Powered by Deep Web Technologies
Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Rome, Italy: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Rome, Italy: Energy Resources Rome, Italy: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 3169070 Coordinates 41.8954656°, 12.4823243° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.8954656,"lon":12.4823243,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

Proceedings of the 17th International Congress on Acoustics Proceedings, Rome, Italy, 2001.  

E-Print Network [OSTI]

. The interaction terminates in a ritualized nose-to-nose greeting. #12;Proceedings of the 17th InternationalProceedings of the 17th International Congress on Acoustics Proceedings, Rome, Italy, 2001

Reichmuth, Colleen

3

Bank of Italy | Open Energy Information  

Open Energy Info (EERE)

Bank of Italy Bank of Italy Jump to: navigation, search Logo: Bank of Italy Name Bank of Italy Address Via nazionale 91 Place Rome, Italy Zip 00149 Number of employees 5001-10,000 Year founded 1900 Coordinates 41.8975332°, 12.488383° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.8975332,"lon":12.488383,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

5

Club of Rome  

ScienceCinema (OSTI)

Le Club de Rome s'est fait connatre du grand public par la publication du premier ouvrage "Halte la croissance" qui a fait l'object d'un dbat, il y a 2 ans. Le Prof. Tinbergen a commenc par s'adonner la physique, il est docteur en physique et trs tt il s'est tourn vers les problmes sociaux conomiques. Il est expert auprs des nombreux gouvernements et organisations internationales et il a vu ses travaux couronns par le prix Nobel en 1969.

None

2011-04-25T23:59:59.000Z

6

Solar Brain Srl | Open Energy Information  

Open Energy Info (EERE)

Brain Srl Jump to: navigation, search Name: Solar Brain Srl Place: Rome, Italy Zip: 189 Sector: Solar Product: Rome-based solar and alternative energy company. References: Solar...

7

rome.ppt  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Integral Differences: Integral Differences: Kinetic Energy Savings or a Cut-off Effect? Mike Norman! ! Materials Science Division! Argonne National Laboratory Rome - July 2, 2007 Norman and Chubukov, Phys Rev B 73, 140501 (2006) ∫dω Re σ(ω) = ω pl 2 /8 Sum all bands -> proportional to n/m (f sum rule) Single band only -> proportional to E K E K = Σ k (∂ 2 ε k /∂k 2 ) n k E kinetic = Σ k ε k n k Optical Integrals In general, E K is not a conserved quantity, though it is for a parabolic dispersion - k 2 /2m* Sum Rule - Klein and Blumberg, Science 283, 42 (1999) Molegraaf & van der Marel Science 295, 2239 (2002) An increase is observed in the optical weight below T c relative to the extrapolated behavior from above T c A similar effect has been seen in Bi2212 by the ESPCI group

8

Robust Optimization Made Easy with ROME  

E-Print Network [OSTI]

A common theme in this body of work is a search for techniques to ... In terms of the classes of problems that ROME can model and solve, ROME is considerably less .... Users enter the ROME environment by issuing a call to rome begin, which

2009-08-04T23:59:59.000Z

9

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

10

Constitutionality of the Rome Statute in Ukraine.  

E-Print Network [OSTI]

??Acceptance of the Rome Statute poses a number of problems under domestic law; particularly ratification of this document raises issues of constitutional compatibility. The main (more)

Bykova, Ganna

2008-01-01T23:59:59.000Z

11

24-26 September 2008, Rome, Italy Thermal Design of  

E-Print Network [OSTI]

conductivity of most materials used to electrically insulate the devices enhances the thermal issues that could to estimate the overall thermal resistance by considering a combination of individual thermal resistances of layout parameters upon the thermal resistance of such devices. This contribution is aimed at supplying

Technische Universiteit Delft

12

Virtualizing Ancient Rome: 3D acquisition and modeling of a large plaster-of-Paris model of imperial Rome  

E-Print Network [OSTI]

Virtualizing Ancient Rome: 3D acquisition and modeling of a large plaster-of-Paris model plaster-of-Paris model of imperial Rome (16x17 meters) created in the last century. Its overall size's urban history is well documented and studied. There is even a highly-regarded plaster-of-Paris model

Frischer, Bernard

13

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

14

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Organizzato da: Christopher Smith, British School at Rome  

E-Print Network [OSTI]

Organizzato da: Christopher Smith, British School at Rome Attilio Mastrocinque, Università di LIPPOLIS, Attilio MASTROCINQUE, Christopher SMITH - Presentazione 10.00 ­ 10.30 Elio LO CASCIO - I fora e

Guidoni, Leonardo

20

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

22

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

23

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

24

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

25

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

26

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

27

U.S. and Italy Sign Agreement to Collaborate on Carbon Capture and Storage  

Broader source: Energy.gov (indexed) [DOE]

Italy Sign Agreement to Collaborate on Carbon Capture and Italy Sign Agreement to Collaborate on Carbon Capture and Storage Technologies U.S. and Italy Sign Agreement to Collaborate on Carbon Capture and Storage Technologies May 23, 2009 - 12:00am Addthis ROME, ITALY - U.S. Energy Secretary Steven Chu today joined with Italian Minister of Economic Development Claudio Scajola to sign a bilateral agreement to advance carbon capture and storage (CCS) technologies in each country. Working together, the U.S. and Italy will further the development of technologies needed to limit carbon dioxide emissions from coal-fired powered plants and move toward a sustainable low carbon economy that addresses the challenge of global warming. "To prevent the worst effects of climate change, we must accelerate our efforts to capture and store carbon in a safe and cost-effective way.

28

International Congress on " Rome, 12-13 March 2009  

E-Print Network [OSTI]

1 International Congress on " Rome, 12-13 March 2009 ! " A. Introduction: some key concepts B Principle 3 Protection of health, vitality and area of forest resources SFM standards (P,C & I) Hierarchical to planted forests 26 criteria, 55 indicators sustainable development through trade/investments in biological

Pettenella, Davide

29

Palaeomagnetism and rock magnetism in the upper Pliocene Valle Ricca (Rome, Italy) section  

Science Journals Connector (OSTI)

......greigite-bearing sediments of the Sokolov district in Bohemia. The connection...properties of greigite NRM during heating. Indeed, Krs et al. (1992...self-reversalphenomenon due to heating is not the cause of the behaviour...Zuppi, M., 1989. Karst and geothermal water circulation in the Central......

Fabio Florindo; Leonardo Sagnotti

1995-11-01T23:59:59.000Z

30

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

31

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

32

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

33

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

34

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

35

Auswirkungen einer Dmme-Rome-Melioration auf Pseudogleyen im Forstamt Entenpfuhl  

Science Journals Connector (OSTI)

Im Forstamt Entenpfuhl (Soonwald/Rheinland-Pfalz) wurden die Auswirkungen einer 1985 durchgefhrten Dmme-Rome-Melioration auf Pseudogleyen hinsichtlich physikalischer Standorteigenschaften, des Humushaushalte...

Ch. Siebe; R. Jahn; E. Gttler; K. Stahr

1991-12-01T23:59:59.000Z

36

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

37

Indicators reflecting local and transboundary sources of PM2.5 and PMCOARSE in Rome Impacts in air quality  

Science Journals Connector (OSTI)

Abstract The keystone of this paper was to calculate and interpret indicators reflecting sources and air quality impacts of PM2.5 and PMCOARSE (PM10PM2.5) in Rome (Italy), focusing on potential exogenous influences. A backward atmospheric trajectory cluster analysis was implemented. The likelihood of daily PM10 exceedances was studied in conjunction with atmospheric patterns, whereas a Potential Source Contribution Function (PSCF) based on air mass residence time was deployed on a grid of a 0.5נ0.5 resolution. Higher PM2.5 concentrations were associated with short/medium range airflows originated from Balkan Peninsula, whereas potential PMCOARSE sources were localized across the Mediterranean and coastal North Africa, due to dust and sea spray transportation. According to the outcome of a daily Pollution Index (PI), a slightly increased degradation of air quality is induced due to the additional quantity of exogenous PM but nevertheless, average levels of PI in all trajectory clusters belong in the low pollution category. Gaseous and particulate pollutants were also elaborated by a Principal Component Analysis (PCA), which produced 4 components: [Traffic], [photochemical], [residential] and [Secondary Coarse Aerosol], reflecting local sources of air pollution. PM2.5 levels were strongly associated with traffic, whereas PMCOARSE were produced autonomously by secondary sources.

Konstantinos Dimitriou; Pavlos Kassomenos

2014-01-01T23:59:59.000Z

38

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

39

Italy Revisited: The Encyclopedia  

E-Print Network [OSTI]

chests for the in- creasingly lavish gifts and counter-gifts that accompanied mar- riages between wealthy Italian families. Paul F. Watsons essay evokes the social importance of these boxes, which is a feat since so few of the early ones have survived... discourse. Less defensible is an entry on Albertus Magnus, a German scholastic who never taught in Italy, with a wasteful illustration, again the ti- tle page of an early printed text. Although he was read in Italy, and was one of Thomas Aquinas teachers...

Epstein, Steven A.

2005-01-01T23:59:59.000Z

40

Nuclear Power for Italy  

Science Journals Connector (OSTI)

ITALY HAS DECIDED to use British know-how to build its first big nuclear power plant. A.G.I.P. Nucleare, a subsidiary of the Italian government-owned petroleum organization, E.N.I., and Britain's Nuclear Power Plant Co. will sign final agreement next ...

1957-12-02T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

11241. Proposed by Roberto Tauraso, Universit`a di Roma "Tor Vergata", Rome, Italy. Find a closed formula for  

E-Print Network [OSTI]

are well known; it turns out that M = Fm (the mth Fibonacci number) and N = Lm (the mth Lucas number (-2)n ; (b) if = -1 + Lm 5 , where m is an odd integer, then F,odd(n) = (6 - Lm - 5Fm)(-2 - 3Lm + 5Fm) 20Fm(Lm + 4) · 2(Lm - 1)(Lm + 4) 5(2 + 3Lm + 5Fm) n + (6 - Lm + 5Fm)(2 + 3Lm + 5Fm) 20Fm(Lm + 4) · 2

Heckman, Christopher Carl

42

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

43

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

44

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

45

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

46

An Examination of the Economic Role of Table Fish in Ancient Rome  

E-Print Network [OSTI]

From many ancient sources, including Cicero and Pliny, it is clear that table fish were a luxury good in Rome. However, whether or not local coastal people could obtain fish from the same catches at a less extravagant price is a subject for debate...

King, Allyson R.

2013-05-31T23:59:59.000Z

47

FSAAWG, ROME 2011 1 Synthetic Voice Forgery in the Forensic Context: a  

E-Print Network [OSTI]

FSAAWG, ROME 2011 1 Synthetic Voice Forgery in the Forensic Context: a short tutorial Guillaume Paristech, dép. TSI 37-39 rue Dareau 75014 PARIS Abstract--Technical voice forgery in the forensic area has, the forensic context is quite different since the human ear might be able to detect a synthetic voice, thus

Paris-Sud XI, Université de

48

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

49

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development  

Science Journals Connector (OSTI)

...Control, and Management Engineering, University of Rome, 00185 Rome, Italy d Institute for Systems Analysis and Computer Science Antonio Ruberti, National Research Council, 00185 Rome, Italy e SysBio Centre for Systems Biology, 00185 Rome, Italy www...

Maria Concetta Palumbo; Sara Zenoni; Marianna Fasoli; Mélanie Massonnet; Lorenzo Farina; Filippo Castiglione; Mario Pezzotti; Paola Paci

2014-12-09T23:59:59.000Z

50

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

51

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

52

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

53

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

54

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

55

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

56

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

57

A review of "Giovanni Baglione: Artistic Reputation in Baroque Rome." by Maryvelma Smith ONeil,  

E-Print Network [OSTI]

: In The Presentation of the Virgin in Santa Maria dell? Orto the temple out of which the priest emerges to greet Mary is the church itself (pl. 31); we see not a prie-Dieu but Neri?s knees in Saint Charles Borromeo and Saint Philip Neri in Meditation (pl. 63... fresco on the vault of the family chapel (pl. 103) may include a cratered moon, perhaps a rare reflection of Galileo?s discovery seen in Cigoli?sWoman of the Apocalypse in the dome of the chapel of Pope Paul V, Santa Maria Maggiore, Rome. One must...

Jeffrey Fontana

2005-01-01T23:59:59.000Z

58

Free-Space Optical High-Speed Link in the Urban Area of Southern Rome: Preliminary Experimental  

E-Print Network [OSTI]

Free-Space Optical High-Speed Link in the Urban Area of Southern Rome: Preliminary Experimental Set is placed on water particle effects (fog and rain). A semi-empirical model evaluation of these atmospheric, Piazza Pakistan, height 50 m), and the headquarters of the Department of Foreign Trade (point C, Viale

Marzano, Frank Silvio

59

Italy Geothermal Region | Open Energy Information  

Open Energy Info (EERE)

Region Larderello Geothermal Area Mount Amiata Geothermal Area Travale-Radicondoli Geothermal Area Energy Generation Facilities within the Italy Geothermal Region Bagnore 3...

60

United States and Italy Sign Agreements to Advance Developments...  

Broader source: Energy.gov (indexed) [DOE]

Italy Sign Agreements to Advance Developments in Nuclear Energy United States and Italy Sign Agreements to Advance Developments in Nuclear Energy September 30, 2009 - 12:00am...

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

European Particle Accelerator Conference -Rome, Italy -June 7-12, 1988 DEVELOPMENT OFA HIGH BRIGHTNESS ELECTRON GUN FOR THE ACCELERATOR TEST FACILITY AT  

E-Print Network [OSTI]

BRIGHTNESS ELECTRON GUN FOR THE ACCELERATOR TEST FACILITY AT BROOKHAVEN NATIONAL LABORATORY* K. Batchelor, HDonald Princeton University At innBNL--41767 DE89 002179 Abstract An electron gun utilizing aradio frequency on the design of (he electron gun which will provide r.f. bunches of upto 101 electrons synchronized

McDonald, Kirk

62

Strong seismic motions estimated from a one direction-three components ("1d-3c") approach, application to the city of rome, italy  

E-Print Network [OSTI]

Strong seismic motions in soils generally lead to both a stiffness reduction and an increase of the energy dissipation in the surficial layers. In order to study such phenomena, several nonlinear constitutive models were proposed and were generally implemented for 1D soil columns. However, one of the main difficulties of complex rheologies is the large number of parameters needed to describe the model. In this sense, the multi-surface cyclic plasticity approach, developed by Iwan in 1967 but linked to Prandtl or Preisach theoretical work, is an interesting choice: the only data needed is the modulus reduction curve. Past studies have generally implemented such models for one-directional shear wave propagation in a "1D" soil column considering one motion component only ("1C"). Conversely, this work aims at studying strong motion amplification by considering seismic wave propagation in a "1D" soil column accounting for the influence of the 3D loading path on the nonlinear behavior of each soil layer. In the "1D...

D'Avila, Maria Paola Santisi; Semblat, Jean-Franois; Gandomzadeh, Ali; Martino, Salvatore; Bonilla, Luis Fabian

2014-01-01T23:59:59.000Z

63

Charity, architecture and urban development in post-Tridentine Rome : the hospital of the SS.ma Trinit dei Pellegrini e Convalescenti (1548-1680)  

E-Print Network [OSTI]

This dissertation analyzes the institutional, architectural and urban history of charitable institutions in Rome from the fifteenth to the seventeenth century. It highlights the previously ignored central role that these ...

Keyvanian, Carla L. (Carla Lucia), 1962-

2000-01-01T23:59:59.000Z

64

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

65

Photovoltaic waste assessment in Italy  

Science Journals Connector (OSTI)

Abstract At present, photovoltaics is, after hydro and wind power, the third most important renewable energy source in terms of its capacity to be globally installed; furthermore, for two years in a row, it was the number one new source of electricity generation installed in the European Union. Italy became the second country in the European Union concerning the cumulative installed power of PV (in 2013, the Italian PV cumulative power reached over 17,620MW), which was also the result of the very attractive support policy. In connection with this development, the issue has emerged about the treatment and disposal of photovoltaic waste when the operative time (approximately twenty-thirty years) of the photovoltaic systems ended. The European Union, to address this environmental impact, passed the Directive 2012/19/EU to increase the amount of waste of electrical and electronic equipment in the form of photovoltaic panels that have been appropriately collected and treated to reduce the volume that become disposed. This paper aims to provide an assessment of the potential waste arising in Italy from the use and end-of-life phases of these renewable energy systems in the coming years and their disposal and/or recycling. Based on the lifetime of 25 years of photovoltaic panels, the estimate has been referred to two periods of waste generation (20122038 and 20392050). The importance of managing this flow of waste to enhance the correct disposal of the hazardous substances as well as the importance of the recovery and recycling of valuable resources has also been underlined.

Annarita Paiano

2015-01-01T23:59:59.000Z

66

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23

Spagnolo, Filippo

67

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005: Solution 2: #12;CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum

Spagnolo, Filippo

68

?enseignement de ?endoscopie digestive en Italie  

Science Journals Connector (OSTI)

En Italie, nous disposons de deux coles de postgraduat : Gastroentrologie et Endoscopie Digestive et ?autre part : Chirurgie Digestive et Endoscopie Chirurgicale. Le premier cours dure quatre ans, le second cin...

A. Russo

1991-07-01T23:59:59.000Z

69

Venice, Italy: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Venice, Italy: Energy Resources Venice, Italy: Energy Resources Jump to: navigation, search Name Venice, Italy Equivalent URI DBpedia GeoNames ID 3164603 Coordinates 45.438611°, 12.326667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.438611,"lon":12.326667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

70

Italy: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Italy: Energy Resources Italy: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.83333,"lon":12.83333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

71

Baroque Sensation in Modern Design  

E-Print Network [OSTI]

: Italy 1. San Carlo alle Quattro Fontane, Rome 2. Santa Maria degli Angeli e dei Martiri, Rome 3. Sant'Agnese in Agone, Rome 4. Santa Maria dell'Orazione e Morte, Rome 5. Santa Maria in Campitelli, Rome 6. Il Ges?, Rome 7. Sant'Ignazio, Rome 8.... Santa Maria Maddalena, Rome 9. Santa Maria del Popolo (Chigi Chapel), Rome 10. Santa Maria in Vallicella (Chiesa Nuova), Rome 11. San Giovanni dei Fiorentini, Rome 12. The Church of Sant'Andrea al Quirinale, Rome 13. Sant'Ivo alla Sapienza, Rome...

Mason, Jordan 1986-

2011-05-02T23:59:59.000Z

72

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005

Spagnolo, Filippo

73

Geothermal Literature Review At International Geothermal Area, Italy  

Open Energy Info (EERE)

International Geothermal Area, Italy International Geothermal Area, Italy (Ranalli & Rybach, 2005) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermal Literature Review At International Geothermal Area, Italy (Ranalli & Rybach, 2005) Exploration Activity Details Location International Geothermal Area Italy Exploration Technique Geothermal Literature Review Activity Date Usefulness not indicated DOE-funding Unknown Notes Latera area, Tuscany, re: Heat Flow References G. Ranalli, L. Rybach (2005) Heat Flow, Heat Transfer And Lithosphere Rheology In Geothermal Areas- Features And Examples Retrieved from "http://en.openei.org/w/index.php?title=Geothermal_Literature_Review_At_International_Geothermal_Area,_Italy_(Ranalli_%26_Rybach,_2005)&oldid=510813

74

Giancarlo Fortino University of Calabria, Italy  

E-Print Network [OSTI]

Giancarlo Fortino University of Calabria, Italy Carlos E. Palau Universitat Politecnica de Valencia and Carlos E. Palau, editors. p. cm. Includes bibliographical references and index. Summary: "This book site development. 2. Information storage and retrieval systems. I. Fortino, Giancarlo, 1971- II. Palau

Buyya, Rajkumar

75

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C  

E-Print Network [OSTI]

Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C General; Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia

Albrecht, David

76

E-Print Network 3.0 - architectural design meeting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

12;When in Rome... Rome - Italy ... Source: Michigan State University, Center for Beam Theory and Dynamical Systems Collection: Physics 22 An Analysis of Decision-centric...

77

Italy (including San Marino) Fossil-Fuel CO2 Emissions  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Western Europe » Italy Western Europe » Italy (including San Marino) Italy (including San Marino) Fossil-Fuel CO2 Emissions Graph graphic Graphics Data graphic Data Trends As occurred in many industrialized nations, CO2 emissions from Italy rose steeply since the late 1940's until the growth was abruptly terminated in 1974. Since 1974, emissions from liquid fuels have vacillated, dropping from 76% to 46% of a static but varying total. Significant increases in natural gas consumption have compensated for the drop in oil consumption. In 2008, 35.8% of Italy's fossil-fuel CO2 emissions were due to natural gas consumption. Coal usage grew steadily until 1985 when CO2 emissions from coal consumption reached 16 million metric tons of carbon. Not until 2004 did coal usage exceed 1985 levels and now accounts for 13.9% of Italy's

78

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

79

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

80

E-Print Network 3.0 - area central italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of agricultural commodities in central Italy. Students... coursework in the historic center of Florence, Italy during Spring ... Source: Cline, Kenneth C. - Horticultural...

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

2009 International Energy Workshop Fondazione Giorgio Cini, Venice, Italy  

E-Print Network [OSTI]

2009 International Energy Workshop 17-19 June Fondazione Giorgio Cini, Venice, Italy Exploring the Energy Security and Climate Policy Nexus with the POLES Energy Model in the SECURE Project ­ preliminary Author manuscript, published in "International energy workshop, Venise : Italy (2009)" #12;halshs

Paris-Sud XI, Université de

82

United States and Italy Sign Nuclear Energy Agreements | Department of  

Broader source: Energy.gov (indexed) [DOE]

United States and Italy Sign Nuclear Energy Agreements United States and Italy Sign Nuclear Energy Agreements United States and Italy Sign Nuclear Energy Agreements September 30, 2009 - 1:23pm Addthis U.S. Secretary of Energy Steven Chu and Italian Minister for Economic Development Claudio Scajola today signed two important nuclear energy agreements that may lead to construction of new nuclear power plants and improved cooperation on advanced nuclear energy systems and fuel cycle technologies in both countries. The U.S.-Italy Joint Declaration Concerning Industrial and Commercial Cooperation in the Nuclear Energy Sector, which was signed on behalf of the United States by Secretary Chu and Deputy Secretary of Commerce Dennis F. Hightower, affirms the strong interest of the United States and Italy to encourage their respective nuclear industries to seek opportunities for the

83

United States and Italy Sign Nuclear Energy Agreements | Department of  

Broader source: Energy.gov (indexed) [DOE]

United States and Italy Sign Nuclear Energy Agreements United States and Italy Sign Nuclear Energy Agreements United States and Italy Sign Nuclear Energy Agreements September 30, 2009 - 1:23pm Addthis U.S. Secretary of Energy Steven Chu and Italian Minister for Economic Development Claudio Scajola today signed two important nuclear energy agreements that may lead to construction of new nuclear power plants and improved cooperation on advanced nuclear energy systems and fuel cycle technologies in both countries. The U.S.-Italy Joint Declaration Concerning Industrial and Commercial Cooperation in the Nuclear Energy Sector, which was signed on behalf of the United States by Secretary Chu and Deputy Secretary of Commerce Dennis F. Hightower, affirms the strong interest of the United States and Italy to encourage their respective nuclear industries to seek opportunities for the

84

Italy Nuclear Security Summit: Fact Sheet | National Nuclear Security  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Italy Nuclear Security Summit: Fact Sheet | National Nuclear Security Italy Nuclear Security Summit: Fact Sheet | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > Media Room > Fact Sheets > Italy Nuclear Security Summit: Fact Sheet Fact Sheet Italy Nuclear Security Summit: Fact Sheet Mar 26, 2012 Between the 1960s and mid-1980s, Italy had an ambitious nuclear power

85

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005. The contribution will be organised as a poster and will present illustrations of the way student teachers meet

Spagnolo, Filippo

86

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005

Spagnolo, Filippo

87

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005. Kiliskiego 12, piotr@wlodkowic.pl The poster is to present the first results of research made among teachers

Spagnolo, Filippo

88

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 with his education. In this poster, we study the students' personal school-routes as a variable

Spagnolo, Filippo

89

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

CIEAEM 57 ­ Italie ­ Italy Foire aux idées, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session July 23-29, 2005 will have a format of a poster. It will focus on the illustrations of the above goals. Problems from

Spagnolo, Filippo

90

Antonio Pietrangeli, The Director of Women: Feminism, Film Theory and Practice in Postwar Italy  

E-Print Network [OSTI]

Wisconsin Press, 2005. Camus, Albert. The Myth of Sisyphus.buildings in Rome. 321 Albert Camus, The Myth of Sisyphus (actresses, from Goethe to Camus, from Luigi Tenco to Mario

Van Ness, Emma Katherine

2013-01-01T23:59:59.000Z

91

Emobility (Smart Grid Project) (Pisa, Italy) | Open Energy Information  

Open Energy Info (EERE)

Pisa, Italy) Pisa, Italy) Jump to: navigation, search Project Name Emobility Country Italy Headquarters Location Pisa, Italy Coordinates 43.716133°, 10.396584° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.716133,"lon":10.396584,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

92

Electricity demand, GDP and employment: evidence from Italy  

Science Journals Connector (OSTI)

This paper applies time series methodologies to examine the causal relationship among electricity demand, real per capita GDP and total labor force for Italy from 1970 to 2009. After a brief introduction, a su...

Cosimo Magazzino

2014-03-01T23:59:59.000Z

93

Health assessment for Griffiss Air Force Base NPL (National Priorities List) site, Rome, Oneida County, New York, Region 2. CERCLIS No. NY4571924451. Final report  

SciTech Connect (OSTI)

The Griffiss Air Force Base National Priorities List Site is located near the City of Rome, New York. Most of these sites have not been sufficiently investigated at this time for a complete determination of their possible health effects. Residential wells south of Griffiss Air Force Base are contaminated with volatile organic compounds: trichloroethene and 1,1,2,2-tetrachloroethane. The measured concentrations of trichloroethene and 1,1,2,2-tetrachloroethane, to date, are below levels of concern. The site is of potential public health concern because of the risk to human health that could result from possible future exposure to hazardous substances at levels that may result in adverse health effects over time.

Not Available

1988-06-09T23:59:59.000Z

94

Eprice (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

(Italy) (Italy) Jump to: navigation, search Project Name Eprice Country Italy Coordinates 41.360317°, 12.766113° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.360317,"lon":12.766113,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

95

Grid4EU (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

Grid4EU (Smart Grid Project) (Italy) Grid4EU (Smart Grid Project) (Italy) Jump to: navigation, search Project Name Grid4EU Country Italy Coordinates 41.910454°, 12.65625° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.910454,"lon":12.65625,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

96

Address (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

Italy) Italy) Jump to: navigation, search Project Name Address Country Italy Coordinates 41.746727°, 12.052002° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.746727,"lon":12.052002,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

97

BeAware (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

(Italy) (Italy) Jump to: navigation, search Project Name BeAware Country Italy Coordinates 41.689323°, 12.44751° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.689323,"lon":12.44751,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

98

THREE WORDS ABOUT MOBILE PHONES: FINDINGS FROM SWEDEN, THE US, ITALY, JAPAN, AND KOREA  

E-Print Network [OSTI]

THREE WORDS ABOUT MOBILE PHONES: FINDINGS FROM SWEDEN, THE US, ITALY, JAPAN, AND KOREA Naomi S phones: findings from Sweden, the US, Italy, Japan, and Korea While roughly half of the world students in Sweden, the US, Italy, Japan, and Korea, between the ages of 18 and 24. One of our open

Carlini, David

99

A combined wind wavetidal model for the Venice lagoon, Italy  

E-Print Network [OSTI]

A combined wind wave­tidal model for the Venice lagoon, Italy L. Carniello and A. Defina Department between waves and tide propagation. The combined wind wave­tidal model is applied to the Venice lagoon. Particular attention is devoted to the dissipation of wave energy at the steep boundaries between channels

Fagherazzi, Sergio

100

BeyWatch (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

Italy Italy Coordinates 41.475658°, 12.172852° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.475658,"lon":12.172852,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

EUDEEP (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

Italy Italy Coordinates 41.43449°, 13.040771° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.43449,"lon":13.040771,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

102

E-Print Network 3.0 - acireale sicily italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universiteit van Amsterdam Collection: Mathematics 59 On the Mesozoic Ionian Basin R. Catalano,1 Summary: Tethys (Sicily, Italy); new evidences for the position of the...

103

Tonnare in Italy: Science, History and Culture of Sardinian Tuna Fishing  

E-Print Network [OSTI]

December 1, 2008, SeaFood Business section. http://policy forums. International seafood industry, trade, and56. Catarci, Camillo. The Seafood Market in Italy. GLOBEFISH

Emery, Katherine B

2010-01-01T23:59:59.000Z

104

The New Engineering Bachelor Programmes in Italy and at Politecnico di Milano  

Science Journals Connector (OSTI)

This paper treats the new structure of engineering studies in Italy, that starting from academic year 2000/2001 introduces bachelor programmes for all the students.

Roberto Negrini

2001-01-01T23:59:59.000Z

105

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

106

United States and Italy Sign Agreements to Advance Developments in Nuclear  

Broader source: Energy.gov (indexed) [DOE]

Italy Sign Agreements to Advance Developments in Italy Sign Agreements to Advance Developments in Nuclear Energy United States and Italy Sign Agreements to Advance Developments in Nuclear Energy September 30, 2009 - 12:00am Addthis Washington, D.C. - U.S. Secretary of Energy Steven Chu and Italian Minister for Economic Development Claudio Scajola today signed two important nuclear energy agreements that may lead to construction of new nuclear power plants and improved cooperation on advanced nuclear energy systems and fuel cycle technologies in both countries. The U.S.-Italy Joint Declaration Concerning Industrial and Commercial Cooperation in the Nuclear Energy Sector, which was signed on behalf of the United States by Secretary Chu and Deputy Secretary of Commerce Dennis F. Hightower, affirms the strong interest of the United States and Italy to

107

ES Energy Spa | Open Energy Information  

Open Energy Info (EERE)

Energy Spa Energy Spa Jump to: navigation, search Name ES Energy Spa Place Rome, Italy Zip 144 Sector Wind energy Product A company that operates a wind turbine power station on Montefalcone, Italy. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

108

RESIDENTIAL COMPLEX WITH A LOW ENERGY CONSUMPTION AT PRATO (ITALY)  

Science Journals Connector (OSTI)

ABSTRACT During recent years in Italy there has been widespread experimentation with passive solar technologies, carried out for the main part on multi-storey residential buildings in highly urbanized situations. Some important findings have emerged from these; in particular bioclimatic criteria have shown the possibility of allowing 50% higher energy savings with respect to traditional buildings, while on the other hand bringing very high extra-costs (up to 40 - 50% of construction costs) in addition to considerable inconveniences for inhabitants (reduction in quality of living conditions, cooling problems in Summer). The pilot project we are presenting has come out of these reflections and is the outcome of collaboration between the Florence Autonomous Institute for Pubblic Housing and AGIP Petroli; its principal goal is the sperimentation with intermediary solutions between the traditional building model and bioclimatic prototypes constructed during the last few years, thereby examining the real feasibility of low - energy consumption building within the ambit of constraints placed upon government subsidized building. KEYWORDS Italy, housing, low energy consumption housing, bioclimatic architecture, passive solar sistems.

Francesco Pica; Gabriella Pistone; Riccardo Roda

1988-01-01T23:59:59.000Z

109

Geothermal power in Italy: A social multi-criteria evaluation  

Science Journals Connector (OSTI)

Abstract Italy was the first country in the world to exploit geothermal resources for electricity production. In Europe it is still the first country in terms of installed capacity. Currently, the only region in Italy with geothermal power plants is Tuscany. This study focuses on Mt. Amiata, one of the two geothermal areas in Tuscany. In Mt. Amiata a strong opposition to the exploitation of geothermal resources is rising. The context is characterized by contested scientific results regarding crucial issues such as the impact of geothermal exploitation on human health and the conservation of water resources. A social multi-criteria evaluation is proposed to explore the different legitimate perspectives of the actors involved. Scenarios are distinguished in terms of their technology, plant site and installed capacity. Criteria reflect economic considerations, social aspects and environmental concerns. A Condorcet consistent aggregation algorithm is applied and results are analyzed using a sensitivity analysis. The alternative scenarios are evaluated by attaching different weights to the criteria reflecting divergent points of view.

Matteo Borzoni; Francesco Rizzi; Marco Frey

2014-01-01T23:59:59.000Z

110

ISIS Facchinetti: A Nearly Zero Energy Retrofit in Italy  

Science Journals Connector (OSTI)

Abstract The research presented here is about the energy retrofit of an existing high school building close to Varese (Italy). As the building was designed in the 60's with a peculiar architectural language, it has been protected by the conservation authorities. However, the construction system in exposed concrete and the large expanses of single glass make the energy performance of the building very poor. The Provincia di Varese, owner of the building, decided to realize an exemplary retrofit project, which would be the first renovated educational building in Italy in line with the future scenario of Nearly Zero-Energy Building expected from 2019 (2021 for private buildings) by the European Directive 2010/31/UE. In this work energetic and payback analysis are developed to delineate three different preliminary scenarios of intervention. The process has always followed discussions with the conservation authorities, which contributed to the definition of realistic scenarios. Interesting results are obtained: a potential energy demand reduction of 70% can be obtained with the passive solutions proposed; in combination with active strategies (efficient mechanical systems and controls) and with the integration of photovoltaic panels (BiPV), the overall energy need of the building can be reduced to nearly zero.

Michele Sauchelli; Gabriele Masera; Gabriele DAntona; Giampaolo Manzolini

2014-01-01T23:59:59.000Z

111

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

112

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

113

ACADEMEI DEI LINCEI OF ROME  

Science Journals Connector (OSTI)

...manatees, monkeys, ocelots, orang-outangs, panthers, raccoons, rhinoceroses, sea-lions, seals...entry prior to delivery of the property. STREET CARS IN GLASGOW. THE street car system of Glasgow is owned and operated by the city...

1900-09-28T23:59:59.000Z

114

Contingent Valuation of renewable energy innovations: vegetal biomass in Italy  

Science Journals Connector (OSTI)

Warming-up of the planet and scarcity of conventional energy resources has led to aim of reducing the consumption of fossil fuels and the development of innovative renewable technologies for energy production. However, innovations and investments in renewable energy can encounter resistance of local communities. This makes planning for the development of Renewable Energy Source-based power plants often very difficult. Against this background, we investigate the level of social consensus on and support of the development of an energy plant based on the use of vegetal biomass in Central Sardinia, Italy. The method adopted is Contingent Valuation. Estimates of ex-ante household Willingness To Pay are implemented, as they are important indicators of the social endorsement for the project development. Implications concerning consensus/disagreement on innovative technologies for sustainable energy production are discussed as perspectives of future research.

Andrea De Montis; Corrado Zoppi

2009-01-01T23:59:59.000Z

115

3D Tomographic Imaging Of The Southern Apennines (Italy)- A Statistical  

Open Energy Info (EERE)

Tomographic Imaging Of The Southern Apennines (Italy)- A Statistical Tomographic Imaging Of The Southern Apennines (Italy)- A Statistical Approach To Estimate The Model Uncertainty And Resolution Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: 3D Tomographic Imaging Of The Southern Apennines (Italy)- A Statistical Approach To Estimate The Model Uncertainty And Resolution Details Activities (0) Areas (0) Regions (0) Abstract: A new dataset of first P-wave arrival times is used to derive the 3D tomographic model of the Campania-Lucania region in the southern Apennines (Italy). We address the issue related to the non-uniqueness of the tomographic inversion solution through massive numerical experimentation based on the global exploration of the model parameter space starting from a large variety of physically plausible initial models.

116

Assets in Action "A Night in Italy" fundraiser on October 20  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Assets in Action "A Night in Italy" Fundraiser Assets in Action "A Night in Italy" Fundraiser Community Connections: Our link to Northern New Mexico Communities Latest Issue:Dec. 2013 - Jan. 2014 All Issues » submit Assets in Action "A Night in Italy" fundraiser on October 20 Building "Healthy Communities, Healthy Youth" is the goal of Los Alamos' Assets in Action program. October 1, 2012 dummy image Read our archives Contacts Editor Linda Anderman Email Community Programs Office Kurt Steinhaus Email Building "Healthy Communities, Healthy Youth" is the goal of Los Alamos' Assets in Action program. You can further its efforts by attending the fundraiser "A Night in Italy" scheduled for Saturday, October 20. The event will be held in Los Alamos at the Hilltop House Hotel

117

Airborne Toxic (Big 5) and GHG (CO2) Emissions: Italy 19911995  

Science Journals Connector (OSTI)

This paper presents a cursory examination of the possible evolution of airborne pollutants in Italy over the period 19911995. Also included are two brief digressions of more general scope on (i) cost-effectiv...

Peter L. Fano

1993-01-01T23:59:59.000Z

118

Joint Statement by the United States and Italy on the 2014 Nuclear...  

National Nuclear Security Administration (NNSA)

the 2014 Nuclear Security Summit Press Release Mar 24, 2014 See a fact sheet here. The White House Office of the Press Secretary Italy and the United States of America are pleased...

119

A Review of "Shakespeare, Politics, and Italy: Intertextuality on the Jacobean Stage  

E-Print Network [OSTI]

. Shakespeare, Politics, and Italy: Intertextuality on the Jacobean Stage. Farnham, Surrey, UK and Burlington, Vermont: Ashgate, 2009. x + 242pp. $99.95. Review by hugh f. wilson, grambling state university. In ?Of Studies,? Lord Bacon remarks that some... books are to be tasted, some books devoured whole, and some books need to be digested more slowly; this one takes time for digestion. Shakespeare, Politics, and Italy: Intertextuality on the Jacobean Stage does not so much ?conclude,? as end...

Wilson, Hugh F.

2010-01-01T23:59:59.000Z

120

GUILIZZONI, PIERO, ANDREA LAMI, AND ALDO MARCHETTO ...  

Science Journals Connector (OSTI)

Oct 23, 1991 ... ment stratigraphic studies of fossil diatoms, chry- sophycean ... Health and Environment-Rome,. Italy. ..... ceous particles derived from fossil-fuel.

2000-03-19T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Mobile Robot Sensing for Environmental Applications  

E-Print Network [OSTI]

deployable cable based robot, in IEEE ICRA, Rome, Italy,Mobile robot sensing for environmental applications Amarjeetsystems per- formed using mobile robot sensing systems. Both

2007-01-01T23:59:59.000Z

122

Power from bio-sources in Italy incentives and results  

SciTech Connect (OSTI)

In Italy most of the technologies for producing power from bio-sources, as well as from other non-conventional renewable Energy Sources (RES), are rather mature, but their exploitation is still not completely convenient from the economic point of view. It depends on many factors, such as designing of plants, selection of energy conversion system and components, selection of installation site, size of market still too limited, high production costs of the technologies and lack of adequate financial supports. In the early nineties, in the attempt to overcome this situation, the Italian Government issued a series of measures addressed mainly to the power production from RES. This gives a short description of the regulations in force and some details about an important incentive tool (CIP 6/92 and relative decrees) for RES power plants installation. In particular, it indicates the possible power plant typologies, the criteria to assimilate the fossil fuel plants to RES ones, the present prices of electricity transferred into the grid and the methodology for updating the prices. Furthermore, the paper gives some data concerning submitted proposals, plant operation planning and their geographic distribution according to different bio-sources typologies.

Gerardi, V.; Ricci, A.; Scoditti, E. [ENEA, Rome (Italy)

1996-12-31T23:59:59.000Z

123

Photovoltaics in Italy, Mechanisms of Promotion: A Cost-Benefit Analysis of the Italian Conto Energia and Evaluation of Externalities  

Science Journals Connector (OSTI)

Italy is currently one of the fastest growing photovoltaic markets worldwide. The introduction of the feed-in-tariff mechanism called Conto Energia has raised...

Marco Lucentini; Diego Di Palma

2013-01-01T23:59:59.000Z

124

Analysis Of Multiple Scattering At Vesuvius Volcano, Italy, Using Data Of  

Open Energy Info (EERE)

Scattering At Vesuvius Volcano, Italy, Using Data Of Scattering At Vesuvius Volcano, Italy, Using Data Of The Tomoves Active Seismic Experiment Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Analysis Of Multiple Scattering At Vesuvius Volcano, Italy, Using Data Of The Tomoves Active Seismic Experiment Details Activities (0) Areas (0) Regions (0) Abstract: Data from the TomoVes active seismic experiment are used to study scattering effects in the shallow heterogeneous structure of Vesuvius volcano. Seismograms from shots located on the volcano itself are characterised by spindle-like envelopes, small or missing P-onsets, missing S-onsets, and long codas. Seismograms from shots in the surroundings of the volcano, on the contrary, show clear and impulsive P- and S-onsets and short codas. The different shapes of the envelopes can be explained by

125

3-D Density Model Of Mt Etna Volcano (Southern Italy) | Open Energy  

Open Energy Info (EERE)

3-D Density Model Of Mt Etna Volcano (Southern Italy) 3-D Density Model Of Mt Etna Volcano (Southern Italy) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: 3-D Density Model Of Mt Etna Volcano (Southern Italy) Details Activities (0) Areas (0) Regions (0) Abstract: A detailed density model of Mt. Etna and its surrounding areas has been evaluated using a 3-D inversion of the gravimetric data acquired in the 1980's. Several high-density and low-density bodies are found, penetrating from shallow depths as far down as 12 km bsl. A positive correlation (in terms of location, extent, density, and velocity) is established between several anomalies of the density model and features identified in previously published seismic tomographies. A prominent high-density body extending down to 7 km bsl is recognized in the southern

126

DLC+VIT4IP (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

Italy) Italy) Jump to: navigation, search Project Name DLC+VIT4IP Country Italy Coordinates 41.352074°, 12.249756° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.352074,"lon":12.249756,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

127

It Matters Which Way You Slice It: Risk Management for the 2005 Procurement Auction of Italy's Acquirente Unico  

SciTech Connect (OSTI)

As the single buyer in Italy for retail consumers not eligible for competitive supply as well as eligible customers who do not choose a competitive supplier, the Acquirente Unico purchases roughly half of Italy's electricity. Here are some of the key risk management considerations that were involved in its 2005 procurement.

Fraser, Hamish; Lanza, Salvatore

2006-02-01T23:59:59.000Z

128

A review of "Erotic Cultures of Renaissance Italy" edited by Sara F. Mathews-Grieco  

E-Print Network [OSTI]

is to be commended for providing non-military historians of the British Isles with a sound introduction to a subject of immense importance to the period. Sara F. Mathews-Grieco, ed. Erotic Cultures of Renaissance Italy. Farnham and Burlington, VT: Ashgate, 2010... into two halves, the #15;rst section under the title ?Visual testimony and verbal games.? Sarah F. Matthews-Grieco then o ers a major essay on the diversity of printed sexual images of the #15;fteenth century in Italy. She goes beyond obvious sources...

Salkeld, Duncan

2012-01-01T23:59:59.000Z

129

Supporting Broadband Growth in an Interregional Level: The Case of Greece-Italy Partnership  

E-Print Network [OSTI]

to these data, EU27 average stands at 20.0%. Denmark and Finland led the European in broadband penetration rate broadband penetration at 9.1%) is far behind. Italy has a broadband penetration rate up to 17.1%, which lies just below the EU27average broadband penetration rate. It is important to mention that even though

Bouras, Christos

130

Concorso Tesi di Laurea e Concorso Tesi di Dottorato di Ricerca BioEnergy Italy 2014  

E-Print Network [OSTI]

Concorso Tesi di Laurea e Concorso Tesi di Dottorato di Ricerca BioEnergy Italy 2014 Bioenergie, Chimica Verde e Agricoltura Destinato ai laureati di qualsiasi Facoltà che hanno dell'uso delle bioenergie o della chimica verde in agricoltura I Concorsi - promossi da Cremona

Segatti, Antonio

131

Laghi di Monticchio (Southern Italy, Region Basilicata): genesis of sediments--a geochemical study  

E-Print Network [OSTI]

Laghi di Monticchio (Southern Italy, Region Basilicata): genesis of sediments--a geochemical study and Sediments, Telegrafenberg C328, 14473 Potsdam, Germany (2) Institut des Sciences de la Terre d'Orléans (ISTO Cedex 2, France Abstract The sedimentation record of Lago Grande di Monticchio (LGM) is one of the most

Boyer, Edmond

132

Stresa, Italy, 26-28 April 2006 VIBRATIONAL ENERGY SCAVENGING WITH SI TECHNOLOGY  

E-Print Network [OSTI]

for a permanent power density. This residual ambient energy can be harnessed to generate electrical powerStresa, Italy, 26-28 April 2006 VIBRATIONAL ENERGY SCAVENGING WITH SI TECHNOLOGY ELECTROMAGNETIC present the design and optimization of an electromagnetic inertial microgenerator for energy scavenging

Boyer, Edmond

133

Hydrothermal dolomites in SW Sardinia (Italy): evidence for a widespread late-Variscan fluid flow event  

E-Print Network [OSTI]

Hydrothermal dolomites in SW Sardinia (Italy): evidence for a widespread late-Variscan fluid flow, the Cambrian carbonates underwent ductile deformation and greenschist facies metamorphism. The same is true-temperature metamorphic rocks within the overlying nappes. It is assumed that a late-Variscan hydrothermal event, which

Boni, Maria

134

Belgirate, Italy, 28-30 September 2005 A COMPREHENSIVE THERMAL-AWARE POWER MANAGEMENT SYSTEM WITH  

E-Print Network [OSTI]

control mechanism more flexible. Besides battery life, thermal impact is another major reason to utilizeBelgirate, Italy, 28-30 September 2005 A COMPREHENSIVE THERMAL-AWARE POWER MANAGEMENT SYSTEM power techniques due to shortage of battery life. Conventional power management designs focused

Paris-Sud XI, Université de

135

Stresa, Italy, 25-27 April 2007 STEP-UP CONVERTER FOR ELECTROMAGNETIC VIBRATIONAL ENERGY  

E-Print Network [OSTI]

are important factors in determining the choice of technique used for the conversion. A relatively largeStresa, Italy, 25-27 April 2007 STEP-UP CONVERTER FOR ELECTROMAGNETIC VIBRATIONAL ENERGY SCAVENGER generally requires a voltage step-up circuit. A suitable voltage step-up circuit for a low voltage energy

Boyer, Edmond

136

Feedback processes between magmatic events and flank movement at Mount Etna (Italy) during the 20022003 eruption  

E-Print Network [OSTI]

. The models suggest that the 2002­2003 events are the result of interrelated processes consisting of (1Feedback processes between magmatic events and flank movement at Mount Etna (Italy) during the 2002 and southeastern flanks. Understanding the precise interconnectivity of these processes may help to forecast

Amelung, Falk

137

Stresa, Italy, 26-28 April 2006 RECENT DEVELOPMENTS IN MEMS-BASED MICRO FUEL CELLS  

E-Print Network [OSTI]

cell achieved a maximum power density of 58 mW cm-2 at room temperature with hydrogen as fuel. 1Stresa, Italy, 26-28 April 2006 RECENT DEVELOPMENTS IN MEMS-BASED MICRO FUEL CELLS Tristan Pichonat ABSTRACT Micro fuel cells (µ-FC) represent promising power sources for portable applications. Today, one

Boyer, Edmond

138

Carbon Dioxide Emissions of the City Center of Firenze, Italy: Measurement, Evaluation, and Source Partitioning  

Science Journals Connector (OSTI)

An eddy covariance station was installed in the city center of Firenze, Italy, to measure carbon fluxes at half-hourly intervals over a mostly homogeneous urban area. Carbon dioxide (CO2) emission observations made over an initial period of 3.5 ...

A. Matese; B. Gioli; F. P. Vaccari; A. Zaldei; F. Miglietta

2009-09-01T23:59:59.000Z

139

Stresa, Italy, 26-28 April 2006 A NOVEL CONTACT RESISTANCE MODEL OF ANISOTROPIC CONDUCTIVE FILM  

E-Print Network [OSTI]

resistance based on the assumption of equal electric conductivity is not so realistic. MoreoverStresa, Italy, 26-28 April 2006 A NOVEL CONTACT RESISTANCE MODEL OF ANISOTROPIC CONDUCTIVE FILM resistance model for the flat panel display (FPD) packaging based on the within layer parallel and between

Boyer, Edmond

140

Simulation of coastal groundwater remediation: the case of Nard fractured aquifer in Southern Italy  

Science Journals Connector (OSTI)

A new theoretical approach for evaluating the sharp interface position in a fractured aquifer was applied to the Nardo aquifer (Southern Italy). The results, based on Dupuit and Ghyben-Herzberg approximations, clearly show both the extent of seawater ... Keywords: Coastal springs, Fractured aquifers, Mathematical models, Seawater intrusion

Costantino Masciopinto

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Renewable Energies Development RED 2002 | Open Energy Information  

Open Energy Info (EERE)

Renewable Energies Development RED 2002 Renewable Energies Development RED 2002 Jump to: navigation, search Name Renewable Energies Development (RED) 2002 Place Rome, Italy Zip 142 Product PV systems integrator. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

142

Interenergy Srl | Open Energy Information  

Open Energy Info (EERE)

Interenergy Srl Interenergy Srl Jump to: navigation, search Name Interenergy Srl Place Rome, Italy Zip 50 Sector Efficiency, Renewable Energy Product An Italian engineering and consulting firm specialised in renewable energy and energy efficiency. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

143

Green Utility Srl | Open Energy Information  

Open Energy Info (EERE)

Utility Srl Utility Srl Jump to: navigation, search Name Green Utility Srl Place Rome, Italy Zip 153 Product Italian PV project developer established by Solon, GESENU and Green Utility management. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

144

High-temperature rapid pyrometamorphism induced by a charcoal pit burning: The case of Ricetto, central Italy  

Science Journals Connector (OSTI)

Bulk chemistry and mineralogy of the peculiar rock of Ricetto (Carseolani Mts., Central Apennines, Italy) was studied to resolve its controversial origin: igneous dyke or anthropic product. This hybrid rock co...

Flavio Capitanio; Francesco Larocca

2004-02-01T23:59:59.000Z

145

L'INSERTION DES ROMS PAR L'HABITAT FLORENCE (ITALIE) FRANTZ David  

E-Print Network [OSTI]

1 L'INSERTION DES ROMS PAR L'HABITAT ? FLORENCE (ITALIE) FRANTZ David ESO-Caen MRSH Université de les populations roms d'une ville moyenne italienne, Florence, entre les années 1980 et aujourd'hui. Entre Italiens et « extra-comunitari », les Roms représentent une population hétérogène dont la

Boyer, Edmond

146

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

147

Api Nova Energia Srl | Open Energy Information  

Open Energy Info (EERE)

Api Nova Energia Srl Jump to: navigation, search Name: Api Nova Energia Srl Place: Roma, Italy Zip: 198 Sector: Renewable Energy Product: Develops, builds, finances, acquires, owns...

148

Kerself SPA | Open Energy Information  

Open Energy Info (EERE)

Italy Zip: 42015 Sector: Solar Product: Italian manufacturer of electric motors and pumps; installs and produces PV and solar passive systems. References: Kerself SPA1 This...

149

Rome, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

88.6312126° 88.6312126° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9802852,"lon":-88.6312126,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

150

Rome, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

3.379073° 3.379073° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.664815,"lon":-83.379073,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

151

G-7 Energy Ministers Meet in Rome  

Broader source: Energy.gov [DOE]

Secretary Moniz participated in meetings with fellow G-7 counterparts to discuss ways to strengthen collective energy security.

152

Effects of ambient and boat noise on hearing and communication in three fish species living in a marine protected area (Miramare, Italy)  

E-Print Network [OSTI]

in a marine protected area (Miramare, Italy) Antonio Codarin a , Lidia E. Wysocki b , Friedrich Ladich b, Austria c Etho-ecology Marine Laboratory, Natural Marine Reserve of Miramare ­ WWF, Viale Miramare 349 Ambient noise Hearing a b s t r a c t The WWF-Natural Marine Reserve of Miramare (Trieste, Italy

Ladich, Friedrich

153

G. Vlad et al. THEORY OF FUSION PLASMAS -Varenna, Italy, 28/8-1/9, 2006 1 Interaction of fast particles and  

E-Print Network [OSTI]

G. Vlad et al. THEORY OF FUSION PLASMAS - Varenna, Italy, 28/8-1/9, 2006 1 Interaction of fast. Shinohara, M. Ishikawa and M. Takechi (JT-60U); M. Schneider (CRONOS codes) #12;G. Vlad et al. THEORY et al. THEORY OF FUSION PLASMAS - Varenna, Italy, 28/8-1/9, 2006 3 Introduction - 1 · Next generation

Vlad, Gregorio

154

A review of "Art and the Religious Image in El Grecos Italy" by Andrew Caper  

E-Print Network [OSTI]

that reveal far more complexity in interpersonal colonial interactions than we have previ- ously appreciated. Andrew Casper. Art and the Religious Image in El Grecos Italy. University Park, Pennsylvania: The Pennsylvania State University Press, 2014. xiii... + 221 pp. + 84 illus. $79.95. Review by livia stoenescu, texas a&m university. Andrew Caspers Art and the Religious Image in El Grecos Italy breaks new ground in art historical literature by engaging recent re- search both in typological reassessment...

Stoenescu, Livia

2014-01-01T23:59:59.000Z

155

Belgirate, Italy, 28-30 September 2005 MECHANISM AND THERMAL EFFECT OF DELAMINATION IN LIGHT-EMITTING  

E-Print Network [OSTI]

for the investigation of the thermal behavior of the delaminated LEDs. Increase of thermal resistance with the degreeBelgirate, Italy, 28-30 September 2005 MECHANISM AND THERMAL EFFECT OF DELAMINATION IN LIGHT-EMITTING DIODE PACKAGES Jianzheng Hu, Lianqiao Yang, and Moo Whan Shin Department of Materials Science

Paris-Sud XI, Université de

156

ISIT2000, Sorrento, Italy, June 25{30, 2000 Constellation Mappings For Two-Dimensional Non-Uniform Signaling  

E-Print Network [OSTI]

that constel- lation mappings which minimize the average symbol energy and, given this, maximize the decoding-QAM constellation with a mapping M1 . For p > 0:5, the mapping M1 minimizes the average symbol energyISIT2000, Sorrento, Italy, June 25{30, 2000 Constellation Mappings For Two-Dimensional Non

Linder, Tamás

157

EWEC'07 Conference, 7-10 May 2007, Milan, Italy. POW'WOW Virtual Laboratory for Wind Power  

E-Print Network [OSTI]

EWEC'07 Conference, 7-10 May 2007, Milan, Italy. 1 POW'WOW Virtual Laboratory for Wind Power for the short-term prediction of wind power production. The relevant and common forecast length of these tools purposes. A state of the art on wind power forecasting has been published by Giebel et al [1]. On the other

Paris-Sud XI, Université de

158

Modelling air quality impact of a biomass energy power plant in a mountain valley in Central Italy  

E-Print Network [OSTI]

fuel power plants with those fuelled with modern biomass (IPCC, 2011). However, from an air qualityModelling air quality impact of a biomass energy power plant in a mountain valley in Central Italy a c t Pollutant increments due to a biomass power plant simulated with CALPUFF.

Curci, Gabriele

159

OWEMES -Offshore Wind And Other Marine Renewable Energies In Mediterranean And European Seas Civitavecchia (Italy), 20th  

E-Print Network [OSTI]

OWEMES - Offshore Wind And Other Marine Renewable Energies In Mediterranean And European Seas Civitavecchia (Italy), 20th -22th April 2006 How to avoid Biases in Offshore Wind Power Forecasting Lueder von, adaptive system, Neural Network, single site forecast, systematic error Abstract Large-scale offshore wind

Heinemann, Detlev

160

The limits of public policy intervention in urban logistics: The case of Vicenza (Italy) and lessons for other European cities.  

E-Print Network [OSTI]

1 The limits of public policy intervention in urban logistics: The case of Vicenza (Italy - University of Lyon Laetitia DABLANC, INRETS Abstract For over fifteen years, the subject of urban logistics logistics, local policy, regulations, urban distribution centres, competition 1. Introduction Freight

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Performance of the Italian strong motion network during the 2009, LAquila seismic sequence (central Italy)  

Science Journals Connector (OSTI)

On April 6, 2009, the town of LAquila in the Abruzzo region (central Italy) was struck by a seismic event at 01:32 (UTC), of magnitude MW=6.3. The mainshock was followed by a long period of intense seismic act...

Elisa Zambonelli; Rita de Nardis; Luisa Filippi

2011-02-01T23:59:59.000Z

162

ASME-ATI-UIT 2010 Conference on Thermal and Environmental Issues in Energy Systems 16 19 May, 2010, Sorrento, Italy  

E-Print Network [OSTI]

, 2010, Sorrento, Italy INTRODUCTION Air source heat pump systems are used for heating and cooling heat pump exchanges heat directly from the indoor environment to the outdoor ambient air, and during buildings all year around. They are energy efficient, compact and have low installation cost. An air source

163

Zeno, Achilles and the turtle Not very far from Crotona (now in Italy, but back then it was a Greek  

E-Print Network [OSTI]

Zeno, Achilles and the turtle Not very far from Crotona (now in Italy, but back then it was a Greek of "infinite divisibility" of time and space. The paradox most often quoted concerns Achilles and a turtle: Achilles, the swiftest runner in Greece, can never catch a turtle that has been given a head start. For

De Carli, Laura

164

The piazza - social core or romantic anachronism: a culture-historical and ethnographic study in Todi, Italy  

E-Print Network [OSTI]

In this thesis a public piazza in Italy is studied. Traditional urban squares in Europe have had a wide range of functions and purposes over the centuries. Squares were used as a stage to display political and religious power, as a place for trade...

Kruse, Eva-Maria

2002-01-01T23:59:59.000Z

165

Proc. of the 12th Int. Conference on Digital Audio Effects (DAFx-09), Como, Italy, September 1-4, 2009  

E-Print Network [OSTI]

-4, 2009 ENERGY AND ACCURACY ISSUES IN NUMERICAL SIMULATIONS OF A NON-LINEAR IMPACT MODEL Stefano Papetti@dei.unipd.it Davide Rocchesso Dept. of Art and Industrial Design IUAV University of Venice, Italy roc@iuav.it ABSTRACT methods, based on enforcing numerical energy consistency, are suggested to improve the accuracy

Avanzini, Federico

166

Radon Laboratory: A Proposal for Scientific Culture Dissemination Among Young Students in Italy  

SciTech Connect (OSTI)

In Italy the 'nuclear issue' was for a long time a taboo. A way to approach this theme to make the public more trusting of nuclear issues is to discuss radioactivity and ionizing radiation starting from young students. An experimental activity that involves secondary school students has been developed. The approach is to have students engaged in activities that will allow them to understand how natural radioactivity is a part of our everyday environment. This would include how radiation enters our lives in different ways, to demonstrate that natural radioactive sources found in soil, water, and air contribute to our exposure to natural ionizing radiation and how this exposure effects human health. Another objective is to develop a new technique for teaching physics which will enhance scientific interest of students in applications of nuclear physics in both environmental and physical sciences.

Groppi, Flavia; Manenti, Simone; Gini, Luigi; Bonardi, Mauro L. [Universita degli Studi di Milano and Istituto Nazionale di Fisica Nucleare Sezione di Milano-L.A.S.A., Radiochemistry Laboratory, via F.lli Cervi, 201-20090 Segrate (Italy); Bazzocchi, Anna [Universita degli Studi di Milano and Istituto Nazionale di Fisica Nucleare Sezione di Milano-L.A.S.A., Radiochemistry Laboratory, via F.lli Cervi, 201-20090 Segrate (Italy); Liceo Scientifico Tecnologico I.I.S. 'E. Mattei', San Donato Milanese (Italy)

2009-08-19T23:59:59.000Z

167

Abatement efficiency of municipal wastewater treatment plants using different technologies (Orbetello Lagoon, Italy)  

Science Journals Connector (OSTI)

Two small-scale municipal wastewater treatment plants (Neghelli and Terrarossa) discharging effluents into a lagoon of great environmental interest and highly stressed by tourism (Orbetello, Italy) were monitored over the year 2001. We evaluated plants' performances developing a general efficiency indicator of removal to select the suitable purification technology (activated sludge, Neghelli vs. rotating biodisc reactor, Terrarossa). Unexpected, conventional technologies (activated sludge) had best performances (84% vs. 62%) with higher removal efficiencies for dissolved nutrients producing, on average, better final effluents. Even if Terrarossa showed a great improvement in summertime, during winter it seemed to be considerably affected by sea aerosol. Before the final discharge in lagoon, effluents were phytodepurated in a pond to reduce their nutrient load. Although data showed that the pond had further abatement efficiency over 80%, final outlet water represented a dangerous input for the lagoon ecosystem.

Monia Renzi; Guido Perra; Cristiana Guerranti; Enrica Franchi; Silvia Focardi

2009-01-01T23:59:59.000Z

168

Design and construction of a solar multistory building in Tuscany (Italy)  

SciTech Connect (OSTI)

A solar low income multifamily housing project, under construction in Leghorn (Tuscany, Italy), which combines passive and conservative technologies with an active solar energy plant is presented. The working group took into consideration the following items: the local climatic conditions; the Italian housing laws; a specific heating service contract; a minimum required annual energy saving; and a fixed economic budget. In order to meet the above conditions most satisfactorily, it was necessary to use a number of computer programs as design and performance evaluation tools and to develop a special passive solar component. The six-story high building, consisting of 24 flats, with linear typology is described. The south facade has been realized with two different passive systems: direct gain and solar wall. An active solar system provides part of the building hot water requirement. The minimization of thermal loss has been emphasized by means of reduction of surface/volume ratio and an adequate study of the building construction details.

D'Alessandro, G.; Serravezza, A.

1981-01-01T23:59:59.000Z

169

Maternal Risk Factors for Fetal Alcohol Spectrum Disorders in a Province in Italy  

Science Journals Connector (OSTI)

AbstractBackground Maternal risk factors for fetal alcohol spectrum disorders (FASD) in Italy and Mediterranean cultures need clarification, as there are few studies and most are plagued by inaccurate reporting of antenatal alcohol use. Methods Maternal interviews (n=905) were carried out in a population-based study of the prevalence and characteristics of FASD in the Lazio region of Italy which provided data for multivariate case control comparisons and multiple correlation models. Results Case control findings from interviews seven years post-partum indicate that mothers of children with FASD are significantly more likely than randomly-selected controls or community mothers to: be shorter; have higher body mass indexes (BMI); be married to a man with legal problems; report more drinking three months pre-pregnancy; engage in more current drinking and drinking alone; and have alcohol problems in her family. Logistic regression analysis of multiple candidate predictors of a FASD diagnosis indicates that alcohol problems in the child's family is the most significant risk factor, making a diagnosis within the continuum of FASD 9 times more likely (95%C.I.=1.6 to 50.7). Sequential multiple regression analysis of the child's neuropsychological performance also identifies alcohol problems in the child's family as the only significant maternal risk variable (p<.001) when controlling for other potential risk factors. Conclusions Underreporting of prenatal alcohol use has been demonstrated among Italian and other Mediterranean antenatal samples, and it was suspected in this sample. Nevertheless, several significant maternal risk factors for FASD have been identified.

Mauro Ceccanti; Daniela Fiorentino; Giovanna Coriale; Wendy O. Kalberg; David Buckley; H. Eugene Hoyme; J. Phillip Gossage; Luther K. Robinson; Melanie Manning; Marina Romeo; Julie M. Hasken; Barbara Tabachnick; Jason Blankenship; Philip A. May

2014-01-01T23:59:59.000Z

170

Forthcoming Events  

Science Journals Connector (OSTI)

...Della Vida, Via de'Penitenzieri 13, Rome) 3-9. Water Desalination, 1st intern. symp., Washington, D.C. (Atomic Indus-trial...Went-worth Inst., 550 Huntington Ave.. Boston) 19-22. Economics of Automatic Data Processing, symp., Rome, Italy...

1965-09-17T23:59:59.000Z

171

Forthcoming Events  

Science Journals Connector (OSTI)

...Della Vida, Via de'Penitenzieri 13, Rome) 3-9. Water Desalination, 1st intern. symp., Washington, D.C. (Atomic Indus-trial...Went-worth Inst., 550 Huntington Ave., Boston) 19-22. Economics of Automatic Data Processing, symp., Rome, Italy...

1965-09-24T23:59:59.000Z

172

Forthcoming Events  

Science Journals Connector (OSTI)

...Della Vida, Via de'Penitenzieri 13, Rome) 3-9. Water Desalination, 1st intern. symp., Washington, D.C. (Atomic Indus-trial...Went-worth Inst., 550 Huntington Ave., Boston) 19-22. Economics of Automatic Data Processing, symp., Rome, Italy...

1965-09-10T23:59:59.000Z

173

This project is co-funded by the European Union  

E-Print Network [OSTI]

This project is co-funded by the European Union within the ALFA programme A project implemented by the Università degli Studi "Gugliemo Marconi" Rome, ITALY #12;This project is co-funded by the European Union within the ALFA programme A project implemented by the Università degli Studi "Gugliemo Marconi" Rome

174

Enel Produzione SpA | Open Energy Information  

Open Energy Info (EERE)

Produzione SpA Produzione SpA Jump to: navigation, search Name Enel Produzione SpA Place Roma, Italy Zip 198 Sector Biomass, Geothermal energy, Hydro, Services, Wind energy Product Rome-based project developer of electric services and subsidiary of Enel S.p.A. Has interests in developing and operating geothermal, mini-hydro, wind, photovoltaic and biomass power generation in Italy. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

175

DOCUMENT UPDATED: 30 November 2012 KING'S-AHRC STUDENTSHIPS FOR 2013/14  

E-Print Network [OSTI]

and the Roman provinces from the pre-Roman period to the late Roman empire; the language, literature, history of Greece from the Mycenaean period to the Roman empire; the history, art and archaeology of Rome, Italy

Applebaum, David

176

Differential Role of Transcription-Coupled Repair in UVBInduced Response of Human Fibroblasts and Keratinocytes  

Science Journals Connector (OSTI)

...Cancer Institute, Rome, Italy Most solar radiation-induced skin cancers...cellular components by the higher-energy shorter solar wavelengths comprising the UVB spectra...learn more about the response to solar radiation of the target cells for...

Mariarosaria D'Errico; Massimo Teson; Angelo Calcagnile; Tiziana Nardo; Naomi De Luca; Chiara Lazzari; Silvia Soddu; Giovanna Zambruno; Miria Stefanini; and Eugenia Dogliotti

2005-01-15T23:59:59.000Z

177

Inhibition of Proliferation by c-myb Antisense RNA and Oligodeoxynucleotides in Transformed Neuroectodermal Cell Lines  

Science Journals Connector (OSTI)

...Rome, Italy (GR), or Department of Microbiology, Thomas Jefferson University, 10th...Oncol.. ///: 266-272, 1986. 39. Gilbert, F.. Feder, M., Balaban. G...Res., 44: 5444-5449, 1984. 40. Gilbert. F. Chromosome abnormalities, gene...

Giuseppe Raschell; Anna Negroni; Tomasz Skorski; Sabina Pucci; Malgorzata Nieborowska-Skorska; Antonino Romeo; and Bruno Calabretta

1992-08-01T23:59:59.000Z

178

12 - Advertising in the luxury sector in China: standardisation or adaptation? A comparison between China and Italy  

Science Journals Connector (OSTI)

Abstract: In the general framework of internationalisation, this chapter focusses on the advertising strategies adopted by top companies in the luxury sector. The chapter reports some of the findings of a study to determine the importance of local culture in advertising content by comparing Chinese and Italian ads. In particular, after an overview of the advertising market in China and in Italy, the content of ads from Vogue, one of the most popular and influential fashion and beauty magazines in both China and Italy, are analysed. The focus is on three industries: clothing, cosmetics and jewellery. This chapter contributes to the standardisationadaptation discussion and shows that strategies are affected by both country and product category.

Francesca Checchinato; Cinzia Colapinto; Alice Giusto

2014-01-01T23:59:59.000Z

179

A review of "Nuns Chronicles and Convent Culture in Renaissance and Counter-Reformation Italy." by K. J. P. Lowe  

E-Print Network [OSTI]

150 SEVENTEENTH-CENTURY NEWS Women?s writing scholars and English drama historians will benefit from her study. K. J. P. Lowe. Nuns? Chronicles and Convent Culture in Renaissance and Counter- Reformation Italy. Cambridge: Cambridge University... Press, 2003. xvi + 437 pp. + 42 illus. $90.00. Review by THOMAS WORCESTER, COLLEGE OF THE HOLY CROSS. Vernacular chronicles of three convents form the basis of this study: Santa Maria delle Vergini (Venice), known as Le Vergini; Santa Maria...

Thomas Worcester

2005-01-01T23:59:59.000Z

180

Numerical and Experimental Analysis of Combustion and Exhaust Emissions in a Dual-Fuel Diesel/Natural Gas Engine  

Science Journals Connector (OSTI)

Department of Mechanical Engineering, UTV, University of Rome Tor Vergata, Rome, Italy, and IM-CNR, Istituto Motori of Italian National Research Council, Naples, Italy ... Accordingly, the use of NG as primary fuel allows the same compression ratio of the conventional diesel engine; thus, existing diesel engines can be easily converted to dual-fuel operation. ... Thus, a more general combustion model (G-equation or EDC) could be considered to represent flame propagation. ...

Stefano Cordiner; Michele Gambino; Sabato Iannaccone; Vittorio Rocco; Riccardo Scarcelli

2008-02-21T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Bromate, chlorite, chlorate, haloacetic acids, and trihalomethanes occurrence in indoor swimming pool waters in Italy  

Science Journals Connector (OSTI)

Abstract Subjects attending indoor swimming pools are exposed to disinfection by-products (DBPs) by inhalation, dermal contact and/or ingestion, as a consequence of water disinfection treatments with chlorine and related compounds. The occurrence of trihalomethanes (THMs) in pool waters has been well documented, while information about other DBPs, including bromate, chlorite, chlorate and haloacetic acids (HAAs), is very limited even though some of these substances are potentially dangerous for human health. The aim of this study was to investigate the occurrence of bromate, chlorite, chlorate, \\{HAAs\\} and \\{THMs\\} both in pool and in source water of 24 public indoor swimming pools in Emilia Romagna Region, Northern Italy. \\{THMs\\} were evaluated with a standardized method involving the head-space gas-chromatographic technique, while HAAs, bromate, chlorite, and chlorate were detected by Ion Chromatography with Mass Spectrometry. \\{THMs\\} were measured in all the pool water samples (mean value: 36.928.2?g/l), while they were detectable in less than 50% of source waters and always at very low levels (mean value: 2.04.1?g/l), as a consequence of drinking water disinfection with chlorine dioxide, a widespread disinfection method in Italy. Bromate was always absent in source water samples, and it was detected in 3 samples of pool water only (range: 1048?g/l). \\{HAAs\\} were scarcely detected in source waters (3 positive samples, maximum level observed: 21?g/l), while in pool water they were always present at detectable levels and showed high concentrations (range: 11403?g/l, mean value of 164108?g/l). Chlorite was present in 22 water supply samples (mean value: 149122?g/l) but only in one pool water. Chlorate, on the contrary, resulted as the most prevalent DBP both in source (range: 2499?g/l) and in pool waters, where it showed the highest levels, with a mean value of 3661?g/l and a maximum value of 19537?g/l. Such environmental levels could result in an important human exposure, mainly by ingestion and/or dermal contact, to non volatile \\{DBPs\\} different than THMs. Exposure to those DBPs, therefore, needs to be further investigated and strategies aimed at minimizing it should be identified and undertaken. Attention should be paid, above all, to chlorate: this substance appears really widespread in swimming pool water and, according to the most recent toxicological studies, its potential human health effects could be relevant.

Elena Righi; Gugliemina Fantuzzi; Guerrino Predieri; Gabriella Aggazzotti

2014-01-01T23:59:59.000Z

182

A commercial project for private investments. Update of the 280 MW api Energia IGCC plant construction in central Italy.  

SciTech Connect (OSTI)

This paper has the aim to give a general overview of the api Energia IGCC project starting from the project background in 1992 and ending with the progress of construction. api Energia S.p.A., a joint VENTURE between api anonima petroli italiana S.p.A., Roma, Italy (51%), ABB Sae Sadelmi S.p.A., Milano, Italy (25%) and Texaco Development Corporation (24%), is building a 280 MW Integrated Gasification Combined Cycle plant in the api refinery at Falconara Marittima, on Italy' s Adriatic coast, using heavy oil residues. The plant is based on the modern concept of employing a highly efficient combined cycle power plant fed with a low heating value fuel gas produced by gasifying heavy refinery residues. This scheme provides consistent advantages in terms of efficiency and environmental impact over alternative applications of the refinery residues. The electric power produced will feed the national grid. The project has been financed using the ``project financing'' scheme: over 1,000 billion Lira, representing 75% of the overall capital requirement, have been provided by a pool of international banks. In November 1996 the project reached financial closure and immediately after the detailed design and procurement activities started. Engineering, Procurement and Construction activities, carried out by a Consortium of companies of the ABB group, are totally in line with the schedule. Commercial operation of the plant, is scheduled for November 1999.

Del Bravo, R.; Pinacci, P.; Trifilo, R.

1998-07-01T23:59:59.000Z

183

Smart Grids in the EU with smart regulation: Experiences from the UK, Italy and Portugal  

Science Journals Connector (OSTI)

Abstract The paper describes the integration between what used to be a passive element of the energy value chain the grid and both upstream and downstream elements. The evolution of communications among the elements has permitted a more robust and adaptable structure that already is being implemented: the Smart Grid. The paper relates the evolution of EU policy concerning both the development and the rolling-out of solutions to exploit the potential of the Smart Grid concept and describes what has been done by the regulators of three countries that share the same goal but seek to attain it via distinct paths. The article starts with a justification of the need for more integrated networks and a definition of the Smart Grid. A second part covers the risks and difficulties of implementation within an established network, introducing the role of the regulator. The third part describes EU policy response and three different approaches by regulators in the UK, Italy and Portugal, showing how in each case policy is influenced by characteristics of their respective national electricity markets in terms of competition dynamics.

Joo Crispim; Jos Braz; Rui Castro; Jorge Esteves

2014-01-01T23:59:59.000Z

184

Smart meters and energy savings in Italy: Determining the effectiveness of persuasive communication in dwellings  

Science Journals Connector (OSTI)

Abstract To secure a sustainable energy development in the residential sector, attitudes and human behavior need to be modified toward more efficient and conscious energy usage. The goal of this research is to assess evaluations and to test the effectiveness in reducing domestic electricity consumption. The aim of the smart monitoring system we evaluate is to provide households with a user-friendly tool that improves awareness of energy behavior in homes, enabling better management via the visualization of consumption and persuasive tailored information on domestic electricity use. In our study, the system was tested on 31 Italian families selected among volunteers all over Italy, participating to the first trial phase from October 2012 to November 2013. A combination of persuasive communication strategies such as graphical real-time and historical feedback based on real data and comparison tools to encourage competitiveness against similar households were provided to users through a domestic user-friendly interface. In addition, personalized energy saving prompts were sent via web-newsletters to trial users. The study concludes that energy related persuasive communication is effective in reducing electricity consumption in dwellings on average ?18% and up to ?57%.

Simona DOca; Stefano P. Corgnati; Tiziana Buso

2014-01-01T23:59:59.000Z

185

Biomethane production from different crop systems of cereals in Northern Italy  

Science Journals Connector (OSTI)

Abstract Global warming is linked to the reduction of green house gas emissions (GHG). The anaerobic digestion of animal manure and energy crops is a promising way of reducing GHG emissions. The increasing number of biogas plants involves a high consumption of energy crops and the needed of big agricultural area. In Italy, cereals silages are the main feedstock for biogas production and are commonly grown under two different crop systems: single crop (only maize) and double crops (maize later winter cereals). In this paper we present the results of experimental field tests carried out by monitoring the anaerobic biomethane potential (BMP) of different cereals silages commonly grown in the Padanian Plan. A laboratory device has been developed to measure the specific biomethane production of the different cereal silages. The different energy crops have been evaluated, in single and double crop systems, expressing the biomethane production per hectare. The maize hybrids show higher specific biomethane potentials respect to winter cereals. Maize FAO class 700 achieves the highest production per hectare as a single crop. Nevertheless, the highest biomethane productions per hectare are reached with double crop system in particular when maize FAO class 500 follows triticale (+12% respect the best single crop system).

Marco Negri; Jacopo Bacenetti; Massimo Brambilla; Andrea Manfredini; Andrea Cantore; Stefano Bocchi

2014-01-01T23:59:59.000Z

186

Assessment of GHG emissions of biomethane from energy cereal crops in Umbria, Italy  

Science Journals Connector (OSTI)

Abstract Biomethane from energy crops is a renewable energy carrier and therefore it potentially contributes to climate change mitigation. However, significant greenhouse gas (GHG) emissions resulting from cultivation and processing must be considered. Among those, the production and use of nitrogen fertilizers, the resulting nitrous oxide (N2O) emissions, the methane emissions from digestate storage and the energy consumption of the biogas plant are crucial factors. In the present paper an integrated life cycle assessment (LCA) of GHG emissions from biomethane production is carried out, taking into account own measurements and experience data from a modern biogas plant located in Umbria, Italy. The study is also focused on the electricity consumption of the biogas plant, assessing the specific absorption power of each machinery. The analysis is based on the methodology defined by the European Union Renewable Energy Directive 2009/28/EC (RED). The main result is that the biomethane chain exceeds the minimum value of GHG saving (35%) mainly due to the open storage of digestate. However by varying the system, using heat and electricity from a biogas CHP plant and covering digestate storage tank, a reduction of 68.9% could be obtained.

C. Buratti; M. Barbanera; F. Fantozzi

2013-01-01T23:59:59.000Z

187

Images of energy: Policy perspectives on the introduction of hydroelectricity in Italy, 1882-1914  

SciTech Connect (OSTI)

This study considers the link between energy technologies and cultural attitudes. Contemporary energy policy makers lack the conceptual tools with which to evaluate culturally appropriate energy choices. A way to regain a contextual capability is needed; that is, the capacity to recognize and avert situations where technological advance is insufficiently harmonized with its embedding environment. This study explores how both policy makers and the general public form their [open quotes]images of energy.[close quotes] It does so in three parts, beginning with an examination of the concepts of [open quotes]technology,[close quotes] [open quotes]culture[close quotes] and [open quotes]cognitive map,[close quotes] and an explanation of their interrelationship. The second part presents two historical case-studies of the introduction of hydroelectricity in Italy from 1882-1914. It considers how a relatively unknown technology made its way into urban and rural life, who its primary surveyors were, and how it shaped and was shaped by the cognitive maps of those into whose lives it marched. The final part extends the investigation to contemporary socio-cultural dynamics. Through concepts derived from General System Theory, the process of technological integration is interpreted in light of events that shape the world today. The design of a model to be used by energy makers and educators alike in conceiving culturally attuned energy alternatives is proposed. Such a model would describe energy-related cognitive maps and could serve as the basis for informed decision-making on energy choice at all levels of society. The study concludes with suggestions for a research agenda to further explore individual and collective energy-related cognitive maps.

Laszlo, A.R.

1992-01-01T23:59:59.000Z

188

U.S. Energy Secretary Highlights Need for Energy Diversity at 20th World  

Broader source: Energy.gov (indexed) [DOE]

Highlights Need for Energy Diversity at 20th Highlights Need for Energy Diversity at 20th World Energy Congress Ministerial Forum in Rome U.S. Energy Secretary Highlights Need for Energy Diversity at 20th World Energy Congress Ministerial Forum in Rome November 13, 2007 - 4:31pm Addthis Welcomes Italy as 17th Nation to Join Global Nuclear Energy Partnership ROME, ITALY - U.S. Secretary of Energy Samuel W. Bodman today will deliver remarks at the 20th World Energy Congress Ministerial Forum, highlighting the importance of robust investments in a diversity of energy supplies and breakthrough technologies to meet growing global demand for energy. While in Rome, Secretary Bodman welcomed Italy to the Global Nuclear Energy Partnership (GNEP), an international framework aimed at expanding nuclear power worldwide while responsibly managing nuclear waste and reducing

189

A review of "Hope and Healing: Painting in Italy in a Time of Plague" by Gauvin Alexander Bailey, Pamela M. Jones, Franco Mormando, and Thomas W. Worcester, eds.  

E-Print Network [OSTI]

. Worcester, eds. Hope and Healing: Painting in Italy in a Time of Plague, 1500- 1800. Worcester, Mass.: Clark University, College of the Holy Cross, Worcester Art Museum, 2005. viii + 264 pp. + 43 color and 68 b/w illus. $39.95. Review by JEFFREY... of the show, Thomas Worcester: ?This exhibition has sought to explore how early modern people (especially in Italy) thought about life and death, illness and health, plague and piety. It has sought to show how painting was a privileged expression of metaphors...

Fontana, Jeffrey

2007-01-01T23:59:59.000Z

190

1st Workshop on Dependability Issues in Wireless Ad Hoc Networks and Sensor Networks (DIWANS'04), Florence, Italy, Fault Tolerant Communication Topologies for Wireless Ad Hoc Networks  

E-Print Network [OSTI]

1st Workshop on Dependability Issues in Wireless Ad Hoc Networks and Sensor Networks (DIWANS'04), Florence, Italy, June 2004 Fault Tolerant Communication Topologies for Wireless Ad Hoc Networks Bernd, distributed algorithms, failure locality 1 Introduction Wireless sensor networks, mobile ad hoc networks

191

Springer's LNCS Proc. of the 2005 Int. Conf. on High Performance Computing and Communications (HPCC-05), Sorrento, Italy, September 21-24, 2005. (in press)  

E-Print Network [OSTI]

-05), Sorrento, Italy, September 21-24, 2005. (in press) High Performance Subgraph Mining in Molecular and the growing amount of available data makes distributed graph mining techniques particularly relevant. The effectiveness of the distributed method has been evaluated on the well-known National Cancer Institute's HIV

Berthold, Michael R.

192

Bulk Power System Dynamics and Control VI, August 22-27, 2004, Cortina d'Ampezzo, Italy Voltage Stability Enhancement via Model Predictive  

E-Print Network [OSTI]

Bulk Power System Dynamics and Control VI, August 22-27, 2004, Cortina d'Ampezzo, Italy Voltage of the North American power system in August 2003 could have been avoided by tripping a relatively small amount be more palatable. Recent advances in communications and computer systems facilitate such non-disruptive

Hiskens, Ian A.

193

Forecasting short-term electricity consumption using a semantics-based genetic programming framework: The South Italy case  

Science Journals Connector (OSTI)

Abstract Accurate and robust short-term load forecasting plays a significant role in electric power operations. This paper proposes a variant of genetic programming, improved by incorporating semantic awareness in algorithm, to address a short term load forecasting problem. The objective is to automatically generate models that could effectively and reliably predict energy consumption. The presented results, obtained considering a particularly interesting case of the South Italy area, show that the proposed approach outperforms state of the art methods. Hence, the proposed approach reveals appropriate for the problem of forecasting electricity consumption. This study, besides providing an important contribution to the energy load forecasting, confirms the suitability of genetic programming improved with semantic methods in addressing complex real-life applications.

Mauro Castelli; Leonardo Vanneschi; Matteo De Felice

2015-01-01T23:59:59.000Z

194

ENEA Italian National Agency for New Technologies Energy and the  

Open Energy Info (EERE)

ENEA Italian National Agency for New Technologies Energy and the ENEA Italian National Agency for New Technologies Energy and the Environment Jump to: navigation, search Name ENEA (Italian National Agency for New Technologies, Energy and the Environment) Place Rome, Italy Zip 196 Product ENEA is a public undertaking operating in the fields of energy, the environment and new technologies. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

195

Enel Green Power SpA formerly Erga SpA | Open Energy Information  

Open Energy Info (EERE)

Enel Green Power SpA formerly Erga SpA Enel Green Power SpA formerly Erga SpA Jump to: navigation, search Name Enel Green Power SpA (formerly Erga SpA) Place Pisa, Italy Zip 56122 Sector Geothermal energy, Hydro, Renewable Energy, Solar, Wind energy Product Rome-based renewable energy division of Enel S.p.A, developing and managing operations in wind, solar, geothermal mini-hydro. Coordinates 43.70996°, 10.39946° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.70996,"lon":10.39946,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

196

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

197

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

198

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

199

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

200

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

202

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

203

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

204

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

205

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

206

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

207

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

208

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

209

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

210

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

211

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

212

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

213

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

214

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

215

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

216

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

217

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

218

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

219

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

220

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

222

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

223

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

224

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

225

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

226

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

227

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

228

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

229

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

230

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

231

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

232

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

233

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

234

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

235

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

236

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

237

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

238

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

239

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

240

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

242

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

243

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

244

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

245

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

246

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

247

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

248

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

249

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

250

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

251

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

252

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

253

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

254

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

255

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

256

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

257

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

258

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

259

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

260

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Peltier A., 2008, La cartographie rglementaire des risques naturels en Suisse, en Italie et en France , La mise en carte des risques naturels, Diversit des approches, Montpellier : Presses Universitaires de la Mditerrane,  

E-Print Network [OSTI]

Peltier A., 2008, « La cartographie réglementaire des risques naturels en Suisse, en Italie et en (2008) 61-67" #12;Peltier A., 2008, « La cartographie réglementaire des risques naturels en Suisse, en

Paris-Sud XI, Université de

262

This paper was published in: V.Roberto et al. Eds., Proceedings of the 10th International Conference on Image Analysis and Processing, Venice, Italy, September 27-29, 1999, pp.142-147.  

E-Print Network [OSTI]

Conference on Image Analysis and Processing, Venice, Italy, September 27-29, 1999, pp.142-147. Comparison but differ in the value of a phase parameter, are combined, yielding the so-called Gabor-energy quantity

Petkov, Nicolai

263

Paper E-06, in: M. Pellei and A. Porta (Eds.), Remediation of Contaminated Sediments--2003. Proceedings of the Second International Conference on Remediation of Contaminated Sediments (Venice, Italy; 30 Sep3 Oct 2003). ISBN 1-57477-  

E-Print Network [OSTI]

. Proceedings of the Second International Conference on Remediation of Contaminated Sediments (Venice, Italy; 30 contamination problem at the U.S. Department of Energy (DOE) waste sites with the result that chromate is second

Matin, A.C.

264

AgriKomp GmbH | Open Energy Information  

Open Energy Info (EERE)

Germany Zip: D-91732 Product: A major German and international group specializing in biogas plants. Subdidiaries France, Italy, Czech Rep, Poland References: agriKomp GmbH1...

265

ISFNT-5, Rome, Sep. 1999 APEX Liquid Wall 1  

E-Print Network [OSTI]

and inconspicuously electrical conducting medium of molten salt Flibe, 2) a low Z material and more likely compatible be maintained throughout the reactor based on 3-D hydrodynamics calculations. However, being a low thermally reduction) of FW thermal stresses, the elimination of thick plasma facing armor materials, and a possibly

California at Los Angeles, University of

266

The Definition of Public Space in Republican Rome  

E-Print Network [OSTI]

public library, meaning that for its original audiences it would have had the characteristics of a private space

Russell, Amy

2011-01-01T23:59:59.000Z

267

Physiological Stress, Bone Growth and Development in Imperial Rome  

E-Print Network [OSTI]

Measures Short-Form D h OPD AOC " RC V f,r,t net V f,r,t MWTBurr et al. , (1990), while AOC, " RC, V f,r,t, and net V f,Robling and Stout, 2000). AOC AOC, or accumulated osteon

Beauchesne, Patrick Denis

2012-01-01T23:59:59.000Z

268

"SAPIENZA" UNIVERSITY OF ROME Academic Year 2008/2009  

E-Print Network [OSTI]

magister degree n. Class Name 1 LM -52 International Relations 2 LM -56 Economic Analysis of International Institutions 3 LM -62 Sciences of Politics 4 LM -63 Sciences of Public Administration 5 LM -90 European Studies LM -16 Advanced Finance and Insurance 2 LM -56 Economics and Institutions of European

Roma "La Sapienza", Università di

269

Physiological Stress, Bone Growth and Development in Imperial Rome  

E-Print Network [OSTI]

30-49 30-49 vs. 50+ Kruskal- Wallis 18-29 vs. N.S On.Ar (with age using Kruskal-Wallis tests. Sex differences forwere located. The Kruskal-Wallis test was utilized when

Beauchesne, Patrick Denis

2012-01-01T23:59:59.000Z

270

The Definition of Public Space in Republican Rome  

E-Print Network [OSTI]

caeco scelerata latebat in aere vivebatque anima deterioreout of dead bronze (caeco aere). But it is also falsa and a

Russell, Amy

2011-01-01T23:59:59.000Z

271

Physiological Stress, Bone Growth and Development in Imperial Rome  

E-Print Network [OSTI]

factors such as poor sanitation and thus disease (Storey,dangerous. Poverty, crime, poor sanitation and disease posedMartin, 1993) due to poor sanitation, or in this case, one

Beauchesne, Patrick Denis

2012-01-01T23:59:59.000Z

272

THE CRYOPLANT FOR THE ITER NEUTRAL BEAM TEST FACILITY TO BE BUILT AT RFX IN PADOVA, ITALY  

SciTech Connect (OSTI)

The Neutral Beam Test Facility (NBTF), planned to be constructed in Padua (Italy), will constitute the prototype of the two Neutral Beam Injectors (NBI), which will be installed in the ITER plant (Cadarache-France). The NBTF is composed of a 1 MV accelerator that can produce a 40 A deuteron pulsed neutral beam particles. The necessary vacuum needed in the accelerator is achieved by two large cryopumps, designed by FZK-Karlsruhe, with radiation shields cooled between 65 K and 90 K and with cryopanels cooled by 4 bar supercritical helium (ScHe) between 4.5 K and 6.5 K. A new cryoplant facility will be installed with two large helium refrigerators: a Shield Refrigerator (SR), whose cooling capacity is up to 30 kW between 65 K and 90 K, and a helium Main Refrigerator (MR), whose equivalent cooling capacity is up to 800 W at 4.5 K. The cooling of the cryopanels is obtained with two (ScHe) 30 g/s pumps (one redundant), working in a closed cycle around 4 bar producing a pressure head of 100 mbar. Two heat exchangers are immersed in a buffer dewar connected to the MR. The MR and SR different operation modes are described in the paper, as well as the new cryoplant installation.

Pengo, R. [INFN-LNL, Viale dell'Universita 2, I-35020 Legnaro, Padova (Italy); Fellin, F. [Consorzio RFX, 35127 Camin, Padova (Italy); Sonato, P. [Consorzio RFX, 35127 Camin, Padova (Italy); Dipartimento d'Ingegneria Elettrica dell'Universita' di Padova, 35100 Padova (Italy)

2010-04-09T23:59:59.000Z

273

Quantifying biomineralization of zinc in the Rio Naracauli (Sardinia, Italy), using a tracer injection and synoptic sampling  

Science Journals Connector (OSTI)

Abstract Streams draining mined areas throughout the world commonly have high concentrations of Zn. Because Zn is not easily removed from stream water and because it can be toxic to aquatic organisms, its presence is a persistent problem. The discovery of biomineralization of Zn-bearing solids in the mine drainage of Rio Naracauli, in Sardinia, Italy, provides insights into strategies for removing Zn and improving water quality in streams affected by mine drainage. Until now, the transport and attenuation of Zn has not been quantified in this stream setting. A continuous tracer injection experiment was conducted to quantify the biomineralization process and to identify the loading of constituents that causes a change from precipitation of hydrozincite [Zn5(CO3)2(OH)6] in the upstream reach to precipitation of a Zn-silicate phase downstream. Based on the mass-load calculations derived from the tracer experiment, about 1.2kg/day of Zn is sequestered in hydrozincite. This biomineralization represents nearly 90% removal of Zn. Other elements such as Pb and Cd also are sequestered, either in the hydrozincite, or in a separate phase that forms simultaneously. In the lower 600m of the stream, where the Zn-silicate forms, as much as 0.7kg/day Zn are sequestered in this solid, but additions of Zn to the stream from groundwater discharge lead to an overall increase in load in that portion of the Rio Naracauli.

G. De Giudici; R.B. Wanty; F. Podda; B.A. Kimball; P.L. Verplanck; P. Lattanzi; R. Cidu; D. Medas

2014-01-01T23:59:59.000Z

274

A Review of "Speaking of the Moor: From Alcazar to Othello" by Emily C. Bartels  

E-Print Network [OSTI]

, she assures us that ?the alienation of the Moor is not only not assumed; it is also not assured? (44). The book continues its exploration of Mediterranean multicul- turalism in the other three plays that notably take place in Europe, Italy... this thesis. ?Incorporate in Rome? studies how Aaron is integrated into Rome?s imperial household in Titus Andronicus, and ?Othello and the Moor of Venice? explores the ?of? in ?Moor of Venice.? Between each of the four chapters that critique the four plays...

Berthelemy, Anthony G.

2009-01-01T23:59:59.000Z

275

International Environmental Evaluation for the Helical Screw Expander Generator Unit Projects in Cesano, Italy and Broadlands, New Zealand  

SciTech Connect (OSTI)

The objectives of the Helical Screw Expander (HSE) Generator Program are (1) to accelerate the development of geothermal resources by introducing this advanced conversion technology, (2) to provide operating experience to prospective users of the equipment, and (3) to collect data on the performance and reliability of the equipment under various geothermal resource conditions. The participants hope to achieve these goals by testing a small-scale, transportable HSE generator at existing geothermal test facilities that produce fluids of different salinity, temperature and pressure conditions. This Environmental Evaluation has been prepared, using available information, to analyze the environmental consequences of testing the HSE generator. Its purpose is to support a decision on the need for a complete environmental review of the HSE program under the terms of Executive Order 121 14, ''Environmental Effects Abroad of Major federal Actions''. This Executive Order requires review of projects which involve the release of potentially toxic effluents that are strictly regulated in the United States, or which may have significant environmental effects on the global commons, on natural or ecological resources of international significance, or on the environment of non-participating countries. The final guidelines implementing the provisions of the Executive Order for DOE have been published. This evaluation deals with testing to be conducted at Cesano, Italy by the designated contractor of the Italian government, the Ente Narionale per l'Energia Ellectrica (ENEL), and at Broadlands, New Zealand by the Ministry of Works and Development of New Zealand. Testing at Cerro Prieto, Mexico has already been completed by the Comision Federal de Electricidad and is not evaluated in this report.

Webb, J.W.; Mezga, L.J.; Reed, A.W.

1981-08-01T23:59:59.000Z

276

Scholars from northeast Brazil, Costa Rica, southeast Mexico, Nicaragua, Italy, and the United States gathered for a think-tank international week April 18-22, 2011 to examine Latin America's equity-gap challenges using a community engagement  

E-Print Network [OSTI]

Scholars from northeast Brazil, Costa Rica, southeast Mexico, Nicaragua, Italy, and the United. The keynote address--Brazil's Unified Health System May Promote Social Inequality: Paradox or dialectic/northeastern Brazil constitute nadirs of economic and health inequality. The stunting rates among children

Liu, Taosheng

277

Contamination levels and congener distribution of PCDDs, \\{PCDFs\\} and dioxin-like \\{PCBs\\} in buffalos milk from Caserta province (Italy)  

Science Journals Connector (OSTI)

An extraordinary plan of official control was carried out in 2008 in Campania (Italy) with the aim to monitor polychlorinated dibenzo-p-dioxins (PCDDs), dibenzofurans (PCDFs) and dioxin-like polychlorinated biphenyls (dl-PCBs) levels in buffalo milk and to detect the contaminated farms, most of which are located in Caserta province. For these companies has been ordered seizure and execution of additional analyses has been requested in farms falling in the nearness, within a distance of 3km, for a total of 304 farms examined. Moreover, all non-compliant farms were subjected to a periodic sampling in order to monitor trends in the levels of contamination. In this paper the distribution and the concentrations of 17 PCDD/Fs and 12 dioxin-like \\{PCBs\\} in 460 samples of buffalo milk collected in the province of Caserta (Italy) are presented. The range of WHO-TEQ values for the PCDD/Fs in milk was 0.17pgTEQg?1fat and 87.0pgTEQg?1fat with a mean value 3.63pgTEQg?1fat and medium value 2.25pgTEQg?1fat. The concentrations of dioxin-like \\{PCBs\\} in the analysed samples ranged from 0.21pgTEQg?1fat to 15.9pgTEQg?1fat and the WHO-TEQ values of sum of PCDDs, \\{PCDFs\\} and dl-PCBs ranged from 0.45pgTEQg?1fat to 103.0pgTEQg?1fat. The geo-referencing analysis allowed to individuate a restricted area of the region object of the present study where is located the majority of the non-compliant farms. The study of the congeners distribution has finally suggested that the likely cause of contamination is to be attributed to the illegal burning of waste.

Mauro Esposito; Francesco Paolo Serpe; Frank Neugebauer; Stefania Cavallo; Pasquale Gallo; Germana Colarusso; Loredana Baldi; Giuseppe Iovane; Luigi Serpe

2010-01-01T23:59:59.000Z

278

Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills  

Open Energy Info (EERE)

Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills Volcano (Rome, Italy)- Geochemical Evidence Of Magmatic Degassing? Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills Volcano (Rome, Italy)- Geochemical Evidence Of Magmatic Degassing? Details Activities (0) Areas (0) Regions (0) Abstract: Recent studies suggested that Alban Hills (Rome) is a quiescent and not an extinct volcano, as it produced Holocene eruptions and several lahars until Roman times by water overflow from the Albano crater lake. Alban Hills are presently characterized by high PCO2 in groundwaters and by several cold gas emissions usually in sites where excavations removed the

279

INSTITUTE OF PHYSICS PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 45 (2005) 685693 doi:10.1088/0029-5515/45/7/018  

E-Print Network [OSTI]

INSTITUTE OF PHYSICS PUBLISHING and INTERNATIONAL ATOMIC ENERGY AGENCY NUCLEAR FUSION Nucl. Fusion 1 Associazione EURATOM-ENEA sulla Fusione, Centro Ricerche di Frascati, C.P. 65-00044 Frascati, Rome, Italy 2 Institute of Plasma Physics and Laser Microfusion, PO Box 49, PL-00-908, Warsaw, Poland Received

Vlad, Gregorio

280

Aquaculture: global status and trends  

Science Journals Connector (OSTI)

...the development of assessment tools. LCA is one of the key approaches, measuring...efficiency gains might be realized. While LCA provides a useful headline figure, it...paper no. 413. Rome, Italy: Food and Agriculture Organization of the United Nations. Barrington...

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

On energy and entropy influxes in the GreenNaghdi Type III theory of heat conduction  

Science Journals Connector (OSTI)

...1009 120 185 On energy and entropy influxes in the Green-Naghdi Type III...Rome, Italy The energy-influx/entropy-influx relation in the Green-Naghdi Type III...isotropic (that is, in Green-Naghdi's theory, when energy and entropy influxes...

2013-01-01T23:59:59.000Z

282

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June -1 July 2005 Tarragona (Spain) 1 Source Regulation of Fast Energetic  

E-Print Network [OSTI]

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005 Tarragona (Spain, Rome, Italy #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005, EPM, ...) #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005

Vlad, Gregorio

283

^ K1SO KepOR ISO. l* s* foto--*if  

E-Print Network [OSTI]

on the Reliability of Mechanical Components and Systems for Nuclear Reactor Safety Organized under the auspices Protection System S. Antocicco, G. Tenaglia, A. Valeri CNEN Rome Italy Reliability and Availability Analysis, California USA Structures Fracture Mechanics Approach to the Assessment of Reliability of Reactor Pressure

284

G. Vlad et al. Cadarache, France, Jan 10-11, 2006 -IMP-5 meeting 1 Magnetohydrodynamic  

E-Print Network [OSTI]

G. Vlad et al. Cadarache, France, Jan 10-11, 2006 - IMP-5 meeting 1 The Hybrid Magnetohydrodynamic.R. Frascati - C.P. 65 - I-00044 - Frascati, Rome, Italy #12;G. Vlad et al. Cadarache, France, Jan 10-11, 2006-plasma scenarios do not include the possibility of Alfvén mode - -particle interactions #12;G. Vlad et al

Vlad, Gregorio

285

ThermoSense: Occupancy Thermal Based Sensing for HVAC Control  

E-Print Network [OSTI]

ThermoSense: Occupancy Thermal Based Sensing for HVAC Control Alex Beltran Elect. Eng. & Comp Occupancy Sensing, Thermal Sensing, HVAC Control 1. INTRODUCTION From 1980 to 2010, energy in the United, November 13-14 2013, Rome, Italy. Copyright 2013 ACM 978-1-4503-2431-1/13/11 ...$15.00. (HVAC) consumed 42

Cerpa, Alberto E.

286

Neo-Latin News  

E-Print Network [OSTI]

lyric poetry from Greece to Rome; Celtis, Latin poetry from Italy to Germany). Bernhard Coppel (277-87) reads Celtis?s Carmen saeculare for the year 1500 as the ?Lied der Deutschen? in which the poet imitates several aspects of Horace?s Carmen saeculare...

Craig Kallendorf, et al

2003-01-01T23:59:59.000Z

287

Toward the next generation of air quality monitoring: Mercury Nicola Pirrone a,*, Wenche Aas b  

E-Print Network [OSTI]

, Elsie M. Sunderland f a CNR-Institute of Atmospheric Pollution Research, Rome, Italy b Norwegian Institute of Air Pollution, Kjeller, Norway c CNR-Institute of Atmospheric Pollution Research, Division of Engineering & Applied Sciences, Harvard University, Cambridge, MA, USA h i g h l i g h t s Atmospheric Hg

Sunderland, Elsie M.

288

IceCube Collaboration Contributions to ARENA 2008  

E-Print Network [OSTI]

Contributions of the IceCube Collaboration to the 3rd International Workshop on Acoustic and Radio EeV Neutrino detection Activities (ARENA 2008). The conference was held at Roma University "Sapienza," June 25-27, 2008, in Rome, Italy. This is an html index of the IceCube Collaboration contributions, with clickable links to the individual papers.

IceCube Collaboration

2008-11-15T23:59:59.000Z

289

Strategic use of the underground in an energy mix plan: Synergies among CO2, CH4 geological storage and geothermal energy. Latium Region case study (Central Italy)  

Science Journals Connector (OSTI)

Abstract In recent decades, the worldwide demand for energy has been increasing, with an associated rise in CO2 emissions being observed. In such conditions, the development of low carbon energy technologies and strategic energy-mix plans is necessary, and an evaluation of the underground energy potential may be a useful step in developing these plans. This evaluation involves the synergic development of such technologies as: coal combustion in combination with CO2 geological storage (CCS), natural gas geological storage (CH4-GS) and geothermal energy (GE), especially in densely populated countries, such as Italy. Currently, 13.7% of Italian energy demand is met by foreign providers. Most of the Italian regions have energy deficits, and the Latium Region (in Central Italy) represents one of those in the worst conditions. This work proposes a methodology to develop energy-mix scenarios, starting in Latium, to identify areas that are potentially suitable for CCS, CH4-GS and GE. Six geothermal systems and one CO2/CH4 storage potential area were identified. Three main scenarios are proposed: (A) a combination of CH4-GS with methane as cushion gas and GE; (B) a combination of CH4-GS with CO2 as cushion gas and GE; (C) a combination of CCS and GE. Scenario A results in a reduction of the regional energy deficit that ranges from 21.8% to 45.6%. In Scenario B, the regional energy deficit reduction ranges from 30.8% to 80.7% and the CO2 emissions reduction ranges from 1.4% to 5.6%, supposing an injection of 20years. Scenario C shows a decrease in the regional energy deficit that ranges from 15.9% to 22.1%, while the CO2 emissions reduction ranges from 7.1% to 31.3%, over the same time period. The proposed scenarios may be useful not only for the scientific community but also for policymakers as they identify the most reliable energetic strategies. Thus, this case study could be extended to the entire Italian territory with the ultimate goal of reaching energy autonomy in each region.

M. Procesi; B. Cantucci; M. Buttinelli; G. Armezzani; F. Quattrocchi; E. Boschi

2013-01-01T23:59:59.000Z

290

Serum levels of polychlorinated dibenzo-p-dioxins, polychlorinated dibenzofurans and polychlorinated biphenyls in a population living in the Naples area, southern Italy  

Science Journals Connector (OSTI)

Abstract The objective of this study was to estimate the levels of polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs) and polychlorinated biphenyls (DL-PCBs and NDL-PCBs) in blood serum obtained from non-occupationally exposed volunteers living in the Naples area (Campania Region, southern Italy). The samples were taken from two geographical zones: one was an urban area of Naples and its surroundings and the other was located in an area deemed to be at high environmental risk. Total mean concentrations of these persistent pollutants proved to be in the range 1.4317.38pgWHO-TEQ1998g?1 lipid for PCDD/Fs, and 0.9825.45pgWHO-TEQ1998g?1 lipid for DL-PCBs. NDL-PCBs were in the range 316.57482.90ngg?1 lipid. No significant differences were observed between women and men, nor between donors living in the two different areas. The mean levels of PCDD/Fs and \\{PCBs\\} in the population living in the Naples area were lower than those observed in some studies of populations living in exposed areas (near incineration plants or industrial sites) and urban or rural areas.

Mauro Esposito; Francesco Paolo Serpe; Gianfranco Diletti; Giovanni Messina; Giampiero Scortichini; Cinzia La Rocca; Loredana Baldi; Michele Amorena; Marcellino Monda

2014-01-01T23:59:59.000Z

291

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

292

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

293

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

294

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

295

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

296

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

297

A. Oumbe, Ph. Blanc, T. Ranchin, M. Schroedter-Homscheidt, L. Wald, 2009. A new method for estimating solar energy resource. In Proceedings of the ISRSE 33, held in Stresa, Italy, 4-9 May 2009. Published by Joint Research Center, Ispra,  

E-Print Network [OSTI]

for estimating solar energy resource. In Proceedings of the ISRSE 33, held in Stresa, Italy, 4-9 May 2009. Published by Joint Research Center, Ispra, USBKey, paper 773. A new method for estimating solar energy sources of energy should be better exploited to meet demand. Among them, solar energy offers a great

Paris-Sud XI, Université de

298

Originally from Venice, Italy Martina studied in Liverpool (UK) for her PhD in Nuclear Physics. In 2003 she started a post-doc at the Lawrence Berkeley National Laboratory, working on the development of gamma-ray tracking detectors for nuclear physics exp  

E-Print Network [OSTI]

Originally from Venice, Italy Martina studied in Liverpool (UK) for her PhD in Nuclear Physics of gamma-ray tracking detectors for nuclear physics experiments. Since May 2005, she is a postdoctoral and, the department! Martina Descovich PhD Education Ph.D. in Nuclear Physics (2003) University

Pouliot, Jean

299

Energy News | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

24, 2009 24, 2009 Secretary Chu Joins with World Leaders to Sign International Partnership for Energy Efficiency Cooperation The Department of Energy announced today that U.S. Energy Secretary Steven Chu joined with top energy leaders from around the world to launch the International Partnership for Energy Efficiency Cooperation (IPEEC). As part of the Group of 8 (G8) Energy Ministers Meeting in Rome this weekend, G8 members and other interested countries took steps to accelerate the implementation of energy efficient measures in their economies. May 23, 2009 U.S. and Italy Sign Agreement to Collaborate on Carbon Capture and Storage Technologies ROME, ITALY - U.S. Energy Secretary Steven Chu today joined with Italian Minister of Economic Development Claudio Scajola to sign a bilateral

300

The dolia and the sea-borne commerce of Imperial Rome  

E-Print Network [OSTI]

. . . . . . . . . Figure 14. Examples of stamps found on dolia from land excavations. Figure 15. Examples of stamps found on dolia from sea exca- vations. Figure 16. Plan of the Iillg ~ from Boscoreale "Pisanella: V. De Prisco" (MA, Campania). . . . . . . . . . 266...). Figure 35. Stamp on the shoulder of a dolium. 284 . 285 285 . 286 LIST OF FIGURES (CONTINUED) Pigure 36. Stamp on the lip of a dolium. Figure 37. Dolia dnfnnng with their lids in a nnlln Ninnnlg in Boscoreale (" Villa Regina", NA& Campania...

Brenni, Gianmarco Mario Raffaele

2012-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Forum on How to Feed the World in 2050, FAO, Rome Oct. 2009 Agriculture for Development  

E-Print Network [OSTI]

for development IV. Why the continued under-use of agriculture for development? V. Conditions for success

Sadoulet, Elisabeth

302

Empire of the Imagination: The Power of Public Fictions in Ovid's 'Reader Response' to Augustan Rome  

E-Print Network [OSTI]

in modum siderum vagari in aere et esse sic immortales. 87the choice of vagari in aere, rather than aether or 879) corresponds with the aere of Stoic glory. I refer to

Pandey, Nandini B.

2011-01-01T23:59:59.000Z

303

Empire of the Imagination: The Power of Public Fictions in Ovid's 'Reader Response' to Augustan Rome  

E-Print Network [OSTI]

1974. Water Carriers in Hades: A Study of Catharsis throughultimate punishment in Hades tends to confirm this negativewill eventually join them in Hades. The statement that none

Pandey, Nandini B.

2011-01-01T23:59:59.000Z

304

A review of "Privacy, Playreading, and Womens Closet Drama, 1550-1700." by Marta Straznicky  

E-Print Network [OSTI]

in Renaissance and Counter- Reformation Italy. Cambridge: Cambridge University Press, 2003. xvi + 437 pp. + 42 illus. $90.00. Review by THOMAS WORCESTER, COLLEGE OF THE HOLY CROSS. Vernacular chronicles of three convents form the basis of this study: Santa... Maria delle Vergini (Venice), known as Le Vergini; Santa Maria Annunziata (Florence), known as Le Murate; Santi Cosma e Damiano (Rome), known as San Cosimato. The chronicler of Le Vergini, a house of canonesses, was an anonymous member (or several...

Nancy M. Bunker

2005-01-01T23:59:59.000Z

305

A Review of "The Death of the Baroque and the Rhetoric of Good Taste" by Vernon Hyde Minor  

E-Print Network [OSTI]

Taste. Minor?s focus is eighteenth-century Italy, and in particular the Accademia degli Arcadi, a powerful group of elites who functioned as the tastemakers of settecento Rome. Employing the tools of post- modern critical theory, Minor investigates... to the experiential and sensory visions taught by Ignatius of 180 seventeenth-century news Loyola?s Spiritual Exercises, a text that exercised great influence on the art of seicento Italy. However, during a period in which Cartesian ratio- nality and Jansenism were...

Bentz, Katherine M.

2009-01-01T23:59:59.000Z

306

Estimation of radiation doses to members of the public in Italy from intakes of some important naturally occurring radionuclides (238U, 234U, 235U, 226Ra, 228Ra, 224Ra and 210Po) in drinking water  

Science Journals Connector (OSTI)

The radiological quality in some samples of drinking water collected in Italy has been evaluated in the paper. As far as the measured ? or ? radionuclides are concerned, the doses for all the analysed samples of drinking water are in the range of 1.8036.2?Svyr?1, all being well below the reference level of the committed effective dose (100?Svyr?1) recommended by the WHO. As far as each measured ? or ? radionuclide is concerned, the dose contributions for most of the analysed water samples are in this order: 210Po>228Ra>226Ra>234U>238U>224Ra>235U, and 210Po and 228Ra can yield a significant contribution to the doses from the analysed drinking water samples. As far as the elements are concerned, the dose contributions are 48.027.9% from radium, 31.723.1% from polonium, and 20.314.1% from uranium. The water samples, No. 2, 7, 13, and 15, can lead to a dose of >10?Svyr?1, mainly due to the dose contribution from 210Po and 228Ra, especially water samples No. 2 and 13. The obtained data can provide basic information for consumers and competent authorities regarding the internal exposure risk due to drinking water intake, and can possibly serve as a comparison when evaluating the dose contribution from artificial radionuclides released to the environment as a result of any human practices and accidents in the studied area.

Guogang Jia; Giancarlo Torri

2007-01-01T23:59:59.000Z

307

Environmental Cleanup | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

May 23, 2009 May 23, 2009 U.S. and Italy Sign Agreement to Collaborate on Carbon Capture and Storage Technologies ROME, ITALY - U.S. Energy Secretary Steven Chu today joined with Italian Minister of Economic Development Claudio Scajola to sign a bilateral agreement to advance carbon capture and storage (CCS) technologies in each country. Working together, the U.S. and Italy will further the development of technologies needed to limit carbon dioxide emissions from coal-fired powered plants and move toward a sustainable low carbon economy that addresses the challenge of global warming. May 15, 2009 Secretary Chu Announces $2.4 billion in Funding for Carbon Capture and Storage Projects Funds to Advance Research, Development and Deployment of Carbon Capture and Storage Technologies and Infrastructure

308

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

309

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

310

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

311

Braudels Mediterranean and Italy  

E-Print Network [OSTI]

della Sera, morto a Parigi, a 83 anni, il maestro delle totale; Si spento a Parigi ad 83 anni il pi prestigiosodel cielo; morto a Parigi a 83 anni lo storico Fernand

Marino, John A.

2010-01-01T23:59:59.000Z

312

The Utilisation of Volcanic Steam in Italy  

Science Journals Connector (OSTI)

... exploitation of natural resources; and the welkin is still ringing with cries of increase production,back to the land, and keep the home-fires burning. Examples ... definite and successful effort been made in this direction, namely, by utilising the natural steam which emerges from the earth in volcanic districts. The jets of ...

1924-01-12T23:59:59.000Z

313

John Ray in Italy: lost manuscripts rediscovered  

Science Journals Connector (OSTI)

...was an old borgo, others the praetorian camp. A slight shot or two beyond is the foundation...cabinets of the sixteenth- and seventeenth centuries, in The origins of museums (ed. Oliver...Marcello Malpighi and seventeenth-century anatomy (Johns Hopkins Press, Baltimore...

2014-01-01T23:59:59.000Z

314

Financing future power generation in Italy  

SciTech Connect (OSTI)

Under Italian law, independent power generation fueled by renewable and so-called ``assimilated'' sources must be given incentives. To implement this provision, a resolution known as ``CIP 6'' and a decree setting forth the procedure to sell such electricity to ENEL were issued. CIP 6 has recently been revoked and new incentives have been announced. In the meantime, CIP 6 continues to apply to various projects which have been approved but not yet constructed.

Esposito, P.

1998-07-01T23:59:59.000Z

315

John Ray in Italy: lost manuscripts rediscovered  

Science Journals Connector (OSTI)

...discovered manuscripts but also throw light on the way in which Ray's...other edibles. /p. 25/ About Christmas time it is the fashion all over...all the feathers are of a light crimson very pleasant colour...the two men or it may throw light on the nature of the tours that...

2014-01-01T23:59:59.000Z

316

A refined biomonitoring study of airborne particulate matter pollution in Rome, with magnetic measurements on Quercus Ilex tree leaves  

Science Journals Connector (OSTI)

......in cities both in space and time. We report...industry, domestic heating or vehicles, as...such as building constructions or natural fires...developed an industrial sector and it has little...favoured domestic heating or long-range...holder during the heating run. In this study......

Michael Sznyi; Leonardo Sagnotti; Ann M. Hirt

2008-04-01T23:59:59.000Z

317

Identifying acoustical coupling by measurements and prediction-models for St. Peters Basilica in Rome  

Science Journals Connector (OSTI)

St. Peters Basilica is one of the largest buildings in the world having a huge volume resulting from the addition of different parts. Consequently sound propagation cannot be interpreted using a conventional approach and requires experimental measures to be compared with statistical-acoustics and geometrical predictions in order to explain the interplay between shape materials and sound waves better. In previous research one of the most evident effects the surprisingly low reverberation time was believed to result from acoustical coupling phenomena. Taking advantage of more refined measuring techniques available today an acoustic survey was carried out and the results were analyzed using different methods including Bayesian parameter estimation of multiple slope decays and directional energy plots which showed that coupling effects actually take place even though measured reverberation times were longer than those given in previous studies. In addition experimental results were compared with geometrical- and statistical-acoustic models of the basilica which showed that careful selection of input data and in statistical models the inclusion of phenomena such as direct sound radiation and non-diffuse energy transfer allow obtaining accurate results. Finally both models demonstrated that reduced reverberation depends more on increased absorption of decorated surfaces than on coupling effects.

Francesco Martellotta

2009-01-01T23:59:59.000Z

318

A refined biomonitoring study of airborne particulate matter pollution in Rome, with magnetic measurements on Quercus Ilex tree leaves  

Science Journals Connector (OSTI)

......delineate spatial airborne anthropogenic PM...the PM magnetic fraction which can then be...constructions or natural fires. This study has...particles in the airborne PM by means of standard...idling cars do not release an equally high...of the magnetic fraction. In this study......

Michael Sznyi; Leonardo Sagnotti; Ann M. Hirt

2008-04-01T23:59:59.000Z

319

Multilingual Practices of Senegalese Immigrants in Paris and Rome: A Comparative Study of Language Use and Identity Construction  

E-Print Network [OSTI]

seen as representing a fracture linguistique (Goudailliergoes on to show that this fracture linguistique therefore

Smith, Maya Angela

2013-01-01T23:59:59.000Z

320

A refined biomonitoring study of airborne particulate matter pollution in Rome, with magnetic measurements on Quercus Ilex tree leaves  

Science Journals Connector (OSTI)

......distance from fossil fuel power stations...quantification of pollution in Kathmandu...screening of a pollution hotspot in the...quantification of urban pollution sources in atmospheric...Biomonitoring of air quality in Cologne...spinel solid solutions, Phys. Chem......

Michael Sznyi; Leonardo Sagnotti; Ann M. Hirt

2008-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

A review of "Court and Politics in Papal Rome." by Gianvittorio Signorotto and Maria A. Visceglia, eds.  

E-Print Network [OSTI]

accomplishments. Scaglia, Osborne notes, did not always work towards obvious goals. Instead, he operated within a developing political culture that prized contacts, friendships, and artistic patronage. Osborne, in this last instance, makes much of the fact...

Erminia Ardissino

2003-01-01T23:59:59.000Z

322

A refined biomonitoring study of airborne particulate matter pollution in Rome, with magnetic measurements on Quercus Ilex tree leaves  

Science Journals Connector (OSTI)

......causes adverse effects to human health. Specific magnetic susceptibility...proposing guidelines concerning human health and the exposure of the population...iron-bearing magnetic PM is dangerous to the human health due to its aggressively reacting......

Michael Sznyi; Leonardo Sagnotti; Ann M. Hirt

2008-04-01T23:59:59.000Z

323

Den Haag Brussel Londen Parijs Berlijn Stockholm Helsinki Rome Singapore Tokio Peking Seoel New Delhi Washington Silicon Valley  

E-Print Network [OSTI]

- 23-2-2009 Inleiding Lichter en veiliger: het zijn twee trends binnen de robotica die samenkomen industriële robotica beheerst door de grote industriegiganten, waaronder de Duitse bedrijven Kuka en Reiss. Alleen een volledig nieuwe benadering van de robotica kan leiden tot een innovatieve technologie

Stryk, Oskar von

324

Synergic and conflicting issues in planning underground use to produce energy in densely populated countries, as Italy: Geological storage of CO2, natural gas, geothermics and nuclear waste disposal  

Science Journals Connector (OSTI)

In densely populated countries there is a growing and compelling need to use underground for different and possibly coexisting technologies to produce low carbon energy. These technologies include (i) clean coal combustion merged with CO2 Capture and Storage (CCS); (ii) last-generation nuclear power or, in any case, safe nuclear wastes disposal, both temporary and geological somewhere in Europe (at least in one site): Nuclear wastes are not necessarily associated to nuclear power plants; (iii) safe natural gas (CH4) reserves to allow consumption also when the foreign pipelines are less available or not available for geopolitical reasons and (iv) low-space-consuming renewables in terms of Energy Density Potential in Land (EDPL measured in [GWh/ha/year]) as geothermics. When geothermics is exploited as low enthalpy technology, the heat/cool production could be associated, where possible, to increased measures of building efficiency, low seismic risks building reworking and low-enthalpy heat managing. This is undispensable to build up smart cities. In any case the underground geological knowledge is prerequisite. All these technologies have been already proposed and defined by the International Energy Agency (IEA) Road Map 2009 as priorities for worldwide security: all need to use underground in a rational and safe manner. The underground is not renewable in most of case histories [10,11]. IEA recently matched and compared different technologies in a unique Clean Energy Economy improved document (Paris, November 1617, 2011), by the contribution of this vision too (see reference). In concert with energy efficiency improvement both for plants and buildings, in the frame of the smart cities scenarios, and the upstanding use of energy savings, the energetic planning on regional scale where these cities are located, are strategic for the year 2050: this planning is strongly depending by the underground availability and typology. Therefore, if both literature and European Policy are going fast to improve the concept of smart cities this paper stresses the concept of smart regions, more strategic than smart cities, passing throughout a discussion on the synergic and conflicting use of underground to produce energy for the smart regions as a whole. The paper highlights the research lines which are urgent to plan the soundest energy mix for each region by considering the underground performances case by case: a worldwide mapping, by GIS tools of this kind of information could be strategic for all the world energy management authorities, up to ONU, with its Intergovernmental Panel on Climate Change (IPCC), the G20, the Carbon Sequestration Leadership Forum (CSLF) and the European Platforms such as the Zero Emissions Fossil Fuel Power Plants (EU-ZEP Platform), the Steel Platform, the Biomass Platform too. All of these organizations agree on the need for synergistic and coexistent uses of underground for geological storage of CO2, CH4, nuclear waste and geothermic exploitation. The paper is therefore a discussion of the tools, methods and approaches to these underground affecting technologies, after a gross view of the different uses of underground to produce energy for each use, with their main critical issues (i.e. public acceptance in different cases). The paper gives some gross evaluation for the Lazio Region and some hints from the Campania Region, located in Central Italy. Energy Density Potential in Land (EDPL), is calculated for each renewable energy technology (solar, wind, geothermal) highlighting the potentiality of the last. Why the Italian case history among the densely populated countries? on the Italian territory is hard to find suitable areas (mostly if greenfields) to use the own underground, with respect to other European countries, due to the presence of seismotectonic activity and many faulted areas characterized by Diffuse Degassing Structures (DDSs, which are rich in CO2 and CH4). In this cases, public acceptan

Fedora Quattrocchi; Enzo Boschi; Angelo Spena; Mauro Buttinelli; Barbara Cantucci; Monia Procesi

2013-01-01T23:59:59.000Z

325

Refinery Furnaces Retrofit with Gas Turbines Achieve Both Energy Savings and Emission Reductions  

E-Print Network [OSTI]

A., Rome, Italy ABSTRACT Integrating gas turbines with refinery furnaces can be a cost effective means of reducing NO emissions while also generating electricity ~t an attractive heat rate. Design considerations and system costs are presented..., described in Figure 1, 2. The combustion oxygen is carried by a more I I i I' has been used as a design basis. The heater is based on the actual design of a unit built by KTI SpA. The furnace does not include air preheater or steam generation...

Giacobbe, F.; Iaquaniello, G.; Minet, R. G.; Pietrogrande, P.

326

El Ma Electronic Machining srl | Open Energy Information  

Open Energy Info (EERE)

Ma Electronic Machining srl Ma Electronic Machining srl Jump to: navigation, search Name El.Ma. Electronic Machining srl Place Riva del Garda (TN), Italy Zip 38066 Sector Hydro, Hydrogen, Solar, Wind energy Product String representation "Italy-based, in ... solar sectors." is too long. References El.Ma. Electronic Machining srl[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. El.Ma. Electronic Machining srl is a company located in Riva del Garda (TN), Italy . References ↑ "El.Ma. Electronic Machining srl" Retrieved from "http://en.openei.org/w/index.php?title=El_Ma_Electronic_Machining_srl&oldid=344591" Categories: Clean Energy Organizations Companies Organizations

327

Archimede Solar Energy Srl | Open Energy Information  

Open Energy Info (EERE)

Archimede Solar Energy Srl Archimede Solar Energy Srl Jump to: navigation, search Name Archimede Solar Energy Srl Place Massa Martana, Italy Zip 6056 Sector Solar Product Italy-based producer of receiver tubes for thermodynamic solar power plants. References Archimede Solar Energy Srl[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Archimede Solar Energy Srl is a company located in Massa Martana, Italy . References ↑ "Archimede Solar Energy Srl" Retrieved from "http://en.openei.org/w/index.php?title=Archimede_Solar_Energy_Srl&oldid=342289" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version

328

Stea Divisione Energia Solare | Open Energy Information  

Open Energy Info (EERE)

Stea Divisione Energia Solare Stea Divisione Energia Solare Jump to: navigation, search Name Stea Divisione Energia Solare Place Italy Zip 70125 Sector Services, Solar Product Italy-based company present alternative energy, offering engineering services, marketing and installation of solar PV and solar thermal projects. References Stea Divisione Energia Solare[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Stea Divisione Energia Solare is a company located in Italy . References ↑ "Stea Divisione Energia Solare" Retrieved from "http://en.openei.org/w/index.php?title=Stea_Divisione_Energia_Solare&oldid=351695" Categories: Clean Energy Organizations Companies Organizations

329

Estelux Srl | Open Energy Information  

Open Energy Info (EERE)

Estelux Srl Estelux Srl Jump to: navigation, search Name Estelux Srl Place San Pietro in Gù, Italy Zip 35010 Sector Solar Product Estelux plans to build Italys first solar-grade polysilicon plant, using an updated version of the Siemens technology. References Estelux Srl[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Estelux Srl is a company located in San Pietro in Gù, Italy . References ↑ "[ Estelux Srl]" Retrieved from "http://en.openei.org/w/index.php?title=Estelux_Srl&oldid=345149" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties

330

Final_Tech_Session_Schedule_and_Location.xls  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sequestration through reforestation projects in China and Argentina: a multiple benefit sequestration through reforestation projects in China and Argentina: a multiple benefit approach Lucia Perugini ∗ ; Riccardo Valentini ∇ ; Antonio Lumicisi + *∇ University of Tuscia, Department of Forest Science and Environment ,Via San Camillo de Lellis snc, 01100 Viterbo, Italy + Ministry for the Environment and Territory, Department for Environmental Research and Development, Via Cristoforo Colombo, 44 - 00147 Rome - Italy Introduction Each of the Conferences of the Parties (COP) to the Rio Conventions - the Convention on Biological Diversity (CBD), the United Nations Conventions to Combat Desertification (UNCCD) and the United Nations Framework Convention on Climate Change (UNFCCC) - has underlined the need for enhanced collaboration among the conventions. For example, the UNFCCC COP has affirmed that there is a need for

331

Emobility (Smart Grid Project) | Open Energy Information  

Open Energy Info (EERE)

Emobility Emobility Country Italy Headquarters Location Rome, Italy Coordinates 41.959492°, 12.260742° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.959492,"lon":12.260742,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

332

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

333

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

334

Mascoma Corporation | Open Energy Information  

Open Energy Info (EERE)

Corporation Corporation Jump to: navigation, search Name Mascoma Corporation Address 679 Ellsworth Road Place Rome, New York Zip 13441 Sector Biofuels Product Producer of biofuels from lignocellulosic biomass using microorganisms and enzymes Website http://www.mascoma.com/ Coordinates 43.2182876°, -75.4105147° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.2182876,"lon":-75.4105147,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

335

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

336

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

337

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

338

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

339

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

340

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

342

Public health assessment for Griffiss Air Force Base, Rome, Oneida County, New York, Region 2. Cerclis No. NY4571924451. Addendum. Final report  

SciTech Connect (OSTI)

The public health assessment addendum addresses the two public health issues identified at Griffiss Air Force Base by the Agency for Toxic Substances and Disease Registry (ATSDR): (1) exposures to contaminated fish from Three Mile and Six Mile Creeks, and (2) past exposures to contaminated groundwater through private wells off base. Frequent consumption of contaminated fish from Three Mile and Six Mile Creeks could pose a health problem. However, if NYSDOH fish consumption guidelines are followed, fish consumption should not present a public health hazard. ATSDR cannot evaluate exposures to contaminated groundwater through private well use prior to 1982 because there are no sampling data.

NONE

1996-09-09T23:59:59.000Z

343

(1) Studies on Malaria (2) La dcouverte de la transmission du paludisme par les moustiques (3) Letters from Rome on certain Discoveries connected with Malaria  

Science Journals Connector (OSTI)

... (1) SIR RONALD ROSS has prepared this summarised and readable account of his work on malaria for the ... work of Laveran and Golgi are briefly reviewed, and in the second and third Sir Ronald describes the difficult conditions under which his observations on the development of the parasites of ...

1929-12-28T23:59:59.000Z

344

9REN Pangea Green Energy JV | Open Energy Information  

Open Energy Info (EERE)

Pangea Green Energy JV Pangea Green Energy JV Jump to: navigation, search Name 9REN & Pangea Green Energy JV Place Torino, Italy Zip 10128 Product Italy-based developer of PV projects in the Sicily and Puglia regions. Coordinates 45.069512°, 7.705403° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.069512,"lon":7.705403,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

345

Eos Energia | Open Energy Information  

Open Energy Info (EERE)

Eos Energia Eos Energia Place Bologna, Italy Zip 40133 Sector Solar Product Italy-based solar project design and construction company. Coordinates 44.50483°, 11.345169° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.50483,"lon":11.345169,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

346

Fabbrica Trentina Conduttori Srl FCT | Open Energy Information  

Open Energy Info (EERE)

Trentina Conduttori Srl FCT Trentina Conduttori Srl FCT Jump to: navigation, search Name Fabbrica Trentina Conduttori Srl (FCT) Place Rovereto, Italy Zip 68068 Sector Solar Product Italy-based producer of security cables for alarm systems. The firm also provides solar cables and PV junction boxes. Coordinates 45.88481°, 11.04317° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.88481,"lon":11.04317,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

347

Infrastrutture S p A | Open Energy Information  

Open Energy Info (EERE)

Infrastrutture S p A Infrastrutture S p A Jump to: navigation, search Name Infrastrutture S.p.A Place Milano, Italy Zip I-20123 Sector Solar, Wind energy Product Milan-based developer of wind and solar projects in Italy. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

348

Multi GreenPower Spa | Open Energy Information  

Open Energy Info (EERE)

GreenPower Spa GreenPower Spa Jump to: navigation, search Name Multi GreenPower Spa Place Verona, Italy Zip 37135 Sector Solar Product Italy-based solar installation, construction and project development firm. Coordinates 45.438113°, 10.991505° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.438113,"lon":10.991505,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

349

IMAT SpA | Open Energy Information  

Open Energy Info (EERE)

IMAT SpA IMAT SpA Jump to: navigation, search Name IMAT SpA Place Fontanafredda, Italy Zip 33074 Sector Renewable Energy, Solar Product Italy-based company specializing in manufacturing of components for household refrigeration. Their main renewable energy focus is solar power. Coordinates 45.971831°, 12.571475° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.971831,"lon":12.571475,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

350

REN Electron srl formerly FIMI Group srl | Open Energy Information  

Open Energy Info (EERE)

Electron srl formerly FIMI Group srl Electron srl formerly FIMI Group srl Jump to: navigation, search Name REN Electron srl (formerly FIMI Group srl) Place Carugate (MI), Italy Zip 20061 Sector Solar Product Italian solar installers. References REN Electron srl (formerly FIMI Group srl)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. REN Electron srl (formerly FIMI Group srl) is a company located in Carugate (MI), Italy . References ↑ "[ REN Electron srl (formerly FIMI Group srl)]" Retrieved from "http://en.openei.org/w/index.php?title=REN_Electron_srl_formerly_FIMI_Group_srl&oldid=350281" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes

351

Resolar | Open Energy Information  

Open Energy Info (EERE)

Resolar Resolar Jump to: navigation, search Name Resolar Place Milan, Italy Zip 20121 Sector Solar Product Project developer of solar projects in Italy and other Mediterranean countries. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

352

Ghella Spa | Open Energy Information  

Open Energy Info (EERE)

Ghella Spa Ghella Spa Jump to: navigation, search Name Ghella Spa Place Roma, Italy Zip 196 Sector Solar Product Italian construction company. Ghella , through a JV with Spanish project developer Gransolar, develops PV projects in Italy. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

353

Nuova Thermosolar Srl | Open Energy Information  

Open Energy Info (EERE)

Nuova Thermosolar Srl Nuova Thermosolar Srl Jump to: navigation, search Name Nuova Thermosolar Srl Place Formigine, Italy Zip 41043 Sector Solar Product Italy-based solar system construction and installation company. Coordinates 44.57216°, 10.847985° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.57216,"lon":10.847985,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

354

Fedi Impianti | Open Energy Information  

Open Energy Info (EERE)

Fedi Impianti Fedi Impianti Jump to: navigation, search Name Fedi Impianti Place Firenze, Italy Zip 50127 Sector Solar Product Italy-based solar inverter distributor for Power-One, Sharp and Mitsubishi. The firm is also involved in PV project construction. Coordinates 43.78237°, 11.254995° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.78237,"lon":11.254995,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

355

Reflex Spa | Open Energy Information  

Open Energy Info (EERE)

Reflex Spa Reflex Spa Jump to: navigation, search Name Reflex Spa Place Treviso, Italy Zip 31030 Sector Solar Product Italy-based company specializing in crystal industrial technology. The company is actively involved in the solar power sector. Coordinates 45.66631°, 12.24204° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.66631,"lon":12.24204,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

356

Contemporary Italian Novels on Chinese Immigration to Italy  

E-Print Network [OSTI]

Durante i cinque anni in cui ho studiato a Parigi,Parigi mi ha detto che dovevo vivere in modo romantico, con

Zhang, Gaoheng

2013-01-01T23:59:59.000Z

357

The Royal Society and post-Galilean Science in Italy  

Science Journals Connector (OSTI)

...Catholic Church imposed on scientific liberty. The spread of new ideas in the Italian...structure that represented the ideal of liberty and scientific progress, and where the...to natural history within the Baconian project encouraged many Italians to send their...

1997-01-01T23:59:59.000Z

358

Recent Sea-Level Variations in Japan and Italy1  

Science Journals Connector (OSTI)

... few cases from 1894) to 1910, referred to in a note in NATURE of December 26, 1912 (vol. xc., p. 471). They are greatly in excess of ...

C. D.

1913-06-19T23:59:59.000Z

359

Impact to public and environment of NORM industries in Italy  

Science Journals Connector (OSTI)

......refractory materials production, (d) rare earths processing, (e) thorium compounds...210Po 232Th 40K SI Fertilisers industry Phosphogypsum n.a. 1300-4000 n.a. n.a...assisting the Environment Ministry for phosphogypsum disposal site remediation programmes......

F. Trotti; F. Liziero; C. Zampieri; S. De Zolt

2009-12-01T23:59:59.000Z

360

Giardia Cysts in Wastewater Treatment Plants in Italy  

Science Journals Connector (OSTI)

...global level. The recycling of treated wastewaters...investigation in four wastewater treatment plants in...Giardia cysts in wastewater treatment plants in...global level. The recycling of treated wastewaters...investigation in four wastewater treatment plants in...

Simone M. Cacci; Marzia De Giacomo; Francesca A. Aulicino; Edoardo Pozio

2003-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Strain rate relaxation of normal and thrust faults in Italy  

Science Journals Connector (OSTI)

......P. Effect of viscoelastic postseismic relaxation on estimates of interseismic crustal strain accumulation at Yucca Mountain, Nevada. Geophys. Res. Lett. (2010) 37:L06307. doi:10.1029/2010GL042795. Hetland E.A. , Hager......

Federica Riguzzi; Mattia Crespi; Roberto Devoti; Carlo Doglioni; Grazia Pietrantonio; Anna Rita Pisani

2013-01-01T23:59:59.000Z

362

greece and italy An Artistic and Literary Odyssey  

E-Print Network [OSTI]

: the Bronze Age Aegean kingdoms, Archaic and Classical Greece, pre-Roman Etruria, the early Roman Empire Italian; others, drawing. In the winter ("Renaissance") we focus on the Roman appropriation of Greek art

363

Italy Nuclear Security Summit: Fact Sheet | National Nuclear...  

National Nuclear Security Administration (NNSA)

Nuclear Security Summit: Fact Sheet | National Nuclear Security Administration People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency...

364

A typological assessment of Iron Age weapons in South Italy.  

E-Print Network [OSTI]

??Master of Philosophy (MPhil)%%%Typologies, especially of spearheads, have been decried as inadequate by the archaeological community. They have prevented the synthetic study of ancient weapons (more)

Inall, Yvonne Louise

2009-01-01T23:59:59.000Z

365

Structure and deformation mechanisms along the Tonale Line, n. Italy  

E-Print Network [OSTI]

foliation in the host rocks. Subsidiary fracture and fault data within the brittle fault zone are approximately correlated with the Riedel and associated shear array. The host rock anisotropy probably acted as a pre-existing set of weakness planes... that promoted the propagation of subsidiary fractures along these planes into the main fault zone. ACKNOWLEDGEMENTS I would like to thank my advisory committee: Drs. John M. Logan (Chairman), Melvin Friedman, David W. Mohr, and Stefan Schmid (ETH-ZDrich). I...

Welker, Mary Clare

2012-06-07T23:59:59.000Z

366

Transformed materials : a material research center in Milan, Italy  

E-Print Network [OSTI]

[Transformed Materials] is an exploration into today's design methodologies of architecture production. The emergence of architectural form is questioned in relation to the temporal state of design intent and the physical ...

Skerry, Nathaniel S. (Nathaniel Standish), 1971-

2002-01-01T23:59:59.000Z

367

Dietary Folate and Risk of Prostate Cancer in Italy  

Science Journals Connector (OSTI)

...also made for nonalcohol energy intake, using the residual...vitamin B6 intake were energy adjusted using the residual method. The measurement unit was set at 1 SD of the...cancer, and nonalcohol energy intake. The reference...

Claudio Pelucchi; Carlotta Galeone; Renato Talamini; Eva Negri; Maria Parpinel; Silvia Franceschi; Maurizio Montella; and Carlo La Vecchia

2005-04-01T23:59:59.000Z

368

Scandium minerals in the miaroles of granite at Baveno, Italy  

Science Journals Connector (OSTI)

...be a scandium equivalent of babingtonite (scandiobabingtonite, Ca2FeScSi5O14...complete series ranging from pure babingtonite to scandiobabingtonite, confirming...pale coloured crystals of babingtonite (which is usually black...restrictions have necessitated the use of EDS-equipped scanning...

Carlo Maria GRAMACCIOLI; Italo CAMPOSTRINI; Paolo ORLANDI

369

SEEP2010 Conference Proceedings, June 29th , Bari, ITALY  

E-Print Network [OSTI]

.poggi@polito.it, pierluigi.claps@polito.it) Abstract: In this study we focus on energy production by micro-hydro plants (MHPs renovation. Keywords: Micro-hydro, hydroelectric potential, water distribution systems, measure of financial, the possibility of energy production from micro-hydro systems takes a role of main interest. In this paper we

Poggi, Davide

370

Report of GWC participation at Torino, Italy 2 Meeting of MatER (WTERT-Italy), 12-14 September  

E-Print Network [OSTI]

of mercury & Dioxins (on volunteer base). The gate fees of WTE plants are in the range of 50 -110 /ton

371

Proceedings of the 29th National Heat Transfer Conference of Italy, Politecnico di Torino, Torino, Italy, June 2022, 2011 INTRODUCTION  

E-Print Network [OSTI]

trends are known, no information about the local heat transfer coefficient in the evaporator U.D.) has been brazed on the main tube of the condenser section in order to connect the vacuum/filling valve transducer 20 Copper fitting FLOW PATTERNS AND CORRESPONDING LOCAL HEAT TRANSFER COEFFICIENTS IN A PULSATING

Khandekar, Sameer

372

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

373

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

374

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

375

Theory Seminar Schedule  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

6-2007 6-2007 Click on a title to read an abstract, if available (underlined). 10 July 2007 Special Day: Tuesday, 3:00pm Robert Wiringa Argonne National Laboratory wiringa@theory.phy.anl.gov Dependence of nuclear binding on hadronic mass variation 3 July 2007 Special Day and Time: Tuesday, 10:30am Renato Higa University of Bonn, Germany higa@itkp.uni-bonn.de Coulomb interactions within Halo EFT 5 June 2007 Special Day and Time: Tuesday, 10.30am Omar Benhar Istituto Nazionale di Fisica Nucleare, Rome, Italy benhar@roma1.infn.it The equation of state of neutron star matter and gravitational wave emission 29 May 2007 Special Day: Tuesday Ulrich Mosel Giessen University, Germany Ulrich.Mosel@theo.physik.uni-giessen.de Hadrons in Medium - Theory meets experiment 10 May 2007

376

Inspection Report: IG-0592 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

2 2 Inspection Report: IG-0592 March 1, 2003 Actions Taken in Response to Missing Hazardous Waste Containing Cyanide Recently, the U.S. Government has become increasingly sensitive to the potential for terrorists to use certain materials as weapons of mass destruction. A report completed by the Central Intelligence Agency stated that "The threat from terrorists using a weapon of mass destruction has increased since Sept. 11, and extremist groups appear most interested in chemicals like cyanide." For example, in February 2002, four suspected terrorists were arrested in Italy in possession of cyanide and maps of Rome pinpointing the U.S. Embassy and the city's drinking water network. Inspection Report: IG-0592 More Documents & Publications Semiannual Report to Congress: October 1, 2002 - March 31, 2003

377

Energia Servizi Engineering SpA E S Engineering | Open Energy Information  

Open Energy Info (EERE)

Servizi Engineering SpA E S Engineering Servizi Engineering SpA E S Engineering Jump to: navigation, search Name Energia & Servizi Engineering SpA (E&S Engineering) Place Rome, Italy Sector Hydro, Wind energy Product Italian developer of biogas, wind, mini-hydro and PV projects. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

378

Modula Spa | Open Energy Information  

Open Energy Info (EERE)

Modula Spa Modula Spa Jump to: navigation, search Name Modula Spa Place Rome, Italy Product Italian electricity wholesaler. Coordinates 41.90311°, 12.49576° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.90311,"lon":12.49576,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

379

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

11 - 21420 of 31,917 results. 11 - 21420 of 31,917 results. Article U.S and Russia Develop Action Plan to Enhance Global and Bilateral Nuclear Energy Cooperation WASHINGTON, DC - U.S. Secretary of Energy Samuel W. Bodman and Russian Federal Atomic Energy Agency (Rosatom) Director Sergey V. Kiriyenko last week submitted to U.S. President George W. Bush and... http://energy.gov/articles/us-and-russia-develop-action-plan-enhance-global-and-bilateral-nuclear-energy-cooperation Article U.S. Energy Secretary Highlights Need for Energy Diversity at 20th World Energy Congress Ministerial Forum in Rome Welcomes Italy as 17th Nation to Join Global Nuclear Energy Partnership http://energy.gov/articles/us-energy-secretary-highlights-need-energy-diversity-20th-world-energy-congress-ministerial

380

Also a Centennial Year for Ernest Orlando Lawrence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Also a Centennial Year for Ernest Orlando Lawrence Also a Centennial Year for Ernest Orlando Lawrence Ernest Orlando Lawrence was the founder of Lawrence Berkeley and Lawrence Livermore national laboratories and the winner of the 1939 Nobel Prize for Physics for his invention of the cyclotron. He would have been 100 years old on August 8, 2001. Ernest Lawrence and Enrico Fermi Ernest Lawrence and Enrico Fermi December 17-Ernest O. Lawrence and Enrico Fermi seemed to live parallel lives. They were born only a month apart, though an ocean away-Lawrence in South Dakota and Fermi in Rome, Italy. Both Lawrence and Fermi became interested in physics at an early age; both won Nobel Prizes only a year apart for work related to the discovery of radioactive elements; both contributed significantly as leaders in winning the science war during

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

International Fund for Agricultural Development | Open Energy Information  

Open Energy Info (EERE)

Fund for Agricultural Development Fund for Agricultural Development Jump to: navigation, search Logo: International Fund for Agricultural Development Name International Fund for Agricultural Development Address International Fund for Agricultural Development Via Paolo di Dono, 44 00142 Place Rome, Italy Phone number 39-0654591 Website http://www.ifad.org/ Coordinates 41.8299626°, 12.4944539° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.8299626,"lon":12.4944539,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

382

Secretary Chu Joins with World Leaders to Sign International Partnership  

Broader source: Energy.gov (indexed) [DOE]

Joins with World Leaders to Sign International Joins with World Leaders to Sign International Partnership for Energy Efficiency Cooperation Secretary Chu Joins with World Leaders to Sign International Partnership for Energy Efficiency Cooperation May 24, 2009 - 12:00am Addthis The Department of Energy announced today that U.S. Energy Secretary Steven Chu joined with top energy leaders from around the world to launch the International Partnership for Energy Efficiency Cooperation (IPEEC). As part of the Group of 8 (G8) Energy Ministers Meeting in Rome this weekend, G8 members and other interested countries took steps to accelerate the implementation of energy efficient measures in their economies. IPEEC signatories included members of the G8 - Canada, France, Germany, Italy, Japan, the Russian Federation, the United Kingdom, and the United States,

383

Low Emittance Tuning Studies for SuperB  

SciTech Connect (OSTI)

SuperB[1] is an international project for an asymmetric 2 rings collider at the B mesons cm energy to be built in the Rome area in Italy. The two rings will have very small beam sizes at the Interaction Point and very small emittances, similar to the Linear Collider Damping Rings ones. In particular, the ultra low vertical emittances, 7 pm in the LER and 4 pm in the HER, need a careful study of the misalignment errors effects on the machine performances. Studies on the closed orbit, vertical dispersion and coupling corrections have been carried out in order to specify the maximum allowed errors and to provide a procedure for emittance tuning. A new tool which combines MADX and Matlab routines has been developed, allowing for both corrections and tuning. Results of these studies are presented.

Liuzzo, Simone; /INFN, Pisa; Biagini, Maria; /INFN, Rome; Raimondi, Pantaleo; /INFN, Rome; Donald, Martin; /SLAC

2012-07-06T23:59:59.000Z

384

Brita Bergman (born 30/3 1946) CURRICULUM VITAE 2011 Sign Language Section, Department of Linguistics Abridged version  

E-Print Network [OSTI]

, and 5th Symposia of Sign Language Research (Stockholm 1979, Rome 1983, Lappeenranta 1987, Salamanca 1992

385

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

386

Edison SpA | Open Energy Information  

Open Energy Info (EERE)

SpA SpA Jump to: navigation, search Name Edison SpA Place Milan, Italy Zip 20121 Sector Hydro, Wind energy Product Independent power producer with approximately 9,300MW of hydro, fossil fuel and wind generation assets. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

387

Uni Land | Open Energy Information  

Open Energy Info (EERE)

Land Land Jump to: navigation, search Name Uni Land Place Bologna, Italy Zip 40063 Sector Solar Product Italian property company, which buys land without permits and develops it for residential and commerical use before selling it on. The firm is involved with solar project development. Coordinates 44.50483°, 11.345169° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.50483,"lon":11.345169,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

388

Politecnico di Milano | Open Energy Information  

Open Energy Info (EERE)

Politecnico di Milano Politecnico di Milano Jump to: navigation, search Name Politecnico di Milano Place Milan, Italy Zip 20133 Sector Solar Product Milan-based technical university. The institute has interests in solar system development and Green Building efficiencies. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

389

Esco Energy Srl | Open Energy Information  

Open Energy Info (EERE)

Esco Energy Srl Esco Energy Srl Jump to: navigation, search Name Esco Energy Srl Place Potenza, Italy Zip 85100 Sector Wind energy Product Develops a photovoltaic gel, based on a-Si, that can be applied to windows and is fully transparent. Coordinates 40.637202°, 15.799273° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.637202,"lon":15.799273,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

390

GEE Energy GmbH Co KG | Open Energy Information  

Open Energy Info (EERE)

GEE Energy GmbH Co KG GEE Energy GmbH Co KG Jump to: navigation, search Name GEE Energy GmbH & Co. KG Place Hamburg, Germany Zip 20459 Sector Biomass Product Biomass trader delivering wood pellets, wood and bark briquettes to Germany, Scandinavia, Austria, Italy and Switzerland. Coordinates 53.553345°, 9.992455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.553345,"lon":9.992455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

391

Unendo Energia | Open Energy Information  

Open Energy Info (EERE)

Unendo Energia Unendo Energia Jump to: navigation, search Name Unendo Energia Place Milano, Italy Zip 20152 Sector Biomass, Hydro, Solar, Wind energy Product Milano-based developer of clean energy projects within the wind, solar, biomass, CERS, and small hydro sectors. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

392

SaGea | Open Energy Information  

Open Energy Info (EERE)

SaGea SaGea Jump to: navigation, search Name SaGea Place Cagliari, Italy Zip 9125 Sector Solar Product Cagliari-based PV developer that designs, installs and maintains equipment for solar energy generation for both private and corporate users. Coordinates 39.214525°, 9.110492° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.214525,"lon":9.110492,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

393

Ost Energy | Open Energy Information  

Open Energy Info (EERE)

Ost Energy Ost Energy Jump to: navigation, search Name Ost Energy Place London, United Kingdom Zip NW11 7TJ Product Provides engineering and technical consultancy for PV and STEG projects in Italy and Spain. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

394

Factory Renewable Energy Alternatives Srl FREA | Open Energy Information  

Open Energy Info (EERE)

Factory Renewable Energy Alternatives Srl FREA Factory Renewable Energy Alternatives Srl FREA Jump to: navigation, search Name Factory Renewable Energy Alternatives Srl (FREA) Place Milan, Italy Zip 20121 Sector Wind energy Product Milan-based developer of wind generation in the Italian market, that also invests in innovative technologies. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

395

Italsilicon Srl | Open Energy Information  

Open Energy Info (EERE)

Italsilicon Srl Italsilicon Srl Jump to: navigation, search Name Italsilicon Srl Place Brugherio, Italy Zip 20047 Sector Solar Product Italian joint venture to manufacture 2,500t worth of solar-grade silicon. Coordinates 45.55274°, 9.297035° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.55274,"lon":9.297035,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

396

La Esco del Sole Srl | Open Energy Information  

Open Energy Info (EERE)

Esco del Sole Srl Esco del Sole Srl Jump to: navigation, search Name La Esco del Sole Srl Place Milan, Italy Zip 20125 Sector Efficiency, Solar Product Italian energy efficiency consultancy firm and system installer for solar PV projects, based in Milan. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

397

TOLO Energia Srl | Open Energy Information  

Open Energy Info (EERE)

TOLO Energia Srl TOLO Energia Srl Jump to: navigation, search Name TOLO Energia Srl Place Milan, Italy Zip 20122 Sector Biomass Product TOLO Energia is a an integrated clean energy holding company involved in biomass, biodiesel, PV, water treatment, emissions trading, and turnkey system projects. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

398

Airon Group Spa | Open Energy Information  

Open Energy Info (EERE)

Airon Group Spa Airon Group Spa Jump to: navigation, search Name Airon Group Spa Place Florence, Italy Zip 50122 Sector Solar, Wind energy Product Florence-based strategy and management control planning firm. The firm has invested and advised in solar and wind energy. Coordinates 45.922405°, -88.249839° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.922405,"lon":-88.249839,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

399

Albasolar | Open Energy Information  

Open Energy Info (EERE)

Albasolar Albasolar Jump to: navigation, search Name Albasolar Place Alba, Italy Zip 12051 Product An Italian installer of PV systems for the residential sector. Coordinates 32.792857°, -95.639017° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.792857,"lon":-95.639017,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

400

Fabbrica Energie Rinnovabili Alternative FERA srl | Open Energy Information  

Open Energy Info (EERE)

Rinnovabili Alternative FERA srl Rinnovabili Alternative FERA srl Jump to: navigation, search Name Fabbrica Energie Rinnovabili Alternative (FERA) srl Place Milan, Italy Zip 20121 Sector Renewable Energy, Wind energy Product Milan-based developer of renewable energy projects, primarily wind and STEG. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Gruppo Sistemi Energetici | Open Energy Information  

Open Energy Info (EERE)

Gruppo Sistemi Energetici Gruppo Sistemi Energetici Jump to: navigation, search Name Gruppo Sistemi Energetici Place Foggia, Italy Zip IVA 03231620711 Sector Biomass, Geothermal energy, Renewable Energy, Solar, Wind energy Product Renewable project developer including solar, wind, geothermal and biomass. Coordinates 41.46212°, 15.544865° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.46212,"lon":15.544865,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

402

Horus Energy SRL | Open Energy Information  

Open Energy Info (EERE)

Horus Energy SRL Horus Energy SRL Jump to: navigation, search Name Horus Energy SRL Place Siracusa, Italy Zip 96100 Sector Solar Product Siracusa - based solar PV project developer. Coordinates 37.076922°, 15.279578° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.076922,"lon":15.279578,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

403

Depasol Eco Energy Systems | Open Energy Information  

Open Energy Info (EERE)

Depasol Eco Energy Systems Depasol Eco Energy Systems Jump to: navigation, search Name Depasol - Eco-Energy Systems Place Trinitapoli, Italy Zip 71049 Sector Solar Product Manufacturer of PV modules and solar passive systems, plans an ingot and cell division as of January 2008. Coordinates 41.35687°, 16.091535° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.35687,"lon":16.091535,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

404

ErgyCapital SpA formerly Greenergy Capital | Open Energy Information  

Open Energy Info (EERE)

ErgyCapital SpA formerly Greenergy Capital ErgyCapital SpA formerly Greenergy Capital Jump to: navigation, search Name ErgyCapital SpA (formerly Greenergy Capital) Place Milan, Italy Zip 20121 Sector Efficiency, Renewable Energy Product Investment company specializing in renewable energy and energy efficiency. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

405

Enermill Energie Rinnovabili srl | Open Energy Information  

Open Energy Info (EERE)

Enermill Energie Rinnovabili srl Enermill Energie Rinnovabili srl Jump to: navigation, search Name Enermill Energie Rinnovabili srl Place Vercelli, Italy Zip 13040 Sector Solar, Wind energy Product Enermill is focusing on developping wind and solar PV projects. Coordinates 45.32255°, 8.41844° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.32255,"lon":8.41844,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

406

Prothea Solar | Open Energy Information  

Open Energy Info (EERE)

Prothea Solar Prothea Solar Jump to: navigation, search Name Prothea Solar Place Milan, Italy Zip 20100 Sector Solar Product Milan-based greenfield developer and turn key provider of solar energy power plants. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

407

Almeco SpA | Open Energy Information  

Open Energy Info (EERE)

Almeco SpA Almeco SpA Jump to: navigation, search Name Almeco SpA Place Milan, Italy Zip 20098 Product Milan-based lighting company. Manufactures daylight saving systems and light pipes as well as reflectors and absorbers for STEG. Coordinates 45.468945°, 9.18103° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.468945,"lon":9.18103,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

408

Wind Energy Resource Atlas of Armenia (CD-ROM)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...

409

Aristotle's Journey to Europe: A Synthetic History of the Role Played by the Islamic Empire in the Transmission of Western Educational Philosophy Sources from the Fall of Rome through the Medieval Period  

E-Print Network [OSTI]

to reach medieval Europe after the split of the Roman Empire into east and west sectors, but these two potential paths functionally became, instead, dual roadblocks to its transmission. In the western portion of the former Roman Empire...

Cloud, Randall R.

2007-12-12T23:59:59.000Z

410

2010 GORDON RESEARCH CONFERENCE ON MITOCHONDRIA & CHLOROPLASTS, LUCCA, ITALY, JULY 11-16, 2010  

SciTech Connect (OSTI)

The 2010 GRC on Mitochondria & Chloroplasts will assemble an international group of molecular, structural and cellular biologists, biochemists and geneticists investigating a broad spectrum of fundamental problems related to the biology of these organelles in animal, plant and fungal cells. This field has witnessed an extraordinary expansion in recent years, fueled by the discovery of the role of mitochondria in human disease and ageing, and of the synergy of chloroplasts and mitochondria in energetic output, the identification of novel factors involved in organelle division, movement, signaling and acclimation to changing environmental conditions, and by the powerful tools of organelle proteomics. The 2010 GRC will highlight advances in the elucidation of molecular mechanisms of organelle biogenesis including regulation of genome structure, evolution and expression, organellar protein import, assembly and turnover of respiratory and photosynthetic complexes, bidirectional signaling between organelles and nucleus, organelle morphology and dynamics, and the integration of cellular metabolism. We will also explore progress in mechanisms of disease and ageing/ senescence in animals and plants. The organellar field has forged new fronts toward a global and comprehensive understanding of mitochondrial and chloroplast biology at the molecular level. Many of the molecules under study in model organisms are responsible for human diseases, providing significant impetus for a meeting that encourages interactions between mammalian, fungal and plant organellar biologists.

Alice Barkan

2010-07-16T23:59:59.000Z

411

Exile vs. Exodus: Nationalism and Gendered Migration from Ukraine to Italy and California  

E-Print Network [OSTI]

Arel, Dominique. 2009. Ukraine Since the War in Georgia. 255-266 in Women in Russia and Ukraine. Cambridge [England]:in Post- Socialist Ukraine. East European Politics and

Solari, Cinzia

2010-01-01T23:59:59.000Z

412

U.S. and Italy Sign Agreement to Collaborate on Carbon Capture...  

Office of Environmental Management (EM)

while coping with urgent energy security and climate challenges. The Clean Coal and Carbon Sequestration Annex signed between the two countries is part of the Obama...

413

Exposure to magnetic fields of railway engine drivers: a case study in Italy  

Science Journals Connector (OSTI)

......two personal meters were employed in order to better evaluate the exposure of engine drivers(6). An EMDEX LITE meter (Enertech Consultants, Campbell and CA) was used to measure and store the individual engine driver exposure to magnetic field in the......

G. M. Contessa; R. Falsaperla; V. Brugaletta; P. Rossi

2010-12-01T23:59:59.000Z

414

Exile vs. Exodus: Nationalism and Gendered Migration from Ukraine to Italy and California  

E-Print Network [OSTI]

by Russian president Vladimir Putin and Ukraines incumbentAs recently as April 2008, Putin described Ukraine as an

Solari, Cinzia

2010-01-01T23:59:59.000Z

415

Assessment of the radiological impact of a decommissioning nuclear power plant in Italy  

E-Print Network [OSTI]

The assessment of the radiological impact of a decommissioning Nuclear Power Plant is presented here through the results of an environmental monitoring survey carried out in the area surrounding the Garigliano Power Plant. The levels of radioactivity in soil, water, air and other environmental matrices are shown, in which {\\alpha}, {\\beta} and {\\gamma} activity and {\\gamma} equivalent dose rate are measured. Radioactivity levels of the samples from the Garigliano area are analyzed and then compared to those from a control zone situated more than 100 km away. Moreover, a comparison is made with a previous survey held in 2001. The analyses and comparisons show no significant alteration in the radiological characteristics of the area surroundings the plant, with an overall radioactivity depending mainly from the global fallout and natural sources.

A. Petraglia; C. Sabbarese; M. De Cesare; N. De Cesare; F. Quinto; F. Terrasi; A. D'Onofrio; P. Steier; L. K. Fifield; A. M. Esposito

2012-07-17T23:59:59.000Z

416

Assessment of the radiological impact of a decommissioning nuclear power plant in Italy  

E-Print Network [OSTI]

The assessment of the radiological impact of a decommissioning Nuclear Power Plant is presented here through the results of an environmental monitoring survey carried out in the area surrounding the Garigliano Power Plant. The levels of radioactivity in soil, water, air and other environmental matrices are shown, in which {\\alpha}, {\\beta} and {\\gamma} activity and {\\gamma} equivalent dose rate are measured. Radioactivity levels of the samples from the Garigliano area are analyzed and then compared to those from a control zone situated more than 100 km away. Moreover, a comparison is made with a previous survey held in 2001. The analyses and comparisons show no significant alteration in the radiological characteristics of the area surroundings the plant, with an overall radioactivity depending mainly from the global fallout and natural sources.

Petraglia, A; De Cesare, M; De Cesare, N; Quinto, F; Terrasi, F; D'Onofrio, A; Steier, P; Fifield, L K; Esposito, A M; 10.1051/radiopro/2012010

2012-01-01T23:59:59.000Z

417

Elemental and gamma-ray surveys in the volcanic soils of Ischia Island, Italy  

Science Journals Connector (OSTI)

...M.G., The distribution of Uranium over Europe: geological and...Epidemiologia e Prevenzione Extract from Cancer Report Atlas of Cancer Mortality in the Campania Region...Belkin, H. E., Occurrence of Uranium, Thorium and REE bearing minerals...

P. Frattini; B. De Vivo; A. Lima; D. Cicchella

418

Anthropogenic vs. natural pollution: an environmental study of an industrial site under remediation (Naples, Italy)  

Science Journals Connector (OSTI)

...i.e. petrol lead, coal ash) as a by-product...plants, sewage sludge and mining. Weathering produces...furnace steel), iron, coal and grain handling facilities...Anonymous 1979a ). Coal utilized in the coke...mines, e.g. from the Appalachia Region (Anonymous 1979b...

M. Tarzia; B. De Vivo; R. Somma; R. A. Ayuso; R. A. R. McGill; R. R. Parrish

419

Underwater survey and excavation at the ancient port of Gravisca, Italy  

E-Print Network [OSTI]

advanced practices ini building artificial harbor -'nstalla!iona. For example, studies of the Roman ports at Cosa, Pyi. gi, Civitavecchia, snd Ostis on the Tuscan coast, and the port' of Pozzuoli and Baiae to the south, have revealed extensive . vidence...'I, C ' . I'I I ' I ~ld' ICI I I. II II Sites ( 19 7 6) 3 6 6; id em, op , c i t, ( in no te 2 8) 1. 9 6- 19 7 . rcvealr d traces of. an ear'ier Etruscan to?in (6th-3rd century B. C, ), larger and richer than the Roman colony and w'th a somewhat...

Shuey, Elizabeth Bostwick

2012-06-07T23:59:59.000Z

420

Guest, J., Cole, P., Duncan, A. & Chester, D. 2003. Volcanoes of Southern Italy.:  

Science Journals Connector (OSTI)

...established'. Great stuff and a real eye opener to the personalities...surrounded by dense housing estates with their attendant vandalism...Valuing the Resource: the Sustainable Ap-proach', was introduced...in Somerset has remained a sustainable resource despite two centuries...

Ralf Gertisser

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Regional Balanced Growth in Italy and the Increase in Oil Prices  

Science Journals Connector (OSTI)

The recent rise in fuel prices has had many diverse consequences both for ... while to enquire into the effect that the oil price rise may have on regional development within ... precisely that, namely, to determ...

Murray Brown; Maurizio Di Palma

1976-01-01T23:59:59.000Z

422

Stresa, Italy, 25-27 April 2007 NI-MH BATTERY MODELLING FOR AMBIENT INTELLIGENCE APPLICATIONS  

E-Print Network [OSTI]

, to make comparisons and eventually for the simulations there is a need for a proper battery model and MEMS actuators use mobile power supplies to ensure energy for their operation. These are mostly and lower power consumption. Today even software developers have to take also the battery-aware system

Paris-Sud XI, Université de

423

A review of "Church, Censorship and Culture in Early Modern Italy." by Gigliola Fragnito, ed.  

E-Print Network [OSTI]

deal with the question of authority in church and state rather than theology or faith per se? (12). Early on, James was affected by Scotch contests among Roman Catholics, Presbyterians, and Epis- copalians; and Doelman speculates that in 1603, James... must have relished the thought of leading an Episcopalian church in England. James was also a religious poet; he enjoyed duBartas and trans- lated a section, Uranie, in which the poet converts from secular to sacred verse in order to achieve the laurel...

Erminia Ardissino

2002-01-01T23:59:59.000Z

424

Stresa, Italy, 26-28 April 2006 POWER PROCESSING CIRCUITS FOR MEMS INERTIAL ENERGY SCAVENGERS  

E-Print Network [OSTI]

on a spring suspension within a frame. When the frame is accelerated, causing relative displacement between which may be electromagnetic (typically a coil and permanent magnet) [1], electrostatic (a variable generators are based around resonant mass-spring systems, although for some applications (particularly

Paris-Sud XI, Université de

425

Stresa, Italy, 26-28 April 2006 THERMOELECTRIC AND MICROBATTERY HYBRID SYSTEM WITH ITS POWER  

E-Print Network [OSTI]

developed. It consists in hybriding an energy storage system (thin film solid state battery change depending on the outside conditions) and required by the thin film solid state battery conversion and energy storage. A hybrid system comprising a thermoelectric generator, a thin film solid state

Paris-Sud XI, Université de

426

Indoor radon concentration measurements in some dwellings of the Penisola Sorrentina, South Italy  

Science Journals Connector (OSTI)

......multiple groups were performed by non-parametric Kruskal-Wallis test. All statistical analyses were performed using...values are represented by dots. The application of Kruskal-Wallis test demonstrated that the annual radon concentrations......

Maria Quarto; Mariagabriella Pugliese; Filomena Loffredo; Vincenzo Roca

2013-09-01T23:59:59.000Z

427

Regional infrastructure and firm investment: theory and empirical evidence for Italy  

Science Journals Connector (OSTI)

The authors model the channels through which public expenditure on infrastructure influences firm value and shapes...via both adjustment costs and marginal profitability of capital. The authors test these hypothe...

Francesco Aiello; Alfonsina Iona; Leone Leonida

2012-06-01T23:59:59.000Z

428

Radionuclide concentrations in air particulate at Palermo (Italy) following Fukushima accident  

Science Journals Connector (OSTI)

......Ethernet environment. Data analysis was performed using...evaluation of the burnup of a reactor, but it is also capable...confirms with sufficient reliability the origin of the radioactive...particulate by multi-spectra analysis. (1990) Quaderni D...Spectrometric analysis of the filters highlights......

S. Rizzo; E. Tomarchio

2013-03-01T23:59:59.000Z

429

Waste management health risk assessment: A case study of a solid waste landfill in South Italy  

SciTech Connect (OSTI)

An integrated risk assessment study has been performed in an area within 5 km from a landfill that accepts non hazardous waste. The risk assessment was based on measured emissions and maximum chronic population exposure, for both children and adults, to contaminated air, some foods and soil. The toxic effects assessed were limited to the main known carcinogenic compounds emitted from landfills coming both from landfill gas torch combustion (e.g., dioxins, furans and polycyclic aromatic hydrocarbons, PAHs) and from diffusive emissions (vinyl chloride monomer, VCM). Risk assessment has been performed both for carcinogenic and non-carcinogenic effects. Results indicate that cancer and non-cancer effects risk (hazard index, HI) are largely below the values accepted from the main international agencies (e.g., WHO, US EPA) and national legislation ( and ).

Davoli, E., E-mail: enrico.davoli@marionegri.i [Istituto di Ricerche Farmacologiche 'Mario Negri', Environmental Health Sciences Department, Via Giuseppe La Masa 19, 20156 Milano (Italy); Fattore, E.; Paiano, V.; Colombo, A.; Palmiotto, M. [Istituto di Ricerche Farmacologiche 'Mario Negri', Environmental Health Sciences Department, Via Giuseppe La Masa 19, 20156 Milano (Italy); Rossi, A.N.; Il Grande, M. [Progress S.r.l., Via Nicola A. Porpora 147, 20131 Milano (Italy); Fanelli, R. [Istituto di Ricerche Farmacologiche 'Mario Negri', Environmental Health Sciences Department, Via Giuseppe La Masa 19, 20156 Milano (Italy)

2010-08-15T23:59:59.000Z

430

Stresa, Italy, 25-27 April 2007 NOVEL BONDING TECHNOLOGIES FOR WAFER-LEVEL TRANSPARENT  

E-Print Network [OSTI]

OF MOEMS Herwig Kirchberger, Paul Lindner, Markus Wimplinger EV Group, A-4782 St. Florian, DI Erich), enjoys the potential to account for almost one third of the total MEMS sales by 2010, mainly driven annual growth rate (CAGR) of MEMS device sales of around 13% over the next 5 years, which is mainly

Boyer, Edmond

431

Breast Cancer and Alcohol Consumption: A Case-Control Study in Northern Italy  

Science Journals Connector (OSTI)

...INTRODUCTION Alcohol consumption has been inconsistently...Since alcohol consumption is wide spread among...conducted in the homes of the respondents...following surgery (on average, 7.8 months after...estimating alcohol consumption in European countries...nutrient, and energy values were compiled...

Paolo Toniolo; Elio Riboli; Fulvia Protta; Martine Charrel; and Alberto P. M. Cappa

1989-09-15T23:59:59.000Z

432

Robert H. Williams (United States) CONTRIBUTING AUTHORS: Matthew Bunn (United States), Stefano Consonni (Italy),  

E-Print Network [OSTI]

-term goal. The technological revolution under way in power generation-- where advanced systems are replacing steam turbine tech- nologies--supports this long-term goal. Natural-gas-fired combined cycles offering towards the long-term goal of near-zero air pollutant and greenhouse gas emissions--without complicated

433

Stresa, Italy, 26-28 April 2006 A MICRO TURBINE DEVICE WITH ENHANCED  

E-Print Network [OSTI]

reported during test. 1. INTRODUCTION Micro gas turbine engine [1-2] is one of the promising solutions, AIST, Namiki 1-2, Tsukuba, 305-8564 Japan ABSTRACT As part of progress in developing a micro gas to provide high-density power source for microsystems. We are developing a silicon-based micro gas turbine

Paris-Sud XI, Université de

434

WORKSHOP REPORT FOR THE ENTERFACE WORKSHOP IN GENOVA, ITALY 2009 1 Bacteria Hunt  

E-Print Network [OSTI]

Abstract--Brain-Computer Interfaces (BCIs) allow users to control applications by brain activity. Among between the two BCI paradigms. Index Terms--brain-computer interfaces, computer games, multimodal interaction. ! 1 INTRODUCTION The study of Brain-Computer Interfaces (BCI) is a multidisciplinary field which

Dupont, Stéphane

435

Gas flow anomalies in seismogenic zones in the Upper Tiber Valley, Central Italy  

Science Journals Connector (OSTI)

......obtained from a deep borehole drilled near Pieve Santo...oil company AGIP. The borehole, called PSS1, is located...4252-4392 m). A large part of the recognized...Pieve Santo Stefano drilling were reconsidered...Pieve Santo Stefano borehole demonstrated the existence......

J. Heinicke; T. Braun; P. Burgassi; F. Italiano; G. Martinelli

2006-11-01T23:59:59.000Z

436

The age of patients with thyrotoxicosis factitia in Italy from 1973 to 1996  

Science Journals Connector (OSTI)

Thyrotoxicosis factitia, a syndrome due to the surreptitious ingestion of excess thyroid hormones, has generally ... goiter, absence of circulating anti-thyroid antibodies. Surreptitious ingestion of thyroid horm...

F. Bogazzi; L. Bartalena; G. Scarcello

1999-02-01T23:59:59.000Z

437

The Intersection of Sculpture, Scripture and Salvation at the Romanesque Cathedral in Sovana, Italy  

E-Print Network [OSTI]

face, the Fall capital, cathedral of Sovana. Figure 102: Moses smiting the rock scene, detail of Israelite drinking from the water, right face, the Fall capital, cathedral of Sovana. Figure 103: Daniel in the Lions? Den capital, cathedral... by the many factors that contributed to its development with periods of prosperity and decline. The characteristics of location and geography impacted livelihood in terms of access to: water, food, raw materials, transportation routes to and from Sovana...

Greenwood, Jill Vessely

2009-08-28T23:59:59.000Z

438

Active faults and induced seismicity in the Val d'Agri area (Southern Apennines, Italy)  

Science Journals Connector (OSTI)

......slope of the cumulative curve (point...extensional stress field (NE-trending...ascribed to the oil exploitation...stimulation in oil sands, Pure...C., 2002. Production-induced normal...Valhall and Ekofish oil fields, Pure appl......

L. Valoroso; L. Improta; L. Chiaraluce; R. Di Stefano; L. Ferranti; A. Govoni; C. Chiarabba

2009-07-01T23:59:59.000Z

439

Stresa, Italy, 26-28 April 2006 MOTION-BASED GENERATORS FOR INDUSTRIAL APPLICATIONS  

E-Print Network [OSTI]

in the design and realization of two prototypes, based on electromagnetic and electrostatic conversion of energy by unwanted factors such as air damping, squeezed film damping and friction, which convert the kinetic energy interest in the research on miniature energy sources. In this paper a closer look is given to the use

Paris-Sud XI, Université de

440

Assessing the health risks of natural CO2 seeps in Italy  

Science Journals Connector (OSTI)

...characteristics such as water content are known to show...placing them close to the ground; either the victim...immediately cease, strict remediation procedures would have...scenarios. CCS offers rapid remediation of CO 2 emissions...breathing height above ground and avoids regions of low topography...

Jennifer J. Roberts; Rachel A. Wood; R. Stuart Haszeldine

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Corporate governance and safeguard of minority shareholders in Italy: theoretical analysis and empirical research  

Science Journals Connector (OSTI)

This paper analyses the relationship between governance systems and protection of minority shareholders, with the purpose of evaluating the contribution of governance systems to favouring a fair distribution of value to the shareholders of listed companies, regardless of the size of the share held. It should be considered that where governance actually protects minority shareholders, there should be an inverse correlation between compliance with best practices and majority premiums.

Giuseppe Sancetta; Alessandro Gennaro

2009-01-01T23:59:59.000Z

442

Evidence for static stress interaction among earthquakes in the southcentral Apennines (Italy)  

Science Journals Connector (OSTI)

......in aquifers, whose diffusion processes can generate complex modulations...knowledge of stress-interaction processes in the seismically active regions...dislocazioni, in.Proc. 12th Mtg Italian National Solid Earth...breve periodo, in.Proc. 4th Mtg Italian National Solid Earth......

C. Troise; G. De Natale; F. Pingue; S. M. Petrazzuoli

1998-09-01T23:59:59.000Z

443

Belgirate, Italy, 28-30 September 2005 BONDING SEMICONDUCTOR LASER CHIPS  

E-Print Network [OSTI]

without thermo- electric cooler, so called uncooled modules, establish themselves as a cost will discuss here a model to determine the substrate material giving the best chip reliability expectations for GaAs and InP laser chips. In that respect, a comparison of the thermo-mechanical stresses induced

Paris-Sud XI, Université de

444

Belgirate, Italy, 28-30 September 2005 THERMIONIC REFRIGERATION WITH PLANAR AND NONPLANAR ELECTRODES  

E-Print Network [OSTI]

thermoelectric materials is still low. The fig- ure of merit for these materials Z T = S2 T / with S the thermo-power (Seebeck coefficient), the electrical con- ductivity, the thermal conductivity and T the average be used as generators. A large demand of micro-structured generators [5] and coolers is expected

Paris-Sud XI, Université de

445

Adv. Sci. Technol. (Faenza, Italy) 33, 1037-1050 (2003) TECHNOLOGICAL CHALLENGES FOR TRANSPARENT CONDUCTORS  

E-Print Network [OSTI]

in part by the US National Renewable Energy Laboratory. #12;2 2. OPTICAL AND ELECTRONIC PROPERTIES 2 of etching; and factors affecting their usage: chemical durability, surface roughness, hardness, mechanical in modern technology, such as energy efficient windows, displays, anti-static coatings.1

446

Do Governments Effectively Stabilize Fuel Prices by Reducing Specific Taxes? Evidence from Italy  

Science Journals Connector (OSTI)

After the sharp increase of oil prices experienced in recent years, in order to stabilize fuel prices, many countries experimented automatic fiscal mechanisms consisting ... in specific taxes matching the rise in...

Marina Di Giacomo; Massimiliano Piacenza

2011-01-01T23:59:59.000Z

447

Stresa, Italy, 26-28 April 2006 MACRO AND MICRO SCALE ELECTROMAGNETIC KINETIC  

E-Print Network [OSTI]

. INTRODUCTION Developments in ultra low power electronics, RF communications and MEMS sensors in wireless sensorT is the total damping factor and is the phase angle given by: ( ) - = - mk cT 2 1 tan (3) The power

Paris-Sud XI, Université de

448

E-Print Network 3.0 - adriatic sea italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

from the Adriatic ... Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin Collection: Environmental Sciences and Ecology 28 Biogeosciences, 4,...

449

E-Print Network 3.0 - area northern italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Forest Research Agency of the UK Forestry Commission Collection: Renewable Energy 5 BUILDING STRONG U.S. ARMY CORPS OF ENGINEERS ENGINEERING AND SUPPORT CENTER,...

450

Taphonomy of the faunal remains of a rural roman farmsite, San Giovanni di Ruoti, Italy  

E-Print Network [OSTI]

remains. The taphonomic analysis included examination of the pig skeletal element representation, identification of the specific agents that modify bone, identification of the butchering techniques used at the site, and documentation of possible... element discrimination when identifications are made. The element analysis resulted in a predictible pattern of bone survival based on the physical structure of the bones. When the faunal sample was examined for the effects of the ten taphonomic agents...

Hunter, Cristi Assad

2012-06-07T23:59:59.000Z

451

GIS-Supported Decision Making for Low-Temperature Geothermal Energy in Central Italy  

Science Journals Connector (OSTI)

The project specifications of a geospatial decision support system are described in this chapter. The system is dedicated to the low-temperature geothermal energy, and it allows to build spatial models of the res...

Alberto Gemelli; Adriano Mancini

2013-01-01T23:59:59.000Z

452

Assessing the health risks of natural CO2 seeps in Italy  

Science Journals Connector (OSTI)

...continue to use fossil fuel energy sources are considering...usually be the least-cost domestic option for many countries...volcanic edifices or geothermal fields which are sparsely populated...pp 4665 4672 , Energy Procedia . 6 Desbarats...storage of carbon dioxide . Energy 32 : 1194 1201 . 13 Beaubien...

Jennifer J. Roberts; Rachel A. Wood; R. Stuart Haszeldine

2011-01-01T23:59:59.000Z

453

Assessing the health risks of natural CO2 seeps in Italy  

E-Print Network [OSTI]

risk from surface CO2 seeps. Data were elicited from Googas (17), a web-based catalogue of degassing

Haszeldine, Stuart

454

ECCM15 -15TH EUROPEAN CONFERENCE ON COMPOSITE MATERIALS, Venice, Italy, 24-28 June 2012  

E-Print Network [OSTI]

industries are expanding, notably in the automotive industry. Furthermore, natural fibres have the intrinsic® and Terralin® ) must be characterized. Vacuum moulded Flax/PLA and Flax/PP samples were made, and samples based on sisal, flax, hemp fibres associated to either PLA, PP or epoxy matrix and exposed to distilled

Boyer, Edmond

455

Recovering energy from biogas emission: the case of Mariana Mantovana landfill (Italy)  

Science Journals Connector (OSTI)

This paper deals with the analytic rating of the economic investment in an energy recovery plant for municipal waste, in relation to the estimate of its capability to exploit biogas production transformation, and sale of electricity production, and the Green Certificates. The approach entails the assessment of potential scenarios of biogas flare coming from its production forecasts, according to different models: the LandGEM Model and the stoichiometric model describing the degradation of the organic fraction. The proposed approach has been applied to the landfill in Mariana Mantovana (MN), and has show positive trends, highlighting the advantages of this investment.

Massimo Bertolini; Maurizio Bevilacqua

2007-01-01T23:59:59.000Z

456

ECCM15 -15TH EUROPEAN CONFERENCE ON COMPOSITE MATERIALS, Venice, Italy, 24-28 June 2012  

E-Print Network [OSTI]

and laminography was used to study the damage micro-mechanisms of impact-loaded specimens, and micro-focus CT (µ to developing better materials is to study the internal damage mechanisms #12;ECCM15 - 15TH EUROPEAN CONFERENCE (SRCL) allows damage micro-mechanisms to be captured, and in previous studies, this has worked well [7

457

DISI -Via Sommarive, 14 -38123 POVO, Trento -Italy http://disi.unitn.it  

E-Print Network [OSTI]

through the NAPA-WINE Project (Network-Aware P2P-TV Application over Wise Network ­ www.napa-wine.eu), ICT on applications using it. The de- velopment of streamers in the Napa-Wine project [1] has shown that using GRAPES of the streamer. 1 Introduction Peer-to-peer (P2P) technologies are becoming increasingly popular as a way

Lo Cigno, Renato Antonio

458

Antonio Pietrangeli, The Director of Women: Feminism, Film Theory and Practice in Postwar Italy  

E-Print Network [OSTI]

gawks at the girls in bikinis. Afraid to ask for a hotelthe man who buys her the bikini (she told him he could onlywho, clad in her newly-won bikini, stands on a swing in the

Van Ness, Emma Katherine

2013-01-01T23:59:59.000Z

459

Climate Change Effects on Hydropower Potential in the Alcantara River Basin in Sicily (Italy)  

Science Journals Connector (OSTI)

In recent years, increasing attention has been paid to hydropower generation, since it is a renewable, efficient, and reliable source of energy, as well as an effective tool to reduce the atmospheric concentrations of greenhouse gases resulting ...

G. T. Aronica; B. Bonaccorso

2013-09-01T23:59:59.000Z

460

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant

462

Existing Commercial Reference Buildings Constructed In or After 1980 -  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)

463

Food and Agriculture Organization of the United Nations | Open Energy  

Open Energy Info (EERE)

and Agriculture Organization of the United Nations and Agriculture Organization of the United Nations Jump to: navigation, search Logo: Food and Agriculture Organization of the United Nations Name Food and Agriculture Organization of the United Nations Address Viale delle Terme di Caracalla Place Rome, Italy Year founded 1945 Phone number (+39) 06 57051 Website http://www.fao.org/about/en/ Coordinates 41.8792066°, 12.4952115° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.8792066,"lon":12.4952115,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

464

Evaluation of Local Enforcement of Energy Efficiency Standards and Labeling  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Evaluation of Local Enforcement of Energy Efficiency Standards and Labeling Evaluation of Local Enforcement of Energy Efficiency Standards and Labeling Program in China Title Evaluation of Local Enforcement of Energy Efficiency Standards and Labeling Program in China Publication Type Conference Proceedings Year of Publication 2012 Authors Zheng, Nina, Nan Zhou, Cecilia Fino-Chen, and David Fridley Conference Name International Energy Program Evaluation Conference Date Published 06/2012 Conference Location Rome, Italy Keywords china, china energy, china energy group, energy analysis and environmental impacts department, energy efficiency, local enforcement, policy studies, standards & labeling programs Abstract As part of China's commitment to promoting and improving the local enforcement of appliance energyefficiency standards and labeling, the China National Institute of Standardization launched a localenforcement of efficiency standards and labeling project on August 14, 2009. For this project, Jiangsu,Shandong, Sichuan and Shanghai were selected as pilot locations. This paper provides information onthe local enforcement project's recent background, activities and results as well as comparison toprevious rounds of check-testing in 2006 and 2007. In addition, the paper also offers evaluation on theachievement and weaknesses in the local enforcement scheme and recommendations based oninternational experience.

465

Energy distribution measurement of narrow-band ultrashort x-ray beams via K-edge filters subtraction  

SciTech Connect (OSTI)

The characterization of novel x-ray sources includes the measurement of the photon flux and the energy distribution of the produced beam. The aim of BEATS2 experiment at the SPARC-LAB facility of the INFN National Laboratories of Frascati (Rome, Italy) is to investigate possible medical applications of an x-ray source based on Thomson relativistic back-scattering. This source is expected to produce a pulsed quasi-monochromatic x-ray beam with an instantaneous flux of 10{sup 20} ph/s in pulses 10 ps long and with an average energy of about 20 keV. A direct measurement of energy distribution of this beam is very difficult with traditional detectors because of the extremely high photon flux. In this paper, we present a method for the evaluation of the energy distribution of quasi-monochromatic x-ray beams based on beam filtration with K-edge absorbing foils in the energy range of interest (16-22 keV). The technique was tested measuring the energy distribution of an x-ray beam having a spectrum similar to the expected one (SPARC-LAB Thomson source) by using a tungsten anode x-ray tube properly filtered and powered. The energy distribution obtained has been compared with the one measured with a HPGe detector showing very good agreement.

Cardarelli, Paolo; Di Domenico, Giovanni; Marziani, Michele; Mucollari, Irena; Pupillo, Gaia; Sisini, Francesco; Taibi, Angelo; Gambaccini, Mauro [Dipartimento di Fisica, Universita di Ferrara and INFN - Ferrara, via Saragat 1, I-44122 Ferrara (Italy)

2012-10-01T23:59:59.000Z

466

Development of biomarkers in an integrated approach to environmental studies  

Science Journals Connector (OSTI)

This study was conducted in a contained environment in order to develop biomarkers and to evaluate the environmental damage after a release of two different toxic substances which are widely used in industrial production. In a simulation study performed in Tor Mancina area (near Rome, Italy), two dangerous substances (formaldehyde and bromine) were tested. Chemical and physical characterisation, nutritive and organic contents, and trace elements presence were also investigated. The contamination effects on soil functional qualities and plant nutrition were evaluated; furthermore DNA damage with short-term genotoxicity tests and DNA biosensor on polluted soils and gravitational water, was detected. The genotoxic effects were evaluated on Vicia faba seedlings by two different short-term tests: comet assay and micronuclei test. A DNA-based biosensor for the detection of genotoxic compounds in soil samples was assembled by immobilising double stranded calf thymus DNA on screen-printed electrodes. An agreement between the comet assay and the other methodologies was observed. The results showed that the nature and the concentration of the two substances result in different molecular interaction with exposed environment. Furthermore, some of the chemical physical parameters considered are applicable indicators for the evaluation of the soil??plant system pollution.

Elena Sturchio; Priscilla Boccia; Miriam Zanellato; Claudio Beni; Graziana Bagni; Marco Mascini; Mario Pezzella

2007-01-01T23:59:59.000Z

467

Central Banks and Gold Puzzles  

E-Print Network [OSTI]

Greece, Ireland, Italy, Netherland, Portugal, Spain,Indicators. For Italy and Netherland, general governmentGreece, Ireland, Italy, Netherland, Portugal, Spain,

Aizenman, Joshua; Inoue, Kenta

2012-01-01T23:59:59.000Z

468

Indoor carbon dioxide concentrations and sick building syndrome symptoms in the BASE study revisited: Analyses of the 100 building dataset  

E-Print Network [OSTI]

Proceedings of Healthy Buildings '95, Milan, Italy, 3:1305-Proceedings of Healthy Buildings '95, Milan, Italy, Vol 3,

Erdmann, Christine A.; Steiner, Kate C.; Apte, Michael G.

2002-01-01T23:59:59.000Z

469

Reducing indoor residential exposures to outdoor pollutants  

E-Print Network [OSTI]

Proceedings of Healthy Buildings 95, Milan, Italy, Vol. 3,Proceedings of Healthy Buildings 95, Milan, Italy, Vol.

Sherman, Max H.; Matson, Nance E.

2003-01-01T23:59:59.000Z

470

A University Consortium on Efficient and Clean High-Pressure...  

Broader source: Energy.gov (indexed) [DOE]

* Working with Jacqueline Chen (Sandia National Laboratories), Ramanan Sankaran (ORNL), Mauro Valorani (University of Rome, La Sapienza), Chris Rutland (UWisc) on mixing effects on...

471

Augustus, Egypt, and Propaganda.  

E-Print Network [OSTI]

??Augustus was a master of propaganda who employed Ancient and Hellenized Egypt as a means to legitimize his newly acquired power in Rome after the (more)

Broadbent, Valerie

2012-01-01T23:59:59.000Z

472

E-Print Network 3.0 - area food prices Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of copies. Delegates and observers are kindly requested to Summary: OF CLIMATE CHANGE AND BIOENERGY Rome, 3 - 5 June 2008 SOARING FOOD PRICES: FACTS, PERSPECTIVES, IMPACTS... .What...

473

How do colloidal gels form and flow | ornl.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

a Senior Fulbright Scholar (Konstanz, Germany) and served as a guest Professor at the ETH, Zurich (1997) and the University of Rome (2004). Prof. Wagner has authored or...

474

Jimmy Bell's Experience Brings Valuable Input to Federal Advisory...  

Office of Environmental Management (EM)

Jimmy graduated from Berry College in Rome, Ga, in 1960 with a bachelor's degree in chemistry and mathematics. He went directly to graduate school at the University of...

475

Belgirate, Italy, 28-30 September 2005 THERMAL MODELLING OF MULTI-FINGER ALGAN/GAN HEMT's  

E-Print Network [OSTI]

dissipation of 1.8W. Table 1 gives the thermal conductivity of the materials used in the simul grown on SiC or sapphire substrates. Sapphire substrates are relatively cheap, but their low thermal conductivity is a major disadvantage. To improve the thermal performance, a hybrid integration of the HEMT onto

Paris-Sud XI, Université de

476

The New Stakes for National Cinemas, a Word on the Case of Italy, and an Interview with Ivan Cotroneo  

E-Print Network [OSTI]

Arcalli. Ultimo tango a Parigi. DVD. Directed by Bernardoor AC: Ultimo tango a Parigi (Last Tango in Paris, 1972)?

Cristiano, Anthony

2013-01-01T23:59:59.000Z

477

Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

Oxford University Press. Hacking, Ian. 1986. "Making Upof counting them, see Hacking 1986, 1990:3. On the role of

Cook Martn, David

2005-01-01T23:59:59.000Z

478

Heterogeneous rock mass classification by means of the geological strength index: the San Mauro formation (Cilento, Italy)  

Science Journals Connector (OSTI)

This paper describes an application of the geological strength index (GSI) method to the San Mauro formation, which is characterized by sandstones alternating with argillaceous marls. The Sandstone/Pelite (S/P) r...

P. Budetta; M. Nappi

2011-11-01T23:59:59.000Z

479

Linguistic Encounters Now and Then: Amara Lakhous and Tahar Lamri Engage in the Debate on (Dis)United Italy  

E-Print Network [OSTI]

internal migra- tion. As De Mauro points out, today Italianthe 1980s. 4. In Tullio De Mauros chapter on La cultura e

Mari, Lorenzo; Shvanyukova, Polina

2012-01-01T23:59:59.000Z

480

Mauro Picone, Sandro Faedo, and the numerical solution of partial differential equations in Italy (19281953)  

Science Journals Connector (OSTI)

In this paper we revisit the pioneering work on the numerical analysis of partial differential equations (PDEs) by two Italian mathematicians, Mauro Picone (18851977) and Sandro Faedo...

Michele Benzi; Elena Toscano

2014-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Waste Growth Challenges Local Democracy. The Politics of Waste between Europe and the Mediterranean: a Focus on Italy  

E-Print Network [OSTI]

The new incinerator (or waste-to-energy plant) in the Alpinedecreasing. Indeed waste-to- energy plants and recyclingDerived Fuel) and sent to a waste-to- energy plants, are now

Mengozzi, Alessandro

2010-01-01T23:59:59.000Z

482

Benefits and costs of tourism and outdoor recreation in the Natural Park of the Ampezzo Dolomites (Veneto-Italy)  

E-Print Network [OSTI]

1 Benefits and costs of tourism and outdoor recreation in the Natural Park of the Ampezzo Dolomites economy. The Alps Agreement too, with particular regard to Tourism Protocol has underlined that tourism development has to be sustainable. Therefore, we need to know tourism and outdoor recreation benefits

Tempesta, Tiziano

483

Resource-Limited Multiattribute Value Analysis of Alternatives for Immobilizing Radioactive Liquid Process Waste Stored in Saluggia, Italy  

Science Journals Connector (OSTI)

This large Italian public works project started with the development of engineering data to support the evaluation of three alternatives for processing nuclear waste. After an analysis of the alternatives' performance from an engineering perspective ... Keywords: EUREX, Sogin, alternatives, applications, decision analysis, decision making, decision theory, energy, environment, multiattribute value analysis, nuclear waste

Alan J. Brothers; Shas V. Mattigod; Denis M. Strachan; Gordon H. Beeman; Paul K. Kearns; Angelo Papa; Carlo Monti

2009-06-01T23:59:59.000Z

484

Waste Growth Challenges Local Democracy. The Politics of Waste between Europe and the Mediterranean: a Focus on Italy  

E-Print Network [OSTI]

option (obviously with biogas recovery) although producingdegrees of improvement (e.g. biogas recovery, pretreatment

Mengozzi, Alessandro

2010-01-01T23:59:59.000Z

485

Jan Hendrik Bruinier II Anna von Pippich Fabrizio Andreatta -Milan, Italy II Massimo Bertolini -Essen, Germany II Siegfried Bcherer -  

E-Print Network [OSTI]

Massimo Bertolini - Essen, Germany II Siegfried Böcherer - Mannheim, Germany II Thanasis Bouganis - Durham II Jay Jorgenson - New York, USA II Winfried Kohnen - Heidelberg, Germany II Jürg Kramer - Berlin, Germany II Siddarth Sankaran - Bonn, Germany II Maryna Viazovska - Bonn, Germany II Tonghai Yang - Madison

Haller-Dintelmann, Robert

486

Waste Growth Challenges Local Democracy. The Politics of Waste between Europe and the Mediterranean: a Focus on Italy  

E-Print Network [OSTI]

activities, such as waste burning versus waste dumping.and the Geographies of Waste Governance: A Burning Issue forEurope: Burning oriented Incineration (waste-to-energy)

Mengozzi, Alessandro

2010-01-01T23:59:59.000Z

487

Asbestiform sepiolite coated by aliphatic hydrocarbons from Perletoa, Aosta Valley Region (Western Alps, Italy): characterization, genesis and possible hazards  

Science Journals Connector (OSTI)

...spectra collected on composite films between xylan-type hemicelluloses (polysaccharides...and probably interacts with the fibre surfaces via specific bonds. These interactions...hydrocarbon coating and the sepiolite fibres surface slowly but inexorably opened new interstices...

R. Giustetto; K. Seenivasan; E. Belluso

488

A review of "Monteverdis Unruly Women: The Power of Song in Early Modern Italy." by Bonnie Gordon,  

E-Print Network [OSTI]

music accord- ing to our modern understandings of the body, the voice, and musical mean- ing. Jean-No?l Laurenti. Valeurs morales et religieuses sur la sc?ne de l?Acad?mie royale de musique (1663-1737). Geneva: Droz, 2002. 440 pp. CHF 148. Review...

Weaver, Andrew H.

2007-01-01T23:59:59.000Z

489

Harmonisation of indoor material emissions labelling systems in the EU JRC Ispra, Italy, May 19-20, 2005  

E-Print Network [OSTI]

available in France on the environmental properties and on the emissions to indoor air of building products products in France F. Maupetit 1 , O. Ramalho, E. Robine and C. Cochet Centre Scientifique et Technique du-based characteristics of building products. This evaluation scheme has been introduced in France in 2003, on a voluntary

Paris-Sud XI, Université de

490

Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

ABBREVIATIONS AFI CGE CCI CNC CSE DSCD DSCS DGI DGRN DNM ICImore likely to naturalize) ( CNC 1916:212). Considering thatbetween 1910 and 1911 (CNC 1916:212). An alternative to

Cook Martn, David

2005-01-01T23:59:59.000Z

491

Investigating the reasons for the failure of palaeointensity experiments: a study on historical lava flows from Mt. Etna (Italy)  

Science Journals Connector (OSTI)

......Solid symbols are for heating, open symbols for...When observed under oil at the largest magnifications...carried out under oil. (a) Type M sample...or produced during heating. It should be nevertheless...determinations. The price for this advantage...acquired after heating of a sample to T......

Manuel Calvo; Michel Prvot; Mireille Perrin; Janna Riisager

2002-04-01T23:59:59.000Z

492

The 1944 eruption of Vesuvius, Italy: combining contemporary accounts and field studies for a new volcanological reconstruction  

Science Journals Connector (OSTI)

...victims) were killed inside their houses at Pompei due to the presence...people were killed as result of house roofs collapsing (Lacroix...on the effects of eruptions. Sydney: Academic Press, pp. 1-424...luoghi colpiti. Continua l'opera di soccorso alle popolazioni...

PAUL D. COLE; CLAUDIO SCARPATI

493

Stresa, Italy, 26-28 April 2006 ABOVE IC MICRO-POWER GENERATORS FOR RF-MEMS  

E-Print Network [OSTI]

for both cathode and solid state electrolyte thin films. 2. EXPERIMENTAL 2.1. Materials selection Cathode't allow dimensions below a few mm² active area, and besides the whole process flow is done under controlled atmosphere so as to ensure materials chemical stability (mainly lithiated materials). Within

Paris-Sud XI, Université de

494

ACTIVITIES AND FUTURE PLANS AT LNF INFN, Laboratori Nazionali di Frascati, C.P. 13, 00044 Frascati (Roma), Italy  

E-Print Network [OSTI]

at another important National Laboratory of INFN, the underground facility at Gran Sasso. In the field

Istituto Nazionale di Fisica Nucleare (INFN)

495

Stresa, Italy, 26-28 April 2006 DESIGN AND FABRICATION OF A MICRO ELECTROSTATIC VIBRATION-TO-  

E-Print Network [OSTI]

], radioisotope [4] and ambient heat [5], is attracting many recent interests as the self-sustainable power source. The vibration spectra of several household appliances were measured. A typical vibration source has a peak of the discharge process become constant, as shown in Fig. 4. Figure 1 Typical vibration spectrum of a household

Boyer, Edmond

496

The Tortonian reference section at Monte dei Corvi (Italy): evidence for early remanence acquisition in greigite-bearing sediments  

Science Journals Connector (OSTI)

......Dekkers 2002). Both ZFC and FC warming curves contain no evidence for...at 10 K; it decreases upon warming and disappears completely at...F.J. , et al, 2005. The Global Boundary Stratotype Section...greigite-smythite mineralization in brown-coal basins of the Krusne hory Piedmont......

S. K. Hsing; M. J. Dekkers; C. Franke; W. Krijgsman

2009-10-01T23:59:59.000Z

497

Waste Growth Challenges Local Democracy. The Politics of Waste between Europe and the Mediterranean: a Focus on Italy  

E-Print Network [OSTI]

proof on about 10 ships that sunk in the Mediterranean withSeptember 2009, one of these sunk cargos was discovered off

Mengozzi, Alessandro

2010-01-01T23:59:59.000Z

498

Temperatures at the Base of the Seismogenic Crust Beneath Long Valley Caldera, California, and the Phlegrean Fields Caldera, Italy  

Science Journals Connector (OSTI)

In seismically active volumes of the crust, the base of the seismogenic zone commonly corresponds with the temperature at which the first mineral species in the crustal rock enters the quasi-plastic domain. This ...

David P. Hill

1992-01-01T23:59:59.000Z

499

Seasonal trends and spatial variations of PM10-bounded polycyclic aromatic hydrocarbons in Veneto Region, Northeast Italy  

Science Journals Connector (OSTI)

Abstract The Veneto Region extends for ?18.4103km2 in the northeastern part of the Po Valley and includes mountains, hills, plain and coastal environments with very different and discontinuous anthropogenic pressures. Although many efforts have been made to mitigate air pollution, the European air quality standards for atmospheric pollutants are frequently breached. This study investigates the levels of eight PM10-bound \\{PAHs\\} collected in 21 stations categorized as rural background, urban and suburban backgrounds, traffic and industrial hot-spots during one year (2011). Data were statistically processed to detect the PAH seasonal trends, their relationship with other air pollutants and micro-meteorological parameters and the space variations at a regional scale. Results show that \\{PAHs\\} levels are relatively high in the largest part of the region, with 10 sites exceeding the levels of BaP targeted by the European legislation. Two sites exhibited anomalously high \\{PAHs\\} concentrations and this anomaly became even more evident when considering the population density as a surrogate for the potential anthropogenic pressure. The \\{PAHs\\} levels were found directly proportional to other gaseous pollutants (CO, NO, NOx, SO2) suggesting common polluting sources. The analysis of time trends of PAH concentrations reveals significant coincidences throughout the region, i.e. simultaneous changes are observed in most sites as a consequence of similar emission sources and accumulation/removal processes. In this scenario, the control strategies currently imposed at local level (e.g. traffic limitations) have proven scarcely effective in mitigating air pollution and a real coordination at regional or even interregional level cannot be further postponed. Peculiar features of the \\{PAHs\\} pollution in the Veneto were also identified and some measures for protecting the human health were suggested.

Mauro Masiol; Gianni Formenton; Alberto Pasqualetto; Bruno Pavoni

2013-01-01T23:59:59.000Z

500

The EduSeis Project in Italy: An Educational Tool for Training and Increasing Awareness of Seismic Risk  

Science Journals Connector (OSTI)

...data-acquisition purposes using intranet and/or Internet networks...the active use of modern technologies, learn about the dynamics...data and tools of advanced technology. The educational activity...projects based on innovative technologies and the active participation...

L. Cantore; A. Bobbio; F. Di Martino; A. Petrilio; M. Simini; A. Zollo