Powered by Deep Web Technologies
Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Proton Sea Quark Flavour Asymmetry and Roper Resonance  

E-Print Network (OSTI)

We study the proton and the Roper resonance together with the meson cloud model, by constructing a Hamiltonian matrix and solving the eigenvalue equation. The proton sea quark flavour asymmetry and some properties of the Roper resonance are thus reproduced in one scheme.

Yong-Jun Zhang; Bin Zhang

2010-05-25T23:59:59.000Z

2

The Role of the Roper in Chiral Perturbation Theory  

SciTech Connect

We include the Roper excitation of the nucleon in a version of heavy-baryon chiral perturbation theory recently developed for energies around the delta resonance. We find significant improvement in the P{sub 11} channel.

Bingwei Long, U. van Kolck

2011-11-01T23:59:59.000Z

3

2010 Worldwide Gasification Database  

DOE Data Explorer (OSTI)

The 2010 Worldwide Gasification Database describes the current world gasification industry and identifies near-term planned capacity additions. The database lists gasification projects and includes information (e.g., plant location, number and type of gasifiers, syngas capacity, feedstock, and products). The database reveals that the worldwide gasification capacity has continued to grow for the past several decades and is now at 70,817 megawatts thermal (MWth) of syngas output at 144 operating plants with a total of 412 gasifiers.

4

Characterization of Potato Leaf Starch  

Science Journals Connector (OSTI)

Characterization of Potato Leaf Starch ... Potatoes of the cultivar Producent were grown south of Uppsala, Sweden. ...

Stalin Santacruz; Kristine Koch; Roger Andersson; Per Åman

2004-03-11T23:59:59.000Z

5

Worldwide Energy and Manufacturing USA Inc formerly Worldwide Manufacturing  

Open Energy Info (EERE)

Manufacturing USA Inc formerly Worldwide Manufacturing Manufacturing USA Inc formerly Worldwide Manufacturing USA Jump to: navigation, search Name Worldwide Energy and Manufacturing USA Inc (formerly Worldwide Manufacturing USA) Place San Bruno, California Zip 94066 Product Worldwide Manufacturing USA is an engineering company based in San Bruno, California. References Worldwide Energy and Manufacturing USA Inc (formerly Worldwide Manufacturing USA)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Worldwide Energy and Manufacturing USA Inc (formerly Worldwide Manufacturing USA) is a company located in San Bruno, California . References ↑ "Worldwide Energy and Manufacturing USA Inc (formerly Worldwide Manufacturing USA)"

6

Analyzing power for ?-p elastic scattering in the energy region of the Roper resonance  

Science Journals Connector (OSTI)

High-precision measurements of the analyzing power AN in ?-p elastic scattering at p?=471–687 MeV/c are presented and compared with the results of recent ?N partial-wave analyses (PWA’s) by the Karlsruhe-Helsinki, CMU-LBL, and VPI groups. While agreeing with the main features of the measured angular dependence of AN, the three PWA’s yield larger values than the measurements at forward angles at p?=471, 547, and 625 MeV/c. At 687 MeV/c the PWA’s do not agree with the data at far backward angles. We estimate the effect of our data on the phase shifts in this energy region, which includes the Roper resonance.

A. Mokhtari; W. J. Briscoe; A. D. Eichon; D. H. Fitzgerald; G. J. Kim; B. M. K. Nefkens; J. A. Wightman; M. E. Sadler

1986-01-01T23:59:59.000Z

7

Dynamic Worldwide Solar Energy | Open Energy Information  

Open Energy Info (EERE)

Worldwide Solar Energy Jump to: navigation, search Name: Dynamic Worldwide Solar Energy Sector: Solar Product: US-based solar developer and financer. References: Dynamic Worldwide...

8

Starch-Binding Domain Affects Catalysis in Two Lactobacillus ?-Amylases  

Science Journals Connector (OSTI)

...Starch. Amylase activity...starch, amylose, amylopectin, or corn...starch. Amylase activity...starch, amylose, amylopectin, or raw...B) a-amylases as measured...and 63C. , amylose; , soluble...starch; , amylopectin; , corn...

R. Rodríguez-Sanoja; B. Ruiz; J. P. Guyot; S. Sanchez

2005-01-01T23:59:59.000Z

9

Wastewater Reuse — a Worldwide Issue  

Science Journals Connector (OSTI)

Water resource shortages are a problem that are plaguing the world. Wastewater recycling and reuse may be the solution to this worldwide problem. Recycled and properly treated wastewater is a safe alternative sou...

Thomas G. Sanders; Lisa M. Dunn; Vujica Yevjevich

1996-01-01T23:59:59.000Z

10

Molecular Genetic Analysis of Maize Starch Branching Isoforms: Modulation of Starch Branching Enzyme Isoform Activities in Maize to Produce Starch with Novel Branching Architecture and Properties  

SciTech Connect

Modulation of Starch Branching enzyme Isoform Activities in Maize to Produce Starch with Novel Branching Architecture and Properties.

Guiltinan, Mark J.; Thompson, Donald

2009-07-21T23:59:59.000Z

11

WORLDWIDE FOCUS ON NUCLEAR WASTE  

Science Journals Connector (OSTI)

WORLDWIDE FOCUS ON NUCLEAR WASTE ... Volume grows and years pile up, but world lacks consensus on disposing of nuclear waste ... WHAT TO DO WITH SPENT nuclear fuel and high-level radioactive waste is a problem shared by much of the world. ...

JEFF JOHNSON

2001-06-18T23:59:59.000Z

12

Gaia Worldwide | Open Energy Information  

Open Energy Info (EERE)

Worldwide Worldwide Jump to: navigation, search Logo: Gaia Worldwide Name Gaia Worldwide Address PO Box 400848 Place Cambridge, Massachusetts Zip 02140 Region Greater Boston Area Number of employees 1-10 Year founded 2005 Phone number +1 (617) 312-3866 Notes Provider of Executive Search and headhunting services to solar and directly related industries. Coordinates 42.3906856°, -71.1299976° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3906856,"lon":-71.1299976,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

13

Brucite nanoplates reinforced starch bionanocomposites  

Science Journals Connector (OSTI)

In this paper the mechanical reinforcement of nano-sized brucite, Mg(OH)2 in a series of bionanocomposite films based on starch was investigated. Brucite nanoplates with an aspect ratio of 9.25 were synthesized by wet precipitation and incorporated into starch matrices at different concentrations (0–7.5 wt.%). Scanning electron microscopy revealed a high degree of nanoplate dispersion within the starch bionanocomposites and good interfacial adhesion between the filler and matrix. The brucite nanoplates formed agglomerates at high concentrations. The reinforcement factor values of the bionanocomposites were higher than the values predicted from the Halphin–Tsai model, which was attributed mainly to the high surface area of the nanoplates. Brucite (1 wt.%) nearly doubled the elastic modulus of starch films. Thermogravimetric analyses indicated some interaction between starch and the brucite that modified their decomposition profiles. Mechanical tests of glycerol plasticized bionanocomposites showed that the reinforcing efficiency of brucite remained high even at 10 wt.% and 20 wt.% of plasticizer.

Francys K.V. Moreira; Daniel C.A. Pedro; Gregory M. Glenn; José M. Marconcini; Luiz H.C. Mattoso

2013-01-01T23:59:59.000Z

14

Biochemical evidence that starch breakdown by Bacteroides thetaiotaomicron involves outer membrane starch-binding sites and periplasmic starch-degrading enzymes.  

Science Journals Connector (OSTI)

...cell-associated amylase, amylopectinase...associated with starch breakdown, alpha-glucosidase...cell-associated amylase, amylopectinase...associated with starch breakdown, alpha-glucosidase...inducer of the starch- degrading...inducers or that break- down of maltose...

K L Anderson; A A Salyers

1989-06-01T23:59:59.000Z

15

Cecropia peltata Accumulates Starch or Soluble Glycogen by Differentially Regulating Starch Biosynthetic Genes  

Science Journals Connector (OSTI)

...transporter MEX1 to fuel metabolism at...by concurrent degradation accompanying...required for starch degradation in Arabidopsis thaliana. Plant Cell 21 : 334-346...regulator of starch degradation in plants...transporter. Plant Cell 13 : 1907-1918...

Sylvain Bischof; Martin Umhang; Simona Eicke; Sebastian Streb; Weihong Qi; Samuel C. Zeeman

2013-04-30T23:59:59.000Z

16

Bacterial Alpha Amylase Paper Disc Tests on Starch Agar  

Science Journals Connector (OSTI)

...Articles Bacterial Alpha Amylase Paper Disc Tests on Starch Agar Egon Stark Ralph...Mass. Bacterial Alpha Amylase Paper Disc Tests on Starch Agar EGON STARK...hydrolysis of soluble starch by a bacterial alpha-amylase preparation, so...

Egon Stark; Ralph Wellerson Jr.; Philip A. Tetrault; Carl F. Kossack

1953-09-01T23:59:59.000Z

17

The unique features of starch metabolism in red algae  

Science Journals Connector (OSTI)

...unique features of starch metabolism in red algae Roberto Viola 1 * Pi Nyvall 2 Marianne...SE-106 91 Stockholm, Sweden Red algae (Rhodophyceae) are photosynthetic eukaryotes...plastids. The starch granules from red algae (floridean starch) show structural similarities...

2001-01-01T23:59:59.000Z

18

Improved method for detection of starch hydrolysis  

SciTech Connect

A new starch hydrolysis detection method which does not rely on iodine staining or the use of color-complexed starch is described. A linear relationship was obtained with agar-starch plates when net clearing zones around colonies of yeasts were plotted against enzyme levels (semilogarithm scale) produced by the same yeast strains in liquid medium. A similar relationship between starch clearing zones and alpha-amylase levels from three different sources was observed. These observations suggest that the method is useful in mutant isolations, strain improvement programs, and the prediction of alpha-amylase activities in culture filtrates or column effluents. (Refs. 18).

Ohawale, M.R.; Wilson, J.J.; Khachatourians, G.G.; Ingledew, W.M.

1982-09-01T23:59:59.000Z

19

STATEMENT OF CONSIDERATIONS REQUEST BY CHEVRONTEXACO WORLDWIDE...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

being the worldwide leader in the gasification process and integration of technology into combined cycle power systems. Texaco Development Corporation's gasification process is a...

20

Career Information on the Worldwide Web  

E-Print Network (OSTI)

Career Information on the Worldwide Web. (URLs of the links are represented as indented from the parent page above it, Names of the pages or links are on the ...

CarlCowen

2009-09-10T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Equipment and services for worldwide applications  

SciTech Connect

The report presents a digest of geothermal energy technology. The worldwide distribution of geothermal resources is described, and the degree to which various countries are exploiting their resources estimated. Detailed information about US technologies is presented, from exploration through applications to cost factors. (ACR)

Not Available

1985-01-01T23:59:59.000Z

22

Effect of ground corn steeping on starch properties  

Science Journals Connector (OSTI)

Pasting and thermal properties, and microstructure of starch from ground corn (GS) steeped at 52 °C in ... were investigated. The isolated starch obtained by wet milling was characterised by determining pasting p...

Monica Haros; Wioletta Blaszczak; Oscar E. Perez…

2006-01-01T23:59:59.000Z

23

Worldwide Oil Production Michaelis-Menten Kinetics Correlation and Regression  

E-Print Network (OSTI)

Worldwide Oil Production Michaelis-Menten Kinetics Topic 4 Correlation and Regression Transformed Variables 1 / 13 #12;Worldwide Oil Production Michaelis-Menten Kinetics Outline Worldwide Oil Production Michaelis-Menten Kinetics Lineweaver-Burke double reciprocal plot 2 / 13 #12;Worldwide Oil Production

Watkins, Joseph C.

24

Continuous enzymatic liquefaction of starch for saccharification  

SciTech Connect

A process was explored for continuous enzymatic liquefaction of corn starch at high concentration and subsequent saccharification to glucose. The process appears to be quite efficient for conversion of starch to glucose and enzymatic liquefaction and should be readily adaptable to industrial fermentation processes. Preliminary work indicated that milled corn or other cereal grains also can be suitably converted by such a process. Essentially, the process involved incorporation of a thermostable, bacterial alpha-amylase for liquefaction and, subsequently, of a glucoamylase into the continuous mixer under conditions conductive to rapid enzymatic hydrolyses. Also studied was the effect on substrate liquefaction of variables such as starch concentration (40-70%), level of alpha-amylase (0.14-0.4%, dry starch basis), temperature (70-100 degrees C), pH (5.8-7.1), and residence time (6 and 12 minutes). The degree of liquefaction was assessed by determining 1) the Brookfield viscosity, 2) the amount of reducing groups, and 3) the rate and extent of glucose formed after glucoamylase treatment. Best liquefaction processing conditions were achieved by using 50-60% starch concentration, at 95 degrees C, with 0.4% alpha-amylase, and a 6 minute residence period in the mixer. Under these conditions, rates and extents of glucose obtained after glucoamylase treatment approached those obtained in longer laboratory batch liquefactions. The amount of glucose formed in 24 hours with the use of 0.4% glucoamylase was 86% of theory after a 6-min continuous liquefaction, compared to 90% for a 30-min laboratory batch liquefaction (95 degrees C, 0.4% alpha-amylase). (Refs. 15).

Carr, M.E.; Black, L.T.; Bagby, M.O.

1982-01-01T23:59:59.000Z

25

Electroexcitation of the Roper resonance for 1.7 < Q**2 < 4.5 -GeV2 in vec-ep ---> en pi+  

SciTech Connect

DOI: http://dx.doi.org/10.1103/PhysRevC.78.045209
The helicity amplitudes of the electroexcitation of the Roper resonance are extracted for 1.7 < Q2 < 4.5 GeV2 from recent high precision JLab-CLAS cross section and longitudinally polarized beam asymmetry data for pi+ electroproduction on protons at W=1.15-1.69 GeV. The analysis is made using two approaches, dispersion relations and a unitary isobar model, which give consistent results. It is found that the transverse helicity amplitude A_{1/2} for the gamma* p -> N(1440)P11 transition, which is large and negative at Q2=0, becomes large and positive at Q2 ~ 2 GeV2, and then drops slowly with Q2. The longitudinal helicity amplitude S_{1/2}, which was previously found from CLAS ep -> eppi0,enpi+ data to be large and positive at Q2=0.4,0.65 GeV2, drops with Q2. Available model predictions for gamma* p -> N(1440)P11 allow us to conclude that these results provide strong evidence in favor of N(1440)P11 as a first radial excitation of

Aznauryan, Inna; Burkert, Volker; Kim, Wooyoung; Park, Kil; Adams, Gary; Amaryan, Moscov; Amaryan, Moskov; Ambrozewicz, Pawel; Anghinolfi, Marco; Asryan, Gegham; Avagyan, Harutyun; Bagdasaryan, H.; Baillie, Nathan; Ball, J.P.; Ball, Jacques; Baltzell, Nathan; Barrow, Steve; Batourine, V.; Battaglieri, Marco; Bedlinskiy, Ivan; Bektasoglu, Mehmet; Bellis, Matthew; Benmouna, Nawal; Berman, Barry; Biselli, Angela; Blaszczyk, Lukasz; Bonner, Billy; Bookwalter, Craig; Bouchigny, Sylvain; Boyarinov, Sergey; Bradford, Robert; Branford, Derek; Briscoe, Wilbert; Brooks, William; Bultmann, S.; Bueltmann, Stephen; Butuceanu, Cornel; Calarco, John; Careccia, Sharon; Carman, Daniel; Casey, Liam; Cazes, Antoine; Chen, Shifeng; Cheng, Lu; Cole, Philip; Collins, Patrick; Coltharp, Philip; Cords, Dieter; Corvisiero, Pietro; Crabb, Donald; Crede, Volker; Cummings, John; Dale, Daniel; Dashyan, Natalya; De Masi, Rita; De Vita, Raffaella; De Sanctis, Enzo; Degtiarenko, Pavel; Denizli, Haluk; Dennis, Lawrence; Deur, Alexandre; Dhamija, Seema; Dharmawardane, Kahanawita; Dhuga, Kalvir; Dickson, Richard; Djalali, Chaden; Dodge, Gail; Donnelly, J.; Doughty, David; Dugger, Michael; Dytman, Steven; Dzyubak, Oleksandr; Egiyan, Hovanes; Egiyan, Kim; Elfassi, Lamiaa; Elouadrhiri, Latifa; Eugenio, Paul; Fatemi, Renee; Fedotov, Gleb; Feldman, Gerald; Feuerbach, Robert; Forest, Tony; Fradi, Ahmed; Funsten, Herbert; Gabrielyan, Marianna; Garcon, Michel; Gavalian, Gagik; Gevorgyan, Nerses; Gilfoyle, Gerard; Giovanetti, Kevin; Girod, Francois-Xavier; Goetz, John; Gohn, Wesley; Golovach, Evgeny; Gonenc, Atilla; Gordon, Christopher; Gothe, Ralf; Graham, L.; Griffioen, Keith; Guidal, Michel; Guillo, Matthieu; Guler, Nevzat; Guo, Lei; Gyurjyan, Vardan; Hadjidakis, Cynthia; Hafidi, Kawtar; Hafnaoui, Khadija; Hakobyan, Hayk; Hakobyan, Rafael; Hanretty, Charles; Hardie, John; Hassall, Neil; Heddle, David; Hersman, F.; Hicks, Kenneth; Hleiqawi, Ishaq; Holtrop, Maurik; Hyde, Charles; Ilieva, Yordanka; Ireland, David; Ishkhanov, Boris; Isupov, Evgeny; Ito, Mark; Jenkins, David; Jo, Hyon-Suk; Johnstone, John; Joo, Kyungseon; Juengst, Henry; Kalantarians, Narbe; Keller, Dustin; Kellie, James; Khandaker, Mahbubul; Kim, Kui; Klein, Andreas; Klein, Andreas; Klimenko, Alexei; Kossov, Mikhail; Krahn, Zebulun; Kramer, Laird; Kubarovsky, Valery; Kuhn, Joachim; Kuhn, Sebastian; Kuleshov, Sergey; Kuznetsov, Viacheslav; Lachniet, Jeff; Laget, Jean; Langheinrich, Jorn; Lawrence, Dave; Lee, T.; Lima, Ana; Livingston, Kenneth; Lu, Haiyun; Lukashin, Konstantin; MacCormick, Marion; Markov, Nikolai; Mattione, Paul; McAleer, Simeon; McKinnon, Bryan; McNabb, John; Mecking, Bernhard; Mehrabyan, Surik; Melone, Joseph; Mestayer, Mac; Meyer, Curtis; Mibe, Tsutomu; Mikhaylov, Konstantin; Minehart, Ralph; Mirazita, Marco; Miskimen, Rory; Mokeev, Viktor; Morand, Ludyvine; Moreno, Brahim; Moriya, Kei; Morrow, Steven; Moteabbed, Maryam; Mueller, James; Munevar Espitia, Edwin; Mutchler, Gordon; Nadel-Turonski, Pawel; Nasseripour, Rakhsha; Niccolai, Silvia; Niculescu, Gabriel; Niculescu, Maria-Ioana; Niczyporuk, Bogdan; Niroula, Megh; Niyazov, Rustam; Nozar, Mina; O'Rielly, Grant; Osipenko, Mikhail; Ostrovidov, Alexander; Park, S.; Pasyuk, Evgueni; Paterson, Craig; Anefalos Pereira, S.; Philips, Sasha; Pierce, Jerome; Pivnyuk, Nikolay; Pocanic, Dinko; Pogorelko, Oleg; Polli, Ermanno; Popa, Iulian; Pozdnyakov, Sergey; Preedom, Barry; Price, John; Prok, Yelena; Protopopescu, Dan; Qin, Liming; Raue, Brian; Riccardi, Gregory; Ricco, Giovanni; Ripani, Marco; Ritchie, Barry; Rosner, Guenther; Rossi, Patrizia; Rowntree, David; Rubin, Philip; Sabatie, Franck; Saini, Mukesh; Salamanca, Julian; Salgado, Carlos; Santoro, Joseph; Sapunenko, Vladimir; Schott, Diane; Schumacher, Reinhard; Serov, Vladimir; Sharabian, Youri; Sharov, Dmitri; Shaw, J.; Shvedunov, Nikolay; Skabelin, Alexander; Smith, Elton; Smith, Lee; Sober, Daniel; Sokhan, Daria; Stavinskiy, Aleksey; Stepanyan, Samuel; Stepanyan, Stepan; Stokes, Burnham

2008-10-01T23:59:59.000Z

26

E-Print Network 3.0 - affects starch accumulation Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

starch Summary: the rate of starch synthesis and affects the composition of starch in potato tubers (Geigenber- ger et al... al. 1988) can accumulate as much as 15% of the normal...

27

E-Print Network 3.0 - amylose maize starches Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

THE GELATINIZATION PROPERTIES OF STANDARD MAIZE STARCH Summary: , high amylose maize, potato and lentil starches. The magnitude of these changes was found... in gelatinization...

28

Worldwide Energy Efficiency Action through Capacity Building and Training  

Open Energy Info (EERE)

Worldwide Energy Efficiency Action through Capacity Building and Training Worldwide Energy Efficiency Action through Capacity Building and Training (WEACT) Jump to: navigation, search Logo: Worldwide Energy Efficiency Action through Capacity Building and Training (WEACT) Name Worldwide Energy Efficiency Action through Capacity Building and Training (WEACT) Agency/Company /Organization National Renewable Energy Laboratory, The International Partnership for Energy Efficiency Cooperation Sector Energy Focus Area Energy Efficiency Topics Background analysis Resource Type Training materials Website http://www.nrel.gov/ce/ipeec/w Country Mexico, India UN Region Northern America References Worldwide Energy Efficiency Action through Capacity Building and Training (WEACT)[1] Abstract Included are training materials for the Worldwide Energy Efficiency Action through Capacity Building & Training (WEACT) Workshop in Mexico City, 28-30 September 2010.

29

Jon C. Arnold Managing Director, Worldwide Power and Utilities  

E-Print Network (OSTI)

. Jon C. Arnold Managing Director, Worldwide Power and Utilities Microsoft Corporation Jon Arnold is the Managing Director, Worldwide Power and Utilities for Microsoft. As Microsoft's senior executive for Power and Utilities his primary responsibility is to establish and drive Microsoft's industry strategy, which extends

30

Worldwide Carbon Capture and Storage Projects on the Increase | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Worldwide Carbon Capture and Storage Projects on the Increase Worldwide Carbon Capture and Storage Projects on the Increase Worldwide Carbon Capture and Storage Projects on the Increase November 13, 2009 - 12:00pm Addthis Washington, D.C. -- Worldwide efforts to fund and establish carbon capture and storage (CCS) projects have accelerated, according to a new Department of Energy (DOE) online database, indicating ongoing positive momentum toward achieving the G-8 goal for launching 20 CCS demonstrations by 2010. The database, a project of the Office of Fossil Energy's (FE) National Energy Technology Laboratory (NETL), reveals 192 proposed and active CCS projects worldwide. The projects are located in 20 countries across five continents. The 192 projects globally include 38 capture, 46 storage, and 108 for capture and storage. While most of the projects are still in the

31

Redesigned CCS Website Offers Wealth of Information on Worldwide  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Redesigned CCS Website Offers Wealth of Information on Worldwide Redesigned CCS Website Offers Wealth of Information on Worldwide Technology, Projects Redesigned CCS Website Offers Wealth of Information on Worldwide Technology, Projects June 28, 2011 - 1:00pm Addthis Washington, DC - A wealth of information about worldwide carbon capture and storage (CCS) technologies and projects is available on the newly launched, updated and redesigned National Carbon Sequestration Database and Geographic Information System (NATCARB) website. NATCARB is an interactive virtual encyclopedia of key CCS information, including locations and information on field projects, a map of all publically announced worldwide CCS projects and their status; and the complete latest edition of NETL's assessment of carbon storage resource potential in the United States and portions of Canada.

32

Utilization of diets with hydrolyzed potato starch, or glucose by juvenile white sturgeon (Acipenser transmontanus), as affected by Maillard reaction during feed processing  

E-Print Network (OSTI)

Utilization of hydrolysed potato starch by juvenile AtlanticWhite sturgeon; Hydrolyzed potato starch; Glucose; Plasmaglucose or hydrolyzed potato starch (HPS). Four diets

Deng, D F; Hemre, G I; Storebakken, T; Shiau, S Y; Hung, SSO

2005-01-01T23:59:59.000Z

33

A family of starch-active polysaccharide monooxygenases  

Science Journals Connector (OSTI)

...addition to {alpha}(1?4) bonds...form between amylose and amylopectin in starch, which...degraded mainly by {alpha}-amylase and glucoamylase...Methods Materials. Amylopectin from maize (Sigma; 11020), amylose with average...

Van V. Vu; William T. Beeson; Elise A. Span; Erik R. Farquhar; Michael A. Marletta

2014-01-01T23:59:59.000Z

34

Mutants of Arabidopsis with altered regulation of starch degradation  

SciTech Connect

Mutants of Arabidopsis thaliana (L.) Heynh. with altered regulation of starch degradation were identified by screening for plants that retained high levels of leaf starch after a period of extended darkness. The mutant phenotype was also expressed in seeds, flowers, and roots, indicating that the same pathway of starch degradation is used in these tissues. In many respects, the physiological consequences of the mutations were equivalent to the effects observed in previously characterized mutants of Arabidopsis that are unable to synthesize starch. One mutant line, which was characterized in detail, had normal levels of activity of the starch degradative enzymes {alpha}-amylase, {beta}-amylase, phosphorylase, D-enzyme, and debranching enzyme. Thus, it was not possible to establish a biochemical basis for the phenotype, which was due to a recessive mutant at a locus designated sex 1 at position 12.2 on chromosome 1. This raises the possibility that hitherto unidentified factors, altered by the mutation, play a key role in regulating or catalyzing starch degradation.

Caspar, T.; Lin, Tsanpiao; Kakefuda, G.; Benbow, L.; Preiss, J.; Somerville, C. (Michigan State Univ., East Lansing (USA))

1991-04-01T23:59:59.000Z

35

Phosphoglucan-bound structure of starch phosphatase Starch Excess4 reveals the mechanism for C6 specificity  

Science Journals Connector (OSTI)

...glucose homopolymers amylose (10–25%) and amylopectin (75–90%) (1, 2). Amylose is a linear molecule formed from {alpha}-1,4-glycosidic...chains, whereas amylopectin is formed from...starch hydrolyzing amylases, and dephosphorylation...

David A. Meekins; Madushi Raththagala; Satrio Husodo; Cory J. White; Hou-Fu Guo; Oliver Kötting; Craig W. Vander Kooi; Matthew S. Gentry

2014-01-01T23:59:59.000Z

36

Worldwide Trends in Energy Use and Efficiency: Key Insights from  

Open Energy Info (EERE)

Worldwide Trends in Energy Use and Efficiency: Key Insights from Worldwide Trends in Energy Use and Efficiency: Key Insights from International Energy Agency (IEA) Indicator Analysis in Support of the Group of Eight (G8) Plan of Action Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Worldwide Trends in Energy Use and Efficiency: Key Insights from International Energy Agency (IEA) Indicator Analysis in Support of the Group of Eight (G8) Plan of Action Focus Area: Power Plant Efficiency Topics: Potentials & Scenarios Website: www.iea.org/papers/2008/indicators_2008.pdf Equivalent URI: cleanenergysolutions.org/content/worldwide-trends-energy-use-and-effic Language: English Policies: "Regulations,Deployment Programs" is not in the list of possible values (Deployment Programs, Financial Incentives, Regulations) for this property.

37

1 Worldwide Computing Middleware 1 1.1 Middleware . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2  

E-Print Network (OSTI)

Contents 1 Worldwide Computing Middleware 1 1.1 Middleware . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 1.1.1 Asynchronous Communication . . . . . . . . . . . . . . . . . . . . . . . . 2 1.1.2 Higher-level Services . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 1.1.3 Virtual Machines

Varela, Carlos

38

Waxy Chlamydomonas reinhardtii: monocellular algal mutants defective in amylose biosynthesis and granule-bound starch synthase activity accumulate a structurally modified amylopectin.  

Science Journals Connector (OSTI)

...EC 2.4.1.21 Starch Synthase | Alleles Amylopectin genetics metabolism Amylose genetics...metabolism Chloroplasts metabolism ultrastructure Kinetics...Selection, Genetic Starch chemistry Starch...Characterisation of starch granules from waxy, nonwaxy and hybrid seeds of Amaranthus hypochondriacus...

B Delrue; T Fontaine; F Routier; A Decq; J M Wieruszeski; N Van Den Koornhuyse; M L Maddelein; B Fournet; S Ball

1992-06-01T23:59:59.000Z

39

In Vitro Utilization of Amylopectin and High-Amylose Maize (Amylomaize) Starch Granules by Human Colonic Bacteria  

Science Journals Connector (OSTI)

...starch, the amylose/amylopectin ratio, the...interaction, amylose-lipid complexes...presence of amylase inhibitors...include both a-amylase and a-glucosidase...shown that both amylopectin maize starch and high-amylose maize starch...

Xin Wang; Patricia Lynne Conway; Ian Lewis Brown; Anthony John Evans

1999-11-01T23:59:59.000Z

40

RESISTANT STARCH FROM NOVEL RS-CONTAINING PREPARATIONS: RESIDUAL SUSCEPTIBILITY TO AMYLOLYSIS AND GROWTH OF BIFIDOBACTERIUM STRAINS.  

E-Print Network (OSTI)

??Starches differ with respect to both digestion rate and digestion extent in the small intestine. The portion of starch not hydrolyzed by pancreatic ?-amylase and… (more)

Saibene, Debora

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Formation of a raw starch-hydrolyzing alpha-amylase by Clostridium 2021: Effect of carbon sources  

Science Journals Connector (OSTI)

Clostridium 2021 was found to produce ?-amylase effective at hydrolyzing raw starch. Of the carbohydrates examined, starch at 3 % concentration was found to be the best carbon sou...

M. C. Avendano; I. Cornejo

1987-02-01T23:59:59.000Z

42

Ethanol fermentation of cassava starch pretreated with alkali  

SciTech Connect

In view of the current industrial process for the conventional ethanol fermentation, in which raw starch materials are heated at 120 degrees C for 2 h, conditions for an alternative process were set: an overall time from saccharification to ethanol fermentation of within 3-4 days, an operation temperature of below 60 degrees C, an ethanol yield of over 93%, and a ratio of raw material to fermentation volume of within 1:4. To meet these conditions, previously a steeping method of starch materials in 0.5N HCl solution at 60 degrees C for 12 h were used, followed by combined actions of ..cap alpha..-amylase and glucoamylase. The ethanol yield from uncooked cassava starch treated under the conditions described was 95% after fermentation for 3 days with Saccharomyces cerevisiae. However, the use of a relatively higher concentration of acid for steeping is still a problem and gelatinization of starch materials is insufficient. This communication, therefore, describes effects of alkali steeping and structural change of starch granules on the ethanol fermentation. 8 references.

Shin, Y.C.; Lee, S.Y.; Choe, Y.K.; Kim, H.S.; Byun, S.M.

1986-04-01T23:59:59.000Z

43

The Phosphoglucan Phosphatase Like Sex Four2 Dephosphorylates Starch at the C3-Position in Arabidopsis  

Science Journals Connector (OSTI)

...produce novel starches for industrial applications. The degree...from the Riken Bioresource Center (stock number pda16983...Eisenberg, D. (1992). Assessment of protein models with three-dimensional...starch-derived pastes for industrial applications. In Arabidopsis...

Diana Santelia; Oliver Kötting; David Seung; Mario Schubert; Matthias Thalmann; Sylvain Bischof; David A. Meekins; Andy Lutz; Nicola Patron; Matthew S. Gentry; Frédéric H.-T. Allain; Samuel C. Zeeman

2011-11-18T23:59:59.000Z

44

Role of starch as a substrate for Bacteroides vulgatus growing in the human colon.  

Science Journals Connector (OSTI)

...the starches amylose and amylopectin. Amylase and alpha-glucosidase...the starches amylose and amylopectin. Amylase and alpha-glucosidase...2.1.20 alpha-Glucosidases | Amylases metabolism Amylopectin metabolism Amylose metabolism...

R E McCarthy; M Pajeau; A A Salyers

1988-08-01T23:59:59.000Z

45

Solar Storm Closely Watched Worldwide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solar Storm Closely Watched Worldwide Solar Storm Closely Watched Worldwide Solar Storm Closely Watched Worldwide March 9, 2012 - 10:14am Addthis While this week's solar storm captures the interest of scientists, researchers and people around the world, the Energy Department works with others to monitor the storm's potential impact on the nation's electrical grid. | Image credit: NOAA. While this week's solar storm captures the interest of scientists, researchers and people around the world, the Energy Department works with others to monitor the storm's potential impact on the nation's electrical grid. | Image credit: NOAA. Kenneth Friedman Senior Policy Advisor in the Office of Electricity Delivery and Energy Reliability The solar storm that is capturing the interest of scientists, researchers

46

Solar Storm Closely Watched Worldwide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Storm Closely Watched Worldwide Storm Closely Watched Worldwide Solar Storm Closely Watched Worldwide March 9, 2012 - 10:14am Addthis While this week's solar storm captures the interest of scientists, researchers and people around the world, the Energy Department works with others to monitor the storm's potential impact on the nation's electrical grid. | Image credit: NOAA. While this week's solar storm captures the interest of scientists, researchers and people around the world, the Energy Department works with others to monitor the storm's potential impact on the nation's electrical grid. | Image credit: NOAA. Kenneth Friedman Senior Policy Advisor in the Office of Electricity Delivery and Energy Reliability The solar storm that is capturing the interest of scientists, researchers and people around the world is a geomagnetic disturbance from the sun.

47

STATEMENT OF CONSIDERATIONS REQUEST BY CHEVRONTEXACO WORLDWIDE POWER & GASIFICATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CHEVRONTEXACO WORLDWIDE POWER & GASIFICATION CHEVRONTEXACO WORLDWIDE POWER & GASIFICATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN PATENT RIGHTS UNDER SUBCONTRACT QZ001 UNDER DOE COOPERATIVE AGREEMENT NO. DE-FC26-99FT40675; W(A)-03-001, CH-1127 The Petitioner, ChevronTexaco Worldwide Power & Gasification (ChevronTexaco) is a subcontractor to Research Triangle Institute (RTI) under the subject cost plus fixed fee agreement for the performance of work entitled, Novel Technologies for Gaseous Containment Control. The purpose of the agreement is to prove the feasibility of synthesis gas clean up techniques, including the warm synthesis gas process based on the RVS-1 sorbent developed by the Department of Energy and RTI and, for reverse selective membrane technology developed by Dupont and Air Liquide, Membrane Dupont Air Liquide (MEDAL) and RTI.

48

Obesity Management Using Diacylglycerol and Low Glycemic Index Starch in Dogs  

E-Print Network (OSTI)

) and amylopectin (branched glucose polymer containing both ?-1,4- and ?-1,6- linkages). Starch digestibility is afected not only by procesing but also by plant species. High-amylose corn (low glycemic index, LGI) starch is a starch from amylomaize corn that has... and 25% amylose (Thomison, 2004). Nguyen et al. (1998) reported that postprandial hyperglycemia and insulin secretion depend on the ratio of amylose to amylopectin consumed. These authors found a positive linear correlation betwen the starch content...

Nagaoka, Daisuke

2010-01-16T23:59:59.000Z

49

Degradation of Raw Starch by a Wild Amylolytic Strain of Lactobacillus plantarum  

Science Journals Connector (OSTI)

...cassava, can break down cassava raw starch that has not...excreted a high alpha-amylase activity...Degradation of Raw Starch by a Wild Amylolytic...cassava, can break down cassava raw starch that has not...excreted a high alpha-amylase activity...

Eric Giraud; Alain Champailler; Maurice Raimbault

1994-12-01T23:59:59.000Z

50

Extraction and Proteome Analysis of Starch Granule-Associated Proteins in Mature Wheat Kernel (Triticum aestivum L.)  

Science Journals Connector (OSTI)

The presence of ?-amylase inside the starch granules indicates that this enzyme is needed to directly break down the starch polymer. ... (48, 49) This xylanase inhibitor also displays inhibitory activity toward barley alpha-amylases. ... (54) Some authors studied starch associated proteins from commercial wheat starches,(54) and found stress defense proteins including ?-amylase subtilisin inhibitor, chitinase and serpin. ...

Emmanuelle Bancel; Hélène Rogniaux; Clément Debiton; Christophe Chambon; Gérard Branlard

2010-04-21T23:59:59.000Z

51

68 CEREAL CHEMISTRY Variability in Starch Acetylation Efficiency  

E-Print Network (OSTI)

. Six waxy corn (maize) hybrids from 1998 and five waxy corn hybrids from 1999 were wet-milled, and reduced retro- gradation upon cooling (Rutenberg and Solarek 1984). Corn (maize) starch obtained by wet influences numerous processes associated with corn milling. Peplinski et al (1989) dry-milled corn from

52

Effects of charge-carrying amino acids on the gelatinization and retrogradation properties of potato starch  

Science Journals Connector (OSTI)

Abstract The objective of this study was to evaluate the effects of charge-carrying amino acids (lysine (Lys), arginine (Arg), aspartic acid (Asp) and glutamic acid (Glu)) on the gelatinization and retrogradation properties of potato starch. Acidic amino acids (Asp and Glu) showed a decreasing trend in swelling power and granule size of potato starch, but increased amylose leaching and gelatinization temperature. Alkaline amino acid (Arg) showed an increasing trend in swelling power and granule size of potato starch, but decreasing amylose leaching and gelatinization temperature. Lys had no effect on the swelling power of potato starch, except at a high content (0.2 mol/kg). Like other two acidic amino acids, Lys also increased gelatinization temperature. Moreover, the addition of alkaline amino acids (Arg) decreased syneresis value of potato starch but acidic amino acids (Asp and Glu) increased it. Compared to Arg, the syneresis of potato starch with Lys was similar to that of its native starch.

Wenting Chen; Hongxian Zhou; Hong Yang; Min Cui

2015-01-01T23:59:59.000Z

53

Early Argonne reactor lit the way for worldwide nuclear industry -  

NLE Websites -- All DOE Office Websites (Extended Search)

Early Argonne reactor lit the way for worldwide Early Argonne reactor lit the way for worldwide nuclear industry About Director's Welcome Organization Achievements Highlights Fact Sheets, Brochures & Other Documents Multimedia Library Visit Argonne Work with Argonne Contact us Nuclear Energy Why Nuclear Energy? Why are some people afraid of Nuclear Energy? How do nuclear reactors work? Cheaper & Safer Nuclear Energy Helping to Solve the Nuclear Waste Problem Nuclear Reactors Nuclear Reactors Early Exploration Training Reactors Basic and Applied Science Research LWR Technology Development BORAX-III lighting Arco, Idaho (Press Release) Heavy Water and Graphite Reactors Fast Reactor Technology Integral Fast Reactor Argonne Reactor Tree CP-1 70th Anniversary CP-1 70th Anniversary Argonne's Nuclear Science and Technology Legacy

54

Worldwide outlook clouded by market slump of late 1993  

SciTech Connect

Excess production and production capacity reasserted their influence in worldwide petroleum markets last year, pushing crude oil prices to their lowest levels since before the Persian Gulf crisis. The development ended the relative price stability that has characterized the period since the crisis ended in January 1991. One of the major questions now being asked is whether there has been a downward shift in the seasonal range of crude prices. In the near future, OPEC's degree of success in balancing the market will be a key to prices. Another is politics in the Middle East. If it were not for a United Nations embargo, the market would have another 2--3 million b/d of oil supply--from Iraq. The paper discusses worldwide demand, economic trends, the supply in 1993, the supply outlook, prices, and international drilling activities.

Beck, R.J.

1994-01-31T23:59:59.000Z

55

Air-Conditioning Systems Simulate World-Wide Climates  

Science Journals Connector (OSTI)

Air-Conditioning Systems Simulate World-Wide Climates ... WEATHER conditions equivalent to those in any part of the world can be simulated in a four-compartment test box set up at State College, Penna., by the U. S. Department of Agriculture's Regional Pasture Research Laboratory in its work to develop better pastures. ... Three heavily insulated doors permit access to each compartment; an inner door keeps conditioned air in the box from rushing out when the main door is opened. ...

1941-10-25T23:59:59.000Z

56

Hanford's 200 West Pump and Treat System Garners Worldwide Attention |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

200 West Pump and Treat System Garners Worldwide 200 West Pump and Treat System Garners Worldwide Attention Hanford's 200 West Pump and Treat System Garners Worldwide Attention August 27, 2013 - 12:00pm Addthis The award recognized CH2M HILL for its excellence in the international water industry. CH2M HILL’s Water Business Group's International Client Sector Director Peter Nicol accepted the award from Global Water Awards Speaker and former Mexican President Vicente Fox. The award recognized CH2M HILL for its excellence in the international water industry. CH2M HILL's Water Business Group's International Client Sector Director Peter Nicol accepted the award from Global Water Awards Speaker and former Mexican President Vicente Fox. The 200 West Pump and Treat System design and construction teams utilized energy efficient and sustainable design elements, including recycled steal. This photo shows the system’s processing equipment. Approximately 539 tons, or 5 percent, of the steel used in construction was recycled.

57

Quantum Fuel Systems Technologies Worldwide Inc Quantum Technologies | Open  

Open Energy Info (EERE)

Fuel Systems Technologies Worldwide Inc Quantum Technologies Fuel Systems Technologies Worldwide Inc Quantum Technologies Jump to: navigation, search Name Quantum Fuel Systems Technologies Worldwide Inc (Quantum Technologies) Place Irvine, California Zip CA 92614 Sector Hydro, Hydrogen, Solar, Vehicles, Wind energy Product A California-based company with new energy activities in powertrains for hybrid vehicles, gas and hydrogen storage equipment manufacturing, and wind and solar energy. Coordinates 41.837752°, -79.268594° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.837752,"lon":-79.268594,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

58

Trends in worldwide ICT electricity consumption from 2007 to 2012  

Science Journals Connector (OSTI)

Abstract Information and Communication Technology (ICT) devices and services are becoming more and more widespread in all aspects of human life. Following an increased worldwide focus on the environmental impacts of energy consumption in general, there is also a growing attention to the electricity consumption associated with ICT equipment. In this paper we assess how ICT electricity consumption in the use phase has evolved from 2007 to 2012 based on three main ICT categories: communication networks, personal computers, and data centers. We provide a detailed description of how we calculate the electricity use and evolution in these three categories. Our estimates show that the yearly growth of all three individual ICT categories (10%, 5%, and 4%, respectively) is higher than the growth of worldwide electricity consumption in the same time frame (3%). The relative share of this subset of ICT products and services in the total worldwide electricity consumption has increased from about 3.9% in 2007 to 4.6% in 2012. We find that the absolute electricity consumption of each of the three categories is still roughly equal. This highlights the need for energy-efficiency research across all these domains, rather than focusing on a single one.

Ward Van Heddeghem; Sofie Lambert; Bart Lannoo; Didier Colle; Mario Pickavet; Piet Demeester

2014-01-01T23:59:59.000Z

59

Starch Granule Initiation in Arabidopsis Requires the Presence of Either Class IV or Class III Starch Synthases  

Science Journals Connector (OSTI)

...as amylopectin structure, amylopectin/amylose ratio, shape, morphology...of the residual starch (amylose content, amylopectin chain length distribution...enzyme b 168 14.6 173 10.7 alpha-Amylase c 0.218 0.05 0.247...

Nicolas Szydlowski; Paula Ragel; Sandy Raynaud; M. Mercedes Lucas; Isaac Roldán; Manuel Montero; Francisco José Muñoz; Miroslav Ovecka; Abdellatif Bahaji; Véronique Planchot; Javier Pozueta-Romero; Christophe D'Hulst; Ángel Mérida

2009-08-07T23:59:59.000Z

60

Pdc - The Worldwide Leader in Hydrogen Refueling Station Compression  

NLE Websites -- All DOE Office Websites (Extended Search)

Pdc - Pdc - The Worldwide Leader in Hydrogen Refueling Station Compression Over 185 Compressors in the Worlds 220+ Hydrogen Energy Facilities Diaphragm Compressor Technology: Benefits of Technology: - Highest duty cycle of all current technologies - Lowest power consumption of the technologies - Lowest cooling requirements Challenges: - High(er) capital cost amongst the technologies - Currently - If not run properly, susceptible to maintenance problems. - Compressor likes to "run often". Cost Constraints of All Technologies General Cost Issues Currently Facing Compressor Manufacturers: Low Volume. Take Away: Buy More, Save More. Lack of clear codes and standards for industry. Take Away: Standardize, Standardize, Standardize Cost Constraints of All Technologies

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Oppenheimer Gives Plan for World-Wide Atomic Research  

Science Journals Connector (OSTI)

Oppenheimer Gives Plan for World-Wide Atomic Research ... A PLAN for research and development of atomic energy depending upon close international cooperation and "complete and absolute openness" presented by J. Robert Oppenheimer to the United Nations Atomic Energy Commission has been made public. ... In an effort to list the problems occurring in the field with relation to their urgency, importance, and difficulty, Dr. Oppenheimer enumerated six areas of development, attempting to indicate those which were likely to lead to benefits in the future. ...

1947-06-23T23:59:59.000Z

62

Application of genetics to the development of starch-fermenting yeasts  

SciTech Connect

Yeast strains capable of direct fermentation of manioc starch were developed by hybridizing strains of Saccharomyces diastaticus and Saccharomyces cerevisiae. Hybrids were evaluated for speed of alcohol production, and yields and speed of formation of glycoamylase. Up to 6% solutions of Lintner starch could be fermented directly with about 80% conversion to alcohol. Pretreatment of crude 40% manioc starch suspensions with alpha-amylase, followed by fermentations with a starch-fermenting yeast strain, permitted accumulation of 12% ethanol within three days. Starch conversion was almost 100%. A fragment of DNA was cloned from S. diastaticus using the yeast-E. coli shuttle vector, YEp13, and was used to transform a strain of S. cerevisiae to a starch-fermenting state. Supported by National Science Foundation grant INT 7927328 and National Institutes of Health grant GM 27860. Dr. Laluce was supported by a grant from Fundacao de Amparo a Pesquisa do Estado do Sao Paulo and by her university. (Refs. 5).

Mattoon, J.R.; Kim, K.; Laluce, C.

1987-01-01T23:59:59.000Z

63

Alcohol production from various enzyme-converted starches with or without cooking  

SciTech Connect

The effectiveness of alcoholic fermentation was compared by measuring alcoholic yields from various starch mashes, both cooked and uncooked. Alcohol yields from cooked and liquefied starch by bacterial ..cap alpha..-amylase were 93.9% for corn, 92.0% for cassava, 90.6% for potato, and 73.0% for babassu, whereas alcohol yields from raw starch were 90.0% for corn, 89.0% for cassava, 48.9% for babassu, and 11.4% for potato. (JMT)

Park, Y.K.; Rivera, B.C.

1982-02-01T23:59:59.000Z

64

Determination of total dietary fiber and resistant starch in processed corn and rice products  

E-Print Network (OSTI)

), and probably, Maillard reaction products. Values of TDF for rice products decreased up to 50% during milling, but remained unchanged with parboiling. Formation of RS around 1% in corn was found when consecutive heat treatments were applied (alkaline... starch" (RS) was first used by Englyst and Cummings in 1982 to describe starch that was resistant to pancreatic amylase. During heat treatments (boiling or baking), intermolecular hydrogen bonds between the starch granules are formed (crystallization...

Corujo Martinez, Juan Ignacio

2012-06-07T23:59:59.000Z

65

Effect of calcium buffers and whole plant processing methods on starch digestibility of sorghum based diets in Holstein cows  

E-Print Network (OSTI)

. Significant rela- tionships were found between fecal starch percentage and fecal pH, starch digestibility and fecal pH, and fecal starch percentage and starch d ige st ibility. Experiment 3 was a comparison of the effect on digestibility of three methods... Relationship between starch digestibility and fecal pH in Experiment 2. 15 Relationship between whole plant grain sorghum processing for silage and fecal pH in Experiment 3 . 75 16 Relationship between fecal starch percentage and fecal pH in Experiment 3...

Fernandez, John Anthony

1980-01-01T23:59:59.000Z

66

Simultaneous saccharification of cassava starch and fermentation of algae for biodiesel production  

Science Journals Connector (OSTI)

A simpler approach to produce biodiesel from cassava starch was established, which successfully integrates the simultaneous saccharification and heterotrophic algal fermentation in an identical system. Batch e...

Yue Lu; Yi Ding; Qingyu Wu

2011-02-01T23:59:59.000Z

67

Effect of repeated retrogradation on structural characteristics and in vitro digestibility of waxy potato starch  

Science Journals Connector (OSTI)

Abstract The effects of repeated retrogradation (RR) treatment on the structural characteristics and in vitro digestibility of waxy potato starch were investigated. The cycling times of RR ranging from 1 to 5 were designated as RR-1, RR-2, RR-3, RR-4, and RR-5, respectively. A maximum SDS content (40.41%) was obtained by RR-2 treatment with the time interval of 48 h. RR-2-treated starch product exhibited a narrower melting temperature range, a higher onset temperature and a lower melting enthalpy compared with RR-1 treatment. Compared with native starch, X-ray diffraction patterns of treated starches were altered from B-type to C-type. The variation in relative crystallinity of RR-treated starch products was consistent with that in melting enthalpy. Moreover, compared with RR-1-treated starch, a large number of cavities were observed on the surface of RR-2-treated starch product with a time interval of 48 h, whereas more smooth regions were found on the surface of RR-5-treated starch product. This study suggested that structural changes of waxy potato starch treated with different cycling times of RR significantly affected the digestibility.

Yao-Yu Xie; Xiao-Pei Hu; Zheng-Yu Jin; Xue-Ming Xu; Han-Qing Chen

2014-01-01T23:59:59.000Z

68

Thermal Properties of Starch From New Corn Lines as Impacted by Environment and During Line Development  

SciTech Connect

The objectives of this research were to further characterize exotic by adapted corn inbreds by studying the impact of environment on their starch thermal properties, and investigating the development of starch thermal properties during kernel maturation by using differential scanning calorimetry (DSC). A method to expedite identification of unusual starch thermal traits was investigated by examining five corn kernels at a time, instead of one kernel, which the previous screening methods used. Corn lines with known thermal functions were blended with background starch (control) in ratios of unique starch to control starch, and analyzed by using DSC. Control starch was representative of typical corn starch. The values for each ratio within a mutant type were unique ({alpha} < 0.01) for most DSC measurements. These results supported the five-kernel method for rapidly screening large amounts of corn germplasm to identify unusual starch traits. The effects of 5 growing locations on starch thermal properties from exotic by adapted corn and Corn Belt lines were studied using DSC. The warmest location, Missouri, generally produced starch with greater gelatinization onset temperature (T{sub oG}), narrower range of gelatinization (R{sub G}), and greater enthalpy of gelatinization ({Delta}H{sub G}). The coolest location, Illinois, generally resulted in starch with lower T{sub oG}, wider R{sub G}, and lower {Delta}H{sub G}. Starch from the Ames 1 farm had thermal properties similar to those of Illinois, whereas starch from the Ames 2 farm had thermal properties similar to those of Missouri. The temperature at Ames 2 may have been warmer since it was located near a river; however, soil type and quality also were different. Final corn starch structure and function change during development and maturity. Thus, the changes in starch thermal properties during 5 stages of endosperm development from exotic by adapted corn and Corn Belt lines at two locations were studied by using DSC. The T{sub oG} tended to decrease during maturation of the kernel, whereas the {Delta}H{sub G} tended not to change. Retrogradation parameters did not vary greatly among days after pollination (DAP) and between locations. Genotypes were affected differently by environments and significant interactions were found between genotype, environment,and DAP.

Elizabeth M. Lenihan

2003-12-12T23:59:59.000Z

69

Comparative Methodologies for Measuring Metabolizable Energy of Various Types of Resistant High Amylose Corn Starch  

Science Journals Connector (OSTI)

Comparative Methodologies for Measuring Metabolizable Energy of Various Types of Resistant High Amylose Corn Starch ... BACKGROUND: Knowledge of energetic availability of dietary fibres is important for human nutrition. ...

Richard T. Tulley; Marko J. Appel; Tanya G. Enos; Maren Hegsted; Kathleen L. McCutcheon; Jun Zhou; Anne M. Raggio; Roger Jeffcoat; Anne Birkett; Roy J. Martin; Michael J. Keenan

2009-08-27T23:59:59.000Z

70

Correlated changes in structure and viscosity during gelatinization and gelation of tapioca starch granules  

Science Journals Connector (OSTI)

Melting of the semicrystalline structure of native tapioca starch granules is correlated to solution viscosity for elucidating gelatinization and gelation processes.

Huang, H.-K.

2014-10-21T23:59:59.000Z

71

Application of hazard analysis (HACCP) in starch production by the wet milling of maize.  

E-Print Network (OSTI)

??This study is based on the Hazard Analysis in the Wet Milling of maize for the production of starch at the Bellville plant of African… (more)

Samuels, R. C.

1993-01-01T23:59:59.000Z

72

Research helps safeguard nuclear workers worldwide - Argonne's Historical  

NLE Websites -- All DOE Office Websites (Extended Search)

Research helps safeguard nuclear workers Research helps safeguard nuclear workers worldwide About Director's Welcome Organization Achievements Highlights Fact Sheets, Brochures & Other Documents Multimedia Library Visit Argonne Work with Argonne Contact us Nuclear Energy Why Nuclear Energy? Why are some people afraid of Nuclear Energy? How do nuclear reactors work? Cheaper & Safer Nuclear Energy Helping to Solve the Nuclear Waste Problem Nuclear Reactors Nuclear Reactors Early Exploration Training Reactors Basic and Applied Science Research LWR Technology Development BORAX-III lighting Arco, Idaho (Press Release) Heavy Water and Graphite Reactors Fast Reactor Technology Integral Fast Reactor Argonne Reactor Tree CP-1 70th Anniversary CP-1 70th Anniversary Argonne's Nuclear Science and Technology Legacy Argonne's Nuclear Science and Technology Legacy

73

Scenarios for a worldwide deployment of nuclear power  

Science Journals Connector (OSTI)

The growing worldwide demand for energy must be controlled. However, even in the event of voluntary policies to dampen energy demand, it is hard to imagine that the demand could be less than twice as much as today's by 2050. We feel it is necessary to satisfy this demand. It is obvious also that greenhouse gas emissions must be reduced in order to limit the severe consequences that they entail. An energy shortage could develop if new sources of large-scale energy production are not established. A significant contribution of nuclear power to such energy production by 2050 rests on a well-coordinated and optimised deployment scheme (Loiseaux et al., 2004; The Future of Nuclear Power, 2003). This requires, as early as today, a reflection on the present status of nuclear power, on its extrapolation into the future and, thus, on the means that should be put to work and the transition possibilities.

E. Merle-Lucotte; D. Heuer; C. Le Brun; J.M. Loiseaux

2006-01-01T23:59:59.000Z

74

Fuel Cells Market Exceeds $1.3 Billion in Worldwide Sales | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Fuel Cells Market Exceeds 1.3 Billion in Worldwide Sales Fuel Cells Market Exceeds 1.3 Billion in Worldwide Sales December 1, 2014 - 5:14pm Addthis The market for fuel cells is...

75

Fourier Transform Infrared (FT-IR) Microspectroscopic Census of Single Starch Granules for Octenyl Succinate Ester Modification  

Science Journals Connector (OSTI)

Fourier transform infrared (FT-IR) microspectroscopy was used to investigate reaction homogeneity of octenyl succinic anhydride modification on waxy maize starch and detect uniformity of blends of modified and native starches. For the first time, the ...

Yanjie Bai; Yong-Cheng Shi; David L. Wetzel

2009-06-24T23:59:59.000Z

76

Osnabrcker Studierende der Wirtschaftsinformatik erstellen ersten Online-Nachhaltigkeitsbericht fr Hellmann Worldwide Logistics  

E-Print Network (OSTI)

-Nachhaltigkeitsbericht für Hellmann Worldwide Logistics Auf Initiative von Prof. Dr. Lohmeier und Prof. Dr. Teuteberg wurde Osnabrücker Unternehmens Hellmann Worldwide Logistics (10.735 Mitarbeiter und 2,67 Milliarden Euro Umsatz PDF-Dokument verfügba- ren Nachhaltigkeitsbericht von Hellmann Worldwide Logistics in einen mit vielen

Steinhoff, Heinz-Jürgen

77

When incubated with PPA, the strands of spaghetti were solubilized and the starch  

E-Print Network (OSTI)

the pathway for the alpha-amylase to access starch. Pre-incu- bation with pepsin released starch concluded that the protein network does not constitute a complete physical bar- rier to alpha-amylase increased after 1 h of alpha-amylolysis (+ 10% at 24 h) due to the presence of contaminating proteases which

Paris-Sud XI, Université de

78

Changes in worldwide demand for metals (final). Open File report  

SciTech Connect

Worldwide demand for metals was analyzed to identify the important factors that explain differences in the level of demand among world countries. The per capita demand for steel, aluminum, copper, and total nonferrous metals was investigated for 40 to 50 countries over a 22-year period. These countries have been further grouped into four world regions for purposes of making generalizations about the importance of these factors for countries in different stages of development and with dissimilar levels of per capita gross domestic product (GDP). Intercountry and intertemporal differences are explained largely by differences in per capita GDP and changes over time in per capita GDP, oil real prices, and to a lesser extent, metal real prices. The trend in world consumption is dramatically different in the last decade than the previous one. In 1962-73, per capita consumption increased in all areas and consumption intensity (consumption divided by (GDP) increased in most areas). In 1973-84, per capita consumption fell in most areas and intensity fell dramatically, except in developing nations.

Faucett, J.G.; Chmelynski, H.J.

1986-08-01T23:59:59.000Z

79

Microscopic Analysis of Corn Fiber Using Corn Starch- and Cellulose-Specific Molecular Probes  

SciTech Connect

Ethanol is the primary liquid transportation fuel produced from renewable feedstocks in the United States today. The majority of corn grain, the primary feedstock for ethanol production, has been historically processed in wet mills yielding products such as gluten feed, gluten meal, starch, and germ. Starch extracted from the grain is used to produce ethanol in saccharification and fermentation steps; however the extraction of starch is not 100% efficient. To better understand starch extraction during the wet milling process, we have developed fluorescent probes that can be used to visually localize starch and cellulose in samples using confocal microscopy. These probes are based on the binding specificities of two types of carbohydrate binding modules (CBMs), which are small substrate-specific protein domains derived from carbohydrate degrading enzymes. CBMs were fused, using molecular cloning techniques, to a green fluorescent protein (GFP) or to the red fluorescent protein DsRed (RFP). Using these engineered probes, we found that the binding of the starch-specific probe correlates with starch content in corn fiber samples. We also demonstrate that there is starch internally localized in the endosperm that may contribute to the high starch content in corn fiber. We also surprisingly found that the cellulose-specific probe did not bind to most corn fiber samples, but only to corn fiber that had been hydrolyzed using a thermochemical process that removes the residual starch and much of the hemicellulose. Our findings should be of interest to those working to increase the efficiency of the corn grain to ethanol process.

Porter, S. E.; Donohoe, B. S.; Beery, K. E.; Xu, Q.; Ding, S.-Y.; Vinzant, T. B.; Abbas, C. A.; Himmel, M. E.

2007-09-01T23:59:59.000Z

80

Carbohydrate-Binding Module–Cyclodextrin Glycosyltransferase Fusion Enables Efficient Synthesis of 2-O-d-Glucopyranosyl-l-Ascorbic Acid with Soluble Starch as the Glycosyl Donor  

Science Journals Connector (OSTI)

...Engineering Laboratory for Cereal Fermentation Technology...AA-2G) from soluble starch by fusing a carbohydrate-binding...starch or glycogen metabolism. CBM20 members with affinity for starch are commonly referred...overnight. Then the seed culture was inoculated...l-AA and soluble starch), the final concentration...

Ruizhi Han; Jianghua Li; Hyun-Dong Shin; Rachel R. Chen; Guocheng Du; Long Liu; Jian Chen

2013-03-15T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Kairos Consulting Worldwide Wins HUBZone Business of the Year Award at Small Business Forum & Expo  

Energy.gov (U.S. Department of Energy (DOE))

Kairos Consulting Worldwide, Chicago, IL, won the HUBZone Business of the Year Award at the Small Business Forum & Expo in Tampa, FL, on July 12, 2014.

82

Digestibility of Sugar, Starches, and Pentosans of Roughages.  

E-Print Network (OSTI)

gms. No. 3649-50. ..................... Eaten ........................................ Excreted 1491 gms. No. 3700.. .................. Sugars Mono. 55.8 2.6 53.2 1.5 51.7 97.2 97.5 F8.0 28.0 Starch. 212.4 10.0 202.4 6.7 195.7 96.6... 95.9 35.2 35.2 Di. 54.0 .3 -- 53.7 .7 53.5 99.6 99.7 12.8 12.8 .1 99.2 99.2 33.6 0 33.6 1.1 32.5 96.7 1.2 ................................. Digested. Reduc- ing sugar from hemi- cellulose. 111.2 5.2 106.0 48.8 57...

Fraps, G. S. (George Stronach)

1916-01-01T23:59:59.000Z

83

Adaptation to a Starch Environment and Regulation of alpha-Amylase in Drosophila  

Science Journals Connector (OSTI)

The adaptation to glucose and starch foods insix species, D. melanogaster, D.virilis, D. saltans, D. funebris,D. levanonensis and D. americana, wasstudied by measuring productivity. D.melanogaster and D. virilis ...

Junichi Fujimoto; Chie Kanou; Yozo Eguchi; Yoshinori Matsuo

84

Alpha-amylase assay with dyed-starch in polyethylene glycol and dextran solutions  

Science Journals Connector (OSTI)

The ?-amylase assay method with RBB-starch was shown to work well in the presence of polyethylene glycol and dextran, polymers commonly used in aqueous two-phase systems. Neither the polymer type, polymer conc...

Kyung Moon Park; Nam Sun Wang

85

Screening for and Identification of Starch-, Amylopectin-, and Pullulan-Degrading Activities in Bifidobacterial Strains  

Science Journals Connector (OSTI)

...oligosaccharides in soy by alpha-d-galactosidase...vitro utilization of amylopectin and high-amylose maize (Amylomaize...identification of starch-, amylopectin-, and pullulan-degrading...were screened for alpha-amylase and/or pullulanase...

Sinéad M. Ryan; Gerald F. Fitzgerald; Douwe van Sinderen

2006-08-01T23:59:59.000Z

86

Regulation of starch accumulation by granule-associated plant 14-3-3 proteins  

Science Journals Connector (OSTI)

...involved in producing amylose, an {alpha}(1–4) glucan...in the synthesis of amylopectin, an {alpha}(1–6) branched...found together with amylose to form starch granules...catabolic enzymes such as amylase, {alpha}-glucosidase...

Paul C. Sehnke; Hwa-Jee Chung; Ke Wu; Robert J. Ferl

2001-01-01T23:59:59.000Z

87

And so can plants with high starch contents. [Cereal grains conversion to ethanol  

SciTech Connect

Researchers at Miles Laboratories are looking into the hydrolysis of starch using two enzymes - alpha-amylase and glucoamylase, as high concentrations of starch like those found in cereal grains can be converted into ethanol by way of sugars. It is estimated that to produce 1 gallon of ethanol requires about 56 lb of corn and with 85% fermentation efficiency, the enzyme cost per gallon of ethanol would be 6-7 cents.

Not Available

1980-09-08T23:59:59.000Z

88

Observing nanoscience and technology worldwide Newsletter n2, February 2009 Stephan Roche www.nanotrendchart.com  

E-Print Network (OSTI)

Observing nanoscience and technology worldwide Newsletter n°2 of the 35 largest districts worldwide. Studying nano-districts gives a new view on nanoscience Data from 200 represented. Interestingly, al- though activity in nanoscience is concentrated in a limited number of areas

Paris-Sud XI, Université de

89

Preparation of tailor-made starch-based aerogel microspheres by the emulsion-gelation method  

Science Journals Connector (OSTI)

The inherent biocompatibility and biodegradability of starch, a natural polysaccharide-based product, allows its use in the form of microspheres as a chemical carrier for life science applications. However, current methods of preparation of starch microspheres utilize chemical crosslinkers and drying methods (air drying, freeze drying) that leads to problems of degradability of the matrix and low specific surface areas and chemical loading capacities. In this work, corn starch aerogel microspheres, a special class of nanoporous materials, were prepared by the combination of an emulsion-gelation method and supercritical drying without the use of chemical crosslinkers. Effects of gelation temperature (368, 393 and 413 K), oil-to-aqueous starch solution ratio (1:1, 2:1, 3:1) and surfactant content (3, 6 and 10% (w/w)) on the textural and morphological properties of the aerogel material were studied. The obtained starch aerogels were characterized using nitrogen adsorption–desorption measurements, helium pycnometry, CHN elemental analyses, thermogravimetry and scanning electron microscopy. Spherical starch aerogel microspheres with tailor-made specific surface areas (34–120 m2 g?1 range) and particle sizes (215–1226 ?m diameter range) were obtained. Aerogel textural properties were mainly influenced by the gelation temperature used, whereas the particle morphology depended on the three processing parameters studied. High specific chemical loading capacity (1.1 × 10?3 g m?2) of the aerogel microspheres was obtained using ketoprofen as a model compound.

C.A. García-González; J.J. Uy; M. Alnaief; I. Smirnova

2012-01-01T23:59:59.000Z

90

The use of starch matrices in slow release fungicide formulations and their efficacy in controlling Phymatotrichum omnivorum on cotton  

E-Print Network (OSTI)

P. omnivorum 23 First Experiment ? In Vitro Analysis of Hyphal Inhibition. Second Experiment - In Vitro Analysis of Inhib1tion of Sclerotial Germination. . . . . 23 24 Evaluation of the Release of Propiconazole from the Starch Matrices under... pesticide. . . . . . . . . . . . 14 Growth of Ph matotr1chum omnivorum hyphae on potato dextrose agar amended w1th decanted incubation water of slow release starch matrices with entrapped propiconazo le. . . . . . . . 46 Ouench curves for three starch...

Small, Theresa Marie

1984-01-01T23:59:59.000Z

91

Diabetic Nephropathy: Worldwide epidemic and effects of current treatment on natural history  

Science Journals Connector (OSTI)

Diabetic nephropathy has become a worldwide epidemic, accounting for approximately one third of all cases of end-stage renal disease. With increasing prevalence of diabetes particularly in Asia, and a global p...

Peter Rossing MD; DMSC

2006-01-01T23:59:59.000Z

92

Recent worldwide reviews of wastewater irrigation have demonstrated the contribution this widespread, and often  

E-Print Network (OSTI)

Recent worldwide reviews of wastewater irrigation have demonstrated the contribution. Policymakers and planners can maintain or increase the benefits of wastewater irrigation, while minimizing negative health and environmental impacts, by developing a realistic strategy for managing wastewater use

Scott, Christopher

93

Developing a tight gas sand advisor for completion and stimulation in tight gas reservoirs worldwide  

E-Print Network (OSTI)

DEVELOPING A TIGHT GAS SAND ADVISOR FOR COMPLETION AND STIMULATION IN TIGHT GAS RESERVOIRS WORLDWIDE A Thesis by KIRILL BOGATCHEV Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE December 2007 Major Subject: Petroleum Engineering DEVELOPING A TIGHT GAS SAND ADVISOR FOR COMPLETION AND STIMULATION IN TIGHT GAS RESERVOIRS WORLDWIDE A Thesis by KIRILL...

Bogatchev, Kirill Y

2008-10-10T23:59:59.000Z

94

Role of Streptococcus gordoniiAmylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation  

Science Journals Connector (OSTI)

...that both AbpA and amylase are required for maximal...defined media with potato starch as the predominant...wild-type strains on starch in the absence of amylase also suggests that...cooperation necessary to break down salivary glycoproteins...

Jeffrey D. Rogers; Robert J. Palmer Jr.; Paul E. Kolenbrander; Frank A. Scannapieco

2001-11-01T23:59:59.000Z

95

Kinetics of enzymatic starch liquefaction: simulation of the high molecular weight product distribution  

SciTech Connect

Enzymatic corn starch liquefaction with alpha-amylase was carried out. Molecular weight distributions of the resulting hydrolysates are presented using aqueous size exclusion chromatographic techniques. It is demonstrated that despite the fact that the enzyme employed reacts in a random endoacting manner, the product distributions are nonrandom. The results are explained in part by a multimerization process whereby the polymeric substrate molecules preferentially associate, forming intermolecular aggregates. These aggregates are either a consequence of the manner in which the material is deposited into the native granular structure of starch or due to intrinsic physical chemical properties of the polysaccharide. In the latter case, the results are shown to correspond to known multimerized amylose, although complete characterization of the polysaccharide is currently not available. The results presented are used to develop a simplified kinetic model of starch liquefaction and shown to simulate the product distributions accurately. 44 references.

Rollings, J.E.; Thompson, R.W.

1984-12-01T23:59:59.000Z

96

Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch  

SciTech Connect

Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

Fujii, M.; Kawamura, Y.

1985-03-01T23:59:59.000Z

97

Modulated Release of a Volatile Compound from Starch Matrixes via Enzymatically Controlled Degradation  

Science Journals Connector (OSTI)

The activity of the liquid enzyme formulation (protein content was 38 mg/mL) was 120 KNU/g of enzyme formulation (1 Kilo Novo alpha-amylase Unit, KNU, activity unit is the amount of enzyme which breaks down 5.26 g of starch/h at 37 °C to dextrins and oligosaccharides at pH 5.6 (as given in the Termamyl product data sheet by Novo Nordisk). ... Although the amount of water was minimized, ?-amylase started to break down the matrix during the encapsulation process. ... (GCWS) starches (waxy maize, normal maize, Hylon-5, and Hylon-7; amylose content <1, 28, 54, and 68%, resp.) ...

Gülden Y?lmaz; Gaye Öngen; Remy O. J. Jongboom; Herman Feil; Cees van Dijk; Wim E. Hennink

2002-01-05T23:59:59.000Z

98

2013 Survey of Non-Starch Ethanol and Renewable Hydrocarbon Biofuels Producers  

SciTech Connect

In order to understand the status of the industry for non-starch ethanol and renewable hydrocarbon biofuels as of the end of calendar year 2013, the National Renewable Energy Laboratory (NREL) conducted the first of what is anticipated to be an annual survey of U.S. non-starch ethanol and renewable hydrocarbon biofuels producers. This report presents the results of this initial survey and describes the survey methodology. Subsequent surveys will report on the progress over time of the development of these facilities and companies.

Schwab, A.; Geiger, J.; Lewis, J.

2015-01-01T23:59:59.000Z

99

The effects of storage on starch characteristics and chip quality of Texas Irish potatoes  

E-Print Network (OSTI)

THE EFFECTS OF STORAGE QN STARCH CHARACTERISTICS AND CHIP QUALITY OF TEXAS IRISH POTATOES A Thesis Roy Eric McDonald Submitted to the Graduate College of' the Te~s AEcM University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May& 1966 Major Subject: Horticulture THE EFFECTS OF STORAGE ON STARCH CHARACTERISTICS AND CHIP QUALITY OF TEXAS IRISH POTATOES A Thesis by Roy Eric McDonald Approved as to style and content by: (Chairman oi' ttee) (Heag...

McDonald, Roy E

1966-01-01T23:59:59.000Z

100

Characterization of Irradiated Starches by Using FT-Raman and FTIR Spectroscopy  

Science Journals Connector (OSTI)

Degradation of starch polymers resulting in decreased viscosity and increased water solubility, and increased acidity with increasing radiation doses are potential changes observed in irradiated starches. ... FT-Raman spectra were obtained using a Nicolet 870 spectrometer with the Raman module 32B (Madison, WI) and Nd:YAG laser operating at 1064 nm with a maximum power of 2 W. The system was equipped with an InGaAs (Indium?Gallium Arsenide) detector, XT-KBr beam-splitter with 180° reflective optics, and a fully motorized sample position adjustment feature. ...

Ramazan Kizil; Joseph Irudayaraj; Koushik Seetharaman

2002-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

The year open (energy) data went worldwide | OpenEI Community  

Open Energy Info (EERE)

The year open (energy) data went worldwide The year open (energy) data went worldwide Home > Groups > OpenEI Community Central Graham7781's picture Submitted by Graham7781(1992) Super contributor 9 March, 2010 - 10:39 imported OpenEI When we say that OpenEI is a Linked Data system, what does it really mean to you? In short, it means that OpenEI data can easily be connected to other data on the Web (in a standardized way). Okay, but what does that really mean to you? None other than the founder of the Web himself, Tim Berners-Lee, provided some examples to answer that question at a recent TED talk: TED 2010 Video: The year open data went worldwide And if you missed his talk from last year, it provides even more information on the importance of Linked Data: TED 2009 Video: Tim Berners-Lee on the next Web

102

A Report on Worldwide Hydrogen Bus Demonstrations, 2002-2007 | Open Energy  

Open Energy Info (EERE)

A Report on Worldwide Hydrogen Bus Demonstrations, 2002-2007 A Report on Worldwide Hydrogen Bus Demonstrations, 2002-2007 Jump to: navigation, search Tool Summary Name: A Report on Worldwide Hydrogen Bus Demonstrations, 2002-2007 Agency/Company /Organization: US DOT Focus Area: Vehicles Topics: Analysis Tools Website: www.fuelcells.org/wp-content/uploads/2012/02/busreport.pdf From 2002-2007 > 20 cities in the US, Europe, China, Japan & Australia demonstrated buses powered by fuel cells or hydrogen-fueled internal combustion engines. The resulting report analyzes lessons learned from the demonstrations, identifies key remaining challenges for introduction of the technology, & suggests potential roles for government in supporting commercialization of fuel cell buses. How to Use This Tool This tool is most helpful when using these strategies:

103

Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis  

SciTech Connect

Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.

Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer

2008-01-15T23:59:59.000Z

104

Continuous bioconversion of starch to ethanol by calcium-alginate immobilized enzymes and yeasts  

SciTech Connect

Continuous bioconversion of starch to EtOH by immobilized enzymes and yeasts was studied. Commercial corn starch (10%) was 1st batch-liquefied with bacterial alpha-amylase. In continuous-flow systems, liquefied starch was then converted to glucose with Ca alginate-entrapped fungal glucoamylase, and the resulting glucose was fermented to EtOH by Ca alginate-entrapped active dry yeast. The continuous-flow saccharification-fermentation processes were performed in either 2-stage (sequential) or single-stage (simultaneous) operations. In the single-stage operation, immobilized glucoamylase produced glucose from liquefied starch continuously for 11 days. In the simultaneous saccharification technique using immobilized glucoamylase and yeast mixture in a single-stage column, EtOH production was 69% of theoretical for 5 days. In the 2-stage operation, in which immobilized glucoamylase and yeast were contained in separate columns connected in tandem, EtOH production averaged 97% of theoretical for 5 days. The overall alcoholic production efficiency was significantly greater in the 2-stage system than in the single-stage system.

McGhee, J.E.; Carr, M.E.; St. Julian, G.

1984-01-01T23:59:59.000Z

105

Modeling of Turing Structures in the Chlorite—Iodide—Malonic Acid—Starch Reaction System  

Science Journals Connector (OSTI)

...through a column ofpolyacrylamide gel show that the latter do have significantly longer retention times. We may picture the Iions moving not in a simple gel but in a medium with many traps (gel-bound 12, starch) that capture I-for a period oftime...

ISTVÁN LENGYEL; IRVING R. EPSTEIN

1991-02-08T23:59:59.000Z

106

Water-soluble graft copolymers of starch-acrylamide and uses therefor  

DOE Patents (OSTI)

Graft copolymers having starch as the central chain with grafted side chains of acrylamide or acrylamide-acrylic acid, and a process for preparation of such copolymers in the presence of Ce.sup.+4 or other redox initiators. These copolymers are employed in preparing highly viscous aqueous solutions that are particularly useful in oil recovery from subterranean wells.

Butler, George B. (Gainesville, FL); Hogen-Esch, Thieo E. (Gainesville, FL); Meister, John J. (Dallas, TX); Pledger, Jr., Huey (Gainesville, FL)

1983-08-23T23:59:59.000Z

107

Solution structure of the granular starch binding domain of Aspergillus niger glucoamylase bound to -cyclodextrin  

E-Print Network (OSTI)

starch strands apart thus increasing the hydrolyzable surface, or alternatively it may localize to the catalytic domain is attached is flexible, allowing the catalytic site to access a large surface area Cellulomonas fimi has two noncatalytic binding domains that clearly bind to different ligands; xylan binds only

Williamson, Mike P.

108

Biodegradability and mechanical properties of poly-(beta-hydroxybutyrate-co-beta-hydroxyvalerate)-starch blends.  

Science Journals Connector (OSTI)

...A 400-ml inoculum from an anaerobic digester and an activated sludge unit was added...wt/wt) or 21% (vol/vol) starch. Wool et al. (13) described this relationship...Biotechnol. Tech. 4:221-226. 13. Wool, R. P., J. S. Peanasky, J. M...

B A Ramsay; V Langlade; P J Carreau; J A Ramsay

1993-04-01T23:59:59.000Z

109

Genetic dissection of floridean starch synthesis in the cytosol of the model dinoflagellate Crypthecodinium cohnii  

Science Journals Connector (OSTI)

...respectively, in amylose and amylopectin synthesis. They...hydrolases (amylases, glucosidases...enzymes, {alpha}-1,4...polysaccharide of amylose ({lambda...max of amylopectin. We confirmed...modification in amylopectin CL distribution...beta}-amylase and subjected...from the {alpha}-1,6...starches of high amylose mutants of...

David Dauvillée; Philippe Deschamps; Jean-Philippe Ral; Charlotte Plancke; Jean-Luc Putaux; Jimi Devassine; Amandine Durand-Terrasson; Aline Devin; Steven G. Ball

2009-01-01T23:59:59.000Z

110

Convergent Evolution of Polysaccharide Debranching Defines a Common Mechanism for Starch Accumulation in Cyanobacteria and Plants  

Science Journals Connector (OSTI)

...indirect DBE-like alpha-1,6 glucosidase...the presence of amylose, which yielded...from that of amylopectin-like polymers...by the starch amylopectin- or glycogen-containing...enzymes (e.g., amylases, branching enzymes, and alpha-1,4 glucanotransferase...

Ugo Cenci; Malika Chabi; Mathieu Ducatez; Catherine Tirtiaux; Jennifer Nirmal-Raj; Yoshinori Utsumi; Daiki Kobayashi; Satoshi Sasaki; Eiji Suzuki; Yasunori Nakamura; Jean-Luc Putaux; Xavier Roussel; Amandine Durand-Terrasson; Debashish Bhattacharya; Anne-Sophie Vercoutter-Edouart; Emmanuel Maes; Maria Cecilia Arias; Monica Palcic; Lyann Sim; Steven G. Ball; Christophe Colleoni

2013-10-25T23:59:59.000Z

111

Protein Phosphorylation in Amyloplasts Regulates Starch Branching Enzyme Activity and Proteinâ??Protein Interactions  

Science Journals Connector (OSTI)

...example, the amylose extender...in beta-amylase (EC 3...in beta-amylase migration...formation of alpha-(16)-branches in amylopectin, are regulated...Total Starch Amylose Fraction...mg of the alpha-amylase inhibitor...1948). Amylose and amylopectin fractionated...

Ian J. Tetlow; Robin Wait; Zhenxiao Lu; Rut Akkasaeng; Caroline G. Bowsher; Sergio Esposito; Behjat Kosar-Hashemi; Matthew K. Morell; Michael J. Emes

2004-02-18T23:59:59.000Z

112

Starch granule initiation is controlled by a heteromultimeric isoamylase in potato tubers  

Science Journals Connector (OSTI)

...limit-dextrinase, {alpha}-amylase, and {beta}-amylase (Table 2, which is published as supporting information...much lower than that for amylopectin from potato starch (see...and relative amounts of amylose and amylopectin were examined by gel permeation...

Regla Bustos; Brendan Fahy; Christopher M. Hylton; Robert Seale; N. Miranda Nebane; Anne Edwards; Cathie Martin; Alison M. Smith

2004-01-01T23:59:59.000Z

113

Starch composites reinforced by bamboo cellulosic crystals Dagang Liu a,c  

E-Print Network (OSTI)

Agricultural Center, Baton Rouge, LA 70803, USA a r t i c l e i n f o Article history: Received 9 March 2009, competitiveness in price, and applicability to various industries (Yang et al., 2007; Lenz, 1993; Pandey et al energy or by incorporation of a plasticizing agent (e.g., water, amide, and/or polyols), starch can

114

EFFECT OF HYDROTHERMAL TREATMENT ON PHYSICOCHEMICAL1 PROPERTIES OF WHEAT, WAXY AND STANDARD MAIZE STARCHES2  

E-Print Network (OSTI)

1 EFFECT OF HYDROTHERMAL TREATMENT ON PHYSICOCHEMICAL1 PROPERTIES OF WHEAT, WAXY AND STANDARD MAIZE.10.005 #12;2 ABSTRACT18 Standard maize (SMS), waxy maize (WMS) and wheat (WTS) starches were19 hydrothermally treated at three pressure levels. Effects of D.I.C. processing conditions20 on thermal characteristics

Paris-Sud XI, Université de

115

Dissection of Maize Kernel Composition and Starch Production by Candidate Gene Association  

Science Journals Connector (OSTI)

...where protein, oil, and starch compositions...Proportion of Variance Cumulative Variance Interpretation...NIR-1 0.34 0.34 Oil and protein accumulation...NIR-2 0.13 0.47 Oil production versus protein production...winterH and summerC field seasons. Cumulatively...

Larissa M. Wilson; Sherry R. Whitt; Ana M. Ibáñez; Torbert R. Rocheford; Major M. Goodman; Edward S. Buckler IV

2004-09-17T23:59:59.000Z

116

Climate shaped the worldwide distribution of human mitochondrial DNA sequence variation  

Science Journals Connector (OSTI)

...association with temperature, which appear...shape the current distribution of mtDNA sequences...selection|climate|temperature|human evolution...affecting mtDNA, with temperature being highlighted...Gyllensten 2007; Sun et al. 2007...directly modelling the distribution of worldwide mitochondrial...

2009-01-01T23:59:59.000Z

117

Spring 2011 Rube Goldberg's humerous cartoons have inspired students world-wide to have fun  

E-Print Network (OSTI)

Spring 2011 Rube Goldberg's humerous cartoons have inspired students world-wide to have fun, the undergraduates built their Rube Goldberg machine at the Learning Factory in the spring. Apart from the lumber an Archimedes screw to drive the water uphill, a Thompson's coil to activate a switch, and a diet coke

Demirel, Melik C.

118

For a Worldwide Leading Industrial Automation Company, we are looking for : Embedded Software Development Engineer  

E-Print Network (OSTI)

/skill · Heat radiation technology knowledge/skill · EMI suppression knowledge/skill · Safety Standard knowledgeFor a Worldwide Leading Industrial Automation Company, we are looking for : Embedded Software contribution to the complete development process, from concept, planning and embedded software designs

Segatti, Antonio

119

A worldwide survey of haplotype variation and linkage disequilibrium in the human genome  

E-Print Network (OSTI)

from 52 populations in the Human Genome Diversity Project (HGDP)-Centre d'Etude du Polymorphisme HumainA worldwide survey of haplotype variation and linkage disequilibrium in the human genome Donald F & Jonathan K Pritchard1 Recent genomic surveys have produced high-resolution haplotype information, but only

Jakobsson, Mattias

120

Introduction Water conservation is becoming increasingly important to many utilities worldwide. Not only are water  

E-Print Network (OSTI)

#12;Introduction Water conservation is becoming increasingly important to many utilities worldwide, to conserve. Utilities often use price structure and other demand side management tools to send a conservation be defined as the time period between billing. Most water utilities either use monthly (once a month), or bi

Mangel, Marc

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Database specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB)  

SciTech Connect

This Database Specification for the Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB) describes the database organization and storage allocation, provides the detailed data model of the logical and physical designs, and provides information for the construction of parts of the database such as tables, data elements, and associated dictionaries and diagrams.

Faby, E.Z.; Fluker, J.; Hancock, B.R.; Grubb, J.W.; Russell, D.L. [Univ. of Tennessee, Knoxville, TN (United States)] [Univ. of Tennessee, Knoxville, TN (United States); Loftis, J.P.; Shipe, P.C.; Truett, L.F. [Oak Ridge National Lab., TN (United States)] [Oak Ridge National Lab., TN (United States)

1994-03-01T23:59:59.000Z

122

Research Data Alliance (RDA) Accelerating Data Sharing and Exchange World-wide  

E-Print Network (OSTI)

Research Data Alliance (RDA) ­ Accelerating Data Sharing and Exchange World-wide Data Data Alliance (RDA) is an emerging international organization whose goal is to accelerate data-driven research and discovery. The Research Data Alliance is being formed to facilitate such efforts. Germinating

Varela, Carlos

123

Analyzing the Limits and Extent of Alpha-Amylase Catalyzed Removal of Starch-Based Filter Cake  

E-Print Network (OSTI)

The ability of starch to impart functions including fluid-loss control, cuttings transport, and rheological characteristics to water-based drilling fluids has led to its widespread use in the oil industry. The filter cake deposited by these drilling...

Dharwadkar, Pavan S.

2012-02-14T23:59:59.000Z

124

Trials and Tribulations of Ancient Starch Research: An Investigation of Contamination and Earth Ovens at Fort Hood, Texas  

E-Print Network (OSTI)

and control samples. Laboratory and field equipment were processed and analyzed for contamination. Only one feature (Feature 4 from 41 CV984) yielded starch granules that are unambiguously archaeological in origin, rather than the result of contamination...

Laurence, Andrew

2013-04-26T23:59:59.000Z

125

Fermentation of starch by Klebsiella oxytoca P2, containing plasmids with {alpha}-amylase and pullulanase genes  

SciTech Connect

Klebsiella oxytoca P2(pC46), an ethanol-producing recombinant, has been evaluated in fermentation of maltose and starch. The maximum ethanol produced by P2(pC46) was 0.34 g ethanol/g maltose and 0.38, 0.40, or 0.36 g ethanol/g starch in fermentation of 1, 2, or 4% starch, representing 68, 71, and 64% the theoretical yield. The pC46 plasmid transformed to cells of K. oxytoca P2 reduced the ethanol production from maltose and starch. In fermentation of starch after its digestion at 60 C for 24 h, in two-step fermentation, the time for maximum ethanol production was reduced to 12--24 h and the theoretical yield was around 90%. The increase in starch concentration resulted in lower {alpha}-amylase activity but in higher pullulanase activity. The high activity and thermostability of the amylolytic enzymes from this transformant suggest that it has a potential for amylolytic enzymes source.

Santos, V.L. dos; Araujo, E.F.; Barros, E.G. de; Guimaraes, W.V.

1999-12-20T23:59:59.000Z

126

Development of rapidly fermenting strains of Saccharomyces diastaticus for direct conversion of starch and dextrins to ethanol  

SciTech Connect

Alcoholic fermentation, growth, and glucoamylase production by 12 strains of Saccharomyces diastaticus were compared by using starch and dextrins as substrates. Haploid progeny produced from a rapidly fermenting strain, SD2, were used for hybridization with other S. diastaticus and Saccharomyces cerevisiae haploids. Alcoholic fermentation and enzyme production by hybrid diploids and their haploid parents were evaluated. Although the dosage of the STA or DEX (starch or dextrin fermentation) genes may enhance ethanol production, epistatic effects in certain strain combinations caused decreases in starch-fermenting activity. Both the nature of the starch or dextrin used and the fermentation medium pH had substantial effects on alcohol production. Commercial dextrin was not as good a substrate as dextrins prepared by digesting starch with ..cap alpha..-amylase. Crude manioc starch digested by ..cap alpha..-amylase was fermented directly by selected hybrids with almost 100% conversion efficiency. The manioc preparation contained adequate minerals and growth factors. This procedure should be suitable for direct commercial application in manioc-producing regions in Brazil and elsewhere. A rapidly fermenting haploid strain, SD2-A8, descended from strain SD2, contains two unlinked genes controlling formation of extracellular amylase. A convenient method for detecting these genes (STA genes) in replica plates containing large numbers of meiotic progeny was developed.

Laluce, C.; Mattoon, J.R.

1984-07-01T23:59:59.000Z

127

The Effects of Sorghum [Sorghum Bicolor (L.) Moench] Phenolic Compounds on Starch Digestibility of Porridges  

E-Print Network (OSTI)

of whole sorghum grain and ground whole sorghum grain. ............ 24 4. b* values of whole sorghum grain and ground whole sorghum grain. ............ 25 5. The residue of whole sorghum grain porridges after 18 h bacterial alpha amylase digestion.... Davis and Hoseney (1979) reported that tannins isolated from sorghum grain inhibited the enzyme alpha-amylase, and they also bind to the starch granule to varying degrees. Daiber (1975) and Beta et al (2000) found that condensed tannins inactivated...

Austin, Dilek

2010-01-14T23:59:59.000Z

128

Prececal, postileal and total tract starch digestion in ponies fed corn, oats, barley or sorghum grain  

E-Print Network (OSTI)

Barley Oats Corn Sorghum Sorghum Barley Oats Corn Whole grains were purchased from a local commercial supplier. All grains were elevator run. Prior to ration formulation grains were coarsely cracked in an automatic roller mill..., chromium and starch by the same procedures except 5 ml of wet sample was used for each analy- For determination of amylase content and viscosity, grains were pulverized in a laboratory Udy mill through a 1 mm screen. An alkaline hydroylsate was prepared...

Arnold, Fairfax Ferguson

2012-06-07T23:59:59.000Z

129

Process of converting starch to glucose and glucose to lactic acid  

SciTech Connect

This document describes a method for converting starch into lactic acid of sufficient purity for use as a substrate for biodegradable plastics. The process is designed to work on industrial food waste streams such as potato wastes or cheese whey permeate. For potato waste, {alpha}-amylase and calcium chloride are added to the starch containing waste and incubated at a pH of 4--7, a temperature of 90--130{degree}C, and a pressure above 15 psi for not less than 15 minutes. At this point, glucoamylase is added and the mixture is incubated at a temperature of 50--70{degree}C and a pH below 6.5 for 4 hours. This results in the conversion of more than 90% of the starch into glucose, which is substantially free of microbial contamination. The hydrolysate is filtered, and introduced with additional nutrients to a fermentor containing a lactose producing microorganism to form a fermentation broth. This results in the fermentation of glucose to lactose, which is filtered and subjected to electrodialysis for purification. Conversion of glucose to lactic acid or lactate occurs with an efficiency of over 95%. 1 fig. (MHB)

Tsai, TenLin; Sanville, C.Y.; Coleman, R.D.; Schertz, W.W.

1990-12-31T23:59:59.000Z

130

Process of converting starch to glucose and glucose to lactic acid  

SciTech Connect

This document describes a method for converting starch into lactic acid of sufficient purity for use as a substrate for biodegradable plastics. The process is designed to work on industrial food waste streams such as potato wastes or cheese whey permeate. For potato waste, {alpha}-amylase and calcium chloride are added to the starch containing waste and incubated at a pH of 4--7, a temperature of 90--130{degree}C, and a pressure above 15 psi for not less than 15 minutes. At this point, glucoamylase is added and the mixture is incubated at a temperature of 50--70{degree}C and a pH below 6.5 for 4 hours. This results in the conversion of more than 90% of the starch into glucose, which is substantially free of microbial contamination. The hydrolysate is filtered, and introduced with additional nutrients to a fermentor containing a lactose producing microorganism to form a fermentation broth. This results in the fermentation of glucose to lactose, which is filtered and subjected to electrodialysis for purification. Conversion of glucose to lactic acid or lactate occurs with an efficiency of over 95%. 1 fig. (MHB)

Tsai, TenLin; Sanville, C.Y.; Coleman, R.D.; Schertz, W.W.

1990-01-01T23:59:59.000Z

131

Preparation and characterization of bionanocomposite films based on potato starch/halloysite nanoclay  

Science Journals Connector (OSTI)

Abstract In this research casting method was used to prepare potato starch based bio-nanocomposite films with halloysite nanoclay as the reinforcing materials. The composition included potato starch with 40% (w/w) of a mixture of sorbitol/glycerol (weight ratio of 3 to 1as plasticizer) with nanoclay (0–5% w/w). The films were dried under controlled conditions. Physicochemical properties such as solubility in water, water absorption capacity (WAC), water vapour permeability (WVP), oxygen permeability, and mechanical properties of the films were measured. Results showed that by increasing the concentration of nanoclay, mechanical properties of films were improved. Tensile strength was increased from 7.33 to 9.82 MPa, and elongation at break decreased from 68.0 to 44.0%. Solubility in water decreased from 35 to 23%, and heat seal strength increased from 375 to 580 N/m. Also incorporation of clay nanoparticles in the structure of biopolymer decreased permeability of the gaseous molecules. In summary, addition of halloysite nanoclay, improve the barrier and mechanical properties of potato starch films and this bionanocomposites have high potential to be used for food packaging purposes.

Fatemeh Sadegh-Hassani; Abdorreza Mohammadi Nafchi

2014-01-01T23:59:59.000Z

132

Determination of the structural changes by Raman and {sup 13}C CP/MAS NMR spectroscopy on native corn starch with plasticizers  

SciTech Connect

The plasticizing - antiplasticizing effect of water and glycerol contents on native corn starch samples is investigated by FT-Raman and {sup 13}C CP/MAS NMR spectroscopy. The presence of both amorphous and crystalline structural phases was evidenced in pure native corn starch and also in the samples containing plasticizers. Among the crystalline starch structures, the A- and V- types were suggested by CP/MAS NMR spectra.

Cozar, O. [Academy of Romanian Scientists, Splaiul Independentei 54, 050094, Bucharest, Romania and National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch (Romania)] [Academy of Romanian Scientists, Splaiul Independentei 54, 050094, Bucharest, Romania and National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch (Romania); Filip, C.; Tripon, C. [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania)] [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania); Cioica, N.; Co?a, C.; Nagy, E. M. [National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch, RO-400458 Cluj-Napoca (Romania)] [National Institute of Research-Development for Machines and Installations Designed to Agriculture and Food Industry - INMA Bucure?ti - Cluj-Napoca Branch, RO-400458 Cluj-Napoca (Romania)

2013-11-13T23:59:59.000Z

133

Genome of the Cyanobacterium Microcoleus vaginatusFGP-2, a Photosynthetic Ecosystem Engineer of Arid Land Soil Biocrusts Worldwide  

Science Journals Connector (OSTI)

...vaginatusFGP-2, a Photosynthetic Ecosystem Engineer of Arid Land Soil Biocrusts Worldwide...inputs (1). The improved high-quality draft (4) genome of M. vaginatusstrain...FGP-2, a photosynthetic ecosystem engineer of arid land soil biocrusts worldwide...

Shawn R. Starkenburg; Krista G. Reitenga; Tracey Freitas; Shannon Johnson; Patrick S. G. Chain; Ferran Garcia-Pichel; Cheryl R. Kuske

2011-06-24T23:59:59.000Z

134

Microsoft Word - questionaire.doc  

U.S. Energy Information Administration (EIA) Indexed Site

1 Residential Energy Consumption Survey 1 Residential Energy Consumption Survey Form EIA-457A (2001)--Household Questionnaire OMB No.: 1905-0092, Expiring February 29, 2004 i U.S. Department of Energy Energy Information Administration 2001 Residential Energy Consumption Survey Household Questionnaire Final and Fielded Version Do Not Use Any Other Version that Does Not Include this Notice INTRODUCTION TO INTERVIEW Hello, I am __________________________ from Roper Starch Worldwide Inc., a social science research firm. We are conducting a study for the U.S. Department of Energy about energy consumption in homes. Although your participation is voluntary, we hope you will participate in this important study of energy usage. Your identity and all the responses you give me will be kept strictly confidential. The survey will take about 40 minutes.

135

2001 Residential Energy Consumption Survey Form EIA-457C (2001)--Rental Agents, Landlords, and Apartment Managers Questionnaire  

U.S. Energy Information Administration (EIA) Indexed Site

Form EIA-457C (2001)--Rental Agents, Landlords, and Apartment Managers Questionnaire OMB No. 1905-0092, Expiring March 31, 200X i U.S. Department of Energy Energy Information Administration 2001 Residential Energy Consumption Survey Rental Agents, Landlords, and Apartment Managers Questionnaire INTRODUCTION TO INTERVIEW Hello, I am __________________________ from Roper Starch Worldwide Inc., a social science research firm. We are conducting a study for the U.S. Department of Energy about energy consumption in homes. Although your participation is voluntary, we hope you will participate in this important study of energy usage. Your identity and all the responses you give me will be kept strictly confidential. The survey will take about 15 minutes.

136

14 - Economic factors affecting coal preparation: plant design worldwide and case studies illustrating economic impact  

Science Journals Connector (OSTI)

Abstract: The economic drivers behind the differences in design of plants treating coal destined for thermal and metallurgical coal markets worldwide are considered. Differences between plant designs in Australia, South Africa and the United States for both coal types will be discussed. Environmental constraints on plant design will be reviewed, in particular the means of dealing with ‘dry rejects disposal’ and water scarcity. Dealing with the ever-deteriorating quality of plant feed material, with the inevitable increase in near density material, will also be considered.

P.J. Bethell

2013-01-01T23:59:59.000Z

137

EFFECT OF ENDOSPERM HARDNESS ON AN ETHANOL PROCESS USING A GRANULAR STARCH HYDROLYZING ENZYME  

SciTech Connect

Granular starch hydrolyzing enzymes (GSHE) can hydrolyze starch at low temperature (32°C). The dry grind process using GSHE (GSH process) has fewer unit operations and no changes in process conditions (pH 4.0 and 32°C) compared to the conventional process because it dispenses with the cooking and liquefaction step. In this study, the effects of endosperm hardness, protease, urea, and GSHE levels on GSH process were evaluated. Ground corn, soft endosperm, and hard endosperm were processed using two GSHE levels (0.1 and 0.4 mL per 100 g ground material) and four treatments of protease and urea addition. Soft and hard endosperm materials were obtained by grinding and sifting flaking grits from a dry milling pilot plant; classifications were confirmed using scanning electron microscopy. During 72 h of simultaneous granular starch hydrolysis and fermentation (GSHF), ethanol and glucose profiles were determined using HPLC. Soft endosperm resulted in higher final ethanol concentrations compared to ground corn or hard endosperm. Addition of urea increased final ethanol concentrations for soft and hard endosperm. Protease addition increased ethanol concentrations and fermentation rates for soft endosperm, hard endosperm, and ground corn. The effect of protease addition on ethanol concentrations and fermentation rates was most predominant for soft endosperm, less for hard endosperm, and least for ground corn. Samples (soft endosperm, hard endosperm, or corn) with protease resulted in higher (1.0% to 10.5% v/v) ethanol concentration compared to samples with urea. The GSH process with protease requires little or no urea addition. For fermentation of soft endosperm, GSHE dose can be reduced. Due to nutrients (lipids, minerals, and soluble proteins) present in corn that enhance yeast growth, ground corn fermented faster at the beginning than hard and soft endosperm.

P. Wang; W. Liu, D. B; Johnston, K. D; Rausch, S. J; Schmidt, M. E; Tumbleson, V. Singh

2010-01-01T23:59:59.000Z

138

An Image and Video Search Engine for the World-Wide Web John R. Smith and Shih-Fu Chang  

E-Print Network (OSTI)

An Image and Video Search Engine for the World-Wide Web John R. Smith and Shih-Fu Chang Department of Electrical Engineering and Center for Image Technology for New Media Columbia University, New York, N

Chang, Shih-Fu

139

Investigation of potato starch and sonicated RAS as alternative carbon sources for biological nitrogen removal  

Science Journals Connector (OSTI)

High nitrogen discharge from wastewater impacts negatively on the marine environment. Under the South Australian Environmental Improvement Program, metropolitan wastewater treatment plants are reconfigured to meet the new nitrogen discharge guideline. The denitrification process is carbon limited with carbon supplementation required to meet discharge guidelines, hence molasses is used for carbon source. Although molasses is inexpensive, other carbon sources particularly industrial waste potato starch and sonicated Return Activated Sludge (RAS) are explored. Research to evaluate soluble carbon release is quantified and preliminary results are presented suggesting that sonicated RAS may be an attractive substitute for molasses.

Gideon Kuncoro; Yung Ngothai; Uwe Kaeding; David Sweeney; Brian O'Neill

2009-01-01T23:59:59.000Z

140

Starch characteristics of selected grain sorghums as related to human foods  

E-Print Network (OSTI)

with Watson (25) . The exception, number 17, was the sugary endosperm Kafir type, SA-5023-0-1-2. It contained 58 per cent total starch and was significantly different from the others (Table 4). Con- sidering that the total carbohydrate content of this type... IO I I \\Cl CI I S . ~ '0 N O Cl 20 The amylose percentages revealed significant differences ( Table 4). The waxy types, numbers 1, 2, 3, and 5, contained very little amylose. This agrees with Watson (25). The highest amylose content...

Miller, Oliver Harrell

2012-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Potential of waxy sorghum and modified starches in production of Chinese Lunar New Year Cake  

E-Print Network (OSTI)

BQQ -99Q 220 c Le" s than 30 Unit Chain Leng th of. End Grouo (4 of glucose) Swelling Power at 95 C o Retrogr ada. tion of gel 20 ? 2B 56f S 1 owg Slowg a: V' dal, A. J. and Juliano, B. O. (5) b: JuI iano, B. O. et al. (13) c: PaI miano, E... of amylopectin and the gran- ular structure of amylopectin were the two main factor s af- fecting the free ze-thaw stability of cereal starch gels. The physical structure, chemical composition and physicochemical properties of waxy sor ghum have not been...

Kuo, Chung-Kung Mike

2012-06-07T23:59:59.000Z

142

Design plan for development of the worldwide port system (WPS) regional integrated cargo database (ICDB)  

SciTech Connect

The Worldwide Port System (WPS) Regional Integrated Cargo Database (ICDB) is a major military computer system that provides visibility over international cargo. Development started in early 1993 and implementation began on the West Coast in August of 1995. The Design Plan coordinated developmental efforts for the ICDB and its related processes. A Design Plan was especially important because the ICDB was developed at multiple sites by Oak Ridge National Laboratory and Military Traffic Management Command personnel. A Design Plan was essential to ensure that a consistent design was maintained throughout all modules, that functional and technical requirements were accomplished, that all components and processes worked together successfully, and that the development schedule was met. This plan described ICDB modules and tasks within each module. It documented responsibilities and dependencies by module and presented a schedule for development, testing, and integration.

Truett, L.F.; Rollow, J.P.; Shipe, P.C.

1995-11-01T23:59:59.000Z

143

Overexpression of the maize Corngrass1 microRNA prevents flowering, improves digestibility, and increases starch content of switchgrass  

Science Journals Connector (OSTI)

...accumulates in stems.Cg1 switchgrass aerial stems store starch and initiate both roots...maize . Plant Cell 6 : 1343 – 1355 . 28 Fukushima RS Hatfield RD ( 2004 ) Comparison of the acetyl bromide...CAAGTGCTACGGCAAGGAGG CGTGAGGGTCATTGTCTTCTGC 1. Fukushima RS, Hatfield RD (2004) Comparison...

George S. Chuck; Christian Tobias; Lan Sun; Florian Kraemer; Chenlin Li; Dean Dibble; Rohit Arora; Jennifer N. Bragg; John P. Vogel; Seema Singh; Blake A. Simmons; Markus Pauly; Sarah Hake

2011-01-01T23:59:59.000Z

144

INFLUENCE OF D.I.C HYDROTHERMAL PROCESS CONDITIONS ON THE GELATINIZATION PROPERTIES OF STANDARD MAIZE STARCH  

E-Print Network (OSTI)

INFLUENCE OF D.I.C HYDROTHERMAL PROCESS CONDITIONS ON THE GELATINIZATION PROPERTIES OF STANDARD ABSTRACT Standard maize starch was hydrothermally treated at residual moisture content (~12 %) by Instantaneous Controlled Pressure Drop for various pressure levels and processing times. In order to examine

Paris-Sud XI, Université de

145

Structure of the Arabidopsis Glucan Phosphatase LIKE SEX FOUR2 Reveals a Unique Mechanism for Starch Dephosphorylation  

Science Journals Connector (OSTI)

...diets and a key constituent in many manufacturing processes. Starch is composed of two...F162A/W136A/R157A/F261A) show additive effects, implying that the sites function...physicochemical properties, thus enhancing manufacturing of feedstock for both food and nonfood...

David A. Meekins; Hou-Fu Guo; Satrio Husodo; Bradley C. Paasch; Travis M. Bridges; Diana Santelia; Oliver Kötting; Craig W. Vander Kooi; Matthew S. Gentry

2013-06-28T23:59:59.000Z

146

Apple Maturity Protocol Tests for apple flesh firmness and starch conversion are important tools for monitoring crop  

E-Print Network (OSTI)

Apple Maturity Protocol Tests for apple flesh firmness and starch conversion are important tools for monitoring crop maturity. Flesh firmness, as measured with a pressure gauge, determines how long apples can adequate firmness for fresh market or processing uses. A second common assay for apple maturity

147

Worldwide outdoor round robin study of organic photovoltaic devices and modules  

Science Journals Connector (OSTI)

Abstract Accurate characterization and reporting of organic photovoltaic (OPV) device performance remains one of the important challenges in the field. The large spread among the efficiencies of devices with the same structure reported by different groups is significantly caused by different procedures and equipment used during testing. The presented article addresses this issue by offering a new method of device testing using “suitcase sample” approach combined with outdoor testing that limits the diversity of the equipment, and a strict measurement protocol. A round robin outdoor characterization of roll-to-roll coated OPV cells and modules conducted among 46 laboratories worldwide is presented, where the samples and the testing equipment were integrated in a compact suitcase that served both as a sample transportation tool and as a holder and test equipment during testing. In addition, an internet based coordination was used via plasticphotovoltaics.org that allowed fast and efficient communication among participants and provided a controlled reporting format for the results that eased the analysis of the data. The reported deviations among the laboratories were limited to 5% when compared to the Si reference device integrated in the suitcase and were up to 8% when calculated using the local irradiance data. Therefore, this method offers a fast, cheap and efficient tool for sample sharing and testing that allows conducting outdoor measurements of OPV devices in a reproducible manner.

Morten V. Madsen; Suren A. Gevorgyan; R. Pacios; J. Ajuria; I. Etxebarria; Jeff Kettle; Noel D. Bristow; Marios Neophytou; Stelios A. Choulis; Lucimara Stolz Roman; Teketel Yohannes; Andrea Cester; Pei Cheng; Xiaowei Zhan; Jiang Wu; Zhiyuan Xie; Wei-Chen Tu; Jr-Hau He; Christopher J Fell; Kenrick Anderson; Martin Hermenau; Davide Bartesaghi; L. Jan Anton Koster; Florian Machui; Irene González-Valls; Monica Lira-Cantu; Petr P. Khlyabich; Barry C. Thompson; Ritu Gupta; Kiruthika Shanmugam; Giridhar U. Kulkarni; Yulia Galagan; Antonio Urbina; Jose Abad; Roland Roesch; Harald Hoppe; P. Morvillo; E. Bobeico; Eugen Panaitescu; Latika Menon; Qun Luo; Zhenwu Wu; Changqi Ma; Artak Hambarian; Varuzhan Melikyan; M. Hambsch; Paul L. Burn; Paul Meredith; Thomas Rath; Sebastian Dunst; Gregor Trimmel; Giorgio Bardizza; Harald Müllejans; A.E. Goryachev; Ravi K. Misra; Eugene A. Katz; Katsuhiko Takagi; Shinichi Magaino; Hidenori Saito; Daisuke Aoki; Paul M. Sommeling; Jan M. Kroon; Tim Vangerven; Jean Manca; Jurgen Kesters; Wouter Maes; Olga D. Bobkova; Vasily A. Trukhanov; Dmitry Yu. Paraschuk; Fernando A. Castro; James Blakesley; Sachetan M Tuladhar; Jason Alexander Röhr; Jenny Nelson; Jiangbin Xia; Elif Alturk Parlak; Tülay Asl? Tumay; Hans-Joachim Egelhaaf; David M. Tanenbaum; Gretta Mae Ferguson; Robert Carpenter; Hongzheng Chen; Birger Zimmermann; Lionel Hirsch; Guillaume Wantz; Ziqi Sun; Pradeep Singh; Chaitnya Bapat; Ton Offermans; Frederik C. Krebs

2014-01-01T23:59:59.000Z

148

Survey of Worldwide Light Water Reactor Experience with Mixed Uranium-Plutonium Oxide Fuel  

SciTech Connect

The US and the Former Soviet Union (FSU) have recently declared quantities of weapons materials, including weapons-grade (WG) plutonium, excess to strategic requirements. One of the leading candidates for the disposition of excess WG plutonium is irradiation in light water reactors (LWRs) as mixed uranium-plutonium oxide (MOX) fuel. A description of the MOX fuel fabrication techniques in worldwide use is presented. A comprehensive examination of the domestic MOX experience in US reactors obtained during the 1960s, 1970s, and early 1980s is also presented. This experience is described by manufacturer and is also categorized by the reactor facility that irradiated the MOX fuel. A limited summary of the international experience with MOX fuels is also presented. A review of MOX fuel and its performance is conducted in view of the special considerations associated with the disposition of WG plutonium. Based on the available information, it appears that adoption of foreign commercial MOX technology from one of the successful MOX fuel vendors will minimize the technical risks to the overall mission. The conclusion is made that the existing MOX fuel experience base suggests that disposition of excess weapons plutonium through irradiation in LWRs is a technically attractive option.

Cowell, B.S.; Fisher, S.E.

1999-02-01T23:59:59.000Z

149

1982 worldwide pipeline construction will top 21,900 miles, $9. 5 billion  

SciTech Connect

Reports that pipeline construction slowed slightly in 1982 because of lowered economic activity worldwide, with an upturn forecast for 1983. Explains that need for new pipelines to transport increasing amounts of oil and gas energy now being discovered, plus use of pipelines to transport other commodities in increasing amounts, has created a backlog of demand for facilities. Indicates that commodities suited for pipeline transport and getting consideration include crude oil; refined products; natural gas liquids; LPG; coal slurries; carbon dioxide (used for enhanced oil recovery); chemicals such as ammonia, ethane, ethylene, and similar petrochemical feedstocks; industrial gases such as oxygen, nitrogen; and solids slurries such as ores, wood chips, and other non-soluble minerals, even items such as wood chips and wood pulp for paper-making. Reveals that there are 10,396 miles of coal slurry pipeline planned for the US and 500 miles in Canada. Major US projects underway in the gas pipeline field include the 797-mile, 36-in. Trailblazer system in Nebraska, Wyoming, Colorado, and Utah. Products/ LPG/NGL pipelines underway include 105 miles of dual 4 and 6-in. line in Kansas. Crude pipeline activity includes 100 miles of 12-in. in California and 80 miles of 4 thru 40-in. in Alaska on the North Slope. Updates plans in Canada, Scotland, Denmark, Ireland, France, the Middle East, Australia, Southeast Asia, Mexico, South America and the USSR.

Hall, D.

1982-07-01T23:59:59.000Z

150

Abstract. Breast cancer is the most common cancer in women worldwide. Transformation of a normal cell to a malignant one  

E-Print Network (OSTI)

Abstract. Breast cancer is the most common cancer in women worldwide. Transformation of a normal regulators of growth. Biomarkers associated with cancer were examined in human breast epithelial cells transformed by high-LET radiation in the presence of 17Ã?-estradiol. An established cancer model was used

151

A Joint Programme of: "Water will remain a strategic resource for countries worldwide, and the quest for water  

E-Print Network (OSTI)

A Joint Programme of: "Water will remain a strategic resource for countries worldwide, and the quest for water sustainability will become increasingly intricate and delicate. A keen understanding of governance issues and policy options will continue to be a key consideration to better water resource

Chaudhuri, Sanjay

152

For a Worldwide Leading Industrial Automation Company, we are looking for: Electronics and Power Electronics Development Engineer  

E-Print Network (OSTI)

For a Worldwide Leading Industrial Automation Company, we are looking for: Electronics and Power Electronics Development Engineer in Barcelona In this position the candidate will join the Global Development with Software and System Test Engineers, with colleagues from Marketing, Sales and Production

Segatti, Antonio

153

Fermilab FERMILAB-TM-2175 July 2002 SAM Managed Cache and Processing for Clusters in a Worldwide  

E-Print Network (OSTI)

Fermilab FERMILAB-TM-2175 July 2002 SAM Managed Cache and Processing for Clusters in a Worldwide, Sinisa Veseli, Stephen White, Victoria White Fermilab, Batavia, Illinois, USA *Northwestern University at Fermilab as a versatile, distributed, data management system. One of its many features is its ability

154

Abstract-Electricity transmission planning does not have a common solution worldwide, with most countries trusting on  

E-Print Network (OSTI)

Abstract- Electricity transmission planning does not have a common solution worldwide, with most-growing conditions of the Chilean energy market, driven by private agents, meant the need to introduce changes issue in the restructuring of the electricity market all over the world. Transmission systems costs

Catholic University of Chile (Universidad Católica de Chile)

155

Observed reductions of surface solar radiation at Sites in the United States and worldwide from 1961 to 1990  

E-Print Network (OSTI)

and there is room for further improvement (World Climate Research Programme, 1991). 2. All Sky Solar Radiation Here I use a new quality-tested global database of monthly mean surface solar radiation time seriesObserved reductions of surface solar radiation at Sites in the United States and worldwide from

156

Searching for Images and Videos on the World-Wide Web John R. Smith and Shih-Fu Chang  

E-Print Network (OSTI)

Searching for Images and Videos on the World-Wide Web John R. Smith and Shih-Fu Chang Department of Electrical Engineering and Center for Image Technology for New Media, Columbia University, New York, N-Wide Web. #12;John R. Smith and Shih-Fu Chang 1 1 Introduction A large number of catalogs and search

Chang, Shih-Fu

157

Distinct Characteristics of Single Starch-Binding Domain SBD1 Derived from Tandem Domains SBD1-SBD2 of Halophilic Kocuria varians Alpha-Amylase  

Science Journals Connector (OSTI)

Kocuria varians alpha-amylase contains tandem starch-binding domains SBD1-SBD2...Escherichia coli. The circular dichroism (CD) spectrum of His-SBD12 was characterized by a positive peak at 233 nm...

Rui Yamaguchi; Tsutomu Arakawa; Hiroko Tokunaga; Matsujiro Ishibashi…

2012-03-01T23:59:59.000Z

158

β-AMYLASE4, a Noncatalytic Protein Required for Starch Breakdown, Acts Upstream of Three Active β-Amylases in Arabidopsis Chloroplasts  

Science Journals Connector (OSTI)

...clarified. Two enzymes, alpha-amylase and beta-amylase, could potentially produce...through the hydrolysis of amylopectin and amylose, the glucans that constitute starch. alpha-Amylase is an endohydrolase and...

Daniel C. Fulton; Michaela Stettler; Tabea Mettler; Cara K. Vaughan; Jing Li; Perigio Francisco; Manuel Gil; Heike Reinhold; Simona Eicke; Gaëlle Messerli; Gary Dorken; Karen Halliday; Alison M. Smith; Steven M. Smith; Samuel C. Zeeman

2008-04-04T23:59:59.000Z

159

Use of functionalized metallocene copolymers from ethylene and polar olefins as compatibilizers for low-density-polyethylene/starch and low-density-polyethylene/dextran blends .  

E-Print Network (OSTI)

??Functionalized metallocene copolymers synthesized from ethylene with 5-hexen-1-ol and ethylene with 10-undecen-1-ol were used as compatibilizers in LDPE/starch and LDPE/dextran blends in order to improve… (more)

Domínguez Barceló, Ana María

2006-01-01T23:59:59.000Z

160

U.S. DEPARTMENT OF COMMERCE DANIEL C. ROPER, Secretary  

E-Print Network (OSTI)

science in the fields of biology, technology, economic and tati tic of the fi heries. They are distributed un1l supply them at adverli ed prices. Statistical Bulletins.- tati tical bulletin cover (a) tati tic tic of fishery product landed at Bo ton and Glouce ter, Mas ., Portland, Maine, and eattle, Wa h

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Highly exfoliated eco-friendly thermoplastic starch (TPS)/poly (lactic acid)(PLA)/clay nanocomposites using unmodified nanoclay  

Science Journals Connector (OSTI)

Abstract Highly exfoliated, biodegradable thermoplastic starch (TPS)/polylactic acid (PLA)/sodium montmorillonite (NaMMT) nanocomposites were prepared by an eco-friendly approach, involving in-situ gelatinization of potato starch in presence of dispersed nanoclay followed by melt mixing with PLA. The morphological analysis revealed that the NaMMT was selectively dispersed into the TPS in a highly delaminated manner. An increase in mechanical as well as thermomechanical properties was evident in the presence of PLA and more influenced in the presence of clay. The water absorption was significantly decreased in the presence of PLA (?8%) itself and both PLA and clay (?8–12%) in the nanocomposites. The improved mechanical properties along with its biodegradability might lead to a new green material in the area of packaging.

Ayana B.; Supratim Suin; B.B. Khatua

2014-01-01T23:59:59.000Z

162

Evaluation of Exogenous Enzymes Targeting Non-starch Polysaccharides in Reduced Energy Diets on Broiler Growth Performance and Processing Parameters  

E-Print Network (OSTI)

(Bedford, 2000). The inclusion of xylanase, protease, or amylase improves FCR, increases AME, and starch digestibility in cereal grain diets (Choct et al., 1999; Kalmendal and Tauson, 2012; O’Neill et al., 2012). The inclusion of xylanase significantly.... Short contact time can lead to less absorption of these longer chain polysaccharides, representing a loss in digestible energy for the bird. Additionally, the inability for broilers to break down nutrients entrapped in the matrix of cell walls of feed...

Klein, Joseph Thomas

2013-12-04T23:59:59.000Z

163

Artocarpus heterophyllus L. seed starch-blended gellan gum mucoadhesive beads of metformin \\{HCl\\}  

Science Journals Connector (OSTI)

Abstract Jackfruit (Artocarpus heterophyllus Lam., family: Moraceae) seed starch (JFSS)–gellan gum (GG) mucoadhesive beads containing metformin \\{HCl\\} were developed through ionotropic gelation technique. The effect of GG to JFSS ratio and CaCl2 concentration on the drug encapsulation efficiency (DEE, %) and cumulative drug release at 10 h (R10h, %) was optimized and analyzed using response surface methodology based on 32 factorial design. The optimized JFSS–GG beads containing metformin \\{HCl\\} showed DEE of 92.67 ± 4.46%, \\{R10h\\} of 61.30 ± 2.37%, and mean diameter of 1.67 ± 0.27 mm. The optimized beads showed pH-dependent swelling and mucoadhesivity with the goat intestinal mucosa. The in vitro drug release from all these JFSS–GG beads containing metformin \\{HCl\\} was followed zero-order pattern (R2 = 0.9907–0.9975) with super case-II transport mechanism over a period of 10 h. The beads were also characterized by SEM and FTIR. The optimized JFSS–GG beads containing metformin \\{HCl\\} exhibited significant hypoglycemic effect in alloxan-induced diabetic rats over prolonged period after oral administration.

Amit Kumar Nayak; Dilipkumar Pal; Kousik Santra

2014-01-01T23:59:59.000Z

164

Sorbitol accumulation in male and female rats consuming starch or fructose diets with or without copper  

SciTech Connect

The present study was designed to examine the relationship between the sex of the rats, tissue sorbitol accumulation and copper deficiency in rats consuming dietary fructose. Rats were provided with a diet containing either 62.7% fructose or starch, and either 6.0 or 0.6 {mu}g copper/g for three weeks. Hepatic copper concentration of all rats consuming the copper-deficient diets was about 40% of copper sufficient rats. Hepatic, renal and thymic sorbitol concentrations were significantly elevated in males consuming the fructose, copper-deficient diet when compared to all other dietary groups regardless of the sex of the rat. Hepatic, renal the thymic fructose concentrations were significantly higher in rats eating fructose as compared to female rats. Hepatic glucose concentration was higher in males and females consuming the fructose, copper-deficient diet when compared to all other dietary groups. Renal glucose concentration was elevated in males as compared to females. These results demonstrate that the pathology and complications of copper deficiency in the male rat consuming fructose closely parallel aberration in tissue sorbitol accumulation.

Lewis, C.G.; Fields, M.; Beal, T. (Dept. of Agriculture, Beltsville, MD (USA))

1989-02-09T23:59:59.000Z

165

SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules  

SciTech Connect

SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysis demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.

Koropatkin, Nicole M.; Smith, Thomas J. (Danforth)

2010-09-21T23:59:59.000Z

166

Thermophilic hydrogen production from starch wastewater using two-phase sequencing batch fermentation coupled with UASB methanogenic effluent recycling  

Science Journals Connector (OSTI)

Abstract The aim of this study was to evaluate the performance of thermophilic hydrogenesis coupled with mesophilic methanogenesis in which the effluent was recycled to the hydrogen reactor for starch wastewater treatment. With this system, the hydrogen production rate and yield were 3.45 ± 0.25 L H2/(L·d) and 5.79 ± 0.41 mmol H2/g \\{CODadded\\} respectively, and thus higher than the values of the control group without methanogenic effluent recycling. In addition, relatively higher contents of acetate and butyrate were obtained in the hydrogen reactor with recirculation. The methane reactors were operated with the effluent from the hydrogen reactor, and methane yield was stabilized at 0.21–0.23 L/g \\{CODremoval\\} in both. Analysis of the microbial communities further showed that methanogenic effluent recirculation enriched microbial communities in the hydrogen reactor. Two species of bacteria effective in hydrogenesis, Thermoanaerobacterium thermosaccharolyticum and Clostridium thermosaccharolyticum, dominated during hydrogen production, whereas archaea belonging to Euryarchaeota were detected and cultured in the methane reactor. The recycled effluent supplied alkaline substrates for the hydrogen producing bacteria. Alkali balance calculations showed that the amount of added alkali was reduced by 88%. This amount, required for hydrogen production from starch wastewater, was contributed by alkali in the methanogenic effluent, (2225 ± 140 mg CaCO3/L), resulting in lower operational costs.

Li Xie; Nanshi Dong; Lei Wang; Qi Zhou

2014-01-01T23:59:59.000Z

167

Modeling most likely pathways for smuggling radioactive and special nuclear materials on a worldwide multi-modal transportation network  

SciTech Connect

Nuclear weapons proliferation is an existing and growing worldwide problem. To help with devising strategies and supporting decisions to interdict the transport of nuclear material, we developed the Pathway Analysis, Threat Response and Interdiction Options Tool (PATRIOT) that provides an analytical approach for evaluating the probability that an adversary smuggling radioactive or special nuclear material will be detected during transit. We incorporate a global, multi-modal transportation network, explicit representation of designed and serendipitous detection opportunities, and multiple threat devices, material types, and shielding levels. This paper presents the general structure of PATRIOT, all focuses on the theoretical framework used to model the reliabilities of all network components that are used to predict the most likely pathways to the target.

Saeger, Kevin J [Los Alamos National Laboratory; Cuellar, Leticia [Los Alamos National Laboratory

2010-10-28T23:59:59.000Z

168

Modeling most likely pathways for smuggling radioactive and special nuclear materials on a worldwide multimodal transportation network  

SciTech Connect

Nuclear weapons proliferation is an existing and growing worldwide problem. To help with devising strategies and supporting decisions to interdict the transport of nuclear material, we developed the Pathway Analysis, Threat Response and Interdiction Options Tool (PATRIOT) that provides an analytical approach for evaluating the probability that an adversary smuggling radioactive or special nuclear material will be detected during transit. We incorporate a global, multi-modal transportation network, explicit representation of designed and serendipitous detection opportunities, and multiple threat devices, material types, and shielding levels. This paper presents the general structure of PATRIOT, and focuses on the theoretical framework used to model the reliabilities of all network components that are used to predict the most likely pathways to the target.

Saeger, Kevin J [Los Alamos National Laboratory; Cuellar, Leticia [Los Alamos National Laboratory

2010-01-01T23:59:59.000Z

169

Biomass Resources , Worldwide  

Science Journals Connector (OSTI)

The way bioenergy is developed, under what conditions, and...78, 79] with examples of such scenarios for Argentina). Bioenergy has the opportunity to contribute to climate ... and developing countries alike but t...

Dr. André Faaij

2012-01-01T23:59:59.000Z

170

Biomass Resources , Worldwide  

Science Journals Connector (OSTI)

The way bioenergy is developed, under what conditions, and...78, 79] with examples of such scenarios for Argentina). Bioenergy has the opportunity to contribute to climate ... and developing countries alike but t...

Dr. André Faaij

2013-01-01T23:59:59.000Z

171

Purification, Characterization, and Gene Cloning of a Novel Maltosyltransferase from an Arthrobacter globiformis Strain That Produces an Alternating ?-1,4- and ?-1,6-Cyclic Tetrasaccharide from Starch  

Science Journals Connector (OSTI)

...sequence showed similarities to alpha-amylase and cyclomaltodextrin glucanotransferase...conserved regions common in the alpha-amylase family enzymes were also found...Oligosaccharides 9005-25-8 Starch EC 2.4.1.- Glucosyltransferases...

Kazuhisa Mukai; Hikaru Watanabe; Michio Kubota; Hiroto Chaen; Shigeharu Fukuda; Masashi Kurimoto

2006-02-01T23:59:59.000Z

172

Trace and ultratrace metals in bottled waters: Survey of sources worldwide and comparison with refillable metal bottles  

Science Journals Connector (OSTI)

Bottled waters from diverse natural and industrial sources are becoming increasingly popular worldwide. Several potentially harmful trace metals (Ag, Be, Li, Ge, Sb, Sc, Te, Th, U) are not monitored regularly in such waters. As a consequence, there is extremely limited data on the abundance and potential health impacts of many potentially toxic trace elements. Containers used for the storage of bottled waters might also increase trace metal levels above threshold limits established for human consumption by the EPA or WHO. Applying strict clean room techniques and sector field ICP–MS, 23 elements were determined in 132 brands of bottled water from 28 countries. In addition, leaching experiments with high purity water and various popular metal bottles investigated the release of trace metals from these containers. The threshold limits for elements such as Al, Be, Mn and U in drinking water were clearly exceeded in some waters. Several bottled waters had Li concentrations in the low mg/L range, a level which is comparable to blood plasma levels of patients treated against manic depression with Li-containing drugs. The rate of release of trace metals from metal bottles assessed after 13 days was generally low, with one exception: Substantial amounts of both Sb and Tl were released from a commercially available pewter pocket flask, exceeding international guidelines 5- and 11-fold, respectively. Trace metal levels of most bottled waters are below guideline levels currently considered harmful for human health. The few exceptions that exist, however, clearly reveal that health concerns are likely to manifest through prolonged use of such waters. The investigated coated aluminium and stainless steel bottles are harmless with respect to leaching of trace metals into drinking water. Pocket flasks, in turn, should be selected with great care to avoid contamination of beverages with harmful amounts of potentially toxic trace metals such as Sb and Tl.

Michael Krachler; William Shotyk

2009-01-01T23:59:59.000Z

173

The Case for the Application of Worldwide Marine Radioactivity Studies In the Search for Undeclared Facilities and Activities  

SciTech Connect

Undeclared nuclear facilities unequivocally remain the most difficult safeguards challenge facing the International Atomic Energy Agency (IAEA). Recent cases of undeclared facilities revealed in Iran and Syria, which are NPT signatory States, show both the difficulty and the seriousness of this threat to nonproliferation. In the case of undeclared nuclear facilities, the most effective deterrent against proliferation is the application of Wide-Area Environmental Sampling (WAES); however, WAES is currently cost-prohibitive. As with any threat, the most effective countering strategy is a multifaceted approach. Some of the approaches applied by the IAEA include: open source analysis, satellite imagery, on-site environmental sampling, complementary access under the Additional Protocol (where in force), traditional safeguards inspections, and information provided by member States. These approaches, naturally, are focused on specific States. Are there other opportunities not currently within the IAEA purview to assess States that may provide another opportunity to detect clandestine facilities? In this paper, the author will make the case that the IAEA Department of Safeguards should explore the area of worldwide marine radioactivity studies as one possible opportunity. One such study was released by the IAEA Marine Environment Laboratory in January 2005. This technical document focused on 90Sr, 137Cs, and 239/240Pu. It is clearly a challenging area because of the many sources of anthropogenic radionuclides in the world’s oceans and seas including: nuclear weapons testing, reprocessing, accidents, waste dumping, and industrial and medical radioisotopes, whose distributions change based on oceanographic, geochemical, and biological processes, and their sources. It is additionally challenging where multiple States share oceans, seas, and rivers. But with the application of modern science, historical sampling to establish baselines, and a focus on the most relevant radionuclides, the potential is there to support this challenging IAEA safeguards mission.

Mark Schanfein

2013-06-01T23:59:59.000Z

174

Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter  

SciTech Connect

A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. (Biosource Genetics Corporation, Vacaville, CA (United States))

1993-05-01T23:59:59.000Z

175

Students of the B.Sc Electronic Engineering have the ability to work in the positions listed below and related areas within the Electronics Industry worldwide  

E-Print Network (OSTI)

Students of the B.Sc Electronic Engineering have the ability to work in the positions listed below and related areas within the Electronics Industry worldwide: INTRA Programme B.Eng Electronic Engineering is to produce graduates who have: Programme Outline: The B.Eng Electronic Engineering is designed to provide

Humphrys, Mark

176

The worldwide demand for green energy systems is evident. In this context, wind energy converters will play a paramount role. Extending the service life of a  

E-Print Network (OSTI)

acquisition units and a computer installed in the wind energy converter, is designed to continuously collect measurement data from the wind energy converter. As shown in Fig. 1, six three- dimensional accelerometersABSTRACT The worldwide demand for green energy systems is evident. In this context, wind energy

Stanford University

177

The effect of heat treatment on the digestibility of wheat gluten in a model food system containing wheat gluten, corn starch and corn oil  

E-Print Network (OSTI)

ntestinal epithelium to free amino acids (8, 9). The bioavailability of am1no acids in a protein depends on the protein source, the type of processing it undergoes and the inter- actions between the protein and other diet components (10). If a protein... of the batter. The protein used was wheat gluten (Teklad Test Diets, Ma'dison, Wise. ), the fat, corn oil (ICN Nutritional Biochemicals, Cleveland, Ohio) and the carbohydrate, corn starch (United States Biochemical Corp. , 19 Cleveland, Ohio). The batter...

Fox, Debra Marie Ruzicka

2012-06-07T23:59:59.000Z

178

Monitoring of enzymatic hydrolysis of starch by microdialysis sampling coupled on-line to anion exchange chromatography and integrated pulsed electrochemical detection using post-column switching  

SciTech Connect

A quantitative evaluation of the hydrolysis of wheat starch using Termamyl, a thermostable {alpha}-amylase, is reported. Data from the monitoring of the hydrolysis of wheat starch indicated that, after 1 h, glucose and maltooligosaccharides up to DP 7 were the main hydrolysis products and thus enabled optimization of a liquefaction step during the production of L-lactic acid. The monitoring system used, both in the on- and off-line mode, was based on continuous flow microdialysis sampling (CFMS) coupled to anion exchange chromatography and integrated pulsed electrochemical detection (IPED). A microdialysis probe equipped with a 5-mm polysulfone (SPS 4005) membrane, with a molecular-weight cut-off of 5 kDa, was used to sample the hydrolysis products of native wheat starch at 90 C. Characteristic fingerpoint separations were achieved by anion exchange chromatography after enzymatic hydrolysis. Post-column switching improved the detection and, consequently, also quantification of the hydrolysates as fouling of the electrode could be reduced. Maltooligosaccharide standards were used for quantification and to verify the elution of the hydrolysates by spiking the off-line samples.

Torto, N.; Gorton, L.; Emneus, J.; Laurell, T. [Univ. of Lund (Sweden)] [Univ. of Lund (Sweden); Marko-Varga, G. [Astra Draco AB, Lund (Sweden). Bioanalytical Chemistry] [Astra Draco AB, Lund (Sweden). Bioanalytical Chemistry; Akerberg, C.; Zacchi, G. [Univ. of Lund (Sweden). Dept. of Chemical Engineering] [Univ. of Lund (Sweden). Dept. of Chemical Engineering; [Lund Inst. of Tech. (Sweden)

1997-12-05T23:59:59.000Z

179

Effects of brewers` condensed solubles (BCS) on the production of ethanol from low-grade starch materials  

SciTech Connect

Yeast fermentation was performed on grain and bakery byproducts with and without adding the same volume of brewers` condensed solubles (BCS). Starch material in the grain and bakery byproducts effectively was converted to fermentable sugars with conversion ratios of 93-97% by successive treatments of samples with bacterial {alpha}-amylase and fungal glucoamylase. The yeast fermentation of these enzyme-digested byproducts alone showed that ethanol concentrations of 16.4-42.7 mL/100 g dry solid in the broth were achieved with fermentation efficiencies of 87-96%. Addition of BCS to the grain byproducts increased ethanol concentration by 10-86% by increasing the potential glucose content of the broth. The rates of fermentation measured by CO{sub 2} gas production demonstrated that BCS addition to bakery byproducts reduced the fermentation time from 62-72 h to 34-35 h. In bakery byproducts that were low in amino nitrogen, exhaustion of nitrogenous compounds in substrates was found to be a limiting factor for yeast growth. Because BCS is a rich source of nitrogen, adding BCS to these substrates markedly increased the fermentation rate. 15 refs., 4 figs., 3 tabs.

Choi, C.H.; Chung, D.S.; Seib, P.A. [Kansas State Univ., Manhattan, KS (United States)] [and others

1995-02-01T23:59:59.000Z

180

A laboratory and pilot plant scaled continuous stirred reactor separator for the production of ethanol from sugars, corn grits/starch or biomass streams  

SciTech Connect

An improved bio-reactor has been developed to allow the high speed, continues, low energy conversion of various substrates to ethanol. The Continuous Stirred Reactor Separator (CSRS) incorporates gas stripping of the ethanol using a recalculating gas stream between cascading stirred reactors in series. We have operated a 4 liter lab scale unit, and built and operated a 24,000 liter pilot scale version of the bioreactor. High rates of fermentation are maintained in the reactor stages using a highly flocculent yeast strain. Ethanol is recovered from the stripping gas using a hydrophobic solvent absorber (isothermal), after which the gas is returned to the bioreactor. Ethanol can then be removed from the solvent to recover a highly concentrated ethanol product. We have applied the lab scale CSRS to sugars (glucose/sucrose), molasses, and raw starch with simultaneous saccharification and fermentation of the starch granules (SSF). The pilot scale CSRS has been operated as a cascade reactor using dextrins as a feed. Operating data from both the lab and pilot scale CSRS are presented. Details of how the system might be applied to cellulosics, with some preliminary data are also given.

Dale, M.C.; Lei, Shuiwang; Zhou, Chongde

1995-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Using atmospheric plasma to design multilayer film from polylactic acid and thermoplastic starch: a screening Life Cycle Assessment  

Science Journals Connector (OSTI)

Abstract The accumulation of plastic waste and the increasing awareness of the environmental implications and technical challenges associated to their treatment and recycling have led to a constant increase of biopolymers market in the 90's. Polylactic acid (PLA) is one of the most promising biodegradable plastics, showing a wide range of potential applications, e.g. in the packaging industry. However, the high production costs hamper its further development. The use of PLA in multilayer (ML) films is a potential opportunity to reduce the production costs. This study tackled the ecodesign of a clam shell for packaging applications based on a novel ML film made of PLA and thermoplastic starch (TPS), evaluating the environmental performance of different design concepts through Life Cycle Assessment (LCA). In order to assure proper compatibility between PLA and TPS, the use of dielectric barrier discharge (dbd) plasma technology at atmospheric pressure to increase the hydrophilicity of PLA was investigated. The results have highlighted the significant contribution of plasma treatment to the overall environmental impact of the ML film and the need for further optimisation. Despite the contribution of the PLA end-of-life phase to the overall environmental impact of the ML clam shell is low, the methodological approach to end-of-life can have a significant influence on the LCA results. This seems to be due to the low PLA recycling and recovery rate assumed, which is nevertheless realistic. The promotion of high recovery and recycling rates should therefore be a priority in the future. At the current development stage, even the most improved ML clam shell concept obtained using atmospheric plasma technology is not an environmentally sound alternative to pure PLA clam shell, although it is likely to be a cost-effective option. A good compromise between cost and environmental constrains to be further investigated could be to increase further the proportion of PLA in the ML, by improving the water adsorption capability of TPS through, e.g., the addition of a phthalate free plasticiser.

Enrico Benetto; Colin Jury; Elorri Igos; Julien Carton; Paula Hild; Christèle Vergne; Jean Di Martino

2015-01-01T23:59:59.000Z

182

Starch collars dangerous pests  

Science Journals Connector (OSTI)

... effective needs to be looked at," says Kabir Cham, a member of the World Health Organization's Roll Back Malaria programme, which works to replace DDT with safer insecticides. ...

Corie Lok

2001-05-18T23:59:59.000Z

183

The World-Wide Telescope  

Science Journals Connector (OSTI)

...faster, cheaper, and smarter. So the...cluster. Computational Grids are clusters...Virtual Observatory to benefit the international...distributed data archives Grid technology. Japan...community through the Grid Physics Network...Virtual Observatory to benefit the international...

Alexander Szalay; Jim Gray

2001-09-14T23:59:59.000Z

184

Direct enzymatic extraction of starch from corn as an energy saving alternative to production of high fructose syrup. Final executive report  

SciTech Connect

The purpose of this project was to study, test, and demonstrate a process of producing high-fructose corn syrup and protein byproducts from dry milled corn as an energy conserving alternative of the current industrial corn wet-milling process. This final report is divided into 5 sections. Section 1 deals with the process which is the main and, indeed, the final product of the energy conservation study. Section 2 deals with protein Extraction which conditions the dry-milled corn before hydrolysis. Section 3 deals with the analytical technique of GPC developed with the alpha-amylase hydrolysis of starch. Section 4 deals with immobilized glucoamylase hydrolysis. Section 5 deals with the recovery of soluble protein by ion-exchange resins. Each section has been abstracted separately for inclusion in the Energy Data Base. (DMC)

Not Available

1982-12-01T23:59:59.000Z

185

Indeed is the #1 job search engine worldwide. Since 2004, Indeed has given job seekers free access to millions of jobs from thousands of company websites and job boards. Our core mis-  

E-Print Network (OSTI)

Indeed is the #1 job search engine worldwide. Since 2004, Indeed has given job seekers free access to millions of jobs from thousands of company websites and job boards. Our core mis- sion is to help people get jobs. To make this possible, we built an amazing platform that han- dles 5 billion job search

Ghosh, Joydeep

186

The results of a world-wide study on yield improvement are presented. Die yields col-lected from 21 fabs are transformed via a logit formula and compared. The die yields and  

E-Print Network (OSTI)

-aided manufacturing practices and statistical process control practices in addition to commonly cited practices improvement rates of the fabs are compared, and manufacturing yield improve- ment practices are evaluated such as particle control and advanced manufacturing technology. #12;Introduction The results of a world-wide study

California at Berkeley, University of

187

The transformation of modern electricity grids at the local and global scale into smart grids is at the core of sustainable economic, environmental and societal growth worldwide. This migration to more intelligent, user-friendly and responsive grids aroun  

E-Print Network (OSTI)

flows, the automatic management of power outages, and the integration of renewable energy sources is at the core of sustainable economic, environmental and societal growth worldwide. This migration to more intelligent, user-friendly and responsive grids around the world is in large part enabled by the development

Fang, Yuguang "Michael"

188

Towards the Integration of Dark- and Photo-Fermentative Waste Treatment. 4. Repeated Batch Sequential Dark- and Photofermentation using Starch as Substrate  

SciTech Connect

In this study we demonstrated the technical feasibility of a prolonged, sequential two-stage integrated process under a repeated batch mode of starch fermentation. In this durable scheme, the photobioreactor with purple bacteria in the second stage was fed directly with dark culture from the first stage without centrifugation, filtration, or sterilization (not demonstrated previously). After preliminary optimization, both the dark- and the photo-stages were performed under repeated batch modes with different process parameters. Continuous H{sub 2} production in this system was observed at a H{sub 2} yield of up to 1.4 and 3.9 mole mole{sup -1} hexose during the dark- and photo-stage, respectively (for a total of 5.3 mole mole{sup -1} hexose), and rates of 0.9 and 0.5 L L{sup -1} d{sup -1}, respectively. Prolonged repeated batch H{sub 2} production was maintained for up to 90 days in each stage and was rather stable under non-aseptic conditions. Potential for improvements in these results are discussed.

Laurinavichene, T. V.; Belokopytov, B. F.; Laurinavichius, K. S.; Khusnutdinova, A. N.; Seibert, M.; Tsygankov, A. A.

2012-05-01T23:59:59.000Z

189

Toward Robust Climate Baselining: Objective Assessment of Climate Change Using Widely Distributed Miniaturized Sensors for Accurate World-Wide Geophysical Measurements  

SciTech Connect

A gap-free, world-wide, ocean-, atmosphere-, and land surface-spanning geophysical data-set of three decades time-duration containing the full set of geophysical parameters characterizing global weather is the scientific perquisite for defining the climate; the generally-accepted definition in the meteorological community is that climate is the 30-year running-average of weather. Until such a tridecadal climate base line exists, climate change discussions inevitably will have a semi-speculative, vs. a purely scientific, character, as the baseline against which changes are referenced will be at least somewhat uncertain. The contemporary technology base provides ways-and-means for commencing the development of such a meteorological measurement-intensive climate baseline, moreover with a program budget far less than the {approx}$2.5 B/year which the US. currently spends on ''global change'' studies. In particular, the recent advent of satellite-based global telephony enables real-time control of, and data-return from, instrument packages of very modest scale, and Silicon Revolution-based sensor, data-processing and -storage advances permit 'intelligent' data-gathering payloads to be created with 10 gram-scale mass budgets. A geophysical measurement system implemented in such modern technology is a populous constellation 03 long-lived, highly-miniaturized robotic weather stations deployed throughout the weather-generating portions of the Earths atmosphere, throughout its oceans and across its land surfaces. Leveraging the technological advances of the OS, the filly-developed atmospheric weather station of this system has a projected weight of the order of 1 ounce, and contains a satellite telephone, a GPS receiver, a full set of atmospheric sensing instruments and a control computer - and has an operational life of the order of 1 year and a mass-production cost of the order of $20. Such stations are effectively ''intra-atmospheric satellites'' but likely have serial-production unit costs only about twenty-billionths that of a contemporary NASA global change satellite, whose entirely-remote sensing capabilities they complement with entirely-local sensing. It's thus feasible to deploy millions of them, and thereby to intensively monitor all aspects of the Earths weather. Analogs of these atmospheric weather stations will be employed to provide comparable-quality reporting of oceanic and land-surface geophysical parameters affecting weather. This definitive climate baselining system could be in initial-prototype operation on a one-year time-scale, and in intermediate-scale, proof-of-principle operation within three years, at a total cost of {approx}$95M. Steady-state operating costs are estimated to be {approx} $75M/year, or {approx}3% of the current US. ''global change'' program-cost. Its data-return would be of great value very quickly as simply the best weather information, and within a few years as the definitive climatic variability-reporting system. It would become the generator of a definitive climate baseline at a total present-value cost of {approx}$0.9 B.

Teller, E; Leith, C; Canavan, G; Marion, J; Wood, L

2001-11-13T23:59:59.000Z

190

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

test systems”, Renewable and Sustainable Energy Reviews, 15,a review”, Renewable and Sustainable Energy Reviews, 15, pp.survey”, Renewable and Sustainable Energy Reviews. Bossart,

Marnay, Chris

2014-01-01T23:59:59.000Z

191

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

Environmental Energy Technologies Division Lawrence Berkeley18 Recommendation 3: Match technology to end-use31 Illinois Institute of Technology Project (a perfect power

Marnay, Chris

2014-01-01T23:59:59.000Z

192

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

Future in Telligent power grids: Analysis of the vision inof common coupling Figure 3: Power grid, from generation towas part of the Regional Power Grid with Renewable Energy

Marnay, Chris

2014-01-01T23:59:59.000Z

193

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

energy resources, such as small hydro, wind, biomass, andSolar PV Biomass Wind Small hydro Figure 6: China’s feed-in

Marnay, Chris

2014-01-01T23:59:59.000Z

194

Worldwide R&D of Virtual Observatory  

E-Print Network (OSTI)

Virtual Observatory (VO) is a data intensive online astronomical research and education environment, taking advantages of advanced information technologies to achieve seamless and uniform access to astronomical information. The concept of VO was introduced in late of 1990s to meet challenges brought up with data avalanche in astronomy. This paper reviews current status of International Virtual Observatory Alliance, technical highlights from world wide VO projects, and a brief introduction of Chinese Virtual Observatory.

Chenzhou Cui; Yongheng Zhao

2007-11-27T23:59:59.000Z

195

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

China’s current feed-in tariff policies encourages theof tariff, if not a feed-in tariff)? The opportunities forhome to a specific feed-in tariff policy for distributed

Marnay, Chris

2014-01-01T23:59:59.000Z

196

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

19 Recommendation 4: Integrate energy functions: CHP and4: Integrate energy functions: CHP and CCHP Demands forand power technologies (CHP) as well as combined cooling,

Marnay, Chris

2014-01-01T23:59:59.000Z

197

Worldwide electricity consumption of communication networks  

Science Journals Connector (OSTI)

There is a growing research interest in improving the energy efficiency of communication networks. In order to assess the impact of introducing new energy efficient technologies, an...

Lambert, Sofie; Van Heddeghem, Ward; Vereecken, Willem; Lannoo, Bart; Colle, Didier; Pickavet, Mario

2012-01-01T23:59:59.000Z

198

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

MW gas turbines, one 3 MW steam turbine, a 1.2 MW solar PVMW gas turbines, one 3 MW steam turbine, and a 1.2 MW solar-

Marnay, Chris

2014-01-01T23:59:59.000Z

199

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

resources, (such as distributed generators, storage devices,distributed energy resources (DER) to the grid, specifying standard interconnection, operating, and metering requirements for DER generators.

Marnay, Chris

2014-01-01T23:59:59.000Z

200

A World-wide Stratospheric Aerosol Layer  

Science Journals Connector (OSTI)

...Massachusetts An aerosol layer has been identified by a stratospheric balloon and aircraft aerosol collection program. Measurements...Abstract. An aerosol layer has been identified by a stratospheric balloon and aircraft aerosol collection program. Meas-urements...

Christian E. Junge; Charles W. Chagnon; James E. Manson

1961-05-12T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Worldwide 'Power exchanges' | OpenEI Community  

Open Energy Info (EERE)

Indian government is attempting to set-up power exchang, where one can buysell electrical power (just like stock exchange). Please let me know: If power exchange exists in...

202

Optimal Transport in Worldwide Metro Networks  

E-Print Network (OSTI)

Metro networks serve as good examples of traffic systems for understanding the relations between geometric structures and transport properties.We study and compare 28 world major metro networks in terms of the Wasserstein distance, the key metric for optimal transport, and measures geometry related, e.g. fractal dimension, graph energy and graph spectral distance. The finding of power-law relationships between rescaled graph energy and fractal dimension for both unweighted and weighted metro networks indicates the energy costs per unit area are lower for higher dimensioned metros. In L space, the mean Wasserstein distance between any pair of connected stations is proportional to the fractal dimension, which is in the vicinity of our theoretical calculations treated on special regular tree graphs. This finding reveals the geometry of metro networks and tree graphs are in close proximity to one another. In P space, the mean Wasserstein distance between any pair of stations relates closely to the average number ...

Li, Wei; Liu, Shiping; Zhu, Yueying; Deng, Shengfeng; Zhao, Longfeng; Han, Jihui; Cai, Xu

2014-01-01T23:59:59.000Z

203

Worldwide Occurrences of Arsenic in Ground Water  

Science Journals Connector (OSTI)

...decision-making process of water managers, remediation specialists, and...The geologic and ground-water conditions that promote...water managers, remediation specialists, and...The geologic and ground-water conditions that promote...

D. Kirk Nordstrom

2002-06-21T23:59:59.000Z

204

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

in meeting its renewable energy goals in a cost effective4: Cost sharing of Department of Energy’s Renewable andrenewable energy on a large scale with acceptable cost and

Marnay, Chris

2014-01-01T23:59:59.000Z

205

Rapid worldwide depletion of predatory fish communities  

E-Print Network (OSTI)

data, industrialized trawl fisheries occurred before research surveys took place. For oceanic a United Nations resolution on restoring fisheries and marine ecosystems to healthy levels4 . However the beginning of exploita- tion. Industrialized fisheries typically reduced community bio- mass by 80% within 15

Siegel, David A.

206

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

some policies for smaller scale solar PV projects, such aspolicies that encourage the development of renewable energy resources, such as small hydro, wind, biomass, and solar

Marnay, Chris

2014-01-01T23:59:59.000Z

207

Lessons Learned from Microgrid Demonstrations Worldwide  

E-Print Network (OSTI)

include: high reliability distribution system, intelligentlocal distribution grid (with 99.9% reliability) is enoughReliability Efficiency Clean energy Local control Energy security Technology providers Transmission and distribution

Marnay, Chris

2014-01-01T23:59:59.000Z

208

A multi-gene phylogeny of Cephalopoda supports convergent morphological evolution in association with multiple habitat shifts in the marine environment  

E-Print Network (OSTI)

464–476. 60. Jereb P, Roper CFE: Cephalopods of the World.195–207. 107. Jereb P, Roper CFE: Cephalopods of the World.

Lindgren, Annie R; Pankey, Molly S; Hochberg, Frederick G; Oakley, Todd H

2012-01-01T23:59:59.000Z

209

Sorghum tannins: Interaction with Starch and its Effects on in vitro Starch Digestibility  

E-Print Network (OSTI)

phenolic extracts with pure amylose/amylopectin, extractable polymeric PA was in much lower concentration (62% less) in presence of amylose compared to amylopectin. This drop in concentration increased to 85% when purified tannin extract (90% polymeric PA...

Ribeiro de Barros, Frederico

2012-12-10T23:59:59.000Z

210

Cecropia peltata Accumulates Starch or Soluble Glycogen by Differentially Regulating Starch Biosynthetic Genes  

Science Journals Connector (OSTI)

...plants and prokaryotes and UDP Glc in red algae, fungi, and animals). The class of...for Suc catabolism are active in MBs to fuel glycogen and lipid synthesis. Transcript...inner envelope maltose transporter MEX1 to fuel metabolism at night (Niittyla et al...

Sylvain Bischof; Martin Umhang; Simona Eicke; Sebastian Streb; Weihong Qi; Samuel C. Zeeman

2013-04-30T23:59:59.000Z

211

Mutants of Arabidopsis Lacking Starch Branching Enzyme II Substitute Plastidial Starch Synthesis by Cytoplasmic Maltose Accumulation  

Science Journals Connector (OSTI)

...STPases), alpha-1,4 glucanotransferases, alpha- and beta-amylases, and pullulanase...lambdamax of Amylopectin (nm) Amylose Ratio...Amylopectin and amylose were separated...Distribution of Amylopectin and WSGs...Maltose by alpha- and beta-Amylases Twenty milligrams...

Sylvain Dumez; Fabrice Wattebled; David Dauvillee; David Delvalle; Véronique Planchot; Steven G. Ball; Christophe D'Hulst

2006-10-06T23:59:59.000Z

212

Worldwide Status of Energy Standards for Buildings - Appendices  

E-Print Network (OSTI)

source material: Singapore USA: ASHRAE 90 A,B,C 12. COMPUTERthe CNRC's evaluation of ASHRAE 90 1-1989 and correction forsource material: USA: ASHRAE 90 12. COMPUTER programs used:

Janda, K.B.

2008-01-01T23:59:59.000Z

213

United States geothermal technology: Equipment and services for worldwide applications  

SciTech Connect

This document has two intended audiences. The first part, ``Geothermal Energy at a Glance,`` is intended for energy system decision makers and others who are interested in wide ranging aspects of geothermal energy resources and technology. The second part, ``Technology Specifics,`` is intended for engineers and scientists who work with such technology in more detailed ways. The glossary at the end of the document defines many of the specialized terms. A directory of US geothermal industry firms who provide goods and services for clients around the world is available on request.

NONE

1995-05-01T23:59:59.000Z

214

Kairos Consulting Worldwide Wins HUBZone Business of the Year...  

Office of Environmental Management (EM)

Agencies to include the Department of Energy, the Department of Defense, and the National Nuclear Security Administration (NNSA). Kairos provides professional support services for...

215

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

number of drums in each cavern associated with each wasteArea F: Maintenance Area T Cavern Entrance Tunnel Ca FigureCross section of L L W cavern. Shotcrete Roof - Crane '

2010-01-01T23:59:59.000Z

216

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

Review comments on that plan from the Nuclear Regulatoryreview by the United States Nuclear Regulatory Commission, of a Site Characterization Plan.

2010-01-01T23:59:59.000Z

217

Occupational exposures worldwide and revision of international standards for protection  

Science Journals Connector (OSTI)

......adequately. The regulatory body is required...established by the regulatory body; the user...adopted a strategic plan(4) for the...has conducted a review of the content...Governmental, Legal and Regulatory Framework for...an outline of plans for data collection...a result of a review of the BSS in......

R. Czarwinski; M. J. Crick

2011-03-01T23:59:59.000Z

218

ILCAD, the unique worldwide road/rail safety awareness campaign  

E-Print Network (OSTI)

, education and human factors specialists, institutions, academics... to exchange information and provide and understood; share good Engineering, Enforcement practices and perhaps the most important propose Education available free of charge for ILCAD partners � 14 posters in different languages � a video 2014 co

Illinois at Urbana-Champaign, University of

219

Experimental Design of Worldwide Internet Voting System using PKI  

E-Print Network (OSTI)

easily participate in voting over the Internet. It is consid- ered as a good solution for the recent interest for Internet voting as a good solution to make voting more accessible and convenient, it is widely voting together with good eÃ?ciency. In this research, we design Internet voting system us- ing public key

Kim, Kwangjo

220

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

Site Scale Model of Yucca Mountain, Nevada. LawrenceHazard Analysis for Yucca Mountain, Nevada, Draft Report,and A4. D. Voegele 1. Yucca Mountain Site Characterization

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

rock salt (greater than 95% halite). Figure 11.3 illustrateslaw" in that the "older halite" (z2) on average creepsfaster than the "younger halite" (z3). Two formulae for

2010-01-01T23:59:59.000Z

222

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

Japan and can be taken as being rep- The Power Reactor and Nuclearand Japan, to possess an overall capacity for manage- ment of low and intermediate level wastes produced by the country's nuclear powerPower Reactor and Nuclear Fuel Development Corporation, 1-9-13 Akasaka, Minato-ku,Tokyo 107 Japan

2010-01-01T23:59:59.000Z

223

Worldwide Status of Energy Standards for Buildings - Appendices  

E-Print Network (OSTI)

Organization: Energy Efficiency Building Code (EEBC-92)to increase energy efficiency in buildings: Infonnationabout energy efficiency for buildings in: Jamaica 22.

Janda, K.B.

2008-01-01T23:59:59.000Z

224

Geological challenges in radioactive waste isolation: Third worldwide review  

E-Print Network (OSTI)

in this type of underground facility. After evaluatingrock mass, and underground facility engineering. Undergroundassessment issues in underground facilities, and share

Witherspoon editor, P.A.; Bodvarsson editor, G.S.

2001-01-01T23:59:59.000Z

225

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

waste disposal in underground facilities, Braunschweig (of the present underground facility to perform larger scaleothers i n the underground facility (URF). This research

2010-01-01T23:59:59.000Z

226

Genotype-Imputation Accuracy across Worldwide Human Populations  

E-Print Network (OSTI)

human populations has facilitated the mapping of complex-disease loci in genome-wide association (GWA) studies. These databases, such as The International HapMap Project (2.5 to 4 million SNPs genome-wide1 as ``reference panels,'' useful for diverse purposes in human genetics. Information in reference panels can

Rosenberg, Noah

227

Parasite prevalence and the worldwide distribution of cognitive ability  

Science Journals Connector (OSTI)

...domestic product per capita and several...product (GDP) are controlled...the brain demands 87 per cent of the...their hosts' energy budget...education and GDP per capita are not statistically...a higher GDP, but a wealthier...allocation of energy to immune...

2010-01-01T23:59:59.000Z

228

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

Bardosi 1. Paks, Nuclear Power Plant Ltd. , 7030 Paks P.O.operation of Chinshan Nuclear Power Plant (NPP) Unit onedistribution of nuclear power plants (NPPs) on Chinese

2010-01-01T23:59:59.000Z

229

A worldwide overview of superconductivity development efforts for utility applications  

SciTech Connect

The progress and prospects for the application of high temperature superconductivity to the electric power sector has been the topic of an IEA Implementing Agreement begun in 1990. The present task members are: Canada, Denmark, Finland, Germany, Israel, Italy, Japan, the Netherlands, Norway, Sweden, Switzerland, Turkey, the United Kingdom, and the United States. As a result of the Implementing Agreement, work has been performed by the Operating Agent with the full participation of all of the member countries. This work has facilitated the exchange of information among experts in all member countries and is the basis for much of the information contained in this paper. This paper summarizes progress toward application of high temperature superconductivity to devices for use in the electric power sector such as: fault-current limiters, cables, superconducting magnetic energy Storage, rotating machinery, transformers, and flywheels incorporating magnetic bearings. Such devices are being designed, built and tested throughout the world.

Giese, R.F.

1996-04-01T23:59:59.000Z

230

Worldwide Status of Energy Standards for Buildings - Appendices  

E-Print Network (OSTI)

about energy efficiency for buildings in: Norway 1. TheC - 83 NORWAY 16. Entities involved in IMPLEMENTING energy

Janda, K.B.

2008-01-01T23:59:59.000Z

231

Worldwide Trends in Energy Use and Efficiency: Key Insights from...  

Open Energy Info (EERE)

www.iea.orgpapers2008indicators2008.pdf Equivalent URI: cleanenergysolutions.orgcontentworldwide-trends-energy-use-and-effic Language: English Policies:...

232

SOFC Worldwide — Technology Development Status and Early Applications  

Science Journals Connector (OSTI)

Solid Oxide Fuel Cells (SOFC) of various types and designs have been developed world wide through the last two decades. They offer interesting advantages over other fuel cell types, but also have inherent mate...

L. Blum; R. Steinberger-Wilckens…

2005-01-01T23:59:59.000Z

233

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

c. contamination from Chernobyl m. Technologic complexity a.and Complications from the Chernobyl Disaster . . . .5by radionuclides from Chernobyl Geological division of

2010-01-01T23:59:59.000Z

234

Status of hydrogen fuel cell electric buses worldwide  

Science Journals Connector (OSTI)

Abstract This review summarizes the background and recent status of the fuel cell electric bus (FCEB) demonstration projects in North America and Europe. Key performance metrics include accumulated miles, availability, fuel economy, fuel cost, roadcalls, and hydrogen fueling. The state-of-the-art technology used in today's fuel cell bus is highlighted. Existing hydrogen infrastructure for refueling is described. The article also presents the challenges encountered in these projects, the experiences learned, as well as current and future performance targets.

Thanh Hua; Rajesh Ahluwalia; Leslie Eudy; Gregg Singer; Boris Jermer; Nick Asselin-Miller; Silvia Wessel; Timothy Patterson; Jason Marcinkoski

2014-01-01T23:59:59.000Z

235

New handbook for standardised measurement of plant functional traits worldwide  

E-Print Network (OSTI)

. S Ecological Farming Systems, Agroscope Reckenholz Tänikon, Research Station ART, Reckenholzstrasse 191, 8046, University of Alaska Fairbanks, Fairbanks, AK 99775-7000, USA. F Systems Ecology, Faculty of Earth and Life Sciences, Department of Ecological Science, VU University, De Boelelaan 1085, 1081 HV Amsterdam

Sack, Lawren

236

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

research program initiated by the State Committee on NuclearProgram for Research, Development and Utilization of Nuclearresearch and development (R&D) programme. In view of this new situation, the two nuclear

2010-01-01T23:59:59.000Z

237

Chapter 18 - Worldwide Coal Mine Methane and Coalbed Methane Activities  

Science Journals Connector (OSTI)

Abstract The chapter provides an overview of coal bed methane production in all countries (except USA; covered in Chapter 17) around the world where there is a viable coal deposit. Coal deposits are shown in a map and coal bed methane reserves are estimated. All countries can follow the lead provided by USA in CBM production where 10% of total gas consumption (2 TCF/year) comes from coal seams. Exploitation of thick and deep coal seams using the latest technology can create a vast source of domestic energy for many countries around the world.

Charlee Boger; James S. Marshall; Raymond C. Pilcher

2014-01-01T23:59:59.000Z

238

Worldwide Status of Energy Standards for Buildings - Appendices  

E-Print Network (OSTI)

for NON-RESIDENTIAL BUILDINGS. This survey has been designedtypes of energy standards for buildings. Please respond asI: GENERAL OVERVIEW OF BUILDING ENERGY STANDARDS Does your

Janda, K.B.

2008-01-01T23:59:59.000Z

239

Pdc- The Worldwide Leader in Hydrogen Refueling Station Compression  

Energy.gov (U.S. Department of Energy (DOE))

This presentation by Matther Weaver of Pdc Machines Inc. was given at the was given at the DOE Hydrogen Compression, Storage, and Dispensing Workshop in March 2013.

240

Geological Problems in Radioactive Waste Isolation: Second Worldwide Review  

E-Print Network (OSTI)

Bernard Neerdael SCK-CEN , HADES Project, Waste and Disposalunderground labora- tory (HADES) was constructed in the claydisposal: Historical Review of Hades Program Early studies

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Virus-like particle-induced fusion from without in tissue culture cells: role of outer-layer proteins VP4 and VP7.  

Science Journals Connector (OSTI)

...proteins VP4 and VP7 JM Gilbert HB Greenberg Department of Microbiology and Immunology...Falconer, J. M. Gilbert, A. M. Roper...Falconer, J. M. Gilbert, A. M. Roper...Department of Microbiology and Immunology...

J M Gilbert; H B Greenberg

1997-06-01T23:59:59.000Z

242

Cape Townshend North Point  

E-Print Network (OSTI)

ie Princhester We rribee Whelan Mar l borough Lawrence Murray Alli gator Raglan Ck Nebo Roper Ck R Ck

Greenslade, Diana

243

Biochemical evidence that starch breakdown by Bacteroides thetaiotaomicron involves outer membrane starch-binding sites and periplasmic starch-degrading enzymes.  

Science Journals Connector (OSTI)

...can utilize amylose, amylopectin, and pullulan...cell-associated amylase, amylopectinase...breakdown, alpha-glucosidase...can utilize amylose, amylopectin, and pullulan...cell-associated amylase, amylopectinase...breakdown, alpha-glucosidase...

K L Anderson; A A Salyers

1989-06-01T23:59:59.000Z

244

Performance evaluation of starch based polymer for enhanced oil recovery  

E-Print Network (OSTI)

for Elgin-56 sandstone before and after a 1. 0% polymer treatment. 27 3. 6 Fractional flow curve of water for Okesa-23 sandstone before and after a 1. 0% polymer treannent. 28 3. 7 Oil production rate vs. time for edge water influx grid systems with P... = 1. 5, 2. 0, and 3. 0. 34 Cumulative oil production vs. time for edge water influx grid systems with P = 1. 5, 2. 0, and 3. 0. 35 3. 9 Bottomhole pressure vs. time for edge water influx grid systems with P = 1. 5, 2. 0, and 3. 0. 35 3. 10 Oil...

Skurner, James Andrew

2012-06-07T23:59:59.000Z

245

Surface Chemical Modification of Waxy Maize Starch Nanocrystals  

Science Journals Connector (OSTI)

(16)?Chisholm, B. J.; Moore, R. B.; Barber, G.; Khouri, F.; Hempstead, A.; Larsen, M.; Olson, E.; Kelley, J.; Balch, G.; Caraher, J. Macromolecules 2002, 35, 5508. ... Chisholm, Bret J.; Moore, Robert B.; Barber, Grant; Khouri, Farid; Hempstead, Anne; Larsen, Michael; Olson, Eric; Kelley, Jim; Balch, Gary; Caraher, Joel ...

Hélène Angellier; Sonia Molina-Boisseau; Mohamed Naceur Belgacem; Alain Dufresne

2005-02-05T23:59:59.000Z

246

An evaluation of starches and hydrocolloids in microwaveable beef roasts  

E-Print Network (OSTI)

consists of polymers of alpha-D-glucose. These polymers produce two molecules; amylose, a linear chain of alpha-D-(1-4) glycosidic linkages, and amylopectin, branched chains of alpha-D-(1-4) and alpha-D-(1-6) glycosidic linkages. Amylose is the component... consists of polymers of alpha-D-glucose. These polymers produce two molecules; amylose, a linear chain of alpha-D-(1-4) glycosidic linkages, and amylopectin, branched chains of alpha-D-(1-4) and alpha-D-(1-6) glycosidic linkages. Amylose is the component...

Luker, Janet Darcy

2012-06-07T23:59:59.000Z

247

Characterization of Extruded Thermoplastic Starch Reinforced by Montmorillonite Nanoclay  

Science Journals Connector (OSTI)

The purpose of this study was to understand how the montmorillonite (MMT) nanoclay influences physical and mechanical properties of thermoplastic ... produced by a conventional extrusion procedure. MMT nanoclay w...

Yachuan Zhang; Qiang Liu; Andrew Hrymak…

2013-03-01T23:59:59.000Z

248

LCA Case Studies of Starch-Based Foam  

Science Journals Connector (OSTI)

The LDPE block/WBF was delivered to the company specialising in foam conversion (Foam Engineers Ltd., UK). Here the ... cut and converted to the shaped pieces of insulation for the final manufacture of the coolbo...

Miao Guo

2012-01-01T23:59:59.000Z

249

Reverse Osmosis: Application to Potato-Starch Factory Waste Effluents  

Science Journals Connector (OSTI)

One of the major problems of our country, and most others, is pollution of the water supplies. In this paper, we hope to describe for you a specific pollution problem of great importance, a possible means of alle...

W. L. Porter; J. Siciliano; S. Krulick; E. G. Heisler

1970-01-01T23:59:59.000Z

250

STARCH-EXCESS4 Is a Laforin-Like Phosphoglucan Phosphatase Required for Starch Degradation in Arabidopsis thaliana  

Science Journals Connector (OSTI)

...pass neither alpha-1,6 branches...clusters of amylopectin. Our view...by beta-amylase. Indeed...pre-phosphorylated alpha-glucans...elongation of amylose and amylopectin chains in...plastidial beta-amylases. Plant Physiol...2005). alpha-Amylase is not required...priming of amylose synthesis...

Oliver Kötting; Diana Santelia; Christoph Edner; Simona Eicke; Tina Marthaler; Matthew S. Gentry; Sylviane Comparot-Moss; Jychian Chen; Alison M. Smith; Martin Steup; Gerhard Ritte; Samuel C. Zeeman

2009-01-13T23:59:59.000Z

251

E-Print Network 3.0 - acid esters evaluated Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Abstract... This paper describes an exploratory study on the synthesis of fatty acidpotato starch esters using... : potato starch, fatty acid starch esters, starch laurate, ......

252

NREL Helps Apply Renewable Energy and Energy Efficiency Technologies Worldwide (Fact Sheet)  

NLE Websites -- All DOE Office Websites (Extended Search)

(NREL) applies its (NREL) applies its technical expertise and capabilities to promote the use of renew- able energy (RE) and energy efficiency (EE) technologies through- out the world. NREL's international work spans our full range of capabilities, which include three primary areas of expertise: * Analysis - NREL provides technology-neutral information, global and regional assessments and decision tools, and expert advice. * Research and Development - NREL conducts collaborative research and development (R&D) and shares methods and results with leading research institutions throughout the world. * Deployment/Commercialization - NREL teams with private industry, other countries, and international institutions to increase the speed and scale of investments in RE and EE

253

Collection and recycling of electronic scrap: A worldwide overview and comparison with the Brazilian situation  

SciTech Connect

Highlights: Black-Right-Pointing-Pointer Review of the different e-waste collection systems and recycling processes. Black-Right-Pointing-Pointer We present the e-waste collection systems used in Europe and in the US. Black-Right-Pointing-Pointer We present e-waste collection systems used in Asia and Latin America. Black-Right-Pointing-Pointer E-waste management between developed and developing countries is very different. Black-Right-Pointing-Pointer We made a comparison of the world situation to the current Brazilian reality. - Abstract: Recycling and the related issue of sustainable development are increasing in importance around the world. In Brazil, the new National Policy on Solid Wastes has prompted discussion on the future of electronic waste (e-waste). Over the last 10 years, different e-waste collection systems and recycling processes have been applied globally. This paper presents the systems used in different countries and compares the world situation to the current Brazilian reality. To establish a recycling process, it is necessary to organize efficient collection management. The main difficulty associated with the implementation of e-waste recycling processes in Brazil is the collection system, as its efficiency depends not only on the education and cooperation of the people but also on cooperation among industrial waste generators, distributors and the government. Over half a million waste pickers have been reported in Brazil and they are responsible for the success of metal scrap collection in the country. The country also has close to 2400 companies and cooperatives involved in recycling and scrap trading. On the other hand, the collection and recycling of e-waste is still incipient because e-wastes are not seen as valuable in the informal sector. The Brazilian challenge is therefore to organize a system of e-waste management including the informal sector without neglecting environmentally sound management principles.

Reis de Oliveira, Camila, E-mail: Camilareis.oliveira@hotmail.com [Instituto de Quimica, Universidade Federal do Rio Grande do Sul (UFRGS), Av. Bento Goncalves 9500, 91501-970, Porto Alegre, RS (Brazil); Moura Bernardes, Andrea, E-mail: amb@ufrgs.br [Programa de Pos-Graduacao em Engenharia de Minas, Metalurgica e de Materiais (PPGE3M) and Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil); Gerbase, Annelise Engel, E-mail: agerbase@ufrgs.br [Instituto de Quimica, Universidade Federal do Rio Grande do Sul (UFRGS), Av. Bento Goncalves 9500, 91501-970, Porto Alegre, RS (Brazil)

2012-08-15T23:59:59.000Z

254

Analysis of the interaction between air transportation and economic activity : a worldwide perspective  

E-Print Network (OSTI)

Air transportation usage and economic activity are interdependent. Air transportation provides employment and enables certain economic activities which are dependent on the availability of air transportation services. The ...

Ishutkina, Mariya A. (Mariya Aleksandrovna)

2009-01-01T23:59:59.000Z

255

The worldwide air transportation network: Anomalous centrality, community structure, and cities' global roles  

Science Journals Connector (OSTI)

...times associated with the image a country or region wants to project (1–4). The air transportation system is also responsible...network of cities, not of airports; for example, Newark Liberty International Airport, John F. Kennedy International Airport...

R. Guimerà; S. Mossa; A. Turtschi; L. A. N. Amaral

2005-01-01T23:59:59.000Z

256

GANT2 PROVIDES CONNECTIVITY TO CERN'S NEW WORLDWIDE LHC COMPUTING GRID  

E-Print Network (OSTI)

of discovery and will help us understand the secrets of the universe itself," commented David Foster, Head

Escolano, Francisco

257

Improving health worldwide Keppel Street Building and gardens. Anne Koerber / LSHTM  

E-Print Network (OSTI)

governments and funding to tackle AIDS and other diseases. He co-discovered the Ebola virus and has published Research by the Prime Minister of Japan. "From the discovery of the Ebola virus to the struggle against HIV

Maizels, Rick

258

E-Print Network 3.0 - anp worldwide experience Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

SELECT INITIAL ENGINE TESTS... Oak Ridge, Tennessee 37830 Authors: U. Hans Behling John Mauro SC&A, Inc. July 2005 12;ANP Source... Regarding Initial Engine Test...

259

GEOLOGIC ASSESSMENT OF DRILLING, COMPLETION, AND STIMULATION METHODS IN SELECTED GAS SHALE PLAYS WORLDWIDE  

E-Print Network (OSTI)

The United States regularly imports majority of the transportation oil, and several TCF of natural gas annually. Nevertheless, there is very large resource of natural gas in unconventional reservoirs, with over 2,200 TCF of natural gas in just...

Patel, Harsh Jay

2014-04-11T23:59:59.000Z

260

Developing a tight gas sand advisor for completion and stimulation in tight gas reservoirs worldwide  

E-Print Network (OSTI)

and experience about completion and stimulation technologies used in TGS reservoirs. We developed the principal design and two modules of a computer program called Tight Gas Sand Advisor (TGS Advisor), which can be used to assist engineers in making decisions...

Bogatchev, Kirill Y.

2009-05-15T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Biogeographic characterization of blue whale song worldwide: Using song to identify populations  

E-Print Network (OSTI)

Hz signals recorded near Midway Island. J. Acoust. Soc. Am.song types. recorded near Midway Island (Northrop et al. ,song, first reported from Midway Island recordings made in

McDonald, Mark A; Mesnick, Sarah L; Hildebrand, John A

2006-01-01T23:59:59.000Z

262

TRENDS AND INNOVATIONS IN HIGHER EDUCATION REFORM: Worldwide, Latin America and in the Caribbean  

E-Print Network (OSTI)

but leaders of social change and innovation. We are awaretransformations of social mobility. Innovation in order to

Francisco López Segrera

2010-01-01T23:59:59.000Z

263

Antarctic marine benthic biodiversity in a world-wide latitudinal context  

Science Journals Connector (OSTI)

In the 1950s and 1960s, the first data sets were assembled to examine whether or not there was a latitudinal gradient of species richness in the sea. These data comprised very few species and were from very sm...

John S. Gray

2002-01-01T23:59:59.000Z

264

Antarctic marine benthic biodiversity in a world-wide latitudinal context  

Science Journals Connector (OSTI)

In the 1950s and 1960s, the first data sets were assembled to examine whether or not there was a latitudinal gradient of species richness in the sea. These data comprised very few species and were from very s...

John S. Gray

2001-09-01T23:59:59.000Z

265

The Census of Marine Life—evolution of worldwide marine biodiversity research  

Science Journals Connector (OSTI)

This paper discusses the origin and development of the 10-year Census of Marine Life, describing the way in which a ... was ripe to engage in a large-scale marine biodiversity program incorporating the newest tec...

Vera Alexander; Patricia Miloslavich; Kristen Yarincik

2011-12-01T23:59:59.000Z

266

Worldwide advanced nuclear power reactors with passive and inherent safety: What, why, how, and who  

SciTech Connect

The political controversy over nuclear power, the accidents at Three Mile Island (TMI) and Chernobyl, international competition, concerns about the carbon dioxide greenhouse effect and technical breakthroughs have resulted in a segment of the nuclear industry examining power reactor concepts with PRIME safety characteristics. PRIME is an acronym for Passive safety, Resilience, Inherent safety, Malevolence resistance, and Extended time after initiation of an accident for external help. The basic ideal of PRIME is to develop power reactors in which operator error, internal sabotage, or external assault do not cause a significant release of radioactivity to the environment. Several PRIME reactor concepts are being considered. In each case, an existing, proven power reactor technology is combined with radical innovations in selected plant components and in the safety philosophy. The Process Inherent Ultimate Safety (PIUS) reactor is a modified pressurized-water reactor, the Modular High Temperature Gas-Cooled Reactor (MHTGR) is a modified gas-cooled reactor, and the Advanced CANDU Project is a modified heavy-water reactor. In addition to the reactor concepts, there is parallel work on super containments. The objective is the development of a passive box'' that can contain radioactivity in the event of any type of accident. This report briefly examines: why a segment of the nuclear power community is taking this new direction, how it differs from earlier directions, and what technical options are being considered. A more detailed description of which countries and reactor vendors have undertaken activities follows. 41 refs.

Forsberg, C.W.; Reich, W.J.

1991-09-01T23:59:59.000Z

267

Analysis of the Interaction Between Air Transportation and Economic Activity: A Worldwide Perspective  

E-Print Network (OSTI)

Air transportation usage and economic activity are interdependent. Air transportation provides employment

Hansman, R. John

2009-03-30T23:59:59.000Z

268

Analysis of the Interaction Between Air Transportation and Economic Activity: A Worldwide Perspective  

E-Print Network (OSTI)

Air transportation usage and economic activity are interdependent. Air transportation provides employment

Ishutkina, Mariya A.

2011-10-14T23:59:59.000Z

269

Barriers to Mobility: The Lockout Effect of U.S. Taxation of Worldwide Corporate Profits  

E-Print Network (OSTI)

Using data from a survey of tax executives, we examine the corporate response to the one-time dividends received deduction in the American Jobs Creation Act of 2004. We describe the firms’ reported sources and uses of the ...

Graham, John R.

270

The biannual news magazine for 146,000 IUPUI alumni worldwide In competItIon,  

E-Print Network (OSTI)

Magazine design: George Brown (BFA '84) Editing: Jill Jansen (BA '90) | Jill Jansen Communications, Inc

Zhou, Yaoqi

271

A Population-Genetic Perspective on the Similarities and Differences Among Worldwide Human Populations  

E-Print Network (OSTI)

with the genome-wide microsatellites of the Human Genome Diver- sity Project/Centre d'Etude du Polymorphisme individuals in one group from those in other groups? 3. Of the genetic variants that exist in the human genome using the alleles in his or her genome? 6. What events in human evolutionary history are responsible

Rosenberg, Noah

272

E-Print Network 3.0 - accurate world-wide geophysical Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Edinburgh, EH9 3JW, UK Summary: the geophysical monitorability of injected supercritical CO2 stored in subsurface saline aquifers. We use... the information expected to be...

273

Arguments Pro and Against Shale Gas Exploitation Worldwide and in Romania  

Science Journals Connector (OSTI)

Abstract Shale gas emerges as a new and important source of energy for the post - industrial world. It is assumed that countries that have considerable shale deposits will be better placed in the 21st century competition between states. The United States have one of biggest deposits of shale gas, underscores a domestic production “boom” and is on the verge of becoming a gas exporter in Western Europe. The United States still has few capabilities to export shale gas to Europe. It would have to build new liquefaction facilities to do that. On the other side, Russia is, for the moment, the energy giant of Europe, its massive exports of natural gas to the area, acting as a powerful political leverage especially on the eastern and central European space. But in Europe, at least 10 countries are believed to hold significant shale gas reserves; among them, Romania is assumed to have huge unconventional gas reserves, whose exploitation could ensure its medium-term energy independence, and combined with newly discovered gas in the Black Sea, and energy efficiency improvement measures, provide not only the energy independence but transform Romania into a regional power pole. The interesting fact is how each country in Europe, will choose to convert resources in shale gas reserves and to exploit them to the benefit of the economy, the society and the environment. Besides some clear positive effects (decreasing energy imports, creating a stronger negotiating position against external (fossil fuel) suppliers and diversifying Europe's energy mix) will shale gas extraction succeed to decrease gas bill for population, by reducing prices, or will it stick only to royalties and fees collection, as well as with some local social and economic effects, with the consequence of prolonged pollution or even potentially devastating effects on the environment? In order that gas-gas competition begins to act effectively and exert a strong competitive pressure on gas import prices in Europe (by changing their base and weaken the link with oil prices, up to a possible decoupling of it) it is necessary that Europe will benefit from a big inflow of gas supplies, shale gas included, from different sources than

Mariana Papatulica

2014-01-01T23:59:59.000Z

274

CPI Concrete Plant International 2 | 2013 www.cpi-worldwide.com2 PRECAST CONCRETE ELEMENTS  

E-Print Network (OSTI)

of the insulating core. The grid passes through slits in the foam core, but does not create a thermal break due. With the insulation and CFRP grid in place, the inner wythe reinforcement is added above the rigid foam insulation with an inner and an outer wythe of concrete separated by a core of rigid foam insulation. Thermal efficiency

275

On the World-wide Circulation of the Deeper Waters of the World Ocean  

E-Print Network (OSTI)

circulation of the Pacific Ocean: Flow patterns, tracers,in preparing the figures. Fig. 1 Pacific Ocean winds Fig.2 Pacific Ocean circulation Fig. 4 Pacific Ocean potential

Reid, Joseph L

2009-01-01T23:59:59.000Z

276

The WTERT Awards recognize outstanding contributions to advancing sustainable waste management worldwide  

E-Print Network (OSTI)

on the sustainable waste management "ladder" than the U.S., at a GDP per capita Brunner (Austria) 2008: Covanta Energy (USA); Inventor Artie Cole (USA) 2010: City, composting and waste-to- energy, 200-2014. ROK has achieved a higher standing

277

Writing World-Wide Web CGI scripts in the REXX language  

SciTech Connect

This talk is aimed at people who have experience with REXX and are interested in using it to write WWW CGI scripts. As part of this, the author describes several functions that are available in a library of REXX functions that simplify writing WWW CGI scripts. This library is freely available at //www.slac.standard.edu/slac/www/tool/cgi-rexx/.

Cottrell, R.L.A.

1996-03-01T23:59:59.000Z

278

Worldwide Human Relationships Inferred from Genome-Wide Patterns of Variation  

Science Journals Connector (OSTI)

...Genet. 3 , e90 ( 2007 ). 11 H. M. Cann et al., Science 296 , 261 ( 2002 ). 12 Human Genome Diversity Panel, http://shgc.stanford.edu/hgdp or ftp://ftp.cephb.fr/hgdp_supp1. 13 H. Tang et al., Genet. Epidemiol. 28 , 289 ( 2005...

Jun Z. Li; Devin M. Absher; Hua Tang; Audrey M. Southwick; Amanda M. Casto; Sohini Ramachandran; Howard M. Cann; Gregory S. Barsh; Marcus Feldman; Luigi L. Cavalli-Sforza; Richard M. Myers

2008-02-22T23:59:59.000Z

279

Carbon-dioxide emissions trading and hierarchical structure in worldwide finance and commodities markets  

Science Journals Connector (OSTI)

In a highly interdependent economic world, the nature of relationships between financial entities is becoming an increasingly important area of study. Recently, many studies have shown the usefulness of minimal spanning trees (MST) in extracting interactions between financial entities. Here, we propose a modified MST network whose metric distance is defined in terms of cross-correlation coefficient absolute values, enabling the connections between anticorrelated entities to manifest properly. We investigate 69 daily time series, comprising three types of financial assets: 28 stock market indicators, 21 currency futures, and 20 commodity futures. We show that though the resulting MST network evolves over time, the financial assets of similar type tend to have connections which are stable over time. In addition, we find a characteristic time lag between the volatility time series of the stock market indicators and those of the EU CO2 emission allowance (EUA) and crude oil futures (WTI). This time lag is given by the peak of the cross-correlation function of the volatility time series EUA (or WTI) with that of the stock market indicators, and is markedly different (>20 days) from 0, showing that the volatility of stock market indicators today can predict the volatility of EU emissions allowances and of crude oil in the near future.

Zeyu Zheng, Kazuko Yamasaki, Joel N. Tenenbaum, and H. Eugene Stanley

2013-01-29T23:59:59.000Z

280

Worldwide bioassay data resources for plutonium/americium internal dosimetry studies  

Science Journals Connector (OSTI)

......1968 and 1978. (3)RF-USTUR samples from Rocky Flats donors were analyzed at the Rocky Flats Laboratories between 1969 and 1987. Samples...origins of the SD for samples analyzed at PNL and Rocky Flats have not been investigated. THE CASE FOR A......

G. Miller; A. E. Riddell; R. Filipy; L. Bertelli; T. Little; R. Guilmette

2007-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

There is no clear criterion for determining sustainabil-ity of freshwater fisheries. Freshwater fisheries worldwide  

E-Print Network (OSTI)

ecological processes and may thus serve as microcosms for larger fisheries. Activities and conditions on land for the resource, and (3) associated humans. Fishery assessment therefore often includes quantifying static- economics. Thorough fishery assessment may require a multidisciplinary team. Fisheries Indicators

Kwak, Thomas J.

282

E-Print Network 3.0 - agriculture faces world-wide Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Service Summary: This publication was written specifically for use on the World Wide Web and is best viewed in hypertext form... Agricultural Land and Methods of Protection...

283

Application Developer HTH Worldwide is a leader in helping world travelers gain access to quality  

E-Print Network (OSTI)

a fulltime opening for an experienced Database Programmer/Web Developer. The individual will be responsible for the design, development, implementation, and maintenance of Web database applications on Windows Servers & Qualifications: The position requires 23 years experience in web and database programming. The following

Plotkin, Joshua B.

284

Using the World-Wide Web to create a constructive learning environment  

E-Print Network (OSTI)

. Teachers need the ability to evaluate a student's progress in mastery of the material. The present Walden's Paths tool has no such ability to track each student as they use the Path Server. Also, the present Path Server of Walden's Paths does not have a... for allowing me to participate in the Walden's Paths Project. I would especiaBy like to thank both Frank Shipman and Richard Furuta for allowing me the freedom to implement my ideas into the Walden's Paths Path Server. I would also like to thank my Walden...

Brenner, Donald Adair

1997-01-01T23:59:59.000Z

285

A Closed-Loop Process from Microwave-Assisted Hydrothermal Degradation of Starch to Utilization of the Obtained Degradation Products as Starch Plasticizers  

Science Journals Connector (OSTI)

Girisuta, B.; Danon, B.; Manurung, R.; Janssen, L.; Heeres, H.Experimental and kinetic modelling studies on the acid-catalysed hydrolysis of the water hyacinth plant to levulinic acid Bioresour. ... Girisuta, B.; Danon, B.; Manurung, R.; Janssen, L. P. B. M.; Heeres, H. J. ...

Duo Wu; Minna Hakkarainen

2014-08-06T23:59:59.000Z

286

Influence of Dietary Starch Inclusion on Cecal Environment and Microbial Populations in Horses  

E-Print Network (OSTI)

by Bacteriodets (5.71% healthy, 9.94% lamintis). Clostridiales, Lactobacilles, and RFP12 of Verruco5 were the most abundant orders identified. On the family level, Steptococcaceae were the most dominant (24.17% healthy, 16.11% laminitis). The dominant genera...

Warzecha, Christine Marie

2013-08-07T23:59:59.000Z

287

In vitro starch digestibility and estimated glycemic index of sorghum products  

E-Print Network (OSTI)

Index (GI) of some extruded or puffed products reported in the literature (from in vivo studies).............................................. 42 11 Particle size distribution of sorghum and corn flours used in the porridges...) and estimated Glycemic Index (EGI) of porridges. ....................................................................................... 63 15 Glycemic Index (GI) of some cereal porridges reported in the literature (from in vivo studies...

De Castro Palomino Siller, Angelina

2007-09-17T23:59:59.000Z

288

Changes in Bowel Microbiota Induced by Feeding Weanlings Resistant Starch Stimulate Transcriptomic and Physiological Responses  

Science Journals Connector (OSTI)

...Zealand The ability to predictably engineer the composition of bowel microbial...described by Knoch et al. (17). RNA quality was assessed using RNA 6000 Nano...responses. | The ability to predictably engineer the composition of bowel microbial...

Wayne Young; Nicole C. Roy; Julian Lee; Blair Lawley; Don Otter; Gemma Henderson; Mark J. McCann; Gerald W. Tannock

2012-07-13T23:59:59.000Z

289

Macromolecular Orientation in Glassy Starch Materials That Exhibit Shape Memory Behavior  

Science Journals Connector (OSTI)

In the case of thermoplastic SMP,(5) the shape memory effect is usually attributed to the presence of two types of domain: one flexible and one rigid. ... The X-ray radiation, Cu K?1 (? = 0.154?05 nm), produced in a sealed tube at 40 kV and 40 mA was selected and parallelized using a Gobël mirror parallel optics system and collimated to produce a 500 ?m beam diameter. ... The microscope was equipped with a 32X Schwarzschild objective (numerical aperture (NA): 0.65), with a 50 ?m liquid nitrogen cooled MCT detector. ...

Cyril Ve?chambre; Alain Bule?on; Laurent Chaunier; Fre?de?ric Jamme; Denis Lourdin

2010-11-12T23:59:59.000Z

290

The Phosphoglucan Phosphatase Like Sex Four2 Dephosphorylates Starch at the C3-Position in Arabidopsis  

Science Journals Connector (OSTI)

...plants and a key resource for humankind both as the main component of...sequentially from the nonreducing end of an alpha-1,4-linked...Arabidopsis leaves harvested at the end of the light period and analyzed...sex4 plants harvested at the end of the light period. Phosphate...

Diana Santelia; Oliver Kötting; David Seung; Mario Schubert; Matthias Thalmann; Sylvain Bischof; David A. Meekins; Andy Lutz; Nicola Patron; Matthew S. Gentry; Frédéric H.-T. Allain; Samuel C. Zeeman

2011-11-18T23:59:59.000Z

291

Modification of Corn Starch Ethanol Refinery to Efficiently Accept Various High-Impact Cellulosic Feedstocks  

SciTech Connect

The goal of the Corn-to-Cellulosic Migration (CCM) pilot facility was to demonstrate the implementation of advanced technologies and methods for conversion of non-food, cellulosic feedstocks into ethanol, assess the economics of the facility and evaluate potential environmental benefits for biomass to fuels conversion. The CCM project was comprised of design, build, and operate phases for the CCM pilot facility as well as research & development, and modeling components. The CCM pilot facility was designed to process 1 tonne per day of non-food biomass and biologically convert that biomass to ethanol at a rate of 70 gallons per tonne. The plant demonstrated throughputs in excess of 1 tonne per day for an extended run of 1400 hours. Although target yields were not fully achieved, the continuous operation validated the design and operability of the plant. These designs will permit the design of larger scale operations at existing corn milling operations or for greenfield plants. EdeniQ, a partner in the project and the owner of the pilot plant, continues to operate and evaluate other feedstocks.

Derr, Dan

2013-12-30T23:59:59.000Z

292

A redox-regulated chloroplast protein phosphatase binds to starch diurnally and functions in its accumulation  

Science Journals Connector (OSTI)

...linear and branched glucans (amylose and amylopectin) that determine the properties of...the activity and binding of {alpha}-glucan, water dikinase...possibly the activity of {beta}-amylase (21). However, to our knowledge...

Lubomir N. Sokolov; Jose R. Dominguez-Solis; Anne-Laure Allary; Bob B. Buchanan; Sheng Luan

2006-01-01T23:59:59.000Z

293

Molecular Structure of Starch-Type Polysaccharides from Hericium ramosum and Hericium coralloides  

Science Journals Connector (OSTI)

...short-chain amylose molecules...ENLARGEMENT OF AMYLOPECTIN BY ADP-D-GLUCOSE - ALPHA-1,4-GLUCAN...short-chain amylose molecules...Both salivary amylase and, -amylase...to branched amylopectin molecules...in that the amylose molecules produced...The, B-amylase preparation...

D. A. McCracken; J. L. Dodd

1971-10-22T23:59:59.000Z

294

Production of bread from blends of sorghum flour and gelatinized cassava starch  

E-Print Network (OSTI)

bread. Dorado flour produced the best loaf, ATx630*Tx435 flour produced bread with lower loaf volume and a sticky crumb, and waxy flour produced unacceptable bread with wet, sticky crumb and low loaf volume. Amylose content was 25.6, 20.8, and 4...

Hugo, Leda Florinda

2012-06-07T23:59:59.000Z

295

The Phosphoglucan Phosphatase Like Sex Four2 Dephosphorylates Starch at the C3-Position in Arabidopsis  

Science Journals Connector (OSTI)

...industrial material. Amylopectin (a polymer comprised of alpha-1,4-linked...branched via alpha-1,6-bonds...is composed of amylose, which is essentially...interspersed between the amylopectin molecules. By...exoamylases (beta-amylases) and debranching...

Diana Santelia; Oliver Kötting; David Seung; Mario Schubert; Matthias Thalmann; Sylvain Bischof; David A. Meekins; Andy Lutz; Nicola Patron; Matthew S. Gentry; Frédéric H.-T. Allain; Samuel C. Zeeman

2011-11-18T23:59:59.000Z

296

The effect of enzymes and starch damage on wheat flour tortilla quality  

E-Print Network (OSTI)

affect tortilla weight, moisture and pH. Bacterial 2 amylase extended shelf stability while maltogenic 1 and xylanase exhibited smaller improvements in shelf stability and other tortilla properties. Addition of 0.05 activity unit bacterial 2 amylase...

Arora, Sapna

2007-04-25T23:59:59.000Z

297

The Heterotrophic Dinoflagellate Crypthecodinium cohnii Defines a Model Genetic System To Investigate Cytoplasmic Starch Synthesis  

Science Journals Connector (OSTI)

...Analysis of debranched amylopectin/amylose by gel permeation...purified amylopectin and amylose. Amylopectin and amylose from C...Variation in storage alpha-polyglucans of red algae: amylose and semi-amylopectin types in Porphyridium...

Philippe Deschamps; Delphine Guillebeault; Jimi Devassine; David Dauvillée; Sophie Haebel; Martin Steup; Alain Buléon; Jean-Luc Putaux; Marie-Christine Slomianny; Christophe Colleoni; Aline Devin; Charlotte Plancke; Stanislas Tomavo; Evelyne Derelle; Hervé Moreau; Steven Ball

2008-02-29T23:59:59.000Z

298

Pathway of Cytosolic Starch Synthesis in the Model Glaucophyte Cyanophora paradoxa  

Science Journals Connector (OSTI)

...glycogen to amylopectin: a model...biosynthesis of amylose. Trends Plant...reinhardtii alpha-1,4 glucanotransferase...function in amylopectin biosynthesis...in storage alpha-polyglucans of red algae: amylose and semi-amylopectin types in porphyridium...

Charlotte Plancke; Christophe Colleoni; Philippe Deschamps; David Dauvillée; Yasunori Nakamura; Sophie Haebel; Gehrardt Ritte; Martin Steup; Alain Buléon; Jean-Luc Putaux; Danielle Dupeyre; Christophe d'Hulst; Jean-Philippe Ral; Wolfgang Löffelhardt; Steven G. Ball

2007-11-30T23:59:59.000Z

299

The maltase-glucoamylase gene: Common ancestry to sucrase-isomaltase with complementary starch digestion activities  

Science Journals Connector (OSTI)

...glucose]n polymer, and amylopectin, with additional 6-O-{alpha}- d -glucopyranosyl...a mixture of ?25% amylose with 75% amylopectin, a fact of nutritional...the small intestine, {alpha}-amylase (1,4-{alpha...

Buford L. Nichols; Stephen Avery; Partha Sen; Dallas M. Swallow; Dagmar Hahn; Erwin Sterchi

2003-01-01T23:59:59.000Z

300

The starch-related R1 protein is an ?-glucan, water dikinase  

Science Journals Connector (OSTI)

...and also corn amylopectin (that does not...incorporation in corn amylopectin was less than 15...wild-type potato amylopectin (data not shown...true for potato amylose, concurring with...identification of R1 as an {alpha}-glucan, water...enzymes such as amylases. Alternatively...

Gerhard Ritte; James R. Lloyd; Nora Eckermann; Antje Rottmann; Jens Kossmann; Martin Steup

2002-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Structural basis for the glucan phosphatase activity of Starch Excess4  

Science Journals Connector (OSTI)

...10% w/w amylose and > 80% w/w amylopectin in Arabidopsis...leaves (1). Amylose is a linear molecule...moieties linked by {alpha}-1,4-glycosidic...few branches. Amylopectin, which is similar...to {beta}-amylases that release maltose...

Craig W. Vander Kooi; Adam O. Taylor; Rachel M. Pace; David A. Meekins; Hou-Fu Guo; Youngjun Kim; Matthew S. Gentry

2010-01-01T23:59:59.000Z

302

Molecular Aspects of Storage Protein and Starch Synthesis in Wheat and Rice Seeds  

Science Journals Connector (OSTI)

Seed formation in cereals is accompanied by the mobilization and transport of nitrogen from leaves and other source tissues to the developing cereal grain. Nitrogen enters the seed primarily as amino acids, of...

Thomas Okita; Arun Aryan; Christopher Reeves; Woo Taek Kim…

1989-01-01T23:59:59.000Z

303

Gourd and squash artifacts yield starch grains of feasting foods from preceramic Peru  

Science Journals Connector (OSTI)

...containers or serving vessels (Table 2...most often as wood for fuel or construction (30...regarding prehistoric consumption of algarrobo pods...gourd and squash serving vessels found in the pit, are...consistent with the refuse of consumption. Common Andean...

Neil A. Duncan; Deborah M. Pearsall; Robert A. Benfer; Jr.

2009-01-01T23:59:59.000Z

304

E-Print Network 3.0 - artocarpus altilis starch Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

ufi yam Dioscorea spp. ulu breadfruit Artocarpus... altilis Parkinson umala sweet potato Ipomoea batatas L. vi Polynesian plum Spondias dulcis Forst Source: Duffy, David...

305

Preparation and Characterization of Poly(Lactic Acid)-g-Maleic Anhydride Starch Blends  

E-Print Network (OSTI)

dispersion than neat PLA. The main disadvantages of TPS are its moisture sensitivity, limited temperature temperature of PLA is not affected by grafting. Glass transition temperatures and dynamic mechanical Introduction Poly(lactic acid) (PLA) exhibits high bio- degradability; however, it is expensive ­ what limits

North Texas, University of

306

J. Mol. Biol. (1996) 259, 970987 Solution Structure of the Granular Starch Binding  

E-Print Network (OSTI)

, 1991; PDB, accession code, 1cgt); 1D, one-dimensional; 2D, two-dimensional; 3D, three-dimensional; bCD (Lawson et al. 1994; PDB accession code, 1cdg); 1CGT, crystal structure of free CGTase (Klein & Schulz

Williamson, Mike P.

307

Interference Prevention in Size-Exclusion Chromatographic Analysis of Debranched Starch Glucans by Aqueous System  

Science Journals Connector (OSTI)

The barium acetate reacts with ammonium sulfate and produces barium sulfate, the latter having very low solubility (0.00115 g/L at 18 °C) and can be easily removed by filtration (Figure 9). ... In some cases, a weak anionic water-soluble polymer, dextran (Mw = 2 kg/mol), could be excluded from the pores of silica gel upon elution with water,(39) but a mixture of pullulans was eluted without a good correlation with molecular size when a silica gel packed column was eluted with water (data not show). ... (43, 44) In the present system, the laser detector with a vertically polarized 30 mW gallium-arsenide laser operating at ? = 690 nm gave less noise upon the elution with sodium nitrate (Figure 5). ...

Amy Hui-Mei Lin; Yung-Ho Chang; Wen-Bin Chou; Ting-Jang Lu

2011-05-09T23:59:59.000Z

308

The Effect of Dietary Starch Concentration on Glycogen Replenishment in Performance Horses  

E-Print Network (OSTI)

/wk. The SET consisted of a 30-min warm-up period at a brisk trot in a panel exerciser, followed by 27 min of gradually ascending high-intensity work on a treadmill. Skeletal muscle biopsies were taken from the biceps femoris at rest, immediately after...

Vonderohe, Caitlin

2013-12-12T23:59:59.000Z

309

Cardiac catecholamines in rats fed copper deficient or copper adequate diets containing fructose or starch  

SciTech Connect

The symptoms of copper (Cu) deficiency are known to be more severe when rats are fed a diet with fructose (F) as the principal carbohydrate. Mortality, in males, due to cardiac abnormalities usually occurs after five weeks of a 62% F, 0.6 ppm Cu deficient diet. These effects are not observed if cornstarch (CS) is the carbohydrate (CHO) source. Studies with F containing diets have shown increased catecholamine (C) turnover rates while diets deficient in Cu result in decreased norepinephrine (N) levels in tissues. Dopamine B-hydroxylase (EC 1.14.17.1) is a Cu dependent enzyme which catalyzes the conversion of dopamine (D) to N. An experiment was designed to investigate the effects of CHO and dietary Cu on levels of three C in cardiac tissue. Thirty-two male and female Sprague-Dawley rats were fed Cu deficient or adequate diets with 60% of calories from F or CS for 6 weeks. N, epinephrine (E) and D were measured by HPLC. Statistical analysis indicates that Cu deficiency tends to decrease N levels, while having the reverse effect on E. D did not appear to change. These findings indicate that Cu deficiency but not dietary CHO can affect the concentration of N and E in rat cardiac tissue.

Scholfield, D.J.; Fields, M.; Beal, T.; Lewis, C.G.; Behall, K.M. (Dept. og Agriculture, Beltsville, MD (USA))

1989-02-09T23:59:59.000Z

310

PHYSICAL REVIEW E 87, 012814 (2013) Carbon-dioxide emissions trading and hierarchical structure in worldwide finance  

E-Print Network (OSTI)

of the stock market indicators and those of the EU CO2 emission allowance (EUA) and crude oil futures (WTI WTI) with that of the stock market indicators, and is markedly different (>20 days) from 0, showing

Stanley, H. Eugene

311

TANSEI 05The University of Tokyo Magazine March, 2005 TANSEI aims at sharing worldwide the latest developments at UT  

E-Print Network (OSTI)

reform in Europe and in Japan. Two Executive Vice-Presidents' Interviews held on the occasion reforms are under way in a number of European countries, including Sweden. For Europe and Japan, what are the challenges for university reform and what measures are required? 05March, 2005 Vol. University reforms

Imai, Hiroshi

312

Reinterpretation of gizzard sizes of red knots world-wide emphasises overriding importance of prey quality at migratory stopover sites  

Science Journals Connector (OSTI)

...Tierra del Fuego, S-Argentina February 1.820.06...Antonio Oeste, E-Argentina March 1.350.05 3...site. Figure 3 Daily energy requirement (horizontal...Oeste, Rio Negro, Argentina. J. Field Ornithol...Diamond1997Maximum sustained energy budgets in humans and...

2005-01-01T23:59:59.000Z

313

SUSTAINABLE NANOTECHNOLOGY ORGANIZATION (SNO) Vision The Sustainable Nanotechnology Organization (SNO) is a non-profit, worldwide professional society  

E-Print Network (OSTI)

SUSTAINABLE NANOTECHNOLOGY ORGANIZATION (SNO) Vision The Sustainable Nanotechnology Organization that are engaged in: · Research and development of sustainable nanotechnology · Implementation of sustainable nanotechnology for Environment, Health, and Safety · Advances in nanoscience, methods, protocols and metrology

314

Abstract--The profound change in the electric industry worldwide in the last twenty years assigns an increasing  

E-Print Network (OSTI)

Value. I. INTRODUCTION He reformed electric industry scheme sets the transmission sector at the center

Catholic University of Chile (Universidad Católica de Chile)

315

Strategic implications for US - Persian Gulf relations on domestic and worldwide oil production for future US oil demand. Final report  

SciTech Connect

The U.S. dependence on oil imports is examined in light of current U.S. oil production, its potential for future discoveries, and the availability of oil products form Venezuela, Mexico, and other South American countries. There is no geologic reason why the U.S. cannot continue to replace its reserves consumed annually, continue conservation efforts reducing its import dependence, and shift its foreign oil supply closer to home, i.e., Mexico and South America. Increasing the price of oil domestically ensures continued exploration, and shifting the source of imports reduces the length of SLOC'S carrying critical oil products.

Kaplan, S.S.

1987-03-01T23:59:59.000Z

316

Analysis of energy saving potential of air-side free cooling for data centers in worldwide climate zones  

Science Journals Connector (OSTI)

Abstract Based on the climate classification of ASHRAE 90.1 and the required operating environment conditions for data centers suggested by the ASHRAE Technical Committee TC 9.9, a dynamic building energy simulation program was used to examine the potential energy savings of the air-side free cooling technology with differential enthalpy control used in data centers in 17 climate zones. The results showed that significant free cooling potential was achieved in data centers located in mixed-humid, warm-marine, and mixed-marine climate zones. Because significant humidification is required to adjust outdoor air in climate zones with a lower dew point temperature, such as very-cold, subarctic, cool-dry, and cold-dry climate zones, the power consumed is even higher. Although the cooling degree day (CDD) and heating degree day (HDD) are key factors of climate classification and air conditioning energy consumption, they are not entirely correlated to the specific operating environment conditions of data centers. The results of this study showed that for every 2 °C decline in the indoor temperature of a data center, the energy saving of free cooling technology may decrease by 2.8–8.5%. The rate of decline varies in different climate zones.

Kuei-Peng Lee; Hsiang-Lun Chen

2013-01-01T23:59:59.000Z

317

Building upon Historical Competencies: Next-generation Clean-up Technologies for World-Wide Application - 13368  

SciTech Connect

The Department of Energy's Savannah River Site has a 60-year history of successfully operating nuclear facilities and cleaning up the nuclear legacy of the Cold War era through the processing of radioactive and otherwise hazardous wastes, remediation of contaminated soil and groundwater, management of nuclear materials, and deactivation and decommissioning of excess facilities. SRS recently unveiled its Enterprise.SRS (E.SRS) strategic vision to identify and facilitate application of the historical competencies of the site to current and future national and global challenges. E.SRS initiatives such as the initiative to Develop and Demonstrate Next generation Clean-up Technologies seek timely and mutually beneficial engagements with entities around the country and the world. One such ongoing engagement is with government and industry in Japan in the recovery from the devastation of the Fukushima Daiichi Nuclear Power Station. (authors)

Guevara, K.C. [DOE Savannah River Operations Office, Aiken, South Carolina 29808 (United States)] [DOE Savannah River Operations Office, Aiken, South Carolina 29808 (United States); Fellinger, A.P.; Aylward, R.S.; Griffin, J.C.; Hyatt, J.E.; Bush, S.R. [Savannah River National Laboratory, Aiken, South Carolina 29808 (United States)] [Savannah River National Laboratory, Aiken, South Carolina 29808 (United States)

2013-07-01T23:59:59.000Z

318

Estimates of worldwide hydrate resources are large, but they are also uncertain because of inherent difficulties in  

E-Print Network (OSTI)

. Theoretical models for unconsolidated deepwater sedi- ments. Most rock physics models for unconsolidated sedi the elas- tic properties of granular materials. The model we propose for unconsolidated sediments is based-Mindlin model. Walton's theory is par- ticularly appropriate for highly unconsolidated sediments at low

Texas at Austin, University of

319

Group decisions in humans and animals: a survey  

Science Journals Connector (OSTI)

...by a Philip Leverhulme Prize and would like to thank the Leverhulme Trust for its support. We are also grateful to Jason Alexander, Marc Fleurbaey, Mathias Koenig-Archibugi, Tim Roper and Laura Valentini for their very helpful comments and...

Larissa Conradt; Christian List

2009-01-01T23:59:59.000Z

320

Fabry-Perot tuning of the band-gap polarity in plasmonic crystals Jin E. Kihm,1 Y. C. Yoon,1 D. J. Park,1 Y. H. Ahn,1 C. Ropers,2 C. Lienau,2,3 J. Kim,4 Q. H. Park,5 and D. S. Kim1,  

E-Print Network (OSTI)

-resolved transmission spectra of nanoslit arrays in metal films demonstrate band-gap formation resulting from surface-gap flipping. Our results indicate an interesting route towards band-gap engineering in plasmonic crystals. DOI of electronic and photonic band gaps--i.e., energy regions with a vanishing density of states in crystal- line

Peinke, Joachim

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Pelagic cephalopods of Gulf Stream cyclonic rings  

E-Print Network (OSTI)

of the Florida Straits was done by Cairns (1976). Helpful taxonomic distributional information is contained in Chun (1910), G. Voss (1956), Clarke (1966), and Young (1972). Despite these works, however, there remains a great deal of confusion in some families.... Voss (1956, 1958, 1960, 1962), Clarke (1967), Roper (1969), Roper et al. (1969), N. Voss (1969, 1974), Young (1972), and Wormuth (1976). Specimens were then measured for dorsal mantle length (ML) and displacement volume (DV). The dorsal mantle...

Lea, Charles Elliot

1978-01-01T23:59:59.000Z

322

Purification and Characterization of ?-Amylase from Bacillus licheniformis CUMC305  

Science Journals Connector (OSTI)

...starch), the alpha-amylase enzyme was...soluble starch, amylose, amylopectin, and glycogen...activity. alpha-Amylase was fairly...starch), the alpha-amylase enzyme was...soluble starch, amylose, amylopectin, and glycogen...

T. Krishnan; A. K. Chandra

1983-08-01T23:59:59.000Z

323

Central Carbon Metabolism and Electron Transport in Chlamydomonas reinhardtii: Metabolic Constraints for Carbon Partitioning between Oil and Starch  

Science Journals Connector (OSTI)

...the green alga Chlamydomonas. Alternative oxidase...of excess energy. However...where an energy loss of about...as well to algae in darkness...conditions, the energy requirement...mechanisms and alternative electron transfer...

Xenie Johnson; Jean Alric

2013-03-29T23:59:59.000Z

324

Feasibility Study for Co-Locating and Integrating Ethanol Production Plants from Corn Starch and Lignocellulosic Feedstocks (Revised)  

SciTech Connect

Analysis of the feasibility of co-locating corn-grain-to-ethanol and lignocellulosic ethanol plants and potential savings from combining utilities, ethanol purification, product processing, and fermentation. Although none of the scenarios identified could produce ethanol at lower cost than a straight grain ethanol plant, several were lower cost than a straight cellulosic ethanol plant.

Wallace, R.; Ibsen, K.; McAloon, A.; Yee, W.

2005-01-01T23:59:59.000Z

325

Effects of Variations in High Molecular Weight Glutenin Allele Composition and Resistant Starch on Wheat Flour Tortilla Quality  

E-Print Network (OSTI)

strong gluten that gives small diameter tortillas with good flexibility over storage. Good quality tortilla flour should have extensible gluten that will provide rapid extension during pressing to form larger diameter tortillas that retain air bubbles... and flexibility during storage (Waniska et al. 2004). Tortilla producers use food additives such as reducing agents, fats and enzymes to increase gluten extensibility in dough during production of wheat flour tortilla. However, besides reducing...

Jondiko, Tom Odhiambo

2012-02-14T23:59:59.000Z

326

Structure of the Arabidopsis Glucan Phosphatase LIKE SEX FOUR2 Reveals a Unique Mechanism for Starch Dephosphorylation  

Science Journals Connector (OSTI)

...Maltohexaose and Phosphate. (A) Ribbon diagram of LSF2 (residues 79 to 282, C193S...vapor diffusion using a Mosquito liquid handling robot (TTPLabtech) using a 200-nL...respectively). Supplemental Data The following materials are available in the online version of...

David A. Meekins; Hou-Fu Guo; Satrio Husodo; Bradley C. Paasch; Travis M. Bridges; Diana Santelia; Oliver Kötting; Craig W. Vander Kooi; Matthew S. Gentry

2013-06-28T23:59:59.000Z

327

Mutational Analysis of the Pullulanase-Type Debranching Enzyme of Maize Indicates Multiple Functions in Starch Metabolism  

Science Journals Connector (OSTI)

...proportions of the amylose and amylopectin components of...both involved in amylopectin biosynthesis in...decreased b-amylase activity. Plant...biosynthesis of the amylopectin crystal. Plant...de-branching enzyme and alpha-polyglucan structure...

Jason R. Dinges; Christophe Colleoni; Martha G. James; Alan M. Myers

2003-02-21T23:59:59.000Z

328

A Novel Factor FLOURY ENDOSPERM2 Is Involved in Regulation of Rice Grain Size and Starch Quality  

Science Journals Connector (OSTI)

...2B). Figure 2. Amylose Content and Amylopectin Composition of the...Wild-Type Grain. (A) Amylose content of the wild...amylopectins. Debranched amylopectin was compared with...and PGIb), and alpha-amylase (Amy3C, Amy3D...

Kao-Chih She; Hiroaki Kusano; Kazuyoshi Koizumi; Hiromoto Yamakawa; Makoto Hakata; Tomohiro Imamura; Masato Fukuda; Natsuka Naito; Yumi Tsurumaki; Mitsuhiro Yaeshima; Tomohiko Tsuge; Ken'ichiro Matsumoto; Mari Kudoh; Eiko Itoh; Shoshi Kikuchi; Naoki Kishimoto; Junshi Yazaki; Tsuyu Ando; Masahiro Yano; Takashi Aoyama; Tadamasa Sasaki; Hikaru Satoh; Hiroaki Shimada

2010-10-01T23:59:59.000Z

329

Structure of the Arabidopsis Glucan Phosphatase LIKE SEX FOUR2 Reveals a Unique Mechanism for Starch Dephosphorylation  

Science Journals Connector (OSTI)

...Glc polymers: amylopectin (75 to 90%) and amylose (10 to 25...Structurally, amylose is a linear molecule composed of alpha-1,4-glycosidic-linked...branches, while amylopectin is formed from...isoamylases, and amylases (Keeling and...

David A. Meekins; Hou-Fu Guo; Satrio Husodo; Bradley C. Paasch; Travis M. Bridges; Diana Santelia; Oliver Kötting; Craig W. Vander Kooi; Matthew S. Gentry

2013-06-28T23:59:59.000Z

330

Dietary Fiber/Carnitine, Diacylglycerol, and Low Glycemic Index Starch Effects on Obesity and Triglyceride Rich Lipoprotein Metabolsim in Dogs  

E-Print Network (OSTI)

fiber, carnitine, diacylglycerol (DAG), and low glycemic index (LGI) act on such dietary components, a series of studies was conducted: 1) the combination of dietary fiber/carnitine effect on short term (3 and 7 h) satiety and long term (6 weeks) canine...

Mitsuhashi, Yuka

2011-02-22T23:59:59.000Z

331

UNLOCKING ANCIENT DIET: USING STARCH GRANULES IN FOOD RESIDUE FROM COOKING CERAMICS TO ANALYZE PRE-COLUMBIAN ERA CADDO DIET  

E-Print Network (OSTI)

This thesis examines the nature of food residues on sherds of ancient Caddoan ceramic cooking vessels from East Texas, which was the homeland of Caddoan peoples for more than 2,000 years. Interior surfaces of some ceramic cooking vessels retain...

Skrla, Amy

2011-04-28T23:59:59.000Z

332

Be-CoDiS: An epidemiological model to predict the risk of human diseases spread worldwide. Application to the 2014 Ebola Virus Disease epidemic  

E-Print Network (OSTI)

Ebola virus disease is a lethal human and primate disease that currently requires a particular attention from the national and international health authorities due to important outbreaks concurring in some Western African countries and possible spread to other continents, which has already occurred in the USA and Spain. Regarding the emergency of this situation, there is a need of development of decision tools to help the authorities to focus their efforts in important factors that can help to eradicate Ebola. Mathematical modeling and, more precisely, epidemiological modeling can help to predict the possible evolution of the Ebola outbreaks and to give some recommendations in the region to be prioritized for surveillance. In this work, we present a first formulation of a new spatial-temporal epidemiological model, called Be-CoDiS (Between-COuntries Disease Spread), based on the combination of a deterministic Individual-Based model (modelling the interaction between countries, considered as individual) for be...

Benjamin, Ivorra; Diène, Ngom

2014-01-01T23:59:59.000Z

333

Home Page > Business > Industrial > Global Trade Of Wood Chips Down 26% In 2009 As Pulpmills Reduce Production Worldwide, Reports Wood Resources International  

E-Print Network (OSTI)

from South Africa have declined 40%. With pulp production slowly increasing this fall and energy are Australia, South Africa, Vietnam and Uruguay. Australia, the world's largest exporter, has reduced shipmentsHome Page > Business > Industrial > Global Trade Of Wood Chips Down 26% In 2009 As Pulpmills Reduce

334

Internship Philips Research North America, Briarcliff Manor, NY Philips Research North America (PRNA) is one of Philips' six worldwide research laboratories where  

E-Print Network (OSTI)

of Healthcare and Lighting and in the areas of Controls, Communication, & Healthcare Informatics (CCHI/C++. · Interest in medical imaging, background/knowledge in ultrasound is preferred. · Clinical experience

Adams, Mark

335

Internship Philips Research North America, Briarcliff Manor, NY Philips Research North America (PRNA) is one of Philips' six worldwide research laboratories where  

E-Print Network (OSTI)

of Healthcare and Lighting and in the areas of Controls, Communication, & Healthcare Informatics (CCHI. · Interest in medical imaging, background/knowledge in ultrasound is preferred by not required. · Clinical

Adams, Mark

336

High-Throughput Analysis of Antimalarial Susceptibility Data by the WorldWide Antimalarial Resistance Network (WWARN) In Vitro Analysis and Reporting Tool  

Science Journals Connector (OSTI)

...Travers, C Rogier, and B Pradines. 2011. Use of the atmospheric generators for capnophilic bacteria Genbag-CO2 for the evaluation...L Gerena, M Lopez-Sanchez, NE Roncal, and NC Waters. 2007. Assessment and continued validation of the...

Charles J. Woodrow; Sabina Dahlström; Richard Cooksey; Jennifer A. Flegg; Hervé Le Nagard; France Mentré; Claribel Murillo; Didier Ménard; François Nosten; Kanlaya Sriprawat; Lise Musset; Neils B. Quashie; Pharath Lim; Rick M. Fairhurst; Sam L. Nsobya; Veronique Sinou; Harald Noedl; Bruno Pradines; Jacob D. Johnson; Philippe J. Guerin; Carol H. Sibley; Jacques Le Bras

2013-04-22T23:59:59.000Z

337

1.1 million searches50% linked to full text18,500+ new records 10+ million PDFs displayed of TIC-hosted materials70 academic subscribers worldwide  

E-Print Network (OSTI)

1.1 million searches·50% linked to full text·18,500+ new records 10+ million PDFs displayed of TIC at: http://tic.msu.edu/TIC_Annual_Report_2012.pdf #12;TIC Annual 2012·i Contents Historic Milestones of TIC

Liu, Taosheng

338

Population Physiologically-Based Pharmacokinetic Modeling for the Human Lactational Transfer of PCB 153 with Consideration of Worldwide Human Biomonitoring Results  

E-Print Network (OSTI)

P. J. J. (1994). PCB and dioxin levels in plasma and humanexposure to PCBs and dioxins. Chemosphere 28, Kostyniak, P.to polychlorinated biphenyls and dioxins through dietary

Redding, Laurel E.

2010-01-01T23:59:59.000Z

339

ADP-Glucose Pyrophosphorylase, a Regulatory Enzyme for Bacterial Glycogen Synthesis  

Science Journals Connector (OSTI)

...and J. Preiss. 1998. Starch: basic science to biotechnology...wheat endosperm increases seed yield. Proc. Natl...pyrophosphorylase in regulating starch levels in plant tissues...genes in relation to starch biosynthesis during seed development in Vicia...

Miguel A. Ballicora; Alberto A. Iglesias; Jack Preiss

2003-06-01T23:59:59.000Z

340

Rumen holotrich ciliate protozoa.  

Science Journals Connector (OSTI)

...G. S. 1969. The metabolism of starch, maltose, glucose...degrada- tion of starch by holotrich protozoa...M. 1982. Energy metabolism of anaerobic protozoa...effect of protein and starch from cereal seeds upon the number of...

A G Williams

1986-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Hyperthermophilic Enzymes: Sources, Uses, and Molecular Mechanisms for Thermostability  

Science Journals Connector (OSTI)

...adjunct to PCR to break down cellular structures...Applications in Starch Processing Most...thermostable a-amylase at 95C for 2...replace a-amylases during starch liquefaction...involves a-amylase-catalyzed starch liquefaction...

Claire Vieille; Gregory J. Zeikus

2001-03-01T23:59:59.000Z

342

Genetic Engineering of Algae for Enhanced Biofuel Production  

Science Journals Connector (OSTI)

...of the insoluble starch granule. In A. thaliana, alpha-amylase (AMY3) is thought to participate in starch degradation, and...Interestingly, starch can be degraded even when all three alpha-amylases in A. thaliana have...

Randor Radakovits; Robert E. Jinkerson; Al Darzins; Matthew C. Posewitz

2010-02-05T23:59:59.000Z

343

Bacteroides: the Good, the Bad, and the Nitty-Gritty  

Science Journals Connector (OSTI)

...that contribute to starch utilization by Bacteroides...pullulanase, and an alpha-glucosidase to...thetaiotaomicron on starch. J. Bacteriol...Cell-associated alpha-amylases of butyrate-producing...maltooligosaccharides and starch. J. Bacteriol...

Hannah M. Wexler

2007-10-01T23:59:59.000Z

344

Co-utilization of polymerized carbon sources by Bacteroides ovatus grown in a two-stage continuous culture system.  

Science Journals Connector (OSTI)

...mixtures of starch and arabinogalactan...substrates (amylase, arabinogalactanase, alpha-glucosidase...indicating that starch was being preferentially...mixtures of starch and arabinogalactan...substrates (amylase, arabinogalactanase, alpha-glucosidase...

G T MacFarlane; G R Gibson

1991-01-01T23:59:59.000Z

345

PROCEEDINGS OF THE CONFERENCE ON ENERGY RESEARCH AT HISTORICALLY BLACK UNIVERSITIES, JUNE 17-19, 1980, SHERATON PATRIOT INN, WILLIAMSBURG, VIRGINIA  

E-Print Network (OSTI)

for the fuel alcohol production. Bioconversion of algae andfuel ethanol from starch and starch-like photosyn- thetic storage products of selected algae and

Authors, Various

2014-01-01T23:59:59.000Z

346

ZBP2 Facilitates Binding of ZBP1 to ?-Actin mRNA during Transcription  

Science Journals Connector (OSTI)

...the N-terminal region was done using Clontechs mouse embryo marathon ready cDNA (catalog no. 7458-1) as the template. The PCR...fluorescence microscope equipped with an Olympus PlanApo60X, 1.4NA oil objective. Images were acquired with a Roper coolSNAP HQ cooled...

Feng Pan; Stefan Hüttelmaier; Robert H. Singer; Wei Gu

2007-09-24T23:59:59.000Z

347

Condamine River Meteor Zamia  

E-Print Network (OSTI)

CONNORS Cape Townshend Townshend Island Island Long Broad Sound Condamine River Maran oa Comet Isaac Daws Roper Nogoa Ca llide Bungeworgorai North Balmy L ogan Denison L o t us Buck land Con ciliation Humb oldt Elphinstone Dam Eungella Dam R Ck Nebo RomaAmby Wowan Warra Miles Moura Dingo Comet Alpha Banana Rannes Marmor

Greenslade, Diana

348

NASA Technical Memorandum 109172 A Strategy for Electronic Dissemination of NASA  

E-Print Network (OSTI)

NASA Technical Memorandum 109172 A Strategy for Electronic Dissemination of NASA Langley Technical Administration Langley Research Center · Hampton, Virginia 23681-0001 NASA Technical Memorandum 109172 A Strategy for Electronic Dissemination of NASA Langley Technical Publications Donna G. Roper, Mary K. McCaskill, Scott D

Nelson, Michael L.

349

CE405/505: Protein Engineering MWF 9 9:50 am, 214 Norton Hall  

E-Print Network (OSTI)

, protease, etc) detergent (subtilisin) starch-processing industry (alpha amylase, glucose isomerase) waste

Park, Sheldon

350

Characterization of ApuB, an Extracellular Type II Amylopullulanase from Bifidobacterium breve UCC2003  

Science Journals Connector (OSTI)

...role of this gene in starch metabolism. The study of the...effect. Although starch and related compounds...Plant cells and seeds are a rich source of starch where it is deposited...available on the metabolism of starch and related...

Mary O'Connell Motherway; Gerald F. Fitzgerald; Sabine Neirynck; Sinead Ryan; Lothar Steidler; Douwe van Sinderen

2008-08-08T23:59:59.000Z

351

Transportation and its Infrastructure  

E-Print Network (OSTI)

Hydrothermal liquefaction Hydrolysis Sugar/starch crops Oil plants Animal fat Milling and hydrolysis Processing

2007-01-01T23:59:59.000Z

352

Heterologous expression of Thermobifida fusca thermostable alpha-amylase in Yarrowia lipolytica and its application in boiling stable resistant sago starch preparation  

Science Journals Connector (OSTI)

A gene encoding the thermostable ?-amylase in Thermobifida fusca NTU22 was amplified by PCR, sequenced, and cloned into Yarrowia lipolytica P01g host strain using the vector pYLSC1 allowing constitutive expressio...

Chao-Hsun Yang; Yu-Chun Huang; Cheng-Yu Chen…

2010-09-01T23:59:59.000Z

353

Study on great northern beans (Phaseolus vulgaris): effect of drum drying process on bean flour properties and effect on gamma radiation on bean starch properties  

SciTech Connect

Great Northern bean (Phaseolus vulgaris L.) drum dried flours at native pH of 6.54, pH 6 and 7 showed reduced activities of trypsin inhibitor, ..cap alpha..-amylase inhibitor, hemagglutinating titer, and nitrogen solubility. Electrophoretic analyses showed a slight modification of the native bean proteins, and the presence of at least four trypsin inhibitors. The study of the effect of 2.5-20 kGy irradiation doses on Great Northern beans showed essentially no modification of the electrophoretic mobility of the storage proteins or the trypsin inhibitors. Nitrogen solubility and hemagglutinating activity were essentially unchanged. With the 20 kGy dose, decrease in ..cap alpha..-amylase inhibitor activity, decrease reactive/available lysine content, and decrease cooking time of the irradiated beans after 11 months of storage were observed. Taste panel results indicated that the control and 20 kGy irradiated bean were significantly different at 5% level. At 20 kGy dose, the beans developed a partially water soluble brown color.

Rayas-Solis, P.

1988-01-01T23:59:59.000Z

354

Fusion of Self-Assembling Amphipathic Oligopeptides with Cyclodextrin Glycosyltransferase Improves 2-O-d-Glucopyranosyl-l-Ascorbic Acid Synthesis with Soluble Starch as the Glycosyl Donor  

Science Journals Connector (OSTI)

...research-article Enzymology and Protein Engineering Fusion of Self-Assembling Amphipathic Oligopeptides...glycosyl donors. The results showed that two fusion enzymes, SAP5-CGTase and SAP6-CGTase...Enzymatic characterization of the two fusion enzymes was performed, and kinetics analysis...

Ruizhi Han; Jianghua Li; Hyun-dong Shin; Rachel R. Chen; Long Liu; Guocheng Du; Jian Chen

2014-05-23T23:59:59.000Z

355

Starch Granule Biosynthesis in Arabidopsis Is Abolished by Removal of All Debranching Enzymes but Restored by the Subsequent Removal of an Endoamylase  

Science Journals Connector (OSTI)

...and is a key renewable resource for humankind as both food and an industrial raw...moiety of ADP-Glc to the nonreducing end of an existing chain. Branch points...pullulan (maltotriosyl units linked end-to-end by alpha-1,6-bonds). The...

Sebastian Streb; Thierry Delatte; Martin Umhang; Simona Eicke; Martine Schorderet; Didier Reinhardt; Samuel C. Zeeman

2008-12-12T23:59:59.000Z

356

WILEY-VCH Verlag GmbH, 69451 Weinheim, 2002 0038-9056/2002/0707-0273 $17.50+.50/0 Starch/Strke 54 (2002) 273284 273  

E-Print Network (OSTI)

solids and treat water for recycling in many food process- ing industries. Several reviews have been processing industry; these include pretreatment of fresh water, recovery of solids and wastewater treatment- ducing evaporation costs, improving product recovery and removing solids prior to wastewater treatment

357

Comparative Characterization of Complete and Truncated Forms of Lactobacillus amylovorus ?-Amylase and Role of the C-Terminal Direct Repeats in Raw-Starch Binding  

Science Journals Connector (OSTI)

...derived from the alpha-amylase gene (amyA) of Lactobacillus...AmyADelta) forms of alpha-amylase; AmyADelta lacks...AmyADelta exhibit similar amylase activities towards...soluble substrates (amylose, amylopectin and alpha-cyclodextrin, and...

R. Rodriguez Sanoja; J. Morlon-Guyot; J. Jore; J. Pintado; N. Juge; J. P. Guyot

2000-08-01T23:59:59.000Z

358

Starch Granule Biosynthesis in Arabidopsis Is Abolished by Removal of All Debranching Enzymes but Restored by the Subsequent Removal of an Endoamylase  

Science Journals Connector (OSTI)

...mutant are degraded by alpha- and beta-amylases during periods of...the chloroplastic alpha-amylase AMY3 partially reverts...function in normal amylopectin synthesis by promoting...amylopectin and amylose) and occurs as semicrystalline...

Sebastian Streb; Thierry Delatte; Martin Umhang; Simona Eicke; Martine Schorderet; Didier Reinhardt; Samuel C. Zeeman

2008-12-12T23:59:59.000Z

359

Comparing the effect of hydroxyethyl starch 130/0.4 with balanced crystalloid solution on mortality and kidney failure in patients with severe sepsis (6S - Scandinavian Starch for Severe Sepsis/Septic Shock trial): Study protocol, design and rationale for a double-blinded, randomised clinical trial  

Science Journals Connector (OSTI)

The independent Data Monitoring and Safety Committee - DMSC - will recommend pausing or stopping the...4 for details)

Anders Perner; Nicolai Haase; Jørn Wetterslev; Anders Åneman; Jyrki Tenhunen…

2011-01-01T23:59:59.000Z

360

Check Point Software Technologies Ltd., worldwide leader in securing the Internet, is the only vendor to deliver Total Security for networks, data and endpoints, unified under a single management framework.  

E-Print Network (OSTI)

open positions at Check Point: User Experience: Major Responsibilities: Leading user-centered design specifications and design concepts for applications. Design and execute usability test procedures, including analytics, surveys & field testing. Guide and train developers on usability principles, and provide them

Pinsky, Ross

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

World Health Organization reported cancer to be leading cause of death that accounted for 7.6 million deaths worldwide in 2008, which is about 13% of all deaths. Out of this colorectal  

E-Print Network (OSTI)

of valdecoxib, a cyclogenase-2 enzyme inhibitor were prepared in mucoadhesive polymers viz. sodium alginate or chitosan and were film coated with pH sensitive polymer Eudragit S100. The microspheres were characterized

Kumar, M. Jagadesh

362

Worldwide, accelerating glacier loss provides independent and startling evidence that global warming is occurring1 It is now clear that the Earth is warming rapidly due to man-made emissions of carbon dioxide and other heat-trap-  

E-Print Network (OSTI)

-made emissions of carbon dioxide and other heat-trap- ping gases, which blanket the planet and cause temperatures future limits on carbon emissions. · Electricity consumers should opt for "green power" where imperative that emissions of the main heat-trapping gas, car- bon dioxide (CO2), are significantly reduced

Combes, Stacey A.

363

Life at High Temperatures  

Science Journals Connector (OSTI)

...carbohydrate is starch, derived primarily from corn. Corn syrup (hydrolyzed corn starch) is produced in enormous amounts by the corn wet-milling industry and can be readily utilized in microbial...

Thomas D. Brock

1985-10-11T23:59:59.000Z

364

Enzymatic corn wet milling: engineering process and cost model  

Science Journals Connector (OSTI)

Enzymatic corn wet milling (E-milling) is a process derived from conventional wet milling for the recovery and purification of starch ... the total starch production in USA by conventional wet milling equaled 23 ...

Edna C Ramírez; David B Johnston; Andrew J McAloon…

2009-01-01T23:59:59.000Z

365

Stable, inducible thermoacidophilic alpha-amylase from Bacillus acidocaldarius.  

Science Journals Connector (OSTI)

...thermoacidophilic a-amylase. This paper...potato starch amylopectin, and amylose were obtained...ide, and a-amylase-free barley...acidocaldarius amylase was able to hy- drolyze starch, amylose, amylopectin, and gly- cogen...

V Buonocore; C Caporale; M De Rosa; A Gambacorta

1976-11-01T23:59:59.000Z

366

A novel method for the preparation of biodegradable microspheres for protein drug delivery  

Science Journals Connector (OSTI)

...glucose, i.e. linear amylase and branched amylopectin (Young 1984). Starch...release from poly(alpha-hydroxy acid) microspheres...properties of substituted amylase matrices. Int. J...Marchessault1998Cross-linked high amylose starch for controlled...

2006-01-01T23:59:59.000Z

367

Fusion of an Oligopeptide to the N Terminus of an Alkaline ?-Amylase from Alkalimonas amylolytica Simultaneously Improves the Enzyme's Catalytic Efficiency, Thermal Stability, and Resistance to Oxidation  

Science Journals Connector (OSTI)

...starch, amylopectin, amylose, glycogen, alpha-cyclodextrin...starch, amylopectin, amylose, glycogen, alpha-cyclodextrin...that form alpha-helical...microdetermination of amylase activity by the use of amylose as the substrate...

Haiquan Yang; Xinyao Lu; Long Liu; Jianghua Li; Hyun-dong Shin; Rachel R. Chen; Guocheng Du; Jian Chen

2013-03-01T23:59:59.000Z

368

Purification and Properties of Extracellular Amylase from the Hyperthermophilic Archaeon Thermococcus profundus DT5432.  

Science Journals Connector (OSTI)

...action. The amylase hydrolyzed...starch, amylose, amylopectin, and glycogen...maltotriose of (alpha)-configuration...Extracellular Amylase from the...action. The amylase hydrolyzed...starch, amylose, amylopectin, and glycogen...maltotriose of (alpha)-configuration...

Y C Chung; T Kobayashi; H Kanai; T Akiba; T Kudo

1995-04-01T23:59:59.000Z

369

Comparison of Paenibacillus azotofixans Strains Isolated from Rhizoplane, Rhizosphere, and Non-Root-Associated Soil from Maize Planted in Two Different Brazilian Soils  

Science Journals Connector (OSTI)

...were capable of metabolizing starch. Hence, starch metabolism might play an important role...Mavingui et al. () for sorbitol metabolism in wheat roots. Other sugars...specificity in the infection of cereals with Azospirillum spp. . Bassam...

Lucy Seldin; Alexandre Soares Rosado; Davi William da Cruz; Alberto Nobrega; Jan Dirk van Elsas; Edilson Paiva

1998-10-01T23:59:59.000Z

370

Genetic contributions to agricultural sustainability  

Science Journals Connector (OSTI)

...value of seeds of transgenic...sunflower seed albumin gene...design of cereal starches. Curr...In Sulfur metabolism in higher...structure of starch and enzyme...methionine in seeds of a maize...threonine. Cereal Chem. 62...

2008-01-01T23:59:59.000Z

371

Genetically Engineering Plants for Crop Improvement  

Science Journals Connector (OSTI)

...manipulating cellular metabolism, and this new research...engineered plants in the seed production and agrichemical...larger quantities of starch or specialized starches with various degrees...particular fatty acids in seed crops, and (iii...

CHARLES S. GASSER; ROBERT T. FRALEY

1989-06-16T23:59:59.000Z

372

SWEET! The Pathway Is Complete  

Science Journals Connector (OSTI)

...e.g., sugars, starch), upon which all terrestrial...flowers, fruits, and seeds. Sucrose can be directly...can be converted into starch in cereal seeds and potato tubers. Thus...Animals Arabidopsis metabolism Arabidopsis Proteins...

David M. Braun

2012-01-13T23:59:59.000Z

373

Seasonal changes in the cecal microflora of the high-arctic Svalbard reindeer (Rangifer tarandus platyrhynchus).  

Science Journals Connector (OSTI)

...summer and winter. Other starch-fermenting species...constituents in hay, cereal and hay-cereal rations. Br. J. Nutr...1970. Influence of starch digestion in large intestine...ed.), Digestion and metabolism in the ruminant. The...

S D Mathiesen; C G Orpin; Y Greenwood; A S Blix

1987-01-01T23:59:59.000Z

374

Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.  

Science Journals Connector (OSTI)

...electrophoresis. One ofthese amylases was purified by...extracellular a-amylase were: opti- mum...characteristic of alpha-type amylases. The relative...lose, soluble starch, amylopectin...in rumen starch break- down. MATERIALS AND...

S J McWethy; P A Hartman

1977-03-01T23:59:59.000Z

375

The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract  

Science Journals Connector (OSTI)

...cellulases, and {alpha}- and {beta}-amylases in B. longum...and branched starches (limit dextrins...pectins and linear starch. Interestingly...largely broken down in the colon...prokaryotically-rare {alpha}-mannosidases...may partially break down mucin...

Mark A. Schell; Maria Karmirantzou; Berend Snel; David Vilanova; Bernard Berger; Gabriella Pessi; Marie-Camille Zwahlen; Frank Desiere; Peer Bork; Michele Delley; R. David Pridmore; Fabrizio Arigoni

2002-01-01T23:59:59.000Z

376

MalE of Group A Streptococcus Participates in the Rapid Transport of Maltotriose and Longer Maltodextrins  

Science Journals Connector (OSTI)

...a-amylase is unable to break down maltotriose, which allows...salivary isoamylases on starch and glycogen. Clin...Muhlemann. 1981. Oral starch degradation and its influence...Levine. 1993. Salivary alpha-amylase: role in dental plaque...

Samuel A. Shelburne III; Han Fang; Nnaja Okorafor; Paul Sumby; Izabela Sitkiewicz; David Keith; Payal Patel; Celest Austin; Edward A. Graviss; James M. Musser; Dar-Chone Chow

2007-01-26T23:59:59.000Z

377

Enzyme Polymorphism and Metabolism  

Science Journals Connector (OSTI)

...SUAREZ, Z, ALPHA-GLYCEROLPHOSPHATE...in Drosophila to break down secondary compounds...oligosaccharides Breakdown of starch Adenine phosphoribosyl...oxidase Aldolase Amylase Carbonic anhydrase...Glycolysis Breakdown starch and glycogen (68...

George B. Johnson

1974-04-05T23:59:59.000Z

378

E-Print Network 3.0 - acid dimethyl ester Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

and Properties of Higher Fatty Esters of Corn Starch Summary: fatty esters (C8C18) of potato starch and corn amylose using fatty acid chlorides and pyridine... exploratory...

379

Effect of limestone reactivity on the digestibility of nutrients in sorghum based diets fed to lactating Holstein cows  

E-Print Network (OSTI)

' the starch- digesting enzyme, pancreatic alpha-amylase. Thus, fecal starch loss in cows fed high energy rations has increased, and, in turn, income over feed costs for a dairyman has d. ecreased. Attempts have been made to improve starch digestibi- lity... in all regions, intestinal maltase activity in intestinal mucosa exceed- ed amylase activity. On the other hand, Mayes and Orskov (28) showed that alpha amylase activity was also not limiting over-all starch utilization in sheep infused with gelled...

Malasri, Kriangchitt Banphabutr

2012-06-07T23:59:59.000Z

380

California’s Energy Future: The View to 2050 - Summary Report  

E-Print Network (OSTI)

Energy Future - The View to 2050 Bin Biofuel Technology Hydrogen Ethanol from sugar and starch (e.g. , corn,

Yang, Christopher

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

California's Energy Future - The View to 2050  

E-Print Network (OSTI)

Energy Future - The View to 2050 Bin Biofuel Technology Hydrogen Ethanol from sugar and starch (e.g. , corn,

2011-01-01T23:59:59.000Z

382

Fermentation of sorghum dough by genus Lactobacillus  

E-Print Network (OSTI)

, sorghum flour can be mixed with wheat flours to produce acceptable bread and pastry products (Rooney, 1970). To determine the cooking quality of sorghum flour, Hiller and Burns (1970) studied the content of total starch, amylose, amylopectin, starch..., sorghum flour can be mixed with wheat flours to produce acceptable bread and pastry products (Rooney, 1970). To determine the cooking quality of sorghum flour, Hiller and Burns (1970) studied the content of total starch, amylose, amylopectin, starch...

Clark, Susie Hong Nguyen

2012-06-07T23:59:59.000Z

383

Nutrient digestion in various segments of the gastrointestinal tract of ponies fed two, three or four meals per day  

E-Print Network (OSTI)

Starch Di stion The digestion of starch occurs primarily in the small intestine, initiated by the amylases and continued by the small intestinal glucosidases, particularly the maltases, glucoamylase and isomaltase (Pike and Brown, 1984). While parotid... Starch Di stion The digestion of starch occurs primarily in the small intestine, initiated by the amylases and continued by the small intestinal glucosidases, particularly the maltases, glucoamylase and isomaltase (Pike and Brown, 1984). While parotid...

Brown, Kimberly Massey

2012-06-07T23:59:59.000Z

384

Process design for energy saving ethanol production  

Science Journals Connector (OSTI)

A process design is shown which minimizes the energy consumption for production of ethanol from starch-containing raw materials.

U. Tegtmeier

1985-02-01T23:59:59.000Z

385

Production of Amylase in Liquid Culture by a Strain of Aspergillus oryzae  

Science Journals Connector (OSTI)

...Bernfeld, P. 1951. Enzymes of starch degradation and synthe- sis...of dry cultures of molds for starch saccharification. Spirtovaya...I. 1948. The relation of starch saccharifying power of fungi...maltase by certain Aspergilli. Cereal Chem. 27:322-330. 33...

A. K. Kundu; S. Das

1970-04-01T23:59:59.000Z

386

An a-amylase (At4g25000) in Arabidopsis leaves is secreted and induced by biotic and abiotic stress  

E-Print Network (OSTI)

role in endosperm starch degradation during cereal seed germination (Beck & Ziegler 1989). Dis- ruption is that leaf cells are alive during transitory starch degradation, whereas cereal endosperm is dead encoding this enzyme has not been described. Because a secreted amylase is isolated from plas- tidic starch

Mudgettt, Mary Beth

387

THE MEDALIST  

Science Journals Connector (OSTI)

...children fed with cereals and skimmed (fat...if it be fed with starch (which is free from...purified protein, starch, salts and butter...of the embryos of seeds or certain animal...purified pro-tein, starch, salts, yeast and...a thought to his metabolism? The secret of this...

Graham Lusk

1927-06-10T23:59:59.000Z

388

Association of Rapidly Metabolized DNA and RNA  

Science Journals Connector (OSTI)

...a-dextrin was formed from starch by the B. macerans...was incubated with starch, even though oligosaccharides...Schardinger dextrins from starch and (ii) cyclodextrinase...L. C. Rawlins, Cereal Chem. 28, 49...germinat-ing peanut seeds. Konrad and Stent...Be-cause the rates of metabolism are much lower in...

Joe H. Cherry

1964-11-20T23:59:59.000Z

389

STUDIES ON THE METABOLISM OF B. BOTULINUS IN VARIOUS MEDIA. XXVI  

Science Journals Connector (OSTI)

...pepton solutions on the metabolism of an organism (probably...sucrose, and soluble starch were added in 2 per...92.4 6.8 835 Starch...with the exception of starch, they apparently exert...pH 4.7) de- 340 METABOLISM OF B. BOTULINUS IN...

E. Wagner; K. F. Meyer; C. C. Dozier

1925-07-01T23:59:59.000Z

390

Cold Resistance and Injury in Woody Plants  

Science Journals Connector (OSTI)

...major realignment of metabolism following growth...which indicates that starch is converted to sugar...effects of sugar on cereal coleoptiles, spinach...disappearance of starch than to the increase...of ripening in dry seeds. There are several...12, 67, 88), starch (92), sugars...

C. J. Weiser

1970-09-25T23:59:59.000Z

391

Book Reviews  

Science Journals Connector (OSTI)

...exclusively with starch, cell wall com-ponents...crasselean acid metabolism. The following...germi-nation of Vicia faba seeds. Since little at-tention...been given to sugar metabolism in plants that use...thoughtful chapter on starch metabolism by M...starch degradation in cereal grains, cell wall...

1975-06-20T23:59:59.000Z

392

Multifunctional Nutrient-Binding Proteins Adapt Human Symbiotic Bacteria for Glycan Competition in the Gut by Separately Promoting Enhanced Sensing and Catalysis  

Science Journals Connector (OSTI)

...of growth on starch in a manner dependent...gnotobiotic mice fed a starch-rich diet that...human gut is to break down complex carbohydrates...the prototypic starch utilization system...composed solely of alpha-1,4- and...catalytic site, the amylase SusG contains...

Elizabeth A. Cameron; Kurt J. Kwiatkowski; Byung-Hoo Lee; Bruce R. Hamaker; Nicole M. Koropatkin; Eric C. Martens

2014-10-01T23:59:59.000Z

393

Preferential Packing of Acidic Glycosidases and Proteases into Bacteroides Outer Membrane Vesicles  

Science Journals Connector (OSTI)

...are able to break down polysaccharides...belong to the starch utilization...Acidic BF0810 alpha-l-Fucosidase...1737 alpha-Amylase Yes Alkaline...contribute to starch utilization...cell-membrane-associated alpha-amylase from a prominent...targets complex starch molecules...

Wael Elhenawy; Mykhaylo O. Debelyy; Mario F. Feldman

2014-04-01T23:59:59.000Z

394

Glycan Foraging in Vivo by an Intestine-Adapted Bacterial Symbiont  

Science Journals Connector (OSTI)

...that can break down a broad array...and import starch, 226 predicted...of genes down-regulated in...S3A). The starch utilization...simplified starch composed of three {alpha}1-4...alpha}-amylases are the only...CPS3 was down-regulated...

Justin L. Sonnenburg; Jian Xu; Douglas D. Leip; Chien-Huan Chen; Benjamin P. Westover; Jeremy Weatherford; Jeremy D. Buhler; Jeffrey I. Gordon

2005-03-25T23:59:59.000Z

395

Honor thy symbionts  

Science Journals Connector (OSTI)

...acquisition of starch (see below...eight-component starch utilization system...involved in binding starch and intermediate-size...subsequently broken down by outer...aeruginosa PAO1 Amylase 8 2 0 2 1 0 Arabinase 2 0 0 0 0 0 {alpha}-Arabinofuranosidase...foundation species that breaks down a large variety...

Jian Xu; Jeffrey I. Gordon

2003-01-01T23:59:59.000Z

396

A Genomic View of the Human-Bacteroides thetaiotaomicron Symbiosis  

Science Journals Connector (OSTI)

...known to break down a wide variety...glycosylhydrolases ({alpha}-galactosidases...mannosidases, amylases, and endo-1...thetaiotaomicron starch utilization...thetaiotaomicron starch utilization...binding of starches to the bacterial...subsequently broken down by outer...periplasmic -amylases (16...

Jian Xu; Magnus K. Bjursell; Jason Himrod; Su Deng; Lynn K. Carmichael; Herbert C. Chiang; Lora V. Hooper; Jeffrey I. Gordon

2003-03-28T23:59:59.000Z

397

Composition of Forage and Grain from Second-Generation Insect-Protected Corn MON 89034 Is Equivalent to That of Conventional Corn (Zea mays L.)  

Science Journals Connector (OSTI)

The TDF was estimated by gelatinizing the samples with alpha-amylase and by digesting with enzymes to break down the starch and protein. ... like CM-cellulose, polydextrose, lactulose, enzymic like modified starches and starch syrups or microbial like xanthan and gellan gum. ...

Suzanne M. Drury; Tracey L. Reynolds; William P. Ridley; Natalia Bogdanova; Susan Riordan; Margaret A. Nemeth; Roy Sorbet; William A. Trujillo; Matthew L. Breeze

2008-05-20T23:59:59.000Z

398

The application of enzyme reaction, nonlinear diffusion models to the malting process  

Science Journals Connector (OSTI)

...to close down the reaction...sugar from starch. A schematic...beta-glucanases, which break up glutin...endosperm. The starch molecules...so-called alpha and beta amylases, the second...released starch to produce...second stage breaks down into the...

2010-01-01T23:59:59.000Z

399

Effect of drying, initial moisture and variety in corn wet milling  

Science Journals Connector (OSTI)

A laboratory wet-milling process was used to determine starch yield and starch recovery of dent and flint corn dried under different drying conditions. A comparison with undried samples was performed. For the undried samples the starch recovery was not significantly different between both varieties. It decreased as both initial moisture content of the grains and drying air temperature increased. The reduction in starch recovery as well as the contamination by protein was greater for the flint than for the dent corn. Swelling, solubility and initial gelatinization temperatures of the starch derived from both varieties were affected by the drying conditions.

Mónica Haros; Costantino Suarez

1997-01-01T23:59:59.000Z

400

Related Publications International Space Station Research and Development Reviews  

E-Print Network (OSTI)

........................................................................................................... 24 Advanced NASA Technology Supports Water Purification Efforts Worldwide

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Performance based evaluation of the seismic resistance of structures with concrete diaphragms  

E-Print Network (OSTI)

. . . . 2. 2. 4 I:6 Scaled Shaking Table Models. 2. 3 Analytical Research 2. 3. 1 Button et al. (1984). 2. 3. 2 Roper and Iding (1984). . 2. 3. 3 Jain and Jennmgs (1984, 1985) . 2. 3. 4 Boppana and Nactm (1985). 2. 3. 5 Syramakezis and Chronopoulos... (1986, 1989). . . . . 2. 3. 6 Kunnath et al. (1991) . . 2. 3. 7 Dolce (1992) . 2. 3. 8 Kang (1993) 2. 3. 9 Lopez et al. (1994) . . 8 8 9 ll 13 14 18 19 20 23 25 27 29 32 33 35 Page 3. CASE STUDY BUILDINGS AND MODELING CRITERIA...

Barron, Joel Martin

2012-06-07T23:59:59.000Z

402

Diffraction dissociation at the LHC  

SciTech Connect

We report on recent calculations of low missing mass single (SD) and double (DD) diffractive dissociation at LHC energies. The calculations are based on a dual-Regge model, dominated by a single Pomeron exchange. The diffractively excited states lie on the nucleon trajectory N*, appended by the isolated Roper resonance. Detailed predictions for the squared momentum transfer and missing mass dependence of the differential and integrated single-and double diffraction dissociation in the kinematical range of present and future LHC measurements are given.

Jenkovszky, Laszlo [Bogolyubov Institute for Theoretical Physics (BITP), Ukrainian National Academy of Sciences 14-b, Metrolohichna str., Kiev, 03680, Ukraine and Wigner Research Centre for Physics, Hungarian Academy of Sciences 1525 Budapest, POB 49 (Hungary); Orava, Risto [Institute of Physics, Division of Elementary Particle Physics, P.O. Box 64 (Gustaf Haellstroeminkatu 2a), FI-00014 University of Helsinki, Finland and CERN, CH-1211 Geneva 23 (Switzerland); Salii, Andrii [Bogolyubov Institute for Theoretical Physics (BITP), Ukrainian National Academy of Sciences 14-b, Metrolohichna str., Kiev, 03680 (Ukraine)

2013-04-15T23:59:59.000Z

403

Studies of physical characteristics and animal response to reconstituted sorghum grain  

E-Print Network (OSTI)

date of reconstitution 35 Endosperm cells containing starch granules from dry grain (840X). 51 Endosperm cells containing starch granules from reconstituted grain (840X) 51 Starch granules from reconstituted grain (840X) 52 10 Reconstituted grain... sorghums *re excellent feed for all classes of livestock. They are generally equal to or better than other cereal grains, including corn, in the production of gain. Grain sorghum can fit into feed rations for fatten- ing all classes of livestock, creep...

Florence, Harold Douglas

2012-06-07T23:59:59.000Z

404

E-Print Network 3.0 - amyloplasts Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

been considered to be an unidirectional and vectorial process wherein ADPG... production and its ultimate conversion to starch in the amyloplast. Because both chloroplasts...

405

E-Print Network 3.0 - aspergillus usamii induced Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

may have either repressing or inducing effects on enzyme productions... . Glucoamylase, amylase, and a-glucosidase are all dup- regulatedT (induced) by starch and ddown Source:...

406

Metagenomic and Cultivation-Based Analysis of Novel Microorganisms and Functions in Metal-Contaminated Environments  

E-Print Network (OSTI)

to break down starch and alpha-amylase genes for glycogenlyase/aceA K01637 Alpha-amylase K07405 Glucoamylase K01178

Yelton, Alexis Pepper

2012-01-01T23:59:59.000Z

407

Diary of Societies  

Science Journals Connector (OSTI)

... Light. I. The Hydrolysis of Starch.-R. B. Thomson and H. B. Sifton: Resin Canals in the Spruce (Picea). An Anatomical and Orcological Study and its ...

1925-05-09T23:59:59.000Z

408

A Low-Carbon Fuel Standard for California, Part 1: Technical Analysis  

E-Print Network (OSTI)

oils (soybean, palm oil, canola, mustard), algae, Starch;properties differ from canola biodiesel, which in turncrops, including soybeans, canola and mustard seeds, and

Farrell, Alexander E.; Sperling, Dan

2007-01-01T23:59:59.000Z

409

A Low-Carbon Fuel Standard for California Part 1: Technical Analysis  

E-Print Network (OSTI)

oils (soybean, palm oil, canola, mustard), algae, Starch;properties differ from canola biodiesel, which in turncrops, including soybeans, canola and mustard seeds, and

2007-01-01T23:59:59.000Z

410

Assessing Impact of Biofuel Production on Regional Water Resource...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Jones et al. 2009 Multiple Products Produced from Biorefinery Biofuel Bio- electricity Biogas Animal feed Fertilizer Chemicals Agricultural residue, grain starch, oil seeds, forest...

411

Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

derived from grain starch, oil seed, animal fats, or other biomass; or produced from a biogas source, including any non-fossilized, decaying, organic matter capable of powering...

412

E-Print Network 3.0 - alloplastic graft material Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

ovei the level of grafting, ease of control of the final material properties... Aliphatic polyester-grafted starch composites by in situ ring opening polymerization* Abstract......

413

Contamination issues in a continuous ethanol production corn wet milling facility  

Science Journals Connector (OSTI)

Low ethanol yields and poor yeast viability were investigated at a continuous ethanol production corn wet milling facility. Using starch slurries and recycle streams...

Esha Khullar; Angela D. Kent…

2013-05-01T23:59:59.000Z

414

Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

is produced from grain, starch, oilseeds, vegetable, algae, animal materials, or other biomass. To be eligible for the tax credit, the capital costs of the production facility must...

415

Methods to assess quality of boiled sorghum, gruel and chapaties from sorghums with different kernel characteristics  

E-Print Network (OSTI)

of carotenoids Endosperm color is classified as white, heteroyellow ?nd yellow. Waxy or non-waxy endo- sperm type is determined by the proportion of the types of starch (13, 14) . The types of starch in sorghum are primarily amylose and amylopectin. Both... are polymers of o-d-glucose. Amylose is an o. -1, 4- linked straight chain polymer. Amylopectin is an o. '-1, 6-branched, Q-1, 4-linked polymer. In most sorghums about 25% of the starch is amylose, but in waxy types almost all of the starch is amylopectin...

Waniska, Ralph Dean

2012-06-07T23:59:59.000Z

416

E-Print Network 3.0 - apoplastic solute accumulation Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

was unaffected until cell breakage, confirming... In photosynthetic tissues, transitory starch accumulates in chloroplasts during the daylight and is degraded Source: Mudgettt,...

417

E-Print Network 3.0 - acclimating pha storage Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

rev.biochem.74.082803.133013 Summary: Words starch, glycogen, polyphosphate, cyanophycin, rubber, PHA synthases, PHA depolymerases, phasin... nontemplate- dependent...

418

Isomerization of sugars  

DOE Patents (OSTI)

Disclosed are processes for isomerizing saccharides. Also disclosed are processes for converting saccharides to furan derivatives. Also disclosed are processes for converting starch to furan derivatives.

Moliner-Marin, Manuel; Roman-Leshkov, Yuriy; Davis, Mark E; Nikolla, Eranda

2014-05-20T23:59:59.000Z

419

E-Print Network 3.0 - activated ester terminated Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Developmental Biology, University of Michigan Collection: Biology and Medicine 39 Synthesis of Higher Fatty Acid Starch Esters using Vinyl Laurate and Stearate as Reactants...

420

E-Print Network 3.0 - apple blossom amaryllidaceae Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Toppings Assorted Dressings Entre Grilled Apple Barbequed Chicken Swiss... Blossom Dressing Starch Oven Roasted Quartered Red Skin Potatoes Desserts Cookies, Brownies, Bars...

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

E-Print Network 3.0 - amylum Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

carbohydrate enzyme activity in the cockroach Diploptera punctata Summary: was 1% potato starch (amylum), and for invertase, the substrate was 1% sucrose. Standards comprising...

422

E-Print Network 3.0 - amaranth quinoa buckwheat Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

3 Gluten Free Diet What is Gluten? Summary: Grains & Starches Tapioca; soybean; potato; arrowroot flours Buckwheat; quinoa; amaranth; millet; teff Source: Mootha, Vamsi K. -...

423

E-Print Network 3.0 - aqueous waxy hull-less Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

integrity became compromised (by 48 h for waxy maize and by 96 h for normal maize and potato starches Source: Guiltinan, Mark - Department of Horticulture, Pennsylvania State...

424

Transgenic Expression of a Bacterial Thermophilic Amylase in the Chlamydomonas reinhardtii Chloroplast to Facilitate Algal Biofuel Production  

Science Journals Connector (OSTI)

This study investigated expression of a thermophilic amylase (arAmyBH) from hyperthermophilic bacterium Thermotoga neapolitana into Chlamydomonas reinhardtii...chloroplast to facilitate in vivo starch hydrolysis ...

Xiaoqing Wang; Zhenhua Ruan; Danielle Boileau; Barbara B. Sears…

2014-10-01T23:59:59.000Z

425

Condensation reactions between phenol, formaldehyde and 5-hydroxymethylfurfural, formed as intermediate in the acid catalyzed dehydration of starchy products  

Science Journals Connector (OSTI)

The incorporation of starch hydrolysates in phenolic resins of the novolak and resol type via intermediate acid catalyzed dehydration to 5-hydroxymethylfurfural (HMF) has been investigated. The course...

Helmut Koch; Joachim Pein

1985-06-28T23:59:59.000Z

426

E-Print Network 3.0 - aerobic microbial ecosystems Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Starch Glucose Complex anaerobic... 12;Microbial Systems as Model Ecosystems P C R Energy Heat ... Source: Vallino, Joseph J. - Ecosystems Center, Marine Biological...

427

IBM, the IBM logo, ibm.com, Smarter Planet and the planet icon are trademarks of International Business Machines Corp., registered in many jurisdictions worldwide. Other product and service names might be trademarks of IBM or other companies. A current li  

E-Print Network (OSTI)

companies to cities. A year into this new era, the signs of a smarter planet are all around us. Smarter of digital devices, connected through the Internet, are producing a vast ocean of data. And all emerging reality. In a study of 439 cities, for those that employ transportation congestion solutions

428

Conversations for a Smarter Planet: 16 in a Series IBM, the IBM logo and ibm.com are trademarks of International Business Machines Corporation, registered in many jurisdictions worldwide. A current list of IBM trademarks is available on the Web at "Copyri  

E-Print Network (OSTI)

with nature--it harnesses it. Smart buildings can reduce energy consumption and CO2 emissions by 50% to 70, instrumentation and interconnection of all systems, recharging ports for electric cars, and ventilated chairs, let's see what new heights--and reduced footprints--we can achieve by filling them with intelligence

429

Donald Frederick, LLNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Donald Donald Frederick, LLNL - Presented at Supercomputing '11 Lawrence Livermore National Laboratory, P. O. Box 808, Livermore, CA 94551! Case Study: Beyond Homogeneous Decomposition with Qbox Scaling Long-Range Forces on Massively Parallel Systems LLNL---PRES---508651 Case S tudy: O utline * Problem D escripBon * ComputaBonal A pproach * Changes f or S caling LLNL---PRES---508651 Computer s imulaBons o f m aterials Computer s imulaBons a re w idely used t o p redict t he p roperBes o f new m aterials o r u nderstand t he properBes o f e xisBng o nes LLNL---PRES---508651 SimulaBon o f M aterials f rom F irst--- Principles First---principles m ethods: Calculate p roperBes o f a g iven m aterial d irectly f rom fundamental p hysics e quaBons. * No e mpirical p arameters Can m ake p redic-ons a bout c

430

EarlyExperienceOnBlueGeneQ.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

and Performance Engineering Team Early Experience on the Blue Gene/Q Supercomputing System Mira P erformance B oot C amp Argonne, M ay 2 1, 2 013 Argonne L eadership C ompuDng F acility Argonne N aDonal L aboratory, A rgonne, I L 2 Outline  Introduc+on - Argonne L eadership C ompu+ng F acility - From B G/P t o B G/Q  BG/Q S ystem C haracteris+cs - Memory S ubsystem - Computa+on C apabili+es - Interconnect a nd C ommunica+on P roper+es - Power C onsump+on a nd E fficiency  BG/Q S pecific F eatures - QPX --- 4 ---way S IMD V ector U nit - Prefetching U nit a nd L ist P refetching  Applica+on S tudies - GTC, G FMC, D NS3D ALCF @ Argonne 3 Produc'on S ystems: Mira - B G/Q s ystem - 49,152 nodes / 786,432 cores - 786 TB of memory - Peak fl op r ate: 1 0 P F - Linpack fl op r ate: 8 .1 P F Intrepid

431

Enzymatic hydrolysis, fermentation, and protein recovery of AFEX-treated coastal bermudagrass  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . ?. .. . Cellulase synergism. . Cellulase inhibition. . . . . . . . . . . . . . . , . . . . . , . . . ?, . . . Alpha-amylase action. Beta-limit dextrin. Transglucosylation and hydrolysis. . . . . . . . . . . Pullulanase activity. . Pectinase activity..., a-glucosidase, glucoamylase, isoamylase, and pullulanase according to their action on starch. Alpha-amylases hydrolyze starch and release the products in the a-anomeric form. Alpha-amylases can be subdivided into endo- and exo-amylases depending...

Ripley, Edward Payson, 1965-

2012-06-07T23:59:59.000Z

432

However there certainly exists some direct relationship between diet selection and sub-  

E-Print Network (OSTI)

of the protein network in the alpha-amylase susceptibility of starch from spaghetti. Pasta were cooked 10 min incubated 24 h in vitro with either human salivary or pig pancreatic alpha-amylase (HSA and PPA with both alpha-amylases. When incubated with HSA, starch was progressively removed from the protein network

Boyer, Edmond

433

The competitive adsorption of human proteins onto natural-based biomaterials  

Science Journals Connector (OSTI)

...of bulk chemistry, surface energy, wettability and phase interconnectivity...Biodegradable polymeric blends of corn starch with: (i) cellulose...2007 The influence of surface energy on competitive protein adsorption...Polyvinyls 0 Serum Albumin 0 corn starch-co-ethylene vinyl...

2010-01-01T23:59:59.000Z

434

The effects of thermal processing on properties of fundamental food polymers in commercial Asian and experimental sorghum noodles  

E-Print Network (OSTI)

that was smooth and amorphous. The protein based noodles were held together by a gluten matrix, small endosperm pieces with intact starch granules were visible and suspended within the matrix. Noodles made from any grain or starch other than wheat must rely...

Leach, Michelle R

2013-02-22T23:59:59.000Z

435

72 CEREAL CHEMISTRY Variability of Reaction Efficiencies and Pasting Properties of Acetylated Dent  

E-Print Network (OSTI)

during 1998 and nine dent corn hybrids grown during 1999 were wet-milled in the laboratory. Starch from with high amounts of extractable starch have been introduced to benefit the wet- milling industry. Corn. Hybrid effect on various corn-processing characteristics has been established in both corn wet milling

436

Metabolic Effectors Secreted by Bacterial Pathogens: Essential Facilitators of Plastid Endosymbiosis?  

Science Journals Connector (OSTI)

...would rapidly rescue a cell infected by such a pathogen...system with substrate to fuel flux through glycogen...eventually released from the cell. Both elementary bodies...synthesis and starch degradation. The maximum likelihood...branches during starch degradation. The homologous enzymes...

Steven G. Ball; Agathe Subtil; Debashish Bhattacharya; Ahmed Moustafa; Andreas P.M. Weber; Lena Gehre; Christophe Colleoni; Maria-Cecilia Arias; Ugo Cenci; David Dauvillée

2013-01-31T23:59:59.000Z

437

Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.  

Science Journals Connector (OSTI)

...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...metabolism Amylopectin metabolism Amylose metabolism...Extracellular Alpha- Amylase from Bacteroides...

S J McWethy; P A Hartman

1977-03-01T23:59:59.000Z

438

Escherichia coli produces a cytoplasmic alpha-amylase, AmyA.  

Science Journals Connector (OSTI)

...liquefying alpha-amylases of bacilli...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...

M Raha; I Kawagishi; V Müller; M Kihara; R M Macnab

1992-10-01T23:59:59.000Z

439

Haloalkaliphilic maltotriose-forming alpha-amylase from the archaebacterium Natronococcus sp. strain Ah-36.  

Science Journals Connector (OSTI)

...N-bromosuccinimide. The amylase hydrolyzed...starch, amylose, amylopectin, and, more...glucose of an alpha-configuration...substrate. The amylase hydrolyzed...N-bromosuccinimide. The amylase hydrolyzed...starch, amylose, amylopectin, and, more...glucose of an alpha-configuration...

T Kobayashi; H Kanai; T Hayashi; T Akiba; R Akaboshi; K Horikoshi

1992-06-01T23:59:59.000Z

440

Seed Lipids  

Science Journals Connector (OSTI)

...of corn processed for starch makes sizable quantities...for marketing. Legume seeds are usually rich in protein...many also contain either starch or galactomannan polysaccha-rides...on the average legume seeds are, like cereal grains, low in oil content...

Ivan A. Wolff

1966-12-02T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

THE AMERICAN CHEMICAL SOCIETY  

Science Journals Connector (OSTI)

...Observations on the Bacterial Metabolism of Sulfur Compounds...Distribution in Certain Seeds: C. L. ALSBERG AND...1 per cent. soluble starch solution add 9 c.c...sucrose. Dextrin and starch are similarly determined...cranberries or any of the cereals. A new specific microchemical...

Charles L. Parsons

1916-08-11T23:59:59.000Z

442

Integrating Terminal Truncation and Oligopeptide Fusion for a Novel Protein Engineering Strategy To Improve Specific Activity and Catalytic Efficiency: Alkaline ?-Amylase as a Case Study  

Science Journals Connector (OSTI)

...Engineering Laboratory for Cereal Fermentation Technology...medium was used for the seed culture of E. coli on...were screened on corn starch and agar plates. After...Km , maximum rate of metabolism [V max], k cat, and...16 U/ml and soluble starch at concentrations ranging...

Haiquan Yang; Long Liu; Hyun-dong Shin; Rachel R. Chen; Jianghua Li; Guocheng Du; Jian Chen

2013-08-16T23:59:59.000Z

443

Mucin secretion in germfree rats fed fiber-free and psyllium diets and bacterial mass and carbohydrate fermentation after colonization.  

Science Journals Connector (OSTI)

...creta were analyzed for neutral and amino sugar and starch contents. The starch content of the colonized FF-diet-fed rat fecal...Wood (ed.), Oat bran. American Association of Cereal Chemists, St. Paul, Minn. 12a.Marlett, J...

L M Cabotaje; F L Shinnick; J M Lopéz-Guisa; J A Marlett

1994-04-01T23:59:59.000Z

444

Plant Hormones and Regulators  

Science Journals Connector (OSTI)

...gibberellins in seed ger-mination...molecular level. Seeds of cereals have two major...germination the starch of the storage...also weaken the seed coats and allow...The growth of cereal seedlings has...hydrolyze the starch to reducing sugar...

J. van Overbeek

1966-05-06T23:59:59.000Z

445

Reducing Bioavailable Sex Hormones through a Comprehensive Change in Diet: the Diet and Androgens (DIANA) Randomized Trial  

Science Journals Connector (OSTI)

...2 98.6 20.5 Starch 150.1 (63.8...chick-peas (56) Cereal products Lignans...or pasta (32) Seeds and nuts Lignans...Hamalainen E. Estrogen metabolism and excretion in...heart disease. Metabolism, 45: 669-672...saturated fat and low starch and fibre are associated...

Franco Berrino; Cristina Bellati; Giorgio Secreto; Edgarda Camerini; Valeria Pala; Salvatore Panico; Giovanni Allegro; and Rudolf Kaaks

2001-01-01T23:59:59.000Z

446

Increasing Crop Production Through More Controlled Photosynthesis  

Science Journals Connector (OSTI)

...harvested organ (such as the seed, root, or fruit) are related...converted to the glucose moiety as starch, a major storage product in...6-phosphate (G6P) and then to starch, or it can be exported from...plant such as the growing tip, seeds, roots, or other sinks. Alternative-ly...

James A. Bassham

1977-08-12T23:59:59.000Z

447

Guar Seed ß-Mannan Synthase Is a Member of the Cellulose Synthase Super Gene Family  

Science Journals Connector (OSTI)

...carbohydrates in the seeds of some plants...analogous to that of starch in cereal grains. For example...developing guar seed endosperm in digitonin...carbohydrates in the seeds of some plants...analogous to that of starch in cereal grains. For example...

Kanwarpal S. Dhugga; Roberto Barreiro; Brad Whitten; Kevin Stecca; Jan Hazebroek; Gursharn S. Randhawa; Maureen Dolan; Anthony J. Kinney; Dwight Tomes; Scott Nichols; Paul Anderson

2004-01-16T23:59:59.000Z

448

Gene Discovery and Product Development for Grain Quality Traits  

Science Journals Connector (OSTI)

...Soybean seeds with altered ratios of seed storage proteins...a number of starches have been created...production in cereals such as wheat...altered ratios of seed storage proteins...a number of starches have been created...production in cereals such as wheat...

Barbara Mazur; Enno Krebbers; Scott Tingey

1999-07-16T23:59:59.000Z

449

Gene for Improved Nutritional Value in Barley Seed Protein  

Science Journals Connector (OSTI)

...adhere to the starch grains in meal...screening of single seeds without affecting...Acids analysis Cereals Genes, Recessive...Proteins analysis metabolism Seeds analysis Gene...adhere to the starch grains in meal...and selection. Cereals have a low content...

L. Munck; K. E. Karlsson; A. Hagberg; B. O. Eggum

1970-05-22T23:59:59.000Z

450

Biotechnology in Food Production and Processing  

Science Journals Connector (OSTI)

...extensive use ofmicrobial metabolism for food preservation...extractability of oil from seeds (51), and pectolytic...processing of meat, cereal, dairy, fruits...substrates such as starch or whey. The so-called...convert pota-to starch into SCP. A Kluyveromyces...crops, particularly cereals, further fundamental...

Dietrich Knorr; Anthony J. Sinskey

1985-09-20T23:59:59.000Z

451

Glycogen Plastids in Müllerian Body Cells of Cecropia peltata—A Higher Green Plant  

Science Journals Connector (OSTI)

...for car-bohydrate metabolism in a plant cell. Further...grana-lamella system and starch grains. Further study...question of glycogen metabolism in re-lation to ultrastructure...The Biogenesis of Starch Granules in Higher Plants...Wallenfels, W. J. Whelan, Cereal Chem. 43, 111 (1966...

Fred R. Rickson

1971-07-23T23:59:59.000Z

452

Fermentation of Barley by Using Saccharomyces cerevisiae: Examination of Barley as a Feedstock for Bioethanol Production and Value-Added Products  

Science Journals Connector (OSTI)

...significance. Cereal grains are high in starch and are currently...2006 at the Kaun Seed Farm in Red Deer...profile of selected seeds, grains, and...technology. Cereal Chem. 72: 360-364...using a granular starch hydrolyzing enzyme. Cereal Chem. 82: 734-738...

Amera Gibreel; James R. Sandercock; Jingui Lan; Laksiri A. Goonewardene; Ruurd T. Zijlstra; Jonathan M. Curtis; David C. Bressler

2008-12-29T23:59:59.000Z

453

THE CHEMISTRY AND BIOLOGICAL SIGNIFICANCE OF THIAMIN  

Science Journals Connector (OSTI)

...per million. In seeds and in certain...in the germs of cereals and in the cells of cereal-grown yeasts...Its presence in seeds in large amounts...when he eats the starch from the seed and...necessary for the metabolism of that starch...

ROBERT R. WILLIAMS

1938-06-24T23:59:59.000Z

454

Identification and Characterization of a Novel Intracellular Alkaline ?-Amylase from the Hyperthermophilic Bacterium Thermotoga maritima MSB8  

Science Journals Connector (OSTI)

...1-h assay using starch as the substrate...also cleaved soluble starch (68%) and b-limit-dextrin...classified as an a-amylase (EC 3.2.1...which helps to break down a-glucan polysaccharides...this cytoplasmic a-amylase is significantly...

Meike Ballschmiter; Ole Fütterer; Wolfgang Liebl

2006-03-01T23:59:59.000Z

455

THE AMYLASE OF CLOSTRIDIUM ACETOBUTYLICUM  

Science Journals Connector (OSTI)

...TABLE 3 The use of amylase as a saccharifying...AMnLA* PER 10 CORN STARCH 0 TEUHNOL PIE 10 0 CORN STARCH 2.5 4.30 5...0 4.55 * The amylase preparation used...enzymes. The enzyme breaks the substrate into...smaller chains down further until the...

Don Scott; L. R. Hedrick

1952-06-01T23:59:59.000Z

456

Industrial microbiology  

Science Journals Connector (OSTI)

...conjunc-tion with a-amylase and amyloglucosi-dase to convert starch to a mixture of glucose...the transfer of a-amylase, glucoamylase, and...intro-duction of amylase 'and glucoamylase...alcohol production from starch, and the introduction...

AL Demain

1981-11-27T23:59:59.000Z

457

Deletion of creB in Aspergillus oryzae Increases Secreted Hydrolytic Enzyme Activity  

Science Journals Connector (OSTI)

...analysis of total alpha-amylase transcript...induced using starch (1%) or...genes encoding starch-degrading...glaA) and alpha-amylase (amyA, amyB...variety of amylases, cellulases...proteases to break down carbohydrates...

A. J. Hunter; T. A. Morris; B. Jin; C. P. Saint; J. M. Kelly

2013-07-08T23:59:59.000Z

458

Pullulanase of Thermoanaerobacterium thermosulfurigenes EM1 (Clostridium thermosulfurogenes): molecular analysis of the gene, composite structure of the enzyme, and a common model for its attachment to the cell surface.  

Science Journals Connector (OSTI)

...only cleave alpha-1,6 linkages...regions of amylases. Comparison...producer of starch-degrading...bination with a-amylases, P-amylases, and glucoamylases...improve the starch saccharification...their complete break- down and the formation...

M Matuschek; G Burchhardt; K Sahm; H Bahl

1994-06-01T23:59:59.000Z

459

The Active Site Is the Least Stable Structure in the Unfolding Pathway of a Multidomain Cold-Adapted ?-Amylase  

Science Journals Connector (OSTI)

...top). The break, which occurred...cold-adapted a-amylase has two stability...1 to 2 min on starch-containing agarose...haloplanktis a-amylase. Domain A (pink...electrophoresis down the gel. An inverse...cold-adapted a-amylase at 12C (left...with iodine for starch hydrolysis activity...

Khawar S. Siddiqui; Georges Feller; Salvino D'Amico; Charles Gerday; Laura Giaquinto; Ricardo Cavicchioli

2005-09-01T23:59:59.000Z

460

Plant Hormones and Regulators  

Science Journals Connector (OSTI)

...in-hibits a-amylase activity (44...dormin inhibits a-amylase activity induced...tubes to grow down the style toward...digestion of the starch-filled storage...radi-cle) to break through, and...now called a-amylase) responsible...liqui-fying the reserve starch. The pres-ence...

J. van Overbeek

1966-05-06T23:59:59.000Z

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Integration and expression of alpha-amylase and endoglucanase genes in the Lactobacillus plantarum chromosome.  

Science Journals Connector (OSTI)

...Transformation, Bacterial alpha-Amylases biosynthesis genetics...molasses, whey, or starch combined with...heterologous at-amylase and a cellulase...SCHEIRLINCK ET AL. to break down soluble starch and CMC. Strains...fermentations. The ot-amylase gene ofB. stearothermophilus...

T Scheirlinck; J Mahillon; H Joos; P Dhaese; F Michiels

1989-09-01T23:59:59.000Z

462

Author's personal copy Carbohydrate Polymers 86 (2011) 700707  

E-Print Network (OSTI)

samples were prepared from a film device attached with twin screw extruder. The surface tension on thermal property, surface tension, and hydrophilicity of extruded starch thermoplastics Yachuan Zhanga and hydrophilic character of extruded potato starch films plasticized with glycerol and triethyl citrate. Film

Thompson, Michael

463

Hard Cider Varieties Suitable for Northern  

E-Print Network (OSTI)

and color, sugar content, flavor, & starch ­ evaluated tree yield, vigor, and harvest date · 2007: We `dessert' apple maturity: ­ firmness, brix, starch ­ flavor, blush, shape, flesh color and quality ­ tree Acidity ­ pH ­ Brix ­ Alcohol content #12;Adams Apple · Late season, dark maroon apple with bland red

464

Genetic Engineering of Algae for Enhanced Biofuel Production  

Science Journals Connector (OSTI)

...expressed sequence tag analysis of life cycle stages of Laminaria digitata (Phaeophyceae...mutant is defective in the R1 protein, a general regulator of starch degradation in plants...biohydrogen, starch-derived alcohols, diesel fuel surrogates, and/or alkanes...

Randor Radakovits; Robert E. Jinkerson; Al Darzins; Matthew C. Posewitz

2010-02-05T23:59:59.000Z

465

Carbon Allocation in Underground Storage Organs  

E-Print Network (OSTI)

Carbon Allocation in Underground Storage Organs Studies on Accumulation of Starch, Sugars and Oil Cover: Starch granules in cells of fresh potato tuber visualised by iodine staining. #12;Carbon By increasing knowledge of carbon allocation in underground storage organs and using the knowledge to improve

466

California Energy Commission STAFF REPORT  

E-Print Network (OSTI)

in this addendum is: · AE Advanced Fuels Keyes, Inc.'s, "Integrated Cellulose/Starch Ethanol Pre- Development, Inc.'s, "Integrated Cellulose/ Starch Ethanol Pre-Development Acceleration Project." Project Description AE Advanced Fuels Keyes (AEAFK) will deploy its patent-pending cellulosic ethanol technology

467

SciTech Connect: Proceedings of the 23rd Seismic Research Symposium...  

Office of Scientific and Technical Information (OSTI)

3rd Seismic Research Symposium: Worldwide Monitoring of Nuclear Explosions Citation Details In-Document Search Title: Proceedings of the 23rd Seismic Research Symposium: Worldwide...

468

Modular Extrapolation Approach for Crop LCA MEXALCA: Global Warming Potential of Different Crops and its Relationship to the Yield  

Science Journals Connector (OSTI)

MEXALCA (Modular EXtrapolation of Agricultural LCA) extrapolates crop inventory data and impacts from an original country inventory to all producing countries worldwide. This allows estimates of worldwide mean...

Thomas Nemecek; Karin Weiler…

2011-01-01T23:59:59.000Z

469

Influence of corn drying on its quality for the wet-milling process  

Science Journals Connector (OSTI)

Flint and dent corn were forced air-dried at 70–110 °C to a final moisture of about 12.0%. The rates of water absorption of both hybrids in the presence of 0.25% SO2 aqueous solution were evaluated in terms of the diffusion coefficient. Drying temperature affected negatively the rate of absorption of both hybrids. A laboratory wet-milling procedure was developed to evaluate starch recovery of corn samples. For flint corn starch recovery drop from 96.5% (undried) to 82% (dried at 110 °C); for dent corn the drop was from 97.5% to 90%. The starch isolated from air-dried corn contained greater amounts of protein than starch originated from undried corn. The effect was more marked for flint than for dent corn and increased with the drying temperature. Sorptional characteristics of starch were practically unaffected by drying temperature. DSC transition temperatures of starch showed an increasing tendency with drying temperature. For both hybrids the gelatinization enthalpy of starch decreased with the increasing of drying temperature, the effect being more marked for flint than for dent corn.

Mónica Haros; Marcela P Tolaba; Constantino Suárez

2003-01-01T23:59:59.000Z

470

Extrusion-cooking of sorghum  

E-Print Network (OSTI)

perpendicular to the main axis, snd mounted on specimen holders with silver conducting paint. The samples were coated with gold-palladiumin a Hummer coater and examined with a JEOL JSM-25 SEiM. Characterization of Starch Fraction Starch susceptible to alpha-amylase... (ESS-alpha), a measure of the extent of starch damage, was determined by digesting 1. 0 g of sample in 45 ml of distilled water (pH 6. 9) containing 1. 0 mg alpha-amylase at 20 'C . After incubation, 3 ml acetic-sulfuric acid buffer and 2 ml of 12 "7...

Gomez, Marta Hilda

2012-06-07T23:59:59.000Z

471

Synthesis of Longtime Water/Air-Stable Ni Nanoparticles and Their High Catalytic Activity for Hydrolysis of Ammonia?Borane for Hydrogen Generation  

Science Journals Connector (OSTI)

Soluble starch (amylose), a renewable polymer, is the main component of starch which is the main energy reserve of all higher plants, and can form a dispersion in water. ... The TEM samples were prepared by depositing one or two droplets of the nanoparticle suspensions onto the amorphous carbon coated copper grids, which were dried in argon atmosphere. ... Nitrogen sorption measurements were carried out on an automatic volumetric adsorption equipment (BEL mini, Japan) using the Brunauer?Emmett?Teller (BET) method to test the surface areas of the in situ synthesized catalysts with/without starch after washing with water and vacuum drying at 90 °C. ...

Jun-Min Yan; Xin-Bo Zhang; Song Han; Hiroshi Shioyama; Qiang Xu

2009-07-09T23:59:59.000Z

472

Effect of dry-heat processing on the expansion of different sorghum cultivars  

E-Print Network (OSTI)

was produced by BTx 378 grown at Rennet, Texas. Environmental factors like place of. growth, and storage conditions had significant influence (P & . 05) on the popping quality of sorghum. Decreased moisture content and an increase in available starch.... 8 to 18. 8 g for ETx 378 grown at Renner and Lubbock, respectively. There was substant'al starch granule damage in the fully popped area. . of the l. ernels. Starch damage (gelatinization) ranged. from 573 mg glucose/g sample for iVSA 954 to 640...

Akoma, Uzoma Chike

2012-06-07T23:59:59.000Z

473

One Hundred Years of Commercial Food Carbohydrates in the United States  

Science Journals Connector (OSTI)

They are only slightly cloudy and exhibit a very low tendency to gel, making them more like the pastes made from tapioca and potato starch than those made from normal corn and other normal cereal starches. ... However, pastes of native waxy maize starch are too stringy and cohesive and break down too easily under shear to be acceptable for some, in fact, many, food applications. ... Tamuri, M.; Kano, M.; Ishii, Y. Heat and acid-stable alpha-amylase enzymes and processes for producing the same. ...

James N. BeMiller

2009-08-31T23:59:59.000Z

474

Development of Dual-Air-Assistant Atomizing Nozzle to Apply Aerosol-Sealing  

NLE Websites -- All DOE Office Websites (Extended Search)

Development of Dual-Air-Assistant Atomizing Nozzle to Apply Aerosol-Sealing Development of Dual-Air-Assistant Atomizing Nozzle to Apply Aerosol-Sealing Technology in Air Duct Systems Speaker(s): Alan Ropers Date: July 8, 2002 - 12:00pm Location: Bldg. 90 An Aerosol-sealing Technology was developed by LBNL to seal leaks in Air Duct Systems (ADS). The firm AEROSEAL already commercializes this technology for residential ADS. The current goal of our research at the Laboratory is to apply this technology to large commercial ADS. That means to develop a new kind of injector called "Compact Injector". So far, the injector that is used is a nozzle from the Schlick-Dusen firm. Results in terms of sealing rate are satisfactory, but this nozzle quickly clogs up with sealant particles. There are two reasons for the clogging problem: the

475

Boundary quantum Knizhnik-Zamolodchikov equations and fusion  

E-Print Network (OSTI)

In this paper we extend our previous results concerning Jackson integral solutions of the boundary quantum Knizhnik-Zamolodchikov equations with diagonal K-operators to higher-spin representations of quantum affine $\\mathfrak{sl}_2$. First we give a systematic exposition of known results on $R$-operators acting in the tensor product of evaluation representations in Verma modules over quantum $\\mathfrak{sl}_2$. We develop the corresponding fusion of $K$-operators, which we use to construct diagonal $K$-operators in these representations. We construct Jackson integral solutions of the associated boundary quantum Knizhnik-Zamolodchikov equations and explain how in the finite-dimensional case they can be obtained from our previous results by the fusion procedure.

Nicolai Reshetikhin; Jasper Stokman; Bart Vlaar

2014-12-19T23:59:59.000Z

476

Boundary quantum Knizhnik-Zamolodchikov equations and fusion  

E-Print Network (OSTI)

In this paper we extend our previous results concerning Jackson integral solutions of the boundary quantum Knizhnik-Zamolodchikov equations with diagonal $K$-operators to higher-spin representations of quantum affine $\\mathfrak{sl}_2$. First we give a systematic exposition of known results on $R$-operators acting in the tensor product of evaluation representations in Verma modules over quantum $\\mathfrak{sl}_2$. We develop the corresponding fusion of $K$-operators, which we use to construct diagonal $K$-operators in these representations. We construct Jackson integral solutions of the associated boundary quantum Knizhnik-Zamolodchikov equations and explain how in the finite-dimensional case they can be obtained from our previous results by the fusion procedure.

Nicolai Reshetikhin; Jasper Stokman; Bart Vlaar

2014-04-22T23:59:59.000Z

477

A social-cognitive framework for understanding serious lies: Activation-decision-construction-action theory  

Science Journals Connector (OSTI)

Abstract Little is known about the cognition of deception (Gombos, 2006). We propose a cognitive account of serious lying (i.e., deception involving high stakes) in response to a solicitation of a truth: Activation-Decision-Construction-Action Theory (ADCAT). Built on the Activation-Decision-Construction Model of answering questions deceptively (Walczyk, Roper, Seeman, & Humphrey, 2003), the theory elaborates on the roles of executive processes, theory of mind, emotions, motivation, specifies cognitive processing thoroughly, and considers the rehearsal of lies. ADCAT's four processing components are (a) activation of the truth, the (b) decision whether and how to alter deceptively the information shared, (c) construction of a deception, and (d) action [acting sincere while delivering a lie]. Core constructs are “theory of mind” and “cognitive resources”. Specifically, throughout serious deception, individuals are inferring the current or potential mental states of targets and taking steps to minimize the allocation of cognitive resources during delivery to appear honest and lie well.

Jeffrey J. Walczyk; Laura L. Harris; Terri K. Duck; Devyani Mulay

2014-01-01T23:59:59.000Z

478

U.S. Department of the Interior June 2013 U.S. Geological Survey  

E-Print Network (OSTI)

worldwide (Hack, 2013). PMC Group, Inc. (Mount Laurel, NJ) completed the acquisition of Dow Chemical Co

479

Serial Replica Exchange Morten Hagen, Byungchan Kim, Pu Liu, Richard A. Friesner, and B. J. Berne*  

E-Print Network (OSTI)

enables the study of biological systems on worldwide distributed computing environments, such as Folding@Home

Berne, Bruce J.

480

Boston University Joint Physics and Chemistry Colloquium  

E-Print Network (OSTI)

in atomic detail. With the latest technology utilizing worldwide distributed comput- ing ("Folding@home

Goldberg, Bennett

Note: This page contains sample records for the topic "roper starch worldwide" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Atmos. Chem. Phys., 10, 19311951, 2010 www.atmos-chem-phys.net/10/1931/2010/  

E-Print Network (OSTI)

for Chemistry, Enviscope, MDS, KNMI, STINASU 4Consortium of over 75 atmospheric research institutes worldwide

Meskhidze, Nicholas

482

Student handbook Class of 2013  

E-Print Network (OSTI)

prestigious institutions, described by The Sunday Times as `an academic powerhouse' with `a worldwide

Bristol, University of

483

Comparison of two interpolation software performance on conservative remapping: SCRIP vs ESMF  

E-Print Network (OSTI)

couplers are worldwide applied by various climate models. ESMF provides an Earth System Modeling Framework

484

Fabrication and Characterization of Organic/Inorganic Photovoltaic Devices  

E-Print Network (OSTI)

facilities. Worldwide, hydroelectricity and wind are the twothe same with the hydroelectricity power plants; instead of

Guvenc, Ali Bilge

2012-01-01T23:59:59.000Z

485

Selection and characterization of alpha-amylase-overproducing recombinant Escherichia coli containing the bacterial hemoglobin gene  

Science Journals Connector (OSTI)

We previously reported that the presence of the bacterial (Vitreoscilla) hemoglobin gene enhances alpha-amylase production in recombinant Escherichia coli...strain MK79. Using the growth of MK79 on starch as a se...

Shie-Chau Liu; Besim Ogretmen; Yao-Yu Chuang…

1992-11-01T23:59:59.000Z

486

Animals gnawing the bark and wood of trees and shrubs is not a malicious act or evidence of a  

E-Print Network (OSTI)

;because they produce amylase enzymes, is similar to cellulose except the long chains of glucose are linked in an alpha configuration. Cellulose has as much food value as starch, but only animals that maintain colonies

487

Determination of alpha-amylase activity in dextran, ficoll and polyethylene glycol solutions  

Science Journals Connector (OSTI)

A new insoluble chromolytic substrate for the spectrophotometric determination of alpha-amylase activity (starch cross-linked with 1,4 ... phase-forming polymers interfere with some commonly used alpha-amylase as...

Ivo Šafa?ík; Miroslava Šafa?íková

488

Extension Bulletin GMI-035 New July 2014 Malting Barley Production  

E-Print Network (OSTI)

the grain to prevent further development. The germination process produces two enzymes � alpha- amylase and beta-amylase � which hydrolyze starches to dextrins and fermentable sugars, necessary components

489

Adaptive polymorphism of tetrameric alpha-amylase inhibitors in wild emmer wheat  

Science Journals Connector (OSTI)

?-Amylase inhibitors are attractive candidates for the control of seed weevils as these insects are highly dependent on starch as an energy source. Wheat tetrameric ?-amylase inhibitor (WTAI) is a mixture (60 ...

Ji-Rui Wang; Mei Deng; Ya-Xi Liu; Xin Qiao; Zhen-Hong Chen…

2011-08-01T23:59:59.000Z

490

Regulation of alpha-amylase production inBacillus licheniformis M27 by enzyme end-products in submerged fermentation and its overcoming in solid state fermentation system  

Science Journals Connector (OSTI)

Alpha-amylase production byBacillus licheniformis M27 in submerged fermentation was reduced from 480 to 30 units/ml when soluble starch concentration in medium was increased from 0.2 to 1.0%. In c...

M. V. Ramesh; B. K. Lonsane

1991-05-01T23:59:59.000Z

491

Alpha-amylase inhibitor increases plasma 3-hydroxybutyric acid in food-restricted rats  

Science Journals Connector (OSTI)

The effect on energy metabolism of delayed absorption of starch by inhibition of ?-amylase was examined by considering levels of plasma glucose and 3-hydroxybutyric acid (3-OHBA) in rats. Addition of ?-amylase...

T. Doi; H. Yoshimatsu; I. Katsuragi; M. Kurokawa; H. Takahashi; A. Motoshio…

1995-06-14T23:59:59.000Z

492

Optimizing Ethanol and Methane Production from Steam-pretreated, Phosphoric Acid-impregnated Corn Stover  

Science Journals Connector (OSTI)

The composition of raw corn stover and the WIS after pretreatment was...27] from the National Renewable Energy Laboratory (NREL). All measurements were performed in duplicate. The starch content of corn stover an...

Pia-Maria Bondesson; Aurélie Dupuy; Mats Galbe…

2014-11-01T23:59:59.000Z

493

Chemical and Physical Properties of Breakfast Cereals and Snacks Made from Specialty Sorghums and Sorghum Bran Using Twin Screw Extruder  

E-Print Network (OSTI)

and on in vitro starch digestibility of sorghum based cereals and snacks were observed. Gluten free and gluten containing breakfast cereal and snacks were developed with different physical, chemical and sensory characteristic. By increasing the sorghum and bran...

Asif, Muhammad

2012-02-14T23:59:59.000Z

494

Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

derived from grain starch, oil seed, animal fat, or other biomass, or produced from a biogas source. GVWR Credit Less than 10,000 pounds (lbs.) Up to 2,400 10,000 to 26,000 lbs....

495

Alternative Fuels Data Center  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

derived from grain starch, oil seed, animal fat, or other biomass, or produced from a biogas source. Excess credits may be carried over for up to three years after the year in...

496

Enhancement of photoassimilate utilization by manipulation of the ADPglucose pyrophosphorylase gene. Progress report, [April 15, 1987--April 14, 1988  

SciTech Connect

Many agronomically important crops are viewed as significant resources of renewable energy. Overall crop productivity could be increased if the efficiency of photoassimilate conversion into dry matter such as starch were improved in storage tissues. Starch production is controlled by the catalytic activity of ADPglucose pyrophosphorylase in the first step of starch biosynthesis. This research focuses on the genetic structure and molecular mechanisms by which it is controlled during plant development and how it is affected by environmental and hormonal conditions. The current goal is to isolate the genes for this enzyme present in both cereal endosperm and potato tuber tissues, and to elucidate its structure and the controlling sequences responsible for gene expression. The long term goal is the improvement of starch production in storage organs by manipulating this gene so that it encodes an enzyme refractive to inorganic phosphate inhibition.

Okita, T.W.

1988-12-31T23:59:59.000Z

497

Jesper Hedal Kløverpris, the winner of the SETAC Europe young scientist LCA award 2010  

Science Journals Connector (OSTI)

The purpose of the dissertation was to investigate where and how much the global agricultural area changes as a result of increased crop consumption in specific regions. For Novozymes, his host company, starch is...

Almut B. Heinrich

2010-07-01T23:59:59.000Z

498

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network (OSTI)

aspects of algal hydrogenase activity, the well-studied anaerobic metabolisms of Chlamydomonas reinhardtii and in vitro hydrogenase activity, starch accumulation/degradation, and anaerobic end product secretion were

Lawson, Catherine L.

499

The Occurrence and Biological Activity of Ferulate-Phytosterol Esters in Corn Fiber and Corn Fiber Oil  

Science Journals Connector (OSTI)

Corn fiber is a pericarp-rich fraction obtained during the processing of corn via “wetmilling.” Wet milling of corn is used by all companies that produce corn starch and corn sweeteners, and by many companies tha...

Robert A. Moreau; Michael J. Powell…

1997-01-01T23:59:59.000Z

500

Fatty acid compositions of lipids from corn and grain sorghum kernels  

Science Journals Connector (OSTI)

Characteristics and fatty acid compositions of the lipid components of the main fractions (germ, starch, gluten, and fiber) obtained in the wet milling of corn and grain sorghum kernels have been determined.

A. R. Baldwin; M. S. Sniegowski

1951-01-01T23:59:59.000Z