtu. The unit was a {number_sign}6 oil-fired, 560 MW{sub e} supercritical pressure, three-cell burner boiler at Commonwealth Electric`s Canal Station, Unit {number_sign}1. This paper presents the results including emissions and boiler performance of the retrofit of DB Riley low NO{sub x} STS (Swirl Tertiary Stage) burners. Low NO{sub x} burners were used in conjunction with close-coupled overfire air using existing burner openings. The project reduced NO{sub x} emissions greater than 705 while firing {number_sign}6 oil, and this was accomplished with less than 10% flue gas recirculation.

Green, R.W.; Dorai, X.A. [DB Riley, Inc., Worcester, MA (United States); Hurley, B.A. [Commonwealth Electric Co., Wareham, MA (United States)

1996-11-01T23:59:59.000Z

467

OXYGEN ENHANCED COMBUSTION FOR NOx CONTROL  

SciTech Connect (OSTI)

This quarterly technical progress report will summarize work accomplished for the Program through the twelfth quarter, January-March 2003, in the following task areas: Task 1--Oxygen Enhanced Combustion, Task 2--Oxygen Transport Membranes, Task 3--Economic Evaluation and Task 4--Program Management. The program is proceeding in accordance with the objectives for the third year. Pilot scale experiments conducted at the University of Utah explored both the effectiveness of oxygen addition and the best way to add oxygen with a scaled version of Riley Power's newest low NOx burner design. CFD modeling was done to compare the REI's modeling results for James River Unit 3 with the NOx and LOI results obtained during the demonstration program at that facility. Investigation of an alternative method of fabrication of PSO1d elements was conducted. OTM process development work has concluded with the completion of a long-term test of a PSO1d element Economic evaluation has confirmed the advantage of oxygen-enhanced combustion. Proposals have been submitted for two additional beta test sites. Commercial proposals have been submitted. Economic analysis of a beta site test performance was conducted.

David R. Thompson; Lawrence E. Bool; Jack C. Chen

2003-04-01T23:59:59.000Z

468

METHANE de-NOX for Utility PC Boilers  

SciTech Connect (OSTI)

Preparations for conducting large-scale combustion tests with caking bituminous coal continued during the start of this quarter. Major project accomplishments related to bituminous coal testing included: a CFD preheat model and evaluation, an update of the process flow diagram and a detailed preheat burner mechanical design (suitable for construction) for firing bituminous coal. Installation and testing of the 85 MMBtu/h bituminous coal preheating system was planned to take place before the end of December. Based on the inability to conduct testing in Riley's Commercial Burner Test Facility (CBTF) during freezing weather, a schedule review indicated required site work for testing bituminous coal at the CBTF could not be completed before freezing weather set in at the site. Further bituminous preheat modification work was put on hold and efforts turned to securing the test facility over the winter season. Bituminous coal tests are therefore delayed; April-May 2005 is earliest estimate of when testing can resume. A request for a time extension was submitted to DOE to extend the project through September 2005 to allow time to secure additional funding and complete the bituminous coal testing. Removal of the PRB PC Preheater from the CBTF burner deck was completed. Decommissioning of the CBTF for the winter was also completed.

Bruce Bryan; Joseph Rabovitser; Serguei Nester; Stan Wohadlo

2004-12-31T23:59:59.000Z

469

Probing the origin of cosmic rays with extremely high energy neutrinos using the IceCube Observatory  

Science Journals Connector (OSTI)

We have searched for extremely high energy neutrinos using data taken with the IceCube detector between May 2010 and May 2012. Two neutrino-induced particle shower events with energies around 1PeV were observed, as reported previously. In this work, we investigate whether these events could originate from cosmogenic neutrinos produced in the interactions of ultrahigh energy cosmic rays with ambient photons while propagating through intergalactic space. Exploiting IceCubes large exposure for extremely high energy neutrinos and the lack of observed events above 100PeV, we can rule out the corresponding models at more than 90% confidence level. The model-independent quasidifferential 90%C.L. upper limit, which amounts to E2??e+??+??=1.210-7??GeV?cm-2?s-1?sr-1 at 1EeV, provides the most stringent constraint in the energy range from 10PeV to 10EeV. Our observation disfavors strong cosmological evolution of the highest energy cosmic-ray sources such as the Fanaroff-Riley type II class of radio galaxies.

M. G. Aartsen et al. (IceCube Collaboration)

2013-12-16T23:59:59.000Z

470

CAIS | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Operational Management » Information Systems » CAIS Operational Management » Information Systems » CAIS CAIS CAIS Costing Overview Inspection or assessment data is loaded into the Condition Assessment Information System (CAIS) Web database where it is costed using various RS Means Construction Cost Book data. RS Means is the predominant national cost estimating system. Currently CAIS Web contains over 53,000 line items dealing with building elements, components, and types and other structure and facilities, and infrastructure systems. These costs are broken down by equipment, material, labor, and overhead type. Costing multipliers based on geographical locations as well as site, area, asset and inspection unit costs can be applied to the RS Means cost. Costs can be based on inspector estimates, repair algorithms, or replacement of components.

471

CDIAC Precipitation Data Sets  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Precipitation Precipitation CDIAC Climate Holdings Containing Precipitation Data Global Data Sets Data Set Name Investigators Data Type/Format Period of Record Global Historical Climatology Network (GHCN); Vs. 1 (CDIAC NDP-041) R.S. Vose et al. Stations data; monthly totals Varies by station; through 1990 Global Historical Climatology Network (GHCN); Vs. 2 (Note: the above link takes you to NOAA's National Climatic Data Center website.) R.S. Vose et al. Station data; monthly totals Varies by station; some through most recent month A Computer-Based Atlas of Global Instrumental Climate Data (CDIAC DB-1003) R.S. Bradley et al. Monthly, seasonal, and annual anomaly maps of precipitation 1851 - 1989 Regional Data Sets Data Set Name Investigators Data Type/Format Period of Record

472

ARM - PI Product - Radiosondes Corrected for Inaccuracy in RH Measurements  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ProductsRadiosondes Corrected for Inaccuracy in RH ProductsRadiosondes Corrected for Inaccuracy in RH Measurements Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send PI Product : Radiosondes Corrected for Inaccuracy in RH Measurements 2000.01.01 - 2005.12.31 Site(s) SGP General Description Corrections for inaccuracy in Vaisala radiosonde RH measurements have been applied to ARM SGP radiosonde soundings. The magnitude of the corrections can vary considerably between soundings. The radiosonde measurement accuracy, and therefore the correction magnitude, is a function of atmospheric conditions, mainly T, RH, and dRH/dt (humidity gradient). The corrections are also very sensitive to the RH sensor type, and there are 3 Vaisala sensor types represented in this dataset (RS80-H, RS90, and RS92).

473

1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Vaisala RS-80H Radiosonde Vaisala RS-80H Radiosonde Dry-Bias Correction Redux B. M. Lesht Environmental Research Division Argonne National Laboratory Argonne, Illinois S. J. Richardson Department of Meteorology Pennsylvania State University University Park, Pennsylvania Introduction In previous studies (e.g., Lesht 1997, 1998, 1999; Lesht and Richardson 2001; Richardson et al. 2000) we examined the effects of dry bias in Vaisala RS-80H radiosonde humidity measurements on Atmospheric Radiation Measurement (ARM) data. Some of this analysis was done by using a preliminary version of a humidity correction algorithm that was developed by Vaisala in conjunction with their colleagues at the National Center for Atmospheric Research (NCAR). Because Vaisala insisted that the information included in the algorithm be proprietary, we were required to execute a

474

City of Tacoma, Washington (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Tacoma, Washington (Utility Company) Tacoma, Washington (Utility Company) Jump to: navigation, search Name Tacoma City of Place Washington Utility Id 18429 Utility Location Yes Ownership M NERC Location WECC NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png RS - Schedule A-1 Residential RS - Schedule A-1 - City of Fife Residential RS - Schedule A-1 - City of Fife - collectively metered apartments

475

The effects of estrogen and menhaden oil treatments on choline levels in the young chicken  

E-Print Network [OSTI]

Phosphatidytethanolamine Choline Aceiylcncene Ethanolamine Trimethylamine Betaine Serins Dimethyalmine Glycine Sarcosine CHh Figure 1. Metabolic Pathways of Choline 0 CHs-O-C-R, Rs-G-O-CH, 0 CH, O-P-O-Base 0 Phospholipid OH-CHsCHsN'(CH3)3 Choline Choline... Phosphorylcholine I. Base Exchange Pathway base COP-Choline II. CDP-Choline Pathway , 9 CHs-O-C-R, Rs-C-O-CH, O CHsO-I -0-CHsCHsN'(CH3)3 Cr Phosphatldylcholine III. Methyltransferasa Pathway ?0 g C Hs-0-0-R t Rs- 0-CH 0 CHsO-P-0-CHsCHsNHs' 0...

Madden, Deborah Marie

2012-06-07T23:59:59.000Z

476

Design of proximity detecting codes  

E-Print Network [OSTI]

? 1) = j+Z(j). 21 This proves correctness of the claim. Now, observe that, [i/2J = Q/2J, as j = I ? 1 snd i is odd. Thus, the rs chechbits assigned to data of weight i and j will be identical, i. e. , f; = fj. As the weight of the corresponding... partial (k+ rq)-bit codewords d;c; snd djcj is identical, weight of the (k+ rs + rs)-bit codewords d;c; f; snd djcj fj is also identicaL Therefore, N(d;c; f;, djc; fj) = N(djcjf;, d;c;f;), and a condition in Theorem 1 is satisfied. ~ j = i ? 1, and i...

Perisetty, Srinivas

2012-06-07T23:59:59.000Z

477

Radiosondes Corrected for Inaccuracy in RH Measurements  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

Corrections for inaccuracy in Vaisala radiosonde RH measurements have been applied to ARM SGP radiosonde soundings. The magnitude of the corrections can vary considerably between soundings. The radiosonde measurement accuracy, and therefore the correction magnitude, is a function of atmospheric conditions, mainly T, RH, and dRH/dt (humidity gradient). The corrections are also very sensitive to the RH sensor type, and there are 3 Vaisala sensor types represented in this dataset (RS80-H, RS90, and RS92). Depending on the sensor type and the radiosonde production date, one or more of the following three corrections were applied to the RH data: Temperature-Dependence correction (TD), Contamination-Dry Bias correction (C), Time Lag correction (TL). The estimated absolute accuracy of NIGHTTIME corrected and uncorrected Vaisala RH measurements, as determined by comparison to simultaneous reference-quality measurements from Holger Voemel's (CU/CIRES) cryogenic frostpoint hygrometer (CFH), is given by Miloshevich et al. (2006).

Miloshevich, Larry

478

THE STRENGTH AND RADIAL PROFILE OF THE CORONAL MAGNETIC FIELD FROM THE STANDOFF DISTANCE OF A CORONAL MASS EJECTION-DRIVEN SHOCK  

SciTech Connect (OSTI)

We determine the coronal magnetic field strength in the heliocentric distance range 6-23 solar radii (Rs) by measuring the shock standoff distance and the radius of curvature of the flux rope during the 2008 March 25 coronal mass ejection imaged by white-light coronagraphs. Assuming the adiabatic index, we determine the Alfven Mach number, and hence the Alfven speed in the ambient medium using the measured shock speed. By measuring the upstream plasma density using polarization brightness images, we finally get the magnetic field strength upstream of the shock. The estimated magnetic field decreases from {approx}48 mG around 6 Rs to 8 mG at 23 Rs. The radial profile of the magnetic field can be described by a power law in agreement with other estimates at similar heliocentric distances.

Gopalswamy, Nat [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Yashiro, Seiji [Department of Physics, Catholic University of America, Washington, DC 20064 (United States)

2011-07-20T23:59:59.000Z

479

Politics and popular literature: Karl May and modern German history  

E-Print Network [OSTI]

. emcee co Ka= ' ". ay. . . I"I "ing hi s r eading hours at night, lvner. f'aced by seemingly hopeless situations, he sou' d still ?'each f' or . hose stories, they ga !e h. '. m coucage ' ike wonk - of pnilosol by for orh rs or the B-. L' oc elde. ? y.... emcee co Ka= ' ". ay. . . I"I "ing hi s r eading hours at night, lvner. f'aced by seemingly hopeless situations, he sou' d still ?'each f' or . hose stories, they ga !e h. '. m coucage ' ike wonk - of pnilosol by for orh rs or the B-. L' oc elde. ? y...

Cook, Colleen

2012-06-07T23:59:59.000Z

480

Effects of Ga ion-beam irradiation on monolayer graphene  

SciTech Connect (OSTI)

The effects of Ga ion on the single layer graphene (SLG) have been studied by Raman spectroscopy (RS), SEM, and field-effect characterization. Under vacuum conditions, Ga ion-irradiation can induce disorders and cause red shift of 2D band of RS, rather than lattice damage in high quality SLG. The compressive strain induced by Ga ion decreases the crystalline size in SLG, which is responsible for the variation of Raman scattering and electrical properties. Nonlinear out-put characteristic and resistance increased are also found in the I-V measurement. The results have important implications during CVD graphene characterization and related device fabrication.

Wang, Quan; Mao, Wei; Zhang, Yanmin; Shao, Ying; Ren, Naifei [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China)] [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China); Ge, Daohan [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China) [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China); State Key Laboratory of Transducer Technology, Chinese Academy of Sciences, Shanghai 200050 (China)

2013-08-12T23:59:59.000Z

Note: This page contains sample records for the topic "rs riley stoker" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Many body physics course Diagrammatic series for the ground state energy, general rules  

E-Print Network [OSTI]

-Mann, Brueckner) = k k ck ck 1 2 q0mn Vq cn-q cmq cm cn H = k k ck ck 1 2 klmn V klmn cl ck cm cnH pos.916 rs [rydberg ] 1 ry ~ 13.6 eV #12;GS of high density electron gas (Gell-Mann, Brueckner) ECorr = E0.046 ry #12;GS of high density electron gas (Gell-Mann, Brueckner) 3° order E3 = rs {A3 d3 q q5 B3 d3 q q

Hellsing, Bo

482

Regmi Research Series ,Year 8, December 1, 1976  

E-Print Network [OSTI]

. Captain Fatte Jung Ba.'13dur Kunwar Rana 17 . Gapta in Babar J ung Bahadur Kunwar Rana ... Ra 9 , 000 ... Rs 5 , 001 '" Re 5,001 I n " add i tion , t~z following member s of' the , Rana .family occupied the following positioos 1n the army... . Captain Fatte Jung Ba.'13dur Kunwar Rana 17 . Gapta in Babar J ung Bahadur Kunwar Rana ... Ra 9 , 000 ... Rs 5 , 001 '" Re 5,001 I n " add i tion , t~z following member s of' the , Rana .family occupied the following positioos 1n the army...

Regmi, Mahesh C

1976-01-01T23:59:59.000Z

483

Orbital Susceptibility of an Interacting Electron Gas. II  

Science Journals Connector (OSTI)

An expression for the wave-vector and frequency-dependent orbital susceptibility (?orb) of an interacting electron gas is derived using the "moment-conserving" method. In the static long-wavelength limit, ?orb is computed and compared with the corresponding "random-phase approximation" (RPA) result reported recently by one of us. The corresponding spin susceptibilities (?sp) computed in the moment-conserving method and RPA agree. Since the moment-conserving method gives positive structure factor up to rsrs

A. K. Rajagopal and J. Rath

1972-09-01T23:59:59.000Z

484

Differential Protein Expression in the Insular Cortex and the Amygdala after Taste Memory Acquisition and Retrieval  

E-Print Network [OSTI]

cortex and the amygdala (Guzman-Ramos et 15 al., 2010; Miranda et al., 2003b). Glutamate regulates neuronal excitation either through its ionotropic (iGluRs) or metabotropic receptors (mGluRs). Local microinfusion of mGluR antagonists has helped... committee members, Dr. Mark Zoran and Dr. Paul Hardin helped considerably in improving and shaping my thesis. I would like to extend special thanks to Dr. Kioko Guzman-Ramos who helped me in making steady progress to reach this point. She has been a...

Venkataraman, Archana

2013-05-03T23:59:59.000Z

485

Part 7, Authors: H To Juzuki  

E-Print Network [OSTI]

, Brasil. ?rs-Ber?tt. om Svens. L?k.-S?llsk. Arb.??rs- Ber?ttelse om Svenska L?kare-S?llskapets Arbeten. Stockholm. ?rsbok Soc. Scient. Fennica.??rsbok?Vou- sikirja?Societas Scientiarum Fennica. Helsingfors. Art. M?d.?L'Art M?dical. Paris. Asker? Vet....?Better Farms. Pulaski, ?. Y. Better Health.?Better Health. London. Biblioth. Choisie M?d. (Planque).?Biblioth?-que Choisie de M?dicine. Tir?e des Ouvra- ges P?riodiques. Tant Francois qu'Etran-gers par [Fran?ois] - Planque. Paris. Biblioth. Laeger...

Segal, Dorothy B.; Carson, Gertrude B.; Hassall, Albert; Doss, Mildred A.

1946-01-01T23:59:59.000Z

486

DYNAMIC CONTROL OF A FLOW-RACK AUTOMATED STORAGE AND RETRIEVAL SYSTEM  

E-Print Network [OSTI]

DYNAMIC CONTROL OF A FLOW-RACK AUTOMATED STORAGE AND RETRIEVAL SYSTEM Khalid HACHEMI*, **, Hassane (CPN) for a flow-rack automated storage and retrieval system. The AS/RS is modelled using Coloured Petri nets, the developed model has been used to capture and provide the rack state. We introduce

Paris-Sud XI, Université de

487

Synthesis of Remote Sensing Within a GIS Database to Estimate Landuse Change: an Analysis of the Nhambita  

E-Print Network [OSTI]

as the carbon emissions resultant in the absence of a project, and serve as an assessment of project success 10 years (Dutschke, 2002). The Miombo Community Land Use and Carbon Management project (currently understanding of the carbon balance of the region. The use of extensive RS data as a compliment to intensive yet

488

Thermoelectric Transport in a ZrN/ScN Superlattice MONA ZEBARJADI,1  

E-Print Network [OSTI]

reduce the lattice contribution to the thermal conductivity. In this paper, we present theoretical is defined as rS2 T=j; where r is the electrical conductivity, S is the Seebeck coefficient, j is the thermal- tion to enhance ZT by using low-dimensional ther- moelectric materials. At low dimensions, the Seebeck

489

An Examination of the Thermodynamics of Fusion, Vaporization, and Sublimation of (R,S)-and (R)-Flurbiprofen by Correlation  

E-Print Network [OSTI]

An Examination of the Thermodynamics of Fusion, Vaporization, and Sublimation of (R,S)- and (R)-Flurbiprofen by Correlation Gas Chromatography PATAMAPORN UMNAHANANT, DARRELL HASTY, JAMES CHICKOS Department of Chemistry (wileyonlinelibrary.com). DOI 10.1002/jps.23094 ABSTRACT: The vaporization, fusion, and sublimation enthalpies of (R

Chickos, James S.

490

Signal Processing 24 (1991) 117-126 117 Interpolating and Nyquist filters with constraints at  

E-Print Network [OSTI]

, Montreal, Quebec, Canada H3A 2A7, and INRS-Telecommunications, Universitd du Quebec, 3 Place du Commerce, Verdun, Quebec, Canada H3E 1H6 Eric Dubois IN RS-Telecommunications, Universit~ du QuObec, 3 Place du Commerce, Verdun, Quebec, Canada H3E 1H6 Received 6 November 1989 Revised 26 November 1990 Abstract

Kabal, Peter

491

Fusion procedure for the two-parameter quantum algebra $U_{r,s}(sl_n)$  

E-Print Network [OSTI]

Irreducible modules of the two-parameter quantum enveloping algebra $U_{r,s}(\\mathfrak{sl}_n)$ are explicitly constructed using the fusion procedure, when $rs^{-1}$ is not a root of unity. This provides an alternative and combinatorial description of the Schur-Weyl duality for two-parameter quantum algebras of type $A$.

Naihuan Jing; Ming Liu

2014-02-15T23:59:59.000Z

492

APPLICATION OF 3S TECHNIQUES IN THE STUDY OF WETLAND ENVIRONMENT OF  

E-Print Network [OSTI]

landscape and unique ecosystem offering physical contribution to human society such as maintenance levels(Yi1995Wang et al2001). Recently many researchers are interested in the study of landscape patterns of wetlands based on RS and GIS at the landscape scale (Liu2004 Kelly 2001 ) However

493

Laser Range Finder Objective: Use a forward pointing laser range finder to  

E-Print Network [OSTI]

Laser Range Finder Objective: Use a forward pointing laser range finder to detect and avoid obstacles. Principle Investigators: Randy Beard, Tim McLain Laser Range Finder Opti-Logic RS400 Laser path, laser detects object. 2. Upon detection, insert cylindrical object into world map and plan path

Wirthlin, Michael J.

494

Comparison of spaced-antenna baseline wind estimators: Theoretical and simulated results  

E-Print Network [OSTI]

Comparison of spaced-antenna baseline wind estimators: Theoretical and simulated results Richard J), Comparison of spaced-antenna baseline wind estimators: Theoretical and simulated results, Radio Sci., 39, RS November 2003; published 22 January 2004. [1] Formulas for the theoretical precision of cross-beam winds

Zhang, Guifu

495

Warm water occupancy by North Sea cod  

Science Journals Connector (OSTI)

...given the number of cod at liberty (129) and the number of days...returned number of days at liberty longest record (days) min...indicate the number of cod at liberty during each month. Average...study was jointly funded by EU projects METACOD (Q5RS-2001-00953...

2007-01-01T23:59:59.000Z

496

ISocRob 2006 Team Description Paper  

E-Print Network [OSTI]

a programmable PID controller, power amplifier and RS232 connection. The omnidirectional wheels were specially the border of the main wheel. A new electromechanical kicker was designed by ServiLog, based on a piston by a servo motor. The kicker has a range of possible displacements, allowing kick force control (i.e., ball

Instituto de Sistemas e Robotica

497

Seasonal changes in the relative abundance of uncultivated sulfate-reducing bacteria in a salt marsh sediment and in the rhizosphere of Spartina alterniflora.  

Science Journals Connector (OSTI)

...reducing bacteria in a salt marsh sediment and in the rhizosphere...alterniflora JN Rooney-Varga R Devereux RS Evans ME Hines Institute...sulfate-reducing bacteria in a salt marsh sediment and in the rhizosphere...from DNA extracted from salt marsh rhizosphere samples. Two novel...

J N Rooney-Varga; R Devereux; R S Evans; M E Hines

1997-10-01T23:59:59.000Z

498

Technical Report KN2010DiSy01  

E-Print Network [OSTI]

University of Konstanz ­ Germany Konstanzer Online-Publikations-System (KOPS) URN: http standardized way), REST catches up regarding straight usages (e.g JAX-RS regarding Java). With the clean technology for web-based applications, we want to mo- tivate a common interface layer for XML-based resources

Scholl, Marc H.

499

Media-based Modulation: A New Approach to Wireless Transmission  

E-Print Network [OSTI]

in energy with respect to a K ? K traditional MIMO are achieved. Similar energy savings are possible in SISO, the corresponding received constellation will consist of M = 2Rm points. It is obviously possible, and indeed constellation transmits Rs + Rm bits which are channel coded to achieve reliable transmission over

Waterloo, University of

500

Curvature effects in vesicle-particle interactions  

Science Journals Connector (OSTI)

...we conclude that the principal curvatures mutually exchange, whereas the geodesic curvatures of the principal directions are rede ned as g1 = g2, g2 = g1. Moreover, 11 = rs 1 e 1 = 22; 21 = 12; 12 = 21 22 = 11: Hence, substituting into (3.16...

2003-01-01T23:59:59.000Z