National Library of Energy BETA

Sample records for rs riley stoker

  1. QER- Comment of Jennifer Riley

    Broader source: Energy.gov [DOE]

    To Whom It May Concern - I am writing to strongly object to the proposed natural gas pipeline extension from Wright, NY to Dracut, MA. There would be no benefit to Massachusetts whatsoever from such a pipeline, which would carry natural gas ultimately to be exported. It would, however, damage sensitive ecosystems and farmland across the state, and carry a constant risk of explosion and leaks. Now is the time to turn decisively away from the use of fossil fuels, especially such a potent greenhouse gas as methane. Governor Patrick has committed our state to a clean energy future, and we are seeing unprecedented development of renewable energy projects. When you add in sensible and planned conservation efforts, it becomes abundantly clear that we do not need the natural gas from this pipeline - even if we were it's intended recipients. This proposed pipeline would benefit only the natural gas companies involved, and would cause significant damage not only to the environment of Massachusetts, but would also contribute to greenhouse gases in the atmosphere at a time when it is imperative that we reduce atmospheric CO2. I cannot urge you strongly enough to deny approval of this pipeline; it is not the way forward. - Jennifer Riley

  2. Katherine Riley | Argonne Leadership Computing Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse Bergkamp Graduate student Subtask 4Photo4 | NationalAboutKatherine Riley

  3. Argonne Leadership Compu2ng Facility www.alcf.anl.gov Katherine Riley

    E-Print Network [OSTI]

    Kemner, Ken

    Argonne Leadership Compu2ng Facility ­ www.alcf.anl.gov Katherine Riley Manager requested 6 Funding sources 7 Other high-performance compu2ng support

  4. Genomics of wood-degrading fungi Ohm, Robin A.; Riley, Robert...

    Office of Scientific and Technical Information (OSTI)

    Genomics of wood-degrading fungi Ohm, Robin A.; Riley, Robert; Salamov, Asaf; Min, Byoungnam; Choi, In-Geol; Grigoriev, Igor V. Not Available Elsevier None USDOE United States...

  5. APRIORI BOUNDS FOR REACTION-DIFFUSION SYSTEMS ARISING IN CHEMICAL JEFF S. MCGOUGH AND KYLE RILEY

    E-Print Network [OSTI]

    McGough, Jeff S.

    APRIORI BOUNDS FOR REACTION-DIFFUSION SYSTEMS ARISING IN CHEMICAL KINETICS JEFF S. MCGOUGH AND KYLE RILEY Abstract. The authors investigate reaction diffusion equations which arise in chemical kinetics diffusion equations, gradient bounds, chemical kinetics, autocatalytic reactions AMS subject classifications

  6. Biodiesel Sim: Crowdsourcing Simulations for Complex Model Analysis Derek Riley, Xiaowei Zhang, Xenofon Koutsoukos

    E-Print Network [OSTI]

    Koutsoukos, Xenofon D.

    Biodiesel Sim: Crowdsourcing Simulations for Complex Model Analysis Derek Riley, Xiaowei Zhang Computation, Biodiesel Abstract Biodiesel is an alternative fuel source that can be easily made by novices of the proces- sor. A biodiesel processor is a complex system that can be modeled and simulated using formal

  7. Facilities management: the development of a model for building condition assessment surveys conducted at Fort Riley, Kansas 

    E-Print Network [OSTI]

    Riblett, Carl Olin

    1993-01-01

    The purpose of this study is to document the research and design of a condition assessment system for buildings by utilizing case study methods for the facilities located at Fort Riley, Kansas, an Army military installation. ...

  8. UBC Social Ecological Economic Development Studies (SEEDS) Student Report Gursimran Singh, Nikola Radoicic, Riley Marsh, Shruti Kapoor

    E-Print Network [OSTI]

    UBC Social Ecological Economic Development Studies (SEEDS) Student Report Gursimran Singh, Nikola Radoicic Gursimran Singh Riley Marsh Shruti Kapoor 1 #12;Abstract This report uses the triple bottom line

  9. Development of METHANE de-NOX Reburn Process for Wood Waste and Biomass Fired Stoker Boilers - Final Report - METHANE de-NOX Reburn Technology Manual

    SciTech Connect (OSTI)

    J. Rabovitser; B. Bryan; S. Wohadlo; S. Nester; J. Vaught; M. Tartan L. Szymanski; R. Glickert

    2007-12-31

    The overall objective of this project was to demonstrate the effectiveness of the METHANE de-NOX® (MdN) Reburn process in the Forest Products Industry (FPI) to provide more efficient use of wood and sludge waste (biosolids) combustion for both energy generation and emissions reduction (specifically from nitrogen oxides (NOx)) and to promote the transfer of the technology to the wide range of wood waste-fired stoker boilers populating the FPI. This document, MdN Reburn Commercial Technology Manual, was prepared to be a resource to promote technology transfer and commercialization activities of MdN in the industry and to assist potential users understand its application and installation requirements. The Manual includes a compilation of MdN commercial design data from four different stoker boiler designs that were baseline tested as part of the development effort. Design information in the Manual include boiler CFD model studies, process design protocols, engineering data sheets and commercial installation drawings. Each design package is unique and implemented in a manner to meet specific mill requirements.

  10. Quantitative Shape Measurements of Distal Volcanic Ash Colleen M. Riley, William I. Rose, and Gregg J.S. Bluth

    E-Print Network [OSTI]

    Rose, William I.

    Quantitative Shape Measurements of Distal Volcanic Ash Colleen M. Riley, William I. Rose, and Gregg-7093; Email: colleenandahi@hotmail.com #12;2 Abstract Large-scale volcanic eruptions produce fine ash ( distances from the volcanic source, thus, becoming a hazard to aircraft and public health. Ash particles

  11. AGE -A HEA Cancer FoRs

    E-Print Network [OSTI]

    Balasuriya, Sanjeeva

    CANCER CANCER R REVIEW D DR ADAM B FoRs RESEARCH DOCUMENT BUTLER, RE H COVERA T ESEARCH P AGE;Cancer FoRs 5 June 2013 Page 2 BACKGROUND This document was created for the Health and Medical Research Strategic Review and attempts to outline the coverage of cancer research throughout the university

  12. Comparison of Vaisala radiosondes RS41 and RS92 at the ARM Southern Great Plains Site

    SciTech Connect (OSTI)

    Jensen, M. P.; Holdridge, D.; Survo, P.; Lehtinen, R.; Baxter, S.; Toto, T.; Johnson, K. L.

    2015-11-02

    In the fall of 2013, the Vaisala RS41-SG (4th generation) radiosonde was introduced as a replacement for the RS92-SGP radiosonde with improvements in measurement accuracy of profiles of atmospheric temperature, humidity and pressure. Thus, in order to help characterize these improvements, an intercomparison campaign was undertaken at the US Department of Energy's Atmospheric Radiation Measurement (ARM) Facility site in north Central Oklahoma USA. During 3–8 June 2014, a total of 20 twin-radiosonde flights were performed in a variety of atmospheric conditions representing typical midlatitude continental summertime conditions. The results suggest that the RS92 and RS41 measurements generally agree within manufacturer specified tolerances with notable exceptions when exiting liquid cloud layers where the "wet bulbing" effect is mitigated in the RS41 observations. The RS41 measurements also appear to show a smaller impact from solar heating. These results suggest that the RS41 does provide important improvements, particularly in cloudy conditions, but under most observational conditions the RS41 and RS92 measurements agree within the manufacturer specified limits and so a switch to RS41 radiosondes will have little impact on long-term observational records.

  13. Comparison of Vaisala radiosondes RS41 and RS92 at the ARM Southern Great Plains Site

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jensen, M. P.; Holdridge, D.; Survo, P.; Lehtinen, R.; Baxter, S.; Toto, T.; Johnson, K. L.

    2015-11-02

    In the fall of 2013, the Vaisala RS41-SG (4th generation) radiosonde was introduced as a replacement for the RS92-SGP radiosonde with improvements in measurement accuracy of profiles of atmospheric temperature, humidity and pressure. Thus, in order to help characterize these improvements, an intercomparison campaign was undertaken at the US Department of Energy's Atmospheric Radiation Measurement (ARM) Facility site in north Central Oklahoma USA. During 3–8 June 2014, a total of 20 twin-radiosonde flights were performed in a variety of atmospheric conditions representing typical midlatitude continental summertime conditions. The results suggest that the RS92 and RS41 measurements generally agree within manufacturermore »specified tolerances with notable exceptions when exiting liquid cloud layers where the "wet bulbing" effect is mitigated in the RS41 observations. The RS41 measurements also appear to show a smaller impact from solar heating. These results suggest that the RS41 does provide important improvements, particularly in cloudy conditions, but under most observational conditions the RS41 and RS92 measurements agree within the manufacturer specified limits and so a switch to RS41 radiosondes will have little impact on long-term observational records.« less

  14. Using MODIS FRP Values to Estimate Forest Fire PM 2.5 Emissions Riley Start, Brian Lamb, Brian Potter, Alistair Smith

    E-Print Network [OSTI]

    Collins, Gary S.

    Using MODIS FRP Values to Estimate Forest Fire PM 2.5 Emissions Riley Start, Brian Lamb, Brian Potter, Alistair Smith Forest and Rangeland Measurements Laboratory, College of Natural Resources, Washington State University USDA Forest Service 1. Introduction Accurate estimates of PM 2.5 (particulate

  15. ARM - Field Campaign - RS-90 Transition IOP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design togovCampaignsMASRAD: Pt.CampaignSTations (RADAGAST)govCampaignsRS-90

  16. 359-06/RDS/rs PERSISTENT SURVEILLANCE FOR

    E-Print Network [OSTI]

    359-06/RDS/rs PERSISTENT SURVEILLANCE FOR PIPELINE PROTECTION AND THREAT INTERDICTION Overview (hot, corrosive, neutrons) ­ Environmentally attractive materials ­ High reliability, (disruptions, off

  17. VLA multifrequency observations of RS CVn binaries

    E-Print Network [OSTI]

    J. Garcia-Sanchez; J. M. Paredes; M. Ribo

    2003-03-21

    We present multiepoch Very Large Array (VLA) observations at 1.4 GHz, 4.9 GHz, 8.5 GHz and 14.9 GHz for a sample of eight RS CVn binary systems. Circular polarization measurements of these systems are also reported. Most of the fluxes observed are consistent with incoherent emission from mildly relativistic electrons. Several systems show an increase of the degree of circular polarization with increasing frequency in the optically thin regime, in conflict with predictions by gyrosynchrotron models. We observed a reversal in the sense of circular polarization with increasing frequency in three non-eclipsing systems: EI Eri, DM Uma and HD 8358. We find clear evidence for coherent plasma emission at 1.4 GHz in the quiescent spectrum of HD 8358 during the helicity reversal. The degrees of polarization of the other two systems could also be accounted for by a coherent emission process. The observations of ER Vul revealed two U-shaped flux spectra at the highest frequencies. The U-shape of the spectra may be accounted for by an optically thin gyrosynchrotron source for the low frequency part whereas the high frequency part is dominated by a thermal emission component.

  18. Dear Mayor Riley: I

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers CoMadison - 1325.8.p, .'~. Washington, DC

  19. 27/10/2010 12:48AGU: Highlatitude geomagnetically induced current events observed on very low frequency radio wave receiver systems Page 1 of 2http://europa.agu.org/?view=article&uri=/journals/rs/rs1002/2009RS004215/2009RS004215.xml&t=

    E-Print Network [OSTI]

    Ulich, Thomas

    frequency radio wave receiver systems Page 1 of 2http://europa.agu.org/?view=article&uri=/journals/rs/rs1002/2009RS004215/2009RS004215.xml&t= Keywords radio waves induced currents geomagnetic Index Terms Ionosphere Abstract Highlatitude geomagnetically induced current events observed on very low frequency radio wave

  20. NEWS & VIEWS nEutRon StaRS

    E-Print Network [OSTI]

    Loss, Daniel

    NEWS & VIEWS nEutRon StaRS a magnetar by another name Fernando Camilo is at the Columbia core, held stable by neutron degeneracy pressure -- with more mass than the Sun within a 10 km radius -- has central densities comparable to those of nuclei. What does the neutron star sky look like, made

  1. A Magnetically-Switched, Rotating Black Hole Model For the Production of Extragalactic Radio Jets and the Fanaroff and Riley Class Division

    E-Print Network [OSTI]

    David L. Meier

    1999-07-30

    A model is presented in which both Fanaroff and Riley class I and II extragalactic jets are produced by magnetized accretion disk coronae in the ergospheres of rotating black holes. While the jets are produced in the accretion disk itself, the output power still is an increasing function of the black hole angular momentum. For high enough spin, the black hole triggers the magnetic switch, producing highly-relativistic, kinetic-energy-dominated jets instead of Poynting-flux-dominated ones for lower spin. The coronal mass densities needed to trigger the switch at the observed FR break power are quite small ($\\sim 10^{-15} g cm^{-3}$), implying that the source of the jet material may be either a pair plasma or very tenuous electron-proton corona, not the main accretion disk itself. The model explains the differences in morphology and Mach number between FR I and II sources and the observed trend for massive galaxies to undergo the FR I/II transition at higher radio power. It also is consistent with the energy content of extended radio lobes and explains why, because of black hole spindown, the space density of FR II sources should evolve more rapidly than that of FR I sources. If the present model is correct, then the ensemble average speed of parsec-scale jets in sources distinguished by their FR I morphology (not luminosity) should be distinctly slower than that for sources with FR II morphology. The model also suggests the existence of a population of high-redshift, sub-mJy FR I and II radio sources associated with spiral or pre-spiral galaxies that flared once when their black holes were formed but were never again re-kindled by mergers.

  2. Fusion Engineering and Design 38 (1997) 189218 ARIES-RS safety design and analysis

    E-Print Network [OSTI]

    California at San Diego, University of

    1997-01-01

    Fusion Engineering and Design 38 (1997) 189­218 ARIES-RS safety design and analysis D. Steiner *, L Abstract The ARIES-RS safety design and analysis focused on achieving two objectives: (1) The avoidance. Preliminary analysis of this modified design suggests that the first wall maximum temperature can be kept

  3. Fusion Engineering and Design 41 (1998) 377383 ARIES-RS maintenance approach for high availability

    E-Print Network [OSTI]

    California at San Diego, University of

    1998-01-01

    . Louis, MO 63166-0516, USA Abstract The ARIES-RS tokamak power plant study developed a design approach as reported by Mau [3]. The ARIES-RS design is based on a commercial fusion power plant with a net electric on design features leading to high overall availability of the plant. The availability of a power station

  4. Fusion Engineering and Design 41 (1998) 491499 Engineering design of the ARIES-RS power plant

    E-Print Network [OSTI]

    California at San Diego, University of

    1998-01-01

    Fusion Engineering and Design 41 (1998) 491­499 Engineering design of the ARIES-RS power plant M 92093-0417, USA Abstract ARIES-RS is a fusion power plant design study which has examined the ability of an advanced tokamak-based power plant to compete with future energy sources and play a significant role

  5. 954ER4 Specification 4 ports RS-232 PCI-Express Serial cards

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    954ER4 Specification 4 ports RS-232 PCI-Express Serial cards FEATURES 4 independent RS-232 serial ports with communication speeds up to 230 921 ­­­­Kbps Designed to meet PCI-Express Base Specification Revision 1.1 Supports x1,x2,x4,x8,x16 lane ­­­­PCI-Express Bus connector keys High speed 16C950 compatible

  6. GSA TEAs ToRs (revised August 2014) Page 1 of 2

    E-Print Network [OSTI]

    Calgary, University of

    GSA TEAs ToRs (revised August 2014) Page 1 of 2 PURPOSE OF THE AWARD: Every year, the GSA presents;GSA TEAs ToRs (revised August 2014) Page 2 of 2 Successful applications will be kept for 2 years after

  7. GSA TEAs ToRs (revised August 2014) Page 1 of 2

    E-Print Network [OSTI]

    Calgary, University of

    GSA TEAs ToRs (revised August 2014) Page 1 of 2 PURPOSE OF THE AWARD: Every year, the GSA presents #12;GSA TEAs ToRs (revised August 2014) Page 2 of 2 Other Regulations: 1. The Teaching & Supervisory faith to remain for the full academic year. 2. The activities of the TEAs-administering committee

  8. Katherine Riley | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Browse by Topic Energy Energy efficiency Vehicles Alternative fuels Automotive engineering Biofuels Diesel Fuel economy Fuel injection Heavy-duty vehicles Hybrid & electric...

  9. Early Super Soft Source spectra in RS Oph

    E-Print Network [OSTI]

    Ness, Jan-Uwe

    2015-01-01

    Recent Swift X-ray monitoring campaigns of novae have revealed extreme levels of variability during the early super-soft-source (SSS) phase. The first time this was observed was during the 2006 outburst of the recurrent nova RS Oph which was also extensively covered by grating observations with XMM-Newton and Chandra. I focus here on an XMM-Newton observation taken on day 26.1, just before Swift confirmed the start of the SSS phase, and a Chandra observation taken on day 39.7. The first observation probes the evolution of the shock emission produced by the collision of the nova ejecta with the stellar wind of the companion. The second observation contains bright SSS emission longwards of 15A while at short wavelengths, the shock component can be seen to have hardly changed. On top of the SSS continuum, additional emission lines are clearly seen, and I show that they are much stronger than those seen on day 26.1, indicating line pumping caused by the SSS emission. The lightcurve on day 39.7 is highly variable ...

  10. Implicit Phasing for R6RS Libraries Abdulaziz Ghuloum and R. Kent Dybvig

    E-Print Network [OSTI]

    Dybvig, R. Kent

    as a set of libraries. It also provides a syntax for defining new portable li- braries. The same library provides programmers with a library form via which new li- braries may be defined. Libraries define newImplicit Phasing for R6RS Libraries Abdulaziz Ghuloum and R. Kent Dybvig Department of Computer

  11. Improved Yield and Diverse Finished Bacterial Genomes using Pacific Biosciences RS II SMRT Sequencing

    E-Print Network [OSTI]

    Weber, David J.

    Improved Yield and Diverse Finished Bacterial Genomes using Pacific Biosciences RS II SMRT-Cruz, Alvaro Godinez, Luke J. Tallon Institute for Genome Sciences, University of Maryland School of Medicine, effective, and highly accurate platform for generation of complete microbial genome sequences. As early

  12. Liverpool Telescope Optical Photometry Following the 2006 Outburst of RS Ophiuchi

    E-Print Network [OSTI]

    M. J. Darnley; R. A. Hounsell; M. F. Bode

    2008-09-26

    We present a preliminary report on the broadband optical photometry of the 2006 outburst of the recurrent nova RS Ophiuchi. These data were obtained using the robotic 2m Liverpool Telescope and cover the outburst from day 27 through day 548.

  13. Remote Sens. 2011, 3, 1427-1446; doi:10.3390/rs3071427 Remote Sensing

    E-Print Network [OSTI]

    Keeton, William S.

    carbon dioxide and potentially complex interactions with other anthropogenic stressors [4,5] requireRemote Sens. 2011, 3, 1427-1446; doi:10.3390/rs3071427 Remote Sensing ISSN 2072-4292 www.mdpi.com/journal/remotesensing Article Evaluating the Remote Sensing and Inventory-Based Estimation of Biomass in the Western Carpathians

  14. Y&ffi#rs&.PowER 3628South35th Street

    E-Print Network [OSTI]

    .-\\L -qI\\ _\\_ -q\\- Y&ffi#rs&.PowER 3628South35th Street Tacoma,Washington 98409-3192 T A C O M A PPower& ConservationCouncil 851SW 6thAvenue,Suite1100 Portland,OR 97204-1348 DearMr. Walker: Tacoma

  15. REGISTRATION HANDBOOK AND ScHEDULE oF CouRsEs

    E-Print Network [OSTI]

    Mojzsis, Stephen J.

    REGISTRATION HANDBOOK AND ScHEDULE oF CouRsEs +; SPRING 1992 BOULDEROFFICE OF THE REGISTRAR #12;T his revised and expanded Registration Handbook andSchedule ofCourses contains all the informa- tion or procedures change at the last minu~e; will you, receive further information. Pl~e keep this handbook with you

  16. WORLDLY | IntegRateD | peRsOnaLIzeD MBa We develop leaders

    E-Print Network [OSTI]

    Shoubridge, Eric

    WORLDLY | IntegRateD | peRsOnaLIzeD MBa beyond business as usual #12;We develop leaders With integrity What is unique about the Desautels Faculty of Management is the way in which we provide students with a rigorous academic education integrated with the real world of business to create a meaningful learning

  17. Remote Sens. 2013, 5, 5173-5192; doi:10.3390/rs5105173 Remote Sensing

    E-Print Network [OSTI]

    California at Berkeley, University of

    Remote Sens. 2013, 5, 5173-5192; doi:10.3390/rs5105173 Remote Sensing ISSN 2072-4292 www: fire detection; geosynchronous; remote sensing; infrared; FUEGO 1. Introduction 1.1. Overview Fire for a geosynchronous OPEN ACCESS #12;Remote Sens. 2013, 5 5174 satellite with modern imaging detectors, software

  18. Remote Sens. 2009, 1, 519-533; doi:10.3390/rs1030519 Remote Sensing

    E-Print Network [OSTI]

    Anderson, Charles W.

    Remote Sens. 2009, 1, 519-533; doi:10.3390/rs1030519 Remote Sensing ISSN 2072-4292 www of Remotely Sensed Data Paul H. Evangelista 1, *, Thomas J. Stohlgren 2 , Jeffrey T. Morisette 2 and Sunil model (Maxent) for its application and performance in remotely sensing invasive Tamarix sp. Six Landsat

  19. R(s) and hadronic tau-Decays in Order alpha_s^4: technical aspects

    E-Print Network [OSTI]

    P. A. Baikov; K. G. Chetyrkin; J. H. Kühn

    2009-06-16

    We report on some technical aspects of our calculation of alpha_s^4 corrections to R(s) and the semi-leptonic tau decay width [1-3]. We discuss the inner structure of the result as well as the issue of its correctness. We demonstrate recently appeared independent evidence positively testing one of two components of the full result.

  20. Sandstone cementation and fluids in hydrocarbon basins R.S. Haszeldinea,*, C.I. Macaulaya

    E-Print Network [OSTI]

    Haszeldine, Stuart

    Sandstone cementation and fluids in hydrocarbon basins R.S. Haszeldinea,*, C.I. Macaulaya , A there is an intermediate view. Processes governing sandstone cementation in the deep sub-surface are elusive, case have driven studies of sandstone cementation in the past ten years: Firstly, the economic motive

  1. Fusion Engineering and Design 38 (1997) 5986 Systems analysis in support of the selection of the ARIES-RS

    E-Print Network [OSTI]

    California at San Diego, University of

    1997-01-01

    Fusion Engineering and Design 38 (1997) 59­86 Systems analysis in support of the selection.A. Keywords: ARIES-RS reference design point; Parametric sensitivities; Systems analysis 1. Introduction, systems analysis was used to aid in the definition of the ARIES-RS design point. This analysis determined

  2. Crystallization of iysozyme with (R)-, (S)- and (RS)-2-methyl-2,4-pentanediol

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Stauber, Mark; Jakoncic, Jean; Berger, Jacob; Karp, Jerome M.; Axelbaum, Ariel; Sastow, Dahniel; Buldyrev, Sergey V.; Hrnjez, Bruce J.; Asherie, Neer

    2015-03-01

    Chiral control of crystallization has ample precedent in the small-molecule world, but relatively little is known about the role of chirality in protein crystallization. In this study, lysozyme was crystallized in the presence of the chiral additive 2-methyl-2,4-pentanediol (MPD) separately using the R and S enantiomers as well as with a racemic RS mixture. Crystals grown with (R)-MPD had the most order and produced the highest resolution protein structures. This result is consistent with the observation that in the crystals grown with (R)-MPD and (RS)-MPD the crystal contacts are made by (R)-MPD, demonstrating that there is preferential interaction between lysozymemore »and this enantiomer. These findings suggest that chiral interactions are important in protein crystallization.« less

  3. Crystallization of lysozyme with (R)-, (S)- and (RS)-2-methyl-2,4-pentanediol

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Stauber, Mark; Jakoncic, Jean; Berger, Jacob; Karp, Jerome M.; Axelbaum, Ariel; Sastow, Dahniel; Buldyrev, Sergey V.; Hrnjez, Bruce J.; Asherie, Neer

    2015-03-01

    Chiral control of crystallization has ample precedent in the small-molecule world, but relatively little is known about the role of chirality in protein crystallization. In this study, lysozyme was crystallized in the presence of the chiral additive 2-methyl-2,4-pentanediol (MPD) separately using the R and S enantiomers as well as with a racemic RS mixture. Crystals grown with (R)-MPD had the most order and produced the highest resolution protein structures. This result is consistent with the observation that in the crystals grown with (R)-MPD and (RS)-MPD the crystal contacts are made by (R)-MPD, demonstrating that there is preferential interaction between lysozymemore »and this enantiomer. These findings suggest that chiral interactions are important in protein crystallization.« less

  4. BVR photometry of a newly identified RS CVn binary star HD 61396

    E-Print Network [OSTI]

    Sudhanshu Barway; S. K. Pandey; Padmakar Singh Parihar

    2004-08-10

    BVR photometry of a recently identified RS CVn binary star HD61396, carried out during 2001, is presented. The new photometry reveal significant evolution in the shape and amplitude of light curve when compared with those reported earlier by Padmakar etal (2000). The traditional two-starspot model has been used to obtain the spot parameters from the observed light curve. Changes in the spot area and their location on the stellar surface are discernible from the extracted parameters from the new photometry.

  5. X-Ray Emitting Blast Wave from the Recurrent Nova RS Ophiuchi

    E-Print Network [OSTI]

    J. L. Sokoloski; G. J. M. Luna; K. Mukai; Scott J. Kenyon

    2006-05-30

    Stellar explosions such as novae and supernovae produce most of the heavy elements in the Universe. Although the onset of novae from runaway thermonuclear fusion reactions on the surface of a white dwarf in a binary star system is understood[1], the structure, dynamics, and mass of the ejecta are not well known. In rare cases, the white dwarf is embedded in the wind nebula of a red-giant companion; the explosion products plow through the nebula and produce X-ray emission. Early this year, an eruption of the recurrent nova RS Ophiuchi[2,3] provided the first opportunity to perform comprehensive X-ray observations of such an event and diagnose conditions within the ejecta. Here we show that the hard X-ray emission from RS Ophiuchi early in the eruption emanates from behind a blast wave, or outward-moving shock wave, that expanded freely for less than 2 days and then decelerated due to interaction with the nebula. The X-rays faded rapidly, suggesting that the blast wave deviates from the standard spherical shell structure[4-6]. The early onset of deceleration indicates that the ejected shell had a low mass, the white dwarf has a high mass[7], and that RS Ophiuchi is a progenitor of the type of supernova integral to studies of the expansion of the universe.

  6. THE SUPERSOFT X-RAY PHASE OF NOVA RS OPHIUCHI 2006

    SciTech Connect (OSTI)

    Osborne, J. P.; Page, K. L.; Beardmore, A. P.; Goad, M. R.; Bode, M. F.; O'Brien, T. J.; Starrfield, S.; Rauch, T.; Ness, J.-U.; Krautter, J.; Schwarz, G.; Burrows, D. N.; Gehrels, N.; Drake, J. J.; Evans, A.; Eyres, S. P. S.

    2011-02-01

    Swift X-ray observations of the {approx}60 day supersoft phase of the recurrent nova RS Ophiuchi (RS Oph) 2006 show the progress of nuclear burning on the white dwarf (WD) in exquisite detail. First seen 26 days after the optical outburst, this phase started with extreme variability likely due to variable absorption, although intrinsic WD variations are not excluded. About 32 days later, a steady decline in count rate set in. NLTE model atmosphere spectral fits during the supersoft phase show that the effective temperature of the WD increases from {approx}65 eV to {approx}90 eV during the extreme variability phase, falling slowly after about day 60 and more rapidly after day 80. The bolometric luminosity is seen to be approximately constant and close to Eddington from day 45 up to day 60, the subsequent decline possibly signaling the end of extensive nuclear burning. Before the decline, a multiply-periodic {approx}35 s modulation of the soft X-rays was present and may be the signature of a nuclear fusion driven instability. Our measurements are consistent with a WD mass near the Chandrasekhar limit; combined with a deduced accumulation of mass transferred from its binary companion, this leads us to suggest that RS Oph is a strong candidate for a future supernova explosion. The main uncertainty now is whether the WD is the CO type necessary for a Type Ia supernova. This may be confirmed by detailed abundance analyses of spectroscopic data from the outbursts.

  7. Women @ Energy: Katherine Riley | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Department? Computational science is an immensely powerful tool. Proving high performance computing power for the best computational science work in the world is inherently...

  8. Women @ Energy: Katherine Riley | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'S FUTURE.Energy Wind Power Today,CarolKaren Schuchardt Women

  9. Crystallization of lysozyme with (R)-, (S)- and (RS)-2-methyl-2, 4-pentanediol

    SciTech Connect (OSTI)

    Stauber, Mark; Jakoncic, Jean; Berger, Jacob; Karp, Jerome M.; Axelbaum, Ariel; Sastow, Dahniel; Buldyrev, Sergey V.; Hrnjez, Bruce J.; Asherie, Neer

    2015-03-01

    Crystallization of lysozyme with (R)-2-methyl-2, 4-pentanediol produces more ordered crystals and a higher resolution protein structure than crystallization with (S)-2-methyl-2, 4-pentanediol. The results suggest that chiral interactions with chiral additives are important in protein crystal formation. Chiral control of crystallization has ample precedent in the small-molecule world, but relatively little is known about the role of chirality in protein crystallization. In this study, lysozyme was crystallized in the presence of the chiral additive 2-methyl-2, 4-pentanediol (MPD) separately using the R and S enantiomers as well as with a racemic RS mixture. Crystals grown with (R)-MPD had the most order and produced the highest resolution protein structures. This result is consistent with the observation that in the crystals grown with (R)-MPD and (RS)-MPD the crystal contacts are made by (R)-MPD, demonstrating that there is preferential interaction between lysozyme and this enantiomer. These findings suggest that chiral interactions are important in protein crystallization.

  10. The rotational order–disorder structure of the reversibly photoswitchable red fluorescent protein rsTagRFP

    SciTech Connect (OSTI)

    Pletnev, Sergei, E-mail: pletnevs@mail.nih.gov [Argonne National Laboratory, Argonne, IL 60439 (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); Subach, Fedor V.; Verkhusha, Vladislav V. [Albert Einstein College of Medicine, Bronx, NY 10461 (United States); Dauter, Zbigniew, E-mail: pletnevs@mail.nih.gov [Argonne National Laboratory, Argonne, IL 60439 (United States)

    2014-01-01

    An analysis of the rotational order–disorder structure of the reversibly photoswitchable red fluorescent protein rsTagRFP is presented. The rotational order–disorder (OD) structure of the reversibly photoswitchable fluorescent protein rsTagRFP is discussed in detail. The structure is composed of tetramers of 222 symmetry incorporated into the lattice in two different orientations rotated 90° with respect to each other around the crystal c axis and with tetramer axes coinciding with the crystallographic twofold axes. The random distribution of alternatively oriented tetramers in the crystal creates the rotational OD structure with statistically averaged I422 symmetry. Despite order–disorder pathology, the structure of rsTagRFP has electron-density maps of good quality for both non-overlapping and overlapping parts of the model. The crystal contacts, crystal internal architecture and a possible mechanism of rotational OD crystal formation are discussed.

  11. Detecting the Companions and Ellipsoidal Variations of RS CVn Primaries: I. sigma Geminorum

    E-Print Network [OSTI]

    Roettenbacher, Rachael M; Henry, Gregory W; Fekel, Francis C; Williamson, Michael H; Pourbaix, Dimitri; Latham, David W; Latham, Christian A; Torres, Guillermo; Baron, Fabien; Che, Xiao; Kraus, Stefan; Schaefer, Gail H; Aarnio, Alicia N; Korhonen, Heidi; Harmon, Robert O; Brummelaar, Theo A ten; Sturmann, Judit; Sturmann, Laszlo; Turner, Nils H

    2015-01-01

    To measure the properties of both components of the RS CVn binary sigma Geminorum (sigma Gem), we directly detect the faint companion, measure the orbit, obtain model-independent masses and evolutionary histories, detect ellipsoidal variations of the primary caused by the gravity of the companion, and measure gravity darkening. We detect the companion with interferometric observations obtained with the Michigan InfraRed Combiner (MIRC) at Georgia State University's Center for High Angular Resolution Astronomy (CHARA) Array with a primary-to-secondary H-band flux ratio of 270+/-70. A radial velocity curve of the companion was obtained with spectra from the Tillinghast Reflector Echelle Spectrograph (TRES) on the 1.5-m Tillinghast Reflector at Fred Lawrence Whipple Observatory (FLWO). We additionally use new observations from the Tennessee State University Automated Spectroscopic and Photometric Telescopes (AST and APT, respectively). From our orbit, we determine model-independent masses of the components (M_1 ...

  12. The Ferrous Iron-Responsive BqsRS Two-Component System Activates Genes That Promote Cationic Stress Tolerance

    E-Print Network [OSTI]

    Heaton, Thomas H.

    , Athens, Georgia, USA. ABSTRACT The physiological resistance of pathogens to antimicrobial treatment fibrosis (CF) patients are readily colonized by diverse antibiotic- resistant microorganisms, including pathogen, senses Fe(II) using a two-component signal transduction system, BqsRS, which is transcriptionally

  13. Fusion Engineering and Design 41 (1998) 371376 The ARIES-RS power core--recent development in Li/V

    E-Print Network [OSTI]

    California at San Diego, University of

    1998-01-01

    McDonnell Douglas Aerospace, City, USA Abstract The ARIES-RS fusion power plant design study is based for a fusion power plant. The blanket system based on Li/V has high temperature operating capability, good engineering is expected to result in a superior power plant design. This paper summarizes the power core

  14. WORLDLY | IntegRateD | peRsOnaLIzeD MBa Message from the Director 4

    E-Print Network [OSTI]

    Shoubridge, Eric

    WORLDLY | IntegRateD | peRsOnaLIzeD MBa beyond business as usual #12;Contents WoRLDLY Message from: An International & Dynamic City 16 InteGRAteD What is Integrated Management? 18 Our Unique Integrated Approach Program 29 PeRsonALIzeD Message from Career Services 30 Employment Statistics 32 Our Mentoring Program 33

  15. Algorithm 1: Key Word Identification Hybrid DIAAF/RS Input:(a) A documentbase (the training part, where the

    E-Print Network [OSTI]

    Coenen, Frans

    ; #12; Algorithm 1: Key Word Identification Hybrid DIAAF/RS Input:(a) A documentbase (the training part, where the noise words have been removed); (b words SKW ; Begin Algorithm: (1) SKW an empty set for holding the identified key words in ; (2) C

  16. Fusion Engineering and Design 41 (1998) 365370 Overview of ARIES-RS tokamak fusion power plant1

    E-Print Network [OSTI]

    Najmabadi, Farrokh

    1998-01-01

    Fusion Engineering and Design 41 (1998) 365­370 Overview of ARIES-RS tokamak fusion power plant1 sources of energy. The Starlite study has examined the ability of tokamak-based power plants to compete plant based on the reversed-shear mode of plasma operation, coupled to a fusion power core which uses

  17. Uniqueness of RS2 type thick branes supported by a scalar field

    E-Print Network [OSTI]

    S. T. Abdyrakhmanov; K. A. Bronnikov; B. E. Meierovich

    2005-03-13

    We study thick brane world models as Z_2-symmetric domain walls supported by a scalar field with an arbitrary potential V(\\phi) in 5D general relativity. Under the global regularity requirement, such configurations (i) have always an AdS asymptotic far from the brane, (ii) are only possible if V(\\phi) has an alternating sign and (iii) V(\\phi) should satisfy a certain fine-tuning type equality. Thus a thick brane with any admissible V(\\phi) is a regularized version of the RS2 brane immersed in the AdS_5 bulk. The thin brane limit is realized in a universal manner by including an arbitrary thick brane model in a one-parameter family, where the parameter "a" is associated with brane thickness; the asymptotic value of V(\\phi) (related to \\Lambda_5, the effective cosmological constant) remains a-independent. The problem of ordinary matter confinement on the brane is discussed for a test scalar field. Its stress-energy tensor is found to diverge at the AdS horizon for both thin and thick branes, making a serious problem for this class of brane world models.

  18. Modelling the spectral energy distribution of the red giant in RS Ophiuchi: evidence for irradiation

    E-Print Network [OSTI]

    Pavlenko, Ya V; Rushton, M T; Evans, A; Woodward, C E; Helton, L A; O'Brien, T J; Jones, D; Elkin, V

    2015-01-01

    We present an analysis of optical and infrared spectra of the recurrent nova RS Oph obtained during between 2006 and 2009. The best fit to the optical spectrum for 2006 September 28 gives effective temperature Tef = 3900~K for log g = 2.0, while for log g = 0.0 we find Tef = 4700~K, and a comparison with template stellar spectra provides Tef $\\sim$ 4500 K. The observed spectral energy distribution (SED), and the intensities of the emission lines, vary on short ($\\sim 1$~day) time-scales, due to disc variability. We invoke a simple one-component model for the accretion disc, and a model with a hot boundary layer, with high ($\\sim 3.9 \\times 10^{-6}$ \\Mdot) and low ($\\sim 2 \\times 10^{-8}$ \\Mdot) accretion rates, respectively. Fits to the accretion disc-extracted infrared spectrum (2008 July 15) yield effective temperatures for the red giant of Tef = 3800 +/- 100~K (log g = 2.0) and Tef = 3700 +/- 100~K (log g = 0.0). Furthermore, using a more sophisticated approach, we reproduced the optical and infrared SEDs ...

  19. Centre for Marine Science and Technology: Research Report 2011-02 Aero-Hydrodynamics of an RS:X Olympic Racing Sailboard

    E-Print Network [OSTI]

    Centre for Marine Science and Technology: Research Report 2011-02 Aero-Hydrodynamics of an RS example for an overview of sailboard aero-hydrodynamics. The current article brings together previous

  20. Evaluation of two Vaisala RS92 radiosonde solar radiative dry bias correction algorithms

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Dzambo, A. M.; Turner, D. D.; Mlawer, E. J.

    2015-10-20

    Solar heating of the relative humidity (RH) probe on Vaisala RS92 radiosondes results in a large dry bias in the upper troposphere. Two different algorithms (Miloshevich et al., 2009, MILO hereafter; and Wang et al., 2013, WANG hereafter) have been designed to account for this solar radiative dry bias (SRDB). These corrections are markedly different with MILO adding up to 40 % more moisture to the original radiosonde profile than WANG; however, the impact of the two algorithms varies with height. The accuracy of these two algorithms is evaluated using three different approaches: a comparison of precipitable water vapor (PWV),more »downwelling radiative closure with a surface-based microwave radiometer at a high-altitude site (5.3 km MSL), and upwelling radiative closure with the space-based Atmospheric Infrared Sounder (AIRS). The PWV computed from the uncorrected and corrected RH data is compared against PWV retrieved from ground-based microwave radiometers at tropical, mid-latitude, and arctic sites. Although MILO generally adds more moisture to the original radiosonde profile in the upper troposphere compared to WANG, both corrections yield similar changes to the PWV, and the corrected data agree well with the ground-based retrievals. The two closure activities – done for clear-sky scenes – use the radiative transfer models MonoRTM and LBLRTM to compute radiance from the radiosonde profiles to compare against spectral observations. Both WANG- and MILO-corrected RH are statistically better than original RH in all cases except for the driest 30 % of cases in the downwelling experiment, where both algorithms add too much water vapor to the original profile. In the upwelling experiment, the RH correction applied by the WANG vs. MILO algorithm is statistically different above 10 km for the driest 30 % of cases and above 8 km for the moistest 30 % of cases, suggesting that the MILO correction performs better than the WANG in clear-sky scenes. The cause of this statistical significance is likely explained by the fact the WANG correction also accounts for cloud cover – a condition not accounted for in the radiance closure experiments.« less

  1. Insights into the evolution of symbiotic recurrent novae from radio synchrotron emission: V745 Scorpii and RS Ophiuchi

    E-Print Network [OSTI]

    Kantharia, N G; Roy, Nirupam; Anupama, G C; Ishwara-Chandra, C H; Chitale, A; Prabhu, T P; Banerjee, D P K; Ashok, N M

    2015-01-01

    We present observations at 610 MHz and 235 MHz using the Giant Metrewave Radio Telescope (GMRT) of the recurrent nova V745 Scorpii which recorded its last outburst on 6 February 2014. This is the second symbiotic recurrent nova whose light curve at GMRT frequencies has been followed in detail, the first being RS Ophiuchi in 2006. We fitted the 610 MHz light curve by a model of synchrotron emission from an expanding shell being modified by radiative transfer effects due to local absorbing gas consisting of a uniformly distributed and a clumpy component. Using our model parameters, we find that the emission at 235 MHz peaked around day 35 which is consistent with our GMRT observations. The two main results of our study are: (1) The radio emission at a given frequency is visible sooner after the outburst in successive outbursts of both V745 Scorpii and RS Ophiuchi. The earlier detection of radio emission is interpreted to be caused by decreasing foreground densities. (2) The clumpy material is located close to t...

  2. Figure 1. Current-sensing calibration circuit consisting of an auxiliary switch Qa and a precision sensing resistor Rs in parallel with a main

    E-Print Network [OSTI]

    Qa and a precision sensing resistor Rs in parallel with a main power switch Q. The auxiliary switch in parallel with a main power switch to achieve accuracy comparable to the sense resistor method, together in parallel with a main power switch Q as shown in Fig. 1, to achieve combined advantages of the accurate

  3. Design and development for a low emission boiler system

    SciTech Connect (OSTI)

    Not Available

    1994-06-01

    The Department of Energy initiated the Combustion 2000 program to develop the next generation of coal-fired power plants. Sargent & Lundy (S&L) is working on the Low Emission Boiler System (LEBS) portion of the program led by Riley Stoker Corporation, with support from Textron Defense Systems, Tecogen, and Reaction Engineering International. Together these organizations form {open_quotes}the Riley Team.{close_quotes} There are four phases of the LEBS development program. Currently, we are working in Phase I, which involves the design of a 400 MWe unit. Phase II through IV will involve pilot scale component testing and a Proof-of-Concept facility ({approximately}40MWe) design, construction, and operation. This document comprises the Design and Development Report for the LEBS. The report describes the design basis, design uncertainties and development plan for each of the major LEBS subsystems.

  4. Functional Promoter Variant rs2868371 of HSPB1 Is Associated With Risk of Radiation Pneumonitis After Chemoradiation for Non-Small Cell Lung Cancer

    SciTech Connect (OSTI)

    Pang, Qingsong; Department of Radiation Oncology and Lung Cancer Center, Tianjin Medical University Cancer Institute and Hospital, Key Laboratory of Cancer Prevention and Therapy, Tianjin ; Wei, Qingyi; Xu, Ting; Yuan, Xianglin; Lopez Guerra, Jose Luis; Levy, Lawrence B.; Liu, Zhensheng; Gomez, Daniel R.; Zhuang, Yan; Wang, Li-E.; Mohan, Radhe; Komaki, Ritsuko; Liao, Zhongxing

    2013-04-01

    Purpose: To date, no biomarkers have been found to predict, before treatment, which patients will develop radiation pneumonitis (RP), a potentially fatal toxicity, after chemoradiation for lung cancer. We investigated potential associations between single nucleotide polymorphisms (SNPs) in HSPB1 and risk of RP after chemoradiation for non-small cell lung cancer (NSCLC). Methods and Materials: Subjects were patients with NSCLC treated with chemoradiation at 1 institution. The training data set comprised 146 patients treated from 1999 to July 2004; the validation data set was 125 patients treated from August 2004 to March 2010. We genotyped 2 functional SNPs of HSPB1 (rs2868370 and rs2868371) from all patients. We used Kaplan-Meier analysis to assess the risk of grade ?2 or ?3 RP in both data sets and a parametric log-logistic survival model to evaluate the association of HSPB1 genotypes with that risk. Results: Grade ?3 RP was experienced by 13% of those with CG/GG and 29% of those with CC genotype of HSPB1 rs2868371 in the training data set (P=.028); corresponding rates in the validation data set were 2% CG/GG and 14% CC (P=.02). Univariate and multivariate analysis confirmed the association of CC of HSPB1 rs2868371 with higher risk of grade ?3 RP than CG/GG after adjustment for sex, age, performance status, and lung mean dose. This association was validated both in the validation data set and with Harrell's C statistic. Conclusions: The CC genotype of HSPB1 rs2868371 was associated with severe RP after chemoradiation for NSCLC.

  5. Ellipsoidal primary of the RS CVn binary zeta And: Investigation using high-resolution spectroscopy and optical interferometry

    E-Print Network [OSTI]

    Korhonen, H; Kovari, Zs; Granzer, Th; Hackman, T; Strassmeier, K G

    2010-01-01

    We have obtained high-resolution spectroscopy, optical interferometry, and long-term broad band photometry of the ellipsoidal primary of the RS CVn-type binary system zeta And. Based on the optical interferometry the apparent limb darkened diameter of zeta And is 2.55 +/- 0.09 mas using a uniform disk fit. The Hipparcos distance and the limb-darkened diameter obtained with a uniform disk fit give stellar radius of 15.9 +/- 0.8 Rsolar, and combined with bolometric luminosity, it implies an effective temperature of 4665 +/- 140 K. The temperature maps obtained from high resolution spectra using Doppler imaging show a strong belt of equatorial spots and hints of a cool polar cap. The equatorial spots show a concentration around the phase 0.75. This spot configuration is reminiscent of the one seen in the earlier published temperature maps of zeta And. Investigation of the Halpha line reveals both prominences and cool clouds in the chromosphere. Long-term photometry spanning 12 years shows hints of a spot activit...

  6. Crystallization of lysozyme with (R)-, (S)- and (RS)-2-methyl-2,4-pentanediol

    SciTech Connect (OSTI)

    Stauber, Mark; Jakoncic, Jean; Berger, Jacob; Karp, Jerome M.; Axelbaum, Ariel; Sastow, Dahniel; Buldyrev, Sergey V.; Hrnjez, Bruce J.; Asherie, Neer

    2015-03-01

    Chiral control of crystallization has ample precedent in the small-molecule world, but relatively little is known about the role of chirality in protein crystallization. In this study, lysozyme was crystallized in the presence of the chiral additive 2-methyl-2,4-pentanediol (MPD) separately using the R and S enantiomers as well as with a racemic RS mixture. Crystals grown with (R)-MPD had the most order and produced the highest resolution protein structures. This result is consistent with the observation that in the crystals grown with (R)-MPD and (RS)-MPD the crystal contacts are made by (R)-MPD, demonstrating that there is preferential interaction between lysozyme and this enantiomer. These findings suggest that chiral interactions are important in protein crystallization.

  7. HANWEI ZHANG 19 Riley Ct. Skillman, NJ 08558

    E-Print Network [OSTI]

    , Pennsylvania, USA [2] Epelbaum, G. and Zhang, H (2007). New development in EfW boiler process modeling: Fully (2007). Process Simulation of a large Mass Burn Waste-To-Energy boiler by the combination of CFD

  8. ROBIN L. RILEY Assistant Professor of Women's and Gender Studies

    E-Print Network [OSTI]

    Raina, Ramesh

    Must Keep Their Work Secret, from Friends, Family and Even Themselves." The Women's Review of Books Feminist Sense of the Iraq War by Cynthia Enloe. Ms. Magazine: spring 2010. Vol. XX No. 2: 57-58. 2 #12.org/reviews/showrev.php?id=9416 Review of Maneuvers: The International Politics of Militarizing Women's Lives by Cynthia Enloe

  9. Efforts to Consolidate Chalcogels with Adsorbed Iodine Riley...

    Office of Scientific and Technical Information (OSTI)

    tin-sulfide; aerogel This document discusses ongoing work with non-oxide aerogels, called chalcogels, that are under development at the Pacific Northwest National...

  10. Initial Assessment of Alternate Metals in Chalcogels Riley, Brian...

    Office of Scientific and Technical Information (OSTI)

    based chemistries available in the literature for making non-oxide, chalcogen-based aerogels, called chalcogels. In each case, a combination of multiple precursors is required to...

  11. Riley County, Kansas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, New York:Virginia: EnergyRidgeview

  12. Riley_Venayagamoorthy_PVSC2011_ForWebsite

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100Nationalquestionnaires 0serialIndustrialSenior8Rick StevensARienk1-4179 C

  13. MTNR1B rs10830963 is associated with fasting plasma glucose, HbA1C and impaired beta-cell function in Chinese Hans from Shanghai

    E-Print Network [OSTI]

    Liu, Chen; Wu, Ying; Li, Huaixing; Qi, Qibin; Langenberg, Claudia; Loos, Ruth J. F.; Lin, Xu

    2010-04-14

    was obtained from the participants and the Institu- tional Review Board of the Institute for Nutritional Sciences approved the study protocol. Genotyping The SNP rs10830963 was genotyped by the GenomeLab SNPstream Genotyping System (Beckman Coulter) with 98... , Nijpels G, Maassen JA, Dekker JM, t Hart LM: Combined effects of single- nucleotide polymorphisms in GCK, GCKR, G6PC2 and MTNR1B on fasting plasma glucose and type 2 diabetes risk. Diabetologia 2009, 52(9):1866-1870. 11. Sparso T, Bonnefond A...

  14. Validation of MCNP4a for highly enriched uranium using the Battelle process safety and risk management IBM RS/6000 workstation

    SciTech Connect (OSTI)

    Negron, S.B.; Lee, B.L. Jr.; Tayloe, R.W. Jr.

    1996-01-01

    This document has been prepared to allow use of the Radiation Shielding and Information Center (RSIC) release of MCNP4a, which has been installed on the Battelle Process Safety and Risk Management (PSRM) IBM RS/6000 workstation, for production calculations for the Portsmouth Gaseous Diffusion Plant (PORTS). This hardware/software configuration is under the configuration control plan listed in Reference 1. The first portion of this document outlines basic information with regard to validation of MCNP4a using the supplied cross sections and the additional MCNPDAT cross sections. A basic discussion of MCNP is provided, along with discussions of the validation database in general. A description of the statistical analysis then follows. The results of this validation indicate that the software and data libraries examined may be used with confidence for criticality calculations at the Portsmouth Gaseous Diffusion Plant (PORTS). When the validation results are treated as a single group, there is a 95% confidence that 99.9% of future calculations of similar critical systems will have a calculated k{sub eff} > 0.95. Based on this result, the Battelle PSRM Nuclear Safety Group has adopted the calculational acceptance criteria that a calculated k{sub eff} + 2{sigma}, {le} 0.95 is safely subcritical. The conclusion of this document is that MCNP4a and all associated cross section libraries installed on the PSRM IBM RS/6000 are acceptable for use in performing production criticality safety calculations for the Portsmouth Gaseous Diffusion Plant.

  15. Understanding the Rate of Clean Up for Oil Zones after a Gel Treatment R.S. Seright, SPE, New Mexico Petroleum Recovery Research Center, W. Brent Lindquist, SPE, and Rong Cai,

    E-Print Network [OSTI]

    New York at Stoney Brook, State University of

    SPE 112976 Understanding the Rate of Clean Up for Oil Zones after a Gel Treatment R.S. Seright, SPE at the 2008 SPE Improved Oil Recovery Symposium held in Tulsa, Oklahoma, U.S.A., 19­23 April 2008. This paper to establish why pore-filling Cr(III)-acetate- HPAM gels reduced permeability to water much more than to oil

  16. Economic Development and the Structure of the Demand for Commercial Energy Ruth A. Judson, Richard Schmalensee and Thomas M. Stoker*

    E-Print Network [OSTI]

    effects are assumed, and flexible forms for income effects are employed. There are substantial differences among sectors in the structure of country, time, and income effects. In particular, the household sector's share of aggregate energy consumption tends to fall with income, the share of transportation tends

  17. Permeability characterization of shear zones in the Hickory sandstone member, Riley Formation, Texas 

    E-Print Network [OSTI]

    Nieto Camargo, Jorge Enrique

    2005-02-17

    Reservoir compartments, typical targets for new infill locations, are commonly created by faults that may reduce or enhanced permeabilities. Faults often contain narrow zones of intense shear comprised of geometrically complex elements that reduce...

  18. Riley oxidation: A forgotten name reaction for synthesis of selenium nanoparticles

    SciTech Connect (OSTI)

    Shah, Chetan P.; Dwivedi, Charu; Singh, Krishan K.; Kumar, Manmohan; Bajaj, Parma N.

    2010-09-15

    A simple wet chemical method, involving reaction of acetone with selenium dioxide, has been developed, to synthesize polyvinyl alcohol-stabilized selenium nanoparticles. The method is capable of producing nanoparticles in the size range of about 100-300 nm, under ambient conditions. The synthesized nanoparticles can be separated easily from the aqueous sols by a high-speed centrifuge, and can be re-dispersed in aqueous medium by a sonicator. The effect of concentrations of selenium dioxide, acetone and PVA on the size of the selenium nanoparticles has been studied. The size of the selenium nanoparticles has been found to increase with increase in the reaction time as well as the concentration of selenium dioxide, while it decreases with increase in the concentration of the stabilizer, PVA. The synthesized selenium nanoparticles have been characterized by UV-visible optical absorption spectroscopy, X-ray diffraction, energy dispersive X-ray analysis, differential scanning calorimetry, atomic force microscopy, scanning electron microscopy and transmission electron microscopy techniques.

  19. Facies Description and Interpretation of the Upper Lower Hickory Sandstone, Riley Formation, Central Texas 

    E-Print Network [OSTI]

    Cook, Timothy D.

    2010-01-16

    Present models suggest that fluvial and marine depositional patterns were distinct from modern patterns prior to the appearance of land plants. Although these models are likely correct, problems exist when one attempts to ...

  20. Project Title : Studies of atmospheric pressure plasmas Supervisors : Prof. D Riley, Prof. W.G. Graham

    E-Print Network [OSTI]

    Paxton, Anthony T.

    been carried out on so called 'plasma jets'. These are plasmas created by applying strong AC electric fields to a stream of He gas that comes out of the end of glass nozzle. This can result in the generation of 'bullets' of plasma that travel at 10s km per second. Such streams of plasma bullets have been used

  1. Bart Riley > A123 Systems > Scientific Advisory Board > The Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & Inspections AuditsBarbara McClintock and

  2. Krm. WLZS spc-IG?rs, JR

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr. Anthony V. Andolina:I 1 ' , :1z. I DATE

  3. RS-Weapons X-Rays

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergyPresidentialThis 3-D rendering ofForm documents theAEC -is

  4. RS-CO-0001-001.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global TechnologyProceeding2-767 (REV

  5. RS-PO-0001-001.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global TechnologyProceeding2-767 (REV

  6. RS-PR-0001-001.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global TechnologyProceeding2-767 (REVRS-PR-0001-001.doc

  7. RS-PR-0004-001.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global TechnologyProceeding2-767

  8. RS-PR-0005-001.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global TechnologyProceeding2-7675-001.doc Utility Bldg

  9. The Shuttle Radar Topography Mission Farr, Tom G., Paul A. Rosen, Edward Caro, Robert Crippen, Riley Duren, Scott Hensley, Michael

    E-Print Network [OSTI]

    1 The Shuttle Radar Topography Mission Farr, Tom G., Paul A. Rosen, Edward Caro, Robert Crippen Barbara, CA Douglas Alsdorf Ohio State University Columbus, OH The Shuttle Radar Topography Mission. The Need for Global Topography At the foundation of modern geosciences, quite literally, is knowledge

  10. EECBG Success Story: Resourceful Kansas Puts Energy Efficient...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Benefits June 2, 2011 - 3:45pm Addthis One of Riley County Public Works' new wind turbines. | Courtesy of Riley County Public Works One of Riley County Public Works' new...

  11. $ %& ' ( ) 0 1 2 ) 34 5 6 78 9 @A B A CD EFG H I P Q RS T U VW5 6 7X Y ` B @ a CD EFG H I b c de fG P g hi EfphIq U r Efpe g g EF ps t t e fIEG 4

    E-Print Network [OSTI]

    Silvester, David J.

    T @ a x e g ID p hg ID E b c de fG P g hi EfphIq e x t s Ihg X H e fH Ie fq U u H i hG ps pE s Eg IFq @9 9 9 u f S EH g e f s fg H p H r D up Is G Eg I Cw B x e g ID pU hg ID E Q H ID Ex H Ihp u Et H fIx Eg I P Q RS T S EH g ps pE s Eg IFq e hg EG ID E r fe Epp Q e G EFFhg 5 fe s t 6 e FFp 6 eq E u

  12. %&$')(10243 5)(16 &$7$8 9 @A B C D)0)E1F(2 8 6( G$HI2 9 C EI0)3 6& $GG %P$0)712 9 C 6( Q)6 &)DEI6 HI')HI($RS%&$T C %)&)'U(1V$W 6& Q)F)DH 3 2 X

    E-Print Network [OSTI]

    Biederman, Irving

    ¦(2 8 6( G$HI2 9 C EI0)3 6& $GG %¦P$0)712 9 C 6( Q)6 &)DEI6 HI')HI($RS%¦&$T C %)&)'U(1V$W 6& Q)F)D¦H 3 2 X Ya` b c d e f c g46 h¦i p qr s t s u v tIv u w u h ixy ¦s v s ru ¦i 1$r it uI4 u x ip uIu h i vp qh t x p qs s w t 4s t x x sS HI13 qrI4 q u ¦i ) v t$ u h u vt x w 4s it iq h t x 4 u x

  13. Microsoft Word - Goodyear_Presentation to DOE on ATVMLP.doc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Brain Riley Date: October 31, 2008 U.S. Department of Energy Advanced Technology Vehicle Manufacturing Loan Program 1 GOODYEAR TIRE & RUBBER COMPANY Submitted by: Brain Riley Date:...

  14. Phylogeny of the pollinating yucca moths, with revision of Mexican species (Tegeticula and Parategeticula;

    E-Print Network [OSTI]

    Segraves, Kari A.

    reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

  15. Single crystalline mesoporous silicon nanowires

    E-Print Network [OSTI]

    Hochbaum, Allon

    2010-01-01

    Semiconductor Chalcogenide Aerogels. Sun, D. ; Riley, A.H. , Hexagonal gels and aerogels from chalcogenide clusters.

  16. Order Code RS20028 Updated August 25, 2008

    E-Print Network [OSTI]

    Laughlin, Robert B.

    disposal or dumping of all materials into marine waters that are within U.S. jurisdiction, although research program; and Title V addresses coastal water quality monitoring. The third title of the MPRSA Water Resources Development Act P.L. 99-662, §§211, 728, 1172 1987 Water Quality Act of 1987 P.L. 100

  17. Re a ctiv ity Pe rs o n a l

    E-Print Network [OSTI]

    Wikswo, John

    Sheet Thymol MSDS Section 1: Chemical Product and Company Identification Product Name: Thymol Catalog with plenty of water for at least 15 minutes. Cold water may be used. WARM water MUST be used. Get medical attention. Skin Contact: In case of contact, immediately flush skin with plenty of water. Cover

  18. 359-06/RDS/rs PERSISTENT SURVEILLANCE FOR

    E-Print Network [OSTI]

    Inductive Advanced Advanced A 3.5 3.5 3.5 3.5 3.5 3.4 4 a m 0.71 0.71 0.71 0.71 0.71 1.85 1.30 Ro m 2.49 2.49 2.49 2.49 2.49 6.35 5.20 Elongation 2.31 2.31 2.31 2.31 2.31 1.85 2.20 Fusion Power MW 246 123 231.5 3.0 5.4 fbs 60% 46% 30% 65% 70% 48% 91% Pcd MW 59 50 20 65 66 35 Paux MW 59 50 20 67 66 59 36 Ip MA

  19. RS India Wind Energy Pvt Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLCALLETEREFU Elektronik GmbH JumpChinaRMRS India Wind

  20. Engineering development of advanced coal-fired low emission boiler systems

    SciTech Connect (OSTI)

    Not Available

    1993-10-01

    Riley Stoker Corporation is leading an R&D program for the expedited development of a new generation of pulverized coal-fired boiler systems. The overall objective is to develop relatively near term technologies to produce Low-Emission coal-fired Boiler Systems (LEBS) ready for full scale commercial generating plants by the end of the decade. The specific goal is to develop a LEBS incorporating an advanced slagging system for improved ash management in addition to meeting the emission and performance goals. This Concept Selection Report documents an evaluation of subsystems and LEBS concepts. Priority was given to the evaluation of the boiler system, steam cycle, and advanced slagging combustor. Some findings are as follows: An ultra supercritical steam cycle is required to meet project efficiency goals. The cost of electricity (COE) for this cycle, at today`s fuel prices, and without externality costs, is slightly higher than a conventional subcritical cycle. The supercritical cycle includes a substantial contingency. Reduction of contingency, escalation of fuel cost, or inclusion of externalities all lead to a lower COE for the supercritical cycle compared to the subcritical cycle. The advanced cycle is selected for inclusion in the LEBS. The advanced slagging combustor (TVC), should it meet the projected performance goals, yields a lower COE than either a dry firing system or a more conventional slagger fitted with post combustion NO{sub x} controls. Verification and development of the advanced slagger performance is the primary focus of this project. A commercial slagging configuration know as U-firing is selected for parallel development and as a platform for adaptation to the TVC.

  1. Proof of concept testing of an integrated dry injection system for SO{sub 2}/NO{sub x} control. Final report

    SciTech Connect (OSTI)

    Helfritch, D.J.; Bortz, S.J. [Research-Cottrell, Inc., Somerville, NJ (United States); Beittel, R. [Riley Stoker Corp., Worcester, MA (United States)

    1994-03-01

    The integrated Dry Injection Process (IDIP) consists of combustion modification using low NO{sub x} burners to reduce NO{sub x} emissions, dry injection of hydrated line at economizer temperatures for primary capture of SO{sub 2}, dry injection of a commercial grade sodium bicarbonate at the air heater exit for additional SO{sub 2} and NO{sub x} removal, and humidification for precipitator conditioning. IDIP offers the potential for simultaneously achieving 90% SO{sub 2} removal, and 65% NO{sub x} removal from a high sulfur flue gas. The process is well suited for new or retrofit applications since it can be incorporated within existing economizer and downstream ductwork. Subscale tests were performed in order to identify the best calcium and sodium sorbents. These tests involved the injection of calcium hydroxide and sodium sorbents at various points of the flue gas system downstream of a 0.25 MM BTU/hr. coal fired combustor, and the gas residence times, cooling rates and temperatures were comparable to those found for full-scale utility boilers. These tests verified that a high surface area hydrated lime provides maximum sorbent utilization and identified an alcohol-water hydrated lime as yielding the highest surface area and the best SO{sub 2} removal capability. The tests also identified sodium bicarbonate to be somewhat more effective than sodium sesquicarbonate for SO{sub 2} removal. The proof of concept demonstration was conducted on the large combustor at the Riley Stoker Research Facility in Worcester, MA. When economically compared to conventional limestone slurry scrubbing on a 300 MW plant, the dry injection process shows lower capital cost but higher operating cost. Hydrated lime injection can be less costly than limestone scrubbing when two or more of the following conditions exist: plant is small (less than 100MW); yearly operating hours are small (less than 3000); and the remaining plant lifetime is small (less than 10 years).

  2. Iodine solubility in a low-activity waste borosilicate glass...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4651; fax: +1 (509)372 5997. E-mail address: brian.riley@pnnl.gov (B.J. Riley). Journal of Nuclear Materials 452 (2014) 178-188 Contents lists available at ScienceDirect...

  3. Shifting Attitudes Towards Tobacco Control in Tobacco Country: Tobacco Industry Political Influence and Tobacco Policy Making in South Carolina

    E-Print Network [OSTI]

    Sullivan BA, Sarah; Barnes, Richard L JD; Glantz, Stanton A. Ph.D.

    2009-01-01

    62 South Carolina Tobacco Settlement ConsensusSOUTH CAROLINA . . . . . . . . . . . . . . . . . . . . . . .Wigand, Riley and the South Carolina Tobacco Collaborative

  4. Field ionization of argon using -phase W nanorods J. P. Singh,a)

    E-Print Network [OSTI]

    Wang, Gwo-Ching

    been realized by many researchers.3­5 Riley et al.3 have demonstrated the detection of helium atoms via

  5. Remote Sens. 2014, 6, 2898-2911; doi:10.3390/rs6042898 remote sensing

    E-Print Network [OSTI]

    deYoung, Brad

    Measurements of ocean wind vectors serve as a basis for marine weather forecasting and offshore wind farms distribution of offshore wind vectors. Representative long-term offshore meteorological time series with high.mdpi.com/journal/remotesensing Article Reconstructed Wind Fields from Multi-Satellite Observations Ruohan Tang 1,2,3, *, Deyou Liu 1

  6. A Compliant Tactile Display for Teletaction G. Moy, C. Wagner, R.S. Fearing

    E-Print Network [OSTI]

    Fearing, Ron

    that a a synthetic grating on the tactile display was perceived as well as a low-pass- ltered real contact. 1 displaywhichhas 4 4elementswith 1.75 mm spacing, proportional lling valves, solenoid exhaust valves, high frequency texture valves, closed loop cont

  7. Remote Sens. 2011, 3, 83-99; doi:10.3390/rs3010083 Remote Sensing

    E-Print Network [OSTI]

    Jin, Menglin

    budget [1-3]. The land surface energy budget can be described as [4]: (1 - )Sd + LWd - Tskin 4 - SH - LE - G = 0 (1) where is surface albedo, Sd is downward surface insulation. LWd is downward longwave change LWd in Equation (1). Furthermore, the clouds microphysical properties (cloud droplet size, cloud

  8. Tactile AfterImages from Static Contact \\Lambda U. Singh and R.S. Fearing

    E-Print Network [OSTI]

    California at Berkeley, University of

    ­ scribes initial work in quantifying tactile ``after­images'' resulting from large loads applied over between 6 \\Gamma 7Hz [11]. Cohn et al. [2] get 7Hz bandwidth with their pneumatically actuated display

  9. Remote Sens. 2010, 2, 1157-1176; doi:10.3390/rs2041157 Remote Sensing

    E-Print Network [OSTI]

    Ellis, Erle C.

    ) are essential for accurate estimation of vegetation biomass, carbon accounting, forestry, fire hazard evaluation closed canopy forest. Results confirm that computer vision can support ultra-low-cost, user-deployed high Keywords: vegetation biomass; vegetation carbon; canopy height models; bundle adjustment; Bundler; LiDAR; 3

  10. Fusion Engineering and Design 38 (1997) 87113 Configuration and engineering design of the ARIES-RS

    E-Print Network [OSTI]

    California at San Diego, University of

    1997-01-01

    appears to offer the best combination of good economic performance and physics credibility for a tokamak operation. This was adopted as the only practical means to meet availability goals. Use of an electrically, this is a prelimi- nary design concept which can be used to guide R&D programs to further improve the product

  11. Remote Sens. 2012, 4, 950-974; doi:10.3390/rs4040950 Remote Sensing

    E-Print Network [OSTI]

    -02431 Masala, Finland; E-Mails: juha.hyyppa@fgi.fi (J.H.); yu.xiaowei@fgi.fi (X.Y.); antero-00014 Helsinki, Finland; E-Mails: mikko.vastaranta@helsinki.fi (M.V.); markus.holopainen@helsinki.fi (M.H.) 3 School of Science and Technology, Aalto University, FI-00076 Aalto, Finland; E-Mail: hannu

  12. Remote Sens. 2010, 2, 514-525; doi:10.3390/rs2020514 Remote Sensing

    E-Print Network [OSTI]

    Weishampel, John F.

    -central Florida. We predicted that fire influences vegetation structure at the mesoscale (i.e., spatial scales classification accuracies occur with averaging over windows representing sizes in the mesoscale range. Keywords

  13. Fusion Engineering and Design 41 (1998) 491499 Engineering design of the ARIES-RS power plant

    E-Print Network [OSTI]

    1998-01-01

    , with a very simple thermal-hydraulic de- sign. Highly radiative zones at the top and bot- tom of the machine. 1. The figure shows the in-vessel sectors together with the magnets, vacuum vessel and cryostat

  14. Fusion Engineering and Design 38 (1997) 115137 ARIES-RS divertor system selection and analysis

    E-Print Network [OSTI]

    California at San Diego, University of

    1997-01-01

    hydraulics and structural analysis on the heat removal component, and the vacuum system are evaluated. Two limits. A detailed description of the calculated heat flux distribution, thermal-hydraulics, structural analysis, fabrication methods and vacuum system design are presented. An innovative design using adjustable

  15. Fusion Engineering and Design 38 (1997) 159188 ARIES-RS magnet systems

    E-Print Network [OSTI]

    1997-01-01

    section has been optimized, using innovative solutions to minimize the cross section and the cost. The sec the toroidal and poloidal field system for minimized size and cost, optimized structure and increased access-I due to the lower magnetic field. On the other hand, the problems in PUL- SAR with respect

  16. 2005 Peered Reviewed Archival Publications Ahluwalia, R.S. and S. Govindarajulu*

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    -384. (MAE) Barth, K.E., D.W. White, J.E. Righman, and L. Yang. 2005. Evaluation of web compactness limits

  17. 3 Rs Recognize, Retreat, Report A2B Anti-Two Block

    E-Print Network [OSTI]

    US Army Corps of Engineers

    of America CO2 Carbon Dioxide CO Carbon Monoxide CONUS Continental United States COR Contracting Officer Film Foaming Foam AGA American Gas Association AHA Activity Hazard Analysis/Analyses AHA American Heart

  18. Silicon Based Microchemical Concepts for Miniature Fuel Keyur Shah, R.S. Besser

    E-Print Network [OSTI]

    Besser, Ronald S.

    , CO2, CO, MeOH, H2O H2-rich stream CO . sensors Thin film HeaterInlet Outlet Si Pyrex Catalyst Foam "Cartridge" 200 micron cavity, Pr:

  19. 42174885 -1 -MP1/RS1/lil 1/7/2013

    E-Print Network [OSTI]

    - 3 - On December 7, 2012, the Alliance for Retail Energy Markets (AREM) and the Marin Energy demonstration and deployment, market support, and market facilitation of clean energy technologies

  20. INSTITUTION OF UNIV E RS IT Y OF C A L IFORNIA , S A N DIEGO

    E-Print Network [OSTI]

    Constable, Steve

    Oceanography span the realms of sea, air, land, and life in efforts to determine how Earth systems work pollution, and marine resources. At Scripps, observation, measurement, and collection of samples and data

  1. Subjects: Trematoda and Trematode Diseases, Part 7: Supergenera and Genera R-S 

    E-Print Network [OSTI]

    Farr, Marion M.; Breen, Virginia L.; Doss, Mildred A.; Roach, Katharine F.

    1968-01-01

    . 21, 1907).? Dollfus,R. P.F. ,[1937c], 399,400,418.- Froissant, A. , 1930a, 11, 37.? Fuhrmann, ?. , 1928b, 19, 29.-Guberlet, J.E., 1933a, 324,325, 326-327(Polystomatidae, Oncho- cotylinae); 1937a, 466. ?Lameere, A. A. L. G. , 1933a, 245.... --Monticelli,F.S., 1903c, 336 (Onchocotylidae, Onchocotylinae). -- Palombi, ?., 1949b, 317-3 18(syn. :Oncho- cotyle Diesing, 1850 p. p. ). --Poche, F. , 1926b, 110 (Polystomatidae). - -Price, E. W., 1942a, 51(Hexabothriiidae, Rajoncho- cotylinae...

  2. FORM RS-2 (Revised 08/05) PERMIT FOR RADIOACTIVE MATERIAL Permit No.

    E-Print Network [OSTI]

    Johnson, Eric E.

    ________________________________________ NMSU Requirements for Sewage Disposal of Aqueous Waste Contaminated with Radioactivity 1. Permittee). Table 13.1 Permittee Limits for Sewage Disposal of Soluble Radioactivity in Aqueous Waste Isotope Radioactive Material" for sewage disposal and restrict facilities personnel from working on such sink until

  3. As Percepções E Experiências Com A Corrupção No Setor De Obra Rodoviárias Do Estado Do RS

    E-Print Network [OSTI]

    Balbinotto Neto, Giacomo; Letizia Garcia, Ricardo

    2006-01-01

    financeiras significativas e tecnologias complexas, o setortêm acesso às mesmas tecnologias e consumidores, e onde não

  4. Wave Propagation and Scattering for the RS2 Brane Cosmology Model

    E-Print Network [OSTI]

    Alain Bachelot

    2009-09-21

    We study the wave equation for the gravitational waves in the Randal-Sundrum brane cosmology model. We solve the global Cauchy problem and we establish that the solutions are the sum of a slowly decaying massless wave localized near the brane, and a superposition of massive dispersive waves. We compute the kernel of the truncated resolvent. We prove some $L^1-L^{\\infty}$, $L^2-L^{\\infty}$ decay estimates and global $L^p$ Strichartz type inequalities. We develop the complete scattering theory : existence and asymptotic completeness of the wave operators, computation of the scattering matrix, determination of the resonances on the logarithmic Riemann surface.

  5. Remote Sens. 2011, 3, 343-361; doi:10.3390/rs3020343 Remote Sensing

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    .mdpi.com/journal/remotesensing Article The HelioClim Project: Surface Solar Irradiance Data for Climate Applications Philippe Blanc; solar irradiance; solar exposure; climate; Africa; Europe; Atlantic Ocean; remote sensing; long Abstract: Meteosat satellite images are processed to yield values of the incoming surface solar irradiance

  6. Remote Sens. 2009, 1, 393-407; doi:10.3390/rs1030393 Remote Sensing

    E-Print Network [OSTI]

    -surface flow, (iii) surface desertification (especially in arid to semi-arid regions of the world), (iv

  7. AFRL-IF-RS-TR-2006-250 Final Technical Report

    E-Print Network [OSTI]

    Noel, Steven

    AND MINING TECHNIQUES INTO AIDE George Mason University APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED, Public Affairs Office (IFOIPA) and is releasable to the National Technical Information Service (NTIS 22202-4302, and to the Office of Management and Budget, Paperwork Reduction Project (0704

  8. Remote Sensing 2010, 2, 1797-1825; doi:10.3390/rs2071797 Remote Sensing

    E-Print Network [OSTI]

    Singer, Michael

    / Published: 19 July 2010 Abstract: Hydraulic gold mining in the Sierra Nevada, California (1853 below dams where floods can remobilize them. This study uses topographic and planimetric data from; hydraulic mining sediment; floodplain morphology OPEN ACCESS #12;Remote Sensing 2010, 2 1798 1. Introduction

  9. Crystal structure of DJ-1/RS and implication on familial Parkinson's disease1

    E-Print Network [OSTI]

    Li, Lian

    role in fertility. Treatment of male rats with sperm toxicants such as ornidazole induced infertility within 10^14 days [4^6]. The infertility was associ- ated with the release of CAP1 (contraception

  10. MHK ISDB/Instruments/WINDSONIC1-L, 2-D Sonic Wind Sensor with RS-232 Output

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHK ISDB/Instruments/NortekMonitor ADCP <MHK| Open

  11. LANL12-RS-107J PYTHON Radiography Analysis Tool (PyRAT). Mid-Year

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols in(JournalTechnicalConnectArticle)!LANL

  12. LANL12-RS-107J PYTHON Radiography Analysis Tool (PyRAT). Mid-Year

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols in(JournalTechnicalConnectArticle)!LANLDeliverable

  13. LANL12-RS-107J PYTHON radiography analysis tool final report for FY15

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols

  14. LANL12-RS-107J PYTHON radiography analysis tool final report for FY15

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech Connect Technical

  15. LANL12-RS-108J Device Modeler Tool Kit - DMTK Final Report for FY14

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech Connect

  16. LANL12-RS-108J Device Modeler Tool Kit - DMTK Final Report for FY14

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech Connect(Technical

  17. LANL12-RS-108J Report on Device Modeler Testing of the Device Modeler Tool

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech Connect(TechnicalKit.

  18. LANL12-RS-108J Report on Device Modeler Testing of the Device Modeler Tool

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech

  19. LANL13-RS-107J PYTHON Radiography Analysis Tool Final Report for FY13

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech(Technical Report) | SciTech

  20. LANL13-RS-107J PYTHON Radiography Analysis Tool Final Report for FY13

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(Journalspectroscopy of aerosols(Technical Report) | SciTech(Technical Report) |

  1. USA RS Basic Contract - Contract No.: DE-RW0000005 | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyThe U.S.Laclede GasEfficiency|Feed| DepartmentOFAdvancedGridThis document describes

  2. BARRIER ISSUES TO THE UTILIZATION OF BIOMASS

    SciTech Connect (OSTI)

    Greg F. Weber; Christopher J. Zygarlicke

    2001-05-01

    In summary, stoker-fired boilers that cofire or switch to biomass fuel may potentially have to deal with ash behavior issues such as production of different concentrations and quantities of fine particulate or aerosols and ash-fouling deposition. Stoker boiler operators that are considering switching to biomass and adding potential infrastructure to accommodate the switch may also at the same time be looking into upgrades that will allow for generating additional power for sale on the grid. This is the case for the feasibility study being done currently for a small (<1-MW) stoker facility at the North Dakota State Penitentiary, which is considering not only the incorporation of a lower-cost biomass fuel but also a refurbishing of the stoker boiler to burn slightly hotter with the ability to generate more power and sell excess energy on the grid. These types of fuel and boiler changes can greatly affect ash behavior issues.

  3. MAPPING FELDSPARS WITH AIRBORNE HYPERSPECTRAL SEBASS IMAGERY

    E-Print Network [OSTI]

    OSU DEAN RILEY AERO / SPECTIR MARK VAN DER MEIJDE ITC-UT FREEK VAN DER MEER ITC-UT #12;MINERAL MODES://www.lpi.usra.edu/science/kirkland/Mesa/text.html Data courtesy Dr. Dean Riley, Aero.org APPLICATION TO AIRBORNE HYPERSPECTRAL IMAGE DATA AEROSPACE HECKER ITC-UT JOHN DILLES OSU DEAN RILEY AERO / SPECTIR MARK VAN DER MEIJDE ITC-UT FREEK VAN DER MEER ITC

  4. THE UNIVERSITY OF VERMONT CATALOGUE 2015-16 2015-2016 Catalogue

    E-Print Network [OSTI]

    Hayden, Nancy J.

    , Senior Lecturer of Sociology, College of Arts and Sciences Riley A. Elliott, Associate Professor, Rubenstein School of Environment and Natural Resources Thomas R. Hudspeth, Professor of Environmental Studies

  5. October | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    Application Performance." The talk will describe the benchmark creation process and a roadmap of future additions to the suite. On Wednesday, November 19, Katherine Riley, ALCF...

  6. Sandia Energy - EC Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Downloaded 49 times Category Energy Security, Photovoltaic, Renewable Energy, Solar Energy, Technical Paper, Technology Validation author Daniel M. Riley, Ganesh K....

  7. Genomics of wood-degrading fungi (Journal Article) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    Details In-Document Search This content will become publicly available on November 1, 2015 Title: Genomics of wood-degrading fungi Authors: Ohm, Robin A. ; Riley, Robert ;...

  8. SANDIA REPORT SAND2014-19137

    E-Print Network [OSTI]

    in Photovoltaic System Performance Monitoring Anton Driesse, Joshua S. Stein, Daniel Riley, Craig Carmignani in Photovoltaic System Performance Monitoring Anton Driesse PV Performance Labs Canada / Germany www.pvperformancelabs.com Joshua S. Stein, Daniel Riley, Craig Carmignani Photovoltaic and Distributed Systems Integration Sandia

  9. High Lift Force with 275 Hz Wing Beat in MFI E. Steltz, S. Avadhanula, and R.S. Fearing

    E-Print Network [OSTI]

    California at Berkeley, University of

    by utilizing a fabrication process that allows for carbon fiber wing spars (the previous spars were made to 40 degrees (80 degrees total flap angle) due to plastic strain in the flexures. Flapping frequency

  10. Tools and Services for Data Intensive Research RS Barga, C Poulain, N Araujo, T Chou and E Viegas MSR Redmond

    E-Print Network [OSTI]

    (`09) · Wayback machine has ~2 PB (`06) · CERN LHC will generate 15 PB/year ('09) · WalMart 4PB data

  11. Inflammation persistently enhances nocifensive behaviors mediated by spinal group I mGluRs through sustained ERK activation

    E-Print Network [OSTI]

    Gereau, Robert W. IV

    sustained ERK activation Hita Adwanikara , Farzana Karima,b , Robert W. Gereau IVa,b,* a Division signaling pathways, which involve the extracellular signal- regulated kinases (ERKs), have been implicated but is associated with increased levels of phosphorylated ERK in dorsal horn neurons. We also tested whether

  12. www.sciencesignaling.org/cgi/content/full/4/196/rs10/DC1 Supplementary Materials for

    E-Print Network [OSTI]

    Perrimon, Norbert

    10628 barr Kary3 Grp1 Cka InR CG31704 PTEN CG8291 CG3173 CG15615 SerT gig (Tsc2) fliI Tor CG10955 S6K

  13. DETECTION OF ALUMINUM WASTE REACTIONS AND WASTE FIRES Jeffrey W. Martin, M.S., P.G., R.S.

    E-Print Network [OSTI]

    , undesirable changes in leachate composition, increased leachate production, and most importantly smoldering combustion of the surrounding solid waste. The landfill liner and explosive gas extraction and leachate, landfill, leachate, leachate recirculation, salt cake, slope stability, smoldering, solid waste, Subtitle D

  14. Improved Usability of Aviation Automation Through Direct

    E-Print Network [OSTI]

    Kaber, David B.

    Improved Usability of Aviation Automation Through Direct Manipulation and Graphical User Interface Design David B. Kaber and Jennifer M. Riley Department of Industrial Engineering North Carolina State University Kheng-Wooi Tan Department of Industrial Engineering Mississippi State University Problems

  15. Numerical Simulation of Land Subsidence in the Los Banos-Kettleman City Area, California

    E-Print Network [OSTI]

    Larson, Keith J; Basagaoglu, Hakan; Marino, Miguel A

    1999-01-01

    risk assessment of land subsidence in Shanhai. EnvironmentalF. and Riley, F. S. 1984. Land Subsidence in the San Joaquinand Miller, R. E. 1975. Land subsidence due to ground water

  16. Microsoft Word - List of Attendees_Industry Comment Meetings...

    Office of Environmental Management (EM)

    Brian Riley Director, Federal & State Affairs U.S. Honda October 22 10:00 - 10:30 am Ed Cohen Vice President, Government & Industry Relations, Honda North America Mark Wagner Vice...

  17. Direct expanded snacks from sorghum 

    E-Print Network [OSTI]

    Maranphal, Nitit

    2003-01-01

    Pascut, David Acosta, Ana M. Leal-Diaz, Laura Silva, Marcelo Mitre-Dieste, Pamela Littlejohn, Leigh Ann Carman, Feliciano Bejosano, Gabriela perez, Rudianto Suhareli, Javier Bueso, Joseph M. Awika, Crystal R. Rudiger, Erin W. Riley, Shane Halfmann...

  18. Indians and Guns

    E-Print Network [OSTI]

    Riley, Angela R.

    2013-01-01

    concomitant freedom to devise gun policy that works forof Angela R. Riley, Indians and Guns, 100 g eo . l.J. 1675 (Ludwig & Adam M. Samaha, Gun Control After Heller: Threats

  19. Jerry R. Strawser Vice President for Finance

    E-Print Network [OSTI]

    Jerry R. Strawser Vice President for Finance and Administration Gary W. Barnes Associate VP Division of Finance and Administration Andrew Mitchell Executive Director Logistics Services Dean Endler David Morrison Interim Director Facilities Coordination Jim Riley Executive Director Utilities & Energy

  20. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    Genomics of wood-degrading fungi","Ohm, Robin A.; Riley, Robert; Salamov, Asaf; Min, Byoungnam; Choi, In-Geol; Grigoriev, Igor V.","2014-11-01T04:00:00Z",1222394,"10.1016...

  1. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Genomics of wood degrading fungi Ohm Robin A Riley Robert Salamov Asaf Min Byoungnam Choi In Geol Grigoriev Igor V Not Available Elsevier None USDOE United States English Journal...

  2. Where do fossil fuel carbon dioxide emissions from California go? An analysis based on radiocarbon observations and an atmospheric transport model

    E-Print Network [OSTI]

    2008-01-01

    independent budgeting of fossil fuel CO 2 over Europe by (COcontributions from fossil fuels, oceans, the stratosphere,15 of 16 G04002 RILEY ET AL. : FOSSIL FUEL CO 2 TRANSPORT IN

  3. The following persons served as members of the Riparian Conference Advisory Committee

    E-Print Network [OSTI]

    Peter Moyle University of California, Davis Jim Nelson California Energy Commission John Rieger California Department of Transportation A.L. Riley California Department of Water Resources Peter Richerson Engineering Command Barbara Talley California Department of Transportation Chuck Watson Watson Environmental

  4. World Energy Consumption and Carbon Dioxide Emissions: 1950 2050

    E-Print Network [OSTI]

    World Energy Consumption and Carbon Dioxide Emissions: 1950 Ñ 2050 Richard Schmalensee, Thomas M. Stoker, andRuth A. Judson* Emissions of carbon dioxide from combustion of fossil fuels, which may-U" relation with a within- sample peak between carbon dioxide emissions (and energy use) per capita and per

  5. Production of a pellet fuel from Illinois coal fines. Technical report, September 1--November 30, 1994

    SciTech Connect (OSTI)

    Rapp, D.; Lytle, J.; Berger, R.

    1994-12-31

    The primary goal of this research is to produce a pellet fuel from low-sulfur Illinois coal fines which could burn with emissions of less than 1.8 lbs SO{sub 2}/10{sup 6} Btu in stoker-fired boilers. The significance of 1.8 lbs SO{sub 2}/10{sup 6} Btu is that in the Chicago (9 counties) and St. Louis (2 counties) metropolitan areas, industrial users of coal currently must comply with this level of emissions. Stokers are an attractive market for pellets because pellets are well-suited for this application and because western coal is not a competitor in the stoker market. Compliance stoker fuels come from locations such as Kentucky and West Virginia and the price for fuels from these locations is high relative to the current price of Illinois coal. This market offers the most attractive near-term economic environment for commercialization of pelletization technology. For this effort, the authors will be investigating the use of fines from two Illinois mines which currently mine relatively low-sulfur reserves and that discard their fines fraction (minus 100 mesh). The research will involve investigation of multiple unit operations including column flotation, filtration and pellet production. The end result of the effort will allow for an evaluation of the commercial viability of the approach. This quarter pellet production work commenced and planning for collection and processing of a preparation plant fines fraction is underway.

  6. N.J. Themelis Trip to China, October 2007 Trip of Nickolas Themelis, WTERT Chair, to China, October 18-

    E-Print Network [OSTI]

    Columbia University

    greatly by the Renewable Energy policy of the country: Coal-fired power plants receive 4-6 cents/kWh. WTE was defined as clean and renewable energy. WTE plants in China are of two main types: Stoker grate and Circulating Fluid Bed. The latter are much smaller and they need coal co-firing, up to 20% of the feed

  7. Proceedings of NAWTEC16 16th Annual North American Waste-to-Energy Conference

    E-Print Network [OSTI]

    Columbia University

    used globally for energy recovery from municipal solid wastes is combustion of "as received" MSW of thermal treatment of MSW in the world (40 million tonnes) and some of the newest plants use stoker require pre-processing of the MSW, combust the resulting syngas to generate steam, and produce a vitrified

  8. Stanford Geothermal Program Stanford University

    E-Print Network [OSTI]

    Stanford University

    s Stanford Geothermal Program Stanford University Stanford, California RADON MEASUEMENTS I N GEOTHERMAL SYSTEMS ? d by * ** Alan K. Stoker and Paul Kruger SGP-TR-4 January 1975 :: raw at Lcs Alams S c i and water, o i l and n a t u r a l gas wells. with radon i n geothermal reservoirs. Its presence i n

  9. Workflow Support Using Proclets: Divide, Interact, and Conquer W.M.P. van der Aalst and R.S. Mans and N.C. Russell

    E-Print Network [OSTI]

    van der Aalst, Wil

    technology in the seventies, the development of informa- tion systems is predominantly data-centric, i in the initial phases of workflow specification do not fit well with the predominant data-centric implementation NSF Workshop on Data-Centric Workflows that took place in Arlington (Virginia) in May 2009. (See [5

  10. Thermodynamic Optimization of Finite Time Processes By R.S. Berry, V.A. Kazakov, S. Sieniutycz, Z. Szwast, and A.M. Tsirlin

    E-Print Network [OSTI]

    Salamon, Peter

    heavy on the results of the Russian school, the number of examples treated and the unity achieved of nomenclature. For #12;example, the use of NP for the nonlinear programming problem clashes with the usage driven by solar energy. These areas have all been significantly impacted by the ideas and methods

  11. 10 Carbon Capture and Storage in the UK Bushby Y.E., Gilfillan S.M.V. and Haszeldine R.S.

    E-Print Network [OSTI]

    Haszeldine, Stuart

    point sources such as power stations and industrial facilities. Existing power stations can be retrofitted with carbon capture equipment and new power stations can be built to be ready for capture. 3 will need to be much greater for use on power station emissions. Transport of carbon dioxide is already used

  12. Cornplcx Orgtmismol Frrr~crions:Intrgrurion und Evolrrriorr in Ver~rbr~r~rs cds. D.B. Wakc and G. Roth, pp. 205-218

    E-Print Network [OSTI]

    Bennett, Albert F.

    , and cardiovascular components) is essential for clarification of evolutionary pathways and an understanding of levels, the innovations necessary for the transition from aquatic to terrestrial and from terrestrial to aerial locomotion is required to overcome drag in an aquatic medium and should be incorporated in any analysis. For terrestrial

  13. Polarizable Ions at Interfaces Instituto de Fisica, Universidade Federal do Rio Grande do Sul, Caixa Postal 15051, CEP 91501-970, Porto Alegre, RS, Brazil

    E-Print Network [OSTI]

    Levin, Yan

    free energy of polarizable ions near water-vapor and water-oil interfaces. The theory predicts.20.Ày, 82.45.Gj There are a number of long standing mysteries in the fields of physical chemistry a dielectric air- (oil-)water interface, the charge on its sur- face shifts progressively from the exposed air

  14. Sl.No. Date Payment Details Purpose Rs. 1 18.4.2005 Akash Ganga Project Akash Ganga Project 108,665

    E-Print Network [OSTI]

    Sivalingam, Krishna M.

    Pvt. Ltd. Atma Charity Wing 5,000 41 2-3-2006 M/s. Controls & Switchgear Contractors Ltd Atma Charity

  15. The Passivity and Breakdown of Beryllium in Aqueous Solutions M.A. Hill, D.P. Butt, and R.S. Lillard

    E-Print Network [OSTI]

    The Passivity and Breakdown of Beryllium in Aqueous Solutions M.A. Hill, D.P. Butt, and R beryllium (Be) has been studied as a function of pH. Below pH 2, Be exhibited active dissolution at all, the presence of the fluoride increased the passive current density of beryllium, but had no effect

  16. RS2503SociologicalandAnthropologicalTheoriesofReligion|2014-2015 SCHOOL OF DIVINITY, HISTORY AND PHILOSOPHY ACADEMIC SESSION 2014-2015

    E-Print Network [OSTI]

    Neri, Peter

    the collapse of the granary can be? 6. Does Mormonism offer a successful religious system? ASSESSMENT DEADLINES

  17. RADIO SCIENCE, VOL. 49, 3643, doi:10.1002/2013RS005288, 2014 Rare examples of early VLF events observed in association

    E-Print Network [OSTI]

    observed in association with ISUAL-detected gigantic jets R. A. Marshall,1 T. Adachi,2 R.-R. Hsu,3 and A. B perturbations with gigantic jets recorded by the Imager of Sprites and Upper Atmospheric Lightnings (ISUAL gigantic jets using a triggered camera. Stanford VLF receivers located around the world are used to detect

  18. In Situ Validation of a Correction for Time-Lag and Bias Errors in Vaisala RS80-H Radiosonde Humidity Measurements

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THE SITE-218 58ImprovingIn MemoriamIn

  19. Instruction Set Quick Reference

    E-Print Network [OSTI]

    Newhall, Tia

    = RS + RT CLO RD, RS RD = COUNTLEADINGONES(RS) CLZ RD, RS RD = COUNTLEADINGZEROS(RS) LA RD, LABEL RD = ADDRESS(LABEL) LI RD, IMM32 RD = IMM32 LUI RD, CONST16 RD = CONST16 LO = RS JUMPS AND BRANCHES (NOTE: ONE DELAY SLOT) B OFF18 PC += OFF18± BAL OFF18 RA = PC + 8, PC

  20. COFIRING BIOMASS WITH LIGNITE COAL

    SciTech Connect (OSTI)

    Darren D. Schmidt

    2002-01-01

    The University of North Dakota Energy & Environmental Research Center, in support of the U.S. Department of Energy's (DOE) biomass cofiring program, completed a Phase 1 feasibility study investigating aspects of cofiring lignite coal with biomass relative to utility-scale systems, specifically focusing on a small stoker system located at the North Dakota State Penitentiary (NDSP) in Bismarck, North Dakota. A complete biomass resource assessment was completed, the stoker was redesigned to accept biomass, fuel characterization and fireside modeling tests were performed, and an engineering economic analysis was completed. In general, municipal wood residue was found to be the most viable fuel choice, and the modeling showed that fireside problems would be minimal. Experimental ash deposits from firing 50% biomass were found to be weaker and more friable compared to baseline lignite coal. Experimental sulfur and NO{sub x} emissions were reduced by up to 46%. The direct costs savings to NDSP, from cogeneration and fuel saving, results in a 15- to 20-year payback on a $1,680,000 investment, while the total benefits to the greater community would include reduced landfill burden, alleviation of fees for disposal by local businesses, and additional jobs created both for the stoker system as well as from the savings spread throughout the community.

  1. Time-resolved optical absorption spectroscopic studies of cytochrome c oxidase from Rhodobacter sphaeroides and ubiquinol oxidase from Escherichia coli

    E-Print Network [OSTI]

    Cassano, Jennifer

    2015-01-01

    FPPEGIITFD PWHLPLINTL ILLCSGCAAT Bov aa 3 SIII Rs aa 3 SIIILAIALGALFT VFQAYEYSHA AFGFAGNIYG Bov aa 3 SIII Rs aa 3 SIIILLVCLIRVQR GHFTPEKHVG FEAAIWYWHF Bov aa 3 SIII Rs aa 3 SIII

  2. Relationships among environment, movement, growth and survival of coastal rainbow trout (Oncorhynchus mykiss)

    E-Print Network [OSTI]

    Heady, Walter Nicholas

    2012-01-01

    doi: 10.11 Lindley ST, Schick RS, Agrawal A, Goslin M,Science 4:1-19 Lindley ST, Schick RS, Mora E, Adams PB,pp 103–128 Lindley ST, Schick RS, Agrawal A, Goslin M,

  3. Ending Copyright Claims in State Primary Legal Materials: Toward an Open Source Legal System

    E-Print Network [OSTI]

    Fortney, Katie

    2010-01-01

    at 801, ¶ 44; Bldg. Officials & Code Adm’rs v. Code Tech. ,34, 66. 40. Bldg. Officials & Code Adm’rs v. Code Tech. ,codes. ”). 48. Bldg. Officials & Code Adm’rs v. Code Tech. ,

  4. Geology of an area between Bluff and Honey Creeks, Mason County, Texas 

    E-Print Network [OSTI]

    Fritz, Joseph Francis

    1954-01-01

    ahelo aeaber Rergan Creak Xiaoatoai comber ttelge conga%one Noecbor Riley f cRtiabian Lien go'ICnbain conge'iceco Reebok Cap Ronntain linea tone aeebor Hickory conge%one aoiber Pre&aabri, an eye%one Zgnoone reoke pine~ino4 gre4itk Oearee...

  5. December 3, 2014 Chenyang Xiao

    E-Print Network [OSTI]

    Carlini, David

    Master of Arts in Sociology University of Toledo, Ohio Non-thesis Master of Arts program July 1994 Agreement and Support for Government Action on Climate Change in the USA, 2006-2012." Weather, Climate M., Riley E. Dunlap, and Chenyang Xiao. Perceived Scientific Agreement and Support for Government

  6. RECOVERY ACT CASE STUDY CHP and district energy serve Texas A&M's 5,200-acre campus, which includes 750 buildings.

    E-Print Network [OSTI]

    .S. Congressman Chet Edwards Texas A&M's CHP system includes a gas turbine generator, heat recovery steam generator, and steam turbine generator. Photo courtesy of Texas A&M University 3 Riley, Jim, "Combined Heat, 2010. Brush Generator 34 MW RO Water Dresser Rand Steam Turbine Ideal Generator 11 MW 12.47 kV EIT HRSG

  7. Water balance and rice growth responses to direct seeding, deep tillage, and landscape placement

    E-Print Network [OSTI]

    Water balance and rice growth responses to direct seeding, deep tillage, and landscape placement--T2, deep chisel + moldboard plough--T3) and establishment practice (TPR, DSR) on the field water University, Ithaca, NY 14853, USA c Department of Biological and Environmental Engineering, Riley-Robb Hall

  8. A New Paradigm for Optimizing Hybrid Simulations of Rare Event Modeling for Complex Systems

    E-Print Network [OSTI]

    Johnson, Eric E.

    -scale complex systems. Most complex systems such as our cities, national air space, nuclear power plants complex systems such as our cities, national air space, nuclear power plants, theme parks and global@nmsu.edu Linda Ann Riley, Department of Industrial Engineering, linriley@nmsu.edu New Mexico State University P

  9. 1438 Biochemical Society Transactions (2012) Volume 40, part 6 Resistance is futile: the bacteriocin model for

    E-Print Network [OSTI]

    Riley, Margaret

    2012-01-01

    , Smith College, Northampton, MA 01063, U.S.A. Abstract Pathogenic bacteria resistant to many or all1438 Biochemical Society Transactions (2012) Volume 40, part 6 Resistance is futile: the bacteriocin model for addressing the antibiotic resistance challenge Margaret A. Riley*1 , Sandra M. Robinson

  10. IMPROVING PUBLIC SAFETY FROM FEDERAL PROTECTION TO SHARED RISK REDUCTION

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Don Riley US Army Corps of Engineers Responsibility for flood risk management in the United States and promoting sound flood risk management. The authority to determine how land is used in floodplains to mitigate flood risk and the performance of federal flood damage reduction infrastructure. One key challenge

  11. Mechanisms of CCl4 Retention and Slow Release in Model Porous Solids and Sediments

    SciTech Connect (OSTI)

    Peyton, Brent M.

    2004-12-01

    This work is part of a larger collaborative project of the same title led by Robert Riley at PNNL. Our task goal is to use a state of the art microbalance and well-defined mesoporous silica particles to characterize the effects of pore size distribution on carbon tetrachloride release rate and sequestration.

  12. Collegeof Agriculture and Life Sciences Proposalfor ResearchFunds

    E-Print Network [OSTI]

    Angenent, Lars T.

    ResearchMentor: Tammo Steenhuis,Biological & Environmental Engineering Signatureof FacultyResearchMentor: '-- 119 Adrian A. Harpold Biological and Environmental Engineering 30 Riley-Robb Hall Cornell University Ithaca Sufficientandsafewateris theunderpinningof asociety'shealth,security,economy,and environmentalcondition[1]. Rainfall

  13. Provided for non-commercial research and educational use. Not for reproduction, distribution or commercial use.

    E-Print Network [OSTI]

    Langerhans, Brian

    or commercial use. This article was originally published in the Encyclopedia of Ecology, Volumes 1-5 published] of Encyclopedia of Ecology, 5 vols. pp. [1912-1915] Oxford: Elsevier. #12;Author's personal copy other basic­918. Pimentel D, Petrova T, Riley M, et al. (2006) Conservation of biological diversity in agricultural

  14. Balancing the expected and the surprising in geometric patterns Neil A. Dodgson

    E-Print Network [OSTI]

    Dodgson, Neil

    movements: fauvism, cubism, art nouveau, art deco, Op art, pop art, modernism and post-modernism amongst by Bridget Riley's early Op art pieces, White Discs 2 (1964) and Fragment 6/9 (1965). I analyse these two that tests and supports this hypothesis, and discuss the implications. Key words: pattern, Op art, æsthetics

  15. Sunlight: Fine-grained Targeting Detection at Scale with Statistical Confidence

    E-Print Network [OSTI]

    ." Unfortunately, today's Web is a very dark and complex ecosystem driven to a large extent by the massive,riley,yannis,augustin,roxana,djhsu@cs.columbia.edu) ABSTRACT We present Sunlight, a system that detects the causes of target- ing phenomena on the web confidence. Today's web is growing increasingly complex and impenetrable as myriad of services collect

  16. Business Administrators Departments Business Administrator Phone Email

    E-Print Network [OSTI]

    Sharp, Kim

    Business Administrators Departments Business Administrator Phone Email Anesthesiology and Critical@mail.med.upenn.edu Cancer Biology James Riley 746-5520 jriley@upenn.edu Cell & Developmental Biology Tracey Longs 898@mail.med.upenn.edu Psychiatry Rosellen Taraborrelli 662-2899 taraborr@mail.med.upenn.edu Radiation Oncology Susan Niskey Popp

  17. No. 01-7662 Supreme Court of the United States

    E-Print Network [OSTI]

    Kammen, Daniel M.

    ALEXANDRA R. GELBER University of California School SIDLEY AUSTIN BROWN & of Law (Boalt Hall) WOOD LLP)...................... 9, 11 Riley v. Taylor, 277 F.3d 261 (3d Cir. 2001) .. 12, 13, 21 Russell v. Acme-Evans Co., 51 F.3d

  18. Reachability Analysis of a Biodiesel Production System Using Stochastic Hybrid Systems

    E-Print Network [OSTI]

    Koutsoukos, Xenofon D.

    Reachability Analysis of a Biodiesel Production System Using Stochastic Hybrid Systems Derek Riley defines the creation of biodiesel from soybean oil and methanol. Modeling and analyzing the biodiesel. In this paper we model a biodiesel production system as a stochastic hybrid system, and we present

  19. Reachability Analysis of Stochastic Hybrid Systems: A Biodiesel Production System

    E-Print Network [OSTI]

    Koutsoukos, Xenofon D.

    Reachability Analysis of Stochastic Hybrid Systems: A Biodiesel Production System Derek Riley problem because it provides a formal framework to analyze complex systems. Biodiesel production is a realistic biochemical process that can be modeled and analyzed using SHS methods. Analysis of a biodiesel

  20. D I G E S T Public Works

    E-Print Network [OSTI]

    US Army Corps of Engineers

    , partners join forces to save Kickapoo Creek, by Cathy Kropp 19 Garrison Hawaii conserves resources while sustainability looks at a garrison, by Rick Cole and Jennifer Erickson 23 Fort Hood turns on solar field Garrison Hawaii puts spotlight on sustainability successes, by Chantal Leonard 29 Fort Riley sends used

  1. e-publishing Received 16 April 2003

    E-Print Network [OSTI]

    Menzel, Randolf - Institut für Biologie

    artificially displaced. Almost all of the bees maintained accurate compensation for lateral wind drift and distance. Keywords: honeybee; vector flight; navigation; harmonic radar; wind compensation 1. INTRODUCTION.1098/rspb.2003.2542 for wind drift. We have therefore used the harmonic radar technique (Riley et al. 1996

  2. ICT Project on Text Transcription of Technical Video Lectures and Creation of Video Searchable Index,

    E-Print Network [OSTI]

    Krishnapura, Nagendra

    Year 2nd Year Total A. Recurring 1.Salaries/wages Rs.89,40,000 Rs.89,40,000 Rs.1,78,80,000 2,15,00,000 BUDGET FOR SALARIES/WAGES: ITEM DESCRIPTION (in Rupees) 1st Year (m.m.*) 2nd Year (m.m.) Total (m: ITEM DESCRIPTION BUDGET (in Rupees) 1st Year 2nd Year Total Other consumables Rs. 60,000 Rs. 60,000 Rs

  3. Dean's Report 2011 1 T h e U n i v e rs i T y o f T e x a s aT a r l i n g T o n

    E-Print Network [OSTI]

    Huang, Haiying

    Cation and He altH Professions de an's rePort 2011 Creating Knowledge. Transforming Lives. #12;Students from proved to be an exciting one for the College of Education and Health Professions, as our faculty, staff, and students tackled new projects, built upon past successes, and achieved more than we ever thought possible

  4. Video analytics for retail A.W. Senior, L. Brown, A. Hampapur, C.-F.Shu, Y. Zhai, R.S. Feris, Y.-L. Tian, S.Borger, C.Carlson

    E-Print Network [OSTI]

    Senior, Andrew

    .3.3). Cameras Video Management Video storage Object Tracking Face Tracking XML Metadata MILS DatabaseWeb browser- resolution IR sensors for through-store tracking. Haritaoglu and Flickner [5] have also examined the use

  5. These courseware materials are to be used in conjunction with Software Engineering: A Practitioner's Approach, 6/e and are provided with permission by R.S. Pressman & Associates, Inc., copyright 1996, 2001, 2005 1

    E-Print Network [OSTI]

    Cukic, Bojan

    These courseware materials are to be used in conjunction with Software Engineering: A Practitioner, 2005 1 Software Engineering EthicsSoftware Engineering Ethics--II An ACM/IEEEAn ACM/IEEE--CS Joint Task Force has produced aCS Joint Task Force has produced a SoftwareSoftware Engineering Code of Ethics

  6. &('0)21436587@9 ACBED6BEDGFH5I36PRQTSU'036VW5XFH1`Yacb0'edea fhgi0prqtstuvgwxsyrHCqpwprwywIstgXgw0gIdegfheCpujiIqkXgEdmlonpXq2rs

    E-Print Network [OSTI]

    Tenenbaum, Josh

    Coughing Fever Headache Working In Factory Smoking Stressful Lifestyle High Fat Diet Flu Bronchitis Lung Cancer Heart Disease Chest Pain Coughing Fever Headache ï ú ù ï©ù Working In Factory Smoking Stressful Lifestyle High Fat Diet Flu Bronchitis Lung Cancer Heart Disease Chest Pain Coughing Fever Headache Working

  7. Sampler on Rural Drinking Water Research Centre for Technology Alternatives for Rural Areas (CTARA)

    E-Print Network [OSTI]

    Sohoni, Milind

    , the investment cost came to Rs. 2200 per capita while for 200 lpcd it came to Rs. 7500 per capita. The results

  8. Composition and Digestibility of the Ether Extract of Hays and Fodders. 

    E-Print Network [OSTI]

    Fraps, G. S.; Rather, J. B.

    1912-01-01

    ..............................................................................................................................Secretary LI eI RFE6BfB- .............................'............................................................................... Stenographer CI JI Rs.- -B9...

  9. NATIONAL CENTRE FOR BIOLOGICAL SCIENCES Annual Maintenance Contract for Electrical Systems in

    E-Print Network [OSTI]

    Udgaonkar, Jayant B.

    substations in NCBS Campus, GKVK Bangalore. 2. ESTIMATE VALUE PUT TO TENDER : Rs.62.29 Lakhs 3. EARNEST MONEY DEPOSIT : Rs.1,24,582.00 4. COST OF TENDER DOCUMENT : Rs. 500/- 5. SALE PERIOD : 12/12/2013 TO 20:________________DATE:____________ __________________________________ FOR A SUM OF RS. ________________ TOWARDS __________________________________THE COST OF TENDER DOCUMENT

  10. Genetic diversity of the Leptospiral immunoglobulin-like (Lig) genes in pathogenic Leptospira spp.

    E-Print Network [OSTI]

    Suchard, Marc A.

    Biotecnologia, Universidade Federal de Pelotas, Pelotas, RS, Brazil c Department of Biomathematics, David Geffen

  11. Relation between quantum tomography and optical Fresnel transform

    E-Print Network [OSTI]

    Hong-yi Fan; Li-yun Hu

    2008-01-13

    Corresponding to optical Fresnel transformation characteristic of ray transfer matrix elements (A;B;C;D); AD-BC = 1, there exists Fresnel operator F(A;B;C;D) in quantum optics, we show that under the Fresnel transformation the pure position density |x>_rs,rs__rs,rs_Fresnel quadrature phase is the tomography (Radon transform of Wigner function), and the tomogram of a state |phi> is just the wave function of its Fresnel transformed state F|phi>, i.e. rs_= . Similarly, we find F|p>_rs,rs_

  12. Method of regulating the amount of underfire air for combustion of wood fuels in spreader-stroke boilers

    DOE Patents [OSTI]

    Tuttle, Kenneth L. (Federal Way, WA)

    1980-01-01

    A method of metering underfire air for increasing efficiency and reducing particulate emissions from wood-fire, spreader-stoker boilers is disclosed. A portion of the combustion air, approximately one pound of air per pound of wood, is fed through the grate into the fuel bed, while the remainder of the combustion air is distributed above the fuel in the furnace, and the fuel bed is maintained at a depth sufficient to consume all oxygen admitted under fire and to insure a continuous layer of fresh fuel thereover to entrap charred particles inside the fuel bed.

  13. Carbonation as a binding mechanism for coal/calcium hydroxide pellets. Technical report, September 1, 1991--November 30, 1991

    SciTech Connect (OSTI)

    Rapp, D.M.

    1991-12-31

    Current coal mining and processing procedures produce a significant quanity of fine coal that is difficult to handle and transport. The objective of this work is to determine if these fines can be economically pelletized with calcium hydroxide, a sulfur capturing sorbent, to produce a clean-burning fuel for fluidized-bed combustors or stoker boilers. To harden these pellets, carbonation, which is the reaction of calcium hydroxide with carbon dioxide to produce a cementitious matrix of calcium carbonate, is being investigated. Previous research indicated that carbonation significantly improved compressive strength, impact and attrition resistance and ``weatherproofed`` pellets formed with sufficient calcium hydroxide (5 to 10% for minus 28 mesh coal fines).

  14. Carbonation as a binding mechanism for coal/calcium hydroxide pellets

    SciTech Connect (OSTI)

    Rapp, D.M.

    1991-01-01

    Current coal mining and processing procedures produce a significant quanity of fine coal that is difficult to handle and transport. The objective of this work is to determine if these fines can be economically pelletized with calcium hydroxide, a sulfur capturing sorbent, to produce a clean-burning fuel for fluidized-bed combustors or stoker boilers. To harden these pellets, carbonation, which is the reaction of calcium hydroxide with carbon dioxide to produce a cementitious matrix of calcium carbonate, is being investigated. Previous research indicated that carbonation significantly improved compressive strength, impact and attrition resistance and weatherproofed'' pellets formed with sufficient calcium hydroxide (5 to 10% for minus 28 mesh coal fines).

  15. Advanced Overfire Air system and design

    SciTech Connect (OSTI)

    Gene berkau

    2004-07-30

    The objective of the proposed project is to design, install and optimize a prototype advanced tangential OFA air system on two mass feed stoker boilers that can burn coal, biomass and a mixture of these fuels. The results will be used to develop a generalized methodology for retrofit designs and optimization of advanced OFA air systems. The advanced OFA system will reduce particulate and NOx emissions and improve overall efficiency by reducing carbon in the ash and excess oxygen. The advanced OFA will also provide capabilities for carrying full load and improved load following and transitional operations.

  16. Human Security and National Security Reform: New Paths for International Leadership 

    E-Print Network [OSTI]

    Abraham, Phebey; Cantrell, Catherine; Carman, Tara; Gruenwald, Emily; Rowley, Thomas A.

    2008-01-01

    of the requirements for the degree of MASTER OF SCIENCE Approved by: Chair of Committee, Brian D. Perkins Committee Members, Bruce Riley Tina L. Gumienny Head of Department, Thomas McKnight December 2008 Major Subject: Biology iii ABSTRACT... kinds of cilia are present on almost all cell types in the body (Davenport & Yoder, 2005). Functionally, motile cilia aid in the movement of extracellular fluid of the environment that they project into, whereas non-motile cilia primarily serve...

  17. Paper E-06, in: M. Pellei and A. Porta (Eds.), Remediation of Contaminated Sediments--2003. Proceedings of the Second International Conference on Remediation of Contaminated Sediments (Venice, Italy; 30 Sep3 Oct 2003). ISBN 1-57477-

    E-Print Network [OSTI]

    Matin, A.C.

    cells and purified ChrR (a P. putida chromate reductase) is also inhibited by co-pollutants of chromate contamination problem at the U.S. Department of Energy (DOE) waste sites with the result that chromate is second- centration is reported to be as high as 173 µM in ground water and 76 mM in sediments (Riley, 1992). Since

  18. A study of Fischer-Tropsch model compounds reacting over ZSM-5 

    E-Print Network [OSTI]

    Riley, Mark Garner

    1984-01-01

    (Member) Charles D. Holland (Chairman of Department) August 1984 ABSTRACT A Study Of Fischer-Tropsch Model Compounds Reacting Over ZSM-5 (August 1984) Mark Garner Riley, B. S. , Texas A&M University Chairman of Advisory Committee: Dr. Rayford G... the discovery of the synthetic zeolite, ZSM-5, research into the production of gasoline from fuel sources other than petroleum has accelerated. Beginning in the early 1970's extensive research was directed towards two processes. The first is the Fischer...

  19. America's Heartland: A Case for Social Resilience?

    E-Print Network [OSTI]

    Wuthnow, Robert

    2014-01-01

    of the Cold War and possibilities of nuclear annihilation. Modernization provided a narrative that put America in the lead among industrialized and developing nations. It highlighted the benefits of science, technology, higher education, urban life... the capacity of these organizations. But small towns and rural areas benefit significantly from farm subsidies, Social Security, and other transfer payments. Communities such as Minot, North Dakota, and Fort Riley, Kansas, benefit from military installations...

  20. Ultrathin amorphous zinc-tin-oxide buffer layer for enhancing heterojunction interface quality in

    E-Print Network [OSTI]

    in improving the performance of Earth-abun- dant solar cells. Thin lm solar cells comprising Earth in metal-oxide solar cells Yun Seog Lee,a Jaeyeong Heo,bc Sin Cheng Siah,a Jonathan P. Mailoa,a Riley E-blocking layer to enhance the performance of an Earth-abundant metal-oxide solar-cell material. A 5 nm thick

  1. Geology of the upper James River area Mason County, Texas 

    E-Print Network [OSTI]

    White, Dixon Nesbit

    1961-01-01

    of tbe Riley foraation ~ ~ ~ ~ . ~ ~ ~ i 19 XV. Weathered surfaoo of bish' exhibiting typioal eoabbago- bead stru001zo ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ a ~ ~ ~ ~ ~ ~ ~ ~ ~ V, Rfohera @bish ooours 1n ths. aiddlo of tho Poiat Peak shale aeabor, Tho biobera bas Man... froa the outcrop aad lies in an 0'1eFCRI$04 positions ~ ~ ~ i ~ ~ ~ ~ ~ ~ ~ VI, Point peak shale on the nest bask of Roy Crmk near the northern interseotion of Rey Creek and the Jaaes RiVsr Roadp ' ~ ~ ~ ~ ~ ~ i...

  2. Some Fungi Attacking Corn

    E-Print Network [OSTI]

    Haslam, Thomas Powell

    1910-01-01

    . R - raceme - X 96. S - sporophore - X 96. , -43- PLATE X I I . Macor erectus: M - mycelium. K - conidium formation. P L A T E XII -44- Trichoderma lignorium. Trichoderma lignorium has been found occurring abundantly in a few fields in Riley... of the Penioillium and the large amount of filamentous growth between the grains readily distinguish it from Penioillium glaucum. -45- PLATE XIII. Trichoderma lignorium: M - mycelium. C - conidia. P L A T E XIII -46- PLATE 117. Trichoderma lignorium: 36...

  3. BARRIER ISSUES TO THE UTILIZATION OF BIOMASS

    SciTech Connect (OSTI)

    Jay R. Gunderson; Bruce C. Folkedahl; Darren D. Schmidt; Greg F. Weber; Christopher J. Zygarlicke

    2002-05-01

    The Energy & Environmental Research Center (EERC) is conducting a project to examine the fundamental issues limiting the use of biomass in small industrial steam/power systems in order to increase the future use of this valuable domestic resource. Specifically, the EERC is attempting to elucidate the ash-related problems--grate clinkering and heat exchange surface fouling--associated with cofiring coal and biomass in grate-fired systems. Utilization of biomass in stoker boilers designed for coal can be a cause of concern for boiler operators. Boilers that were designed for low-volatile fuels with lower reactivities can experience damaging fouling when switched to higher-volatile and more reactive lower-rank fuels, such as when cofiring biomass. Higher heat release rates at the grate can cause more clinkering or slagging at the grate because of higher temperatures. Combustion and loss of volatile matter can start too early with biomass fuels compared to design fuel, vaporizing alkali and chlorides which then condense on rear walls and heat exchange tube banks in the convective pass of the boiler, causing noticeable increases in fouling. In addition, stoker-fired boilers that switch to biomass blends may encounter new chemical species such as potassium sulfates and various chlorides in combination with different flue gas temperatures because of changes in fuel heating value, which can adversely affect ash deposition behavior.

  4. The RO(G)-Graded Equivariant Ordinary Homology of G-Cell ...

    E-Print Network [OSTI]

    using the unit disks of finite dimensional G-representations as cells. Our main result ...... indicate that the first value should be Coker (??R(S) : R(S)G/e. // R(S)).

  5. Disarming Words: Empire and the Seductions of Translation in Egypt

    E-Print Network [OSTI]

    Tageldin, Shaden M.

    2011-01-01

    Recognition 2. The Dismantling I: Al-‘ At t ?r’s Antihistorys citation 80 | The Dismantling I of a line of Arabic verse—post)colonial. Chapter Two The Dismantling I Al-‘At t ?r’s

  6. 2 photon Laser optical path (Will Grimes June 3, 2013) (page 1 of 10) polarized mirror

    E-Print Network [OSTI]

    Stryker, Michael

    bottom periscope mirror periscope (Thor labs RS99) into microscope scan head #12;2 photon Laser in front of the beam. bottom periscope mirror periscope (Thor labs RS99) into microscope scan head beam

  7. Variation in the Maternal Corticotrophin Releasing Hormone-Binding Protein (CRH-BP) Gene and Birth Weight in Blacks, Hispanics and Whites

    E-Print Network [OSTI]

    2012-01-01

    the experiments: PDW HNS RS CFS. Performed the experiments:SE CB. Analyzed the data: CFS JEH PDW. Contributed reagents/LS JEH. Wrote the paper: PDW CFS HNS SE CB RS. References 9.

  8. Framework for Assessing Viability of Threatened and Endangered Chinook Salmon and Steelhead in the Sacramento–San Joaquin Basin

    E-Print Network [OSTI]

    2007-01-01

    Administration Robert S. Schick, National Oceanic andFishery Bulletin Lindley ST, Schick RS, Agrawal A, Goslin M,1, Article 2. Lindley ST, Schick RS, May B, Anderson JJ,

  9. Selective disruption of the cerebral neocortex in alzheimer's disease

    E-Print Network [OSTI]

    2010-01-01

    Martin Reuter 1 , Howard J. Cabral 3 , Christopher P. Hess1048–1055. 21. Desikan RS, Cabral HJ, Hess CP, Dillon WP,25. Desikan RS, Fischl B, Cabral HJ, Kemper TL, Guttmann CR,

  10. Lack of effect of apolipoprotein C3 polymorphisms on indices of liver steatosis, lipid profile and insulin resistance in obese Southern Europeans

    E-Print Network [OSTI]

    Sentinelli, Federica; Romeo, Stefano; Maglio, Cristina; Incani, Michela; Burza, Maria A.; Scano, Francesca; Coccia, Federica; Cossu, Efisio; Leonetti, Frida; Baroni, Marco G.

    2011-06-10

    Abstract Background Apolipoprotein C3 (APOC3) is a component of triglyceride-rich lipoproteins, and APOC3 rs2854116 and rs2854117 polymorphisms have been associated with non-alcoholic fatty liver disease, hypertriglyceridaemia, and insulin...

  11. 11/12/12 06:15Belgische onderzoekers zoeken naar stuk van maan of Mars op Zuidpool (via Engineeringnet.be) Page 1 of 4http://www.engineeringnet.be/belgie/detail_belgie.asp?Id=9186&ti...0stuk%20van%20maan%20of%20Mars%20op%20Zuidpool&category=research

    E-Print Network [OSTI]

    Claeys, Philippe

    /11) Vlaanderen wil voorsprong in 3D-printing niet uit handen geven - artikel Technisch Nieuws (gesponsored) RS

  12. A Variational Principle for Asymptotically Randall-Sundrum Black Holes

    E-Print Network [OSTI]

    Scott Fraser; Douglas M. Eardley

    2015-07-28

    We prove the following variational principle for asymptotically Randall-Sundrum (RS) black holes, based on the first law of black hole mechanics: Instantaneously static initial data that extremizes the mass yields a static black hole, for variations at fixed apparent horizon area, AdS curvature length, cosmological constant, brane tensions, and RS brane warp factors. This variational principle is valid with either two branes (RS1) or one brane (RS2), and is applicable to variational trial solutions.

  13. Journal of Quantitative Spectroscopy & Radiative Transfer 73 (2002) 583602

    E-Print Network [OSTI]

    Siewert, Charles E.

    2002-01-01

    Engenharia Mec^anica, Universidade Federal do Rio Grande do Sul, 90050-170 Porto Alegre, RS, Brazil c

  14. CHAPTER 7 EVALUATION KIT CHAPTER CONTENTS

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    RTN 5V BATT MAIN PWR ONEPPS RED BLACK WHITE DRAIN WHITE DRAIN GREEN ORANGE BROWN BLUE YELLOW 9 PIN D RTCM IN PWR RTN VPP ONEPPS RTN 5V BATT MAIN PWR ONEPPS (100mm) BANANA JACK, POMONA PART NO. 5167-0, 6 NAME 1 RS-232 RXD2 2 RS-232 RXD1 3 RS-232 TXD 4 VPP 5 ONEPPS RTN 6 5V BATT 7 PWR RTN AND RS-232 RTN 8

  15. GS-Lab Report 2008 by J.B. de Smeth, 1 GeoScience-Laboratory

    E-Print Network [OSTI]

    analysis and RS for the identification of soil erosion and desertification in Murcia province SE-Spain Fig

  16. Jagadananda Karaka Ragam Natai

    E-Print Network [OSTI]

    Kalyanaraman, Shivkumar

    ("jaya")!] P P P np pm gm P N S S ; N S ; ; ; || Jaga daa - - - - - nan da Kaa ra ka P P n n P n n P ; sn R ; gm pn pm || Jaga da - - - nan - - - - da Kaa - raka- P P n n P Psn R ; | rs sn np pm gm rs gm pm || Jaga daa - - nan - - - - - - - da Ka ­ra kaa-- - P P rs sn np pm mr rs | np ­ S ; S gm pn pm gm || Jaya

  17. ORIGINAL RESEARCH ARTICLE Separate and interacting effects within the

    E-Print Network [OSTI]

    Nyholt, Dale R.

    , with the majority placing emphasis on examining a functional Val/Met polymorphism within this enzyme. Unfortunately4633, rs165599) in addition to the Val/Met variant (rs4680) in a highly selected sample of Australian Caucasian families containing 107 patients with SZ. The Val/Met and rs4633 variants showed nominally

  18. NATIONAL CENTRE FOR BIOLOGICAL SCIENCES Annual Maintenance Contract for Electrical Systems in

    E-Print Network [OSTI]

    Udgaonkar, Jayant B.

    Maintenance Contract for Electrical systems including substations in Mandara hostel-CB site, NCBS : Rs.47,729.00 4. COST OF TENDER DOCUMENT : Rs. 500/- 5. SALE PERIOD : 13/12/2013 TO 23/12/2013 6. TIME:________________DATE:____________ __________________________________ FOR A SUM OF RS. ________________ TOWARDS __________________________________THE COST OF TENDER DOCUMENT

  19. Silviculture in an uncertain world: Utilizing multi-aged management systems to integrate disturbance

    E-Print Network [OSTI]

    O'Hara, KL; Ramage, BS

    2013-01-01

    1868– 1873. O’Hara, K.L. , Seymour, R.S. , Tesch, S.D. andFront. Ecol. Environ. 6, Seymour, R.S. and Hunter, M.L. 19923, 157– 163. Forestry Seymour, R.S. , White, A.S. and

  20. The Effects of Stressors on Voluntary Running

    E-Print Network [OSTI]

    Dlugosz, Elizabeth Maureen

    2012-01-01

    Ecol. 1-8. White, C.R. and Seymour, R.S. (2005). Allometric616-623. White, C.R. and Seymour, R.S. (2005). Allometric1635-1644. White, C.R. and Seymour, R.S. (2005). Allometric

  1. 2/21/13 4:15 PMUnited States Patent: 8300220 Page 1 of 38http://patft.uspto.gov/netacgi/nph-Parser?Sect1=PTO1&Sect2=HITOF...m&r=1&f=G&l=50&s1=8,300,220.PN.&OS=PN/8,300,220&RS=PN/8,300,220

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    2/21/13 4:15 PMUnited States Patent: 8300220 Page 1 of 38http ) United States Patent 8,300,220 Mahadevan-Jansen , et al. October 30, 2012 Device and method for non and proximal to the third optical port. #12;2/21/13 4:15 PMUnited States Patent: 8300220 Page 2 of 38http

  2. BARRIER ISSUES TO THE UTILIZATION OF BIOMASS

    SciTech Connect (OSTI)

    Bruce C. Folkedahl; Darren D. Schmidt; Greg F. Weber; Christopher J. Zygarlicke

    2001-10-01

    The Energy & Environmental Research Center (EERC) is conducting a project to examine the fundamental issues limiting the use of biomass in small industrial steam/power systems in order to increase the future use of this valuable domestic resource. Specifically, the EERC is attempting to elucidate the ash-related problems--grate clinkering and heat exchange surface fouling--associated with cofiring coal and biomass in grate-fired systems. Utilization of biomass in stoker boilers designed for coal can be a cause of concern for boiler operators. Boilers that were designed for low volatile fuels with lower reactivities can experience damaging fouling when switched to higher volatile and more reactive lower-rank fuels, such as when cofiring biomass. Higher heat release rates at the grate can cause more clinkering or slagging at the grate because of higher temperatures. Combustion and loss of volatile matter can start too early for biomass fuels compared to the design fuel, vaporizing alkali and chlorides which then condense on rear walls and heat exchange tube banks in the convective pass of the stoker, causing noticeable increases in fouling. In addition, stoker-fired boilers that switch to biomass blends may encounter new chemical species such as potassium sulfates and various chlorides, in combination with different flue gas temperatures because of changes in fuel heating value which can adversely affect ash deposition behavior. The goal of this project is to identify the primary ash mechanisms related to grate clinkering and heat exchange surface fouling associated with cofiring coal and biomass--specifically wood and agricultural residuals--in grate-fired systems, leading to future mitigation of these problems. The specific technical objectives of the project are: Modification of an existing EERC pilot-scale combustion system to simulate a grate-fired system; Verification testing of the simulator; Laboratory-scale testing and fuel characterization to determine ash formation and potential fouling mechanisms and to optimize activities in the modified pilot-scale system; and Pilot-scale testing in the grate-fired system. The resulting data will be collected, analyzed, and reported to elucidate ash-related problems during biomass-coal cofiring and offer a range of potential solutions.

  3. Newsfront 29 October - 4 November 2007, Issue 39

    E-Print Network [OSTI]

    Ghimire, Yubaraj

    , diesel price has been increased by Rs.300, and cooking gas (LPG) by Rs. 200 per cylinder. With the latest decision, the price of diesel per litre stands at Rs.56, Kerosene at Rs.51 and LPG cylinder Rs.1100. NOC says the increase in the price is a natural... off. Nevertheless, the southerly wind from the deal has filled the sails and coffers of many politicians that dominate the political landscape today. The ongoing constituent assembly (CA) mess is a remix of both these earlier scams. On the one hand...

  4. Nucla CFB Demonstration Project

    SciTech Connect (OSTI)

    Not Available

    1990-12-01

    This report documents Colorado-Ute Electric Association's Nucla Circulating Atmospheric Fluidized-Bed Combustion (AFBC) demonstration project. It describes the plant equipment and system design for the first US utility-size circulating AFBC boiler and its support systems. Included are equipment and system descriptions, design/background information and appendices with an equipment list and selected information plus process flow and instrumentation drawings. The purpose of this report is to share the information gathered during the Nucla circulating AFBC demonstration project and present it so that the general public can evaluate the technical feasibility and cost effectiveness of replacing pulverized or stoker-fired boiler units with circulating fluidized-bed boiler units. (VC)

  5. Coal/D-RDF (densified refuse-derived fuel) co-firing project, Milwaukee County, Wisconsin

    SciTech Connect (OSTI)

    Hecklinger, R.S.; Rehm, F.R.

    1985-11-01

    A Research and Development Project was carried out to mix a densified refuse-derived fuel with coal at the fuel-receiving point and to co-fire the mixture in a spreader-stoker fired boiler. Two basic series of test runs were conducted. For the first series, coal was fired to establish a base line condition. For the second series, a mixture of coal and densified refuse-derived fuel was fired. The report describes the equipment used to densify refuse derived fuel, procedures used to prepare and handle the coal and densified refuse derived fuel mixture and the test results. The results include the effect of the coal and densified refuse derived fuel mixture on plant operations, boiler efficiency, stack emissions and EP toxicity.

  6. Municipal waste combustion assessment: Fossil fuel co-firing. Final report, October 1988-July 1989

    SciTech Connect (OSTI)

    Landrum, V.J.; Barton, R.G.

    1989-07-01

    The report identifies refuse derived fuel (RDF) processing operations and various RDF types; describes such fossil fuel co-firing techniques as coal fired spreader stokers, pulverized coal wall fired boilers, pulverized coal tangentially fired boilers, and cyclone fired boilers; and describes the population of coal fired boilers that currently co-fire RDF, have previously co-fired RDF but have ceased to do so, and have been used in RDF co-firing demonstrations. (Fossil fuel co-firing, defined as the combustion of RDF with another fuel (usually coal) in a device designed primarily to burn the other fuel, is generally confined to commercial and utility boilers.) Model plants are developed and good combustion practices are recommended.

  7. Zero-Crossing Angle in the Np Analyzing Power at Medium Energies and its Relation to Charge Symmetry 

    E-Print Network [OSTI]

    Bhatia, T. S.; Glass, G.; Hiebert, John C.; Northcliffe, L. C.; Tippens, W. B.; Bonner, BE; Simmons, J. E.; Hollas, C. L.; Newsom, C. R.; Riley, P. J.; Ransome, R. D.

    1981-01-01

    VOLUME 24, NUMBER 2 AUGUST 1981 Zero-crossing angle in the np analyzing power at medium energies and its relation to charge symmetry T. S. Bhatia, G. Glass, J. C. Hiebert, L. C. Northcliffe, and W. B. Tippens Texas AdlM University, College Station..., Texas 77843 B. E. Bonner and J. E. Simmons Los Alantos National Laboratory, Los Alanios, New Mexico 87545 C. L. Hollas, C. R. Newsom, ' P. J. Riley, and R. D. Ransome University of'Texas, Austi?, Texas 787I2 (Received 21 April 1981) The angle...

  8. Effects of ammonium compounds on the foliar activity of acifluorfen 

    E-Print Network [OSTI]

    Schaffers, William Clemens

    1989-01-01

    on the translocation of 2, 4, 5-T in blackjack oak and winged elm. Proc. South. Weed Conf. 20:382-386. 6. Baur, J. R. and R. W. Bovey. 1970. The uptake of picloram by potato tuber tissue. Weed Sci. 18:22-24. 7. Baur, J. R. , R. W. Bovey, R. D. Baker and I. Riley.... and R. L. Smith. 1986. Comparisons of 10- 34-0 to 28-0-0 for velvetleaf control in acifluorfen and bentazon combinations in soybeans. Proc. North Cent. Weed Cont. Conf. 41:53. 21. Forde, B. J. 1966. Translocation patterns of amitrole and ammonium...

  9. The stratigraphy and structure of the Rosita gas fields, Duval County, Texas 

    E-Print Network [OSTI]

    Straccia, Joseph Robert

    1980-01-01

    /mi to the southeast. Several minor, normal faults have disturbed the otherwise uniform dip. There is no evidence on the seismic profile (Riley, Shell Oil Com- pany) of shale or salt uplifts updip from the major fault plane, as was the ce. se at McAllen Ranch (Berg... to interpret structure and environment of deposition. Structural movement along listric normal faults resulted in struc- tural closures and. stratigraphic thickening. Thick sequences of sand- stone and shales show a basal sheared zone, overlain by a folded...

  10. The seasonal biology and control of the garden webworm: Loxostege similalis (Guen.) 

    E-Print Network [OSTI]

    Cogburn, Robert Ray

    1961-01-01

    the ness "garden vsbvorn" to distinguish it fron other veb spinning larvae. Riley stated tbst the nenes oarelsss voxn, oarsless veed vora and alfalfa vebvorn also hare been applied to ths incest. The ness, alfalfa vebvorn, is erroneous~ it is oorreetly... by this incest but cs?sst potatoes vere sstrscssly IIIscN$Aihle and rsp14$tkl+ was frscN?cntly neosssary as a result of tbe dame mawl bt lp ~rhdlal Chittenden (1912) stated that the garden websorsc was aust ~mien in the South and that it fed on weeds...

  11. np elastic spin-transfer measurements at 485 and 635 MeV 

    E-Print Network [OSTI]

    McNaughton, K. H.; Ambrose, DA; Coffey, P.; Johnston, K.; Riley, P. J.; McNaughton, M. W.; Koch, K.; Supek, I.; Tanaka, N.; Glass, G.; Hiebert, John C.; Northcliffe, L. C.; Simon, A. J.; Mercer, D. J.; Adams, D. L.; Spinka, H.; Jeppersen, R. H.; Tripard, G. E.; Woolverton, H.

    1992-01-01

    VOLUME 46, NUMBER 1 JULY 1992 ARTICLES np elastic spin-transfer measurements at 485 and 635 MeV K. H. McNaughton, D. A. Ambrose, P. Coffey, K. 3ohnston, ' and P. J. Riley University of Texas, Austin, Texas 78719 M. W. McNaughton, K. Koch, t I. Supek..., 2564 (1992). [17) K.C. Leung, UC Berkeley Ph. D. thesis [Report UCRL 19705 (1970)]. [18] D. Axen et a/. , Phys. Rev. C 21, 998 (1980). [19) J. Bystricky, C. Lechanoine-Leluc, and F. Lehar, J. Phys. (Paris) 48, 199 (1987); 51, 2747 (1990). ...

  12. Palatability of beef from young bulls 

    E-Print Network [OSTI]

    Riley, Ray Renfrow

    1981-01-01

    Palatability of Beef from Young Bulls. (December 1981) Ray Renfrow Riley, B. S. , Texas ASM University Co-Chairmen of Advisory Committee: Dr. J. W, Savell Dr. G. C. Smrth Electrical stimulation (ES), subcutaneous fat thickness and carcass masculinity... such matched steers were not different (P&. 05) - n overall palatability than steaks from ES young bulls. Steaks from U. S. Choice steers and from U. S. Good steers or bulls that had at least. 7. 62 mm fat thickness did not differ (P&. 05) in 39 of 42...

  13. Geology of the Schep-Panther Creek Area, Mason County, Texas 

    E-Print Network [OSTI]

    Bryant, George Frank

    1959-01-01

    ?stain send?tenn. . . . . . Se VII I . Teo oeaarroasee of the Tel go send?toss. IX. Biaberas in tbo Qergsa Crook line?toss. . . , . . . . , . SS Coataot botueoa tho Morgan Creak liaestoao snd tho Point Peek shale... thick biohera scms, yre- riousiJ iaoladed' hJ eoae ssccloBists Ba. the ysiat Posh shale sa4 bJ others ia the Saa SISS Xiaootuaec uos sopped ia the tboeis S?ea OS a separate uait sithia tbe Poiat Pash ssaber. Tbo ouyosed Riley faraaticuc uas ~ st...

  14. Mechanisms of Fetal Alcohol Spectrum Disorders 

    E-Print Network [OSTI]

    Wilson, Shannon Elizabeth

    2011-10-21

    examined with non-invasive techniques such as MRI (Mattson et al., 1992, 1994; Sowell et al., 1996, 2001; Archibald et al. 2001, Riley et al., 2004), these cases have identified a number of brain regions that suffer damage as a consequence of fetal... to determine normal 4 values and to establish the animal preparation. The large body mass of the sheep is also an advantage. The sheep fetus will weigh between 0.85-4.50 kg during the third trimester equivalent (this weight range represents the rapid...

  15. Maroon & green: New Texas A&M buildings conserve energy, water and money 

    E-Print Network [OSTI]

    Heinrich, Katie

    2013-01-01

    on campus, said Texas A&M Architect Lilia Gonzales. Successes of campus conservation Jim Riley, executive director of Texas A&M?s Utilities & Energy Services Department, said the largest sector of Texas A&M?s water consumption ? more than ?? percent... ? comes from water evaporation at Texas A&M?s four utility plants. ?e consumption occurs in the plant cooling towers maroon & Green New Texas A&M buildings conserve energy, water and money Fall 2013 txH2O 19 ] and is a direct result of evaporative...

  16. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference) |Janka,Ferrara U./INFN,TaÅŸ, Neslihan"Ron Riley" Name Name

  17. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference) |Janka,Ferrara U./INFN,TaÅŸ, Neslihan"Ron Riley" Name

  18. Searches for Exotic Decays of the Upsilon(3S) at BaBar (Conference) |

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference) |Janka,Ferrara U./INFN,TaÅŸ, Neslihan"Ron Riley" NameSciTech

  19. Searches for Exotic Decays of the Upsilon(3S) at BaBar (Conference) |

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference) |Janka,Ferrara U./INFN,TaÅŸ, Neslihan"Ron Riley"

  20. Searches for Higgs bosons at the Tevatron (Conference) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail. (Conference) |Janka,Ferrara U./INFN,TaÅŸ, Neslihan"Ron Riley"Conference:

  1. The gravitational drag force on an extended object moving in a gas

    E-Print Network [OSTI]

    Bernal, C G

    2013-01-01

    Using axisymmetrical numerical simulations, we revisit the gravitational drag felt by a gravitational Plummer sphere with mass M and core radius Rs, moving at constant velocity V0 through a background homogeneous medium of adiabatic gas. Since the potential is non-diverging, there is no gas removal due to accretion. When Rs is larger than the Bondi radius RB, the perturbation is linear at every point and the drag force is well fitted by the time-dependent Ostriker's formula with r_{min}= 2.25Rs, where r_{min} is the minimum impact parameter in the Coulomb logarithm. In the deep nonlinear supersonic regime (Rs2. As a consequence, the drag force does not depend sensitively on the nonlinearity parameter RB/Rs, for RB/Rs-values larger than a certain critical value. We show that our generalized Ostriker's formula for the drag force is more accurate than the formula suggested by Kim & Kim (2009).

  2. Seasonality of soil CO2 efflux in a temperate forest: Biophysical effects of snowpack and spring freeze–thaw cycles

    SciTech Connect (OSTI)

    Wang, Chuankuan; Han, Yi; Chen, Jiquan; Wang, Xingchang; Zhang, Quanzhi; Bond-Lamberty, Benjamin

    2013-08-15

    Changes in characteristics of snowfall and spring freeze–thaw-cycle (FTC) events under the warming climate make it critical to understand biophysical controls on soil CO2 efflux (RS) in seasonally snow-covered ecosystems. We conducted a snow removal experiment and took year-round continuous automated measurements of RS, soil temperature (T5) and soil volumetric water content at the 5 cm depth (W5) with a half-hour interval in a Chinese temperate forest in 2010–2011. Our objectives were to: (1) develop statistical models to describe the seasonality of RS in this forest; (2) quantify the contribution of seasonal RS to the annual budget; (3) examine biophysical effects of snowpack on RS; and (4) test the hypothesis that an FTC-induced enhancement of RS is jointly driven by biological and physical processes.

  3. DISCOVERY OF AN EXTENDED X-RAY JET IN AP LIBRAE

    SciTech Connect (OSTI)

    Kaufmann, S.; Wagner, S. J.; Tibolla, O.

    2013-10-20

    Chandra observations of the low-energy-peaked BL Lac object (LBL) AP Librae (AP Lib) revealed the clear discovery of a non-thermal X-ray jet. AP Lib is the first LBL with an extended non-thermal X-ray jet that shows emission into the very high energy range. The X-ray jet has an extension of ?15''(? 14 kpc). The X-ray jet morphology is similar to the radio jet observed with Very Large Array at 1.36 GHz emerging in the southeast direction and bends by 50° at a distance of 12'' toward the northeast. The intensity profiles of the X-ray emission studied are consistent with those found in the radio range. The spectral analysis reveals that the X-ray spectra of the core and jet region are both inverse-Compton-(IC)-dominated. This adds to a still small sample of BL Lac objects whose X-ray jets are IC-dominated and thus more similar to the high-luminosity Fanaroff-Riley II sources than to the low-luminosity Fanaroff-Riley I objects, which are usually considered to be the parent population of BL Lac objects.

  4. Temperature-associated increases in the global soil respiration record

    SciTech Connect (OSTI)

    Bond-Lamberty, Benjamin; Thomson, Allison M.

    2010-03-25

    Soil respiration (RS), the flux of CO2 from the soil surface to the atmosphere, comprises the second-largest terrestrial carbon flux, but its dynamics are incompletely understood, and the global flux remains poorly constrained. Ecosystem warming experiments, modelling analyses, and biokinetics all suggest that RS should change with climate. This has been difficult to confirm observationally because of the high spatial variability of RS, inaccessibility of the soil medium, and inability of remote sensing instruments to measure large-scale RS fluxes. Given these constraints, is it possible to discern climate-driven changes in regional or global RS fluxes in the extant four-decade record of RS chamber measurements? Here we use a database of worldwide RS observations, matched with high-resolution historical climate data, to show a previously unknown temporal trend in the RS record after accounting for mean annual climate, leaf area, nitrogen deposition, and changes in CO2 measurement technique. Air temperature anomaly (deviation from the 1961-1990 mean) is significantly and positively correlated with changes in RS fluxes; both temperature and precipitation anomalies exert effects in specific biomes. We estimate that the current (2008) annual global RS flux is 98±12 Pg and has increased 0.1 Pg yr-1 over the last 20 years, implying a global RS temperature response (Q10) of 1.5. An increasing global RS flux does not necessarily constitute a positive feedback loop to the atmosphere; nonetheless, the available data are consistent with an acceleration of the terrestrial carbon cycle in response to global climate change.

  5. Molecular tools for marker-assisted breeding of buffelgrass 

    E-Print Network [OSTI]

    Jessup, Russell William

    2005-11-01

    Agarose gel electrophoresis of pPAP10C11 RS-PCR products: (Left) First PCR. (Right) Nested PCR...............................................................?????24 4 Ninety six well plate of first-cycle RS-PCR products for pPAP3E08 ????.25 5... Ninety six well plates of first-cycle RS-PCR products for pPAP10C11.............26 6 Linkage group 7b in apomictic buffelgrass..........................................................31 7 Syntenic sorghum marker placement on buffelgrass linkage...

  6. 1000 VOLUME 42 | NUMBER 11 | NOVEMBER 2010 Nature GeNetics l e t t e r s

    E-Print Network [OSTI]

    Abecasis, Goncalo

    psoriasis(rs4795067,combinedP=1×10-8;rs10782001, combinedP=2×10-6;andrs12586317,combinedP=1× 10-6).Wealsoreplicatedarecentlyidentified3association signalnearRNF114(rs495337,combinedP=2×10-7). Psoriasis vulgaris (PsV) is one the most evident cellular features of psoriasis are epi dermal hyperplasia and altered keratinocyte

  7. BACTERIOCHLOROPHYLL PROTEIN STRUCTURE - - STUDIES WITH POLARIZED LIGHT AND TRIPLET STATE ELECTRON PARAMAGNETIC RESONANCE.

    E-Print Network [OSTI]

    Bolt, John Davis

    2013-01-01

    Ann. Phys. Knox, R.S. , in Bioenergetics of Photosynthesis,514 (1978). Sauer, K. , in Bioenergetics of Photosynthesis,K.L. Papageorgiou, G. , in Bioenergetics of Photosynthesis,

  8. Mechanics, malignancy, and metastasis: The force journey of a tumor cell

    E-Print Network [OSTI]

    Kumar, Sanjay; Weaver, Valerie M.

    2009-01-01

    Research Era of Hope grant W81XWH-05-1-330 (BC044791), CIRM grant RS1-00449 and DOE Low Dose Radiation

  9. Local Investigation of Femtosecond Laser Induced Dynamics of Water Nanoclusters on Cu(111) Michael Mehlhorn,1

    E-Print Network [OSTI]

    Alavi, Ali

    .37.Ef, 68.43.Bc, 82.30.Rs, 82.53.St There is broad interest in supported water-ice and the mechanims

  10. Sugave Water Scheme Report Konkan Gyanpeeth College of Engineering, Karjat

    E-Print Network [OSTI]

    Sohoni, Milind

    in 1998 with the original cost of Rs 234 lakhs and was designed to provide 55 litres per capita per day

  11. The Complex and Multi-Faceted Nature of School Construction Costs: Factors Affecting California. A Report to the American Institute of Architects California Council

    E-Print Network [OSTI]

    Vincent, Jeffrey M; McKoy, Deborah

    2008-01-01

    RS Means Construction Cost Index. Exhibit 8 below summarizesfor comparison using the Turner Building Cost Index, anational construction cost index that factors labor rates

  12. Regulation and Property Values in the United States: The High Cost of Monopoly

    E-Print Network [OSTI]

    Quigley, John M.

    2007-01-01

    1968–1998 Nominal price of new house Saylor cost index R.S. Means cost index U.S. dollars in thousands Year Source:

  13. Object-oriented abstractions for communication in parallel programs 

    E-Print Network [OSTI]

    Saunders, Steven Mack

    2003-01-01

    and MPI on a variety of machines, including an HP-V2200, Origin 3800, IBM Regatta and IBM RS6000 SP....

  14. MARY PARK HA hrough 6 and a

    E-Print Network [OSTI]

    @sfsu.ed 2011] s: Floors 1 th ny resident in M ooms and livin East [odd] side ooms. An asse rs 1, 2, 4, 5

  15. The temperature-jump problem for a variable collision frequency model L. B. Barichello

    E-Print Network [OSTI]

    Siewert, Charles E.

    -900 Porto Alegre, RS, Brazil M. Camargoa) Programa de Po´s-Graduac¸a~o em Engenharia Meca^nica, Universidade

  16. Limited availability of psoriasis and phototherapy care: An analysis of advertisements

    E-Print Network [OSTI]

    Hancox, John G; Balkrishnan, Rajesh; Battle, Jamila; Housman, Tamara Salam; Jr, Alan B Fleischer; Feldman, Steven R

    2005-01-01

    Limited availability of psoriasis and phototherapy care: Anconditions such as psoriasis may find it increasinglyRS, Rolstad T. The impact of psoriasis on quality of life:

  17. A Conceptual Model for Floodplains in the Sacramento-San Joaquin Delta

    E-Print Network [OSTI]

    Opperman, Jeffrey J.

    2012-01-01

    V, McBride JR, Dodd RS. 2005. Salix exigua clonal growth andas narrow-leaved willow (Salix exigua) can also regenerate

  18. The mechanism of the development of hepatic insulin sensitivity in chromogranin a null mice

    E-Print Network [OSTI]

    Chokshi, Sonia K.

    2010-01-01

    R.S. 1983. Role of gluconeogenesis in epinephrine-stimulatedof epinephrine-stimulated gluconeogenesis by insulin inand inhibition of gluconeogenesis which was reversed after

  19. A deformation of quantum affine algebra in squashedWess-Zumino...

    Office of Scientific and Technical Information (OSTI)

    by computing the rs-matrices that satisfy the extended classical Yang-Baxter equation. Finally, two degenerate limits are discussed. Authors: Kawaguchi, Io ; Yoshida,...

  20. Patterns of plant invasions in China: Taxonomic, biogeographic, climatic approaches and anthropogenic effects

    E-Print Network [OSTI]

    2010-01-01

    RS LF HA U W Prov. RE Canary Islands Africa and MadagascarAmerica South Europe, Canary Islands Tropical Asia America

  1. A variant of Wiener's attack on RSA Andrej Dujella

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    the form p q = rpm+1 ± spm rqm+1 ± sqm (3) for some m -1 and nonnegative integers r and s such that rs

  2. Residential and Transport Energy Use in India: Past Trend and Future Outlook

    E-Print Network [OSTI]

    de la Rue du Can, Stephane

    2009-01-01

    Rs) ab ab ov e e Renewable energy India is the only countryof India. Ministry of New and Renewable Energy (MNES),

  3. A validation of the first genome-wide association study of calcaneus ultrasound parameters in the European Male Ageing Study

    E-Print Network [OSTI]

    Roshandel, Delnaz; Thomson, Wendy; Pye, Stephen R.; Boonen, Steven; Borghs, Herman; Vanderschueren, Dirk; Huhtaniemi, Ilpo T.; Adams, Judith E.; Ward, Kate A.; Bartfai, Gyorgy; Casanueva, Felipe; Finn, Joseph D.; Forti, Gianni; Giwercman, Aleksander; Han, Thang S.; Kula, Krzysztof; Lean, Michael E.; Pendleton, Neil; Punab, Margus; Silman, Alan J.; Wu, Frederick C.; Holliday, Kate L.; O'Neill, Terence W.; EMAS Study Group

    2011-01-28

    ? 10-4 were also associated with SOS with p vice versa. The details of the selected SNPs are shown in Additional file 1: Supplementary Table S1. Four SNPs (rs10513725, rs1936473, rs2108167 and rs4954265) failed genotyping. All remaining 34... - caneus is 52-59% and 45-75%, respectively [4-7]. The proportion of population variation in ultrasound para- meters explained by genetic factors is similar in men and women, though there is also evidence suggesting a gen- der-specific component...

  4. Automated MRI measures identify individuals with mild cognitive impairment and Alzheimers disease

    E-Print Network [OSTI]

    2009-01-01

    S. Desikan, 1,2 Howard J. Cabral, 3 Christopher P. Hess, 431: 968–80. Desikan RS, Cabral HJ, Settecase F, Hess CP,

  5. Endoplasmic reticulum protein BI-1 regulates Ca2+

    E-Print Network [OSTI]

    Nizet, Victor

    Endoplasmic reticulum protein BI-1 regulates Ca2+ -mediated bioenergetics to promote autophagy by inositol triphosphate receptors (IP3Rs) maintains cellular bioenergetics, thus suppressing autophagy. We. By reducing steady-state levels of ER Ca2+ via IP3Rs, BI-1 influences mitochondrial bioenergetics, reducing

  6. Principal physics of rotating magnetic-field current drive of field reversed configurations

    E-Print Network [OSTI]

    Washington at Seattle, University of

    /2 1/2 rs, where rs is the FRC separatrix radius and is an effective weighted plasma resistivity. The plasma total temperature Tt is free to be any value allowed by power balance as long as the ratio of FRC. Hoffman,a H. Y. Guo, K. E. Miller, and R. D. Milroy Redmond Plasma Physics Laboratory, University

  7. UNIVERSIT DI BRESCIA FACOLT DI INGEGNERIA

    E-Print Network [OSTI]

    Cassinis, Riccardo

    finalità il controllo remoto del manipolatore industriale fisso Kawasaki RS03N mediante l'utilizzo di materiale e le istruzioni necessarie a chiunque voglia cimentarsi nell'analisi o nell'ampliamento del lavoro'ambiente software utilizzati per controllare da remoto il robot industriale Kawasaki RS03N. 1.1. Microsoft Kinect

  8. The q-analogue of the wild fundamental group (II)

    E-Print Network [OSTI]

    Ramis, J -P

    2007-01-01

    In [RS1], we defined q-analogues of alien derivations and stated their basic properties. In this paper, we prove the density theorem and the freeness theorem announced in loc. cit. [RS1] Ramis J.-P. and Sauloy J., 2007. The q-analogue of the wild fundamental group (I)

  9. On the antenna calibration of space radio instruments using the galactic background: General formulas

    E-Print Network [OSTI]

    California at Berkeley, University of

    and application to STEREO/WAVES, Radio Sci., 46, RS2008, doi:10.1029/2010RS004464. 1. Introduction [2] Radio apply these rela- tions to the antenna calibration of the STEREO/WAVES (S/WAVES) radio instrumentOn the antenna calibration of space radio instruments using the galactic background: General

  10. Revised Submission to PIM and PSM for SDO sdo/03-03-01 Hitachi Ltd. 1

    E-Print Network [OSTI]

    Suzuki, Jun

    Revised Submission to PIM and PSM for SDO ­ sdo/03-03-01 Hitachi Ltd. 1 Revised Submission to Telecom Domain Taskforce RFP Platform Independent Model (PIM) and Platform Specific Model (PSM) for SDO to PIM and PSM for SDO ­ sdo/03-03-01 Hitachi Ltd. 2 &RS\\ULJKW+LWDFKL/WG &RS

  11. CENTRE FOR TECHNOLOGY ALTERNATIVES FOR RURAL AREAS INDIAN INSTITUTE OF TECHNOLOGY, BOMBAY

    E-Print Network [OSTI]

    Sohoni, Milind

    , and schedules of costs our finding is that it economically viable to supply water in pipes from Pej River to the target area at the desirable livelihood norm of 200 lpcd. We estimate the investment cost of this supply system to be around Rs. 7000 per capita at 200 lpcd and Rs. 2100 per capita at 40 lpcd. Keywords Piped

  12. Chemistry & Biology Red Fluorescent Protein with Reversibly

    E-Print Network [OSTI]

    Verkhusha, Vladislav V.

    to the photoswitchable absor- bance, rsTagRFP can be used as an acceptor for a photochromic Fo¨ rster resonance energy-OFF photoswitching of the rsTagRFP acceptor. INTRODUCTION Green fluorescent protein (GFP) from Aequorea victoriaTFP0.7 (Henderson et al., 2007), green Dronpa (Ando et al., 2004) and its derivatives (Ando et al

  13. (Data Logger for Kinemetrics Altus K2) 1 November 2013

    E-Print Network [OSTI]

    Utrecht, Universiteit

    using SSH. 2. The Hardware The embedded computer in the K2L is the Raspberry pi model B with 512MB the Raspberry has no real RS232 interface neither a real time clock that keeps the time when off power. However on the Raspberry board you will find a small board (power monitor) mounted that holds a real RS232 interface

  14. Dopamine D1 Receptor Gene Variation Modulates Opioid Dependence Risk by Affecting Transition to

    E-Print Network [OSTI]

    Chandy, John A.

    Science Center, Xi'an, Shaanxi, People's Republic of China, 8 Methadone Maintenance Therapy Clinic, Xi1 rs4532 (hazard ratios (HR) = 0.694; p = 0.001) and rs686 (HR = 0.681, p = 0.0003). Binary logistic

  15. Pour servir a la numerisation des manuscrits tibetains de Dun-huang conserves a la Bibliotheque Nationale : un fichier de Jacques Bacot et autres documents

    E-Print Network [OSTI]

    Chayet, Anne

    2005-01-01

    (ML).340 - 0257(ML).341 - = Chinois 3289(ML/RS).342 - = Chinois 3088(RS).343 - 0540(ML).344 - 086(ML). 345 - 156, 0358*.346 - 124, 0413*.347 - 0555(ML).348 - 0749(ML).349 - 30(ML).350 - 0794(ML).351 - 130(4)*.352 - 130(5), + 0701(ML).353 - 079(ML).354...

  16. IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS--II: EXPRESS BRIEFS, VOL. 53, NO. 11, NOVEMBER 2006 1245 Area-Efficient VLSI Design of ReedSolomon

    E-Print Network [OSTI]

    Wu, An-Yeu "Andy"

    architecture of the RS decoder by using a novel just-in-time folding modified Euclidean algorithm (JIT-FMEA). The JIT-FMEA VLSI architecture can greatly reduce the hardware complexity by about 50% compared-in-time folding modified Euclidean algorithm (JIT-FMEA), key equation solver (KES), Reed­Solomon (RS) codec, 10

  17. Chicago 54, Ill. United State Depart~ent

    E-Print Network [OSTI]

    .Ftily contnct ...Ii th f1 hermen, shippel"sy,whole- sll ie deA18rs and buyp-rs, importers, tr small field stntions. ·J'hese emplo~, a total of flpproximf'ttel,Y- ~n chemi s ts, engineers

  18. MODELING AND CONTROL OF A CONTINUOUS BIOREACTOR WITH CROSSFLOW FILTRATION

    E-Print Network [OSTI]

    Skogestad, Sigurd

    MODELING AND CONTROL OF A CONTINUOUS BIOREACTOR WITH CROSS­FLOW FILTRATION Ying Zhao and Sigurd on an industrial application of a continuous bioreactor with cross­flow filtration. In this paper the general pHC LC X, rS L , rS Y Figure 1: A continuous bioreactor with cross­flow filtration. The operation

  19. Imaging and measuring the biophysical properties of Fc gamma receptors on single macrophages using atomic force microscopy

    SciTech Connect (OSTI)

    Li, Mi; University of Chinese Academy of Sciences, Beijing 100049 ; Liu, Lianqing; Xi, Ning; Wang, Yuechao; Xiao, Xiubin; Zhang, Weijing

    2013-09-06

    Highlights: •Nanoscale cellular ultra-structures of macrophages were observed. •The binding affinities of Fc?Rs were measured directly on macrophages. •The nanoscale distributions of Fc?Rs were mapped on macrophages. -- Abstract: Fc gamma receptors (Fc?R), widely expressed on effector cells (e.g., NK cells, macrophages), play an important role in clinical cancer immunotherapy. The binding of Fc?Rs to the Fc portions of antibodies that are attached to the target cells can activate the antibody-dependent cell-mediated cytotoxicity (ADCC) killing mechanism which leads to the lysis of target cells. In this work, we used atomic force microscopy (AFM) to observe the cellular ultra-structures and measure the biophysical properties (affinity and distribution) of Fc?Rs on single macrophages in aqueous environments. AFM imaging was used to obtain the topographies of macrophages, revealing the nanoscale cellular fine structures. For molecular interaction recognition, antibody molecules were attached onto AFM tips via a heterobifunctional polyethylene glycol (PEG) crosslinker. With AFM single-molecule force spectroscopy, the binding affinities of Fc?Rs were quantitatively measured on single macrophages. Adhesion force mapping method was used to localize the Fc?Rs, revealing the nanoscale distribution of Fc?Rs on local areas of macrophages. The experimental results can improve our understanding of Fc?Rs on macrophages; the established approach will facilitate further research on physiological activities involved in antibody-based immunotherapy.

  20. Physicochemical Characterization of the Bacterial Cu(I) Sensor CsoR 

    E-Print Network [OSTI]

    Ma, Zhen

    2011-02-22

    from the pathogenic S. aureus Newman strain was identified and characterized, and was found to exhibit biochemical properties similar to those of Mtb and Bsu CsoRs. Parallels between Cu(I)-sensing CsoRs and functional orthologs in the CsoR/RcnR family...

  1. This content has been downloaded from IOPscience. Please scroll down to see the full text. Download details

    E-Print Network [OSTI]

    Barbosa, Marcia C. B.

    , Caixa Postal 15051, CEP 91501-970, Porto Alegre, RS, Brazil Alexei Kornyshev Imperial College London Federal do Rio Grande do Sul, Caixa Postal 15051, CEP 91501-970, Porto Alegre, RS, Brazil In spite of its in a colloidal suspension or a dusty plasma. Neither can one simply predict the direction of the electrophoretic

  2. 359-06/RDS/ Fusion Nuclear Science Facility and Program

    E-Print Network [OSTI]

    359-06/RDS/ rs Fusion Nuclear Science Facility and Program by R.D. Stambaugh Fusion Power, DC #12;359-06/RDS/ rs Mission of a Fusion Nuclear Science Facility (FNSF) Two Candidates: FNSF That Must Be Filled Between ITER and a DEMO * A Fusion Nuclear Science Program and Facility Fills Nearly All

  3. GREENHOUSE GAS EMISSIONS CONTROL BY OXYGEN FIRING IN CIRCULATING FLUIDIZED BED BOILERS: PHASE II--PILOT SCALE TESTING AND UPDATED PERFORMANCE AND ECONOMICS FOR OXYGEN FIRED CFB WITH CO2 CAPTURE

    SciTech Connect (OSTI)

    Nsakala ya Nsakala; Gregory N. Liljedahl; David G. Turek

    2004-10-27

    Because fossil fuel fired power plants are among the largest and most concentrated producers of CO{sub 2} emissions, recovery and sequestration of CO{sub 2} from the flue gas of such plants has been identified as one of the primary means for reducing anthropogenic CO{sub 2} emissions. In this Phase II study, ALSTOM Power Inc. (ALSTOM) has investigated one promising near-term coal fired power plant configuration designed to capture CO{sub 2} from effluent gas streams for sequestration. Burning fossil fuels in mixtures of oxygen and recirculated flue gas (made principally of CO{sub 2}) essentially eliminates the presence of atmospheric nitrogen in the flue gas. The resulting flue gas is comprised primarily of CO{sub 2}, along with some moisture, nitrogen, oxygen, and trace gases like SO{sub 2} and NO{sub x}. Oxygen firing in utility scale Pulverized Coal (PC) fired boilers has been shown to be a more economical method for CO{sub 2} capture than amine scrubbing (Bozzuto, et al., 2001). Additionally, oxygen firing in Circulating Fluid Bed Boilers (CFB's) can be more economical than in PC or Stoker firing, because recirculated gas flow can be reduced significantly. Oxygen-fired PC and Stoker units require large quantities of recirculated flue gas to maintain acceptable furnace temperatures. Oxygen-fired CFB units, on the other hand, can accomplish this by additional cooling of recirculated solids. The reduced recirculated gas flow with CFB plants results in significant Boiler Island cost savings resulting from reduced component The overall objective of the Phase II workscope, which is the subject of this report, is to generate a refined technical and economic evaluation of the Oxygen fired CFB case (Case-2 from Phase I) utilizing the information learned from pilot-scale testing of this concept. The objective of the pilot-scale testing was to generate detailed technical data needed to establish advanced CFB design requirements and performance when firing coals and delayed petroleum coke in O{sub 2}/CO{sub 2} mixtures. Firing rates in the pilot test facility ranged from 2.2 to 7.9 MM-Btu/hr. Pilot-scale testing was performed at ALSTOM's Multi-use Test Facility (MTF), located in Windsor, Connecticut.

  4. URBAN WOOD/COAL CO-FIRING IN THE NIOSH BOILER PLANT

    SciTech Connect (OSTI)

    James T. Cobb Jr.

    2005-02-10

    Phase I of this project began by obtaining R&D variances for permits at the NIOSH boilerplant (NBP), Emery Tree Service (ETS) and the J. A. Rutter Company (JARC) for their portions of the project. Wood for the test burn was obtained from the JARC inventory (pallets), Thompson Properties and Seven D Corporation (construction wood), and the Arlington Heights Housing Project (demolition wood). The wood was ground at ETS and JARC, delivered to the Three Rivers Terminal and blended with coal. Three one-day tests using wood/coal blends of 33% wood by volume (both construction wood and demolition wood) were conducted at the NBP. Blends using hammermilled wood were operationally successful. Emissions of SO{sub 2} and NOx decreased and that of CO increased when compared with combusting coal alone. Mercury emissions were measured and evaluated. During the first year of Phase II the principal work focused upon searching for a replacement boilerplant and developing a commercial supply of demolition wood. The NBP withdrew from the project and a search began for another stoker boilerplant in Pennsylvania to replace it on the project. Three potential commercial demolition wood providers were contacted. Two were not be able to supply wood. At the end of the first year of Phase II, discussions were continuing with the third one, a commercial demolition wood provider from northern New Jersey. During the two-and-a-third years of the contract extension it was determined that the demolition wood from northern New Jersey was impractical for use in Pittsburgh, in another power plant in central New Jersey, and in a new wood gasifier being planned in Philadelphia. However, the project team did identify sufficient wood from other sources for the gasifier project. The Principal Investigator of this project assisted a feasibility study of wood gasification in Clarion County, Pennsylvania. As a result of the study, an independent power producer in the county has initiated a small wood gasification project at its site. Throughout much of this total project the Principal Investigator has counseled two small businesses in developing a waxed cardboard pellet business. A recent test burn of this biofuel appears successful and a purchase contract is anticipated soon. During the past two months a major tree-trimming firm has shown an active interest in entering the wood-chip fuel market in the Pittsburgh area and has contacted the NBP, among others, as potential customers. The NBP superintendent is currently in discussion with the facilities management of the Bruceton Research Center about resuming their interest in cofiring this renewable fuel to the stoker there.

  5. CONTINUED DEVELOPMENT OF THE ROTARY COMBUSTOR FOR REFIRING PULVERIZED COAL BOILERS

    SciTech Connect (OSTI)

    Murray F. Abbott; Jamal B. Mereb; Simon P. Hanson; Michael J. Virr

    2000-11-01

    The Rotary Combustor is a novel concept for burning coal with low SO{sub 2} and NO{sub x} emissions. It burns crushed coal in a fluid bed where the bed is maintained in a rotating drum by centripetal force. Since this force may be varied, the combustor may be very compact, and thus be a direct replacement for a p.c. burner on existing boilers. The primary objective of this project is to demonstrate that a typical industrial boiler can be refired with the modified prototype Rotary Combustor to burn Ohio high-sulfur coal with low emissions of SO{sub 2} and NO{sub x}. The primary problem that must be resolved to demonstrate sustained operations with coal is temperature control in the rotating fluid bed. The prototype Rotary Combustor was assembled and installed on the T-850P CNB boiler at the CONSOL Energy site in South Park, Pennsylvania. Several design improvements were investigated and implemented during the assembly to improve the prototype Rotary Combustor operations compared to prior tests at Detroit Stoker in Monroe, Michigan. An Operating Manual and Safety Review were completed. The shakedown test phase was initiated. Two major problems were initially encountered: binding of the rotating drum at operating temperatures, and reduced fluid-bed pressure drop after short periods of operation. Plating the brush seal rotary land ring with a chrome carbide plasma spray and lubricating the seal prior to each test sufficiently resolved these problems to permit a limited number of operations tests. Unlike previous tests at Detroit Stoker, sustained operation of the prototype Rotary Combustor was accomplished burning a high-Btu fuel, metallurgical coke. The prototype Rotary Combustor was operated with coke in gasifier mode on two occasions. Fluid-bed temperature spiking was minimized with manual control of the feeds (coke, air and steam), and no clinker formation problems were encountered in either test. Emission levels of NO{sub x} were measured at about 270 ppmv which were higher those targeted for the device which were 100 ppmv. This was assumed to be because of the aforementioned temperature spiking. The primary operating problem remains control of the fluid-bed temperature. Although improvements were made, steam flow control was manual, and very coarse. To accomplish this will require finer control of the steam flow to the rotary drum air plenum, and development of an algorithm for automatic control using the Moore APACS{trademark}. This is the recommended succeeding step in the development of the Rotary Combustor for industrial or utility use.

  6. Inclusive ?(2P) production in ?(3S) decay

    E-Print Network [OSTI]

    Baringer, Philip S.

    1991-09-23

    . Lewis, G. S. Ludwig, J. Masui, J. Mevissen, N. B. Mistry, S. Nandi, C. R. Ng, E. Nordberg, C. O' Grady, " J. R. Patterson, D. Peterson, M. Pisharody, D. Riley, M. Sapper, M. Selen, H. Worden, M. Norris, P. Avery, A. Freyberger, J. Rodriguez, J. Yelton, K....o( 1.17 0.73 1.04 0.90 1.12 0.86 1.08 0.80 1.14 0.85 tion, and b as the tensor contribution, the masses are given by [9] M(gq) =M+a ——', b, M(gl) =M —a+2b, and M(go) =M —2a 4b—He. re a and b are computed as the configuration-space expectation values: &v...

  7. Complexity of Groundwater Contaminants at DOE Sites

    SciTech Connect (OSTI)

    Hazen, T.C.; Faybishenko, B.; Jordan, P.

    2010-12-03

    The U.S. Department of Energy (DOE) is responsible for the remediation and long-term stewardship of one of the world's largest groundwater contamination portfolios, with a significant number of plumes containing various contaminants, and considerable total mass and activity. As of 1999, the DOE's Office of Environmental Management was responsible for remediation, waste management, or nuclear materials and facility stabilization at 144 sites in 31 states and one U.S. territory, out of which 109 sites were expected to require long-term stewardship. Currently, 19 DOE sites are on the National Priority List. The total number of contaminated plumes on DOE lands is estimated to be 10,000. However, a significant number of DOE sites have not yet been fully characterized. The most prevalent contaminated media are groundwater and soil, although contaminated sediment, sludge, and surface water also are present. Groundwater, soil, and sediment contamination are present at 72% of all DOE sites. A proper characterization of the contaminant inventory at DOE sites is critical for accomplishing one of the primary DOE missions -- planning basic research to understand the complex physical, chemical, and biological properties of contaminated sites. Note that the definitions of the terms 'site' and 'facility' may differ from one publication to another. In this report, the terms 'site,' 'facility' or 'installation' are used to identify a contiguous land area within the borders of a property, which may contain more than one plume. The term 'plume' is used here to indicate an individual area of contamination, which can be small or large. Even though several publications and databases contain information on groundwater contamination and remediation technologies, no statistical analyses of the contaminant inventory at DOE sites has been prepared since the 1992 report by Riley and Zachara. The DOE Groundwater Data Base (GWD) presents data as of 2003 for 221 groundwater plumes at 60 DOE sites and facilities. Note that Riley and Zachara analyzed the data from only 18 sites/facilities including 91 plumes. In this paper, we present the results of statistical analyses of the data in the GWD as guidance for planning future basic and applied research of groundwater contaminants within the DOE complex. Our analyses include the evaluation of a frequency and ranking of specific contaminants and contaminant groups, contaminant concentrations/activities and total contaminant masses and activities. We also compared the results from analyses of the GWD with those from the 1992 report by Riley and Zachara. The difference between our results and those summarized in the 1992 report by Riley and Zachara could be caused by not only additional releases, but also by the use of modern site characterization methods, which more accurately reveal the extent of groundwater contamination. Contaminated sites within the DOE complex are located in all major geographic regions of the United States, with highly variable geologic, hydrogeologic, soil, and climatic conditions. We assume that the information from the 60 DOE sites included in the GWD are representative for the whole DOE complex. These 60 sites include the major DOE sites and facilities, such as Rocky Flats Environmental Technology Site, Colorado; Idaho National Laboratory, Idaho; Savannah River Site, South Carolina; Oak Ridge Reservation, Tennessee; and Hanford Reservation, Washington. These five sites alone ccount for 71% of the value of the remediation work.

  8. Toward Understanding Phosphoseryl-tRNA Cys Formation: The Crystal Structure of Methanococcus maripaludis Phosphoseryl-tRNA Synthetase

    SciTech Connect (OSTI)

    Kamtekar ,S.; Hohn, M.; Park, h.; Schnitzbauer, M.; Sauerwald, A.; Soll, D.; Steitz, T.

    2007-01-01

    A number of archaeal organisms generate Cys-tRNA{sup Cys} in a two-step pathway, first charging phosphoserine (Sep) onto tRNA{sup Cys} and subsequently converting it to Cys-tRNA{sup Cys}. We have determined, at 3.2-{angstrom} resolution, the structure of the Methanococcus maripaludis phosphoseryl-tRNA synthetase (SepRS), which catalyzes the first step of this pathway. The structure shows that SepRS is a class II, {alpha}{sub 4} synthetase whose quaternary structure arrangement of subunits closely resembles that of the heterotetrameric ({alpha}{beta}){sub 2} phenylalanyl-tRNA synthetase (PheRS). Homology modeling of a tRNA complex indicates that, in contrast to PheRS, a single monomer in the SepRS tetramer may recognize both the acceptor terminus and anticodon of a tRNA substrate. Using a complex with tungstate as a marker for the position of the phosphate moiety of Sep, we suggest that SepRS and PheRS bind their respective amino acid substrates in dissimilar orientations by using different residues.

  9. $WW?/Z$ production in the Randall-Sundrum model at LHC and CLIC

    E-Print Network [OSTI]

    Li Xiao-Zhou; Ma Wen-Gan; Zhang Ren-You; Guo Lei

    2013-03-26

    We study the $W^+W^-\\gamma(Z)$ productions at both the CERN Large Hadron Collider (LHC) and the Compact Linear Collider (CLIC) in the framework of the Randall-Sundrum (RS) model. The impacts of the virtual RS Kaluza-Klein (KK) graviton on these processes are studied and compared with the standard model (SM) background. We present the integrated and differential cross sections in both the RS model and the SM. The results show that the relative RS discrepancies at the CLIC differ from those at the LHC, particularly in the transverse momentum and rapidity distributions. We also find that the RS signature performance, as a result of the resonance character of the RS KK-graviton spectrum, is distinctively unlike that in the large extra dimensions model. We conclude that the CLIC with unprecedented precision and high center-of-mass energy has a potential advantage over the LHC in exploring the effects of the RS KK graviton on the $W^+W^-\\gamma(Z)$ production processes.

  10. Process development for production of coal/sorbent agglomerates

    SciTech Connect (OSTI)

    Rapp, D.M.

    1991-01-01

    The goal of this work was to develop a process flow diagram to economically produce a clean-burning fuel from fine Illinois coal. To accomplish this, the process of pelletizing fine coal with calcium hydroxide, a sulfur capturing sorbent, was investigated. Carbonation, which is the reaction of calcium hydroxide with carbon dioxide (in the presence of moisture) to produce a bonding matrix of calcium carbonate, was investigated as a method for improving pellet quality and reducing binder costs. Proper moisture level is critical to allow the reaction to occur. If too much moisture is present in a pellet, the pore spaces are filled and carbon dioxide must diffuse through the water to reach the calcium hydroxide and react. This severely slows or stops the reaction. The ideal situation is when there is just enough moisture to coat the calcium hydroxide allowing for the reaction to proceed. The process has been successfully demonstrated on a pilot-scale as a method of hardening iron ore pellets (Imperato, 1966). Two potential combustion options are being considered for the coal/calcium hydroxide pellets: fluidized bed combustors and industrial stoker boilers.

  11. Process development for production of coal/sorbent agglomerates

    SciTech Connect (OSTI)

    Rapp, D.M.; Lytle, J.M.; Hackley, K.C.; Moran, D.L.; Becvar, S. (Illinois State Geological Survey, Champaign, IL (United States)); Berger, R.L. (Illinois Univ., Urbana, IL (United States)); Griggs, K. (Army Construction Engineering Research Lab., Champaign, IL (United States))

    1991-01-01

    The objective of this work is to pelletize these fines with a sulfur capturing sorbent such as calcium hydroxide to produce a fuel which will meet future sulfur dioxide emission levels. To decrease binder costs, carbonation, which is the reaction of calcium hydroxide with carbon dioxide in the presence of moisture to produce calcium carbonate, is being investigated as a method for improving pellet quality. The calcium carbonate formed acts as a cementitious matrix which improves pellet strength. Two potential combustion options are being considered -- fluidized bed combustors and industrial stoker boilers. During this quarter a pellet characterization test program was conducted using a fine coal (-28 mesh) concentrate collected from a southern Illinois preparation plant. Results indicate that carbonation produces significant improvements in compressive strength, impact and attrition resistance and weatherability. Also, 20 combustion tests were conducted on pellets formed with 0, 5 and 10% levels of calcium hydroxide (10% calcium hydroxide is a 2.3:1 Ca/S ratio for this sample). Tests were conducted at 850 and 1350 {degrees}C. Chemical analyses of the combustion residues are not yet complete so results will be reported next quarter. 8 refs., 7 tabs.

  12. Process development for production of coal/sorbent agglomerates. Final technical report, September 1, 1990--August 31, 1991

    SciTech Connect (OSTI)

    Rapp, D.M.

    1991-12-31

    The goal of this work was to develop a process flow diagram to economically produce a clean-burning fuel from fine Illinois coal. To accomplish this, the process of pelletizing fine coal with calcium hydroxide, a sulfur capturing sorbent, was investigated. Carbonation, which is the reaction of calcium hydroxide with carbon dioxide (in the presence of moisture) to produce a bonding matrix of calcium carbonate, was investigated as a method for improving pellet quality and reducing binder costs. Proper moisture level is critical to allow the reaction to occur. If too much moisture is present in a pellet, the pore spaces are filled and carbon dioxide must diffuse through the water to reach the calcium hydroxide and react. This severely slows or stops the reaction. The ideal situation is when there is just enough moisture to coat the calcium hydroxide allowing for the reaction to proceed. The process has been successfully demonstrated on a pilot-scale as a method of hardening iron ore pellets (Imperato, 1966). Two potential combustion options are being considered for the coal/calcium hydroxide pellets: fluidized bed combustors and industrial stoker boilers.

  13. Water holding capacities of fly ashes: Effect of size fractionation

    SciTech Connect (OSTI)

    Sarkar, A.; Rano, R.

    2007-07-01

    Water holding capacities of fly ashes from different thermal power plants in Eastern India have been compared. Moreover, the effect of size fractionation (sieving) on the water holding capacities has also been determined. The desorption rate of water held by the fly ash fractions at ambient temperature (25-30{sup o}C) has been investigated. The effect of mixing various size fractions of fly ash in increasing the water holding capacities of fly ash has been studied. It is observed that the fly ash obtained from a thermal power plant working on stoker-fired combustor has the highest water holding capacity, followed by the one that works on pulverized fuel combustor. Fly ash collected from super thermal power plant has the least water holding capacity (40.7%). The coarser size fractions of fly ashes in general have higher water holding capacities than the finer ones. An attempt has been made to correlate the results obtained, with the potential use in agriculture.

  14. FEASIBILITY ANALYSIS FOR INSTALLING A CIRCULATING FLUIDIZED BED BOILER FOR COFIRING MULTIPLE BIOFUELS AND OTHER WASTES WITH COAL AT PENN STATE UNIVERSITY

    SciTech Connect (OSTI)

    Bruce G. Miller; Sharon Falcone Miller; Robert Cooper; Douglas Donovan; John Gaudlip; Matthew Lapinsky; William Serencsits; Neil Raskin; Dale Lamke; Joseph J. Battista

    2001-03-31

    The Pennsylvania State University, under contract to the U.S. Department of Energy (DOE), National Energy Technology Laboratory (NETL) is performing a feasibility analysis on installing a state-of-the-art circulating fluidized bed (CFB) boiler and ceramic filter emission control device at Penn State's University Park campus for cofiring multiple biofuels and other wastes with coal, and developing a test program to evaluate cofiring multiple biofuels and coal-based feedstocks. Penn State currently operates an aging stoker-fired steam plant at its University Park campus and has spent considerable resources over the last ten to fifteen years investigating boiler replacements and performing life extension studies. This effort, in combination with a variety of agricultural and other wastes generated at the agricultural-based university and the surrounding rural community, has led Penn State to assemble a team of fluidized bed and cofiring experts to assess the feasibility of installing a CFB boiler for cofiring biomass and other wastes along with coal-based fuels. The objective of the project is being accomplished using a team that includes personnel from Penn State's Energy Institute and the Office of Physical Plant, Foster Wheeler Energy Services, Inc., and Cofiring Alternatives.

  15. Progress at the interface of wave-function and density-functional theories

    SciTech Connect (OSTI)

    Gidopoulos, Nikitas I.

    2011-04-15

    The Kohn-Sham (KS) potential of density-functional theory (DFT) emerges as the minimizing effective potential in a variational scheme that does not involve fixing the unknown single-electron density. Using Rayleigh Schroedinger (RS) perturbation theory (PT), we construct ab initio approximations for the energy difference, the minimization of which determines the KS potential directly - thereby bypassing DFT's traditional algorithm to search for the density that minimizes the total energy. From second-order RS PT, we obtain variationally stable energy differences to be minimized, solving the severe problem of variational collapse of orbital-dependent exchange-correlation functionals based on second-order RS PT.

  16. Siva Siva Siva Ragam: Panthuvarali

    E-Print Network [OSTI]

    Kalyanaraman, Shivkumar

    ] ; dm ; D S , n R S | ; s r , S , | s n D N S || Paa ma ra tvamu Neda baa si (Ati) ; dm ; D S , n R S | ; s r , S , | s n D N ns || Paa ma ra tvamu Neda baa si (Ati) rs n- d M-D S , n gr rs | ; s r , S , | s n D N ns || Paa ma ra tvamu Neda baa si (Ati) rs n- s , s S s n D ; d r | s n D P M | mdpm gr- gm

  17. Where the Runners Went: British Motivations Behind Postal Policy and Allocation in Colonial India

    E-Print Network [OSTI]

    Bharat, Sheetal

    2012-01-01

    1887 to 1916 Source: Clarke 1921, 197 # POSB Accounts rupeesper account Rs/POSB account number of postal savings bank1954. Story of the Indian Post Office. Nasik: Security

  18. High Speed Rail in Japan: A Review and Evaluation of the Shinkansen Train

    E-Print Network [OSTI]

    Taniguchi, Mamoru

    1992-01-01

    ~High Speed R~l $~r~s High Speed Rail in Japan: A Review andorregulation. High Speed Rail in Japan: A Review andCA94720 CALIFORNIA HIGH SPEED RAIL SERIES Working Paper

  19. October 2011 Principal I

    E-Print Network [OSTI]

    Jia, Songtao

    Mornings October 2011 PROH By signing be placed personne Flammabl ethanol, i He or she including of this f ection Codes rs to prevent ssor motor of od laboratory ces) since the reased. so

  20. The Complex and Multi-Faceted Nature of School Construction Costs: Factors Affecting California. A Report to the American Institute of Architects California Council

    E-Print Network [OSTI]

    Vincent, Jeffrey M; McKoy, Deborah

    2008-01-01

    using the RS Means Construction Cost Index. Exhibit 8 belowIndex, a national construction cost index that factors laborconstruction costs was measured with the School Construction Regulation Index (

  1. Computing Roadmaps of Semi-algebraic Sets (Extended Abstract) 1 ...

    E-Print Network [OSTI]

    2015-12-01

    called the roadmap for the pair (S; M): R(S; M) is a semi-algebraic set of ... bounded by dO(k2): The roadmap allows us to decide whether two points in the set M ...

  2. Computing Roadmaps of Semi-algebraic Sets on a Variety

    E-Print Network [OSTI]

    2015-12-06

    Given a roadmap R(S) and a point p 2 S the connecting subroutine outputs ... a roadmap for a semi-algebraic set whose complexity is sk(logs)dO(k4). : Since the.

  3. Complexity of Computing Semi-algebraic Descriptions of the ...

    E-Print Network [OSTI]

    2015-11-30

    A roadmap 7] of S is a semi-algebraic set R(S). S. which has dimension at most one and satis es;. RM1 For every semi-algebraically connected component C.

  4. Residential and Transport Energy Use in India: Past Trend and Future Outlook

    E-Print Network [OSTI]

    de la Rue du Can, Stephane

    2009-01-01

    electricity kerosene LPG wood TRANSPORT electricity dieselelectricity kerosene LPG wood TRANSPORT electricity dieselthe ab ov 25 e Rs Electricity LPG see above a b 19 ov 2 5 e

  5. MIS301H Introduction to Information Technology Spring 20134

    E-Print Network [OSTI]

    Ghosh, Joydeep

    , 04105 and 04110 Class room: CBA 4.348 Professo rs Dr. Ashish Agarwal (04105, 04110) Dr. Prabhudev Konana (04100) Offic e CBA 5.234 CBA 5.218 E-mail Ashish.Agarwal@mccombs.utexas.edu Prabhudev

  6. The role of the Balanced Scorecard for improvement of management systems in Japanese companies

    E-Print Network [OSTI]

    Abe, Taiji

    2006-01-01

    The concept of the Balanced Scorecard (BSC) was first developed by R.S. Kaplan and D.P. Norton in 1992 and since that time has been implemented in thousands of organizations worldwide. While many tools that were proposed ...

  7. Does D matter? The role of vitamin D in hair disorders and hair follicle cycling

    E-Print Network [OSTI]

    Amor, Karrie T; Rashid, Rashid M; Mirmirani, Paradi

    2010-01-01

    3. Judd SE, Tangpricha V. Vitamin D deficiency and risk forR, Kim N, Kirsner RS. Vitamin D intake and melanoma risk. JPubMed ] 5. Tuohimaa P. Vitamin D and aging. J Steroid

  8. The COMT Val/Met polymorphism is associated with reading-related skills and consistent patterns of functional neural

    E-Print Network [OSTI]

    PAPER The COMT Val/Met polymorphism is associated with reading- related skills and consistent. In particular, we found that the COMT Val/Met polymorphism at rs4680, which results in the substitution

  9. The Relationship Between Eating Disorders and Socioeconomic Status: It's Not What You Think

    E-Print Network [OSTI]

    Gibbons, Pat

    2001-01-01

    20(1):1-12. Foster, D. Anorexia Nervosa and Bulimia Nervosa.RS. How common is anorexia nervosa? A prevalence study.epidemiology of anorexia nervosa. Psychological Medicine,

  10. Consistent cloud computing storage as the basis for distributed applications

    E-Print Network [OSTI]

    Anderson, James William

    2011-01-01

    availability and lower critical—path latency. Sinfonia [21]adds latency to the critical path of RS1\\/I oper- ations,additional latency for the critical path of operations and

  11. Microsoft PowerPoint - APS_2007.ppt

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TFTR RS to ERS comparison Summary and conclusions * The new CXRS wide-view poloidal periscope was installed on C-Mod. Along with the existing toroidal system it allows to make...

  12. Transition Events Timeline Activity / Event

    E-Print Network [OSTI]

    Mojzsis, Stephen J.

    /RS Checkout 2 October 31, 2014 LPW Ping Test November 3, 2014 MAG Roll November 4, 2014 NGIMS Checkout 3 November 5, 2014 Electra Mars Science Laboratory (MSL) Relay Pass November 6, 2014 Orbit Trim Maneuver 0

  13. Dose characterization of the rad source 2400 x-ray irradiator 

    E-Print Network [OSTI]

    Wagner, Jennifer Ann Koop

    2009-05-15

    APPENDIX C ........................................................................................................... 48 APPENDIX D ........................................................................................................... 49 VITA... chamber in RS 2400 exposure chamber ................. 20 Figure 7 Aluminum wire support in cardboard canister .................................. 21 Figure 8 Exposure rate along length of x-ray tube .......................................... 24...

  14. THE JOURNAL OF PHILOSOPHY VOLUME LXXXVI, NO. 6, JUNE 1989

    E-Print Network [OSTI]

    Fitelson, Branden

    THE JOURNAL OF PHILOSOPHY VOLUME LXXXVI, NO. 6, JUNE 1989/8606/281-297 © 1989 The Journal of Philosophy, Inc. 281 #12;282 THE JOURNAL OF PHILOSOPHY "Rs." Or perhaps "R

  15. Crystal Structure and Functional Analysis Identify Evolutionary...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    synthetases (aaRS) have been essential enzymes for protein synthesis throughout evolution. As the tree of life was ascended, tRNA synthetases added new domains, which are...

  16. Metabolic effects of 5?-reductase inhibition in humans 

    E-Print Network [OSTI]

    Upreti, Rita

    2013-07-06

    5?-reductases (5?Rs) catalyse reduction of 4-pregnene steroids, most notably the androgen testosterone to its more potent metabolite dihydrotestosterone (DHT). Well-characterised isozymes of 5?R are designated 5?R1 and ...

  17. Eliminating Electricity Deficit through Energy Efficiency in India: An Evaluation of Aggregate Economic and Carbon Benefits

    E-Print Network [OSTI]

    Sathaye, Jayant

    2010-01-01

    data for thermal and hydro power plants are based on CEA’smillion) per MW while small hydro power plants cost Rs 5.50comes from thermal and hydro power plants. We assume that

  18. Europhysics Letters PREPRINT Multivalent ion driven condensation of DNA-actin

    E-Print Network [OSTI]

    -159, Iran 4 Department of Applied Mathematics, University of Leeds, Leeds LS2 9JT, UK PACS. 82.35.Rs angle x-ray scattering (SAXS) and laser-scanning confocal microscopy, we find that the system undergoes

  19. Adsorption of symmetric random copolymer onto symmetric random surface: the annealed case

    E-Print Network [OSTI]

    A. A. Polotsky

    2015-06-12

    Adsorption of a symmetric (AB) random copolymer (RC) onto a symmetric (ab) random heterogeneous surface (RS) is studied in the annealed approximation by using a two-dimensional partially directed walk model of the polymer. We show that in the symmetric case, the expected a posteriori compositions of the RC and the RS have correct values (corresponding to their a priori probabilities) and do not change with the temperature, whereas second moments of monomers and sites distributions in the RC and RS change. This indicates that monomers and sites do not interconvert but only rearrange in order to provide better matching between them and, as a result, a stronger adsorption of the RC on the RS. However, any violation of the system symmetry shifts equilibrium towards the major component and/or more favorable contacts and leads to interconversion of monomers and sites.

  20. Top-down modification of bottom-up processes: selective grazing reduces macroalgal nitrogen uptake

    E-Print Network [OSTI]

    Bracken, MES; Stachowicz, J J

    2007-01-01

    flow and clear plastic tops to maximize light penetration.RC, Kohrs DG, Alberte RS (1996) Top-down im- pact through aSer Published January 25 Top-down modification of bottom-up

  1. Reflective Terahertz Imaging for early diagnosis of skin burn severity

    E-Print Network [OSTI]

    TEWARI, PRIYAMVADA

    2013-01-01

    Bennett, N. Bajwa, K.S. Barnett, R.S. Singh, M.O. Culjat, A.JL Bourgeois, Dr Kelly S Barnett, Dr JS Sayre and Dr Ioanna

  2. 'Decision support system (DSS) for prevention of cardiovascular disease (CVD) among hypertensive (HTN) patients in Andhra Pradesh, India' - a cluster randomised community intervention trial

    E-Print Network [OSTI]

    Anchala, Raghupathy; Pant, Hira; Prabhakaran, Dorairaj; Franco, Oscar H.

    2012-05-31

    , 365:217–223. 7. Thankappan KR, Sivasankaran S, Khader SA, Sarma PS, Mini GK, Vasan RS: Prevalence, correlates, awareness, treatment and control of hypertension in Kumarakom, Kerala: baseline results of a community-based intervention program. Indian...

  3. ZBORNIK RADOVA 601 Shokin Yu. I.2

    E-Print Network [OSTI]

    .diplomacy.bg.ac.rs 74.0 422.7 123 6 12 Electrical Engineering Institute "Nikola Tesla" www.ieent.org 34.0 464.3 131 11

  4. HUD PowerSaver Pilot Loan Program

    E-Print Network [OSTI]

    Zimring, Mark

    2011-01-01

    comments should be submitted to HUD by December 27, 2010 at:December 10, 2010 HUD P owe rS a ve r P ilo t Lo a n P ro gand Urban Development (HUD) recently announced the creation

  5. Prospects and alterna.ves for development of US stellarator program

    E-Print Network [OSTI]

    equilibrium and stability -Energy, par^cle, and impurity transport -Alpha par.1-0.4% (reduced neoclassical xport) Quasi-axisymmetry (RS tokamak) Compact system size 5 W% Helical ripple 1% (reduced neoclassical xport) Isodynamic (Shafranov shiq ~ 0

  6. EngOpt 2008 -International Conference on Engineering Optimization Rio de Janeiro, Brazil, 01 -05 June 2008.

    E-Print Network [OSTI]

    Grossmann, Ignacio E.

    EngOpt 2008 - International Conference on Engineering Optimization Rio de Janeiro, Brazil, 01 - 05 Luiz Englert, s/n CEP: 90040-040 - Porto Alegre - RS - BRAZIL E-mail: arge@enq.ufrgs.br 1. Abstract

  7. [1978] Desingularization of two-dimensional schemes.pdf

    E-Print Network [OSTI]

    2011-01-23

    e.g. [18, pages 318-319]), so 2 itself is ample [EGA. III, (4.7.1)] ...... is given in [RS, pages 264-268]. (N.B. The ...... 1965), 17-22, Inst. Jorge Juan, Madrid, 1966.

  8. Engineering Professional Development www.engineering.uiowa.edu/epd

    E-Print Network [OSTI]

    Stanier, Charlie

    Holland & Hart Hormel Foods HR Green Idx Innomatix LLC Innovative Software Engineering Iowa City VA Health Care Site PRVN Consultants R.S. Stover Company Radiology Protocols Ready Wireless RFA Engineering

  9. Deriving cloud velocity from an array of solar radiation measurements

    E-Print Network [OSTI]

    Bosch, J.L.; Zheng, Y.; Kleissl, J.

    2013-01-01

    forecasts in the US. Solar Energy 84, 2161–2172. Velden,a total sky imager at the UCSan Diego solar energy testbed.Solar Energy 85, 2881–2893. Durre, I. , Vose, R.S. , Wuertz,

  10. ANNEXURE-1 PRE-QUALIFICATION DOCUMENT CORRIGENDUM

    E-Print Network [OSTI]

    Udgaonkar, Jayant B.

    & Commissioning of 11 KV UG cable and allied civil works from BESCOM Substation to ICTS project site at Survey No, Subedarpalya, Malleshwaram, Bengaluru - 560 012. Cost of the document (non-refundable) shall be Rs. 3000

  11. Das Potsdamer Universittsmagazin Sommer an der Uni

    E-Print Network [OSTI]

    Baer, Christian

    Das Potsdamer Universitätsmagazin 3/2014 Sommer an der Uni: Leere Hörsäle? Volle Terminkalender-Gärtner 14 Kopfkino und Fantasiereisen 15 Sommer, Sonne ... Sport

  12. Direct from CDC's Environmental

    E-Print Network [OSTI]

    Direct from CDC's Environmental Health Services Branch CAPT Mark D. Miller, R.S., M.P.H. The Role control/ handwashing, solid waste disposal, vector control, general safety, sewage disposal, and adequate

  13. CDC Environmental Public Health Leadership Institute Graduate Presentations

    E-Print Network [OSTI]

    , Is the General Public Willing to Accept Non-permitted Food Businesses?--RICARDO ENCARNACION, MPH, REHS Addressing--CURT FERNANDEZ, BSC, MBA AND JIM TOPIE, RS/REHS Healthy Community Design Building Resilient Communities

  14. Multi-Year Lags between Forest Browning and Soil Respiration at High Northern Latitudes

    SciTech Connect (OSTI)

    Bond-Lamberty, Benjamin; Bunn, Andrew G.; Thomson, Allison M.

    2012-11-26

    High-latitude northern ecosystems are experiencing rapid climate changes, and represent a large potential climate feedback because of their high soil carbon densities and shifting disturbance regimes. A significant carbon flow from these ecosystems is soil respiration (RS, the flow of carbon dioxide, generated by plant roots and soil fauna, from the soil surface to atmosphere), and any change in the high-latitude carbon cycle might thus be reflected in RS observed in the field. This study used two variants of a machine-learning algorithm and least squares regression to examine how remotely-sensed canopy greenness (NDVI), climate, and other variables are coupled to annual RS based on 105 observations from 64 circumpolar sites in a global database. The addition of NDVI roughly doubled model performance, with the best-performing models explaining ~62% of observed RS variability

  15. The Biochemistry, Ultrastructure, and Subunit Assembly Mechanism of AMPA Receptors

    E-Print Network [OSTI]

    Nakagawa, Terunaga

    2010-01-01

    of the AMPA-R. In the tetramer, a pair of NTD dimer (NTD 2 )requirement for the dimer-to-tetramer transition during thethe mature AMPA-Rs are tetramers while the LBDs are dimers,

  16. UF/IFAS Nutrient Management Series: Computational Tools for Field Implementation of the Florida

    E-Print Network [OSTI]

    Ma, Lena

    of the Florida Phosphorus Index ­ Polk County Florida 1 G.W. Hurt, R.S. Mylavarapu and S.P. Boetger2 1.............................................................................................. 3 FIELD EVALUATION AND IMPLEMENTATION FOR POLK COUNTY.............................. 4 Phosphorus

  17. Chloride levels increase after 13 years of recycled water use in the Salinas Valley

    E-Print Network [OSTI]

    Platts, Belinda E; Grismer, Mark E

    2014-01-01

    Ayers RS, Westcot DW. 1985. Water Quality for Agri- culture.+ 2.4904 R² = 0.29738 Applied water Cl (meq/L) Engineering-of soil Cl on applied water Cl during study period. Grieve

  18. Fault block kinematics at a releasing stepover of the Eastern...

    Open Energy Info (EERE)

    axis rotation (tilting) in the geothermal area. Authors Pluhar, C.J.; Coe, R.S. ; Lewis, J.C.; Monastero, F.C. ; Glen and J.M.G Published Journal Earth and Planetary...

  19. Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...

    Open Energy Info (EERE)

    and Shell Solar Energy Jump to: navigation, search Name: Tss4U BV (formerly Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip:...

  20. AQUATIC PLANT CONTROL RESEARCH PROGRAM

    E-Print Network [OSTI]

    US Army Corps of Engineers

    of these organisms to environmental factors (e .g. , temperature and solar radiation). Actual field data have been; Howell, Fred G. 13a. TYPE Of REPORT I'3b. TIME COVERED 14. DATE OF REPORT (Year,Month,Dily) rs. PAGE

  1. Schistosomiasis models with density dependence and age of ...

    E-Print Network [OSTI]

    2002-04-08

    Hopefully, a simple model can be thoroughly analyzed and .... time t, and r?s? denote the rate at which infected snails of infection age s release cercariae. Then

  2. Photo: Gerard Kuster Utilization of Satellite Remote Sensing (Multi/Hyper

    E-Print Network [OSTI]

    development in developing world Main instrument: Postgraduate education and training, research, project -link surface-subsurface -fluid pathways -temporal dynamics Societal issues -heat-renewable energy Utrecht (2005-date) Fellow KNAW Research/education Hyperspectral RS Geothermal energy #12;Utilization

  3. Advanced channel coding techniques using bit-level soft information 

    E-Print Network [OSTI]

    Jiang, Jing

    2009-06-02

    ¬level soft information in the multiplicity assignment and the interpolation step, ASD can significantly outperform conventional hard decision decoding (HDD) for RS codes with a very small amount of complexity, even though the kernel of ASD is operating...

  4. ELLIPSOMETRY AFPO Group Laboratoire de physique des solides -CNRS & Universite Paris Sud-11

    E-Print Network [OSTI]

    Paris-Sud 11, Université de

    : = rp rs = tan()ei Consequences: · ellipsometry is very robust, accurate, and reproducible 1.41 0 PS 1.58 0 3 Brewster microscopy This microscopy technique allows the direct observation

  5. Water, Neighborhoods and Urban Design: Micro-Utilities and the Fifth Infrastructure

    E-Print Network [OSTI]

    Elmer, Vicki; Fraker, Harrison

    2011-01-01

    biosolids combined with food waste was a more effectivegardens for on-site food; and 8) solid waste is integratedfood and to create more local “green” employment. It also powers the three “R’s” of solid waste

  6. Inter- and Intra-Specific Correlates of Habitat and Locomotion in Snakes

    E-Print Network [OSTI]

    Gartner, Gabriel Emil Asher

    2011-01-01

    J Comp Physiol 109:147-157. Seymour, R. S. 1987. Scaling ofHerpetologica 33:1-6. Seymour, R. S. 1987. Scaling ofof life. TREE 13:105-109. Seymour, R.S. 1987. Scaling of

  7. Advanced Coding Techniques with Applications to Storage Systems 

    E-Print Network [OSTI]

    Nguyen, Phong Sy

    2012-07-16

    This dissertation considers several coding techniques based on Reed-Solomon (RS) and low-density parity-check (LDPC) codes. These two prominent families of error-correcting codes have attracted a great amount of interest ...

  8. ARTICLE IN PRESS

    E-Print Network [OSTI]

    Fractured hydrocarbon reevoi rs have beer the subject of interest in e

  9. NUCLEAR CHEMISTRY ANNUAL REPORT 1970

    E-Print Network [OSTI]

    Authors, Various

    2011-01-01

    Letters 24, 1507 (1970); Nuclear Data B4, 663 (1970). 5. R.S. Hager and E. C. Seltzer, Nuclear Data A4, 1 (1968). 6. H.J. Nijgh, and R. Van Lieshout, Nuclear Spectroscopy Tables (

  10. Impact of Ghrelin Receptor Antagonism on Nicotine and Cocaine Drug Reactivity in Rats 

    E-Print Network [OSTI]

    Clifford, Patrick Shane

    2013-05-01

    Ghrelin is a 28 amino acid peptide that interacts with ghrelin receptors (GHS-Rs) to modulate brain reinforcement circuits. Systemic ghrelin infusions augment cocaine (COC) stimulated locomotion and conditioned place preference (CPP) in rats...

  11. Rigidity Analysis for Modeling Protein Motion 

    E-Print Network [OSTI]

    Thomas, Shawna L.

    2010-07-14

    . ............................... 128 XIII Comparison of average relative exchange rate for both EX RS and EX CS between the entire protein and the experimentally defined folding core. ................................ 154 xii TABLE Page XIV Comparison between rigidityscores, cluster... exchange rates from rigidity scores and cluster scores to experimental data. ................... 131 50 Visual comparison of simulated exchange rates to experimental data. 149 51 Minimal variance thresholds (dashed lines) to cluster EX RS for Tendamistat...

  12. Phenotypic assortment in wild primate networks: implications for the dissemination of information

    E-Print Network [OSTI]

    Carter, Alecia J.; Lee, Alexander E. G.; Marshall, Harry H.; Ticó, Miquel Torrents; Cowlishaw, Guy

    2015-05-13

    re st ne igh bo ur pr ox im ity (n n) an dg ro om in g( gr oo m )a sso cia tio ns fo rf ou rp he no ty pic tra its ov er th ey ea rs 20 09 –2 01 4f or tw ot ro op so fb ab oo ns (J, L) .( n. a. re fe rs to ph en ot yp es wh ich we re no tm ea su re di...

  13. Solar system constraints on f(G) gravity models

    E-Print Network [OSTI]

    Antonio De Felice; Shinji Tsujikawa

    2009-07-10

    We discuss solar system constraints on f(G) gravity models, where f is a function of the Gauss-Bonnet term G. We focus on cosmologically viable f(G) models that can be responsible for late-time cosmic acceleration. These models generally give rise to corrections of the form epsilon*(r/rs)^p to the vacuum Schwarzschild solution, where epsilon = H^2 rs^2 solar system constraints for a wide range of model parameters.

  14. SMP SPEC CPU95 FP OSCAR 16 IBM RegattaH MGRID 10.6 8

    E-Print Network [OSTI]

    Kasahara, Hironori

    SMP OSCAR IT21 OSCAR SMP OSCAR SMP SPEC CPU95 FP OSCAR 16 IBM RegattaH MGRID 10.6 8 IBM RS is evaluated on different SMPs. For example, it gives us 10.6 times for MGRID on 16 processor IBM RegattaH, 8.5 times speedup for HYDRO2D on 8 processor IBM RS6000 604e High Node against sequential processing and 6

  15. Measurement of the amplitude ratio of $B^0 \\to D^0K^{*0}$ and $B^0 \\to \\bar{D^0}K^{*0}$ decays with a model-independent Dalitz plot analysis using $D\\to K_S^0?^+?^-$ decays

    E-Print Network [OSTI]

    A. Abdesselam; I. Adachi; K. Adamczyk; H. Aihara; S. Al Said; K. Arinstein; Y. Arita; D. M. Asner; T. Aso; V. Aulchenko; T. Aushev; R. Ayad; T. Aziz; V. Babu; I. Badhrees; S. Bahinipati; A. M. Bakich; A. Bala; Y. Ban; V. Bansal; E. Barberio; M. Barrett; W. Bartel; A. Bay; I. Bedny; P. Behera; M. Belhorn; K. Belous; V. Bhardwaj; B. Bhuyan; M. Bischofberger; S. Blyth; A. Bobrov; A. Bondar; G. Bonvicini; C. Bookwalter; A. Bozek; M. Bra\\v{c; ko; J. Brodzicka; T. E. Browder; D. \\v{Cervenkov; M. -C. Chang; P. Chang; Y. Chao; V. Chekelian; A. Chen; K. -F. Chen; P. Chen; B. G. Cheon; K. Chilikin; R. Chistov; K. Cho; V. Chobanova; S. -K. Choi; Y. Choi; D. Cinabro; J. Crnkovic; J. Dalseno; M. Danilov; S. Di Carlo; J. Dingfelder; Z. Dole\\v{z; al; Z. Drásal; A. Drutskoy; S. Dubey; D. Dutta; K. Dutta; S. Eidelman; D. Epifanov; S. Esen; H. Farhat; J. E. Fast; M. Feindt; T. Ferber; A. Frey; O. Frost; M. Fujikawa; B. G. Fulsom; V. Gaur; N. Gabyshev; S. Ganguly; A. Garmash; D. Getzkow; R. Gillard; F. Giordano; R. Glattauer; Y. M. Goh; B. Golob; M. Grosse Perdekamp; J. Grygier; O. Grzymkowska; H. Guo; J. Haba; P. Hamer; Y. L. Han; K. Hara; T. Hara; Y. Hasegawa; J. Hasenbusch; K. Hayasaka; H. Hayashii; X. H. He; M. Heck; M. Hedges; D. Heffernan; M. Heider; A. Heller; T. Higuchi; S. Himori; T. Horiguchi; Y. Horii; Y. Hoshi; K. Hoshina; W. -S. Hou; Y. B. Hsiung; M. Huschle; H. J. Hyun; Y. Igarashi; T. Iijima; M. Imamura; K. Inami; A. Ishikawa; K. Itagaki; R. Itoh; M. Iwabuchi; M. Iwasaki; Y. Iwasaki; T. Iwashita; S. Iwata; I. Jaegle; M. Jones; K. K. Joo; T. Julius; D. H. Kah; H. Kakuno; J. H. Kang; K. H. Kang; P. Kapusta; S. U. Kataoka; N. Katayama; E. Kato; Y. Kato; P. Katrenko; H. Kawai; T. Kawasaki; H. Kichimi; C. Kiesling; B. H. Kim; D. Y. Kim; H. J. Kim; J. B. Kim; J. H. Kim; K. T. Kim; M. J. Kim; S. H. Kim; S. K. Kim; Y. J. Kim; K. Kinoshita; C. Kleinwort; J. Klucar; B. R. Ko; N. Kobayashi; S. Koblitz; P. Kody\\v{s; Y. Koga; S. Korpar; R. T. Kouzes; P. Kri\\v{z; an; P. Krokovny; B. Kronenbitter; T. Kuhr; R. Kumar; T. Kumita; E. Kurihara; Y. Kuroki; A. Kuzmin; P. Kvasni\\v{ck}a; Y. -J. Kwon; Y. -T. Lai; J. S. Lange; D. H. Lee; I. S. Lee; S. -H. Lee; M. Leitgab; R. Leitner; P. Lewis; J. Li; X. Li; Y. Li; L. Li Gioi; J. Libby; A. Limosani; C. Liu; Y. Liu; Z. Q. Liu; D. Liventsev; R. Louvot; P. Lukin; J. MacNaughton; D. Matvienko; A. Matyja; S. McOnie; Y. Mikami; K. Miyabayashi; Y. Miyachi; H. Miyake; H. Miyata; Y. Miyazaki; R. Mizuk; G. B. Mohanty; S. Mohanty; D. Mohapatra; A. Moll; H. K. Moon; T. Mori; H. -G. Moser; T. Müller; N. Muramatsu; R. Mussa; T. Nagamine; Y. Nagasaka; Y. Nakahama; I. Nakamura; K. Nakamura; E. Nakano; H. Nakano; T. Nakano; M. Nakao; H. Nakayama; H. Nakazawa; T. Nanut; Z. Natkaniec; M. Nayak; E. Nedelkovska; K. Negishi; K. Neichi; C. Ng; C. Niebuhr; M. Niiyama; N. K. Nisar; S. Nishida; K. Nishimura; O. Nitoh; T. Nozaki; A. Ogawa; S. Ogawa; T. Ohshima; S. Okuno; S. L. Olsen; Y. Ono; Y. Onuki; W. Ostrowicz; C. Oswald; H. Ozaki; P. Pakhlov; G. Pakhlova; H. Palka; E. Panzenböck; C. -S. Park; C. W. Park; H. Park; H. K. Park; K. S. Park; L. S. Peak; T. K. Pedlar; T. Peng; L. Pesantez; R. Pestotnik; M. Peters; M. Petri?; L. E. Piilonen; A. Poluektov; K. Prasanth; M. Prim; K. Prothmann; C. Pulvermacher; B. Reisert; E. Ribe\\v{z; l; M. Ritter; M. Röhrken; J. Rorie; A. Rostomyan; M. Rozanska; S. Ryu; H. Sahoo; T. Saito; K. Sakai; Y. Sakai; S. Sandilya; D. Santel; L. Santelj; T. Sanuki; N. Sasao; Y. Sato; V. Savinov; O. Schneider; G. Schnell; P. Schönmeier; M. Schram; C. Schwanda; A. J. Schwartz; B. Schwenker; R. Seidl; A. Sekiya; D. Semmler; K. Senyo; O. Seon; I. Seong; M. E. Sevior; L. Shang; M. Shapkin; V. Shebalin; C. P. Shen; T. -A. Shibata; H. Shibuya; S. Shinomiya; J. -G. Shiu; B. Shwartz; A. Sibidanov; F. Simon; J. B. Singh; R. Sinha; P. Smerkol; Y. -S. Sohn; A. Sokolov; Y. Soloviev; E. Solovieva; S. Stani?; M. Stari?; M. Steder; J. Stypula; S. Sugihara; A. Sugiyama; M. Sumihama; K. Sumisawa; T. Sumiyoshi; K. Suzuki; S. Suzuki; S. Y. Suzuki; Z. Suzuki; H. Takeichi; U. Tamponi; M. Tanaka; S. Tanaka; K. Tanida; N. Taniguchi; G. Tatishvili; G. N. Taylor; Y. Teramoto; F. Thorne; I. Tikhomirov; K. Trabelsi; V. Trusov; Y. F. Tse; T. Tsuboyama; M. Uchida; T. Uchida; Y. Uchida; S. Uehara; K. Ueno; T. Uglov; Y. Unno; S. Uno; P. Urquijo; Y. Ushiroda; Y. Usov; S. E. Vahsen; C. Van Hulse; P. Vanhoefer; G. Varner; K. E. Varvell; K. Vervink; A. Vinokurova; V. Vorobyev; A. Vossen; M. N. Wagner; C. H. Wang; J. Wang; M. -Z. Wang; P. Wang; X. L. Wang; M. Watanabe; Y. Watanabe; R. Wedd; S. Wehle; E. White; J. Wiechczynski; K. M. Williams; E. Won; B. D. Yabsley; S. Yamada; H. Yamamoto; J. Yamaoka; Y. Yamashita; M. Yamauchi; S. Yashchenko; J. Yelton; Y. Yook; C. Z. Yuan; Y. Yusa; C. C. Zhang; L. M. Zhang; Z. P. Zhang; L. Zhao; V. Zhilich; V. Zhulanov; M. Ziegler; T. Zivko; A. Zupanc; N. Zwahlen; O. Zyukova; The Belle Collaboration

    2015-03-04

    We report a measurement of the amplitude ratio $r_S$ of $B^0 \\to D^0K^{*0}$ and $B^0 \\to \\bar{D^0}K^{*0}$ decays with a model-independent Dalitz plot analysis using $D\\to K_S^0\\pi^+\\pi^-$ decays. Using the full data sample of $772\\times10^6$ $B\\bar{B}$ pairs collected at the $\\Upsilon(4S)$ resonance with the Belle detector at KEKB accelerator the upper limit is $r_S < 0.87$ at the 68 % confidence level. This result is the first measurement of $r_S$ with a model-independent Dalitz analysis, and is consistent with results from other analyses. The value of $r_S$ indicates the sensitivity of the decay to $\\phi_3$ because the statistical uncertainty is proportional to $1/r_S$. The $r_S$ result is obtained from observables ($x_\\pm$, $y_\\pm$) \\begin{eqnarray} x_- &=& +0.4 ^{+1.0 +0.0}_{-0.6 -0.1} \\pm0.0 \\\\ y_- &=& -0.6 ^{+0.8 +0.1}_{-1.0 -0.0} \\pm0.1 \\\\ x_+ &=& +0.1 ^{+0.7 +0.0}_{-0.4 -0.1} \\pm0.1 \\\\ y_+ &=& +0.3 ^{+0.5 +0.0}_{-0.8 -0.1} \\pm0.1 \\\\ , \\end{eqnarray} where $x_\\pm = r_S \\cos(\\delta_S \\pm \\phi_3)$, $y_\\pm = r_S \\sin(\\delta_S \\pm \\phi_3)$ and $\\phi_3 (\\delta_S)$ are the weak (strong) phase difference between $B^0 \\to D^0K^{*0}$ and $B^0 \\to \\bar{D^0}K^{*0}$. The first uncertainty is statistical, the second is the experimental systematic and the third is the systematic due to the uncertainties on $c_i$ and $s_i$ parameters measured by CLEO.

  16. With Chest Waders, Hip Boots, Or Rain Gear R. O. Parker Jr.

    E-Print Network [OSTI]

    in addition to the boots and rain gear (fig. 1). FEET FIRST When you fall feet first into the water, airWith Chest Waders, Hip Boots, Or Rain Gear R. O. Parker Jr. Neither chest wade rs, hip boots, nor rain ge a r will cause you to drown if you don't panic . Wade rs, the m ost dreaded of the thre e, can

  17. Korinavaramu Ragam: Ramapriya

    E-Print Network [OSTI]

    Kalyanaraman, Shivkumar

    Vara Mosagumaiyya Kodandapaani 1. P ; pm gm G R || S S S ­ rs nd N || Ko ri-na- Vara Mosa gu mai- - - yya sr G R ­ gm P ­ M || P ; ; pm gr gm || Ko- - dan- - da paa- - ni - - - - - 2. pdnd pm gm G R ; pm gm dmG- gR || S S S ­ rs nd N || Ko ri-na- -- - - Vara Mosa gu mai- - - yya sr G R ­ gm N ­ D || P

  18. Real Time Visualization of Structural Response through Wireless

    E-Print Network [OSTI]

    Shinozuka, Masanobu

    #12;12 Sensor Unit & Receiver Unit Data FlowSensor Unit & Receiver Unit Data Flow 9V Battery Regulator Technical Flow Shaker Test Impact Experiment #12;7 Experimental Set UpExperimental Set Up #12;8 ADXL202EADXL MEMS Accelerometer ADXL202E MEMS Accelerometer 44"" 22-1/21/2" RS232 PortRS232 Port Battery RoomBattery

  19. Basketball - Mens - 1931-1940 - 8 

    E-Print Network [OSTI]

    Unknown

    2006-04-14

    the internship, the ROS, and the defense of the internship objectives. 1 2. FNI ORGANIZATIONAL SETTING This sRecior sRdfRs co SRseditR chR ofRduyy od(uriOucioruy scd)ec)dR uc vdRRsR urS ni ehoysl aich u ?dimudg xoe)s or chR eod?oducR scd)ec)dRl chR (do...)? tusRS scd)ec)dR eRrcRdRS or cRehrieuy RpeRyyRreRl urS miedoFyRfRy scd)ec)dR aichir chR (do)?N ,ise)ssior is oxxRdRS eoreRdrir( chR s?Reixie (do)? aich ahieh I aod.RS us u ,w ircRdr qurS eorcir)R co aod. us u x)yyFcimR Rm?yogRRDl mg doyRs urS d...

  20. WMU Power Generation Study Task 2.0 Corn Cob Co-Combustion Study

    SciTech Connect (OSTI)

    2009-09-30

    Much attention has been focused on renewable energy use in large-scale utilities and very small scale distributed energy systems. However, there is little information available regarding renewable energy options for midscale municipal utilities. The Willmar Municipal Utilities Corn Cob-Coal Co-Combustion Project was initiated to investigate opportunities available for small to midscale municipal utilities to "go green". The overall goal of the Project was to understand the current t'enewable energy research and energy efficiency projects that are or have been implemented at both larger and smaller scale and determine the applicability to midscale municipal utilities. More specific objectives for Task 2.0 of this project were to determine the technical feasibility of co-combusting com cobs with coal in the existing WMU boiler, and to identify any regulatory issues that might need to be addressed if WMU were to obtain a significant portion of its heat from such co-combustion. This report addresses the issues as laid out in the study proposal. The study investigated the feasibility of and demonstrated the technical effectiveness of co-combusting corn cobs with coal in the Willmar Municipal Utilities stoker boiler steam generation power plant. The results of the WMU Co-Combustion Project will serve as a model for other midscale utilities who wish to use corn cobs to generate renewable electrical energy. As a result of the Co-Combustion Project, the WMU plans to upgrade their stoker boiler to accept whole corn cobs as well as other types of biomass, while still allowing the fuel delivery system to use 100% coal as needed. Benefits of co-combustion will include: energy security, reduced Hg and CO2 air emissions, improved ash chemistry, potential future carbon credit sales, an immediate positive effect on the local economy, and positive attention focused on the WMU and the City of Willmar. The first step in the study was to complete a feasibility analysis. The feasibility analysis anticipated only positive results from the combustion of corn cobs with coal in the WMU power plant boiler, and therefore recommended that the project proceed. The study proceeded with a review of the existing WMU Power Plant configuration; cob fuel analyses; an application for an Air Quality Permit from the Minnesota Pollution Control Agency to conduct the co-combustion test burns; identification of and a site visit to a similar facility in Iowa; an evaluation of cob grinding machines; and agreements with a corn grower, a cob harvester, and the City of Willmar to procure, harvest, and store cobs. The WMU power plant staff constructed a temporary cob feed system whereby the cobs could be injected into the #3 Boiler firebox, at rates up to 40% of the boiler total heat input. Test burns were conducted, during which air emissions were monitored and fuel and ash samples analyzed. The results of the test burns indicated that the monitored flue gas quality improved slightly during the test burns. The WMU was able to determine that modifications to the #3 Boiler fuel feed system to accept com cobs on a permanent basis would be technically feasible and would enable the WMU to generate electricity from renewable fuels on a dispatchable basis.

  1. GREENHOUSE GAS EMISSIONS CONTROL BY OXYGEN FIRING IN CIRCULATING FLUIDIZED BED BOILERS

    SciTech Connect (OSTI)

    Nsakala ya Nsakala; Gregory N. Liljedahl

    2003-05-15

    Given that fossil fuel fired power plants are among the largest and most concentrated producers of CO{sub 2} emissions, recovery and sequestration of CO{sub 2} from the flue gas of such plants has been identified as one of the primary means for reducing anthropogenic CO{sub 2} emissions. In this study, ALSTOM Power Inc. (ALSTOM) has investigated several coal fired power plant configurations designed to capture CO{sub 2} from effluent gas streams for use or sequestration. Burning fossil fuels in mixtures of oxygen and recirculated flue gas (made principally of CO{sub 2}) essentially eliminates the presence of atmospheric nitrogen in the flue gas. The resulting flue gas is comprised primarily of CO{sub 2}. Oxygen firing in utility scale Pulverized Coal (PC) fired boilers has been shown to be a more economical method for CO{sub 2} capture than amine scrubbing (Bozzuto, et al., 2001). Additionally, oxygen firing in Circulating Fluid Bed Boilers (CFB's) can be more economical than in PC or Stoker firing, because recirculated gas flow can be reduced significantly. Oxygen-fired PC and Stoker units require large quantities of recirculated flue gas to maintain acceptable furnace temperatures. Oxygen-fired CFB units, on the other hand, can accomplish this by additional cooling of recirculated solids. The reduced recirculated gas flow with CFB units results in significant Boiler Island cost savings. Additionally, ALSTOM has identified several advanced/novel plant configurations, which improve the efficiency and cost of the CO{sub 2} product cleanup and compression process. These advanced/novel concepts require long development efforts. An economic analysis indicates that the proposed oxygen-firing technology in circulating fluidized boilers could be developed and deployed economically in the near future in enhanced oil recovery (EOR) applications or enhanced gas recovery (EGR), such as coal bed methane recovery. ALSTOM received a Cooperative Agreement from the US Department of Energy National Energy Technology Laboratory (DOE) in 2001 to carry out a project entitled ''Greenhouse Gas Emissions Control by Oxygen Firing in Circulating Fluidized Bed Boilers.'' This two-phased project is in effect from September 28, 2001, to October 27, 2004. (U.S. DOE NETL Cooperative Agreement No. DE-FC26-01NT41146). Phase I consisted of an evaluation of the technical feasibility and economics of alternate CO{sub 2} capture technologies applied to Greenfield US coal-fired electric generation power plants, and supporting bench-scale testing. And Phase II consists of pilot-scale testing, supporting a refined performance and economic evaluation of the oxygen-fired AFC concept. Phase I, detailed in this report, entails a comprehensive study evaluating the technical feasibility and economics of alternate CO{sub 2} capture technologies applied to Greenfield US coal-fired electric generation power plants. Thirteen separate but related cases (listed below), representing various levels of technology development, were evaluated as described herein. The first seven cases represent coal combustion cases in CFB type equipment. The next four cases represent Integrated Gasification Combined Cycle (IGCC) systems. The last two cases represent advanced Chemical Looping systems, which were completely paid for by ALSTOM and included herein for completeness.

  2. Pilot-scale limestone emission control (LEC) process: A development project. Volume 1: Main report and appendices A, B, C, and D. Final report

    SciTech Connect (OSTI)

    Not Available

    1994-03-01

    ETS, Inc., a pollution consulting firm with headquarters in Roanoke, Virginia, has developed a dry, limestone-based flue gas desulfurization (FGD) system. This SO{sub 2} removal system, called Limestone Emission Control (LEC), can be designed for installation on either new or existing coal-fired boilers. In the LEC process, the SO{sub 2} in the flue gas reacts with wetted granular limestone that is contained in a moving bed. A surface layer of principally calcium sulfate (CaSO{sub 4}) is formed on the limestone. Periodic removal of this surface layer by mechanical agitation allows high utilization of the limestone granules. The primary goal of the current study is the demonstration of the techno/economic capability of the LEC system as a post-combustion FGD process capable of use in both existing and future coal-fired boiler facilities burning high-sulfur coal. A nominal 5,000 acfm LEC pilot plant has been designed, fabricated and installed on the slipstream of a 70,000 pph stoker boiler providing steam to Ohio University`s Athens, Ohio campus. The pilot plant was normally operated on the slipstream of the Ohio Univ. boiler plant flue gas, but also had the capability of operating at higher inlet SO{sub 2} concentrations (typically equivalent to 3-1/2% sulfur coal) than those normally available from the flue gas slipstream. This was accomplished by injecting SO{sub 2} gas into the slipstream inlet. The pilot plant was instrumented to provide around-the-clock operation and was fully outfitted with temperature, SO{sub 2}, gas flow and pressure drop monitors.

  3. Mobilizable RDF/d-RDF burning program

    SciTech Connect (OSTI)

    Niemann, K.; Campbell, J.

    1982-03-01

    The Mobilizable RDF/d-RDF Burning Program was conceived to promote the utilization of refuse-derived fuels (RDF) as a supplement to existing fossil fuel sources in industrial-sized boilers. The program explores the design, development, and eventual construction of densified-RDF (d-RDF) for use in boiler combustion testing as a supplement to stoker coal or wood wastes. The equipment would be mounted on trailers and assembled and operated at preselected sites throughout the country where approximately 750 tons of RDF would be produced and test burned in a local boiler. The equipment, to include a transportable RDF boiler metering and feed system, would then be moved and operated at two to three test sites annually. The program is intended to encourage the construction of permanent resource recovery facilities by involving local waste handling groups in operating the equipment and producing fuel, and potential local fuel users in testing the fuel in their boilers. The Mobilizable Program was developed from two separate tasks. The first task developed the concept behind the program and defined its operational and organizational structure. The second task, a follow-up to the first, was intended principally to finalize test locations, develop equipment designs and specifications, and formalize a management program. This report summarizes the principal findings of both tasks. It identifies the criteria used to identify test locations, outlines the program's management structure, presents design and performance specifications for both the fuel production equipment and boiler fuel feed systems, and provides a detailed evaluation of the parameters involved in burning RDF in industrial-sized boilers. Final conclusions and recommendations identify problem areas encountered in the program, and discuss possible future directions for such a program.

  4. Spatial and kinematic distributions of transition populations in intermediate redshift galaxy clusters

    SciTech Connect (OSTI)

    Crawford, Steven M. [SAAO, P.O. Box 9, Observatory 7935, Cape Town (South Africa); Wirth, Gregory D. [W. M. Keck Observatory, 65-1120 Mamalahoa Highway, Kamuela, HI 96743 (United States); Bershady, Matthew A., E-mail: crawford@saao.ac.za, E-mail: wirth@keck.hawaii.edu, E-mail: mab@astro.wisc.edu [Department of Astronomy, University of Wisconsin, 475 North Charter Street, Madison, WI 53706 (United States)

    2014-05-01

    We analyze the spatial and velocity distributions of confirmed members in five massive clusters of galaxies at intermediate redshift (0.5 < z < 0.9) to investigate the physical processes driving galaxy evolution. Based on spectral classifications derived from broad- and narrow-band photometry, we define four distinct galaxy populations representing different evolutionary stages: red sequence (RS) galaxies, blue cloud (BC) galaxies, green valley (GV) galaxies, and luminous compact blue galaxies (LCBGs). For each galaxy class, we derive the projected spatial and velocity distribution and characterize the degree of subclustering. We find that RS, BC, and GV galaxies in these clusters have similar velocity distributions, but that BC and GV galaxies tend to avoid the core of the two z ? 0.55 clusters. GV galaxies exhibit subclustering properties similar to RS galaxies, but their radial velocity distribution is significantly platykurtic compared to the RS galaxies. The absence of GV galaxies in the cluster cores may explain their somewhat prolonged star-formation history. The LCBGs appear to have recently fallen into the cluster based on their larger velocity dispersion, absence from the cores of the clusters, and different radial velocity distribution than the RS galaxies. Both LCBG and BC galaxies show a high degree of subclustering on the smallest scales, leading us to conclude that star formation is likely triggered by galaxy-galaxy interactions during infall into the cluster.

  5. Dynamics and afterglow light curves of gamma-ray burst blast waves encountering a density bump or void

    SciTech Connect (OSTI)

    Uhm, Z. Lucas; Zhang, Bing, E-mail: uhm@pku.edu.cn, E-mail: zhang@physics.unlv.edu [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China)

    2014-07-01

    We investigate the dynamics and afterglow light curves of gamma-ray burst blast waves that encounter various density structures (such as bumps, voids, or steps) in the surrounding ambient medium. We present and explain the characteristic response features that each type of density structure in the medium leaves on the forward shock (FS) and reverse shock (RS) dynamics for blast waves with either a long-lived or short-lived RS. We show that when the ambient medium density drops, the blast waves exhibit in some cases a period of an actual acceleration (even during their deceleration stage) due to adiabatic cooling of blast waves. Comparing numerical examples that have different shapes of bumps or voids, we propose a number of consistency tests that must be satisfied by correct modeling of blast waves. Our model results successfully pass these tests. Employing a Lagrangian description of blast waves, we perform a sophisticated calculation of afterglow emission. We show that as a response to density structures in the ambient medium, the RS light curves produce more significant variations than the FS light curves. Some observed features (such as rebrightenings, dips, or slow wiggles) can be more easily explained within the RS model. We also discuss the origin of these different features imprinted on the FS and RS light curves.

  6. First model-independent Dalitz analysis of $B^0 \\to DK^{*0}$, $D\\to K_S^0\\pi^+\\pi^-$ decay

    E-Print Network [OSTI]

    Negishi, K; Yamamoto, H

    2015-01-01

    We report a measurement of the amplitude ratio $r_S$ of $B^0 \\to D^0K^{*0}$ and $B^0 \\to \\bar{D^0}K^{*0}$ decays with a Dalitz analysis of $D\\to K_S^0\\pi^+\\pi^-$ decays, for the first time using a model-independent method. We set an upper limit $r_S cos(\\delta_S \\pm \\phi_3)$, $y_\\pm = r_S \\sin(\\delta_S \\pm \\phi_3)$ and $\\phi_3~(\\delta_S)$ is the weak (strong) phase difference between $B^0 \\to D^0K^{*0}$ and $B^0 \\to \\bar{D^0}K^{*0}$.

  7. Transport model analysis of the transverse momentum and rapidity dependence of pion interferometry at SPS energies

    E-Print Network [OSTI]

    Qingfeng Li; Marcus Bleicher; Xianglei Zhu; Horst Stoecker

    2006-12-07

    Based on the UrQMD transport model, the transverse momentum and the rapidity dependence of the Hanbury-Brown-Twiss (HBT) radii $R_L$, $R_O$, $R_S$ as well as the cross term $R_{OL}$ at SPS energies are investigated and compared with the experimental NA49 and CERES data. The rapidity dependence of the $R_L$, $R_O$, $R_S$ is weak while the $R_{OL}$ is significantly increased at large rapidities and small transverse momenta. The HBT "life-time" issue (the phenomenon that the calculated $\\sqrt{R_O^{2}-R_S^{2}}$ value is larger than the correspondingly extracted experimental data) is also present at SPS energies.

  8. Radiosondes Corrected for Inaccuracy in RH Measurements

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Miloshevich, Larry

    2008-01-15

    Corrections for inaccuracy in Vaisala radiosonde RH measurements have been applied to ARM SGP radiosonde soundings. The magnitude of the corrections can vary considerably between soundings. The radiosonde measurement accuracy, and therefore the correction magnitude, is a function of atmospheric conditions, mainly T, RH, and dRH/dt (humidity gradient). The corrections are also very sensitive to the RH sensor type, and there are 3 Vaisala sensor types represented in this dataset (RS80-H, RS90, and RS92). Depending on the sensor type and the radiosonde production date, one or more of the following three corrections were applied to the RH data: Temperature-Dependence correction (TD), Contamination-Dry Bias correction (C), Time Lag correction (TL). The estimated absolute accuracy of NIGHTTIME corrected and uncorrected Vaisala RH measurements, as determined by comparison to simultaneous reference-quality measurements from Holger Voemel's (CU/CIRES) cryogenic frostpoint hygrometer (CFH), is given by Miloshevich et al. (2006).

  9. Radiosondes Corrected for Inaccuracy in RH Measurements

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Miloshevich, Larry

    Corrections for inaccuracy in Vaisala radiosonde RH measurements have been applied to ARM SGP radiosonde soundings. The magnitude of the corrections can vary considerably between soundings. The radiosonde measurement accuracy, and therefore the correction magnitude, is a function of atmospheric conditions, mainly T, RH, and dRH/dt (humidity gradient). The corrections are also very sensitive to the RH sensor type, and there are 3 Vaisala sensor types represented in this dataset (RS80-H, RS90, and RS92). Depending on the sensor type and the radiosonde production date, one or more of the following three corrections were applied to the RH data: Temperature-Dependence correction (TD), Contamination-Dry Bias correction (C), Time Lag correction (TL). The estimated absolute accuracy of NIGHTTIME corrected and uncorrected Vaisala RH measurements, as determined by comparison to simultaneous reference-quality measurements from Holger Voemel's (CU/CIRES) cryogenic frostpoint hygrometer (CFH), is given by Miloshevich et al. (2006).

  10. 1 Introduction 1 2 Invariants 5

    E-Print Network [OSTI]

    Huntbach, Matthew

    4 4 mÃ?n mÃ?n mÃ?n 4 m 2 n 2 m n 2 m 2 n 2 4 #12;mÃ?n m 2 n 2 b w d l d, b ,w := d+1 ,b+3 , w+1 . l c p-c p ,c := p+1 , c+1 E E m n m, n := m+3 ,n-1 m+3Ã?n m+ 3Ã?n = (m+3) +3Ã?(n-1) . m 3 n 1 m+3Ã?n E ls := rs E[ls := rs] E ls rs (p-c)[p ,c := p+1 ,c+1] = (p+1) -(c+1) (m+ 3Ã?n)[m, n := m+3 ,n-1] = (m+3) +3

  11. Millimeter Wave Observations of the Core-Jet and Molecular Gas in the FR I Radio Galaxy NGC 3801

    E-Print Network [OSTI]

    Mousumi Das; Stuart N. Vogel; Gijs A. Verdoes Kleijn; Christopher P. O'Dea; Stefi A. Baum

    2005-05-13

    We present BIMA 3 mm observations of the radio continuum source and the molecular gas disk in the radio loud Fanaroff & Riley Type I (FR I)galaxy NGC3801.We have detected a continuum source in the nucleus and determined that it has a flat millimeter-wave spectrum, suggesting that the emission is non-thermal and due to an AGN; the radio core is not evident in existing VLA observations. We also map the extended 3 mm emission from the previously known radio jets. In addition, we detect CO (1--0) emission associated with the dust disk observed in previous HST images. A velocity gradient is observed, indicating a two kpc radius rotating gas ring or disk oriented roughly perpendicular to the radio jets. The inferred molecular gas mass of the disk is $M(H_{2})=3\\times10^{8}M_{\\odot}$, about 1% of the dynamical mass. We also find a $\\sim 10^8$ M$_\\odot$ molecular gas clump not associated with the gas disk. There is evidence that this gas is associated with a merger and is infalling. This suggests that FR I type activity is related to merger activity, as is thought to be the case for FR II type radio galaxies. We also find indications that one of the radio jets is entraining gas from the infalling molecular gas.

  12. A multi-wavelength study of nuclear activity and environment of a low power radio galaxy CTD 86

    E-Print Network [OSTI]

    Pandge, M B; Singh, K P; Patil, M K

    2012-01-01

    We present multiwavelength X-ray, optical and radio study of the Fanaroff & Riley class I radio galaxy CTD 86 based on \\xmm{}, \\rosat{}, Sloan Digital Sky Survey (SDSS), Vainu Bappu Telescope (VBT) observations and the Faint Images of the Radio Sky at Twenty centimeters (FIRST) survey. X-ray emission from CTD 86 originates from two components - diffuse thermal emission from hot gas ($kT\\sim 0.9\\kev$, $n_e\\sim 10^{-3}{\\rm cm^{-3}}$, $L_X \\sim 5\\times10^{42}{\\rm ergs s^{-1}}$ and size $\\sim 186{\\rm kpc}$), and a central point source representing the active nucleus. The hot gaseous environment of CTD 86 is similar to those found in galaxy groups or bright early-type galaxies. We found no clear signature of radio-lobes interacting with the diffuse hot gas. X-ray emission from the active nucleus is well described by an intrinsically absorbed ($N_H \\sim 5.9\\times10^{22}{\\rm cm^{-2}}$) power law ($\\Gamma \\sim 1.5$) with a $2-10\\kev$ luminosity $L_X \\sim 2.1\\times10^{42}{\\rm ergs s^{-1}}$. CTD 86 has a weak optic...

  13. Possible hot spots excited by the relativistic jets of Cygnus X-3

    E-Print Network [OSTI]

    J. Marti; D. Perez-Ramirez; J. L. Garrido; P. Luque-Escamilla; J. M. Paredes

    2005-05-20

    We present the results of a deep search for associated radio features in the vicinity of the microquasar Cygnus X-3. The motivation behind is to find out evidence for interaction between its relativistic jets and the surrounding interstellar medium, which could eventually allow us to perform calorimetry of the total energy released by this microquasar during its flaring lifetime. Remarkably, two radio sources with mJy emission level at centimeter wavelengths have been detected in excellent alignment with the position angle of the inner radio jets. We propose that these objects could be the hot spots where the relativitic outflow collides with the ambient gas in analogy with Fanaroff-Riley II radio galaxies. These candidate hot spots are within a few arc-minutes of Cygnus X-3 and, if physically related, the full linear extent of the jet would reach tens of parsecs. We discuss here the evidence currently available to support this hypothesis based on both archival data and our own observations.

  14. Internal entrainment and the origin of jet-related broad-band emission in Centaurus A

    E-Print Network [OSTI]

    Wykes, Sarka; Karakas, Amanda I; Vink, Jorick S

    2014-01-01

    The dimensions of Fanaroff-Riley class I jets and the stellar densities at galactic centres imply that there will be numerous interactions between the jet and stellar winds. These may give rise to the observed diffuse and 'knotty' structure of the jets in the X-ray, and can also mass load the jets. We performed modelling of internal entrainment from stars intercepted by Centaurus A's jet, using stellar evolution- and wind codes. From photometry and a code-synthesised population of 12 Gyr (Z = 0.004), 3 Gyr (Z = 0.008) and 0 - 60 Myr (Z = 0.02) stars, appropriate for the parent elliptical NGC 5128, the total number of stars in the jet is ~ 8 x 10^8. Our model is energetically capable of producing the observed X-ray emission, even without young stars. We also reproduce the radio through X-ray spectrum of the jet, albeit in a downstream region with distinctly fewer young stars, and recover the mean X-ray spectral index. We derive an internal entrainment rate of ~ 2.3 x 10^-3 Msun yr^-1 which implies substantial ...

  15. Does Geometric Coupling Generates Resonances?

    E-Print Network [OSTI]

    I. C. Jardim; G. Alencar; R. R. Landim; R. N. Costa Filho

    2015-05-08

    Geometrical coupling in a co-dimensional one Randall-Sundrum scenario (RS) is used to study resonances of $p-$form fields. The resonances are calculated using the transfer matrix method. The model studied consider the standard RS with delta-like branes, and branes generated by kinks and domain-wall as well. The parameters are changed to control the thickness of the smooth brane. With this a very interesting pattern is found for the resonances. The geometrical coupling does not generate resonances for the reduced $p-$form in all cases considered.

  16. Soundings from SGP, June 2014 Sonde Comparison Study

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Jensen, Michael

    In early June 2014, a radiosonde intercomparison trial was undertaken at the SGP Central Facility site with the goal of quantifying the relative performance of the RS92-SGP/MW31 and RS41-SG/MW41 radiosondes/systems. The June time period at SGP represents a springtime mid-latitude convective environment where the extensive remote sensing observations at the SGP site were used to further quantify the environment during the intercomparison. Over the course of five days (3 - 8 June) a total of 20 balloon launches were completed with efforts to sample the entire diurnal cycle and a variety of cloud conditions

  17. Soundings from SGP, June 2014 Sonde Comparison Study

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Jensen, Michael

    2015-03-06

    In early June 2014, a radiosonde intercomparison trial was undertaken at the SGP Central Facility site with the goal of quantifying the relative performance of the RS92-SGP/MW31 and RS41-SG/MW41 radiosondes/systems. The June time period at SGP represents a springtime mid-latitude convective environment where the extensive remote sensing observations at the SGP site were used to further quantify the environment during the intercomparison. Over the course of five days (3 - 8 June) a total of 20 balloon launches were completed with efforts to sample the entire diurnal cycle and a variety of cloud conditions

  18. Candidate locus analysis of the TERT–CLPTM1L cancer risk region on chromosome 5p15 identifies multiple independent variants associated with endometrial cancer risk

    E-Print Network [OSTI]

    Carvajal-Carmona, Luis G.; O’Mara, Tracy A.; Painter, Jodie N.; Lose, Felicity A.; Dennis, Joe; Michailidou, Kyriaki; Tyrer, Jonathan P.; Ahmed, Shahana; Ferguson, Kaltin; Healey, Catherine S.; Pooley, Karen; Beesley, Jonathan; Cheng, Timothy; Jones, Angela; Howarth, Kimberley; Martin, Lynn; Gorman, Maggie; Hodgson, Shirley; National Study of Endometrial Cancer Genetics Group (NSECG); The Australian National Endometrial Cancer Study Group (ANECS); Wentzensen, Nicholas; Fasching, Peter A.; Hein, Alexander; Beckmann, Matthias W.; Renner, Stefan P.; Dörk, Thilo; Hillemanns, Peter; Dürst, Matthias; Runnebaum, Ingo; Lambrechts, Diether; Coenegrachts, Lieve; Schrauwen, Stefanie; Amant, Frederic; Winterhoff, Boris; Dowdy, Sean C.; Goode, Ellen L.; Teoman, Attila; Salvesen, Helga B.; Trovik, Jone; Njolstad, Tormund S.; Werner, Henrica M. J.; Scott, Rodney J.; Ashton, Katie; Proietto, Tony; Otton, Geoffrey; Tzortzatos, Gerasimos; Mints, Miriam; Tham, Emma; RENDOCAS; Hall, Per; Czene, Kamila; Liu, Jianjun; Li, Jingmei; Hopper, John L.; Southey, Melissa C.; Australian Ovarian Cancer Study (AOCS); Ekici, Arif B.; Ruebner, Matthias; Johnson, Nichola; Peto, Julian; Burwinkel, Barbara; Marme, Frederik; Brenner, Hermann; Dieffenbach, Aida K.; Meindl, Alfons; Brauch, Hiltrud; The GENICA Network; Lindblom, Annika; Depreeuw, Jeroen; Moisse, Matthieu; Chang-Claude, Jenny; Rudolph, Anja; Couch, Fergus J.; Olson, Janet E.; Giles, Graham G.; Bruinsma, Fiona; Cunningham, Julie M.; Fridley, Brooke L.; Børresen-Dale, Anne-Lise; Kristensen, Vessela N.; Cox, Angela; Swerdlow, Anthony; Orr, Nicholas; Bolla, Manjeet K.; Wang, Qin; Weber, Rachel Palmieri; Chen, Zhihua; Shah, Mitul; Pharoah, Paul D. P.; Dunning, Alison M.; Tomlinson, Ian; Easton, Douglas F.; Spurdle, Amanda B.; Thompson, Deborah J.

    2014-12-09

    , Sweden J. Liu · J. Li Human Genetics, Genome Institute of Singapore, Singapore, Singapore J. L. Hopper · G. G. Giles Centre for Epidemiology and Biostatistics, Melbourne School of Population and Global Health, The University of Melbourne, Melbourne... 2010 release of the 1000 Genomes Project (2012). These included all known SNPs with MAF >0.02 in Europeans and r2 > 0.1 with the then-known cancer-associated SNPs [rs402710 (McKay et al. 2008)] and/or rs3816659 (Shen et al. 2010), plus a tagging set...

  19. On Properties of the Genetic Algorithms with a Robust Solution Searching Scheme in Multidimensional Search Spaces

    E-Print Network [OSTI]

    Tsutsui, Shigeyoshi

    (-) F x q x y f y dy( ) ( ) ( ) .= - - GA/RS3 N(0,) #12;w h f x h w x w ( ) : : = - 0 otherwise w h R w = - = Ã? 2 1 R(w/) R(w/) w/ 2w h 2w 4w w/ 0.197h 0.383h #12; n n GA/ RS3 F X f f y y d y d yn n n n n( ) ( ) ( ) ( , , )= - - - -L L L L1 1 1 1 1 f x x h w x w n i i i i n

  20. Brane World Dynamics and Adiabatic Matter creation

    E-Print Network [OSTI]

    P. Gopakumar; G. V. Vijayagovindan

    2006-04-10

    We have treated the adiabatic matter creation process in various three-brane models by applying thermodynamics of open systems. The matter creation rate is found to affect the evolution of scale factor and energy density of the universe. We find modification at early stages of cosmic dynamics. In GB and RS brane worlds, by chosing appropriate parameters we obtain standard scenario, while the warped DGP model has different Friedmann equations. During later stages, since the matter creation is negligible the evolution reduces to FRW expansion, in RS and GB models.

  1. Phase stability limit of c-BN under hydrostatic and non-hydrostatic pressure conditions

    SciTech Connect (OSTI)

    Xiao, Jianwei; Du, Jinglian; Wen, Bin, E-mail: wenbin@ysu.edu.cn; Zhang, Xiangyi [State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China)] [State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China); Melnik, Roderick [M2NeT Lab, Wilfrid Laurier University, Waterloo25, 75 University Ave. West, Ontario, Canada N2L 3C5 (Canada)] [M2NeT Lab, Wilfrid Laurier University, Waterloo25, 75 University Ave. West, Ontario, Canada N2L 3C5 (Canada); Kawazoe, Yoshiyuki [New Industry Creation Hatchery Center, Tohoku University, 6-6-4 Aramaki-aza-Aoba, Aoba-ku, Sendai 980-8579, Japan and Institute of Thermophysics, Siberian Branch of the Russian Academy of Sciences, 1, Lavyrentyev Avenue, Novosibirsk 630090 (Russian Federation)] [New Industry Creation Hatchery Center, Tohoku University, 6-6-4 Aramaki-aza-Aoba, Aoba-ku, Sendai 980-8579, Japan and Institute of Thermophysics, Siberian Branch of the Russian Academy of Sciences, 1, Lavyrentyev Avenue, Novosibirsk 630090 (Russian Federation)

    2014-04-28

    Phase stability limit of cubic boron nitride (c-BN) has been investigated by the crystal structure search technique. It indicated that this limit is ?1000 GPa at hydrostatic pressure condition. Above this pressure, c-BN turns into a metastable phase with respect to rocksalt type boron nitride (rs-BN). However, rs-BN cannot be retained at 0 GPa owing to its instability at pressure below 250 GPa. For non-hydrostatic pressure conditions, the phase stability limit of c-BN is substantially lower than that under hydrostatic pressure conditions and it is also dramatically different for other pressure mode.

  2. Rural Electrification in India: Economic and Industrial Aspects of Renewables

    E-Print Network [OSTI]

    Cust, J.; Singh, Anoop; Neuhoff, Karsten

    ). Our fieldwork finds the estimated cost per unit between Rs.6 and Rs.8 for existing biomass plants in rural areas. 2.3.2 Small Hydro  Small run-of-river hydro has enjoyed modest success in many locations across India (Gunaratne 2002; IEA 2002) as a... (RGGVY 2006). The criteria upon which SEBs identify these ‘remote’ villages is largely based on physical constraints such as hard-to-reach locations, rather than an optimization of the economically appropriate mix between grid and off-grid solutions...

  3. Nation Weekly May 23, 2004, Volume 1, Number 5

    E-Print Network [OSTI]

    Upadhyay, Akhilesh

    of painting. 32 Ram Man Dai By Sanjeev Uprety Ram Man Dai’s search for an all-purpose medical panacea began in 1960 when he started experimenting with various combinations of ghee, local herbs like saldhoop and gokuldhoop and fitkiri to create Himali Malam... the beginning of Jet Airways services in Nepal. Jet Airways, a private Indian air- line company, will have daily flights between Kathmandu and Delhi. One-way tickets for the economy class will cost Rs. 6,824 and Rs. 8,856 for business class. Euro 2004 Euro 2004...

  4. The Casimir Force in Randall Sundrum Models with q+1 dimensions

    E-Print Network [OSTI]

    Mariana Frank; Nasser Saad; Ismail Turan

    2008-07-02

    We evaluate the Casimir force between two parallel plates in Randall Sundrum (RS) scenarios extended by q compact dimensions. After giving exact expressions for one extra compact dimension (RS 6D model), we generalize to an arbitrary number of compact dimensions. We present the complete calculation for both two brane scenario (RSI model) and one brane scenario (RSII models) using the method of summing over the modes. We investigate the effects of extra dimensions on the magnitude and sign of the force, and comment on limits for the size and number of the extra dimensions.

  5. Electrical Degradation of InAlAs/InGaAs Metamorphic

    E-Print Network [OSTI]

    del Alamo, Jesús A.

    to saturate 0.8 1 1.2 1.4 1.6 0 200 400 600 time [min] RD gmo /RD(0) RS/RS(0) /gmo(0) Stress at VDGo + VT=1 0 400 800 1200 1600 0.95 1.00 1.05 1.10 1.15 RD /RD (0)andgmo /gmo (0) time [min] 1 2 3 4 RD/RD(0) gmo/gmo(0) VDGo +VT [V] #12;Simpler Case: TLMs Ohmics Channel -Doping Cap Integrated TLMs : uniform

  6. 251Agron. Sustain. Dev. 26 (2006) 251255 INRA, EDP Sciences, 2006

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    2006-01-01

    - tal advantages such as reduced dependence on non-renewable energy/material sources, and less251Agron. Sustain. Dev. 26 (2006) 251­255 © INRA, EDP Sciences, 2006 DOI: 10.1051/agro:2006023, TcRS/PP(20/80) = 114.5 °C). The renewability of rice straw and the recyclability of thermoplastic

  7. Testing Monotonicity Oded Goldreich Shafi Goldwassery Eric Lehmany Dana Ronyz

    E-Print Network [OSTI]

    Goldreich, Oded

    to query an unknown function f : f0; 1gn 7! f0; 1gat arguments of its choice, the test always accepts function. 1.1 Perspective Property Testing, as explicitly defined by Rubinfeld and Sudan [RS96 in this context are actually codeword tests (in this case of BCH codes), and that such tests can be defined

  8. THE CITY COLLEGE SCHOOL OF ENGINEERING December 14, 2010 Earth System Science & Environmental Engineering Academic Evaluation

    E-Print Network [OSTI]

    Wolberg, George

    the list below 3 cr.. CE 36500 Hydrology & Hydraulic Engr Pre: CE 350000 (C min.) or ME 35600 or ChE 341000 Topics in RS Energy ChE59812:Energy Systems Eng EE35700: Power Engineering EE45500: Elements of Power Sys ME43300:Heat Transfer ME47100: Energy Sys Design ME53600:Energy Conversion ME54700: Env Control 6cr

  9. RADIO CONTROL ADC0 (RSSI)

    E-Print Network [OSTI]

    _MISO CHP_OUT ADC0 (RSSI) FLASH INTERFACE FLASH_SI FLASH_SO FLASH_CLK SERIAL_ID UART INTERFACE UART_RXD0 INT2 PCLK PDATA RS232_EN CHP_OUT THERM_PWR PW[0..7] SPI_SCK US_IN_ENA POT_CS POT_SCK INT[0..3] AC- ADC

  10. Louisiana Tech University Ruston, LA 71272

    E-Print Network [OSTI]

    Selmic, Sandra

    Louisiana Tech University P.O. Box Ruston, LA 71272 Phone: (318)257- Fax: (318)257- Email: MEDICAL Disease ___High Blood Pressure ___Kidney Disease ___Mental Illness ___Rheumatism(arthritis) ___Sickle Cell.S. 17:170/R.S. 17:170.1/Schools of Higher Learning) requires all students entering Louisiana Tech

  11. Louisiana Tech University Student Health Center

    E-Print Network [OSTI]

    Selmic, Sandra

    Louisiana Tech University Student Health Center P.O. Box 3023 Ruston, LA 71272 Phone: (318 Disease ___High Blood Pressure ___Kidney Disease ___Mental Illness ___Rheumatism(arthritis) ___Sickle Cell.S. 17:170/R.S. 17:170.1/Schools of Higher Learning) requires all students entering Louisiana Tech

  12. Non-linear Evolution of Double Tearing Modes in Tokamaks E. Fredrickson, M. Bell, R. V. Budny, E. Synakowski

    E-Print Network [OSTI]

    result in the transport of heat and particles in events such as "sawteeth" or disruptions[3 to one with "magnetic islands" which have been shown to reduce the confinement of thermal energy[4]. Thus. This normalized discontinuity in the derivative, , is = (- /r - + /r) / |r=rs . For finite size islands

  13. Extremal Financial Risk Models and Portfolio Evaluation

    E-Print Network [OSTI]

    Zhang, Zhengjun

    Extremal Financial Risk Models and Portfolio Evaluation Zhengjun Zhang Department of Statistics assets. An important application of the proposed method is to calculate VaRs (Value at Risk) and evaluate, financial risk, portfolio evaluation. 2000 Mathematics Subject Classification: 60G70, 62G32, 62P20. 0 #12

  14. IBM HIGHLIGHTS, 2000-2006 February 2007

    E-Print Network [OSTI]

    -health, pharmaceutical, agri-science and other life sciences industries. The new organization brings together the company and knowledge management along with computational biology and parallel computing. IBM acquires Aragon Consulting capabilities of IBM's industry-leading supercomputers to its top-performing RS/6000 S80 enterprise server. IBM

  15. VoluME III 2007 EarthScopE o&M propoSal thE global rEach oF uSarray data

    E-Print Network [OSTI]

    Garnero, Ed

    -mantle boundary (CMB), the age and rotation rate of the inner core, the nature of Earth's magnetic field conductivity, the heat flow through the CMB can be estimated [Lay et al., 2006]. S R S RS-wave ScS A. B. C of mantle convection, the fate of subducting slabs, the genesis of mantle plumes, heat flux across the core

  16. Society of Petroleum Engineers Oil Deposits in Diatomites: A New Challenge for Subterranean Mechanics

    E-Print Network [OSTI]

    Patzek, Tadeusz W.

    Society of Petroleum Engineers SPE 75230 Oil Deposits in Diatomites: A New Challenge for Subterranean Mechanics G. I. Barenblatt1 , For. Mem. RS, NAE, NAS, T. W. Patzek2 , SPE, V. M. Prostokishin3 and D. B. Silin4 Copyright 2002, Society of Petroleum Engineers, Inc. This paper was prepared

  17. n commenting on the recent chess match between Garry Kasparov and Deep Blue, IBM

    E-Print Network [OSTI]

    Munakata, Toshinori

    OnSite Viewpoint n commenting on the recent chess match between Garry Kasparov and Deep Blue, IBM literature even proclaimed, "The power behind Deep Blue is an IBM RS/6000 SP sys- tem finely tuned a somewhat different view of Deep Blue's prowess and its implica- tions for computing in general and AI

  18. Mina de Malfois and the Charitable Impulse 

    E-Print Network [OSTI]

    2006-08-16

    for the function of the neurotransmitter-binding ECD in nAChRs. The features of M1 that are essential for ECD function, however, are not fully known. M1 sequences from ionotropic serotonin (5HT3A) and from ?4, ?2, and ?7 nAChR subunits are similar but behave...

  19. Initial Operation of the TCS Upgrade K.E. Miller, H.Y. Guo, A.L. Hoffman, R.D. Milroy, J.A. Grossnickle, A.Tankut, G.C. Vlases, P. Melnik R.D. Brooks

    E-Print Network [OSTI]

    Washington at Seattle, University of

    magnetic field ne is the plasma density RMF is the RMF rotation frequency rs is the FRC's separatrix radius.A. Grossnickle, A.Tankut, G.C. Vlases, P. Melnik R.D. Brooks Redmond Plasma Physics Laboratory, University of Washington FRCs at RPPL · FRC's have potential to make near ideal reactor - linear, high beta, ... · Physics

  20. Revision 10-11-99 Summary of Thick Liquid FW/Blanket for High Power Density Fusion Devices

    E-Print Network [OSTI]

    California at Los Angeles, University of

    time. A typical FRC reactor can be viewed as a long cylinder in which a football shape of plasma lies compatible with the plasma operation of lithium, and 3) an extremely low vapor pressure fluid of tin addressed for Tokamak (such as ARIES-RS), Spherical Torus (ST), and Field Reverse Configuration (FRC

  1. The TCS Upgrade Impurity Control

    E-Print Network [OSTI]

    Washington at Seattle, University of

    field ne is the plasma density RMF is the RMF rotation frequency rs is the FRC's separatrix radius, A.Tankut, G.C. Vlases Redmond Plasma Physics Laboratory, University of Washington RPPL, University of the TCS upgrade #12;FRCs at RPPL · FRC's have potential to make near ideal reactor - linear, high beta

  2. MODEL SR570 Low-Noise Current Preamplifier

    E-Print Network [OSTI]

    Woodall, Jerry M.

    Conditions iv Symbols v Specifications vi Verifying Specifications ix Abridged Command List x Operation 7 Battery Charger 7 Blanking Input 8 Toggling Input 8 RS-232 Interface 8 Battery Care and Usage 8 Recharging 8 Battery Care 8 Programming Remote Programming 10 Introduction 10 Command Syntax 10 Detailed

  3. Department of Industrial and Manufacturing Engineering Fall 2012 Automation of Test Sample Burning

    E-Print Network [OSTI]

    Demirel, Melik C.

    PENNSTATE Department of Industrial and Manufacturing Engineering Fall 2012 Automation of Test of redesign is $20,385 Operational costs of redesign are $1,080 per month Fully automated solution with Meadoweld RS-100 Abrasive Rail Saw In-house fabricated aluminium workstation ramp with industrial matting

  4. Ab initio molecular dynamics simulation of pressure-induced phase transformation of BeO

    SciTech Connect (OSTI)

    Xiao, H. Y.; Duan, G.; Zu, X. T.; Weber, W. J.

    2011-05-05

    Ab initio molecular dynamics (MD) method has been used to study high pressure-induced phase transformation in BeO based on the local density approximation (LDA) and the generalized gradient approximation (GGA). Both methods show that the wurtzite (WZ) and zinc blende (ZB) BeO transforms to the rocksalt (RS) structure smoothly at high pressure. The transition pressures obtained from the LDA method are about 40 GPa larger than the GGA result for both WZ ? RS and ZB ? RS phase transformations, and the phase transformation mechanisms revealed by the LDA and GGA methods are different. For WZ ? RS phase transformations both mechanisms obtained from the LDA and GGA methods are not comparable to the previous ab initio MD simulations of WZ BeO at 700 GPa based on the GGA method. It is suggested that the phase transformation mechanisms of BeO revealed by the ab initio MD simulations are affected remarkably by the exchange–correlation functional employed and the way of applying pressure.

  5. International Radar Symposium, Dresden/ Germany, Sept 30 Oct 2, 2003. APPROACH FOR PROTECTION

    E-Print Network [OSTI]

    Gavrila, Dariu M.

    (5) ; Morris, Richard(6) (1) Volkswagen AG - Research Electronic Systems/ Driver Assistance Electronics - K-EFE/F - Brieffach 1776 - 38436 Wolfsburg/ Ger- many, e-mail: marc-michael.meinecke@volkswagen.de, Marianandrzej.obojski@volkswagen.de, (2) SiemensVDO Automotive AG - SV SC RS TG - Osterhofener Strasse 19

  6. Forschung Hochenergiephysik Forschung Hochenergiephysik

    E-Print Network [OSTI]

    /JP (04/2006) World Scientific (2007) L. BELLAGAMBA, E. SAUVAN, H. SPIESBERGER Electroweak Physics and Physics Beyond the Standard Model. World Scientific (2007) 867 and hep-ph/0607273 V. CHEKELIAN, C. GWENLAN, R.S. THORNE The Structure Functions and Low x Working Group Summary. World Scientific (2007) 839

  7. ISI ReprintSeries ISIIRS-88-210

    E-Print Network [OSTI]

    Robins, Gabriel

    ISI ReprintSeries ISIIRS-88-210 June1988 University ofSouthern California Gabriel Robins Applications of the ISI Grapher Reprinted from Proceedingsof the ArtificialIntelligenceand Advanced Computer PERFORMING ORGANIZATION REPORT NUMBER(S) 5. MONITORING ORGANIZATION REPORT NUMBER(S) ISI/RS-88

  8. Resource Pooling in Network Virtualization and Heterogeneous Scenarios using Stochastic Petri Nets

    E-Print Network [OSTI]

    Yanikomeroglu, Halim

    Resource Pooling in Network Virtualization and Heterogeneous Scenarios using Stochastic Petri Nets University, Canada {rs,halim}@sce.carleton.ca Abstract--Wireless cellular networks are undergoing severe by the network. While operators traditionally over-provisioned their own separate network capacity in order

  9. Site Name : NAVIDAD Author : D. Carrizo E. Contreras C. Arriagada Site Code : NAVI date : year 08 month 03 day 07

    E-Print Network [OSTI]

    Vigny, Christophe

    NAVI 1/6 Site Name : NAVIDAD Author : D. Carrizo ­ E. Contreras ­ C. Arriagada Site Code : NAVI: Alcalde Horacio Maldonado Keys: Margarita Cepeda #12;NAVI 2/6 Receiver: Trimble NetRS S/N: 4723133161 cable. #12;NAVI 3/6 ADDITIONAL INFORMATION #12;NAVI 4/6 ACCESS SKETCH MAP #12;NAVI 5/6 #12;NAVI 6/6 SITE

  10. Identification and quantification of hydride phases in Zircaloy-4 cladding using synchrotron X-ray diffraction q

    E-Print Network [OSTI]

    Motta, Arthur T.

    Identification and quantification of hydride phases in Zircaloy-4 cladding using synchrotron X-ray diffraction q R.S. Daum a,1 , Y.S. Chu b,2 , A.T. Motta c,* a Nuclear Engineering Division, Argonne National, IL 60439, United States c Department of Mechanical and Nuclear Engineering, The Pennsylvania State

  11. FAILURE OF ZIRCALOY-4 SHEET CONTAINING HYDRIDE BLISTERS O.N. Pierron1

    E-Print Network [OSTI]

    Motta, Arthur T.

    FAILURE OF ZIRCALOY-4 SHEET CONTAINING HYDRIDE BLISTERS O.N. Pierron1 , D.A. Koss1 , A.T. Motta2 , R.S. Daum3 , and K.S. Chan4 1 Dept. Materials Science and Engineering, Penn State Univ., University Park, PA 16802 2 Dept. Mechanical and Nuclear Engineering, Penn State University, University Park, PA

  12. www.lgpm.ecp.fr Director: Patrick Perr

    E-Print Network [OSTI]

    Bezerianos, Anastasia

    .bouveret@ecp.fr École Centrale Paris, Research Centre Report 2011 Microtopography of pitting on stainless steel Chemi-A-MOUSSON, VÉOLIA, ALCAN, NIPPON STEEL CORPORATION, SULFURCELL SOLARTECHNIK GmbH, WÜRTH SOLAR GmbH, VALE (BrazilRcheRs: 13 administRative and technical staFF: 17 doctoRal students: 18 Rank a Publications (souRce: web

  13. Curriculum vitae -Anita Hanako Poulsen Contact details

    E-Print Network [OSTI]

    : Molecular biomarkers and hydrocarbons in coral skeletons as potential tracers for past oil pollution events in the food web. The overarching goal of my research is to improve environmental risk assessment.H. and Tjeerdema, R.S. (2013) Methods for deriving pesticide aquatic life criteria for sediments. Reviews

  14. National Aeronautics and Space Administration Space Launch System

    E-Print Network [OSTI]

    Waliser, Duane E.

    engine. #12;The B-2 test stand at NASA's Stennis Space Center in Mississippi--originally built to test cryogenic liquid hydrogen and liquid oxygen that will feed the vehicle's RS-25 engines. SLS is an advanced, heavy-lift launch vehicle that will provide an entirely new capability for science and human exploration

  15. GOLDEN JUBILEE ALUMNI FUND Indian Institute of Technology

    E-Print Network [OSTI]

    Sivalingam, Krishna M.

    · Hostel Zone Biogas reactor converts food waste into energy for cooking · Solar thermal water heaters opportunities for doing much more #12;Potential new investments ­ An indicative list · Cost-effective Solar air reactors for waste to energy in Taramani or Velachery (Rs. 2 crores) · Solar hot water in dining hall

  16. ELSEVIER Physica C 341-348 (2000) 93-96 www.elsevier,nl/locate/physc

    E-Print Network [OSTI]

    Hu, Jiangping

    2000-01-01

    of freedom may compete so strongly that a new critical point is reached. At this critical point, low energy with a generic Ginzburg-Laudau form of the SO(5) model, 1 f ddr[rcli~l.2H = ~ + I~l 2 + rsL~l~ + I~

  17. 53rd AIAA Aerospace Sciences Meeting AIAA 2015-1616 Discontinuous Galerkin Method for Solving

    E-Print Network [OSTI]

    Roy, Subrata

    energy v = velocity vector vS = Viscous Lundquist number rS = Resistive Lundquist number = shear stress algorithm to solve for a variety of problems. The greatest advantage of this method is its parallelizability confinement, solar wind, plasma thrusters, motion in earth's core etc. In this paper we use modal

  18. "Light" or the Electromagne2c spectrum www.nasa.gov

    E-Print Network [OSTI]

    Mojzsis, Stephen J.

    #12;"Light" or the Electromagne2c spectrum www.nasa.gov #12;What do our eyes at outside of eye www.nasa.gov #12; Cone sensi3vity Numb3rs Blog: http://nuweb2.neu? It follows that.... Etc. #12;This guy named Fraunhofer Fraunhofer lines- Solar Spectrum hFp://apod.gsfc.nasa

  19. Texas A&M University GIS certificate information. Revised 07/2014 1

    E-Print Network [OSTI]

    Texas A&M University GIS certificate information. Revised 07/2014 1 GRADUATE CERTIFICATE IN GEOGRAPHIC INFORMATION SYSTEMS (GIS) GIS technologies are applied to wide-ranging fields with interests between GIS and Remote Sensing (RS) technologies are increasing. The need for qualified individuals

  20. Air temperature profile and air/sea temperature difference measurements by infrared and microwave scanning radiometers

    E-Print Network [OSTI]

    Shaw, Joseph A.

    emission from a uniformly mixed atmospheric gas: oxygen for MW (60 GHz) and carbon dioxide for IR (14.2 mm Dynamics: Boundary layer processes; 3360 Meteorology and Atmospheric Dynamics: Remote sensing; KEYWORDS, 8045, doi:10.1029/2002RS002632, 2003 1 Centre of Excellence for the Integration of Remote Sensing

  1. AN EFFICIENT INTEGRAL TRANSFORM TECHNIQUE OF A SINGULAR WIRE ANTENNA KERNEL

    E-Print Network [OSTI]

    Park, Seong-Ook

    AN EFFICIENT INTEGRAL TRANSFORM TECHNIQUE OF A SINGULAR WIRE ANTENNA KERNEL S.-O. Park Department-348, South of Korea Abstract-This paper presents an efficient integral transform tech- nique for evaluating transforma- tions, the original double integral 1/-Rs with a singular kernal can be represented as a finite

  2. Saliva samples are a viable alternative to blood samples as a source of DNA for high throughput genotyping

    E-Print Network [OSTI]

    Abraham, Jean E.; Maranian, Mel J.; Spiteri, Inmaculada; Russell, Roslin; Ingle, Susan; Luccarini, Craig; Earl, Helena M.; Pharoah, Paul P. D.; Dunning, Alison M.; Caldas, Carlos

    2012-05-30

    , reduce costs and logistical problems asso- ciated blood collection within multicentre studies.Additional file Additional file 1: Figure 1. Primers and probes for Taqman assays. Figure 2 Assessment of fragmentation of 3 matched blood and saliva derived DNA... Additional files Supplementary Figure 1 Primers and probes for Taqman assays rs12642938 Forward primer: ACTCCCAGTTATATACCCAACAGATATGTATAAAT Reverse primer: TGTCTTCATTTTATGATTAATAGATATTTGGGTTGCT VIC probe: CAATTTTTGGACAATATTGAT FAM probe...

  3. All-high-Tc superconductor rapid-single-flux-quantum circuit operating S. Shokhor, B. Nadgorny, M. Gurvitch,a)

    E-Print Network [OSTI]

    Nadgorny, Boris

    writing. The circuit includes two dc/SFQ converters, two Josephson transmission lines, a complete RS SFQ. Single-layer YBCO thin-film circuit consisting of two dc/SFQ con- verters, two Josephson transmission flip-flop, and an SFQ/dc converter readout SQUID . Low-frequency testing has shown that the dc

  4. Emergence of HIV-1 Drug Resistance During Antiretroviral Treatment

    E-Print Network [OSTI]

    2007-04-20

    number of changes per genome is 0.3 per replication cycle, which implies that ..... out in this section to assess the variability of the basic reproductive ratio Rs due ...... long-lived infected cells with a half-life of 1–4 weeks (Perelson et al., 1997), ...

  5. 3.0 Modular Program Pathway 3.1 Pathway Overview

    E-Print Network [OSTI]

    JT-60 SU ARIES-RS Scale (?) Ignitor-like Compact Tok., .(+AT) LHD, W7-AS, W7-X Base Fusion ScienceDraft 7/17/98 21 3.0 Modular Program Pathway 3.1 Pathway Overview The major issues in fusion R gain that have characteristics similar to those expected in a fusion energy source, (2) the achievement

  6. From Milroy and Wright (2000) References and Bibliography

    E-Print Network [OSTI]

    2000-01-01

    , England, sedimentology, 20, 145-160. Arthurton, R.S. 1980. Rhythmic sedimentary sequences in the Triassic., 1997. The Exeter Group, south Devon, England: a contribution to the early post-Variscan stratigraphy to Jurassic stratigraphy and structural evolution of the central Cheshire Basin. Journal Geological Society

  7. Major elemental assymetry and recombination effects in irradiated WC C. Bjorkas, K. Vortler, and K. Nordlund

    E-Print Network [OSTI]

    Nordlund, Kai

    to be related to the high formation energy of W defects. PACS numbers: 83.10.Rs, 82.20.Wt, 79.20.Ap The nature of application areas, ranging from fission and fusion re- actors to semiconductor chip manufacturing and manu impor- tance because of its good mechanical and thermal prop- erties [10, 11] and its presence

  8. Building a Statistical Model toBuilding a Statistical Model to Predict Reactor TemperaturesPredict Reactor Temperatures

    E-Print Network [OSTI]

    Scarrott, Carl

    ENGXT +++= )F( ­ Temperature at Channel (i,j) ­ Fuel Irradiation for Channel (r,s) ­ Direct and Neutron(.)?How to Model F(.)? l Effect of Fuel Irradiation on Temperatures l Direct Non-Linear Effect l Neutron Diffusion Region Cold Outer Region l Similar Behaviour ­ Sharp Increase ­ Constant l Weak Relationship l Scatter

  9. Public sentiment in the United States towards the tariff, 1816-1828 

    E-Print Network [OSTI]

    Matthews, John Francis

    1968-01-01

    ly a:". footed. -"-. pl esentative eorm, -ul*' ert of 'asachuse' ta ap '-e au ';"~eainat 't:le mo lon 3 ayi ~C; that in orner to aava;Dan ' a t' ' rs i't 'w'aa n'cease- y ta ". ct pramptl; . ". 'hc ;hqa ?iau is nat van ed, " a'ld:. 'ulbert, 'ter...

  10. Fax +41 61 306 12 34 E-Mail karger@karger.ch

    E-Print Network [OSTI]

    Nizet, Victor

    , Faculty of Pharmacy, Cairo University, Cairo, Egypt; e VA Medical Center and f Molecular Resource Center M types is proposed. The vast majority of GAS infection is benign. Nonetheless, many divergent M types possess limited capacity to cause invasive infection. M1T1 GAS readily switch to a covRS mutant

  11. Version 1.1 (Jan. 8, 2003) Model PRS10

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    Oscillator 42 Crystal Heater 44 Schematic RB_F2 (Sheet 2 of 7) 44 Temperature Control Servos 44 Conversion Schematic RB_F3 (Sheet 3 of 7) 48 Microcontroller 48 RS-232 50 12 Bit A/D Conversion 50 12-Bit Digital. The unit's short-term stability and low environmental coefficients make it an ideal component in network

  12. Agroecology and Sustainable Food Systems, 39:318, 2015 Copyright Taylor & Francis Group, LLC

    E-Print Network [OSTI]

    Neher, Deborah A.

    Agroecology and Sustainable Food Systems, 39:3­18, 2015 Copyright © Taylor & Francis Group, LLC Seeds, Pathogen, and Early Blight on Brassicas in Organic Farmer Fields DEBORAH A. NEHER, THOMAS R.S. National Organic Standards (NOS) for compost are suffi- cient to kill plant pathogens and weed seed. Known

  13. Correspondence Useoilwealthtosave

    E-Print Network [OSTI]

    , such as the provision of sufficient clean energy, water and food (see go.nature. com/6rs2ih and go.nature. com that some of this wealth should go into evaluating the environmental costs of such rapid development, which

  14. Ecological Modelling 143 (2001) 227243 A globally applicable model of daily solar irradiance

    E-Print Network [OSTI]

    Hunt Jr., E. Raymond

    2001-01-01

    Ecological Modelling 143 (2001) 227­243 A globally applicable model of daily solar irradiance at many ground stations, the total daily solar irradiance (Rs) received at the earth's surface to measured solar irradiance. In a global comparison for the year 1987, VP-RAD-estimated and satellite

  15. Technical Evaluation of U.S. Department of Energy

    E-Print Network [OSTI]

    . Duquette, Ph.D. Rensselaer Polytechnic Institute Troy, New York George M. Hornberger, Ph.D. UniversityTechnical Evaluation of U.S. Department of Energy Yucca Mountain Infiltration Estimates A R e p o r.S. Department of Energy Yucca Mountain Infiltration Estimates Report to the U.S. Congress and the Secretary

  16. 2 01 0 T H I E M E S T U T T GA R T N E W Y O R K198 Metal-Catalyzed

    E-Print Network [OSTI]

    Charette, André

    % yield, dr = 98:2, 93% ee O PMP NO2 N2 RL RS (5 equiv) catalyst 2 (10 mol%) Et2O, ­50 °C, 16 h O PMP NO2 dr = 70:30, 71% ee X = Cl dr = 96:4, 92% ee X = OMe dr = 98:2, 93% ee X = NMe2 dr = 99:1, 96% ee

  17. Pore-Level Examination of Gel Destruction During Oil Flow

    E-Print Network [OSTI]

    New York at Stoney Brook, State University of

    Pore-Level Examination of Gel Destruction During Oil Flow R.S. Seright, SPE, New Mexico Petroleum-scale X-ray computed microtomography (XMT) images were obtained at a variety of oil (hexadecane(III)-acetate-hydrolyzed polyacrylamide (HPAM) gel]. For each pore in our image volume, we followed oil and water saturations

  18. S

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    a nd P rotocols S upported b y B EMOSS CommunicaLon T echnologies q Ethernet ( IEEE 8 02.3) q Serial I nterface ( RS---485) q ZigBee ( IEEE 8 02.15.4) q WiFi (...

  19. (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19)World Intellectual Property

    E-Print Network [OSTI]

    Shor, Leslie McCabe

    , PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, for every kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ with international search report (Art. 21(3)) (74) Agent: HARPER, David, S.; Mcdonnell Boehnen Hulbert & Berghoff

  20. Enhanced midbrain response at 6-month follow-up in cocaine addiction, association with reduced drug-related choice

    E-Print Network [OSTI]

    Samaras, Dimitris

    -up. At both study sessions, we collected fMRI scans during performance of a drug Stroop task, clinical self-report@bnl.gov. Author Contributions SJM, DT, NDV, and RZG designed research; DT, PAW, TM, NAK, FT, GJW, and RW performed research; PAW, RS, DC, JAT, and JB coordinated research recruitment; SJM, DT, JH, and RW analyzed data; SJM

  1. Htfiffi m'* Effects of Alternative Fuels on Vehicle Emissions

    E-Print Network [OSTI]

    : gasoline, gasoline-ethanol l'rlends, diesel, biodiesel blends, LPG lquefied petroleurn gas) ancl CNG operating on gasoline arrd a similar non-FF\\-. llir:s rs a in-al ethanol composition blend requires vehicle in the atmosphere. For many r.ears, the primary vehicie fuels used have been gasoline and diesel fuels. These iuels

  2. Station GPS permanente IPG Paris DGF Uchile UNAP Iquique

    E-Print Network [OSTI]

    Vigny, Christophe

    NetRS, Antenna TRIMBLE Zephyr geodetic and autonomous energy (battery and solar panel). HISTORIC Semi.71476292 - 69.82727839 1675.36 DESCRIPTION North Chile II region, semi-permanent GPS station IPGP / DGF network in the nature telephone nearby NONO Electric power nearby NONO equipment storage available YESYES possibility

  3. Station GPS permanente IPG Paris DGF Uchile UNAP Iquique

    E-Print Network [OSTI]

    Vigny, Christophe

    -glue. Receptor TRIMBLE NetRS, Antenna TRIMBLE Zephyr geodetic and autonomous energy (battery and solar panel IPGP / DGF network installed during Dec- 2007. MONUMENTATION Station located in the coastal platform nearby NONO Electric power nearby NONO equipment storage available YESYES possibility of leaving

  4. A Reliability and Validity Study of the Protective Factors Survey to Assess Protective Factors in Families

    E-Print Network [OSTI]

    Counts, Jacqueline Marie

    2010-04-29

    E co lo gi ca l M od el a nd R is k an d P ro te ct iv e F ac to rs ( N or th C ar ol in a In st it ut e of M ed ic in e, 2 00 5) 5 Adverse consequences for maltreated children are well-documented and include minor injuries...

  5. INDEX TO VOLUME 54 . AcanLhuridao, surgeon fish______________________ fl8

    E-Print Network [OSTI]

    INDEX TO VOLUME 54 Page . AcanLhuridao, surgeon fish______________________ fl8 'Acipcnscr .fll~' STATE OF MICI-IlqAN WAT~;RS Ob' GREEN HAY __ 1-:14 cacrulca, SartlinopL ___________________________ 20 L:n, 1:{8 Cn.~piol(/ cas1Jia.__ ___ _ ______ ________ 60 Cating, .Jamcs P.: DETI'RMING AnE .w ATI.AN

  6. Ultra Low-Cost 3.2Gb/s Optical-Rate Reed Solomon Decoder IC Design

    E-Print Network [OSTI]

    Wu, An-Yeu "Andy"

    decoder by using a novel Just-in-Time Folding Modified Euclidean Algorithm (JIT-FMEA). The JIT- FMEA VLSI called Just-in-Time Folding Modified Euclidean Algorithm (JIT-FMEA), which can construes an ultra low of JIT-FMEA architecture can overcome the critical paths of the bottleneck in a RS decoding procedure

  7. Water Rights Analysis Package (WRAP) River System Hydrology 

    E-Print Network [OSTI]

    Wurbs, R.

    2013-02-20

    CP Record ? Control Point Information ........................................................................ 146 MF Record ? Monthly Factors ....................................................................................... 148 Sequencing... on IN records in a FLO file are developed from observed flows using options controlled by AN, AS, CI, CP, EQ, FA, FC, FD, MF, RS, SA, SC, SV, WP, and XL records in the HYD input HIN file. ? Sequences of monthly net evaporation less precipitation rates on EV...

  8. IDS120h POWER DEPOSITION AND Hg POOL STUDIES Nicholas Souchlas (7/26/2011)

    E-Print Network [OSTI]

    McDonald, Kirk

    IDS120h POWER DEPOSITION AND Hg POOL STUDIES Nicholas Souchlas (7/26/2011) 1 #12;Power deposition;ENERGY DEPOSITED IN SC SOLENOIDS (SC#), SHIELDING (SH#). P12 OPTIMIZED POINT, POOL WALL CASES x=+/-6W DECREASE IN DP (BLUE AREA) SH#4~ SMALL INCREASE IN DP (YELLOW AREA) RS, BP~ SAME DP #12;HIGHLIGHTS : Power

  9. Fusion Engineering and Design 38 (1997) 2757 Physics basis for a reversed shear tokamak power plant

    E-Print Network [OSTI]

    California at San Diego, University of

    1997-01-01

    fusion power plant. Analysis of plasma equilibrium and ideal MHD stability, bootstrap current and current the recirculating power fraction. The final plasma configuration for the ARIES-RS power plant obtains i of 4 reserved. Keywords: Reversed shear; Tokamak power plant; Plasma configuration 1. Introduction The reversed

  10. Fusion Engineering and Design 41 (1998) 337347 Prospects and issues for commercial fusion power systems

    E-Print Network [OSTI]

    California at San Diego, University of

    1998-01-01

    of fusion power concepts, most recently, the ARIES-RS conceptual power plant design based upon the tokamak requirements. We review the present status of this and other power plant designs, identify the key fusion R in an increasingly competi- tive and diverse energy marketplace. Based on a series of conceptual fusion power plant

  11. Fusion procedure for the two-parameter quantum algebra $U_{r,s}(sl_n)$

    E-Print Network [OSTI]

    Naihuan Jing; Ming Liu

    2014-09-20

    Irreducible modules of the two-parameter quantum enveloping algebra $U_{r,s}(\\mathfrak{sl}_n)$ are explicitly constructed using the fusion procedure, when $rs^{-1}$ is not a root of unity. This provides an alternative and combinatorial description of the Schur-Weyl duality for two-parameter quantum algebras of type $A$.

  12. Emotional modulation of hippocampus-dependent spatial learning 

    E-Print Network [OSTI]

    Elliott, Audrea Elizabeth

    2006-10-30

    constantly located in a goal arm. Prior to memory retrieval rats were administered either alpha- two adrenoceptor antagonist RS 79948-197, peripherally (0.03, 0.01, 0.3 mg/kg) or into the basolateral amygdala (0.1 �µg), or saline vehicle. Rats treated...

  13. Research Services and Kent Innovation & Enterprise Setting up an application

    E-Print Network [OSTI]

    Kent, University of

    is saved. Project category: This can be changed in necessary #12;2 PI and CoI names: If inputting the application on behalf of the researcher: Save as `DRAFT' if mandatory questions have not been answered;7 Save as `OPEN' if mandatory questions have been answered. Save as `FOR RS / KIE UPDATE

  14. Abstract--The Akshaya project from Kerala has been a much discussed case for the community of practitioners and scholars

    E-Print Network [OSTI]

    Sanders, Seth

    1 Abstract-- The Akshaya project from Kerala has been a much discussed case for the community, Technology social factors I. INTRODUCTION TARTING 2003, the state of Kerala in southern India initiated by the government of Kerala is roughly Rs. 60 crores (US$15 Million) per district. Part of the reason behind

  15. I would like all figures in my article published in Black and White Education in Brazil

    E-Print Network [OSTI]

    Barbosa, Marcia C. B.

    I would like all figures in my article published in Black and White Education in Brazil: Marcia C Postal 15051 91501970, Porto Alegre, RS, Brazil marcia. barbosa@ufrgs.br Keywords Gender, Physics, Brazil Abstract An overview of the Brazilian educational system is presented with the main

  16. A COMPARISON BETWEEN APRIL 1999 AND FEBRUARY 2000 SOLAR-TERRESTRIAL CONNECTION EVENTS: INTERPLANETARY ASPECTS

    E-Print Network [OSTI]

    Instituto Nacional de Pesquisas Espaciais - São José dos Campos, SP, Brazil N. J. Schuch Centro Regional Sul de Pesquisas Espaciais, CRSPE/INPE ­ Santa Maria, RS, Brazil. The strong geomagnetic storms on April an interplanetary shock detected at 1 astronomical unit (UA) at 10:30 UT on April 16th 1999. This interplanetary

  17. PHYSICAL REVIEW E 88, 032118 (2013) Vortex distribution in a confining potential

    E-Print Network [OSTI]

    Levin, Yan

    2013-01-01

    , Caixa Postal 15051, CEP 91501-970, Porto Alegre, RS, Brazil 2 Departamento de F´isica, Universidade Federal de Santa Catarina, 88040-900 Florian´opolis, Santa Catarina, Brazil (Received 3 May 2013; revised) = -2q(x - x1), (4) where all the lengths are now measured in units of . Consider an infinite

  18. The porcine lung as a potential model for cystic fibrosis Christopher S. Rogers,1

    E-Print Network [OSTI]

    Engelhardt, John F.

    Review The porcine lung as a potential model for cystic fibrosis Christopher S. Rogers,1 William M, Prather RS, Sabater JR, Stoltz DA, Zabner J, Welsh MJ. The porcine lung as a potential model for cystic fibrosis. Am J Physiol Lung Cell Mol Physiol 295: L240­L263, 2008. First published May 16, 2008; doi:10

  19. Cost-effectiveness of multidisciplinary management of Tinnitus at a specialized Tinnitus centre

    E-Print Network [OSTI]

    Cima, Rilana; Joore, Manuela; Maes, Iris; Scheyen, Dyon; Refaie, Amr El; Baguley, David M.; Vlaeyen, Johan W. S.; Anteunis, Lucien

    2009-02-11

    . References 1. Andersson G: Psychological aspects of tinnitus and the appli- cation of cognitive-behavioral therapy. Clin Psychol Rev 2002, 22(7):977-90. 2. A Davies, EA Rafie: Epidemiology of tinnitus. In Tinnitus Handbook Edited by: Tyler RS. San Diego...

  20. ECU's Athena SWAN Charter Awards Handbook

    E-Print Network [OSTI]

    Brierley, Andrew

    ECU's Athena SWAN Charter Awards Handbook May 2015 E CUGENDE R CHAR TE R EC U EQUALIT Y C HART E RS #12;03 About this handbook Which charter should I apply for? Athena SWAN principles Award levels 28 29 30 32 35 36 36 37 38 39 46 58 59 59 59 61 #12;05 This handbook provides detailed information

  1. An electric field induces: Linear band shift

    E-Print Network [OSTI]

    Bonitz, Michael

    number of excitons Nx and temperature T (trap frequency 0 = 3.8 GHz) Trap occupation range and exciton/aB = 35 for Nx=2 and rs = 11 for Nx = 3000 Dipole parameter: a/zeff = 23 for Nx = 2 and a/zeff = 8 for Nx

  2. Bonneville Power Administration U.S. Department

    Energy Savers [EERE]

    inc l ude groundwa t e r supp l i e s , r ivers , s t reams , res e rvo i rs , lake s , ponds , e s tua r ie s , mar s he s , and o c ean wa t e r . F i s h s p e c i e s inc lude...

  3. Proteomic profile of Bithynia siamensis goniomphalos snails upon infection with the carcinogenic liver fluke Opisthorchis viverrini

    E-Print Network [OSTI]

    Prasopdee, Sattrachai; Tesana, Smarn; Cantacessi, Cinzia; Laha, Thewarach; Mulvenna, Jason; Grams, Rudi; Loukas, Alex; Gallego, Javier Sotillo

    2014-10-02

    . Mol Biochem Parasitol, 169.( 2010), pp. 27-39. 553 [46] Zahoor Z, Davies AJ, Kirk RS, Rollinson D, Walker AJ. Larval excretory-secretory products from 554 the parasite Schistosoma mansoni modulate HSP70 protein expression in defence cells of its...

  4. www.mas.ecp.fr Director: Frdric Abergel

    E-Print Network [OSTI]

    Bezerianos, Anastasia

    A digipl AnTe projeCT Te Am) Modelling and estimation of the dynamic system of plants in their environment restoration with numerical models iNDusTRial paRTNeRs BNP Paribas, SAP-BusinessObjects, Alcatel, Bionatics, simulation, analysis, optimization and visualization of complex systems, whether they come from

  5. GROUND WATER MEASUREMENTS FROM OB WELLS FOR THE MONTH OF MAY (2004 to 2008)

    E-Print Network [OSTI]

    Sohoni, Milind

    well + pump Population 1000 1000 600 800 2000 Construction cost (Rs.) 600000 650000 55000 70000 2500000 Maintenance cost 0 2500 500 1000 4000 Time of const.( days ) 90 120 5 7 180 Total No. of most important Quantitative attributes are as follows:- Population served Construction cost Maintenance cost Time required

  6. II ENCONTRO PRESENCIAL DO CURSO DE PS GRADUAO EM NEGCIOS E

    E-Print Network [OSTI]

    Paraná, Universidade Federal do

    Eucaliptus sp.), - Preservação 2,9 milhões de hectares - Certificados: 2,0 milhões de hectares - 222 Empresas Principais usos 2009 2010 2011 AP, MT PR, RR, RS e AM Madeira: energia, carvão, chip de madera para celulose

  7. Running Scheme on a PIC microcontroller Marc Feeley (Universite de Montreal) and Danny Dube (Universite Laval)

    E-Print Network [OSTI]

    Feeley, Marc

    Running Scheme on a PIC microcontroller Marc Feeley (Universit´e de Montr´eal) and Danny Dub´e (Universit´e Laval) · Objective: create a Scheme system for PIC that is R4 RS conformant (except for file I/O) · The PIC is an inexpensive single-chip general purpose computer with little RAM Model Pins MIPS ROM RAM

  8. Chiral Attachment of Styrene Mediated by Surface Dimers on Ge(100) Yun Jeong Hwang, Ansoon Kim, Eunkyung Hwang, and Sehun Kim*

    E-Print Network [OSTI]

    Kim, Sehun

    Chiral Attachment of Styrene Mediated by Surface Dimers on Ge(100) Yun Jeong Hwang, Ansoon Kim + 2] cycloaddition forming di- bonds.5 We expect that styrene (C6H5-CHdCH2) molecules on Ge(100) may to the orientation of the phenyl ring of each styrene molecule: the diastereomeric (R,S) and the enantio- meric (R

  9. Pe t al, (2009) ``Classification of Patte rns of EEG Synchronization for

    E-Print Network [OSTI]

    LeCun, Yann

    2009-01-01

    Mirowski Pe t al, (2009) ``Classification of Patte rns of EEG Synchronization for Se izure Pre Processin g #12; Mirowski P e al, (2009) ``Classifica ion of Pae rns of EEG Synchroniza ion for Se izure ive ime poin s, o form pae rns. Pa ie n ­spe cific machine le arning­base d classifie rs (suppor

  10. Preliminary specification Supersedes data of 1995 Oct 26

    E-Print Network [OSTI]

    Kozak, Victor R.

    Philips Semiconductors Preliminaryspecification CAN transceiver for 24 V systems PCA82C251 FEATURES 14 3 Philips Semiconductors Preliminaryspecification CAN transceiver for 24 V systems PCA82C251 BLOCK slope resistor input Fig.2 Pin configuration. handbook, halfpage 1TXD 2 3 4 8 Rs GND CANH VCC CANL RXD

  11. Approved Module Information for PY1124, 2014/5 Module Title/Name: Research Methods and Statistics Module Code: PY1124

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    types of research methods psychologists use and issues associated with them. To teach students a variety of research designs I: Observation (CS) 6. Types of research designs II: Self-report (CS) #12;7. Types of research designs III: Experimental Design (CS) 8. Types of research designs IV: Qualitative Research (RS) 9

  12. 0740-7459/05/$20.00 2005 IEEE Januar y/Februar y 2005 IEEE SOFTWARE 5 5 qualitytimeE d i t o r s : N a n c y E i c k e l m a n n M o t o r o l a n a n c y. e i c k e l m a n n @ m o t o r o l a . c o m

    E-Print Network [OSTI]

    Berry, Daniel M.

    favorite positions are requirements specification (RS) inspector or inspection facilitator. Each of us has reports any instances of these indicators to the au- thors. Often enough, these potential problems prove that this example was but one of a general problem. Later, when Berry was supervising Kamsties's PhD research

  13. Voronoi toolpaths for PCB mechanical etch: Simple and intuitive algorithms with the 3D GPU

    E-Print Network [OSTI]

    Rus, Daniela

    -Tech. However, it is also possible to use a general purpose CNC vertical milling machine with a high in the standard `G-Code' (EIA RS-274D/ISO 6983) format. Most CNC milling machines can accept this output format

  14. Computational analysis of the interfacial bonding between feed-powder particles and the substrate in the cold-gas

    E-Print Network [OSTI]

    Saylor, John R.

    which can lead to the formation of interfacial roll-ups and vortices can play a significant role: 81.05.Bx; 81.15.Rs Keywords: Dynamic cold-spray process; Spray coating techniques 1. Introduction Coatings are being increasingly used to obtain the required surface and tribological properties in engi

  15. Accelerating Correctly Rounded Floating-Point Division When the Divisor is Known in Advance

    E-Print Network [OSTI]

    Brisebarre, Nicolas

    Brisebarre, Jean-Michel Muller and Saurabh Kumar Raina Laboratoire LIP, ENSL/CNRS/INRIA Arenaire Project, and that division is done in software (this happens for instance on RS6000, PowerPC or Itanium architectures to have at least a rough estimation of the probability of getting an incorrect 2 #12;rounding. Also, one

  16. Crystal structure of tetrameric form of human lysyl-tRNA synthetase: Implications for multisynthetase complex formation

    SciTech Connect (OSTI)

    Guo, Min; Ignatov, Michael; Musier-Forsyth, Karin; Schimmel, Paul; Yang, Xiang-Lei (OSU); (Scripps)

    2008-09-17

    In mammals, many aminoacyl-tRNA synthetases are bound together in a multisynthetase complex (MSC) as a reservoir of procytokines and regulation molecules for functions beyond aminoacylation. The {alpha}{sub 2} homodimeric lysyl-tRNA synthetase (LysRS) is tightly bound in the MSC and, under specific conditions, is secreted to trigger a proinflammatory response. Results by others suggest that {alpha}{sub 2} LysRS is tightly bound into the core of the MSC with homodimeric {beta}{sub 2} p38, a scaffolding protein that itself is multifunctional. Not understood is how the two dimeric proteins combine to make a presumptive {alpha}{sub 2}{beta}{sub 2} heterotetramer and, in particular, the location of the surfaces on LysRS that would accommodate the p38 interactions. Here we present a 2.3-{angstrom} crystal structure of a tetrameric form of human LysRS. The relatively loose (as seen in solution) tetramer interface is assembled from two eukaryote-specific sequences, one in the catalytic- and another in the anticodon-binding domain. This same interface is predicted to provide unique determinants for interaction with p38. The analyses suggest how the core of the MSC is assembled and, more generally, that interactions and functions of synthetases can be built and regulated through dynamic protein-protein interfaces. These interfaces are created from small adaptations to what is otherwise a highly conserved (through evolution) polypeptide sequence.

  17. Analytical Controlled Losses of Potassium from Straw

    E-Print Network [OSTI]

    Thy, P.; Grundvig, S.; Jenkins, B. M.; Shiraki, R.; Lesher, C. E.

    2005-01-01

    straw ashes and 3 h for wood ash. Pellets were placed on Pt3 R-7 R-2 R-8 R-1 R-9 R-S wood ash straw ash a T (°C) SiO 2to 11% (525 °C), and for the wood ash values range from 9% (

  18. Parallel processing techniques applied to transient stability analysis of power systems 

    E-Print Network [OSTI]

    Balachandra, Chandrakumar John

    1982-01-01

    contour cutting strategy will therefore yield a smaller and mor effic'ent t'ableau as illustrated in ='gure Z. b and figure 3. o . The final result is the correc. identification of the three clust rs ofthe graph. T'h e dyna- mic contour cutting...

  19. Why Birds Fly in V-Forma2ons

    E-Print Network [OSTI]

    Budker, Dmitry

    of the upwash, and thus the energy saved, go as e=rs-q · where e is a measure childhood curiosi2es · Perhaps improve the efficiency of aircraA flight forma2ons #12 of the energy savings, · r is a propor2onality constant, · s is wing 2p spacing

  20. Je-S Guide to User Account Registration G91v4/ML/Je-S UserAccGuide February 2011 Page 1 of 9

    E-Print Network [OSTI]

    and STFC as well as the Technology Strategy Board (TSB) and Energy Technologies Institute (ETI Registration A Quick Guide for Applicants applying for a Je-S Account Je-S web page: https://je-s.rcuk.ac.uk. Please contact Research Support rs.compliance@imperial.ac.uk if your registration is urgent due