Powered by Deep Web Technologies
Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Kenya: Enrico Rogora, University of Rome "La Sapienza", Italy, and David M. Malonza and Leo Odongo, Kenyatta University, Kenya  

E-Print Network [OSTI]

Kenya: Enrico Rogora, University of Rome "La Sapienza", Italy, and David M. Malonza and Leo Odongo, Kenyatta University, Kenya General description of partner department The Department of Mathematics

Burton, Geoffrey R.

2

*Associazione Euratom-ENEA-CNR, Istituto di Fisica del Plasma, Milano, Italy **INFM and Dipartimento di Fisica, II Universit di Roma 'Tor Vergata', Rome, Italy  

E-Print Network [OSTI]

________________________ *Associazione Euratom-ENEA-CNR, Istituto di Fisica del Plasma, Milano, Italy **INFM and Dipartimento di Fisica, II Università di Roma 'Tor Vergata', Rome, Italy ***ENEA fellow

Vlad, Gregorio

3

Toward a New Hybrid MHD Gyrokinetic Code: Progresses and Perspectives P25 G. Vlad, S. Briguglio, G. Fogaccia, F. Zonca -Associazione EURATOM-ENEA, Frascati, (Rome) Italy  

E-Print Network [OSTI]

and energetic ions. ·Different from HMGC [1], the new code is suited for studying general axisymmetric highToward a New Hybrid MHD Gyrokinetic Code: Progresses and Perspectives P25 G. Vlad, S. Briguglio, G. Fogaccia, F. Zonca - Associazione EURATOM-ENEA, Frascati, (Rome) Italy Outline ·A new hybrid MHD

Vlad, Gregorio

4

Two-Sided Generalized Topp and Leone (TS-GTL) distributions Donatella Vicari, Department of Statistics, Probability and Applied Statistics, University of Rome  

E-Print Network [OSTI]

of Statistics, Probability and Applied Statistics, University of Rome "La Sapienza", Rome, Italy. E Engineering, SchoolDepartment of of Engineering and Applied Science, The George Washington University, 1776 G of Statistics, Probability and Applied Statistics, University of Rome "La Sapienza", Rome, Italy 2 Corresponding

van Dorp, Johan René

5

Rome, Italy: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType JumpJersey) Jump to:Romania: Energy Resources

6

Communication : S4FE2009 (International Conference on Sustainable Fossil Fuels for Future Energy), Rome, 6 au 10 juillet 2009  

E-Print Network [OSTI]

Communication : S4FE2009 (International Conference on Sustainable Fossil Fuels for Future Energy on Sustainable Fossil Fuels for Future Energy), Rome : Italy (2009)" #12;Communication : S4FE2009 (International Conference on Sustainable Fossil Fuels for Future Energy), Rome, 6 au 10 juillet 2009 2 FFiigguurree 11

Paris-Sud XI, Université de

7

Club of Rome  

ScienceCinema (OSTI)

Le Club de Rome s'est fait connaître du grand public par la publication du premier ouvrage "Halte à la croissance" qui a fait l'object d'un débat, il y a 2 ans. Le Prof. Tinbergen a commencé par s'adonner à la physique, il est docteur en physique et très tôt il s'est tourné vers les problèmes sociaux économiques. Il est expert auprès des nombreux gouvernements et organisations internationales et il a vu ses travaux couronnés par le prix Nobel en 1969.

None

2011-04-25T23:59:59.000Z

8

Robust Optimization Made Easy with ROME  

E-Print Network [OSTI]

A common theme in this body of work is a search for techniques to ... In terms of the classes of problems that ROME can model and solve, ROME is considerably less .... Users enter the ROME environment by issuing a call to rome begin, which

2009-08-04T23:59:59.000Z

9

24-26 September 2008, Rome, Italy Thermal Design of  

E-Print Network [OSTI]

conductivity of most materials used to electrically insulate the devices enhances the thermal issues that could to estimate the overall thermal resistance by considering a combination of individual thermal resistances of layout parameters upon the thermal resistance of such devices. This contribution is aimed at supplying

Technische Universiteit Delft

10

Birori Goa Lima Mexico City Lisbon Naples Palermo Seville Soriano Liampo Villanovafranca Beyond Italy and New Spain  

E-Print Network [OSTI]

Italy and New Spain Itineraries for an Iberian Art History (1440-1640) Convened by Michael Cole Iberian Europe to the Kingdom of the New Spain. New proposals of itineraries for the origin and interpretation of corn cane sculptures Joana Barreto (Villa Medici, Rome): Spain, Italy, Flanders: Some Dynamics

Qian, Ning

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

23

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

24

Rome, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia BlueRiverwoods,RockRipple,Rollingwood, Texas: Energy|Rome is a

25

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

26

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

27

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

28

Virtualizing Ancient Rome: 3D acquisition and modeling of a large plaster-of-Paris model of imperial Rome  

E-Print Network [OSTI]

Virtualizing Ancient Rome: 3D acquisition and modeling of a large plaster-of-Paris model plaster-of-Paris model of imperial Rome (16x17 meters) created in the last century. Its overall size's urban history is well documented and studied. There is even a highly-regarded plaster-of-Paris model

Frischer, Bernard

29

Organizzato da: Christopher Smith, British School at Rome  

E-Print Network [OSTI]

Organizzato da: Christopher Smith, British School at Rome Attilio Mastrocinque, Università di LIPPOLIS, Attilio MASTROCINQUE, Christopher SMITH - Presentazione 10.00 ­ 10.30 Elio LO CASCIO - I fora e

Guidoni, Leonardo

30

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

31

International Congress on " Rome, 12-13 March 2009  

E-Print Network [OSTI]

1 International Congress on " Rome, 12-13 March 2009 ! " A. Introduction: some key concepts B Principle 3 Protection of health, vitality and area of forest resources SFM standards (P,C & I) Hierarchical to planted forests 26 criteria, 55 indicators sustainable development through trade/investments in biological

Pettenella, Davide

32

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

33

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

34

Rome 2007 2nd International Industrial Diamond Conference Proceedings, Rome April 19-Development of a Procedure for Fatigue Crack Growth in PCD  

E-Print Network [OSTI]

and the crack morphology. #12;1. Background Polycrystalline diamond cutters are known to fail during drilling polycrystalline diamond material inevitably leads to premature degradation of the cutter's ability to drill rockRome 2007 2nd International Industrial Diamond Conference Proceedings, Rome April 19- 20, 2007

35

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

36

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

37

5th International Symposium on Fusion Nuclear Technology Rome, September 19 -24 1999  

E-Print Network [OSTI]

5th International Symposium on Fusion Nuclear Technology Rome, September 19 - 24 1999 In as the working gas (and later with a mixture of 10 % oxygen in helium), purging the vacuum vessel with dry

38

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

39

Italy | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

United States and Italy on the 2014 Nuclear Security Summit See a fact sheet here.The White HouseOffice of the Press SecretaryItaly and the United States of America are pleased...

40

11241. Proposed by Roberto Tauraso, Universit`a di Roma "Tor Vergata", Rome, Italy. Find a closed formula for  

E-Print Network [OSTI]

are well known; it turns out that M = Fm (the mth Fibonacci number) and N = Lm (the mth Lucas number (-2)n ; (b) if = -1 + Lm 5 , where m is an odd integer, then F,odd(n) = (6 - Lm - 5Fm)(-2 - 3Lm + 5Fm) 20Fm(Lm + 4) · 2(Lm - 1)(Lm + 4) 5(2 + 3Lm + 5Fm) n + (6 - Lm + 5Fm)(2 + 3Lm + 5Fm) 20Fm(Lm + 4) · 2

Heckman, Christopher Carl

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

1-3 April, Rome, Italy EDA Publishing/DTIP 2009 ISBN: 978-2-35500-009-6  

E-Print Network [OSTI]

and Characterization of a Hybrid Valve for Microfluidic Applications G. Simone1§ , G. Perozziello1§* , G. Sardella1 , I in correspondence of the end of two microfluidic channels of a fabricated PMMA chip. Prior the bonding, a plasma with an external pressure or vacuum is possible, respectively to obstruct or to connect the microfluidic channels

Boyer, Edmond

42

Italy Revisited: The Encyclopedia  

E-Print Network [OSTI]

chests for the in- creasingly lavish gifts and counter-gifts that accompanied mar- riages between wealthy Italian families. Paul F. Watson’s essay evokes the social importance of these boxes, which is a feat since so few of the early ones have survived... discourse. Less defensible is an entry on Albertus Magnus, a German scholastic who never taught in Italy, with a wasteful illustration, again the ti- tle page of an early printed text. Although he was read in Italy, and was one of Thomas Aquinas’ teachers...

Epstein, Steven A.

2005-01-01T23:59:59.000Z

43

An Examination of the Economic Role of Table Fish in Ancient Rome  

E-Print Network [OSTI]

From many ancient sources, including Cicero and Pliny, it is clear that table fish were a luxury good in Rome. However, whether or not local coastal people could obtain fish from the same catches at a less extravagant price is a subject for debate...

King, Allyson R.

2013-05-31T23:59:59.000Z

44

ROME1-1378/2004 Associated production of a light Higgs boson  

E-Print Network [OSTI]

ROME1-1378/2004 Associated production of a light Higgs boson and a chargino pair in the MSSM In the Minimal Supersymmetric Standard Model (MSSM), we study the light Higgs- boson radiation o#11; a light or the pseudoscalar Higgs boson A. In particular, we compute the total cross section and the analytical form

45

Forum on How to Feed the World in 2050, FAO, Rome Oct. 2009 Agriculture for Development  

E-Print Network [OSTI]

Forum on How to Feed the World in 2050, FAO, Rome Oct. 2009 Agriculture for Development Toward #12;2 How to Feed the World in 2050? Urgent to redefine a global strategy in using agriculture for development due to: Food crisis: higher and more volatile prices Rising demands on agriculture: population

Sadoulet, Elisabeth

46

FSAAWG, ROME 2011 1 Synthetic Voice Forgery in the Forensic Context: a  

E-Print Network [OSTI]

FSAAWG, ROME 2011 1 Synthetic Voice Forgery in the Forensic Context: a short tutorial Guillaume Paristech, dép. TSI 37-39 rue Dareau 75014 PARIS Abstract--Technical voice forgery in the forensic area has, the forensic context is quite different since the human ear might be able to detect a synthetic voice, thus

Paris-Sud XI, Université de

47

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

48

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

49

Italy HEU Removal | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Plan Italy HEU Removal Italy HEU Removal Location Italy United States 43 41' 3.4548" N, 11 28' 11.0172" E See map: Google Maps Javascript is required to view this map...

50

A review of "Giovanni Baglione: Artistic Reputation in Baroque Rome." by Maryvelma Smith O’Neil,  

E-Print Network [OSTI]

: In The Presentation of the Virgin in Santa Maria dell? Orto the temple out of which the priest emerges to greet Mary is the church itself (pl. 31); we see not a prie-Dieu but Neri?s knees in Saint Charles Borromeo and Saint Philip Neri in Meditation (pl. 63... fresco on the vault of the family chapel (pl. 103) may include a cratered moon, perhaps a rare reflection of Galileo?s discovery seen in Cigoli?sWoman of the Apocalypse in the dome of the chapel of Pope Paul V, Santa Maria Maggiore, Rome. One must...

Jeffrey Fontana

2005-01-01T23:59:59.000Z

51

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

52

CIRED Workshop "Grid operation and congestion management" -Rome, 11-12 June 2014 Paper No 0371 Page 1 / 4  

E-Print Network [OSTI]

project. The project aims at developing a smart solar neighbourhood in an urban area near the city of NiceCIRED Workshop "Grid operation and congestion management" - Rome, 11-12 June 2014 Paper 0371 Paper IN THE NICE GRID DEMONSTRATOR Andrea MICHIORRI Georges KARINIOTAKIS Fiona FOUCAULT MINES ParisTech ­ France

Boyer, Edmond

53

Free-Space Optical High-Speed Link in the Urban Area of Southern Rome: Preliminary Experimental  

E-Print Network [OSTI]

Free-Space Optical High-Speed Link in the Urban Area of Southern Rome: Preliminary Experimental Set is placed on water particle effects (fog and rain). A semi-empirical model evaluation of these atmospheric, Piazza Pakistan, height 50 m), and the headquarters of the Department of Foreign Trade (point C, Viale

Marzano, Frank Silvio

54

Department of Residential Life University of Connecticut 626 Gilbert Rd Extension Unit 1022 Storrs, CT 06269 Rome Hall, Ground Floor  

E-Print Network [OSTI]

Department of Residential Life · University of Connecticut 626 Gilbert Rd Extension · Unit 1022 be directed to Student Health Services. Residential Life is unable to accept medical information. Students correspondence. Sincerely, Pamela Schipani Interim Director of Residential Life University of Connecticut Rome

Alpay, S. Pamir

55

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

56

Charity, architecture and urban development in post-Tridentine Rome : the hospital of the SS.ma Trinità dei Pellegrini e Convalescenti (1548-1680)  

E-Print Network [OSTI]

This dissertation analyzes the institutional, architectural and urban history of charitable institutions in Rome from the fifteenth to the seventeenth century. It highlights the previously ignored central role that these ...

Keyvanian, Carla L. (Carla Lucia), 1962-

2000-01-01T23:59:59.000Z

57

Ecotourism demand in North-East Italy.fig Ecotourism demand in North-East Italy  

E-Print Network [OSTI]

Ecotourism demand in North-East Italy.fig 1 Ecotourism demand in North-East Italy Tempesta T.1 and analyse ecotourism in North-East Italy. The main objectives were to: a) define a methodology that would quantify the recreational flow from the results of phone and in-person interviews, b) analyse ecotourism

Tempesta, Tiziano

58

COMPENG 2010: Complexity in Engineering, Rome Italy, February 2010 c IEEE 2010 Propagation of load shed in cascading line outages simulated by OPA  

E-Print Network [OSTI]

reliability is especially impor- tant as the electric power infrastructure is being transformed in response change. There are many and diverse mechanisms in power sys- tems by which components tripping or failures and the probability distribution of load shed in simulated blackouts of an electric power system. The average

Dobson, Ian

59

Hybrid MHD-Gyrokinetic codes: extended models, new implementations and forthcoming applications G. Vlad, S. Briguglio, G. Fogaccia, F. Zonca -Associazione EURATOM-ENEA, Frascati, (Rome) Italy  

E-Print Network [OSTI]

Hybrid MHD-Gyrokinetic codes: extended models, new implementations and forthcoming applications G between Alfvén waves and energetic particles and their mutual interaction in toroidal devices. ·HMGC extended to include new physics. ·In this paper we will present the first simulations of an electron

Vlad, Gregorio

60

United States and Italy Sign Agreements to Advance Developments...  

Broader source: Energy.gov (indexed) [DOE]

Italy Sign Agreements to Advance Developments in Nuclear Energy United States and Italy Sign Agreements to Advance Developments in Nuclear Energy September 30, 2009 - 12:00am...

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

AGRUMED France, Italie, Isral Jean-Yves Empereur  

E-Print Network [OSTI]

Olivier Henry France, Italie, Turquie BASSINS VERSANTS Algérie, France, Maroc BISTROMED Espagne, France, Tunisie CHAMO France, Maroc, Tunisie DEMOMED Observatoire démographique de la Méditerranée DEMOSYM Algérie, France, Italie, Maroc GEO-ISRAEL France, Israël, Italie Croatie, Espagne, France, Grèce, Italie, Maroc

van Tiggelen, Bart

62

Department of Physics University of L'Aquila, Italy  

E-Print Network [OSTI]

Head Laser Beam Detector Air Flow Air Flow Pump Inlet Power Monitor Light Trap #12;, Italy CETEMPS'Aquila, Italy #12;Test in the atmosphere East Midlands airport (UK) Observations of ANs + NO2 in the heated, Italy CETEMPS Department of Physics University of L'Aquila, Italy Airborne Laser Induced

Curci, Gabriele

63

Venice, Italy: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip:ScaleVegetation Jump Address:

64

Baroque Sensation in Modern Design  

E-Print Network [OSTI]

: Italy 1. San Carlo alle Quattro Fontane, Rome 2. Santa Maria degli Angeli e dei Martiri, Rome 3. Sant'Agnese in Agone, Rome 4. Santa Maria dell'Orazione e Morte, Rome 5. Santa Maria in Campitelli, Rome 6. Il Ges?, Rome 7. Sant'Ignazio, Rome 8.... Santa Maria Maddalena, Rome 9. Santa Maria del Popolo (Chigi Chapel), Rome 10. Santa Maria in Vallicella (Chiesa Nuova), Rome 11. San Giovanni dei Fiorentini, Rome 12. The Church of Sant'Andrea al Quirinale, Rome 13. Sant'Ivo alla Sapienza, Rome...

Mason, Jordan 1986-

2011-05-02T23:59:59.000Z

65

A review of "Galileo in Rome: The Rise and Fall of a Troublesome Genius" by William R. Shea and Mariano Artigas.  

E-Print Network [OSTI]

. Galileo left Rome in April 1611 and in a letter to the Florentine grand duke sent by Cardinal Francesco Maria del Monte his triumph was made clear. In the third chapter, ?Roman Clouds? (49-93), the authors high- light the events that led to the first...

Alessandro Giostra

2004-01-01T23:59:59.000Z

66

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa  

E-Print Network [OSTI]

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University

Albrecht, David

67

Giancarlo Fortino University of Calabria, Italy  

E-Print Network [OSTI]

Giancarlo Fortino University of Calabria, Italy Carlos E. Palau Universitat Politecnica de Valencia and Carlos E. Palau, editors. p. cm. Includes bibliographical references and index. Summary: "This book site development. 2. Information storage and retrieval systems. I. Fortino, Giancarlo, 1971- II. Palau

Buyya, Rajkumar

68

Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C  

E-Print Network [OSTI]

Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C General; Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia

Albrecht, David

69

Italy: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen Energy2005) | OpenIssaquena County, Mississippi:Italy:

70

Analysis Of Multiple Scattering At Vesuvius Volcano, Italy, Using...  

Open Energy Info (EERE)

Scattering At Vesuvius Volcano, Italy, Using Data Of The Tomoves Active Seismic Experiment Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article:...

71

Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C Information Technology  

E-Print Network [OSTI]

Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008C Information Technology Australia China India Italy Malaysia South Africa CRICOS provider: Monash University 00008CAustralia China India Italy Malaysia South Africa CRICOS provider: Monash University

Albrecht, David

72

21 -11-2013 A. Cattaneo (Scuola Normale Superiore, Italy) 27 -02 -2014 G. Gigli (IIT, Italy) 28 -11-2013 T. Jessel (Columbia University, USA)  

E-Print Network [OSTI]

, Italy) 28 - 11- 2013 T. Jessel (Columbia University, USA) 06 - 03 - 2014 J. Millan (EPFL, Switzerland (Columbia University, USA) 09 - 01 - 2014 K. Gross (EMBL, Italy) 27 - 03 - 2014 Mario De Caro (Università of Parma, Italy) 28 - 11- 2013 T. Jessel (Columbia University, USA) 27 - 02 - 2014 G. Gigli (IIT, Italy) 02

Di Pillo, Gianni

73

2009 International Energy Workshop Fondazione Giorgio Cini, Venice, Italy  

E-Print Network [OSTI]

2009 International Energy Workshop 17-19 June Fondazione Giorgio Cini, Venice, Italy Exploring the Energy Security and Climate Policy Nexus with the POLES Energy Model in the SECURE Project ­ preliminary Author manuscript, published in "International energy workshop, Venise : Italy (2009)" #12;halshs

Paris-Sud XI, Université de

74

Antonio Pietrangeli, The Director of Women: Feminism, Film Theory and Practice in Postwar Italy  

E-Print Network [OSTI]

Wisconsin Press, 2005. Camus, Albert. The Myth of Sisyphus.buildings in Rome. 321 Albert Camus, The Myth of Sisyphus (actresses, from Goethe to Camus, from Luigi Tenco to Mario

Van Ness, Emma Katherine

2013-01-01T23:59:59.000Z

75

Ecofuel plans MTBE plant in Italy  

SciTech Connect (OSTI)

Ecofuel (Milan), an ENI company, is evaluating construction of a new methyl tert-butyl ether (MTBE) plant in Italy, but has shelved plans for a world-scale MTBE unit in Mexico. The Italian unit is tied to ethylene expansion now under way. Later this year EniChem (Milan), a sister company, is due to complete construction of a 360,000-m.t./year cracker at Brindisi. The C{sub 4} stream available there and from the existing cracker at Priolo in Sicily should provide enough feed for a unit of up to 100,000 m.t./year of MTBE capacity. Some of the feedstock could also come from the Ravenna cracker.

Alperowicz, N.

1992-04-29T23:59:59.000Z

76

Paskhevich A., Wenger P. et Chablat D., "Kinematic and stiffness analysis of the Orthoglide, a PKM with simple, regular workspace and homogeneous performances", IEEE International Conference On Robotics And Automation, Rome, Italie, Avril, 2007.  

E-Print Network [OSTI]

with simple, regular workspace and homogeneous performances", IEEE International Conference On Robotics, regular workspace and homogeneous performances Anatoly Pashkevich, Philippe WENGER, Damien CHABLAT Robotic of a prescribed cubic Cartesian workspace that is free of singularities and internal collision. The interesting

Boyer, Edmond

77

Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

and Nationality Policies in Argentina, Italy, and Spain (First, I examine Argentina’s policy of attracting migrants/and Nationality Policy in Argentina, Italy, and Spain (1850-

Cook Martín, David

2005-01-01T23:59:59.000Z

78

FORMATION OF REPLACEMENT DOLOMITE IN THE LATEMAR CARBONATE BUILDUP, DOLOMITES, NORTHERN ITALY: PART 1.  

E-Print Network [OSTI]

FORMATION OF REPLACEMENT DOLOMITE IN THE LATEMAR CARBONATE BUILDUP, DOLOMITES, NORTHERN ITALY: PART F. McDONOUGH*** ABSTRACT. Replacement dolomite in the Latemar carbonate buildup, northern Italy of vertical columns (replacement of limestone breccia pipes) and sheets (replacement along fractures

Carmichael, Sarah

79

THREE WORDS ABOUT MOBILE PHONES: FINDINGS FROM SWEDEN, THE US, ITALY, JAPAN, AND KOREA  

E-Print Network [OSTI]

THREE WORDS ABOUT MOBILE PHONES: FINDINGS FROM SWEDEN, THE US, ITALY, JAPAN, AND KOREA Naomi S phones: findings from Sweden, the US, Italy, Japan, and Korea While roughly half of the world students in Sweden, the US, Italy, Japan, and Korea, between the ages of 18 and 24. One of our open

Carlini, David

80

A combined wind wavetidal model for the Venice lagoon, Italy  

E-Print Network [OSTI]

A combined wind wave­tidal model for the Venice lagoon, Italy L. Carniello and A. Defina Department between waves and tide propagation. The combined wind wave­tidal model is applied to the Venice lagoon. Particular attention is devoted to the dissipation of wave energy at the steep boundaries between channels

Fagherazzi, Sergio

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

The prison of Regina Coeli : a laboratory of identity in the Post-Risorgimento Italy  

E-Print Network [OSTI]

In my thesis I am studying the prison of Regina Coeli in Rome. Completed in 1892, it occupies the space of the convent after which it was named: the convent of Santa Maria Regina Coeli. The particular prison was built in ...

Touloumi, Olga

2006-01-01T23:59:59.000Z

82

E-Print Network 3.0 - area central italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Programme UN Economic... and Marketing AHEC American Hardwood in Europe Convention Venice, Italy 20-22 October 2004 Benvenuto a Venezia Source: Louisiana Forest Products...

83

E-Print Network 3.0 - alghero sardinia italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

di Laurea: "Ottimizzazione di... for extremely large telescopes, May 7th -10th, 2001, Venice, Italy; 2. Second Workshop on ... Source: Arcetri Osservatorio Astrofisico di...

84

3D Tomographic Imaging Of The Southern Apennines (Italy)- A Statistica...  

Open Energy Info (EERE)

Imaging Of The Southern Apennines (Italy)- A Statistical Approach To Estimate The Model Uncertainty And Resolution Jump to: navigation, search OpenEI Reference LibraryAdd to...

85

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

86

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

87

Architectural practice and the planning of minor palaces in Renaissance Italy, 1510-1570  

E-Print Network [OSTI]

This dissertation proposes to study how the commission and design of minor palaces contribute to the understanding of architectural practice in early 16th century Italy. The particular nature of the small urban palace as ...

Pereira, Claudio C. (Caludio Calovi), 1961-

1998-01-01T23:59:59.000Z

88

E-Print Network 3.0 - apulia southern italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ionian Basin R. Catalano,1 Summary: , bordered by southern Italy to the west and north, Greece to the east, and offshore Libya to the south... analysis of fault-controlled...

89

Wars of position : language policy, counter-hegemonies and cultural cleavages in Italy and Norway   

E-Print Network [OSTI]

This thesis investigates the development of the present-day linguistic hegemonies within Italy and Norway as products of ongoing linguistic ‘wars of position’. Language activist movements have been key actors in these ...

Puzey, Guy Edward Michael

2011-11-22T23:59:59.000Z

90

A Review of "Shakespeare, Politics, and Italy: Intertextuality on the Jacobean Stage  

E-Print Network [OSTI]

. Shakespeare, Politics, and Italy: Intertextuality on the Jacobean Stage. Farnham, Surrey, UK and Burlington, Vermont: Ashgate, 2009. x + 242pp. $99.95. Review by hugh f. wilson, grambling state university. In ?Of Studies,? Lord Bacon remarks that some... books are to be tasted, some books devoured whole, and some books need to be digested more slowly; this one takes time for digestion. Shakespeare, Politics, and Italy: Intertextuality on the Jacobean Stage does not so much ?conclude,? as end...

Wilson, Hugh F.

2010-01-01T23:59:59.000Z

91

Power from bio-sources in Italy incentives and results  

SciTech Connect (OSTI)

In Italy most of the technologies for producing power from bio-sources, as well as from other non-conventional renewable Energy Sources (RES), are rather mature, but their exploitation is still not completely convenient from the economic point of view. It depends on many factors, such as designing of plants, selection of energy conversion system and components, selection of installation site, size of market still too limited, high production costs of the technologies and lack of adequate financial supports. In the early nineties, in the attempt to overcome this situation, the Italian Government issued a series of measures addressed mainly to the power production from RES. This gives a short description of the regulations in force and some details about an important incentive tool (CIP 6/92 and relative decrees) for RES power plants installation. In particular, it indicates the possible power plant typologies, the criteria to assimilate the fossil fuel plants to RES ones, the present prices of electricity transferred into the grid and the methodology for updating the prices. Furthermore, the paper gives some data concerning submitted proposals, plant operation planning and their geographic distribution according to different bio-sources typologies.

Gerardi, V.; Ricci, A.; Scoditti, E. [ENEA, Rome (Italy)

1996-12-31T23:59:59.000Z

92

Summer School Directors Nunzio Allocca, Lucilla Anselmino  

E-Print Network [OSTI]

and Baroque Rome Science ­ Galilei and modern science Music ­ Verdi and Italian Opera Cinema ­ The Rome Cinema ­ The Rome of Fellini and Pasolini Culture and institutions ­ "Made in Italy": fashion, style study and discover the many aspects of Italian literature, art, cinema, etc., and perfect their language

Guidoni, Leonardo

93

Summer School Directors Nunzio Allocca, Lucilla Anselmino  

E-Print Network [OSTI]

and Baroque Rome Science ­ Galilei and modern science Music ­ Verdi and Italian Opera Cinema ­ The Rome Cinema ­ The Rome of Fellini and Pasolini Culture and institutions ­ "Made in Italy": fashion, style, art, cinema, etc., and perfect their language skills. Courses are taught by enthusiastic instructors

Leonardi, Stefano

94

Present Status and Future Prospects of Geothermal Development in Italy with an Appendix on Reservoir Engineering  

SciTech Connect (OSTI)

This paper consists of two parts and an appendix. In the first part a review is made of the geothermal activity in Italy from 1975 to 1982, including electrical and non-electrical applications. Remarks then follow on the trends that occurred and the operational criteria that were applied in the same period, which can be considered a transitional period of geothermal development in Italy. Information on recent trends and development objectives up to 1990 are given in the second part of the paper, together with a summary on program activities in the various geothermal areas of Italy. The appendix specifically reviews the main reseroir engineering activities carried out in the past years and the problems likely to be faced in the coming years in developing Itallian fields.

Cataldi, R.; Calamai, A.; Neri, G.; Manetti, G.

1983-12-15T23:59:59.000Z

95

A review of "Erotic Cultures of Renaissance Italy" edited by Sara F. Mathews-Grieco  

E-Print Network [OSTI]

is to be commended for providing non-military historians of the British Isles with a sound introduction to a subject of immense importance to the period. Sara F. Mathews-Grieco, ed. Erotic Cultures of Renaissance Italy. Farnham and Burlington, VT: Ashgate, 2010... into two halves, the #15;rst section under the title ?Visual testimony and verbal games.? Sarah F. Matthews-Grieco then o ers a major essay on the diversity of printed sexual images of the #15;fteenth century in Italy. She goes beyond obvious sources...

Salkeld, Duncan

2012-01-01T23:59:59.000Z

96

Physica A 314 (2002) 539547 www.elsevier.com/locate/physa  

E-Print Network [OSTI]

Dipartimento di Fisica, Istituto Nazionale di Fisica della Materia, UniversitÃ?a di Roma La Sapienza, Rome, Italy b the fundamental principles by which macroscopic Corresponding author. Dipartimento di Fisica, Istituto Nazionale di Fisica della Materia, UniversitÃ?a di Roma La Sapienza, Rome, Italy. Tel.: +39-06-49913435. E

Sciortino, Francesco

97

2578 VOLUME 29J O U R N A L O F P H Y S I C A L O C E A N O G R A P H Y 1999 American Meteorological Society  

E-Print Network [OSTI]

Fisica, Universita` ``la Sapienza,'' and Istituto Nazionale Fisica della Materia, Unita` di Roma, Rome, Italy GUGLIELMO LACORATA Dipartimento di Fisica, Universita` dell' Aquila, Coppito, and Istituto di Fisica dell'Atmosfera--CNR, Rome, Italy ANGELO VULPIANI Dipartimento di Fisica, Universita` ``la Sapienza

Cencini, Massimo

98

Stresa, Italy, 26-28 April 2006 OPTIMIZATION OF PIEZOELECTRIC ELECTRICAL GENERATORS  

E-Print Network [OSTI]

Stresa, Italy, 26-28 April 2006 OPTIMIZATION OF PIEZOELECTRIC ELECTRICAL GENERATORS POWERED the PEG output power [2,3]. Although the power electronic interface used for optimization induces Villeurbanne Cedex, France ABSTRACT This paper compares the performances of a vibration- powered electrical

Boyer, Edmond

99

Laghi di Monticchio (Southern Italy, Region Basilicata): genesis of sediments--a geochemical study  

E-Print Network [OSTI]

Laghi di Monticchio (Southern Italy, Region Basilicata): genesis of sediments--a geochemical study and Sediments, Telegrafenberg C328, 14473 Potsdam, Germany (2) Institut des Sciences de la Terre d'Orléans (ISTO Cedex 2, France Abstract The sedimentation record of Lago Grande di Monticchio (LGM) is one of the most

Boyer, Edmond

100

Stresa, Italy, 26-28 April 2006 VIBRATIONAL ENERGY SCAVENGING WITH SI TECHNOLOGY  

E-Print Network [OSTI]

for a permanent power density. This residual ambient energy can be harnessed to generate electrical powerStresa, Italy, 26-28 April 2006 VIBRATIONAL ENERGY SCAVENGING WITH SI TECHNOLOGY ELECTROMAGNETIC present the design and optimization of an electromagnetic inertial microgenerator for energy scavenging

Boyer, Edmond

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Concorso Tesi di Laurea e Concorso Tesi di Dottorato di Ricerca BioEnergy Italy 2014  

E-Print Network [OSTI]

Concorso Tesi di Laurea e Concorso Tesi di Dottorato di Ricerca BioEnergy Italy 2014 Bioenergie, Chimica Verde e Agricoltura Destinato ai laureati di qualsiasi Facoltà che hanno dell'uso delle bioenergie o della chimica verde in agricoltura I Concorsi - promossi da Cremona

Segatti, Antonio

102

Payments for Forest Environmental and Social Services: organisational models and related experiences in Italy  

E-Print Network [OSTI]

international timber markets Background 1 · Confronting fragmentation of forest estates and therefore of domestic timber supply Forestry in Italy at the dawn of the new millennium: Background 2 · Coping = trade of "credits" between companies and landowners for exceeding the requirements on water use

Pettenella, Davide

103

Supporting Broadband Growth in an Interregional Level: The Case of Greece-Italy Partnership  

E-Print Network [OSTI]

. Main target of the project is the technology and knowhow transfer (relative to broadband) to SMEs Computer Technology Institute, Patras, Grrece ** Computer Engineering and Informatics Dept., University in an Interregional Level between regions of Italy and Greece. Main target of the project is the technology

Bouras, Christos

104

Hydrothermal dolomites in SW Sardinia (Italy): evidence for a widespread late-Variscan fluid flow event  

E-Print Network [OSTI]

Hydrothermal dolomites in SW Sardinia (Italy): evidence for a widespread late-Variscan fluid flow, the Cambrian carbonates underwent ductile deformation and greenschist facies metamorphism. The same is true-temperature metamorphic rocks within the overlying nappes. It is assumed that a late-Variscan hydrothermal event, which

Boni, Maria

105

Stresa, Italy, 25-27 April 2007 BIODEGRADABLE POLYLACTIC ACID (PLA) MICROSTRUCTURES FOR SCAFFOLD  

E-Print Network [OSTI]

Stresa, Italy, 25-27 April 2007 BIODEGRADABLE POLYLACTIC ACID (PLA) MICROSTRUCTURES FOR SCAFFOLD present a simple and cost effective soft lithographic process to fabricate PLA scaffolds for tissue(vinyl alcohol) (PVA) layer was used as a mode release such that the PLA scaffold can be easily peeled off

Boyer, Edmond

106

Combined archaeomagnetic and thermoluminescence study of a brick kiln excavated at Fontanetto Po (Vercelli, Northern Italy)  

E-Print Network [OSTI]

: Rescue excavation Archaeomagnetism Thermoluminescence dating Kiln Italy a b s t r a c t A combined 1511 to 1614 AD, and a second one from 1768 to 1872 AD. Thermoluminescence (TL) study has been also perCombined archaeomagnetic and thermoluminescence study of a brick kiln excavated at Fontanetto Po

Demouchy, Sylvie

107

A glacier inventory for South Tyrol, Italy, based on airborne laser-scanner data  

E-Print Network [OSTI]

A glacier inventory for South Tyrol, Italy, based on airborne laser-scanner data Christoph KNOLL-mail: christoph.knoll@uibk.ac.at ABSTRACT. A new approach to glacier inventory, based on airborne laser supervision. Earlier inventories, from 1983 and 1997, are used to compare changes in area, volume

Kerschner, Hanns

108

European Geothermal Congress 2013 Pisa, Italy, 3-7 June 2013  

E-Print Network [OSTI]

European Geothermal Congress 2013 Pisa, Italy, 3-7 June 2013 1 Main achievements from the multi-well EGS Soultz project during geothermal exploitation from 2010 and 2012 Albert Genter1 , Nicolas Cuenot1 monitoring of the EGS Soultz power plant has been achieved during geothermal exploitation between 2010

Boyer, Edmond

109

European Geothermal Congress 2013 Pisa, Italy, 3-7 June 2013  

E-Print Network [OSTI]

European Geothermal Congress 2013 Pisa, Italy, 3-7 June 2013 1 Relative chronology of deep Rhine Graben, the deep geothermal reservoirs constitute fractured dominated systems. However constitute recharge drain. 1. INTRODUCTION In France, the geothermal heating production is mainly located

Paris-Sud XI, Université de

110

Stresa, Italy, 26-28 April 2006 RECENT DEVELOPMENTS IN MEMS-BASED MICRO FUEL CELLS  

E-Print Network [OSTI]

cell achieved a maximum power density of 58 mW cm-2 at room temperature with hydrogen as fuel. 1Stresa, Italy, 26-28 April 2006 RECENT DEVELOPMENTS IN MEMS-BASED MICRO FUEL CELLS Tristan Pichonat ABSTRACT Micro fuel cells (µ-FC) represent promising power sources for portable applications. Today, one

Boyer, Edmond

111

Hypogenic contribution to speleogenesis in a predominant epigenic karst system: A case study from the Venetian Alps, Italy  

E-Print Network [OSTI]

the Venetian Alps, Italy Nicola Tisato a, , Francesco Sauro b , Stefano M. Bernasconi a , Rolf H.C. Bruijn Frasassi, Monte Cucco and Acqua santa Terme caves (Galdenzi and Menichetti, 1995; Galdenzi, 1997

Gilli, Adrian

112

Marble Transport in the Time of the Severans: A New Analysis of the Punta Scifo a Shipwreck at Croton, Italy  

E-Print Network [OSTI]

Five ancient shipwrecks have been found in the sea off Croton, in southern Italy, each carrying a marble cargo composed of massive blocks, column shafts, and smaller artifacts. Three of them were located while surveying the seafloor with a multibeam...

Bartoli, Dante Giuliano

2009-05-15T23:59:59.000Z

113

Taphonomy of the faunal remains of a rural roman farmsite, San Giovanni di Ruoti, Italy  

E-Print Network [OSTI]

Hunter, B. A. , California State University at Sacramento Chairman of Advisory Committee: Dr. D. Gentry Steele The faunal remains from a rural Roman farmsite, San Giovanni di Ruoti, Italy, were used to perform a taphonomic analysis. The goal... remains. The taphonomic analysis included examination of the pig skeletal element representation, identification of the specific agents that modify bone, identification of the butchering techniques used at the site, and documentation of possible...

Hunter, Cristi Assad

1986-01-01T23:59:59.000Z

114

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

115

Rome, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia BlueRiverwoods,RockRipple,Rollingwood, Texas: Energy|

116

2-D Coda and Direct Wave Attenuation Tomography in Northern Italy  

SciTech Connect (OSTI)

A 1-D coda method was proposed by Mayeda et al. (2003) in order to obtain stable seismic source moment-rate spectra using narrowband coda envelope measurements. That study took advantage of the averaging nature of coda waves to derive stable amplitude measurements taking into account all propagation, site, and Sto-coda transfer function effects. Recently this methodology was applied to micro earthquake data sets from three sub-regions of northern Italy (i.e., western Alps, northern Apennines and eastern Alps). Since the study regions were small, ranging between local-to-near-regional distances, the simple 1-D path assumptions used in the coda method worked very well. The lateral complexity of this region would suggest, however, that a 2-D path correction might provide even better results if the datasets were combined, especially when paths traverse larger distances and complicated regions. The structural heterogeneity of northern Italy makes the region ideal to test the extent to which coda variance can be reduced further by using a 2-D Q tomography technique. The approach we use has been developed by Phillips et al. (2005) and is an extension of previous amplitude ratio techniques to remove source effects from the inversion. The method requires some assumptions such as isotropic source radiation which is generally true for coda waves. Our results are compared against direct Swave inversions for 1/Q and results from both share very similar attenuation features that coincide with known geologic structures. We compare our results with those derived from direct waves as well as some recent results from northern California obtained by Mayeda et al. (2005) which tested the same tomographic methodology applied in this study to invert for 1/Q. We find that 2-D coda path corrections for this region significantly improve upon the 1-D corrections, in contrast to California where only a marginal improvement was observed. We attribute this difference to stronger lateral variations in Q for northern Italy relative to California.

Morasca, P; Mayeda, K; Gok, R; Phillips, W S; Malagnini, L

2007-10-17T23:59:59.000Z

117

Underwater survey and excavation at the ancient port of Gravisca, Italy  

E-Print Network [OSTI]

and endless energy cnd enthusiasm throughout the long weeks of diving or waiting out siroc- co storms. I am also grateful to the Ameri. can Institute of Nautical Archaeology for its support. My sincere appreciation goes also to the many individuals who con... development, the Tuscan coast of Italy (FIC. 1) presents as much of a challenge today to archaeologists interpreting port remains as it did to the earliest seafarers who sought shelter for their ships. In contrast to the bay-studded Aegean so con- 1 duclve...

Shuey, Elizabeth Bostwick

1978-01-01T23:59:59.000Z

118

G. Vlad et al. THEORY OF FUSION PLASMAS -Varenna, Italy, 28/8-1/9, 2006 1 Interaction of fast particles and  

E-Print Network [OSTI]

G. Vlad et al. THEORY OF FUSION PLASMAS - Varenna, Italy, 28/8-1/9, 2006 1 Interaction of fast. Shinohara, M. Ishikawa and M. Takechi (JT-60U); M. Schneider (CRONOS codes) #12;G. Vlad et al. THEORY et al. THEORY OF FUSION PLASMAS - Varenna, Italy, 28/8-1/9, 2006 3 Introduction - 1 · Next generation

Vlad, Gregorio

119

A review of "Art and the Religious Image in El Greco’s Italy" by Andrew Caper  

E-Print Network [OSTI]

that reveal far more complexity in interpersonal colonial interactions than we have previ- ously appreciated. Andrew Casper. Art and the Religious Image in El Greco’s Italy. University Park, Pennsylvania: The Pennsylvania State University Press, 2014. xiii... + 221 pp. + 84 illus. $79.95. Review by livia stoenescu, texas a&m university. Andrew Casper’s Art and the Religious Image in El Greco’s Italy breaks new ground in art historical literature by engaging recent re- search both in typological reassessment...

Stoenescu, Livia

2014-01-01T23:59:59.000Z

120

Assessing the health risks of natural CO2 seeps in Italy  

SciTech Connect (OSTI)

Industrialized societies which continue to use fossil fuel energy sources are considering adoption of Carbon Capture and Storage (CCS) technology to meet carbon emission reduction targets. Deep geological storage of CO2 onshore faces opposition regarding potential health effects of CO2 leakage from storage sites. There is no experience of commercial scale CCS with which to verify predicted risks of engineered storage failure. Studying risk from natural CO2 seeps can guide assessment of potential health risks from leaking onshore CO2 stores. Italy and Sicily are regions of intense natural CO2 degassing from surface seeps. These seeps exhibit a variety of expressions, characteristics (e.g., temperature/ flux), and location environments. Here we quantify historical fatalities from CO2 poisoning using a database of 286 natural CO2 seeps in Italy and Sicily. We find that risk of human death is strongly influenced by seep surface expression, local conditions (e.g., topography and wind speed), CO2 flux, and human behavior. Risk of accidental human death from these CO2 seeps is calculated to be 10-8 year-1 to the exposed population. This value is significantly lower than that of many socially accepted risks. Seepage from future storage sites is modeled to be less than Italian natural flux rates. With appropriate hazard management, health risks from unplanned seepage at onshore storage sites can be adequately minimized.

Roberts, J.J.; Wood, R.A.; Haszeldine, R.S. [Scottish Carbon Capture and Storage, School of GeoSciences, Grant Institute, University of Edinburgh, West Mains Road, Edinburgh EH9 3JW, Scotland (United Kingdom)

2011-10-04T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

EWEC'07 Conference, 7-10 May 2007, Milan, Italy. POW'WOW Virtual Laboratory for Wind Power  

E-Print Network [OSTI]

EWEC'07 Conference, 7-10 May 2007, Milan, Italy. 1 POW'WOW Virtual Laboratory for Wind Power for the short-term prediction of wind power production. The relevant and common forecast length of these tools purposes. A state of the art on wind power forecasting has been published by Giebel et al [1]. On the other

Paris-Sud XI, Université de

122

PHYSCON 2009, Catania, Italy, September, 1-September, 4 2009 EQUINOX: A REAL-TIME EQUILIBRIUM CODE AND ITS  

E-Print Network [OSTI]

PHYSCON 2009, Catania, Italy, September, 1-September, 4 2009 EQUINOX: A REAL-TIME EQUILIBRIUM CODE-A Dieudonné (UMR 66 21), Université de Nice Sophia-Antipolis, CNRS Parc Valrose 06108Nice Cedex 02 France 3 XLOC code is used routinely for plasma shape control [1]. Based on this JET flux boundary code

Faugeras, Blaise

123

Stresa, Italy, 26-28 April 2006 A SILICON-BASED MICRO GAS TURBINE ENGINE FOR POWER GENERATION  

E-Print Network [OSTI]

Stresa, Italy, 26-28 April 2006 A SILICON-BASED MICRO GAS TURBINE ENGINE FOR POWER GENERATION X. C. Our research aims to develop a micro power generation systems based on micro gas turbine engine and a piezoelectric converter, as illustrated in Fig. 1 [6]. The micro gas turbine engine is composed of a centrifugal

Paris-Sud XI, Université de

124

OWEMES -Offshore Wind And Other Marine Renewable Energies In Mediterranean And European Seas Civitavecchia (Italy), 20th  

E-Print Network [OSTI]

OWEMES - Offshore Wind And Other Marine Renewable Energies In Mediterranean And European Seas Civitavecchia (Italy), 20th -22th April 2006 How to avoid Biases in Offshore Wind Power Forecasting Lueder von, adaptive system, Neural Network, single site forecast, systematic error Abstract Large-scale offshore wind

Heinemann, Detlev

125

22nd European Photovoltaic Solar Energy Conference, Fiera Milano, Italy, 3-7 September 2007 Version: 30 August 2007  

E-Print Network [OSTI]

22nd European Photovoltaic Solar Energy Conference, Fiera Milano, Italy, 3-7 September 2007 Version: 30 August 2007 FLUORINATED GREENHOUSE GASES IN PHOTOVOLTAIC MODULE MANUFACTURING: POTENTIAL EMISSIONS, The Netherlands V.M. Fthenakis, vmf@bnl.gov, Phone +1 631 344 2830, National Photovoltaic EH&S Research Center

126

ICEM12-12th International Conference on Experimental Mechanics 29 August -2 September, 2004 Politecnico di Bari, Italy  

E-Print Network [OSTI]

-electromechanical systems (NEMS) device with close-loop feedback is examined. The device is made of a multi-walled carbon Politecnico di Bari, Italy A Feedback Controlled Carbon Nanotube Based NEMS Device C.-H. Ke,a H.D. Espinosa should be addressed; E-mail: espinosa@northwestern.edu. ABSTRACT A switchable carbon nanotube based nano

Espinosa, Horacio D.

127

The multi-dimensional additionality of innovation policies. A multi-level application to Italy and Spain.  

E-Print Network [OSTI]

and Spain. Alberto Marzucchi & Sandro Montresor October 2012 Preliminary ­ Do not quote without prior, at the national and regional level (multi-level). An empirical application is carried out for Italy and Spain, while they show output additionality in Spain only, where they are also able to spur innovative

Sussex, University of

128

Stresa, Italy, 25-27 April 2007 DEVELOPMENT AND APPLICATION OF A DIAPHRAGM MICRO-PUMP WITH  

E-Print Network [OSTI]

Stresa, Italy, 25-27 April 2007 DEVELOPMENT AND APPLICATION OF A DIAPHRAGM MICRO-PUMP@ntu.edu.tw, 8862-23629976 ABSTRACT In this study, a new type of thin, compact, and light weighed diaphragm micro-pump-diaphragm pump with two valves is fabricated in an aluminum case by using highly accurate CNC machine

Paris-Sud XI, Université de

129

ASME-ATI-UIT 2010 Conference on Thermal and Environmental Issues in Energy Systems 16 19 May, 2010, Sorrento, Italy  

E-Print Network [OSTI]

, 2010, Sorrento, Italy INTRODUCTION Air source heat pump systems are used for heating and cooling heat pump exchanges heat directly from the indoor environment to the outdoor ambient air, and during surface from accumulated frost before the heating service could start again. Heat pumps with microchannel

130

ASME-ATI-UIT 2010 Conference on Thermal and Environmental Issues in Energy Systems 16 19 May, 2010, Sorrento, Italy  

E-Print Network [OSTI]

state models used by heat pump manufacturers do not describe well the energy performance of air, 2010, Sorrento, Italy I TRODUCTIO Heat pumps employed in cold climates suffer from a drop in efficiency-source heat pump systems operating in frosting conditions. Heat pump simulation programs are computationally

131

The piazza - social core or romantic anachronism: a culture-historical and ethnographic study in Todi, Italy  

E-Print Network [OSTI]

In this thesis a public piazza in Italy is studied. Traditional urban squares in Europe have had a wide range of functions and purposes over the centuries. Squares were used as a stage to display political and religious power, as a place for trade...

Kruse, Eva-Maria

2002-01-01T23:59:59.000Z

132

Proc. of the 12th Int. Conference on Digital Audio Effects (DAFx-09), Como, Italy, September 1-4, 2009  

E-Print Network [OSTI]

-4, 2009 ENERGY AND ACCURACY ISSUES IN NUMERICAL SIMULATIONS OF A NON-LINEAR IMPACT MODEL Stefano Papetti@dei.unipd.it Davide Rocchesso Dept. of Art and Industrial Design IUAV University of Venice, Italy roc@iuav.it ABSTRACT methods, based on enforcing numerical energy consistency, are suggested to improve the accuracy

Avanzini, Federico

133

"Quaderni di Ricerca in Didattica", n17, 2007. G.R.I.M. (Department of Mathematics, University of Palermo, Italy)  

E-Print Network [OSTI]

of Palermo, Italy) The Pohlke-Schwarz Theorem and its Relevancy in the Didactics of Mathematics Zita Sklenáriková&Marta Pémová 152 The Pohlke-Schwarz Theorem and its Relevancy in the Didactics of Mathematics1 and Didactics of Mathematics Faculty of Mathematics, Physics and Informatics Comenius University 84248

Spagnolo, Filippo

134

"Quaderni di Ricerca in Didattica", n17, 2007. G.R.I.M. (Department of Mathematics, University of Palermo, Italy)  

E-Print Network [OSTI]

of Palermo, Italy) The Pohlke-Schwarz Theorem and its Relevancy in the Didactics of Mathematics Zita Sklenáriková&Marta Pémová 145 The Pohlke-Schwarz Theorem and its Relevancy in the Didactics of Mathematics1 and Didactics of Mathematics Faculty of Mathematics, Physics and Informatics Comenius University 84248

Spagnolo, Filippo

135

ESA Workshop on Aerospace EMC Florence, Italy / 30 March 1 April 2009 A NOVEL WAY OF USING REVERBERATION CHAMBERS  

E-Print Network [OSTI]

ESA Workshop on Aerospace EMC Florence, Italy / 30 March ­ 1 April 2009 A NOVEL WAY OF USING of facility, among others, are often used nowadays for high frequency EMC radiated-immunity tests of using RCs for EMC testing with the generation of high-intensity deterministic temporal wavefronts inside

Paris-Sud XI, Université de

136

Early to mid-Holocene climate change at Lago dell'Accesa (central Italy): climate signal or anthropogenic bias?  

E-Print Network [OSTI]

Early to mid-Holocene climate change at Lago dell'Accesa (central Italy): climate signal; Holocene; Mediterranean; human impact Abstract Despite the high potential of pollen records for climate climate change over large spatial scales (e.g. Peyron et al., 1998; Davis et al., 2003) or to compare

Paris-Sud XI, Université de

137

Belgirate, Italy, 28-30 September 2005 MECHANISM AND THERMAL EFFECT OF DELAMINATION IN LIGHT-EMITTING  

E-Print Network [OSTI]

for the investigation of the thermal behavior of the delaminated LEDs. Increase of thermal resistance with the degreeBelgirate, Italy, 28-30 September 2005 MECHANISM AND THERMAL EFFECT OF DELAMINATION IN LIGHT-EMITTING DIODE PACKAGES Jianzheng Hu, Lianqiao Yang, and Moo Whan Shin Department of Materials Science

Paris-Sud XI, Université de

138

This project is co-funded by the European Union  

E-Print Network [OSTI]

This project is co-funded by the European Union within the ALFA programme A project implemented by the Università degli Studi "Gugliemo Marconi" Rome, ITALY #12;This project is co-funded by the European Union within the ALFA programme A project implemented by the Università degli Studi "Gugliemo Marconi" Rome

139

Design and construction of a solar multistory building in Tuscany (Italy)  

SciTech Connect (OSTI)

A solar low income multifamily housing project, under construction in Leghorn (Tuscany, Italy), which combines passive and conservative technologies with an active solar energy plant is presented. The working group took into consideration the following items: the local climatic conditions; the Italian housing laws; a specific heating service contract; a minimum required annual energy saving; and a fixed economic budget. In order to meet the above conditions most satisfactorily, it was necessary to use a number of computer programs as design and performance evaluation tools and to develop a special passive solar component. The six-story high building, consisting of 24 flats, with linear typology is described. The south facade has been realized with two different passive systems: direct gain and solar wall. An active solar system provides part of the building hot water requirement. The minimization of thermal loss has been emphasized by means of reduction of surface/volume ratio and an adequate study of the building construction details.

D'Alessandro, G.; Serravezza, A.

1981-01-01T23:59:59.000Z

140

CHRONOLOGIE DE LA VIE DE F. GALIANI 1728 (2 dcembre) : Naissance de Ferdinando Galiani Chieti. Septime et dernier enfant de  

E-Print Network [OSTI]

-académique : Componimenti varii per la morte di Domenico Iannaccone Carnefice della Gran Corte della Vicaria, raccolti e governo, 1750, environ (1751-1753) Voyage dans les principales villes d'Italie, Rome, Florence, Padoue

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Optical properties of lattice/spin polarons in underdoped E Cappelluti1  

E-Print Network [OSTI]

Fisica, Università "La Sapienza", P.le A. Moro 2, 00185 Rome, Italy 2 SMC Research Istituto Nazionale di Fisica della Materia and Dipartimento di Fisica Università dell' Aquila, via Vetoio, I-67010 Coppito

Cappelluti, Emmanuele

142

Structural Arrest in Dense Star-Polymer Solutions F. Sciortino,1  

E-Print Network [OSTI]

. Zaccarelli,1 F. Lo Verso,2 L. Reatto,2 K. A. Dawson,3 and C. N. Likos4 1 Dipartimento di Fisica and INFM-00185 Rome, Italy 2 Istituto Nazionale di Fisica della Materia and Dipartimento di Fisica, Universita

Sciortino, Francesco

143

Cataloguer makeover  

E-Print Network [OSTI]

Violeta Ilik Texas A&M University Libraries February 28th 2014 FSRC – Rome, Italy Cataloguer Makeover Are you paying attention? Strout warned us in 1956: “We may be so blinded by . . . firmly established customs that we are incapable...

Ilik, Violeta

2014-02-28T23:59:59.000Z

144

DOCUMENT UPDATED: 30 November 2012 KING'S-AHRC STUDENTSHIPS FOR 2013/14  

E-Print Network [OSTI]

and the Roman provinces from the pre-Roman period to the late Roman empire; the language, literature, history of Greece from the Mycenaean period to the Roman empire; the history, art and archaeology of Rome, Italy

Applebaum, David

145

Situation and prospects for forests and forestry in the  

E-Print Network [OSTI]

on Climate Change, Energy Security and Clean Development. Recent experience in the region ­ where modest, Communication Division, FAO, Viale delle Terme di Caracalla, 00153 Rome, Italy, or by e-mail to: copyright

146

Mechanical Behavior and Microstructural Development of Low-Carbon Steel and Microcomposite Steel Reinforcement Bars Deformed under Quasi-Static and Dynamic Shear Loading  

E-Print Network [OSTI]

pp. 66–77. 44. G. Krauss: Steels: Processing, Structure, andConf. Super High Strength Steels, AIM, Rome, Italy, 2005,cation for Epoxy-Coated Steel Reinforcing Bars,’’ Annual

2009-01-01T23:59:59.000Z

147

Dubrovnik, Croatia 156 Mediterranean Inspiration V1  

E-Print Network [OSTI]

· / · / / · · · · #12;V1 Dubrovnik, Croatia 156 Mediterranean Inspiration V1 PRSRTSTD U on this alluring voyage along the shores of Italy, Greece, Montenegro and Croatia. Depart from Rome and sail north

Liu, Taosheng

148

GEOPHYSICAL RESEARCH LETTERS, VOL. 26, NO. 15, PAGES 2303-2306, AUGUST 1, 1999 Subsidence of Campi Flegrei (Italy) detected by SAR  

E-Print Network [OSTI]

Vesuviano, Napoli - Italy Abstract. Seven ERS SAR images of the Napoli area ac- quired from 1993 to 1996- ing of several environmental phenomena. High spatial sam- pling (with decametre ground resolution

Beauducel, François

149

Planning the Linguistic Landscape: A Comparative Survey of the Use of Minority Languages in the Road Signage of Norway, Scotland and Italy   

E-Print Network [OSTI]

This dissertation explores the controversial nature of current policies on the use of minority language place-names on official signage in Norway, Scotland and in Italy. Following a survey of recent developments in the ...

Puzey, Guy

2008-06-26T23:59:59.000Z

150

Images of energy: Policy perspectives on the introduction of hydroelectricity in Italy, 1882-1914  

SciTech Connect (OSTI)

This study considers the link between energy technologies and cultural attitudes. Contemporary energy policy makers lack the conceptual tools with which to evaluate culturally appropriate energy choices. A way to regain a contextual capability is needed; that is, the capacity to recognize and avert situations where technological advance is insufficiently harmonized with its embedding environment. This study explores how both policy makers and the general public form their [open quotes]images of energy.[close quotes] It does so in three parts, beginning with an examination of the concepts of [open quotes]technology,[close quotes] [open quotes]culture[close quotes] and [open quotes]cognitive map,[close quotes] and an explanation of their interrelationship. The second part presents two historical case-studies of the introduction of hydroelectricity in Italy from 1882-1914. It considers how a relatively unknown technology made its way into urban and rural life, who its primary surveyors were, and how it shaped and was shaped by the cognitive maps of those into whose lives it marched. The final part extends the investigation to contemporary socio-cultural dynamics. Through concepts derived from General System Theory, the process of technological integration is interpreted in light of events that shape the world today. The design of a model to be used by energy makers and educators alike in conceiving culturally attuned energy alternatives is proposed. Such a model would describe energy-related cognitive maps and could serve as the basis for informed decision-making on energy choice at all levels of society. The study concludes with suggestions for a research agenda to further explore individual and collective energy-related cognitive maps.

Laszlo, A.R.

1992-01-01T23:59:59.000Z

151

A review of "Hope and Healing: Painting in Italy in a Time of Plague" by Gauvin Alexander Bailey, Pamela M. Jones, Franco Mormando, and Thomas W. Worcester, eds.  

E-Print Network [OSTI]

. Worcester, eds. Hope and Healing: Painting in Italy in a Time of Plague, 1500- 1800. Worcester, Mass.: Clark University, College of the Holy Cross, Worcester Art Museum, 2005. viii + 264 pp. + 43 color and 68 b/w illus. $39.95. Review by JEFFREY... of the show, Thomas Worcester: ?This exhibition has sought to explore how early modern people (especially in Italy) thought about life and death, illness and health, plague and piety. It has sought to show how painting was a privileged expression of metaphors...

Fontana, Jeffrey

2007-01-01T23:59:59.000Z

152

An analysis of markets for small-scale, advanced coal-combustion technology in Spain, Italy, and Turkey  

SciTech Connect (OSTI)

This report discusses the examination of potential overseas markets for using small-scale, US-developed, advanced coal-combustion technologies (ACTs). In previous work, member countries of the Organization for Economic Cooperation and Development (OECD) were rated on their potential for using ACTs through a comprehensive screening methodology. The three most promising OECD markets were found to be Spain, Italy, and Turkey. This report provides in-depth analyses of these three selected countries. First, it addresses changes in the European Community with particular reference to the 1992 restructuring and its potential effect on the energy situation in Europe, specifically in the three subject countries. It presents individual country studies that examine demographics, economics, building infrastructures, and energy-related factors. Potential niches for ACTs are explored for each country through regional analyses. Marketing channels, strategies, and the trading environments in each country are also discussed. The information gathered indicates that Turkey is a most promising market, Spain is a fairly promising market, and Italy appears to be a somewhat limited market for US ACTs. 76 refs., 16 figs., 14 tabs.

Placet, M.; Gerry, P.A.; Kenski, D.M.; Kern, D.M.; Nehring, J.L.; Szpunar, C.B.

1989-09-01T23:59:59.000Z

153

Atmos. Chem. Phys., 14, 43694381, 2014 www.atmos-chem-phys.net/14/4369/2014/  

E-Print Network [OSTI]

with an intensification of the Indian monsoon (the so-called elevated heat pump, or EHP) that is strongly linked and Climate, ISAC-CNR, Rome, Italy 2Department of Physics, Ferrara University, Ferrara, Italy Correspondence by the reduction of incident solar radiation at the surface and increased heating of the troposphere caused

Meskhidze, Nicholas

154

Probabilistic wind power forecasting -European Wind Energy Conference -Milan, Italy, 7-10 May 2007 Probabilistic short-term wind power forecasting  

E-Print Network [OSTI]

Probabilistic wind power forecasting - European Wind Energy Conference - Milan, Italy, 7-10 May 2007 Probabilistic short-term wind power forecasting based on kernel density estimators J´er´emie Juban jeremie.juban@ensmp.fr; georges.kariniotakis@ensmp.fr Abstract Short-term wind power forecasting tools

Paris-Sud XI, Université de

155

Il Banchetto Rosso, Emilio Romagna, Italy 2007/08, AVB 12% Ctes du Rhne Gentilhomme, Ogier et Fils, Chateauneuf-du-Pape, France,  

E-Print Network [OSTI]

2006/07, AVB 14% Argentina Finca Flichman Malbec Oak Aged, Mendoza, Argentina 2007/08, AVB 13.5% Piropo Malbec, Mendoza, Argentina 2007, AVB 13% Argento, Malbec, Mendoza Valley, Argentina Italy Villa di Libertad Chenin Blanc Chardonnay, Mendoza, Argentina 2007, AVB 13% Australia Berri Estates Unoaked

156

1st Workshop on Dependability Issues in Wireless Ad Hoc Networks and Sensor Networks (DIWANS'04), Florence, Italy, Fault Tolerant Communication Topologies for Wireless Ad Hoc Networks  

E-Print Network [OSTI]

1st Workshop on Dependability Issues in Wireless Ad Hoc Networks and Sensor Networks (DIWANS'04), Florence, Italy, June 2004 Fault Tolerant Communication Topologies for Wireless Ad Hoc Networks Bernd, distributed algorithms, failure locality 1 Introduction Wireless sensor networks, mobile ad hoc networks

157

Paper accepted for presentation at 2003 IEEE Bologna PowerTech Conference, June 23-26, Bologna, Italy Wind Power Forecasting using Fuzzy Neural Networks  

E-Print Network [OSTI]

, Italy Wind Power Forecasting using Fuzzy Neural Networks Enhanced with On-line Prediction Risk) as input, to predict the power production of wind park8 48 hours ahead. The prediction system integrates of the numerical weather predictions. Index Term-Wind power, short-term forecasting, numerical weather predictions

Paris-Sud XI, Université de

158

Springer's LNCS Proc. of the 2005 Int. Conf. on High Performance Computing and Communications (HPCC-05), Sorrento, Italy, September 21-24, 2005. (in press)  

E-Print Network [OSTI]

-05), Sorrento, Italy, September 21-24, 2005. (in press) High Performance Subgraph Mining in Molecular and the growing amount of available data makes distributed graph mining techniques particularly relevant. The effectiveness of the distributed method has been evaluated on the well-known National Cancer Institute's HIV

Berthold, Michael R.

159

2D versus 1D ground-motion modelling for the Friuli region, north-eastern Italy1 W. Imperatori1, *  

E-Print Network [OSTI]

2D versus 1D ground-motion modelling for the Friuli region, north-eastern Italy1 2 W. Imperatori1 and CO2 Storage Security Division, BRGM, 3 avenue C. Guillemin, 450607 Orléans Cedex 2, France.8 9 affects ground motions, particularly in terms of peak ground velocity (PGV). The decay of PGV14

Boyer, Edmond

160

"Quaderni di Ricerca in Didattica (Science)", n. 2, 2011 G.R.I.M. (Department of Mathematics, University of Palermo, Italy)  

E-Print Network [OSTI]

svolta nell'ambito dei corsi di laurea in inge- gneria Onofrio Rosario Battaglia UOP_PERG (University-mail: battaglia@difter.unipa.it Abstract. This paper describes the outcomes of an teaching experiment conducted, University of Palermo, Italy) Battaglia. La distribuzione di Maxwell-Boltzmann ... 37 In relazione a come si

Spagnolo, Filippo

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Peltier A., 2008, La cartographie rglementaire des risques naturels en Suisse, en Italie et en France , La mise en carte des risques naturels, Diversit des approches, Montpellier : Presses Universitaires de la Mditerrane,  

E-Print Network [OSTI]

Peltier A., 2008, « La cartographie réglementaire des risques naturels en Suisse, en Italie et en (2008) 61-67" #12;Peltier A., 2008, « La cartographie réglementaire des risques naturels en Suisse, en

Paris-Sud XI, Université de

162

This paper was published in: V.Roberto et al. Eds., Proceedings of the 10th International Conference on Image Analysis and Processing, Venice, Italy, September 27-29, 1999, pp.142-147.  

E-Print Network [OSTI]

Conference on Image Analysis and Processing, Venice, Italy, September 27-29, 1999, pp.142-147. Comparison but differ in the value of a phase parameter, are combined, yielding the so-called Gabor-energy quantity

Petkov, Nicolai

163

Paper E-06, in: M. Pellei and A. Porta (Eds.), Remediation of Contaminated Sediments--2003. Proceedings of the Second International Conference on Remediation of Contaminated Sediments (Venice, Italy; 30 Sep3 Oct 2003). ISBN 1-57477-  

E-Print Network [OSTI]

. Proceedings of the Second International Conference on Remediation of Contaminated Sediments (Venice, Italy; 30 contamination problem at the U.S. Department of Energy (DOE) waste sites with the result that chromate is second

Matin, A.C.

164

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

165

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

166

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

167

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

168

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

169

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

170

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

171

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

172

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

173

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

174

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

175

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

176

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

177

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

178

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

179

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

180

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

182

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

183

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

184

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

185

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

186

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

187

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

188

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

189

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

190

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

191

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

192

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

193

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

194

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

195

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

196

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

197

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

198

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

199

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

200

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

202

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

203

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

204

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

205

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

206

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

207

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

208

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

209

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

210

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

211

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

212

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

213

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

214

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

215

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

216

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

217

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

218

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

219

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

220

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

222

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

223

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

224

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

225

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

226

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

227

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

228

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

229

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

230

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

231

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

232

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

233

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

234

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

235

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

236

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

237

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

238

The Definition of Public Space in Republican Rome  

E-Print Network [OSTI]

P. L. (1965), '"Lentus in Umbra": a symbolic pattern inet prodest Pompeias ire per umbras (Ars 3.387). Just as inspatiabere cultus in umbra – ‘you will also not stroll

Russell, Amy

2011-01-01T23:59:59.000Z

239

"SAPIENZA" UNIVERSITY OF ROME Academic Year 2008/2009  

E-Print Network [OSTI]

magister degree n. Class Name 1 LM -52 International Relations 2 LM -56 Economic Analysis of International Institutions 3 LM -62 Sciences of Politics 4 LM -63 Sciences of Public Administration 5 LM -90 European Studies LM -16 Advanced Finance and Insurance 2 LM -56 Economics and Institutions of European

Roma "La Sapienza", Università di

240

Revelle in Rome--Summer 2013 Humanities 3GS  

E-Print Network [OSTI]

Predicament (fortuna v. virtù) The Prince, Chap 24-26, pp 66-72; Letters, pp. 123-31; Discourses, pp. 89

Blanco, Philip R.

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Revelle in Rome--Summer 2012 Humanities 3GS  

E-Print Network [OSTI]

: Castiglione Fortune is a Woman: A Book of Occasion or The Renaissance Predicament (fortuna v. virtù

Russell, Lynn

242

Physiological Stress, Bone Growth and Development in Imperial Rome  

E-Print Network [OSTI]

Skeleton. In Bone Loss and Osteoporosis: An AnthropologicalThe radiological diagnosis of osteoporosis: A new approach.170. Birnbaum, E. 1992. Osteoporosis: A Summary of Recent

Beauchesne, Patrick Denis

2012-01-01T23:59:59.000Z

243

The Definition of Public Space in Republican Rome  

E-Print Network [OSTI]

tensions between public and private action which were foundconcepts Public and private in action in the house Spatialof Roman life. Public and private in action in the house

Russell, Amy

2011-01-01T23:59:59.000Z

244

The Definition of Public Space in Republican Rome  

E-Print Network [OSTI]

caeco scelerata latebat in aere vivebatque anima deterioreout of dead bronze (caeco… aere). But it is also falsa and a

Russell, Amy

2011-01-01T23:59:59.000Z

245

ISFNT-5, Rome, Sep. 1999 APEX Liquid Wall 1  

E-Print Network [OSTI]

and inconspicuously electrical conducting medium of molten salt Flibe, 2) a low Z material and more likely compatible be maintained throughout the reactor based on 3-D hydrodynamics calculations. However, being a low thermally reduction) of FW thermal stresses, the elimination of thick plasma facing armor materials, and a possibly

California at Los Angeles, University of

246

Physiological Stress, Bone Growth and Development in Imperial Rome  

E-Print Network [OSTI]

from osteoporosis than men, once menopause has completed (osteoporosis for women today is clearly associated with menopause,osteoporosis is greatly mediated by factors that are independent of the menopause-

Beauchesne, Patrick Denis

2012-01-01T23:59:59.000Z

247

G-7 Energy Ministers Meet in Rome | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of Energy Power.pdf11-161-LNG | Department of Energy Freeport LNGEnergy Research |

248

Physiological Stress, Bone Growth and Development in Imperial Rome  

E-Print Network [OSTI]

factors such as poor sanitation and thus disease (Storey,dangerous. Poverty, crime, poor sanitation and disease posedMartin, 1993) due to poor sanitation, or in this case, one

Beauchesne, Patrick Denis

2012-01-01T23:59:59.000Z

249

A Review of "Speaking of the Moor: From Alcazar to Othello" by Emily C. Bartels  

E-Print Network [OSTI]

, she assures us that ?the alienation of the Moor is not only not assumed; it is also not assured? (44). The book continues its exploration of Mediterranean multicul- turalism in the other three plays that notably take place in Europe, Italy... this thesis. ?Incorporate in Rome? studies how Aaron is integrated into Rome?s imperial household in Titus Andronicus, and ?Othello and the Moor of Venice? explores the ?of? in ?Moor of Venice.? Between each of the four chapters that critique the four plays...

Berthelemy, Anthony G.

2009-01-01T23:59:59.000Z

250

International Environmental Evaluation for the Helical Screw Expander Generator Unit Projects in Cesano, Italy and Broadlands, New Zealand  

SciTech Connect (OSTI)

The objectives of the Helical Screw Expander (HSE) Generator Program are (1) to accelerate the development of geothermal resources by introducing this advanced conversion technology, (2) to provide operating experience to prospective users of the equipment, and (3) to collect data on the performance and reliability of the equipment under various geothermal resource conditions. The participants hope to achieve these goals by testing a small-scale, transportable HSE generator at existing geothermal test facilities that produce fluids of different salinity, temperature and pressure conditions. This Environmental Evaluation has been prepared, using available information, to analyze the environmental consequences of testing the HSE generator. Its purpose is to support a decision on the need for a complete environmental review of the HSE program under the terms of Executive Order 121 14, ''Environmental Effects Abroad of Major federal Actions''. This Executive Order requires review of projects which involve the release of potentially toxic effluents that are strictly regulated in the United States, or which may have significant environmental effects on the global commons, on natural or ecological resources of international significance, or on the environment of non-participating countries. The final guidelines implementing the provisions of the Executive Order for DOE have been published. This evaluation deals with testing to be conducted at Cesano, Italy by the designated contractor of the Italian government, the Ente Narionale per l'Energia Ellectrica (ENEL), and at Broadlands, New Zealand by the Ministry of Works and Development of New Zealand. Testing at Cerro Prieto, Mexico has already been completed by the Comision Federal de Electricidad and is not evaluated in this report.

Webb, J.W.; Mezga, L.J.; Reed, A.W.

1981-08-01T23:59:59.000Z

251

Vers Sommaire Gnral quipe Mathmatiques Appliques  

E-Print Network [OSTI]

(encadrement P. Carmona) Chercheurs invités Jaafar ABOUCHABAKA (Université de Kinitra, Maroc) (2003 et 2005 (�CN)) Abdelkrim CHAKIB (Université Benimellal, Maroc) (2003, 2005 (�CN) et 2006(CNRS)) Abdellatif ELLABIB (Université de Marrakech, Maroc) (2003 et 2006) Francesco GUERRA (Université de Rome, Italie

Coudière, Yves

252

In press to ApJ. Preprint typeset using L A T E X style emulateapj  

E-Print Network [OSTI]

In press to ApJ. Preprint typeset using L A T E X style emulateapj FIRST RESULTS ON PRE MAIN Astrofisica Spaziale del CNR, Via del Fosso del Cavaliere 100, 00133 Rome, Italy In press to ApJ. ABSTRACT gradients provide an upper limit to the T eff . The present models can fit the HR diagram location

D'Antona, Francesca

253

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June -1 July 2005 Tarragona (Spain) 1 Source Regulation of Fast Energetic  

E-Print Network [OSTI]

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005 Tarragona (Spain, Rome, Italy #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005, EPM, ...) #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005

Vlad, Gregorio

254

Adaptive reuse of abandoned historic churches: building type and public perception  

E-Print Network [OSTI]

.......................................................................... 42 2.9.1.1. The Pantheon of Rome, Italy ....................................... 42 2.9.1.2. Hagia Sophia of Istanbul, Turkey ................................ 49 2.9.1.3. The Great Mosque of Cordoba, Spain...) ......................................................... 45 6 Hagia Sophia (Exterior view of today) .................................................................. 50 7 Hagia Sophia (Floor plan of today)........................................................................ 50 8 Hagia Sophia...

Ahn, You Kyong

2009-05-15T23:59:59.000Z

255

Human Missions to Mars: Designing decision-support tools for a safety critical environment  

E-Print Network [OSTI]

Whitely,I. Bogatyreva,O. Johnson,C.W. Wolff,M. Townend,M. Proceedings of the 3rd International Association for the Advancement of Space Safety (IAASS) Conference, â??Building a safer space togetherâ??, International Association for the Advancement of Space Safety (IAASS) Rome, Italy

Whitely, I.; Bogatyreva, O.; Johnson, C.W.

256

2008 Nature Publishing Group REVIEW ARTICLE  

E-Print Network [OSTI]

Rome, Italy; 3 Department of Atmospheric, Oceanic, and Space Sciences, University of Michigan, Ann out of the atmosphere; water ice comprises between 35% and 45% of the mass of Titan depending. LUNINE1,2 * AND SUSHIL K. ATREYA 1 Lunar and Planetary Laboratory, University of Arizona, Tucson, Arizona

Atreya, Sushil

257

Presentation 2.4: Forest biorefining and implications for future wood energy scenarios Jack N. Saddler  

E-Print Network [OSTI]

Presentation 2.4: Forest biorefining and implications for future wood energy scenarios Jack N Products Biotechnology at UBC Forest biorefining and implications for future wood energy scenarios W.mabee@ubc.ca International Seminar on Energy and the Forest Products Industry Rome, Italy: October 30 2006 Forest Products

258

Open Archive TOULOUSE Archive Ouverte (OATAO) OATAO is an open access repository that collects the work of Toulouse researchers and  

E-Print Network [OSTI]

and Biggs, Jeremy and Bressi, Nicolas and Grillas, Patrick and Hull, Andrew P. and Kalettka, Thomas Coccia · Arthur Compin ·Jeremy Biggs ·Nicolas Bressi ·Patrick Grillas· Andrew Hull· Thomas Kalettka. Roma 1, Rome, Italy C. Coccia CISC, Donana, Spain J. Biggs Pond Conservation: The Water Habitats Trust

Boyer, Edmond

259

G. Vlad et al. Cadarache, France, Jan 10-11, 2006 -IMP-5 meeting 1 Magnetohydrodynamic  

E-Print Network [OSTI]

G. Vlad et al. Cadarache, France, Jan 10-11, 2006 - IMP-5 meeting 1 The Hybrid Magnetohydrodynamic.R. Frascati - C.P. 65 - I-00044 - Frascati, Rome, Italy #12;G. Vlad et al. Cadarache, France, Jan 10-11, 2006-plasma scenarios do not include the possibility of Alfvén mode - -particle interactions #12;G. Vlad et al

Vlad, Gregorio

260

A Mechanism for Dynamic Ride Sharing based on Parallel Auctions Alexander Kleiner, Bernhard Nebel and Vittorio Amos Ziparo  

E-Print Network [OSTI]

A Mechanism for Dynamic Ride Sharing based on Parallel Auctions Alexander Kleiner, Bernhard Nebel,nebel}@informatik.uni-freiburg.de Algorithmica Srl, Rome, Italy, ziparo@algorithmica.it Abstract Car pollution is one of the major causes of green- house emissions, and traffic congestion is rapidly becoming a social plague. Dynamic Ride Sharing

Nebel, Bernhard

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

ThermoSense: Occupancy Thermal Based Sensing for HVAC Control  

E-Print Network [OSTI]

ThermoSense: Occupancy Thermal Based Sensing for HVAC Control Alex Beltran Elect. Eng. & Comp Occupancy Sensing, Thermal Sensing, HVAC Control 1. INTRODUCTION From 1980 to 2010, energy in the United, November 13-14 2013, Rome, Italy. Copyright 2013 ACM 978-1-4503-2431-1/13/11 ...$15.00. (HVAC) consumed 42

Cerpa, Alberto E.

262

Stanford University Exploiting Channel Knowledge at the Tx in MISO and MIMO Wireless Exploiting Partial Channel Knowledge at  

E-Print Network [OSTI]

Stanford University Exploiting Channel Knowledge at the Tx in MISO and MIMO Wireless Exploiting Partial Channel Knowledge at the Transmitter in MISO and MIMO Wireless SPAWC 2003 Rome, Italy June 18 Exploiting Channel Knowledge at the Tx in MISO and MIMO Wireless Outline Introduction · Perfect CSI

Paulraj, Arogyaswami

263

Hydrology and Earth System Sciences, 9, 535547, 2005 www.copernicus.org/EGU/hess/hess/9/535/  

E-Print Network [OSTI]

areas, irrigation serves to increase yields, to at- tenuate the effects of droughts or, in the case), Germany 2Food and Agriculture Organization of the United Nations, Rome, Italy Received: 16 June 2005 land cover inventories. 1 Introduction Agriculture is by far the largest water-use sector, accounting

Paris-Sud XI, Université de

264

Toward the next generation of air quality monitoring: Mercury Nicola Pirrone a,*, Wenche Aas b  

E-Print Network [OSTI]

, Elsie M. Sunderland f a CNR-Institute of Atmospheric Pollution Research, Rome, Italy b Norwegian Institute of Air Pollution, Kjeller, Norway c CNR-Institute of Atmospheric Pollution Research, Division of Engineering & Applied Sciences, Harvard University, Cambridge, MA, USA h i g h l i g h t s Atmospheric Hg

Sunderland, Elsie M.

265

1 A Grid based distributed simulation of Plasma Turbulence  

E-Print Network [OSTI]

1 A Grid based distributed simulation of Plasma Turbulence Beniamino Di Martino and Salvatore- cati, Rome, Italy Grid technology is widespreading, but most grid-enabled applications just exploit of Grid platforms. In this paper the porting on a Globus equipped platform of a hierarchically distributed

Vlad, Gregorio

266

Evolution of the WKB amplitude of the IBW electric field along the wave propagation.  

E-Print Network [OSTI]

1 Evolution of the WKB amplitude of the IBW electric field along the wave propagation. P.P. 65, 00044 Frascati, Rome, Italy * ENEA Guest The WKB analysis of the IBW propagation in a 2D tokamak and nonlinear studies of the IB wave-plasma interaction. #12;

267

CIEAEM 57 Italie Italy Ateliers Workshop Piazza Armerina,  

E-Print Network [OSTI]

the hermeneutic approach to knowledge. This fact is a new challenge for mathematics education. Hermeneutics contrasts with some aspects of mathematical epistemology: hermeneutics is "the art of interpretation and is paradigmatic of the hermeneutic approach to mathematics. At the web address http://www.iprase.tn

Spagnolo, Filippo

268

AET Italy | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/Curium Vitrification Project AtOpenLabsEspana SAADAPTAEP

269

Originally from Venice, Italy Martina studied in Liverpool (UK) for her PhD in Nuclear Physics. In 2003 she started a post-doc at the Lawrence Berkeley National Laboratory, working on the development of gamma-ray tracking detectors for nuclear physics exp  

E-Print Network [OSTI]

Originally from Venice, Italy Martina studied in Liverpool (UK) for her PhD in Nuclear Physics of gamma-ray tracking detectors for nuclear physics experiments. Since May 2005, she is a postdoctoral and, the department! Martina Descovich PhD Education Ph.D. in Nuclear Physics (2003) University

Pouliot, Jean

270

A. Oumbe, Ph. Blanc, T. Ranchin, M. Schroedter-Homscheidt, L. Wald, 2009. A new method for estimating solar energy resource. In Proceedings of the ISRSE 33, held in Stresa, Italy, 4-9 May 2009. Published by Joint Research Center, Ispra,  

E-Print Network [OSTI]

for estimating solar energy resource. In Proceedings of the ISRSE 33, held in Stresa, Italy, 4-9 May 2009. Published by Joint Research Center, Ispra, USBKey, paper 773. A new method for estimating solar energyTech, Center for Energy and Processes, BP 207, 06904 Sophia Antipolis, France 2 German Aerospace Center

Paris-Sud XI, Université de

271

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

272

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

273

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

274

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

275

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

276

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

277

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

278

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

279

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

280

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

282

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

283

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

284

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

285

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

286

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

287

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

288

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

289

GRB 060313: A NEW PARADIGM FOR SHORT-HARD BURSTS? Peter W. A. Roming,1  

E-Print Network [OSTI]

of the prompt emission in the gamma-ray and hard X-ray bands by the Swift BAT and the Konus-Wind instruments of the short-hard burst, GRB 060313. The observations reveal multiple peaks in both the gamma-ray and hard X: gamma rays: bursts Online material: color figures 1. INTRODUCTION Gamma-ray bursts (GRBs) are generally

Zhang, Bing

290

The dolia and the sea-borne commerce of Imperial Rome  

E-Print Network [OSTI]

-section of the Riling ~ in S. Sebastia- no al Vesuvio (NA. Campania). Figure 24. Plan of the town hGCCggm& so-called "Magazzino Annonario"& in Ostia (ROMA& Latium) with dolia ~. .. . . . . . 278 Figure 25. Plan of the h()CCRDE located near the Tiber bank in Ostia... (RONA& Latium) Figure 33. Lead reinforcement from a dolium in the harbour hGCCmum in Narseille (Bouches du Rhhne. Provence-Cbte d'Azur). Figure 34. Lead reinforcement from a dolium in the town ~ in Ostia ("Caseggiato dei dolii", ROMA, La- tium...

Brenni, Gianmarco Mario Raffaele

1985-01-01T23:59:59.000Z

291

A review of "Power and Religion in Baroque Rome: Barberini Cultural Policies." by Peter Rietbergen,  

E-Print Network [OSTI]

formed an essential part of the relentless strategy of family aggrandizement practiced by Urban and his favorite nephew Francesco, the Cardinal-padrone appointed to manage the religious and state apparatus of the papacy. In dealing with culture..., as the publication history in the second chapter shows, his nephew Francesco co-opted the cultural influence of the Church to ensure that the poet-pope?s works were imposed as a set text in religious schools. With the role of Cardinal-padrone, the subject...

2007-01-01T23:59:59.000Z

292

Joining past and present--an addition to the National Museum of Rome  

E-Print Network [OSTI]

Contemporary, architectural forms which are constructed upon the landscape of a pre-existing structure or built fabric can make important connections with our past and give us a vital, visual expression of historical change. ...

Leader, Kristin Karli

1994-01-01T23:59:59.000Z

293

Proceedings of the Second World Landslide Forum 3-7 October 2011, Rome Marc Olivier(1)  

E-Print Network [OSTI]

Sedan(2) , Bernard Monod(1) Contribution of physical modelling to landslide hazard mapping: case Abstract In the frame of the DO-SMS project (created within the European SUDOE partnership), a new of Landslides Induced by Climatic Events, is a software designed to support landslide hazard mapping (Sedan

Paris-Sud XI, Université de

294

Empire of the Imagination: The Power of Public Fictions in Ovid's 'Reader Response' to Augustan Rome  

E-Print Network [OSTI]

in modum siderum vagari in aere et esse sic immortales. ” 87the choice of “vagari in aere,” rather than “aether” or “879) corresponds with the “aere” of Stoic glory. I refer to

Pandey, Nandini B.

2011-01-01T23:59:59.000Z

295

Final Joint Statement from G-7 Energy Ministers Meeting in Rome |  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGY TAX POLICIES ANDIndustrialEnergyFinal FY 2009 NEUP RD Awards (2).xlsCOVER

296

Empire of the Imagination: The Power of Public Fictions in Ovid's 'Reader Response' to Augustan Rome  

E-Print Network [OSTI]

1974. Water Carriers in Hades: A Study of Catharsis throughultimate punishment in Hades tends to confirm this negativewill eventually join them in Hades. The statement that “none

Pandey, Nandini B.

2011-01-01T23:59:59.000Z

297

Refinery Furnaces Retrofit with Gas Turbines Achieve Both Energy Savings and Emission Reductions  

E-Print Network [OSTI]

REFINERY FURNACES RETROFIT WITH GAS TURBINES ACHIEVE BOTH ENERGY SAVINGS AND EMISSION REDUCTIONS F. Giacobbe*, G. Iaquaniello**, R. G. Minet*, P. Pietrogrande* *KTI Corp., Research and Development Division, Monrovia, California **KTI Sp...A., Rome, Italy ABSTRACT Integrating gas turbines with refinery furnaces can be a cost effective means of reducing NO emissions while also generating electricity ~t an attractive heat rate. Design considerations and system costs are presented...

Giacobbe, F.; Iaquaniello, G.; Minet, R. G.; Pietrogrande, P.

298

Gas Turbine Fired Heater Integration: Achieve Significant Energy Savings  

E-Print Network [OSTI]

GAS TURBINE FIRED HEATER INTEGRATION: ACHIEVE SIGNIFICANT ENERGY SAVINGS G. Iaquaniello**, P. Pietrogrande* *KTI Corp., Research and Development Division, Monrovia, California **KTI SpA, Rome, Italy ABSTRAer Faster payout will result if gas... as in steam turbines. A specific example of how cogeneration can work in this way is in the integration of a gas turbine with a fired heater as shown in Figure 2. Electrical or mechanical power is delivered by the gas turbine while the exhaust combustion...

Iaquaniello, G.; Pietrogrande, P.

299

A review of "Privacy, Playreading, and Women’s Closet Drama, 1550-1700." by Marta Straznicky  

E-Print Network [OSTI]

in Renaissance and Counter- Reformation Italy. Cambridge: Cambridge University Press, 2003. xvi + 437 pp. + 42 illus. $90.00. Review by THOMAS WORCESTER, COLLEGE OF THE HOLY CROSS. Vernacular chronicles of three convents form the basis of this study: Santa... Maria delle Vergini (Venice), known as Le Vergini; Santa Maria Annunziata (Florence), known as Le Murate; Santi Cosma e Damiano (Rome), known as San Cosimato. The chronicler of Le Vergini, a house of canonesses, was an anonymous member (or several...

Nancy M. Bunker

2005-01-01T23:59:59.000Z

300

THE HOLY SEE, SOCIAL JUSTICE, AND INTERNATIONAL TRADE LAW: ASSESSING THE SOCIAL MISSION OF THE CHURCH IN THE GATT-WTO SYSTEM  

E-Print Network [OSTI]

in one way or the other. ix List of Tables Figure 1: Map of Rome (Italy) & Holy See logo .............................................................. 10 Figure 2: Images of Catholic Social Justice.... 3 Chapter 6, Critique of the Holy See in International Trade, highlights key international trade law issues to which the Holy See has exerted enormous energy through its social doctrine and other matters that border on international trade...

Ihuoma, Alphonsus Anaele Iyke

2014-05-31T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Roman Colonial Landscapes: Interamna Lirenas and its territory through Antiquity  

E-Print Network [OSTI]

-71). Pioneering work was done in the South Etruria Survey organized by the British School at Rome (BSR), which paved the way for many more survey projects in Italy.2 Landscape archaeology, which is actively engaged with other disciplines (e.g. the natural... (Hopkins 1978: 68-69 table 1.2). An examination of the relative trends for farms and villages (settlement types usually related to a primarily free population) extrapolated from twenty-seven survey areas across Italy reveals that more often than...

Bellini, Giovanna; Launaro, Alessandro; Millett, Martin

2013-10-07T23:59:59.000Z

302

A Review of "The Death of the Baroque and the Rhetoric of Good Taste" by Vernon Hyde Minor  

E-Print Network [OSTI]

Taste. Minor?s focus is eighteenth-century Italy, and in particular the Accademia degli Arcadi, a powerful group of elites who functioned as the tastemakers of settecento Rome. Employing the tools of post- modern critical theory, Minor investigates... to the experiential and sensory visions taught by Ignatius of 180 seventeenth-century news Loyola?s Spiritual Exercises, a text that exercised great influence on the art of seicento Italy. However, during a period in which Cartesian ratio- nality and Jansenism were...

Bentz, Katherine M.

2009-01-01T23:59:59.000Z

303

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

304

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

305

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

306

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

307

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

308

Multilingual Practices of Senegalese Immigrants in Paris and Rome: A Comparative Study of Language Use and Identity Construction  

E-Print Network [OSTI]

seen as representing a ‘fracture linguistique’ (Goudailliergoes on to show that this ‘fracture linguistique’ therefore

Smith, Maya Angela

2013-01-01T23:59:59.000Z

309

Tourism Development in Aqaba and Human Sustainability International Conference, Science and Technology in Archaeology and Conservation, Rome  

E-Print Network [OSTI]

Tourism Development in Aqaba and Human Sustainability 6th International Conference, Science. It is an important issue to compromise between the economic development of the region and the sustainability development plans. Israel's strategies aim at benefiting from regional potentialities (geophysical structure

310

GPU-accelerated Affordance Cueing based on Visual Attention Stefan May, Maria Klodt, Erich Rome and Ralph Breithaupt  

E-Print Network [OSTI]

In the design of robotic agents coping with our real environment, as attempted in the domain of artificial in an object affords lifting if it is capable to attach to the object and to lift it. This affordance

Cremers, Daniel

311

A review of "Court and Politics in Papal Rome." by Gianvittorio Signorotto and Maria A. Visceglia, eds.  

E-Print Network [OSTI]

. On the other hand, those individuals interested in the development of political culture may find their interests piqued but could also feel that many important questions were left unanswered. Gianvittorio Signorotto and Maria Antonietta Visceglia, eds. Court... palace committee. The changing force is put in evidence by the essay of Maria Antonietta Visceglia: ?Factions in the Sacred College in the Sixteenth and Seventeenth Centuries? (99-131). This extensive research proves that in the Roman court ?factions...

Erminia Ardissino

2003-01-01T23:59:59.000Z

312

Den Haag Brussel Londen Parijs Berlijn Stockholm Helsinki Rome Singapore Tokio Peking Seoel New Delhi Washington Silicon Valley  

E-Print Network [OSTI]

- 23-2-2009 Inleiding Lichter en veiliger: het zijn twee trends binnen de robotica die samenkomen industriële robotica beheerst door de grote industriegiganten, waaronder de Duitse bedrijven Kuka en Reiss. Alleen een volledig nieuwe benadering van de robotica kan leiden tot een innovatieve technologie

Stryk, Oskar von

313

A review of "The Urban Development of Rome in the Age of Alexander VII." by Dorothy Habel  

E-Print Network [OSTI]

brings genuine order to Alexander?s ?fugitive? vision by organizing the book by site (in the case of the Corso, the author devotes a chapter to each end of it), and within each site, exploring as much as is known about its pre-Alexandrine topographical... of Alexander VII. Cambridge: Cambridge University Press, 2002. xxi + 223 illus. + 400 pp. $95.00. Review by PHILIP GAVITT, SAINT LOUIS UNIVERSITY. This carefully crafted and meticulously-written book assembles a wealth of visual and documentary evidence...

Philip Gavitt

2006-01-01T23:59:59.000Z

314

10:00-10:30 (Rome Ball Room, Marco Polo Parkside Hotel) 10:30-10:45  

E-Print Network [OSTI]

on Living Consumption of China Rural Residents" 5, "Low-carbon Energy in China" 6, "Policy Options in Industry Structure and the Decomposion of the Aggregate Energy Intensity" 15:30-15:50 15:50-18:00 1, "Energy Saving and Development of Low-Carbon Economy in Jiangsu: Analysis of Actual Status and Policies" 2

Takahashi, Ryo

315

Multilingual Practices of Senegalese Immigrants in Paris and Rome: A Comparative Study of Language Use and Identity Construction  

E-Print Network [OSTI]

French language vigorously, while Abdou Diouf, who succeededaussi le deuxième président, Abdou Diouf, qui vit maintenant

Smith, Maya Angela

2013-01-01T23:59:59.000Z

316

Philae  

E-Print Network [OSTI]

and Boston: Brill. Hoffmann, Friedhelm, Martina Minas-under Rome’s supremacy (Hoffmann et al. 2009). To the east

Kockelmann, Holger

2012-01-01T23:59:59.000Z

317

Financing future power generation in Italy  

SciTech Connect (OSTI)

Under Italian law, independent power generation fueled by renewable and so-called ``assimilated'' sources must be given incentives. To implement this provision, a resolution known as ``CIP 6'' and a decree setting forth the procedure to sell such electricity to ENEL were issued. CIP 6 has recently been revoked and new incentives have been announced. In the meantime, CIP 6 continues to apply to various projects which have been approved but not yet constructed.

Esposito, P.

1998-07-01T23:59:59.000Z

318

Editor: Alberto Broggi University of Pavia, Italy  

E-Print Network [OSTI]

, the pre- dicted departure times of buses at specific locations throughout a transit region. King County the Seattle pilot project with data from the Portland Tri-Met transit agency with minimal effort. The format

319

July 1-4, 2003 Bari, Italy  

E-Print Network [OSTI]

in this proceedings include Ric Jensen of the Texas Water Resources Institute and Jennifer Jacobs of SSL, who helped

320

ERASMUS TRAINEESHIP in Italy under Erasmus+ Programme  

E-Print Network [OSTI]

in sustainable architecture. The group experiments natural and low-cost technologies even in emergency contexts and skills of sustainable architecture technics, low-cost technologies, opportunity to participate Beyond Architecture Group Address inc post code c/o Forte Fanfulla Via Fanfulla da Lodi 5, 00176 Roma

Robbiano, Lorenzo

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Braudel’s Mediterranean and Italy  

E-Print Network [OSTI]

della Sera, “É morto a Parigi, a 83 anni, il maestro delle ‘totale; Si é spento a Parigi ad 83 anni il piú prestigiosodel cielo; É morto a Parigi a 83 anni lo storico Fernand

Marino, John A.

2010-01-01T23:59:59.000Z

322

Bank of Italy | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine: EnergyAustin EnergyBacliff,BallengerEnergyNIES Low-CarbonCase Studies

323

AMERICAN FISHES IN ITALY By Giuseppe Besana  

E-Print Network [OSTI]

of their abundance, river perch, tench, roach, pike, bleak, eel, and burbot. Tables I, II, III, and IV show

324

Italy Geothermal Region | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen Energy2005) | OpenIssaquena County, Mississippi:

325

Italy Joint Statement | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeatMulti-Dimensionalthe10 DOE VehicleStationaryLaboratory,Iowa9: What areIt's

326

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

327

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

328

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

329

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

330

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

331

A review of "Architecture as Performance in Seventeenth-Century Europe: Court Ritual in Modena, Rome, and Paris." by Alice Jarrard,  

E-Print Network [OSTI]

of patronage in the secular court. Francesco remains a pivotal figure in the d?Este family, and thus provides a case study for Jarrard?s ideas. Despite Francesco d?Este?s importance, how- ever, he has long been characterized by scholars as ?feckless? (Brown..., 86), ?frivolous? (Haskell, 63), and one who demonstrated a certain ?prudishness? (Southern, 88) in his patronage. How could this be true, given his importance in the world stage at this time period? Jarrard argues that Francesco, in fact, set...

Allison Lee Palmer

2005-01-01T23:59:59.000Z

332

A review of "Art History in the Age of Bellori: Scholarship and Cultural Politics in Seventeenth-Century Rome" by Janis Bell and Thomas Willette, eds.  

E-Print Network [OSTI]

antiquarian, legitimated by the preferment of Queen Christina of Sweden and Popes Clement X and Alexander VIII. It is telling that, as Janis Bell suggests in her extensive introduction, Bellori had a constant ?concern for quality and standards? (3... opportunity ?to monopolize the antiquities market? (75). When he gained the patronage of Queen Christina of Sweden, as Tomaso Montanari points out, Bellori?s continuing advancement further enhanced the standing of his publications. Indeed, by writing works...

Michael J. Redmond

2004-01-01T23:59:59.000Z

333

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

334

People, Policy, and Perpetuity: Sustainability Indicators of Bangladesh Forestry  

E-Print Network [OSTI]

National Conference on Forestry, Dhaka, Bangladesh. FAO. (Tropical forest resources, FAO Forestry Paper 30. Rome: FAO.FAO. (1995). Forestry statistics today for tomorrow. Rome:

Ali, Mohammed; Kabir, M. A.; Hoque, A.T.M. Rafiqul

2006-01-01T23:59:59.000Z

335

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

336

2009 International Energy Workshop Fondazione Giorgio Cini, Venice, Italy  

E-Print Network [OSTI]

of the impacts under future climate change on the energy systems with the POLES model Silvana Mima Patrick Criqui weather events, climate change is expected to have major impacts on economic systems, including energy. Understanding the climate change-energy nexus is becoming an emerging issue of national and international

Boyer, Edmond

337

Mapping Metageographies: The Cartographic Invention of Italy and the Mediterranean  

E-Print Network [OSTI]

Finally, they invaded Egypt. However, when the EmperorsArmenia, Assyria, Arabia and Egypt have come under Roman

della Dora, Veronica

2010-01-01T23:59:59.000Z

338

greece and italy An Artistic and Literary Odyssey  

E-Print Network [OSTI]

: the Bronze Age Aegean kingdoms, Archaic and Classical Greece, pre-Roman Etruria, the early Roman Empire Italian; others, drawing. In the winter ("Renaissance") we focus on the Roman appropriation of Greek art

339

Transformed materials : a material research center in Milan, Italy  

E-Print Network [OSTI]

[Transformed Materials] is an exploration into today's design methodologies of architecture production. The emergence of architectural form is questioned in relation to the temporal state of design intent and the physical ...

Skerry, Nathaniel S. (Nathaniel Standish), 1971-

2002-01-01T23:59:59.000Z

340

The Cenozoic Tectonic History of the Calabrian Orogen, Southern Italy  

E-Print Network [OSTI]

City, northern California: Sedimentology, v. 36, p. 471-495.continental margins: Sedimentology, v. 56, p. 267– Ogniben,

Shimabukuro, David Haruo

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

The Cenozoic Tectonic History of the Calabrian Orogen, Southern Italy  

E-Print Network [OSTI]

geothermal gradient (England and Thompson, 1984; Spear and Peacock, 1989). When collision occurs, the cooling

Shimabukuro, David Haruo

2011-01-01T23:59:59.000Z

342

Foreign Fishery Developments Aid Eyed for Italy's Ailing Marine Fishery  

E-Print Network [OSTI]

wholesale market prices, exvessel prices, landings, imports, and move- ments of fishery products both in wholesale prices for fresh and frozen fishery products traded in New York merchandising centers. The Boston in selected New England ports, Chicago market receipts, and frozen wholesale prices for the New England

343

Family Matters: Testing the Effect of Political Connections in Italy  

E-Print Network [OSTI]

effect on stock returns. Taking stock performance as a proxySudden deaths: Taking stock of political connections,”

Asquer, Raffaele; Calderoni, Federico

2011-01-01T23:59:59.000Z

344

aeolian islands italy: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de 14 Natural Hazards and Earth System Sciences Tsunami generation in Stromboli island and impact on the CiteSeer Summary: Abstract. Stromboli is one of the most active...

345

UPGRADING OF WASTE-TO-ENERGY PLANT IN BRESCIA, ITALY  

E-Print Network [OSTI]

and district heating, gas supply, waste collection, treatment and disposal, and wastewa- ter treatment. Brescia was one of the first cities to have a well-established district heating net- work. Today, the waste

Columbia University

346

Contemporary Italian Novels on Chinese Immigration to Italy  

E-Print Network [OSTI]

Durante i cinque anni in cui ho studiato a Parigi,Parigi mi ha detto che dovevo vivere in modo romantico, con

Zhang, Gaoheng

2013-01-01T23:59:59.000Z

347

EUDEEP (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS Corp JumpESVEUDEEP (SmartEUDEEP

348

BeAware (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine:Barbers Point Housing,Illinois:CountyNew York:Bayport,Baywood,

349

Italy Highly Enriched Uranium and Plutonium Removals | National Nuclear  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickrinformation for andFuel-Efficient Engines |Iron isCancerFuelIt

350

Italy Nuclear Security Summit: Fact Sheet | National Nuclear Security  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickrinformation for andFuel-Efficient Engines |Iron

351

BeyWatch (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: Energy ResourcesJersey: EnergyBerthoud,Biodiesel Place: Orem,BeyWatch Country

352

Geothermal Literature Review At International Geothermal Area, Italy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation, searchGeauga County,Information(EC-LEDS)Et Al.,(Ranalli & Rybach,

353

Address (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 SouthWaterBrasil Jump to:Iowa ASHRAEAddis, LA) Jump to:Vermont:Address

354

United States and Italy Sign Nuclear Energy Agreements | Department of  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of EnergyofProject is on Track| DepartmentPinakin2Nuclear Damage |

355

Emobility (Smart Grid Project) (Pisa, Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model |Rural

356

Emobility (Smart Grid Project) (Milan, Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classifiedProject) |Emeryville, California:Emmet,Emmons

357

Eprice (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It isInformation ContractsCGNPCEolian Renewable EnergyEpochEprice

358

Evidence Of Incremental Growth In The Vulsinian Calderas (Central Italy) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It isInformationexplains a4Evendale, Ohio:Field From SeismicOpen

359

Italy's Colonial Futures: Colonial Inertia and Postcolonial Capital in Asmara  

E-Print Network [OSTI]

per l’Africa e l’Oriente. Battaglia, Roberto. 1958. La primaLaterza. ---. 1996. “Una lunga battaglia per la verità. ” Inthe standard works remain Battaglia (1958), Del Boca (1976),

Fuller, Mia

2011-01-01T23:59:59.000Z

360

Italy in the Mediterranean Today: A New Critical Topography  

E-Print Network [OSTI]

of Pontecorvo’s La battaglia di Algeri as a controversialof Defense’s use of La battaglia, becomes central to the

Fogu, Claudio; Re, Lucia

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

SEEP2010 Conference Proceedings, June 29th , Bari, ITALY  

E-Print Network [OSTI]

.poggi@polito.it, pierluigi.claps@polito.it) Abstract: In this study we focus on energy production by micro-hydro plants (MHPs renovation. Keywords: Micro-hydro, hydroelectric potential, water distribution systems, measure of financial, the possibility of energy production from micro-hydro systems takes a role of main interest. In this paper we

Poggi, Davide

362

Structure and deformation mechanisms along the Tonale Line, n. Italy  

E-Print Network [OSTI]

and Jean Kiefer. Finally, I express my appreciation to my friend and husband, Jeffrey We1ker, who gave me strength and encouragement when I needed it the most. Financial support for this study was provided by U. S. G. S. research grants G-981 and 14...-axis pole figure of a concordant quartz vein from a Tonale Series mylonite. 38 15 Lower-hemi sphere, equal-area projections of normal s to fractures (Y) from the Tonale Series damaged zone. 46 16 Photomicrograph of a sample from the Tonale Series...

Welker, Mary Clare

1985-01-01T23:59:59.000Z

363

CIEAEM 57 Italie Italy Foire aux ides, Session de Poster Piazza Armerina, Forum of Ideas, Poster Session  

E-Print Network [OSTI]

power stations, hydro energy, solar energy, energy from biomass. Hereunder I enclose one example. Atmosphere movement energy, that is wind energy, is a converted form of solar energy. Wind is generated that only maximum 2% of solar energy reaching Earth is subject to conversion into wind kinetic energy, which

Spagnolo, Filippo

364

Report of GWC participation at Torino, Italy 2 Meeting of MatER (WTERT-Italy), 12-14 September  

E-Print Network [OSTI]

of mercury & Dioxins (on volunteer base). The gate fees of WTE plants are in the range of 50 -110 /ton

365

Proceedings of the 29th National Heat Transfer Conference of Italy, Politecnico di Torino, Torino, Italy, June 2022, 2011 INTRODUCTION  

E-Print Network [OSTI]

trends are known, no information about the local heat transfer coefficient in the evaporator U.D.) has been brazed on the main tube of the condenser section in order to connect the vacuum/filling valve transducer 20 Copper fitting FLOW PATTERNS AND CORRESPONDING LOCAL HEAT TRANSFER COEFFICIENTS IN A PULSATING

Khandekar, Sameer

366

Low Emittance Tuning Studies for SuperB  

SciTech Connect (OSTI)

SuperB[1] is an international project for an asymmetric 2 rings collider at the B mesons cm energy to be built in the Rome area in Italy. The two rings will have very small beam sizes at the Interaction Point and very small emittances, similar to the Linear Collider Damping Rings ones. In particular, the ultra low vertical emittances, 7 pm in the LER and 4 pm in the HER, need a careful study of the misalignment errors effects on the machine performances. Studies on the closed orbit, vertical dispersion and coupling corrections have been carried out in order to specify the maximum allowed errors and to provide a procedure for emittance tuning. A new tool which combines MADX and Matlab routines has been developed, allowing for both corrections and tuning. Results of these studies are presented.

Liuzzo, Simone; /INFN, Pisa; Biagini, Maria; /INFN, Rome; Raimondi, Pantaleo; /INFN, Rome; Donald, Martin; /SLAC

2012-07-06T23:59:59.000Z

367

Preliminary Results of 3D-DDTC Pixel Detectors for the ATLAS Upgrade  

SciTech Connect (OSTI)

3D Silicon sensors fabricated at FBK-irst with the Double-side Double Type Column (DDTC) approach and columnar electrodes only partially etched through p-type substrates were tested in laboratory and in a 1.35 Tesla magnetic field with a 180 GeV pion beam at CERN SPS. The substrate thickness of the sensors is about 200 {mu}m, and different column depths are available, with overlaps between junction columns (etched from the front side) and ohmic columns (etched from the back side) in the range from 110 {mu}m to 150 {mu}m. The devices under test were bump bonded to the ATLAS Pixel readout chip (FEI3) at SELEX SI (Rome, Italy). We report leakage current and noise measurements, results of functional tests with Am{sup 241} {gamma}-ray sources, charge collection tests with Sr90 {beta}-source and an overview of preliminary results from the CERN beam test.

La Rosa, Alessandro; /CERN; Boscardin, M.; /Fond. Bruno Kessler, Povo; Dalla Betta, G.-F.; /Trento U. /INFN, Trento; Darbo, G.; Gemme, C.; /INFN, Genoa; Pernegger, H.; /CERN; Piemonte, C.; /Fond. Bruno Kessler, Povo; Povoli, M.; /Trento U. /INFN, Trento; Ronchin, S.; /Fond. Bruno Kessler, Povo; Zoboli, A.; /Trento U. /INFN, Trento; Zorzi, N.; /Fond. Bruno Kessler, Povo; Bolle, E.; /Oslo U.; Borri, M.; /INFN, Turin /Turin U.; Da Via, C.; /Manchester U.; Dong, S.; /SLAC; Fazio, S.; /Calabria U.; Grenier, P.; /SLAC; Grinstein, S.; /Barcelona, IFAE; Gjersdal, H.; /Oslo U.; Hansson, P.; /SLAC; Huegging, F.; /Bonn U. /SLAC /INFN, Turin /Turin U. /Oslo U. /Bergen U. /Oslo U. /Prague, Tech. U. /Bonn U. /SUNY, Stony Brook /Bonn U. /SLAC; ,

2012-04-04T23:59:59.000Z

368

Brita Bergman (born 30/3 1946) CURRICULUM VITAE 2011 Sign Language Section, Department of Linguistics Abridged version  

E-Print Network [OSTI]

, and 5th Symposia of Sign Language Research (Stockholm 1979, Rome 1983, Lappeenranta 1987, Salamanca 1992

369

Incorporating Japanese Curriculum Materials in Mathematics Content  

E-Print Network [OSTI]

Elementary School Teachers 2009 RCML Annual Meeting Berry College, Rome, GA Tad Watanabe Kennesaw State

Watanabe, Tad

370

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

371

Aristotle's Journey to Europe: A Synthetic History of the Role Played by the Islamic Empire in the Transmission of Western Educational Philosophy Sources from the Fall of Rome through the Medieval Period  

E-Print Network [OSTI]

to reach medieval Europe after the split of the Roman Empire into east and west sectors, but these two potential paths functionally became, instead, dual roadblocks to its transmission. In the western portion of the former Roman Empire...

Cloud, Randall R.

2007-12-12T23:59:59.000Z

372

BERMAN, T., AND W. RODHE. 197 1. Distribution and migration of Peridinium in Lake Kinneret. Mitt.  

E-Print Network [OSTI]

expansion. FAO, Rome. - . In press. A lunar cycle in zooplankton. Ecol- %Y. HASLE, G. R. 1950. Phototactic

Lewis Jr., William M.

373

Paper to be presented at IEEE High Assurance Softwar Software Engineering, Nov. 1999, DC. UML--Based Analysis of Embedded Systems  

E-Print Network [OSTI]

­96­1­0298, managed by Air Force's Rome Laboratories, and Eaton Corporation. veloping and modeling embedded systems

Cheng, Betty H.C.

374

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

375

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

376

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

377

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

378

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database  https://github.com/solarpermit/solarpermit/archive/devel.zip 

379

Nonabelian Monopoles  

E-Print Network [OSTI]

Pisa, Italy, International Solvay Institutes, Universit´ePisa, Italy, International Solvay Institutes, Universit´

Auzzi, Roberto

2009-01-01T23:59:59.000Z

380

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

382

Storing Sanctity: Sacristy Reliquary Cupboards in Late Medieval and Renaissance Italy  

E-Print Network [OSTI]

-4: Bartolomeo Bellano, Bernardino of Siena, 1469-1472 Figure 5-5: Bartolomeo Bellano, St. Louis of Toulouse, 1469-1472 Figure 5-6: Lorenzo Canozi, Sts. Bernardino of Siena and Jerome, 1474-1477 Figure 5-7: Lorenzo Canozi, Sts. Anthony of Padua and Francis... of Assisi, 1474-1477 Figure 5-8: Lorenzo Canozi, Sts. Louis of Toulouse and Bonaventure, 1474-1477 Figure 5-9: Bartolomeo Bellano, putto on lower register of reliquary cupboard, 1469-1472 Figure 5-10: Lorenzo Canozi, doors on lower register of reliquary...

Elston, Ashley

383

Stresa, Italy, 25-27 April 2007 SELECTION OF HIGH STRENGTH ENCAPSULANT FOR MEMS DEVICES  

E-Print Network [OSTI]

C and carbon based epoxy resin. It was observed that carbon based epoxy resin has deflection of less is unsuitable as high strength encapsulant. Carbon based epoxy resin is considered the best encapsulation

Paris-Sud XI, Université de

384

Stresa, Italy, 25-27 April 2007 NI-MH BATTERY MODELLING FOR AMBIENT INTELLIGENCE APPLICATIONS  

E-Print Network [OSTI]

, to make comparisons and eventually for the simulations there is a need for a proper battery model and MEMS actuators use mobile power supplies to ensure energy for their operation. These are mostly and lower power consumption. Today even software developers have to take also the battery-aware system

Paris-Sud XI, Université de

385

A review of "English Merchants in Seventeenth Century Italy." by Gigliola Pagano de Divitiis  

E-Print Network [OSTI]

and insubstantial quality that too often mars Italian academic prose. Jonathan Brown and John Elliott, eds. The Sale of the Century: Ar- tistic Relations between Spain and Great Britain, 1604?1655. Madrid: Yale University Press and Museo Nacional del Prado, 2002.... 315 pp. $65 hardback. Review by ELIZABETH R. WRIGHT, UNIVERSITY OF GEORGIA. Art historian Jonathan Brown and historian John Elliott have joined forces to provide an indispensable guide to the political and artistic relationship between Spain...

James Paterson

2003-01-01T23:59:59.000Z

386

A review of "Church, Censorship and Culture in Early Modern Italy." by Gigliola Fragnito, ed.  

E-Print Network [OSTI]

deal with the question of authority in church and state rather than theology or faith per se? (12). Early on, James was affected by Scotch contests among Roman Catholics, Presbyterians, and Epis- copalians; and Doelman speculates that in 1603, James... must have relished the thought of leading an Episcopalian church in England. James was also a religious poet; he enjoyed duBartas and trans- lated a section, Uranie, in which the poet converts from secular to sacred verse in order to achieve the laurel...

Erminia Ardissino

2002-01-01T23:59:59.000Z

387

Stresa, Italy, 26-28 April 2006 POWER PROCESSING CIRCUITS FOR MEMS INERTIAL ENERGY SCAVENGERS  

E-Print Network [OSTI]

on a spring suspension within a frame. When the frame is accelerated, causing relative displacement between which may be electromagnetic (typically a coil and permanent magnet) [1], electrostatic (a variable generators are based around resonant mass-spring systems, although for some applications (particularly

Paris-Sud XI, Université de

388

Stresa, Italy, 26-28 April 2006 A MICRO TURBINE DEVICE WITH ENHANCED  

E-Print Network [OSTI]

reported during test. 1. INTRODUCTION Micro gas turbine engine [1-2] is one of the promising solutions to provide high-density power source for microsystems. We are developing a silicon-based micro gas turbine in micro gas turbine engine, which will generate power output and drive the compressor. The critical

Paris-Sud XI, Université de

389

WORKSHOP REPORT FOR THE ENTERFACE WORKSHOP IN GENOVA, ITALY 2009 1 Bacteria Hunt  

E-Print Network [OSTI]

Abstract--Brain-Computer Interfaces (BCIs) allow users to control applications by brain activity. Among between the two BCI paradigms. Index Terms--brain-computer interfaces, computer games, multimodal interaction. ! 1 INTRODUCTION The study of Brain-Computer Interfaces (BCI) is a multidisciplinary field which

Dupont, Stéphane

390

Stresa, Italy, 26-28 April 2006 THERMOELECTRIC AND MICROBATTERY HYBRID SYSTEM WITH ITS POWER  

E-Print Network [OSTI]

developed. It consists in hybriding an energy storage system (thin film solid state battery change depending on the outside conditions) and required by the thin film solid state battery conversion and energy storage. A hybrid system comprising a thermoelectric generator, a thin film solid state

Paris-Sud XI, Université de

391

The Intersection of Sculpture, Scripture and Salvation at the Romanesque Cathedral in Sovana, Italy  

E-Print Network [OSTI]

-1183, recto: Baldwin IV; verso: Holy Sepulcher, Tower of David (center), Dome of the Rock. Sources: www.numismatics.org. Figure 123: II Maccabees with a scene of John Hyrcanus riding to defend Jerusalem. Paris BNF MS n. acq. Fr. 1404, 226v. Source: Folda... and zinc that were later mined providing a source of wealth to the region.9 Blackwell Publishers Inc., 1998), 16...

Greenwood, Jill Vessely

2009-08-28T23:59:59.000Z

392

SINGLE MOLECULE APPROACHES TO BIOLOGY, 2010 GORDON RESEARCH CONFERENCE, JUNE 27-JULY 2, 2010, ITALY  

SciTech Connect (OSTI)

The 2010 Gordon Conference on Single-Molecule Approaches to Biology focuses on cutting-edge research in single-molecule science. Tremendous technical developments have made it possible to detect, identify, track, and manipulate single biomolecules in an ambient environment or even in a live cell. Single-molecule approaches have changed the way many biological problems are addressed, and new knowledge derived from these approaches continues to emerge. The ability of single-molecule approaches to avoid ensemble averaging and to capture transient intermediates and heterogeneous behavior renders them particularly powerful in elucidating mechanisms of biomolecular machines: what they do, how they work individually, how they work together, and finally, how they work inside live cells. The burgeoning use of single-molecule methods to elucidate biological problems is a highly multidisciplinary pursuit, involving both force- and fluorescence-based methods, the most up-to-date advances in microscopy, innovative biological and chemical approaches, and nanotechnology tools. This conference seeks to bring together top experts in molecular and cell biology with innovators in the measurement and manipulation of single molecules, and will provide opportunities for junior scientists and graduate students to present their work in poster format and to exchange ideas with leaders in the field. A number of excellent poster presenters will be selected for short oral talks. Topics as diverse as single-molecule sequencing, DNA/RNA/protein interactions, folding machines, cellular biophysics, synthetic biology and bioengineering, force spectroscopy, new method developments, superresolution imaging in cells, and novel probes for single-molecule imaging will be on the program. Additionally, the collegial atmosphere of this Conference, with programmed discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings in the beauty of the Il Ciocco site in Tuscany, provides an avenue for scientists from different disciplines to interact and brainstorm and promotes cross-disciplinary collaborations directed toward compelling biological problems.

Professor William Moerner

2010-07-09T23:59:59.000Z

393

Submitted to 37th European Rotorcraft Forum, Vergiate/Gallarate, Italy, 13 15th September 2011.  

E-Print Network [OSTI]

Air Transport System PAV Personal Air Vehicle PPL Private Pilots License RCAH Rate Command, Attitude

Fua, Pascal

394

Submitted to 37th European Rotorcraft Forum, Vergiate/Gallarate, Italy, 13 15th September 2011.  

E-Print Network [OSTI]

and Space Administration PATS Personal Air Transport System PAV Personal Air Vehicle PPL Private Pilots

395

Olive cultivars field-tested in super-high-density system in southern Italy  

E-Print Network [OSTI]

oil output Cumulative oil production tons/acre 5.68b 5.83bsimilar cumulative oil production. Harvesting efficiency,and mean oil output and cumulative production Fruit

Godini, Angelo

2011-01-01T23:59:59.000Z

396

Robert H. Williams (United States) CONTRIBUTING AUTHORS: Matthew Bunn (United States), Stefano Consonni (Italy),  

E-Print Network [OSTI]

steam turbine tech- nologies--supports this long-term goal. Natural-gas-fired combined cycles offering low costs, high efficiency, and low environmental impacts are being chosen wherever natural gas economy if based on gas turbines and combined cycles rather than on steam turbines. Reciprocating engines

397

E-Print Network 3.0 - aeolian archipelago italy Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- Department of Environmental Sciences, University of Toledo; Toledo, University of - Lake Erie Center Collection: Environmental Sciences and Ecology ; Geosciences 83...

398

(No) Queer Futurism: Prostitutes, Pink Poets, and Politics in Italy from 1913-1918  

E-Print Network [OSTI]

Futurism: Prostitutes, Pink Poets, and Politics in Italyto by many as the “pink poet” because of “his ‘American’of his being a “pink poet”) but limits his queerness to the

Van Ness, Emma K

2010-01-01T23:59:59.000Z

399

Solar energy in Italy: a profile of renewable energy activity in its national context  

SciTech Connect (OSTI)

The following are included: country overview; energy summary; Italian Republic-geopolitical, economic, and cultural aspects; the energy profile; imported energy sources; solar energy research and development; solar energy organizations; solar energy related legislation and administration policies; and international agreements, contacts, manufacturers, and projects. (MHR)

Shea, C.A.

1980-12-01T23:59:59.000Z

400

Waste management health risk assessment: A case study of a solid waste landfill in South Italy  

SciTech Connect (OSTI)

An integrated risk assessment study has been performed in an area within 5 km from a landfill that accepts non hazardous waste. The risk assessment was based on measured emissions and maximum chronic population exposure, for both children and adults, to contaminated air, some foods and soil. The toxic effects assessed were limited to the main known carcinogenic compounds emitted from landfills coming both from landfill gas torch combustion (e.g., dioxins, furans and polycyclic aromatic hydrocarbons, PAHs) and from diffusive emissions (vinyl chloride monomer, VCM). Risk assessment has been performed both for carcinogenic and non-carcinogenic effects. Results indicate that cancer and non-cancer effects risk (hazard index, HI) are largely below the values accepted from the main international agencies (e.g., WHO, US EPA) and national legislation ( and ).

Davoli, E., E-mail: enrico.davoli@marionegri.i [Istituto di Ricerche Farmacologiche 'Mario Negri', Environmental Health Sciences Department, Via Giuseppe La Masa 19, 20156 Milano (Italy); Fattore, E.; Paiano, V.; Colombo, A.; Palmiotto, M. [Istituto di Ricerche Farmacologiche 'Mario Negri', Environmental Health Sciences Department, Via Giuseppe La Masa 19, 20156 Milano (Italy); Rossi, A.N.; Il Grande, M. [Progress S.r.l., Via Nicola A. Porpora 147, 20131 Milano (Italy); Fanelli, R. [Istituto di Ricerche Farmacologiche 'Mario Negri', Environmental Health Sciences Department, Via Giuseppe La Masa 19, 20156 Milano (Italy)

2010-08-15T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Stresa, Italy, 25-27 April 2007 NOVEL BONDING TECHNOLOGIES FOR WAFER-LEVEL TRANSPARENT  

E-Print Network [OSTI]

OF MOEMS Herwig Kirchberger, Paul Lindner, Markus Wimplinger EV Group, A-4782 St. Florian, DI Erich), enjoys the potential to account for almost one third of the total MEMS sales by 2010, mainly driven annual growth rate (CAGR) of MEMS device sales of around 13% over the next 5 years, which is mainly

Boyer, Edmond

402

Database Security Sabrina De Capitani di Vimercati, Dip. Elettronica, Universit a di Brescia, 25123 Brescia, Italy  

E-Print Network [OSTI]

data stored in a database is called a database management system DBMS. A database can be seen at di of the underlying operating system see Figure 2. Beside access and processing functionalities, each DBMS must also system, one may think that a DBMS does not need to deal with security as security functionalities

Samarati, Pierangela

403

THE EMILIA THRUST EARTHQUAKE OF 20 MAY 2012 (NORTHERN ITALY): STRONG MOTION AND GEOLOGICAL OBSERVATIONS  

E-Print Network [OSTI]

). The RAN includes both the stations of an historical network, located inside ENEL electric transformer the sites for the new stations, and that ensure electrical power to the same stations. #12;2 Today, thanks

Fleskes, Joe

404

2010 GORDON RESEARCH CONFERENCE ON MITOCHONDRIA & CHLOROPLASTS, LUCCA, ITALY, JULY 11-16, 2010  

SciTech Connect (OSTI)

The 2010 GRC on Mitochondria & Chloroplasts will assemble an international group of molecular, structural and cellular biologists, biochemists and geneticists investigating a broad spectrum of fundamental problems related to the biology of these organelles in animal, plant and fungal cells. This field has witnessed an extraordinary expansion in recent years, fueled by the discovery of the role of mitochondria in human disease and ageing, and of the synergy of chloroplasts and mitochondria in energetic output, the identification of novel factors involved in organelle division, movement, signaling and acclimation to changing environmental conditions, and by the powerful tools of organelle proteomics. The 2010 GRC will highlight advances in the elucidation of molecular mechanisms of organelle biogenesis including regulation of genome structure, evolution and expression, organellar protein import, assembly and turnover of respiratory and photosynthetic complexes, bidirectional signaling between organelles and nucleus, organelle morphology and dynamics, and the integration of cellular metabolism. We will also explore progress in mechanisms of disease and ageing/ senescence in animals and plants. The organellar field has forged new fronts toward a global and comprehensive understanding of mitochondrial and chloroplast biology at the molecular level. Many of the molecules under study in model organisms are responsible for human diseases, providing significant impetus for a meeting that encourages interactions between mammalian, fungal and plant organellar biologists.

Alice Barkan

2010-07-16T23:59:59.000Z

405

ECCM15 -15TH EUROPEAN CONFERENCE ON COMPOSITE MATERIALS, Venice, Italy, 24-28 June 2012  

E-Print Network [OSTI]

tomography (CT) was used to study the effects of particle toughening within unidirectional carbon fibre reinforced polymer (CFRP) materials subjected to impact damage, followed by ex situ CT of compression after beneath the surface of the material [2]. Whilst this internal damage can be detected with ultrasonic

406

Via Po, 53 10124 Torino (Italy) Tel. (+39) 011 6704917 -Fax (+39) 011 6703895  

E-Print Network [OSTI]

/2010 Università di Torino halshs-00923675,version1-3Jan2014 Author manuscript, published in "Handbook Chapter prepared for the Handbook on the Economics and Theory of the Firm or the one concerning the improvements in steam engines, already called

Paris-Sud XI, Université de

407

Prati di Ronco (Premana -LC, Italy) is a mountain area affected by a landslide phenomenon.  

E-Print Network [OSTI]

the environment through solar panels and react to changes when needed. Advanced Research Intelligent Embedded with the sliding phenomenon. The sensor platform can be enriched on demand. The unit, that builds a wireless sensor in displacement among units. The information is routed to a server for data storage, visualization and decision

Alippi, Cesare

408

Major element chemistry in inner alpine snowpacks (Aosta Valley Region, NW Italy) Gianluca Filippa a,  

E-Print Network [OSTI]

Centre on Natural Risks in Mountain and Hilly Enviroments) Università degli Studi di Torino, via L. Da. In the Aosta Valley, local biogenic pollution rather than long-range transport may contribute substantially of strong anthropogenic pollution or dust deposition. Due to the fact that inner alpine valleys cover a non

Williams, Mark W.

409

(No) Queer Futurism: Prostitutes, Pink Poets, and Politics in Italy from 1913-1918  

E-Print Network [OSTI]

conflagrazione” from “La guerra, sola igiene del mondo” (in Marinetti’s “Guerra, sola igiene del mondo” (Edizioni

Van Ness, Emma K

2010-01-01T23:59:59.000Z

410

Belgirate, Italy, 28-30 September 2005 BONDING SEMICONDUCTOR LASER CHIPS  

E-Print Network [OSTI]

without thermo- electric cooler, so called uncooled modules, establish themselves as a cost will discuss here a model to determine the substrate material giving the best chip reliability expectations for GaAs and InP laser chips. In that respect, a comparison of the thermo-mechanical stresses induced

Paris-Sud XI, Université de

411

Belgirate, Italy, 28-30 September 2005 THERMIONIC REFRIGERATION WITH PLANAR AND NONPLANAR ELECTRODES  

E-Print Network [OSTI]

thermoelectric materials is still low. The fig- ure of merit for these materials Z T = S2 T / with S the thermo-power (Seebeck coefficient), the electrical con- ductivity, the thermal conductivity and T the average be used as generators. A large demand of micro-structured generators [5] and coolers is expected

Paris-Sud XI, Université de

412

Adv. Sci. Technol. (Faenza, Italy) 33, 1037-1050 (2003) TECHNOLOGICAL CHALLENGES FOR TRANSPARENT CONDUCTORS  

E-Print Network [OSTI]

in part by the US National Renewable Energy Laboratory. #12;2 2. OPTICAL AND ELECTRONIC PROPERTIES 2 of etching; and factors affecting their usage: chemical durability, surface roughness, hardness, mechanical in modern technology, such as energy efficient windows, displays, anti-static coatings.1

413

E-Print Network 3.0 - adriatic sea italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

from the Adriatic ... Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin Collection: Environmental Sciences and Ecology 28 Biogeosciences, 4,...

414

ISIT2000, Sorrento, Italy, June 2530, 2000 Constabent Properties of Golay-Davis-Jedwab Sequences  

E-Print Network [OSTI]

, respectively, have completely flat power profile. Extensive computation suggests that bipo- lar GDJ sequences always have flat or near-flat HTs, NHTs and CHTs. It is conjectured that these sequences are the unique. The Constahadamard Transform The Walsh-Hadamard Transform (HT), Ht, is constructed from the direct product of 2-point

Parker, Matthew Geoffrey

415

E-Print Network 3.0 - acireale sicily italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(Translation of Italian text by Lucia Rigamonti Source: Columbia University - Waste-to-Energy Research and Technology Council (WTERT) Collection: Renewable Energy 47...

416

E-Print Network 3.0 - area northern italy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Forest Research Agency of the UK Forestry Commission Collection: Renewable Energy 5 BUILDING STRONG U.S. ARMY CORPS OF ENGINEERS ENGINEERING AND SUPPORT CENTER,...

417

Between Documentary and Neorealism: Marshall Plan Films in Italy (1948-1955)  

E-Print Network [OSTI]

Film Unit Chief) later recalled, “Give Europeans the facts and figures on Marshall Aid, to stimulate industrial and agricultural

Longo, Regina M.

2012-01-01T23:59:59.000Z

418

Assessing the health risks of natural CO2 seeps in Italy  

E-Print Network [OSTI]

risk from surface CO2 seeps. Data were elicited from Googas (17), a web-based catalogue of degassing

Haszeldine, Stuart

419

ECCM15 -15TH EUROPEAN CONFERENCE ON COMPOSITE MATERIALS, Venice, Italy, 24-28 June 2012  

E-Print Network [OSTI]

industries are expanding, notably in the automotive industry. Furthermore, natural fibres have the intrinsic® and Terralin® ) must be characterized. Vacuum moulded Flax/PLA and Flax/PP samples were made, and samples based on sisal, flax, hemp fibres associated to either PLA, PP or epoxy matrix and exposed to distilled

Boyer, Edmond

420

Antonio Pietrangeli, The Director of Women: Feminism, Film Theory and Practice in Postwar Italy  

E-Print Network [OSTI]

Castoro Cinema, 1998. Nietzsche, Friedrich. The Gay Science.Science (New York: Random House, 1974), 316-317. Mulvey, “Visual Pleasure and Narrative Cinema,”

Van Ness, Emma Katherine

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

ECCM15 -15TH EUROPEAN CONFERENCE ON COMPOSITE MATERIALS, Venice, Italy, 24-28 June 2012  

E-Print Network [OSTI]

FATIGUE BEHAVIOR OF WOVEN HEMP/EPOXY COMPOSITE: DAMAGE ANALYSIS D. S. de Vasconcellos1* , F. Touchard1 , L fatigue behavior of a woven hemp/epoxy composite, constituted by seven layers of hemp fabric and an epoxy of recyclable and sustainable composite materials. Recent studies have pointed out hemp fiber composites

Paris-Sud XI, Université de

422

Paolo Podio-Guidugli Universit di Roma TorVergata, Italy  

E-Print Network [OSTI]

.g., laser-induced damage in optical components), · desired, leading to various types of (nondestructive Amplification by Stimulated Emission of Radiation · CW Laser Continuous Wave Laser, produces a continu- ous induces structural damage. · Conventional annealing requires a long heating process in a convection

Gilardi, Gianni

423

Between Documentary and Neorealism: Marshall Plan Films in Italy (1948-1955)  

E-Print Network [OSTI]

Hadley. Bureaucracy, the Marshall Plan, and the NationalUniti. Guerra fredda, Piano Marshall e interventi per ilChristenson, Linda R. , ed. “Marshall Plan Filmography. ”

Longo, Regina M.

2012-01-01T23:59:59.000Z

424

Assessment of the radiological impact of a decommissioning nuclear power plant in Italy  

E-Print Network [OSTI]

The assessment of the radiological impact of a decommissioning Nuclear Power Plant is presented here through the results of an environmental monitoring survey carried out in the area surrounding the Garigliano Power Plant. The levels of radioactivity in soil, water, air and other environmental matrices are shown, in which {\\alpha}, {\\beta} and {\\gamma} activity and {\\gamma} equivalent dose rate are measured. Radioactivity levels of the samples from the Garigliano area are analyzed and then compared to those from a control zone situated more than 100 km away. Moreover, a comparison is made with a previous survey held in 2001. The analyses and comparisons show no significant alteration in the radiological characteristics of the area surroundings the plant, with an overall radioactivity depending mainly from the global fallout and natural sources.

A. Petraglia; C. Sabbarese; M. De Cesare; N. De Cesare; F. Quinto; F. Terrasi; A. D'Onofrio; P. Steier; L. K. Fifield; A. M. Esposito

2012-07-17T23:59:59.000Z

425

Assessment of the radiological impact of a decommissioning nuclear power plant in Italy  

E-Print Network [OSTI]

The assessment of the radiological impact of a decommissioning Nuclear Power Plant is presented here through the results of an environmental monitoring survey carried out in the area surrounding the Garigliano Power Plant. The levels of radioactivity in soil, water, air and other environmental matrices are shown, in which {\\alpha}, {\\beta} and {\\gamma} activity and {\\gamma} equivalent dose rate are measured. Radioactivity levels of the samples from the Garigliano area are analyzed and then compared to those from a control zone situated more than 100 km away. Moreover, a comparison is made with a previous survey held in 2001. The analyses and comparisons show no significant alteration in the radiological characteristics of the area surroundings the plant, with an overall radioactivity depending mainly from the global fallout and natural sources.

Petraglia, A; De Cesare, M; De Cesare, N; Quinto, F; Terrasi, F; D'Onofrio, A; Steier, P; Fifield, L K; Esposito, A M; 10.1051/radiopro/2012010

2012-01-01T23:59:59.000Z

426

A Cinematic Nation: Representation, Regionalism, and the National Question in Postwar Italy  

E-Print Network [OSTI]

with little industrial development outside of localized metallurgical, mining, and handcraft endeavors centered in Naples and Palermo. Some citrus crops and grains were exported to France, Spain, and North America, but ties to northern Italian markets were...

Piepergerdes, Brent Jeffrey

2009-12-14T23:59:59.000Z

427

2006-08-27 Fascinating Nonlinear Physics, ICTP Trieste Italy Jens Juul Rasmussen  

E-Print Network [OSTI]

National Laboratory, Department of Optics and Plasma Research, OPL-128, DK-4000 Roskilde, Denmark #12

428

Oil, Beer, and Snails -Sustainable Forest Management Means More than Just Wood JUL 20 2010 | ITALY  

E-Print Network [OSTI]

, especially in those mountain areas covered by coppice forests. Yet, in the first years of the Programme

429

Joint Statement by the United States and Italy on the 2014 Nuclear Security  

National Nuclear Security Administration (NNSA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartmentNationalRestart of the Review of theOFFICEACMEFUTURE MOBILITYMarch

430

DLC+VIT4IP (Smart Grid Project) (Italy) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin:2003)CrowleyEnergyMasse) Jump to:DEXA Jump to:DI

431

3D Tomographic Imaging Of The Southern Apennines (Italy)- A Statistical  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende NewSowitec doWinvestFlume Facility JumpApproach To Estimate

432

Stresa, Italy, 25-27 April 2007 STEP-UP CONVERTER FOR ELECTROMAGNETIC VIBRATIONAL ENERGY  

E-Print Network [OSTI]

micro-machined vibration based power generator with diode based voltage multiplier (VM) circuits which the piezoceramic composite beam coupled with a flyback converter circuit and also derived the equivalent circuits and the EM vibration harvesting device. The measured and calculated results of the VM circuits for the

Boyer, Edmond

433

Stresa, Italy, 25-27 April 2007 FABRICATION OF MEM RESONATORS IN THIN SOI  

E-Print Network [OSTI]

resonators [1, 2] but they offer higher levels of integration in electronic circuits. The research effort to as nanogaps), as this allows reduction of the resonator's equivalent resistance, which is given for small to excite the resonator. The resonators are designed to vibrate in a Lamé­mode and the resonance frequencies

Paris-Sud XI, Université de

434

U.S. and Italy Sign Agreement to Collaborate on Carbon Capture...  

Office of Environmental Management (EM)

while coping with urgent energy security and climate challenges. The Clean Coal and Carbon Sequestration Annex signed between the two countries is part of the Obama...

435

Exile vs. Exodus: Nationalism and Gendered Migration from Ukraine to Italy and California  

E-Print Network [OSTI]

by Russian president Vladimir Putin and Ukraine’s incumbentAs recently as April 2008, Putin described Ukraine as an “

Solari, Cinzia

2010-01-01T23:59:59.000Z

436

3-D Density Model Of Mt Etna Volcano (Southern Italy) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place:ReferenceEditWisconsin:YBR14InformationInformation Of Mt

437

Massachusetts Institute of Technology Elba XI Workshop, Elba, Italy, June 23, 10  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces andMapping the Nanoscale Landscape PrintSurveyMaryspectrometry05/20102010

438

Analysis Of Multiple Scattering At Vesuvius Volcano, Italy, Using Data Of  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300Algoil JumpAltergyExperiments | OpenThe Tomoves Active Seismic Experiment |

439

U.S. and Italy Sign Agreement to Collaborate on Carbon Capture and Storage  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. of Energy, Office ofNuclearProtocolof

440

Assets in Action "A Night in Italy" fundraiser on October 20  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAbout theOFFICEAmesApplication2ArgonneAssembly ofReuse - DOEAssets in

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

United States and Italy Sign Agreements to Advance Developments in Nuclear  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' Research Petroleum ReserveDepartment ofEnergy, Office ofNuclear Damage |Energy |

442

Antonio Pietrangeli, The Director of Women: Feminism, Film Theory and Practice in Postwar Italy  

E-Print Network [OSTI]

gawks at the girls in bikinis. Afraid to ask for a hotelthe man who buys her the bikini (she told him he could onlywho, clad in her newly-won bikini, stands on a swing in the

Van Ness, Emma Katherine

2013-01-01T23:59:59.000Z

443

Representing the Past. Social Anthropology and History of Art in a Holy Drama in Northern Italy  

E-Print Network [OSTI]

austere and medieval, albeit with new houses and facilities, and is hemmed in by high mountains. Through had given the town some limited wealth up until the 18th century, has long been abandoned, and its

Qian, Ning

444

Italy Communication in Milan Austria and Germany PR in Vienna and Munich  

E-Print Network [OSTI]

Summer 2015 Argentina Buenos Aires Brazil Curitiba China Shanghai England London Israel and Palestine Argentina Buenos Aires England London Short-term summer program: Milan Year-long UK Oxford Academic Year Corporate Communication, Information Policy and Governance, Media and Communication Mexico Universidad de

Lien, Jyh-Ming

445

WHO Report on the Global Tobacco Epidemic 2011: Warning about the dangers of tobacco  

E-Print Network [OSTI]

Ireland Israel Italy — V Kazakhstan Kyrgyzstan LatviaIreland Israel Italy Kazakhstan Kyrgyzstan Latvia LithuaniaIreland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania

WHO

2011-01-01T23:59:59.000Z

446

Central Banks and Gold Puzzles  

E-Print Network [OSTI]

Greece, Ireland, Italy, Netherland, Portugal, Spain,Indicators. ” For Italy and Netherland, general governmentGreece, Ireland, Italy, Netherland, Portugal, Spain,

Aizenman, Joshua; Inoue, Kenta

2012-01-01T23:59:59.000Z

447

Overview of ASDEX Upgrade Results Development of integrated operating scenarios for ITER  

E-Print Network [OSTI]

, Romania; Consorzio RFX, Padova, Italy; Centro de Fusão Nuclear, IST Lisbon, Portugal; IFP Milano, Italy

448

Implicit Formality:  Keesing’s Challenge and Its Significance for European Kinship  

E-Print Network [OSTI]

south and east” (Italy, Croatia, Poland, Russia). 1 Althoughfor cousins (Russia, Poland, Croatia, and part of Italy) are

Heady, Patrick

2013-01-01T23:59:59.000Z

449

Indoor carbon dioxide concentrations and sick building syndrome symptoms in the BASE study revisited: Analyses of the 100 building dataset  

E-Print Network [OSTI]

Proceedings of Healthy Buildings '95, Milan, Italy, 3:1305-Proceedings of Healthy Buildings '95, Milan, Italy, Vol 3,

Erdmann, Christine A.; Steiner, Kate C.; Apte, Michael G.

2002-01-01T23:59:59.000Z

450

Reducing indoor residential exposures to outdoor pollutants  

E-Print Network [OSTI]

Proceedings of Healthy Buildings ‘95, Milan, Italy, Vol. 3,Proceedings of Healthy Buildings ’95, Milan, Italy, Vol.

Sherman, Max H.; Matson, Nance E.

2003-01-01T23:59:59.000Z

451

Designing Empire: Austria and the Applied Arts, 1864-1918  

E-Print Network [OSTI]

and Antonio D'Auria. Josef Hoffmann e la Wiener Werkstätte.Alessandra Perizzi. Josef Hoffmann: tempo e geometria. Rome:University Press, 1992. Hoffmann, Josef. "Architektonisches

Rahman, Sabrina Karim

2010-01-01T23:59:59.000Z

452

E-Print Network 3.0 - area food prices Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of copies. Delegates and observers are kindly requested to Summary: OF CLIMATE CHANGE AND BIOENERGY Rome, 3 - 5 June 2008 SOARING FOOD PRICES: FACTS, PERSPECTIVES, IMPACTS... .What...

453

Augustus, Egypt, and Propaganda.  

E-Print Network [OSTI]

??Augustus was a master of propaganda who employed Ancient and Hellenized Egypt as a means to legitimize his newly acquired power in Rome after the… (more)

Broadbent, Valerie

2012-01-01T23:59:59.000Z

454

People, Policy, and Perpetuity: Sustainability Indicators of Bangladesh Forestry  

E-Print Network [OSTI]

2001). Global Forest Resources Assessment 2000. Rome: FAO.and natural resources assessment. Washington, DC: Worldfigure stated in Forest resource Assessment 2000 (FAO, 2001)

Ali, Mohammed; Kabir, M. A.; Hoque, A.T.M. Rafiqul

2006-01-01T23:59:59.000Z

455

E-Print Network 3.0 - aerospace database published Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

.p.A. Rome, IT Fire Control Systems RADARS Oerlikon Aerospace Inc. Montreal, CA ADATS Missile System Surface Source: Laporte, Claude Y. - Dpartement de gnie logiciel et...

456

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada ...

457

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

458

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

459

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

460

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

462

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

463

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

464

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

465

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

466

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

467

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

468

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

469

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

470

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

471

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

472

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

473

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

474

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

475

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

476

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

477

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

478

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

479

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

480

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

Note: This page contains sample records for the topic "rome italy zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

483

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

484

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

485

affect foreign bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

486

allied irish bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

487

affects higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...

488

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

489

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

490

Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

491

Wind: wind power density maps at 50 m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

492

The New Stakes for National Cinemas, a Word on the Case of Italy, and an Interview with Ivan Cotroneo  

E-Print Network [OSTI]

Anthony- Cristiano.pdf. D’Alessandri, Elena. “Lo stato dihtml. Elena D’Alessandri, “Lo stato di salute del cinemaanno-2012.html. D’Alessandri, “Lo stato di salute del cinema

Cristiano, Anthony

2013-01-01T23:59:59.000Z

493

International Topical Meeting on Nuclear Reactor Thermalhydraulics, NURETH-15 NURETH15-xxx Pisa, Italy, May 12-15, 2013  

E-Print Network [OSTI]

The 15th International Topical Meeting on Nuclear Reactor Thermalhydraulics, NURETH-15 NURETH15-xxx technologies in the context of generation IV nuclear power reactors. In order to improve electric efficiency during last years as a possible energy conversion cycle for Sodium nuclear Fast Reactors (SFRs) [1

Paris-Sud XI, Université de

494

A review of "Monteverdi’s Unruly Women: The Power of Song in Early Modern Italy." by Bonnie Gordon,  

E-Print Network [OSTI]

music accord- ing to our modern understandings of the body, the voice, and musical mean- ing. Jean-No?l Laurenti. Valeurs morales et religieuses sur la sc?ne de l?Acad?mie royale de musique (1663-1737). Geneva: Droz, 2002. 440 pp. CHF 148. Review...

Weaver, Andrew H.

2007-01-01T23:59:59.000Z

495

Waste Growth Challenges Local Democracy. The Politics of Waste between Europe and the Mediterranean: a Focus on Italy  

E-Print Network [OSTI]

treatment (MBT) or indoor composting plants are rarely thethat state-of-the-art composting or anaerobic gassificationfacilities as well as composting plants regained favor, at

Mengozzi, Alessandro

2010-01-01T23:59:59.000Z

496

Harmonisation of indoor material emissions labelling systems in the EU JRC Ispra, Italy, May 19-20, 2005  

E-Print Network [OSTI]

available in France on the environmental properties and on the emissions to indoor air of building products products in France F. Maupetit 1 , O. Ramalho, E. Robine and C. Cochet Centre Scientifique et Technique du-based characteristics of building products. This evaluation scheme has been introduced in France in 2003, on a voluntary

Paris-Sud XI, Université de

497

Belgirate, Italy, 28-30 September 2005 RAREFIED GAS HEAT TRANSFER BETWEEN A NANOMETRIC TIP AND A SAMPLE  

E-Print Network [OSTI]

AND A SAMPLE Pierre-Olivier Chapuis1 , Jean-Jacques Greffet1 , Karl Joulain2 et Sebastian Volz1 1 Laboratoire d'Energetique flux on the sample surface: this problem has to be solved in the intermediate regime. 3D effects have and time dependent problems. Figure 1. A skip of the tip. Typical lengths used are l=40 nm and h=20 nm

Paris-Sud XI, Université de

498

Comparative approach to ethnic identity and urban settlement: Visigothic Spain, Lombard Italy and Merovingian Francia, c. 565-774 AD   

E-Print Network [OSTI]

The traditional social and political divisions between the Late Roman and ‘Barbarian’ inhabitants of the post-Roman successor states has in the last few decades been challenged from several new angles. In this thesis, a ...

Ferguson, Craig Alan

2012-06-28T23:59:59.000Z

499

Proceedings of ASME 2012 Internal Combustion Engine Division Spring Technical Conference May 69, 2012, Torino, Piemonte, Italy  

E-Print Network [OSTI]

- CYLINDER HCCI ENGINE WITH HIGH RESIDUALS Erik Hellstr¨om, Jacob Larimore, and Anna Stefanopoulou University ABSTRACT Cyclic variability (CV) in lean HCCI combustion at the lim- its of operation is a known phenomenon of lean HCCI operation with negative valve overlap (nvo). A com- bustion analysis method that estimates

Stefanopoulou, Anna

500

Trade Unions and the Origins of the Union-Based Welfare State in Italy (1950s-1970s)  

E-Print Network [OSTI]

della cittadinanza e governo del conflitto: le politichedella cittadinanza e governo del conflitto: le politiche

Agnoletto, Stefano

2012-01-01T23:59:59.000Z