Sample records for rm te rm

  1. Measurement of jet $p_{\\rm T}$ spectra and $R_{\\rm AA}$ in pp and Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 2.76 TeV with the ALICE detector

    E-Print Network [OSTI]

    Salvatore Aiola; for the ALICE Collaboration

    2014-12-08T23:59:59.000Z

    Hard-scattered partons provide an ideal probe for the study of the Quark-Gluon Plasma because they are produced prior to the formation of the QCD medium in heavy-ion collisions. Jet production is therefore susceptible to modifications induced by the presence of the medium ("jet quenching"). Both RHIC and LHC experiments have provided compelling evidence of jet quenching. Jets are reconstructed in ALICE utilizing the central tracking system for the charged constituents and the Electromagnetic Calorimeter for the neutral constituents. Jet spectra are reported for central (0-10%) and semi-central (10-30%) Pb-Pb events at $\\sqrt{s_{\\rm NN}}=2.76$ TeV. The nuclear modification factor, determined using a pp baseline measured at the same collisional energy, shows a strong suppression of jet production in central Pb-Pb collisions with the expected centrality ordering. Observations are in qualitative agreement with medium-induced energy loss models. Furthermore, indication of a path-length dependence of jet suppression is inferred from measurements of the yields relative to the orientation of the event plane.

  2. Sandia National Laboratories: RM3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RM3 Sandia, NREL Release Wave Energy Converter Modeling and Simulation Code: WEC-Sim On July 29, 2014, in Computational Modeling & Simulation, Energy, News, News & Events,...

  3. $\\phi$-meson production at forward rapidity in p-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV and in pp collisions at $\\sqrt{s}$ = 2.76 TeV

    E-Print Network [OSTI]

    Adam, Jaroslav; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahn, Sang Un; Aimo, Ilaria; Aiola, Salvatore; Ajaz, Muhammad; Akindinov, Alexander; Alam, Sk Noor; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Millan Almaraz, Jesus Roberto; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Armesto Perez, Nestor; Arnaldi, Roberta; Arsene, Ionut Cristian; Arslandok, Mesut; Audurier, Benjamin; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Baltasar Dos Santos Pedrosa, Fernando; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Barth, Klaus; Bartke, Jerzy Gustaw; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Belmont Iii, Ronald John; Belmont Moreno, Ernesto; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biswas, Rathijit; Biswas, Saikat; Bjelogrlic, Sandro; Blair, Justin Thomas; Blanco, Fernando; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botta, Elena; Boettger, Stefan; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Bashir Butt, Jamila; Buxton, Jesse Thomas; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Carnesecchi, Francesca; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Cerkala, Jakub; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Chochula, Peter; Choi, Kyungeon; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Chunhui, Zhang; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Deisting, Alexander; Deloff, Andrzej; Denes, Ervin Sandor; D'Erasmo, Ginevra; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin

    2015-01-01T23:59:59.000Z

    The first measurement of $\\phi$-meson production in p-Pb collisions at a nucleon-nucleon centre-of-mass energy $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV has been performed with the ALICE apparatus at the LHC. The $\\phi$-mesons have been identified in the dimuon decay channel in the transverse momentum ($p_{\\rm T}$) range $1 p_{\\rm T} p-going ($2.03 p_{\\rm T}$ dependence within the uncertainties. The $p_{\\rm T}$ dependence of the $\\phi$ nuclear modification factor $R_{\\rm pPb}$ exhibits an enhancement up to a factor 1.6 at $p_{\\rm T}$ = 3-4 GeV/$c$ in the Pb-going direction. The $p_{\\rm T}$ dependence...

  4. Measurement of jet suppression in central Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-02-05T23:59:59.000Z

    The transverse momentum ($p_{\\rm T}$) spectrum and nuclear modification factor ($R_{\\rm AA}$) of reconstructed jets in 0-10% and 10-30% central Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}=2.76$ TeV were measured. Jets were reconstructed from charged and neutral particles, utilizing the ALICE tracking detectors and Electromagnetic Calorimeter (EMCal), with the anti-$k_{\\rm T}$ jet algorithm with a resolution parameter of R=0.2. The jet $p_{\\rm T}$ spectra are reported in the pseudorapidity interval of $|{\\eta}_{\\rm jet}|5$ GeV/$c$ to suppress jets constructed from the combinatorial background in Pb-Pb collisions. The effect of the leading charged particle requirement has been studied in both pp and Pb-Pb collisions and has been shown to have negligible effects on the $R_{\\rm AA}$ within the uncertainties of the measurement. The nuclear modification factor is obtained by dividing the jet spectrum measured in Pb-Pb by that in pp collisions scaled by the number of independent nucleon-nucleon collisions estimated using a Glauber model. $R_{\\rm AA}$ is found to be $0.28\\pm0.04$ in 0-10% and $0.35\\pm0.04$ in 10-30% collisions, independent of $p_{\\rm T,jet}$ within the uncertainties of the measurement. The observed suppression is in fair agreement with expectations from two model calculations with different approaches to jet quenching.

  5. RM Eolica | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit with form History Facebook iconQuito,Jump to: navigation,REpower NorthRGERLTecRM

  6. Centrality dependence of particle production in p-Pb collisions at $\\sqrt{s_{\\rm NN} }$= 5.02 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-12-21T23:59:59.000Z

    We report measurements of the primary charged particle pseudorapidity density and transverse momentum distributions in p-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV, and investigate their correlation with experimental observables sensitive to the centrality of the collision. Centrality classes are defined using different event activity estimators, i.e. charged particle multiplicities measured in three disjunct pseudorapidity regions as well as the energy measured at beam rapidity (zero-degree). The procedures to determine the centrality, quantified by the number of participants ($N_{\\rm part}$), or the number of nucleon-nucleon binary collisions ($N_{\\rm coll}$), are described. We show that, in contrast to Pb-Pb collisions, in p-Pb collisions large multiplicity fluctuations together with the small range of participants available, generate a dynamical bias in centrality classes based on particle multiplicity. We propose to use the zero-degree energy, which we expect not to introduce a dynamical bias, as an alternative event-centrality estimator. Based on zero-degree energy centrality classes, the $N_{\\rm part}$ dependence of particle production is studied. Under the assumption that the multiplicity measured in the Pb-going rapidity region scales with the number of Pb-participants, an approximate independence of the multiplicity per participating nucleon measured at mid-rapitity of the number of participating nucleons is observed. Furthermore, at high-$p_{\\rm T}$ the p-Pb spectra are found to be consistent with the pp spectra scaled by $N_{\\rm coll}$ for all centrality classes. Our results represent valuable input for the study of the event activity dependence of hard probes in p-Pb collision and, hence, help to establish baselines for the interpretation of the Pb-Pb data.

  7. Production of charged pions, kaons and protons at large transverse momenta in pp and Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-10-29T23:59:59.000Z

    Transverse momentum spectra of $\\pi^{\\pm}$, $\\rm K^{\\pm}$ and p($\\bar{\\rm p}$) up to $p_{\\rm T}$ = 20 GeV/$c$ at mid-rapidity in pp and Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}=$ 2.76 TeV have been measured using the ALICE detector at the Large Hadron Collider. The proton-to-pion and the kaon-to-pion ratios both show a distinct peak at $p_{\\rm T} \\approx 3 GeV/c$ in central Pb-Pb collisions. Below the peak, $p_{\\rm T}$ agreement with hydrodynamical calculations, suggesting that the peak itself is dominantly the result of radial flow rather than anomalous hadronization processes. For $p_{\\rm T}$ > 10 GeV/$c$ particle ratios in pp and Pb-Pb collisions are in agreement and the nuclear modification factors for $\\pi^{\\pm}$, $\\rm K^{\\pm}$ and $\\rm p$($\\bar{\\rm p}$) indicate that, within the systematic and statistical uncertainties, the suppression is the same. This suggests that the chemical composition of leading particles from jets in the medium is similar to that of vacuum jets.

  8. Evidence on the absence of critical transition in AMPT for Pb-Pb collisions at $sqrt{s_{\\rm{NN}}}$ = 2.76 TeV

    E-Print Network [OSTI]

    Ramni Gupta; Rohni Sharma

    2015-01-28T23:59:59.000Z

    Event-by-event fluctuations in the spatial patterns in charged particles generated in Pb--Pb collisions at the center-of-mass energy $\\sqrt{S_{\\rm{NN}}}$ = 2.76 TeV are studied within A MultiPhase Transport (AMPT) model. The spatial patterns of the particles generated in the ($\\eta, \\phi$) space for $|\\eta| \\le 0.8$ are studied using the methodology of intermittency and erraticity analysis. We find negative intermittency for charged particles generated in a range of $p_{\\rm{T}}$ windows. This result contrasts sharply from what is expected for a quark-gluon plasma undergoing hadronization by a second-order phase transition. Appropriate scaling behavior is examined, resulting in definitive scaling exponent $\

  9. Exclusive $\\mathrm{J/}?$ photoproduction off protons in ultra-peripheral p-Pb collisions at $\\sqrt{s_{\\rm NN}}=5.02$ TeV

    E-Print Network [OSTI]

    The ALICE Collaboration

    2014-06-30T23:59:59.000Z

    We present the first measurement at the LHC of exclusive J/$\\psi$ photoproduction off protons, in ultra-peripheral proton-lead collisions at $\\sqrt{s_{\\rm NN}}=5.02$ TeV. Events are selected with a dimuon pair produced either in the rapidity interval, in the laboratory frame, $2.5power law dependence of the $J/\\psi$ photoproduction cross section in $\\gamma {\\rm p}$ energies from about 20 to 700 GeV, or equivalently, from Bjorken-$x$ between $\\sim 2\\times 10^{-2}$ to $\\sim 2\\times 10^{-5}$, thus indicating no significant change in the gluon density behaviour of the proton between HERA and LHC energies.

  10. J/$?$ production and nuclear effects in p-Pb collisions at $\\sqrt{s_{\\rm NN}}=5.02$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-11-20T23:59:59.000Z

    Inclusive J/$\\psi$ production has been studied with the ALICE detector in p-Pb collisions at the nucleon-nucleon center of mass energy $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV at the CERN LHC. The measurement is performed in the center of mass rapidity domains $2.03nuclear modification factor $R_{\\rm pPb}$ for the rapidities under study are presented. While at forward rapidity, corresponding to the proton direction, a suppression of the J/$\\psi$ yield with respect to binary-scaled pp collisions is observed, in the backward region no suppression is present. The ratio of the forward and backward yields is also measured differentially in rapidity and transverse momentum. Theoretical predictions based on nuclear shadowing, as well as on models including, in addition, a contribution from partonic energy loss, are in fair agreement with the experimental results.

  11. Event shape engineering for inclusive spectra and elliptic flow in Pb-Pb collisions at $\\sqrt{s_\\rm{NN}}=2.76$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-07-22T23:59:59.000Z

    We report on results obtained with the Event Shape Engineering technique applied to Pb-Pb collisions at $\\sqrt{s_\\rm{NN}}=2.76$ TeV. By selecting events in the same centrality interval, but with very different average flow, different initial state conditions can be studied. We find the effect of the event-shape selection on the elliptic flow coefficient $v_2$ to be almost independent of transverse momentum $p_\\rm{T}$, as expected if this effect is due to fluctuations in the initial geometry of the system. Charged hadron, pion, kaon, and proton transverse momentum distributions are found to be harder in events with higher-than-average elliptic flow, indicating an interplay between radial and elliptic flow.

  12. 3000 and 3000RM Uninterruptible Power Supplies

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    . Recycling is the best method. Never burn batteries to dispose of them. They may explode. Do not open START OUTPUT LOAD OVERLOAD 100% 75% 50% 25% LINE PRESENT LINE FAILURE SERVICE LOW BATTERY WARNING LOW BATTERY SHUTDOWN TEST #12;CFR 3000 and 3000RM NOTICE: The CFR 3000 and 3000RM generates, uses and can

  13. Dijet asymmetry in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV within a multiphase transport model

    E-Print Network [OSTI]

    Guo-Liang Ma

    2013-06-04T23:59:59.000Z

    Within a multi-phase transport (AMPT) model, dijet asymmetry is studied in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV. It is found that a large dijet asymmetry ($A_{J}$) is produced by strong interactions between jets and partonic matter. It is demonstrated that hadronization and final-state hadronic rescatterings have little effects on $A_{J}$. The final $A_{J}$ is found to be driven by both initial $A_{J}$ and partonic jet energy loss, which is consistent with an increasing jet energy loss in a hot and strongly interacting partonic medium in more central Pb+Pb collisions.

  14. Charge correlations using the balance function in Pb-Pb collisions at $\\sqrt{s_{\\rm NN}} = 2.76$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-09-08T23:59:59.000Z

    In high-energy heavy-ion collisions, the correlations between the emitted particles can be used as a probe to gain insight into the charge creation mechanisms. In this Letter, we report the first results of such studies using the electric charge balance function in the relative pseudorapidity ($\\Delta\\eta$) and azimuthal angle ($\\Delta\\varphi$) in Pb--Pb collisions at $\\sqrt{s_{\\rm NN}}=2.76$ TeV with the ALICE detector at the Large Hadron Collider. The width of the balance function decreases with growing centrality (i.e. for more central collisions) in both projections. This centrality dependence is not reproduced by HIJING, while AMPT, a model which incorporates strings and parton rescattering, exhibits qualitative agreement with the measured correlations in $\\Delta\\varphi$ but fails to describe the correlations in $\\Delta\\eta$. A thermal blast-wave model incorporating local charge conservation and tuned to describe the $p_{\\rm T}$ spectra and v$_2$ measurements reported by ALICE, is used to fit the centrality dependence of the width of the balance function and to extract the average separation of balancing charges at freeze-out. The comparison of our results with measurements at lower energies reveals an ordering with $\\sqrt{s_{\\rm NN}}$: the balance functions become narrower with increasing energy for all centralities. This is consistent with the effect of larger radial flow at the LHC energies but also with the late stage creation scenario of balancing charges. However, the relative decrease of the balance function widths in $\\Delta\\eta$ and $\\Delta\\varphi$ with centrality from the highest SPS to the LHC energy exhibits only small differences. This observation cannot be interpreted solely within the framework where the majority of the charge is produced at a later stage in the evolution of the heavy--ion collision.

  15. Advanced Calculus 2 1. The derivative: Let Rm

    E-Print Network [OSTI]

    Logan, David

    , . . . , m). (9) We assume the transformation (9) to be invertible, that is, we can for the xj as functionsAdvanced Calculus 2 1. The derivative: Let Rm have components j and x: Rm Rn by x() = x1 matrix. You can think of A as a linear function taking Rm to Rm . We denote by AB the image of B under A

  16. Medium modifications of jet shapes in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV within a multiphase transport model

    E-Print Network [OSTI]

    Guo-Liang Ma

    2014-02-06T23:59:59.000Z

    Within a multiphase transport model, medium modifications of differential jet shapes are investigated in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV. The differential jet shapes are significantly modified by the strong interactions between jets and a partonic medium in Pb+Pb collisions relative to that in p+p collisions. The modifications are slightly weakened by the hadronization of coalescence, but strengthened by resonance decays in hadronic rescatterings. Subleading jets display larger medium modifications than leading jets, especially in central Pb+Pb collisions with large dijet asymmetries. These behaviors of medium modifications of differential jet shapes reflect a dynamical evolution of redistribution of jet energy inside a quenched jet cone in high-energy heavy-ion collisions.

  17. Energy Dependence of Profile Functions in $\\rm{p\\bar p}$ and $\\rm pp$ Scattering

    E-Print Network [OSTI]

    Anderson Kendi Kohara; Erasmo Ferreira; Takeshi Kodama

    2013-05-15T23:59:59.000Z

    We construct analytical forms in the impact parameter $b$-space for the real and imaginary amplitudes describing elastic pp and $\\rm p \\bar p $ scattering. The amplitudes converted analytically to the momentum transfer $t$-space have magnitudes, slopes, curvatures, zeros, signs, obeying phenomenological and theoretical expectations, and describe with high precision all details of the data, in the full-t range, and for energies from 20 GeV to 7 TeV. The connection of forward with large-$|t|$ behavior allows precise determination of total cross-sections, slopes and other scattering parameters. We study the properties and the energy dependence of the $b$-space profile functions, observing that the real part has fundamental influence in the structure of $d\\sigma/dt$ at intermediate and large $|t|$ values. We discuss the 540/546 GeV and 1.8/1.96 TeV data from CERN SPS and Fermilab TEVATRON and the 7 TeV results from TOTEM measurements at LHC, and investigate the extrapolation to 14 TeV and higher energies.

  18. The $E_{\\rm p}$ - $E_{\\rm iso}$ relation and the internal shock model

    E-Print Network [OSTI]

    Mochkovitch, R

    2014-01-01T23:59:59.000Z

    The validity of the $E_{\\rm p}$ - $E_{\\rm iso}$ correlation in gamma-ray bursts and the possibility of explaining the prompt emission with internal shocks are highly debated questions. We study whether the $E_{\\rm p}$ - $E_{\\rm iso}$ correlation can be reproduced if internal shocks are indeed responsible for the prompt emission, or conversely, if the correlation can be used to constrain the internal shock scenario. We developed a toy model where internal shocks are limited to the collision of only two shells. Synthetic burst populations were constructed for various distributions of the model parameters, such as the injected power in the relativistic outflow, the average Lorentz factor, and its typical contrast between the shells. These parameters can be independent or linked by various relations. Synthetic $E_{\\rm p}$ - $E_{\\rm iso}$ diagrams are obtained in the different cases and compared with the observed correlation. The reference observed correlation is the one defined by the BAT6 sample, a sample of Swi...

  19. Azimuthal anisotropies of reconstructed jets in Pb+Pb collisions at $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV in a multiphase transport model

    E-Print Network [OSTI]

    Mao-Wu Nie; Guo-Liang Ma

    2014-07-28T23:59:59.000Z

    Azimuthal anisotropies of reconstructed jets [$v_{n}^{jet} (n=2, 3)$] have been investigated in Pb+Pb collisions at the center of mass energy $\\sqrt{s_{_{\\rm NN}}}$ = 2.76 TeV within a framework of a multiphase transport (AMPT) model. The $v_{2}^{jet}$ is in good agreement with the recent ATLAS data. However, the $v_{3}^{jet}$ shows a smaller magnitude than $v_{2}^{jet}$, and approaches zero at a larger transverse momentum. It is attributed to the path-length dependence in which the jet energy loss fraction depends on the azimuthal angles with respect to different orders of event planes. The ratio $v_{n}^{jet}/\\varepsilon_{n}$ increases from peripheral to noncentral collisions, and $v_{n}^{jet}$ increases with the initial spatial asymmetry ($\\varepsilon_{n}$) for a given centrality bin. These behaviors indicate that the $v_{n}^{jet}$ is produced by the strong interactions between jet and the partonic medium with different initial geometry shapes. Therefore, azimuthal anisotropies of reconstructed jet are proposed as a good probe to study the initial spatial fluctuations, which are expected to provide constraints on the path-length dependence of jet quenching models.

  20. Charmonium and $e^+e^-$ pair photoproduction at mid-rapidity in ultra-peripheral Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$=2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-11-07T23:59:59.000Z

    The ALICE Collaboration at the LHC has measured the J/$\\psi$ and $\\psi^{'}$ photoproduction at mid-rapidity in ultra-peripheral Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}=2.76$ TeV. The charmonium is identified via its leptonic decay for events where the hadronic activity is required to be minimal. The analysis is based on an event sample corresponding to an integrated luminosity of about 23 $\\mu\\rm{b}^{-1}$. The cross section for coherent and incoherent J/$\\psi$ production in the rapidity interval $-0.9agreement with those models incorporating moderate nuclear gluon shadowing, such as EPS09 parametrization. In addition the cross section for the process $\\gamma\\gamma\\rightarrow e^+ e^-$ has been measured and found to be in agreement with models implementing QED at leading order.

  1. Measurement of $J/\\psi\\to\\gamma\\eta_{\\rm c}$ decay rate and $\\eta_{\\rm c}$ parameters at KEDR

    E-Print Network [OSTI]

    Anashin, V V; Baldin, E M; Barladyan, A K; Barnyakov, A Yu; Barnyakov, M Yu; Baru, S E; Basok, I Yu; Bedny, I V; Blinov, A E; Blinov, V E; Bobrov, A V; Bobrovnikov, V S; Bogomyagkov, A V; Bondar, A E; Buzykaev, A R; Eidelman, S I; Glukhovchenko, Yu M; Gulevich, V V; Gusev, D V; Karnaev, S E; Karpov, G V; Karpov, S V; Kharlamova, T A; Kiselev, V A; Kononov, S A; Kotov, K Yu; Kravchenko, E A; Kulikov, V F; Kurkin, G Ya; Kuper, E A; Levichev, E B; Maksimov, D A; Malyshev, V M; Maslennikov, A L; Medvedko, A S; Meshkov, O I; Mishnev, S I; Morozov, I I; Muchnoi, N Yu; Neufeld, V V; Nikitin, S A; Nikolaev, I B; Okunev, I N; Onuchin, A P; Oreshkin, S B; Orlov, I O; Osipov, A A; Peleganchuk, S V; Pivovarov, S G; Piminov, P A; Petrov, V V; Poluektov, A O; Pospelov, G E; Prisekin, V G; Rezanova, O L; Ruban, A A; Sandyrev, V K; Savinov, G A; Shamov, A G; Shatilov, D N; Shwartz, B A; Simonov, E A; Sinyatkin, S V; Skrinsky, A N; Smaluk, V V; Sokolov, A V; Sukharev, A M; Starostina, E V; Talyshev, A A; Tayursky, V A; Telnov, V I; Tikhonov, Yu A; Todyshev, K Yu; Tumaikin, G M; Usov, Yu V; Vorobiov, A I; Yushkov, A N; Zhilich, V N; Zhulanov, V V; Zhuravlev, A N

    2014-01-01T23:59:59.000Z

    Using the inclusive photon spectrum based on a data sample collected at the $J/\\psi$ peak with the KEDR detector at the VEPP-4M $e^+e^-$ collider, we measured the rate of the radiative decay $J/\\psi\\to\\gamma\\eta_{\\rm c}$ as well as $\\eta_{\\rm c}$ mass and width. Taking into account an asymmetric photon lineshape we obtained: $\\Gamma^0_{\\gamma\\eta_{\\rm c}}=2.98\\pm0.18 \\phantom{|}^{+0.15}_{-0.33}$ keV, $M_{\\eta_{\\rm c}} = 2983.5 \\pm 1.4 \\phantom{|}^{+1.6}_{-3.6}$ MeV/$c^2$, $\\Gamma_{\\eta_{\\rm c}} = 27.2 \\pm 3.1 \\phantom{|}^{+5.4}_{-2.6}$ MeV.

  2. A measurement of the ratio of inclusive cross sections $\\sigma(p\\bar{p}\\rightarrow Z+b{\\rm\\, jet})/ \\sigma(p\\bar{p}\\rightarrow Z+{\\rm jet})$ at $\\sqrt{s}=1.96$ TeV

    SciTech Connect (OSTI)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls; Alverson, George O.; /Northeastern U.; Alves, Gilvan Augusto; /Rio de Janeiro, CBPF; Ancu, Lucian Stefan; /Nijmegen U. /Fermilab

    2010-10-01T23:59:59.000Z

    The ratio of the cross section for p{bar p} interactions producing a Z boson and at least one b quark jet to the inclusive Z+jet cross section is measured using 4.2 fb{sup -1} of p{bar p} collisions collected with the D0 detector at the Fermilab Tevatron collider at {radical}s = 1.96 TeV. The Z {yields} {ell}{sup +}{ell}{sup -} candidate events with at least one b jet are discriminated from Z+ charm and light jet(s) events by a novel technique that exploits the properties of the tracks associated to the jet. The measured ratio is 0.0193 {+-} 0.0027 for events having a jet with transverse momentum p{sub T} > 20 GeV and pseudorapidity |{eta}| {le} 2.5, which is the most precise to date and is consistent with theoretical predictions.

  3. Selection biases in the gamma ray burst E$_{\\rm iso}$ -- L$_{\\rm opt,X}$ correlation

    E-Print Network [OSTI]

    Coward, David; Wan, Linfeng; Macpherson, Damien

    2014-01-01T23:59:59.000Z

    Gamma ray burst (GRB) optical and X-ray afterglow luminosity is expected to correlate with the GRB isotropic equivalent kinetic energy of the outflow in the standard synchrotron model for GRB afterglows. Previous studies, using prompt GRB isotropic equivalent energy ($E_{\\rm iso}$) as a proxy for isotropic equivalent kinetic energy, have generally confirmed a correlation between X-ray and optical afterglow luminosities. Assuming that GRB afterglow luminosity does not evolve strongly with redshift, we identify a strong Malmquist bias in GRB optical and X-ray afterglow luminosity data. We show that selection effects dominate the observed E$_{\\rm iso}$ -- L$_{\\rm opt,X}$ correlations, and have likely been underestimated in other studies. The bias is strongest for a subset of optically faint bursts $m>24$ at 24 hr with $z>2$. After removing this optical selection bias, the E$_{\\rm iso}$ -- L$_{\\rm opt,X}$ correlation for long GRBs is not statistically significant, but combining both long and short GRB luminosity ...

  4. TraceyStancik Bldg.201,Rm.2S-06

    E-Print Network [OSTI]

    Kemner, Ken

    Paul Blanton Project Manager, Savannah River National Laboratory Agenda Tuesday, WednesdayTraceyStancik Bldg.201,Rm.2S-06 ArgonneNationalLaboratory 9700SouthCassAve. Argonne,IL60439 Hotel Argonne National Laboratory Argonne, Illinois Announcement also available at: http

  5. Bremsstrahlung emission during $?$-decay of $^{226}{\\rm Ra}$

    E-Print Network [OSTI]

    Giorgio Giardina; Giovanni Fazio; Giuseppe Mandaglio; Marina Manganaro; Serghei P. Maydanyuk; Vladislav S. Olkhovsky; Nikolay V. Eremin; Anton A. Paskhalov; Dmitry A. Smirnov; Carmelo Sacca

    2008-04-16T23:59:59.000Z

    We obtained the spectrum of probability of the bremsstrahlung emission accompanying the $\\alpha$-decay of $^{226}{\\rm Ra}$ (E$_{\\alpha}$=4.8 MeV) by measuring the $\\alpha$-$\\gamma$ coincidences and using the model presented in our previous study on the $\\alpha-$decay of $^{214}{\\rm Po}$ (E$_{\\alpha}$=7.7 MeV). We compare the experimental data with the quantum mechanical calculation and find a good agreement between theory and experiment. We discuss the differences between the photon spectra connected with the $\\alpha$-decay of the $^{226}{\\rm Ra}$ and $^{214}{\\rm Po}$ nuclei. For the two mentioned nuclei we analyze the bremsstrahlung emission contributions from the tunneling and external regions of the nucleus barrier into the total spectrum, and we find the destructive interference between these contributions. We also find that the emission of photons during tunneling of the $\\alpha$-particle gives an important contribution to the bremsstrahlung spectrum in the whole E$_{\\gamma}$ energy range of the studied $^{226}$Ra nucleus.

  6. A Tight $L_{\\rm p, iso}-E'_{\\rm p}-\\Gamma_0$ Correlation of Gamma-Ray Bursts

    E-Print Network [OSTI]

    Liang, En-Wei; LV, Jing; Lu, Ruijing; Zhang, Jin; Zhang, Bing

    2015-01-01T23:59:59.000Z

    We select a sample of 34 gamma-ray bursts (GRBs) whose $\\Gamma_0$ values are derived with the onset peak observed in the afterglow lightcurves (except for GRB 060218 whose $\\Gamma_0$ is estimated with its radio data), and investigate the correlations among $\\Gamma_0$, the isotropic peak luminosity ($L_{\\rm p, iso}$), and the peak energy of the $\

  7. Heavy Construction Internship Program RegistRation foRm

    E-Print Network [OSTI]

    Haykin, Simon

    in this program, it must relate to the Heavy Construction industry, be a minimum of 35 hours per weekHeavy Construction Internship Program RegistRation foRm eCCs engineeRing Co-oP anD CaReeR se are strongly encouraged to work with Engineering Co-op and Career Services (ECCS) and the Heavy Construction

  8. TraceyStancik Bldg.201,Rm.2S-06

    E-Print Network [OSTI]

    Kemner, Ken

    Gelder Technical Advisor, Savannah River National Laboratory Agenda Day 1: 8:00 a.m. ­ 5:00 p.m. Day 2: 8TraceyStancik Bldg.201,Rm.2S-06 ArgonneNationalLaboratory 9700SouthCassAve. ArgonneIL60439 Hotel://www.dis.anl.gov/maps/maps.html June 25-27, 2013 Argonne National Laboratory Argonne, Illinois Announcement also available at: http

  9. Relations for Direct CP asymmetries \\\\in $B\\to \\rm PP$ and $B\\to \\rm PV$ decays

    E-Print Network [OSTI]

    T. N. Pham

    2005-10-14T23:59:59.000Z

    The presence of additional strong phase from power corrections and other chirally enhanced terms makes it more difficult to predict direct CP asymmetries in two-body charmless B decays. In this talk, I would like to report on a recent work on QCD Factorisation and Power Corrections in Charmless B Decays. Using the measured branching ratios for $B\\to \\rm PV$, it is shown that power corrections in charmless B decays are probably large, at least for penguin dominated $\\rm PV$ channels. Since the tree-penguin interference responsible for direct CP asymmetries in two-body charmless B decays are related by CKM factors and SU(3) symmetry, we find that, if power corrections other than the chirally enhanced power corrections and annihilation topology were negligible, QCD Factorisation would predict the direct CP asymmetry of $B \\to \\pi^+ \\pi^-$ to be about 3 times larger than that of $B \\to \\pi^\\pm K^\\mp$, with opposite sign, in agreement with the latest measurement from Belle. Similar relations are also given for direct CP asymmetries in $B\\to\\rm PV$ .

  10. Reference Inflow Characterization for River Resource Reference Model (RM2)

    SciTech Connect (OSTI)

    Neary, Vincent S [ORNL

    2011-12-01T23:59:59.000Z

    Sandia National Laboratory (SNL) is leading an effort to develop reference models for marine and hydrokinetic technologies and wave and current energy resources. This effort will allow the refinement of technology design tools, accurate estimates of a baseline levelized cost of energy (LCoE), and the identification of the main cost drivers that need to be addressed to achieve a competitive LCoE. As part of this effort, Oak Ridge National Laboratory was charged with examining and reporting reference river inflow characteristics for reference model 2 (RM2). Published turbulent flow data from large rivers, a water supply canal and laboratory flumes, are reviewed to determine the range of velocities, turbulence intensities and turbulent stresses acting on hydrokinetic technologies, and also to evaluate the validity of classical models that describe the depth variation of the time-mean velocity and turbulent normal Reynolds stresses. The classical models are found to generally perform well in describing river inflow characteristics. A potential challenge in river inflow characterization, however, is the high variability of depth and flow over the design life of a hydrokinetic device. This variation can have significant effects on the inflow mean velocity and turbulence intensity experienced by stationary and bottom mounted hydrokinetic energy conversion devices, which requires further investigation, but are expected to have minimal effects on surface mounted devices like the vertical axis turbine device designed for RM2. A simple methodology for obtaining an approximate inflow characterization for surface deployed devices is developed using the relation umax=(7/6)V where V is the bulk velocity and umax is assumed to be the near-surface velocity. The application of this expression is recommended for deriving the local inflow velocity acting on the energy extraction planes of the RM2 vertical axis rotors, where V=Q/A can be calculated given a USGS gage flow time-series and stage vs. cross-section area rating relationship.

  11. Blast Wave Fits to Elliptic Flow Data at $\\sqrt{s_{\\rm NN}} =$ 7.7--2760 GeV

    E-Print Network [OSTI]

    X. Sun; H. Masui; A. M. Poskanzer; A. Schmah

    2015-02-18T23:59:59.000Z

    We present blast wave fits to elliptic flow ($v_{2}(p_{\\rm T})$) data in minimum bias collisions from the $\\sqrt{s_{\\rm NN}} =$ 7.7--200 GeV at RHIC, and 2.76 TeV at LHC. The fits are performed separately for particles and corresponding anti-particles. The mean transverse velocity parameter $\\beta$ shows an energy dependent difference between particles and corresponding anti-particles, which increases as the beam energy decreases. Possible effects of feed down, baryon stopping, anti-particle absorption, and early production times for anti-particles are discussed.

  12. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Steven Jahn

    Broader source: Energy.gov [DOE]

    Commenter: Steven Jahn 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  13. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Susan Leckband

    Broader source: Energy.gov [DOE]

    Commenter: Susan Leckband 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  14. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Mark Strauch

    Broader source: Energy.gov [DOE]

    Commenter: Mark Strauch 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  15. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Mark Fisher

    Broader source: Energy.gov [DOE]

    Commenter: Mark Fisher 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  16. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Scott Yundt

    Broader source: Energy.gov [DOE]

    Commenter: Scott Yundt 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  17. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Richard L. Dickson

    Broader source: Energy.gov [DOE]

    Commenter: Richard L. Dickson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  18. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Curtis Valle

    Broader source: Energy.gov [DOE]

    Commenter: Curtis Valle 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  19. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Faye Vleger

    Broader source: Energy.gov [DOE]

    Commenter: Faye Vleger 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  20. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Anoop Agrawal

    Broader source: Energy.gov [DOE]

    Commenter: Anoop Agrawal 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  1. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Cameron Anderson

    Broader source: Energy.gov [DOE]

    Commenter: Cameron Anderson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  2. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Timothy Bolden

    Broader source: Energy.gov [DOE]

    Commenter: Timothy Bolden 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  3. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Joseph Herndon

    Broader source: Energy.gov [DOE]

    Commenter: Joseph Herndon 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  4. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Jamie Stalker

    Broader source: Energy.gov [DOE]

    Commenter: Jamie Stalker 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  5. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Ed Kvartek

    Broader source: Energy.gov [DOE]

    Commenter: Ed Kvartek 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  6. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- John Walter

    Broader source: Energy.gov [DOE]

    Commenter: John Walter 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  7. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Cheryl Floreen

    Broader source: Energy.gov [DOE]

    Commenter: Cheryl Floreen 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  8. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Troy Bodily

    Broader source: Energy.gov [DOE]

    Commenter: Troy Bodily 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  9. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Reginald Gaylord

    Broader source: Energy.gov [DOE]

    Commenter: Reginald Gaylord 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  10. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Pete Stafford

    Broader source: Energy.gov [DOE]

    Commenter: Pete Stafford 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  11. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Mario Moreno

    Broader source: Energy.gov [DOE]

    Commenter: Mario Moreno 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  12. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Roby Enge

    Broader source: Energy.gov [DOE]

    Commenter: Roby Enge 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  13. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Terry Vaughn

    Broader source: Energy.gov [DOE]

    Commenter: Terry Vaughn 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  14. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Bret Moscon

    Broader source: Energy.gov [DOE]

    Commenter: Bret Moscon 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  15. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Paul A. Schulte

    Broader source: Energy.gov [DOE]

    Commenter: Paul A. Schulte 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  16. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Thomas W. Morris

    Broader source: Energy.gov [DOE]

    Commenter: Thomas W. Morris 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  17. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Thomas Peterson

    Broader source: Energy.gov [DOE]

    Commenter: Thomas Peterson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  18. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Michael Brisson

    Broader source: Energy.gov [DOE]

    Commenter: Michael Brisson 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  19. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Jim Withers

    Broader source: Energy.gov [DOE]

    Commenter: Jim Withers 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  20. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- J. Chris Cantwell

    Broader source: Energy.gov [DOE]

    Commenter: J. Chris Cantwell 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  1. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Scott Stafford

    Broader source: Energy.gov [DOE]

    Commenter: Scott Stafford 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  2. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- William R. Kleem

    Broader source: Energy.gov [DOE]

    Commenter: William R. Kleem 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  3. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Kenneth Meyer

    Broader source: Energy.gov [DOE]

    Commenter: Kenneth Meyer 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  4. APRIL 3 10:3011:30am Rm 102 Status and Future of Recreational Fisheries in

    E-Print Network [OSTI]

    Anderson, Richard

    Anderson, Director, Washington Department of Fish and Wildlife (WDFW) APRIL 8 5:00­6:00pm Rm 107 Evolution of Saltwater Recreational Fisheries in Washington State Tony Floor, Director, Fishing Affairs, NW Marine Trade APRIL 17 10:30am­12:20pm Rm 102 A) Involving Youth in Recreational Fishing B) Management and Status

  5. The role of the RM-ODP Computational Viewpoint Concepts in the MDA approach

    E-Print Network [OSTI]

    Pires, Luís Ferreira

    43 The role of the RM-ODP Computational Viewpoint Concepts in the MDA approach João Paulo A.utwente.nl Abstract An MDA design approach should be able to accommodate designs at different levels of platform that makes it possible to use RM-ODP concepts in our MDA design approach. This framework allows a recursive

  6. Measurement of the time-dependent CP asymmetries in $B_s^0\\rightarrow J/\\psi K_{\\rm S}^0$

    E-Print Network [OSTI]

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casanova Mohr, Raimon; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gastaldi, Ugo; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Geraci, Angelo; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo

    2015-01-01T23:59:59.000Z

    The first measurement of decay-time-dependent CP asymmetries in the decay $B_s^0\\rightarrow J/\\psi K_{\\rm S}^0$ and an updated measurement of the ratio of branching fractions $\\mathcal{B}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0)/\\mathcal{B}(B_d^0\\rightarrow J/\\psi K_{\\rm S}^0)$ are presented. The results are obtained using data corresponding to an integrated luminosity of 3.0 fb$^{-1}$ of proton-proton collisions recorded with the LHCb detector at centre-of-mass energies of 7 and 8 TeV. The results on the CP asymmetries are $A_{\\Delta\\Gamma}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0) = 0.49_{-0.65}^{+0.77}(stat) \\pm 0.06(syst)$, $C_{\\rm dir}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0) = -0.28 \\pm 0.41(stat) \\pm 0.08(syst)$ and $S_{\\rm mix}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0) = -0.08 \\pm 0.40(stat) \\pm 0.08(syst)$. The ratio $\\mathcal{B}(B_s^0\\rightarrow J/\\psi K_{\\rm S}^0)/\\mathcal{B}(B_d^0\\rightarrow J/\\psi K_{\\rm S}^0)$ is measured to be $0.0431 \\pm 0.0017(stat) \\pm 0.0012(syst) \\pm 0.0025(f_s/f_d)$, where the last uncerta...

  7. Reference Model 6 (RM6): Oscillating Wave Energy Converter.

    SciTech Connect (OSTI)

    Bull, Diana L; Smith, Chris; Jenne, Dale Scott; Jacob, Paul; Copping, Andrea; Willits, Steve; Fontaine, Arnold; Brefort, Dorian; Gordon, Margaret Ellen; Copeland, Robert; Jepsen, Richard A.

    2014-10-01T23:59:59.000Z

    This report is an addendum to SAND2013-9040: Methodology for Design and Economic Analysis of Marine Energy Conversion (MEC) Technologies. This report describes an Oscillating Water Column Wave Energy Converter reference model design in a complementary manner to Reference Models 1-4 contained in the above report. In this report, a conceptual design for an Oscillating Water Column Wave Energy Converter (WEC) device appropriate for the modeled reference resource site was identified, and a detailed backward bent duct buoy (BBDB) device design was developed using a combination of numerical modeling tools and scaled physical models. Our team used the methodology in SAND2013-9040 for the economic analysis that included costs for designing, manufacturing, deploying, and operating commercial-scale MEC arrays, up to 100 devices. The methodology was applied to identify key cost drivers and to estimate levelized cost of energy (LCOE) for this RM6 Oscillating Water Column device in dollars per kilowatt-hour (%24/kWh). Although many costs were difficult to estimate at this time due to the lack of operational experience, the main contribution of this work was to disseminate a detailed set of methodologies and models that allow for an initial cost analysis of this emerging technology. This project is sponsored by the U.S. Department of Energy's (DOE) Wind and Water Power Technologies Program Office (WWPTO), within the Office of Energy Efficiency & Renewable Energy (EERE). Sandia National Laboratories, the lead in this effort, collaborated with partners from National Laboratories, industry, and universities to design and test this reference model.

  8. Sampling and analyses report for postburn sampling at the RM1 UCG Site, Hanna, Wyoming

    SciTech Connect (OSTI)

    Crader, S.E.

    1989-06-01T23:59:59.000Z

    Between June 22, 1989 and June 26, 1989, Western Research Institute (WRI) completed the second quarterly Rocky Mountain 1 Underground Coal Gasification (RM1 UCG) site groundwater monitoring for the year 1989. This quarterly sample outing represents the third sampling since the completion of the RM1 groundwater restoration. Background material and the sampling and analytical procedures associated with this task are described in the `Rocky Mountain 1 Postburn Groundwater Monitoring Quality Assurance Plan`, prepared by the U.S. DOE.

  9. Dark Matter Searches in Jet plus Missing Energy in $\\rm ?p$ collision at CERN LHC

    E-Print Network [OSTI]

    Hao Sun

    2014-08-01T23:59:59.000Z

    In this paper, we investigate the $\\rm \\gamma p$ photoproduction of jet plus missing energy signal to set limits on the couplings of the fermionic dark matter to the quarks at the LHC via the main reaction $\\rm pp\\rightarrow p\\gamma p\\rightarrow p \\chi\\chi j$. We assume a typical LHC multipurpose forward detectors and work in a model independent Effective Field Theory framework. Typically, when we do the background analysis, we also include their corresponding Single Diffractive (SD) productions. Our result shows that by requiring a $5\\sigma$ ($\\rm S/\\sqrt{B} \\geq 5$) signal deviation, with an integrated luminosity of $\\rm {\\cal L} = 200 fb^{-1}$, the lower bounds of WIMP masses scale can be detected up to $\\rm \\Lambda$ equal 665.5, 808.9 and 564.0 GeV for the forward detector acceptances $\\xi_1$, $\\xi_2$, and $\\xi_3$, respectively, where $0.00150.5$, $0.10.5$ and $0.0015<\\xi_3<0.15$.

  10. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Alliance for Water Efficiency (AWE)

    Broader source: Energy.gov [DOE]

    Commenter: Alliance for Water Efficiency (AWE) 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  11. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Christopher R. McKean

    Broader source: Energy.gov [DOE]

    Commenter: Christopher R. McKean 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  12. BREA Minutes Meeting Date and Place: Tuesday, Oct. 14, 2014; Building 400, Rm RSB 2

    E-Print Network [OSTI]

    Johnson, Peter D.

    BREA Minutes Meeting Date and Place: Tuesday, Oct. 14, 2014; Building 400, Rm RSB 2 Attendees live in New York State (NYS), you can change your medical plan after the first year ­ i.e., if you in NYS. Our current insurance with CIGNA is through the Lab, which is selfinsured. How long

  13. Fish and Wildlife Management Questions and RM&E Strategies Key Management Questions

    E-Print Network [OSTI]

    1 Fish and Wildlife Management Questions and RM&E Strategies Key Management Questions 1. Are we meeting biological and programmatic performance objectives established within the Columbia Basin Fish implemented and accomplished as proposed? Strategic Category: Fish Population Status Monitoring The following

  14. Sequence Optimization-based UWB Receiver Jihad Ibrahim, Rekha Menon, and Dr. R.M. Buehrer

    E-Print Network [OSTI]

    Southern California, University of

    Sequence Optimization-based UWB Receiver Jihad Ibrahim, Rekha Menon, and Dr. R.M. Buehrer Sponsored transmit pulse shape Proposed Receiver Transmit Sequence X Channel Receiver Sequence- Correlator Y UWB · Objective: Maximize SNR · Optimal transmit sequence X solves: H is the channel matrix · Optimal X

  15. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wray Wind Energy Project Environmental Assessment DOEEA - 1884 Environmental Assessment December 2012 Finding of No Significant Impact 2012 Comments may be sent to: Mr. Rod...

  16. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hermosa West Wind Energy Project Albany County, Wyoming Draft Environmental Impact Statement DOEEIS - 0438 Draft Environmental Impact Statement Volume I Draft Environmental Impact...

  17. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Buffalo Head Substation Project Adoption of Bureau of Land Management Environmental Assessment (Document No. WY-050-EA11-108) DOEEA - 1938 Environmental Assessment July 2012...

  18. RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    South Table Wind Project Environmental Assessment for Pre-Approval Review DOEEA - 1909 Environmental Assessment July 2012 Finding of No Significant Impact August 2012 Comments may...

  19. Micro-Segmentao de Clientes com Base em Dados de Consumo: Modelo RM-Similis

    E-Print Network [OSTI]

    Cavique, Luís

    1 Micro-Segmentação de Clientes com Base em Dados de Consumo: Modelo RM-Similis Luís Cavique ESCS apresentadas as conclusões. 2 Base de Dados de Clientes Na caracterização de clientes são geralmente utilizados dados resultantes de inquéritos. Com o apoio das Base de Dados ou Aplicações para Clientes, pretende

  20. jou.rm.alnf ELSEVIER Journal of Nuclear Materials 241-243 (1997) 255-259

    E-Print Network [OSTI]

    Raffray, A. René

    jou.rm.alnf HUMOr ELSEVIER Journal of Nuclear Materials 241-243 (1997) 255-259 Erosion lifetime at the side walls. 0022-3115/97/$17.00 Copyright © 1997 Elsevier Science B.V. All rights reserved. PII S0022-3!15(96)00510-7 #12;256 H.D. Pacher et al. / Journal of Nuclear Materials 241 243 (1997) 255 259 10~' ~10 4 1000 ~ _ 1

  1. $N_{\\rm eff}$ in low-scale seesaw models versus the lightest neutrino mass

    E-Print Network [OSTI]

    Hernandez, P; Lopez-Pavon, J

    2014-01-01T23:59:59.000Z

    We evaluate the contribution to $N_{\\rm eff}$ of the extra sterile states in low-scale Type I seesaw models (with three extra sterile states). We explore the full parameter space and find that at least two of the heavy states always reach thermalisation in the Early Universe, while the third one might not thermalise provided the lightest neutrino mass is below ${\\mathcal O}(10^{-3}$eV). Constraints from cosmology therefore severely restrict the spectra of heavy states in the range 1eV- 100 MeV. The implications for neutrinoless double beta decay are also discussed.

  2. $^4{\\rm He}$+$n$+$n$ continuum within an ab initio framework

    E-Print Network [OSTI]

    Carolina Romero-Redondo; Sofia Quaglioni; Petr Navrátil; Guillaume Hupin

    2014-04-07T23:59:59.000Z

    The low-lying continuum spectrum of the $^6{\\rm He}$ nucleus is investigated for the first time within an ab initio framework that encompasses the $^4{\\rm He}$+$n$+$n$ three-cluster dynamics characterizing its lowest decay channel. This is achieved through an extension of the no-core-shell model combined with the resonating-group method, in which energy-independent non-local interactions among three nuclear fragments can be calculated microscopically starting from realistic nucleon-nucleon interactions and consistent ab initio many-body wave functions of the clusters. The three-cluster Schr\\"odinger equation is solved with three-body scattering boundary conditions by means of the hyperspherical-harmonic method on a Lagrange mesh. Using a soft similarity-renormalization-group evolved chiral nucleon-nucleon potential, we find the known $J^\\pi = 2^+$ resonance as well as a result consistent with a new low-lying second $2^+$ resonance recently observed at GANIL at $2.6$ MeV above the $^6$He ground state. We also find resonances in the $2^-$, $1^+$ and $0^-$ channels, while no low-lying resonances are present in the $0^+$ and $1^-$ channels.

  3. NUCLEAR ISOTOPIC DILUTION OF HIGHLY ENRICHED URANIUM BY DRY BLENDING VIA THE RM-2 MILL TECHNOLOGY

    SciTech Connect (OSTI)

    Raj K. Rajamani; Sanjeeva Latchireddi; Vikas Devrani; Harappan Sethi; Roger Henry; Nate Chipman

    2003-08-01T23:59:59.000Z

    DOE has initiated numerous activities to focus on identifying material management strategies to disposition various excess fissile materials. In particular the INEEL has stored 1,700 Kg of offspec HEU at INTEC in CPP-651 vault facility. Currently, the proposed strategies for dispositioning are (a) aqueous dissolution and down blending to LEU via facilities at SRS followed by shipment of the liquid LEU to NFS for fabrication into LWR fuel for the TVA reactors and (b) dilution of the HEU to 0.9% for discard as a waste stream that would no longer have a criticality or proliferation risk without being processed through some type of enrichment system. Dispositioning this inventory as a waste stream via aqueous processing at SRS has been determined to be too costly. Thus, dry blending is the only proposed disposal process for the uranium oxide materials in the CPP-651 vault. Isotopic dilution of HEU to typically less than 20% by dry blending is the key to solving the dispositioning issue (i.e., proliferation) posed by HEU stored at INEEL. RM-2 mill is a technology developed and successfully tested for producing ultra-fine particles by dry grinding. Grinding action in RM-2 mill produces a two million-fold increase in the number of particles being blended in a centrifugal field. In a previous study, the concept of achieving complete and adequate blending and mixing (i.e., no methods were identified to easily separate and concentrate one titanium compound from the other) in remarkably short processing times was successfully tested with surrogate materials (titanium dioxide and titanium mono-oxide) with different particle sizes, hardness and densities. In the current project, the RM-2 milling technology was thoroughly tested with mixtures of natural uranium oxide (NU) and depleted uranium oxide (DU) stock to prove its performance. The effects of mill operating and design variables on the blending of NU/DU oxides were evaluated. First, NU and DU both made of the same oxide, UO{sub 3}, was used in the testing. Next, NU made up of UO{sub 3} and DU made up of UO{sub 2} was used in the test work. In every test, the blend achieved was characterized by spatial sampling of the ground product and analyzing for {sup 235}U concentration. The test work proved that these uranium oxide materials can be blended successfully. The spatial concentration was found to be uniform. Next, sintered thorium oxide pellets were used as surrogate for light water breeder reactor pellets (LWBR). To simulate LWBR pellet dispositioning, the thorium oxide pellets were first ground to a powder form and then the powder was blended with NU. In these tests also the concentration of {sup 235}U and {sup 232}Th in blended products fell within established limits proving the success of RM-2 milling technology. RM-2 milling technology is applicable to any dry radioactive waste, especially brittle solids that can be ground up and mixed with the non-radioactive stock.

  4. The Spin Structure Function $g_1^{\\rm p}$ of the Proton and a Test of the Bjorken Sum Rule

    E-Print Network [OSTI]

    Adolph, C; Alexeev, M G; Alexeev, G D; Amoroso, A; Andrieux, V; Anosov, V; Austregesilo, A; Azevedo, C; Badelek, B; Balestra, F; Barth, J; Baum, G; Beck, G R; Bedfer, Y; Bernhard, J; Bicker, K; Bielert, E R; Birsa, R; Bisplinghoff, J; Bodlak, M; Boer, M; Bordalo, P; Bradamante, F; Braun, C; Bressan, A; Buechele, M; Burtin, E; Capozza, L; Chang, W -C; Chiosso, M; Choi, I; Chung, S U; Cicuttin, A; Crespo, M L; Curiel, Q; Torre, S Dalla; Dasgupta, S S; Dasgupta, S; Denisov, O Yu; Dhara, L; Donskov, S V; Doshita, N; Duic, V; Dziewiecki, M; Efremov, A; Eversheim, P D; Eyrich, W; Ferrero, A; Finger, M; Fischer, H; Franco, C; von Hohenesche, N du Fresne; Friedrich, J M; Frolov, V; Fuchey, E; Gautheron, F; Gavrichtchouk, O P; Gerassimov, S; Giordano, F; Gnesi, I; Gorzellik, M; Grabmüller, S; Grasso, A; Grosse-Perdekamp, M; Grube, B; Grussenmeyer, T; Guskov, A; Haas, F; Hahne, D; von Harrach, D; Hashimoto, R; Heinsius, F H; Herrmann, F; Hinterberger, F; Horikawa, N; d'Hose, N; Hsieh, C -Yu; Huber, S; Ishimoto, S; Ivanov, A; Ivanshin, Yu; Iwata, T; Jahn, R; Jary, V; Jörg, P; Joosten, R; Kabuß, E; Ketzer, B; Khaustov, G V; Khokhlov, Yu A; Kisselev, Yu; Klein, F; Klimaszewski, K; Koivuniemi, J H; Kolosov, V N; Kondo, K; Koenigsmann, K; Konorov, I; Konstantinov, V F; Kotzinian, A M; Kouznetsov, O; Kraemer, M; Kremser, P; Krinner, F; Kroumchtein, Z V; Kuchinski, N; Kunne, F; Kurek, K; Kurjata, R P; Lednev, A A; Lehmann, A; Levillain, M; Levorato, S; Lichtenstadt, J; Longo, R; Maggiora, A; Magnon, A; Makins, N; Makke, N; Mallot, G K; Marchand, C; Martin, A; Marzec, J; Matousek, J; Matsuda, H; Matsuda, T; Meshcheryakov, G; Meyer, W; Michigami, T; Mikhailov, Yu V; Miyachi, Y; Nagaytsev, A; Nagel, T; Nerling, F; Neyret, D; Nikolaenko, V I; Novy, J; Nowak, W -D; Nunes, A S; Olshevsky, A G; Orlov, I; Ostrick, M; Panzieri, D; Parsamyan, B; Paul, S; Peng, J -C; Pereira, F; Pesek, M; Peshekhonov, D V; Platchkov, S; Pochodzalla, J; Polyakov, V A; Pretz, J; Quaresma, M; Quintans, C; Ramos, S; Regali, C; Reicherz, G; Riedl, C; Rocco, E; Rossiyskaya, N S; Ryabchikov, D I; Rychter, A; Samoylenko, V D; Sandacz, A; Santos, C; Sarkar, S; Savin, I A; Sbrizzai, G; Schiavon, P; Schmidt, K; Schmieden, H; Schoenning, K; Schopferer, S; Selyunin, A; Shevchenko, O Yu; Silva, L; Sinha, L; Sirtl, S; Slunecka, M; Sozzi, F; Srnka, A; Stolarski, M; Sulc, M; Suzuki, H; Szabelski, A; Szameitat, T; Sznajder, P; Takekawa, S; ter Wolbeek, J; Tessaro, S; Tessarotto, F; Thibaud, F; Tosello, F; Tskhay, V; Uhl, S; Veloso, J; Virius, M; Weisrock, T; Wilfert, M; Zaremba, K; Zavertyaev, M; Zemlyanichkina, E; Ziembicki, M; Zink, A

    2015-01-01T23:59:59.000Z

    New results for the double spin asymmetry $A_1^{\\rm p}$ and the proton longitudinal spin structure function $g_1^{\\rm p}$ are presented. They were obtained by the COMPASS collaboration using polarised 200 GeV muons scattered off a longitudinally polarised NH$_3$ target. The data were collected in 2011 and complement those recorded in 2007 at 160\\,GeV, in particular at lower values of $x$. They improve the statistical precision of $g_1^{\\rm p}(x)$ by about a factor of two in the region $x\\lesssim 0.02$. A next-to-leading order QCD fit to the $g_1$ world data is performed. It leads to a new determination of the quark spin contribution to the nucleon spin, $\\Delta \\Sigma$ ranging from 0.26 to 0.36, and to a re-evaluation of the first moment of $g_1^{\\rm p}$. The uncertainty of $\\Delta \\Sigma$ is mostly due to the large uncertainty in the present determinations of the gluon helicity distribution. A new evaluation of the Bjorken sum rule based on the COMPASS results for the non-singlet structure function $g_1^{\\rm...

  5. Double Spin Asymmetries of Inclusive Hadron Electroproductions from a Transversely Polarized $^3\\rm{He}$ Target

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhao, Yuxiang; et. al.,

    2015-07-01T23:59:59.000Z

    We report the measurement of beam-target double-spin asymmetries ($A_\\text{LT}$) in the inclusive production of identified hadrons, $\\vec{e}~$+$~^3\\text{He}^{\\uparrow}\\rightarrow h+X$, using a longitudinally polarized 5.9 GeV electron beam and a transversely polarized $^3\\rm{He}$ target. Hadrons ($\\pi^{\\pm}$, $K^{\\pm}$ and proton) were detected at 16$^{\\circ}$ with an average momentum $$=2.35 GeV/c and a transverse momentum ($p_{T}$) coverage from 0.60 to 0.68 GeV/c. Asymmetries from the $^3\\text{He}$ target were observed to be non-zero for $\\pi^{\\pm}$ production when the target was polarized transversely in the horizontal plane. The $\\pi^{+}$ and $\\pi^{-}$ asymmetries have opposite signs, analogous to the behavior of $A_\\text{LT}$ in semi-inclusive deep-inelastic scattering.

  6. Double Spin Asymmetries of Inclusive Hadron Electroproductions from a Transversely Polarized $^3\\rm{He}$ Target

    E-Print Network [OSTI]

    The Jefferson Lab Hall A Collaboration; Y. X. Zhao; K. Allada; K. Aniol; J. R. M. Annand; T. Averett; F. Benmokhtar; W. Bertozzi; P. C. Bradshaw; P. Bosted; A. Camsonne; M. Canan; G. D. Cates; C. Chen; J. -P. Chen; W. Chen; K. Chirapatpimol; E. Chudakov; E. Cisbani; J. C. Cornejo; F. Cusanno; M. Dalton; W. Deconinck; C. W. de Jager; R. De Leo; X. Deng; A. Deur; H. Ding; P. A. M. Dolph; C. Dutta; D. Dutta; L. El Fassi; S. Frullani; H. Gao; F. Garibaldi; D. Gaskell; S. Gilad; R. Gilman; O. Glamazdin; S. Golge; L. Guo; D. Hamilton; O. Hansen; D. W. Higinbotham; T. Holmstrom; J. Huang; M. Huang; H. F Ibrahim; M. Iodice; X. Jiang; G. Jin; M. K. Jones; J. Katich; A. Kelleher; W. Kim; A. Kolarkar; W. Korsch; J. J. LeRose; X. Li; Y. Li; R. Lindgren; N. Liyanage; E. Long; H. -J. Lu; D. J. Margaziotis; P. Markowitz; S. Marrone; D. McNulty; Z. -E. Meziani; R. Michaels; B. Moffit; C. Muñoz Camacho; S. Nanda; A. Narayan; V. Nelyubin; B. Norum; Y. Oh; M. Osipenko; D. Parno; J. -C. Peng; S. K. Phillips; M. Posik; A. J. R. Puckett; X. Qian; Y. Qiang; A. Rakhman; R. Ransome; S. Riordan; A. Saha; B. Sawatzky; E. Schulte; A. Shahinyan; M. H. Shabestari; S. Širca; S. Stepanyan; R. Subedi; V. Sulkosky; L. -G. Tang; W. A. Tobias; G. M. Urciuoli; I. Vilardi; K. Wang; B. Wojtsekhowski; Y. Wang; X. Yan; H. Yao; Y. Ye; Z. Ye; L. Yuan; X. Zhan; Y. Zhang; Y. -W. Zhang; B. Zhao; X. Zheng; L. Zhu; X. Zhu; X. Zong

    2015-02-04T23:59:59.000Z

    We report the measurement of beam-target double-spin asymmetries ($A_\\text{LT}$) in the inclusive production of identified hadrons, $\\vec{e}~$+$~^3\\text{He}^{\\uparrow}\\rightarrow h+X$, using a longitudinally polarized 5.9 GeV electron beam and a transversely polarized $^3\\rm{He}$ target. Hadrons ($\\pi^{\\pm}$, $K^{\\pm}$ and proton) were detected at 16$^{\\circ}$ with an average momentum $$=2.35 GeV/c and a transverse momentum ($p_{T}$) coverage from 0.60 to 0.68 GeV/c. Asymmetries from the $^3\\text{He}$ target were observed to be non-zero for $\\pi^{\\pm}$ production when the target was polarized transversely in the horizontal plane. The $\\pi^{+}$ and $\\pi^{-}$ asymmetries have opposite signs, analogous to the behavior of $A_\\text{LT}$ in semi-inclusive deep-inelastic scattering.

  7. Leptonic decay of the phi(1020) meson in Au+Au collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV measured with the STAR experiment

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calder'on de la Barca S'anchez; J. M. Campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; X. Chen; J. Cheng; M. Cherney; W. Christie; M. J. M. Codrington; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Feng; P. Filip; Y. Fisyak; C. E. Flores; L. Fulek; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; X. Huang; H. Z. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; K. Jiang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; Z. M. Li; Y. Li; X. Li; C. Li; W. Li; X. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; Y. G. Ma; R. Ma; G. L. Ma; L. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; K. Meehan; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. L. Olvitt Jr.; B. S. Page; R. Pak; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; A. Peterson; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; M. Posik; A. M. Poskanzer; N. K. Pruthi; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; S. Raniwala; R. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; M. K. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. Sikora; M. Simko; M. J. Skoby; N. Smirnov; D. Smirnov; D. Solanki; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; M. Stepanov; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. J. Summa; Y. Sun; X. M. Sun; X. Sun; Z. Sun; B. Surrow; D. N. Svirida; M. A. Szelezniak; A. H. Tang; Z. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; A. N. Vasiliev; R. Vertesi; F. Videbaek; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; J. S. Wang; G. Wang; F. Wang; Y. Wang; Y. Wang; H. Wang; G. Webb; J. C. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; Q. H. Xu; Z. Xu; Y. F. Xu; N. Xu; H. Xu; Y. Yang; S. Yang; Q. Yang; Y. Yang; C. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; X. P. Zhang; J. B. Zhang; Y. Zhang; J. Zhang; Z. Zhang; J. L. Zhang; S. Zhang; J. Zhao; F. Zhao; C. Zhong; L. Zhou; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-03-13T23:59:59.000Z

    We report the measurement of the phi(1020) meson production via the leptonic decay channel in Au+Au collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV from the STAR (Solenoidal Tracker at RHIC) experiment. The transverse momentum ($p_{\\rm T}$) spectrum is measured for 0.1 $\\le p_{\\rm T} \\le 2.5$ GeV/$c$ at mid-rapidity ($|y|\\le1$) with a similar detector setup of corresponding measurements via the hadronic decay channel. We obtain the $p_{\\rm T}$-integrated phi(1020) mass $M_{\\phi}=1017.7\\pm0.8 (\\rm {stat.}) \\pm0.9 (\\rm {sys.})$ MeV/$c^{2}$ and width $\\Gamma_{\\phi} = 8.0\\pm 2.5(\\rm {stat.}) \\pm 2.3(\\rm {sys.}) \\textrm{MeV/}c^{2}$, which are within 1.5 $\\sigma$ and 1.1 $\\sigma$ of the vacuum values, respectively. No significant difference is observed in the reconstructed phi(1020) $p_{\\rm T}$ spectrum, $dN/dy$, or $\\left$ between the leptonic and hadronic decay channels. The experimental results are compared to a theoretical model including the medium-modified phi(1020).

  8. Disc evolution and the relationship between $L_{\\rm acc}$ and $L_\\ast$ in T Tauri stars

    E-Print Network [OSTI]

    I. Tilling; C. J. Clarke; J. E. Pringle; C. A. Tout

    2008-01-14T23:59:59.000Z

    We investigate the evolution of accretion luminosity $L_{\\rm acc}$ and stellar luminosity ${L_\\ast}$ in pre-mainsequence stars. We make the assumption that when the star appears as a Class II object, the major phase of accretion is long past, and the accretion disc has entered its asymptotic phase. We use an approximate stellar evolution scheme for accreting pre-mainsequence stars based on Hartmann, Cassen & Kenyon, 1997. We show that the observed range of values $k = L_{\\rm acc}/L_\\ast$ between 0.01 and 1 can be reproduced if the values of the disc mass fraction $M_{\\rm disc}/M_*$ at the start of the T Tauri phase lie in the range 0.01 -- 0.2, independent of stellar mass. We also show that the observed upper bound of $L_{\\rm acc} \\sim L_\\ast$ is a generic feature of such disc accretion. We conclude that as long as the data uniformly fills the region between this upper bound and observational detection thresholds, then the degeneracies between age, mass and accretion history severely limit the use of this data for constraining possible scalings between disc properties and stellar mass.

  9. Accounting strategy of tritium inventory in the heavy water detritiation pilot plant from ICIT Rm. Valcea

    SciTech Connect (OSTI)

    Bidica, N.; Stefanescu, I. [Inst. of Cryogenics and Isotopes Technologies, Uzinei Str. No. 4, Rm. Valcea (Romania); Cristescu, I. [TLK, Forschungszentrum Karlsruhe, Postfach 3640, D76021 Karlsruhe (Germany); Bornea, A.; Zamfirache, M.; Lazar, A.; Vasut, F.; Pearsica, C.; Stefan, I. [Inst. of Cryogenics and Isotopes Technologies, Uzinei Str. No. 4, Rm. Valcea (Romania); Prisecaru, I.; Sindilar, G. [Univ. Politehnica of Bucharest, Splaiul Independentei 313, Bucharest (Romania)

    2008-07-15T23:59:59.000Z

    In this paper we present a methodology for determination of tritium inventory in a tritium removal facility. The method proposed is based on the developing of computing models for accountancy of the mobile tritium inventory in the separation processes, of the stored tritium and of the trapped tritium inventory in the structure of the process system components. The configuration of the detritiation process is a combination of isotope catalytic exchange between water and hydrogen (LPCE) and the cryogenic distillation of hydrogen isotopes (CD). The computing model for tritium inventory in the LPCE process and the CD process will be developed basing on mass transfer coefficients in catalytic isotope exchange reactions and in dual-phase system (liquid-vapour) of hydrogen isotopes distillation process. Accounting of tritium inventory stored in metallic hydride will be based on in-bed calorimetry. Estimation of the trapped tritium inventory can be made by subtraction of the mobile and stored tritium inventories from the global tritium inventory of the plant area. Determinations of the global tritium inventory of the plant area will be made on a regular basis by measuring any tritium quantity entering or leaving the plant area. This methodology is intended to be applied to the Heavy Water Detritiation Pilot Plant from ICIT Rm. Valcea (Romania) and to the Cernavoda Tritium Removal Facility (which will be built in the next 5-7 years). (authors)

  10. Permanent Magnet Assisted Synchronous Reluctance Machine (PMa-SynRM) Design and Performance Analysis for Fan and Pump Applications

    E-Print Network [OSTI]

    Vartanian, Robert

    2014-08-13T23:59:59.000Z

    -5: Different synchronous machines: (a) Permanent Magnet Synchronous Machine (PMSM), (b) Interior Permanent Magnet (IPM), (c) Synchronous Reluctance Machine (SynRM), (d) Axially Laminated Synchronous Reluctance Machine, (e) Permanent Magnet assisted Syn... and assembling the laminations on the shaft axially[11, 20-22]. 6 (a) (b) (c) (d) (e) Fig 1-5: Different synchronous machines: (a) Permanent Magnet Synchronous Machine (PMSM), (b) Interior Permanent Magnet (IPM), (c) Synchronous...

  11. The energy production rate density of cosmic rays in the local universe is $\\sim10^{44-45}\\rm erg~Mpc^{-3}~yr^{-1}$ at all particle energies

    E-Print Network [OSTI]

    Katz, Boaz; Thompson, Todd; Loeb, Abraham

    2013-01-01T23:59:59.000Z

    The energy output (per logarithmic interval of particle energies) of Cosmic Rays (CRs) with energies $10{\\rm GeV}\\lesssim\\varepsilon_p\\lesssim100{\\rm GeV}$ is $\\sim 10^{47}\\rm erg$ per solar mass of star$-$formation, based on the CR production rate in the Milky Way and in starburst galaxies, implying a generation rate of $\\varepsilon_p^2Q\\sim 10^{45}\\rm erg~Mpc^{-3}~yr^{-1}$ in the local universe. It is only $\\sim 10$ times larger than the output, $\\varepsilon_p^2 Q=0.5\\pm0.2\\times 10^{44}\\rm erg~Mpc^{-3}~yr^{-1}$, of Ultra High Energy CRs (UHECRs) at energies $10^{10.5}{\\rm GeV}<\\varepsilon_p<10^{12}\\rm GeV$ (obtained assuming they are mostly protons), which in turn is comparable to the lower limit of $\\varepsilon_p^2 Q\\ge 0.5\\times 10^{44}\\rm erg~Mpc^{-3}~yr^{-1}$ of high energy CRs with $10^6{\\rm GeV}\\lesssim\\varepsilon_p\\lesssim 10^{8}\\rm GeV$ implied by the saturation of the Waxman-Bahcall bound by the neutrino excess recently discovered by IceCube. These similarities are consistent with a flat pro...

  12. New measurement of $\\rm S_{bare}(E)$ factor of the d(d,p)t reaction at astrophysical energies via the Trojan-horse method

    E-Print Network [OSTI]

    Li, Chengbo; Fu, Yuanyong; Zhou, Jing; Zhou, Shuhua; Meng, Qiuying; Spitaleri, C; Tumino, A; Pizzone, R G; Lamia, L

    2015-01-01T23:59:59.000Z

    The study of d(d,p)t reaction is very important for the nucleosynthesis in both standard Big Bang and stellar evolution, as well as for the future fusion reactor planning of energy production. The d(d,p)t bare nucleus astrophysical S(E) factor has been measured indirectly at energies from about 400 keV down to several keV by means of the Trojan horse method applied to the quasi-free process $\\rm {}^2H({}^6Li,pt){}^4He$ induced at the lithium beam energy of 9.5 MeV, which is closer to the zero quasi-free energy point, in CIAE HI-13 tandem accelerator laboratory. An accurate analysis leads to the determination of the d(d,p)t $\\rm S(E)$ factor $\\rm S_{bare}(0)=56.7 \\pm 2.0 keV*b$ and of the corresponding electron screening potential $\\rm U_e = 13.2 \\pm 4.3 eV$. In addition, this work also gives an updated test for the Trojan horse nucleus invariance comparing with previous indirect investigations using $\\rm {}^3He=(d+p)$ breakup.

  13. New measurement of $\\rm S_{bare}(E)$ factor of the d(d,p)t reaction at astrophysical energies via the Trojan-horse method

    E-Print Network [OSTI]

    Chengbo Li; Qungang Wen; Yuanyong Fu; Jing Zhou; Shuhua Zhou; Qiuying Meng; C. Spitaleri; A. Tumino; R. G. Pizzone; L. Lamia

    2015-04-08T23:59:59.000Z

    The study of d(d,p)t reaction is very important for the nucleosynthesis in both standard Big Bang and stellar evolution, as well as for the future fusion reactor planning of energy production. The d(d,p)t bare nucleus astrophysical S(E) factor has been measured indirectly at energies from about 400 keV down to several keV by means of the Trojan horse method applied to the quasi-free process $\\rm {}^2H({}^6Li,pt){}^4He$ induced at the lithium beam energy of 9.5 MeV, which is closer to the zero quasi-free energy point, in CIAE HI-13 tandem accelerator laboratory. An accurate analysis leads to the determination of the d(d,p)t $\\rm S(E)$ factor $\\rm S_{bare}(0)=56.7 \\pm 2.0 keV*b$ and of the corresponding electron screening potential $\\rm U_e = 13.2 \\pm 4.3 eV$. In addition, this work also gives an updated test for the Trojan horse nucleus invariance comparing with previous indirect investigations using $\\rm {}^3He=(d+p)$ breakup.

  14. Sensor Consortium, Rm 214 Old Chemistry Building, State University of New York at Stony Brook, Stony Brook NY 11794-3717

    E-Print Network [OSTI]

    Luryi, Serge

    Sensor Consortium, Rm 214 Old Chemistry Building, State University of New York at Stony Brook twice won the NYS Advisor of the Year Award. The seminar will cover the following topics: · Statement and rationales Lunch will be served at 12:30 PM The NYS SBDC is partially funded by the U.S. Small Business

  15. Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu

    E-Print Network [OSTI]

    Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu - 1 - What Can I Do With A Major In INFORMATION SYSTEMS? This handout will provide education. You'll gain a solid foundation in the various business disciplines and gain an understanding

  16. Evaluation of Cu as an interlayer in Be/F82H diffusion bonds for ITER TBM R.M. Hunt a,

    E-Print Network [OSTI]

    Abdou, Mohamed

    expansion in the region. Prior diffusion bonding research has shown that titanium is a good bonding aidEvaluation of Cu as an interlayer in Be/F82H diffusion bonds for ITER TBM R.M. Hunt a, , S.H. Goods has been investigated as a potential interlayer material for diffusion bonds between beryllium

  17. 230 GHz VLBI observations of M87: event-horizon-scale structure at the enhanced very-high-energy $\\rm \\gamma$-ray state in 2012

    E-Print Network [OSTI]

    Akiyama, Kazunori; Fish, Vincent L; Doeleman, Sheperd S; Broderick, Avery E; Dexter, Jason; Hada, Kazuhiro; Kino, Motoki; Nagai, Hiroshi; Honma, Mareki; Johnson, Michael D; Algaba, Juan C; Asada, Keiichi; Brinkerink, Christiaan; Blundell, Ray; Bower, Geoffrey C; Cappallo, Roger; Crew, Geoffrey B; Dexter, Matt; Dzib, Sergio A; Freund, Robert; Friberg, Per; Gurwell, Mark; Ho, Paul T P; Inoue, Makoto; Krichbaum, Thomas P; Loinard, Laurent; MacMahon, David; Marrone, Daniel P; Moran, James M; Nakamura, Masanori; Nagar, Neil M; Ortiz-Leon, Gisela; Plambeck, Richard; Pradel, Nicolas; Primiani, Rurik A; Rogers, Alan E E; Roy, Alan L; SooHoo, Jason; Tavares, Jonathan-Leon; Tilanus, Remo P J; Titus, Michael; Wagner, Jan; Weintroub, Jonathan; Yamaguchi, Paul; Young, Ken H; Zensus, Anton; Ziurys, Lucy M

    2015-01-01T23:59:59.000Z

    We report on 230 GHz (1.3 mm) VLBI observations of M87 with the Event Horizon Telescope using antennas on Mauna Kea in Hawaii, Mt. Graham in Arizona and Cedar Flat in California. For the first time, we have acquired 230 GHz VLBI interferometric phase information on M87 through measurement of closure phase on the triangle of long baselines. Most of the measured closure phases are consistent with 0$^{\\circ}$ as expected by physically-motivated models for 230 GHz structure such as jet models and accretion disk models. The brightness temperature of the event-horizon-scale structure is $\\sim 1 \\times 10^{10}$ K derived from the compact flux density of $\\sim 1$ Jy and the angular size of $\\sim 40 $ $\\rm \\mu$as $\\sim$ 5.5 $R_{{\\rm s}}$, which is broadly consistent with the peak brightness of the radio cores at 1-86 GHz located within $\\sim 10^2$ $R_{{\\rm s}}$. Our observations occurred in the middle of an enhancement in very-high-energy (VHE) $\\rm \\gamma$-ray flux, presumably originating in the vicinity of the centr...

  18. Sampling and analyses report for June 1992 semiannual postburn sampling at the RM1 UCG site, Hanna, Wyoming

    SciTech Connect (OSTI)

    Lindblom, S.R.

    1992-08-01T23:59:59.000Z

    The Rocky Mountain 1 (RMl) underground coal gasification (UCG) test was conducted from November 16, 1987 through February 26, 1988 (United Engineers and Constructors 1989) at a site approximately one mile south of Hanna, Wyoming. The test consisted of dual module operation to evaluate the controlled retracting injection point (CRIP) technology, the elongated linked well (ELW) technology, and the interaction of closely spaced modules operating simultaneously. The test caused two cavities to be formed in the Hanna No. 1 coal seam and associated overburden. The Hanna No. 1 coal seam is approximately 30 ft thick and lays at depths between 350 ft and 365 ft below the surface in the test area. The coal seam is overlain by sandstones, siltstones and claystones deposited by various fluvial environments. The groundwater monitoring was designed to satisfy the requirements of the Wyoming Department of Environmental Quality (WDEQ) in addition to providing research data toward the development of UCG technology that minimizes environmental impacts. The June 1992 semiannual groundwater.sampling took place from June 10 through June 13, 1992. This event occurred nearly 34 months after the second groundwater restoration at the RM1 site and was the fifteenth sampling event since UCG operations ceased. Samples were collected for analyses of a limited suite set of parameters as listed in Table 1. With a few exceptions, the groundwater is near baseline conditions. Data from the field measurements and analysis of samples are presented. Benzene concentrations in the groundwater were below analytical detection limits.

  19. Sampling and analyses report for December 1991 semiannual postburn sampling at the RM1 UCG site, Hanna, Wyoming

    SciTech Connect (OSTI)

    Lindblom, S.R.

    1992-01-01T23:59:59.000Z

    The Rocky Mountain 1 (RM1) underground coal gasification (UCG) test was conducted from November 16, 1987, through February 26, 1988 at a site approximately one mile south of Hanna, Wyoming. The test consisted of a dual-module operation to evaluate the controlled retracting injection point (CRIP) technology, the elongated linked well (ELW) technology, and the interaction of closely spaced modules operating simultaneously. The test caused two cavities to form in the Hanna No. 1 coal seam and associated overburden. The Hanna No. 1 coal seam was approximately 30 ft thick and lay at depths between 350 and 365 ft below the surface in the test area. The coal seam was overlain by sandstones, siltstones, and claystones deposited by various fluvial environments. The groundwater monitoring was designed to satisfy the requirements of the Wyoming Department of Environmental Quality (WDEQ) in addition to providing research data toward the development of UCG technology that minimizes environmental impacts. Further background material and the sampling and analytical procedures associated with the sampling task are described in the Rocky Mountain 1 Postburn Groundwater Monitoring Quality Assurance Plan (Mason and Johnson 1988).

  20. Dielectron Mass Spectra from Au+Au Collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; H. Bichsel; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bültmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderóndze la Barca Sánchez; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; S. Dhamija; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; L. Eun; O. Evdokimov; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; E. Finch; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; O. Hajkova; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; M. J. LeVine; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. M. M. D. Madagodagettige Don; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; M. Pachr; B. S. Page; S. K. Pal; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; W. Peryt; P. Pile; M. Planinic; J. Pluta; N. Poljak; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; P. R. Pujahari; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. N. Singaraju; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbæk; Y. P. Viyogi; S. Vokal; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; Y. Zawisza; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-07-15T23:59:59.000Z

    We report the STAR measurements of dielectron ($e^+e^-$) production at midrapidity ($|y_{ee}|<$1) in Au+Au collisions at $\\sqrt{s_{\\rm NN}}$ = 200\\,GeV. The measurements are evaluated in different invariant mass regions with a focus on 0.30-0.76 ($\\rho$-like), 0.76-0.80 ($\\omega$-like), and 0.98-1.05 ($\\phi$-like) GeV/$c^{2}$. The spectrum in the $\\omega$-like and $\\phi$-like regions can be well described by the hadronic cocktail simulation. In the $\\rho$-like region, however, the vacuum $\\rho$ spectral function cannot describe the shape of the dielectron excess. In this range, an enhancement of 1.77$\\pm$0.11(stat.)$\\pm$0.24(sys.)$\\pm$0.33(cocktail) is determined with respect to the hadronic cocktail simulation that excludes the $\\rho$ meson. The excess yield in the $\\rho$-like region increases with the number of collision participants faster than the $\\omega$ and $\\phi$ yields. Theoretical models with broadened $\\rho$ contributions through interactions with constituents in the hot QCD medium provide a consistent description of the dilepton mass spectra for the measurement presented here and the earlier data at the Super Proton Synchrotron energies.

  1. RM Power Projects

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    rate-setting functions were integrated in 1990. The projects serve Colorado, Kansas, Nebraska and Wyoming with 830 MW of installed capacity and 3,360 miles of transmission line....

  2. RM Environmental Review (NEPA)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    San Juan County, NM (8-30-13) Lusk Rural Substation Control Building Construction Niobrara County, WY (1-16-13) Malta-Mt. Elbert 230-kV Danger Tree Management, Lake...

  3. Commissioning Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment. CashDay-JuneOffice of EnvironmentalCheckout,

  4. Conceptual Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.Attachment FY2011-40(10 CFR Parts

  5. Conceptual Safety Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.Attachment FY2011-40(10 CFR PartsOil, and

  6. Construction Readiness RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.AttachmentEnergyGeneratingConstruction

  7. Final Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Departmentof Ohio Environmental Protection Agency

  8. Preliminary Safety Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie Croft SeniorDepartment2015NEA-2011-02

  9. Prelminary Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie CroftPRELIMINARY TECHNOLOGYPreliminary

  10. Project Execution Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring Solar forProject Develops

  11. Readiness Review RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo.FrequencyEO-05-01:Regulatory

  12. Risk Management RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR -DepartmentRetail DemandEnergyRisk Management Review

  13. Acquisition Strategy RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613Portsmouth SitePresentations |State Wind EnergyEnergy26.17AcquisitionNo. AL

  14. Decommissioning Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesvilleAboutStatement993 SEAB Meeting December 3, 2013 SEABEnergy

  15. Integrated Project Team RM

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment of EnergyIndustry Research ProjectIntegrated Project Team (IPT)

  16. Event-plane dependent dihadron correlations with harmonic $v_n$ subtraction in Au+Au Collisions at $\\sqrt{s_{_{\\rm NN}}}=200$ GeV

    E-Print Network [OSTI]

    STAR Collaboration

    2014-04-03T23:59:59.000Z

    STAR measurements of dihadron azimuthal correlations ($\\Delta\\phi$) are reported in mid-central (20-60\\%) Au+Au collisions at $\\sqrt{s_{_{\\rm NN}}}=200$ GeV as a function of the trigger particle's azimuthal angle relative to the event plane, $\\phi_{s}=|\\phi_{t}-\\psi_{\\rm EP}|$. The elliptic ($v_2$), triangular ($v_3$), and quadratic ($v_4$) flow harmonic backgrounds are subtracted using the Zero Yield At Minimum (ZYAM) method. The results are compared to minimum-bias d+Au collisions. It is found that a finite near-side ($|\\Delta\\phi|\\pi/2$) correlation shows a modification from d+Au data, varying with $\\phi_{s}$. The modification may be a consequence of pathlength-dependent jet-quenching and may lead to a better understanding of high-density QCD.

  17. A Roadmap to Control Penguin Effects in $B^0_d\\to J/?K_{\\rm S}^0$ and $B^0_s\\to J/??$

    E-Print Network [OSTI]

    Kristof De Bruyn; Robert Fleischer

    2015-03-30T23:59:59.000Z

    Measurements of CP violation in $B^0_d\\to J/\\psi K_{\\rm S}^0$ and $B^0_s\\to J/\\psi \\phi$ decays play key roles in testing the quark-flavour sector of the Standard Model. The theoretical interpretation of the corresponding observables is limited by uncertainties from doubly Cabibbo-suppressed penguin topologies. With continuously increasing experimental precision, it is mandatory to get a handle on these contributions, which cannot be calculated reliably in QCD. In the case of the measurement of $\\sin2\\beta$ from $B^0_d\\to J/\\psi K_{\\rm S}^0$, the $U$-spin-related decay $B^0_s\\to J/\\psi K_{\\rm S}^0$ offers a tool to control the penguin effects. As the required measurements are not yet available, we use data for decays with similar dynamics and the $SU(3)$ flavour symmetry to constrain the size of the expected penguin corrections. We predict the CP asymmetries of $B^0_s\\to J/\\psi K_{\\rm S}^0$ and present a scenario to fully exploit the physics potential of this decay, emphasising also the determination of hadronic parameters and their comparison with theory. In the case of the benchmark mode $B^0_s\\to J/\\psi \\phi$ used to determine the $B^0_s$-$\\bar B^0_s$ mixing phase $\\phi_s$ the penguin effects can be controlled through $B^0_d\\to J/\\psi \\rho^0$ and $B^0_s\\to J/\\psi \\bar{K}^{*0}$ decays. The LHCb collaboration has recently presented pioneering results on this topic. We analyse their implications and present a roadmap for controlling the penguin effects.

  18. Effect of event selection on jetlike correlation measurement in $d$+Au collisions at $\\sqrt{s_{\\rm{NN}}}=200$ GeV

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calder'on de la Barca S'anchez; J. M. campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; J. Cheng; M. Cherney; W. Christie; M. J. M. Codrington; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Feng; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; S. Gupta; A. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; H. Z. Huang; X. Huang; B. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; S. R. Klein; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; X. Li; C. Li; X. Li; W. Li; Z. M. Li; Y. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; L. Ma; G. L. Ma; Y. G. Ma; R. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; M. K. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. J. Summa; Z. Sun; Y. Sun; X. Sun; X. M. Sun; B. Surrow; D. N. Svirida; M. A. Szelezniak; J. Takahashi; Z. Tang; A. H. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbaek; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; J. S. Wang; Y. Wang; F. Wang; Y. Wang; G. Wang; H. Wang; J. C. Webb; G. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; Q. H. Xu; H. Xu; N. Xu; Y. F. Xu; Z. Xu; W. Yan; Y. Yang; Q. Yang; Y. Yang; C. Yang; S. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; X. P. Zhang; S. Zhang; Z. Zhang; Y. Zhang; J. L. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-03-03T23:59:59.000Z

    Dihadron correlations are analyzed in $\\sqrt{s_{_{\\rm NN}}} = 200$ GeV $d$+Au collisions classified by forward charged particle multiplicity and zero-degree neutral energy in the Au-beam direction. It is found that the jetlike correlated yield increases with the event multiplicity. After taking into account this dependence, the non-jet contribution on the away side is minimal, leaving little room for a back-to-back ridge in these collisions.

  19. Growth of cubic GaN on nano-patterned 3C-SiC/Si (0 0 1) substrates R.M. Kemper n

    E-Print Network [OSTI]

    As, Donat Josef

    Growth of cubic GaN on nano-patterned 3C-SiC/Si (0 0 1) substrates R.M. Kemper n , M. Weinl, C matched nano- patterned substrates. In hexagonal GaN inherent spontaneous and piezoelectric polarization conditions to achieve heteroepitaxial growth of cubic GaN [8]. The most ade- quate substrate is 3C-SiC (0 0 1

  20. Measurements of Dielectron Production in Au$+$Au Collisions at $\\sqrt{s_{\\rm NN}}$ = 200 GeV from the STAR Experiment

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderón de la Barca Sánchez; J. M. Campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; X. Chen; J. Cheng; M. Cherney; W. Christie; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Z. Feng; P. Filip; Y. Fisyak; C. E. Flores; L. Fulek; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; S. Gupta; A. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; X. Huang; H. Z. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; K. Jiang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; L. Kochenda; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; X. Li; C. Li; W. Li; Z. M. Li; Y. Li; X. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; Y. G. Ma; G. L. Ma; L. Ma; R. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; K. Meehan; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. Olvitt Jr.; B. S. Page; R. Pak; Y. X. Pan; Y. Pandit; Y. Panebratsev; B. Pawlik; H. Pei; C. Perkins; A. Peterson; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; M. Posik; A. M. Poskanzer; N. K. Pruthi; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; M. K. Sharma; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. Sikora; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; M. Stepanov; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. Summa; X. Sun; Z. Sun; X. M. Sun; Y. Sun; B. Surrow; N. Svirida; M. A. Szelezniak; A. H. Tang; Z. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; A. N. Vasiliev; R. Vertesi; F. Videbæk; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; G. Wang; Y. Wang; F. Wang; Y. Wang; H. Wang; J. S. Wang; J. C. Webb; G. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. G. Xiao; W. Xie; K. Xin; Q. H. Xu; Z. Xu; H. Xu; N. Xu; Y. F. Xu; Q. Yang; Y. Yang; S. Yang; Y. Yang; C. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; X. P. Zhang; J. Zhang; Y. Zhang; J. Zhang; J. B. Zhang; S. Zhang; Z. Zhang; J. Zhao; C. Zhong; L. Zhou; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-04-06T23:59:59.000Z

    We report on measurements of dielectron ($e^+e^-$) production in Au$+$Au collisions at a center-of-mass energy of 200 GeV per nucleon-nucleon pair using the STAR detector at RHIC. Systematic measurements of the dielectron yield as a function of transverse momentum ($p_{\\rm T}$) and collision centrality show an enhancement compared to a cocktail simulation of hadronic sources in the low invariant-mass region ($M_{ee}<$ 1 GeV/$c^2$). This enhancement cannot be reproduced by the $\\rho$-meson vacuum spectral function. In minimum-bias collisions, in the invariant-mass range of 0.30 $-$ 0.76 GeV/$c^2$, integrated over the full $p_{\\rm T}$ acceptance, the enhancement factor is 1.76 $\\pm$ 0.06 (stat.) $\\pm$ 0.26 (sys.) $\\pm$ 0.29 (cocktail). The enhancement factor exhibits weak centrality and $p_{\\rm T}$ dependence in STAR's accessible kinematic regions, while the excess yield in this invariant-mass region as a function of the number of participating nucleons follows a power-law shape with a power of 1.44 $\\pm$ 0.10. Models that assume an in-medium broadening of the $\\rho$ meson spectral function consistently describe the observed excess in these measurements. Additionally, we report on measurements of $\\omega$ and $\\phi$-meson production through their $e^+e^-$ decay channel. These measurements show good agreement with Tsallis Blast-Wave model predictions as well as, in the case of the $\\phi$-meson, results through its $K^+K^-$ decay channel. In the intermediate invariant-mass region (1.1$

  1. Single Spin Asymmetries in Charged Kaon Production from Semi-Inclusive Deep Inelastic Scattering on a Transversely Polarized $^3{\\rm{He}}$ Target

    E-Print Network [OSTI]

    Y. X. Zhao; Y. Wang; K. Allada; K. Aniol; J. R. M. Annand; T. Averett; F. Benmokhtar; W. Bertozzi; P. C. Bradshaw; P. Bosted; A. Camsonne; M. Canan; G. D. Cates; C. Chen; J. -P. Chen; W. Chen; K. Chirapatpimol; E. Chudakov; E. Cisbani; J. C. Cornejo; F. Cusanno; M. M. Dalton; W. Deconinck; C. W. de Jager; R. De Leo; X. Deng; A. Deur; H. Ding; P. A. M. Dolph; C. Dutta; D. Dutta; L. El Fassi; S. Frullani; H. Gao; F. Garibaldi; D. Gaskell; S. Gilad; R. Gilman; O. Glamazdin; S. Golge; L. Guo; D. Hamilton; O. Hansen; D. W. Higinbotham; T. Holmstrom; J. Huang; M. Huang; H. F Ibrahim; M. Iodice; X. Jiang; G. Jin; M. K. Jones; J. Katich; A. Kelleher; W. Kim; A. Kolarkar; W. Korsch; J. J. LeRose; X. Li; Y. Li; R. Lindgren; N. Liyanage; E. Long; H. -J. Lu; D. J. Margaziotis; P. Markowitz; S. Marrone; D. McNulty; Z. -E. Meziani; R. Michaels; B. Moffit; C. Muñoz Camacho; S. Nanda; A. Narayan; V. Nelyubin; B. Norum; Y. Oh; M. Osipenko; D. Parno; J. -C. Peng; S. K. Phillips; M. Posik; A. J. R. Puckett; X. Qian; Y. Qiang; A. Rakhman; R. Ransome; S. Riordan; A. Saha; B. Sawatzky; E. Schulte; A. Shahinyan; M. H. Shabestari; S. Širca; S. Stepanyan; R. Subedi; V. Sulkosky; L. -G. Tang; A. Tobias; G. M. Urciuoli; I. Vilardi; K. Wang; B. Wojtsekhowski; X. Yan; H. Yao; Y. Ye; Z. Ye; L. Yuan; X. Zhan; Y. Zhang; Y. -W. Zhang; B. Zhao; X. Zheng; L. Zhu; X. Zhu; X. Zong

    2014-04-29T23:59:59.000Z

    We report the first measurement of target single spin asymmetries of charged kaons produced in semi-inclusive deep inelastic scattering of electrons off a transversely polarized $^3{\\rm{He}}$ target. Both the Collins and Sivers moments, which are related to the nucleon transversity and Sivers distributions, respectively, are extracted over the kinematic range of 0.1$<$$x_{bj}$$<$0.4 for $K^{+}$ and $K^{-}$ production. While the Collins and Sivers moments for $K^{+}$ are consistent with zero within the experimental uncertainties, both moments for $K^{-}$ favor negative values. The Sivers moments are compared to the theoretical prediction from a phenomenological fit to the world data. While the $K^{+}$ Sivers moments are consistent with the prediction, the $K^{-}$ results differ from the prediction at the 2-sigma level.

  2. COMM-OPINION-ORDER, 76 FERC 61,347, Promoting Wholesale Competition Through Open-Access Non-discriminatory Transmission Services by Public Utilities, Docket No. RM95-8-000, Recovery of Stranded Costs by

    E-Print Network [OSTI]

    Laughlin, Robert B.

    COMM-OPINION-ORDER, 76 FERC ¶61,347, Promoting Wholesale Competition Through Open-Access Non Incorporated Promoting Wholesale Competition Through Open-Access Non-discriminatory Transmission Services Utilities, Docket No. RM94-7-001 [62,646] [¶61,347] Promoting Wholesale Competition Through Open-Access Non

  3. [Smu68] R.M. Smullyan. First-order logic. Berlin: Springer-Verlag, 1968. [Ull88] J.D. Ullman. Principles of Database and Knowledge-Base Systems. Computer Science Press,

    E-Print Network [OSTI]

    Truszczynski, Miroslaw

    [Smu68] R.M. Smullyan. First-order logic. Berlin: Springer-Verlag, 1968. [Ull88] J.D. Ullman of the least model of the Horn logic program [Smu68, AN78]. We #12;rst need some de#12;nit

  4. Quasi-Differential Neutron Scattering Measurements of 238 A.M. Daskalakis, R.M. Bahran, E.J. Blain, B.J. McDermott, S. Piela, and Y. Danon

    E-Print Network [OSTI]

    Danon, Yaron

    Quasi-Differential Neutron Scattering Measurements of 238 U A.M. Daskalakis, R.M. Bahran, E between evaluations through the energy-angle distribution of neutrons from scattering and fission of 238 U using the Rensselaer Polytechnic Institute (RPI) neutron scattering system. Differential neutron

  5. Tulane Neurophenotyping Platform, Rm. 3731, SL-83, Tulane University Medical Center 1430 Tulane Avenue New Orleans, LA 70112, USA Tel: 1 (504)-988-3353 Fax: 1 (504)-988-5283

    E-Print Network [OSTI]

    Kalueff, Allan V.

    Tulane Neurophenotyping Platform, Rm. 3731, SL-83, Tulane University Medical Center 1430 Tulane@gmail.com Tulane Neurophenotyping Platform Behavioral Core Facility and Learning Resource Center serving Tulane a new transgenic mouse strain? - Tulane Neurophenotyping Platform (TNP) will be glad to help

  6. Sampling and analyses report for December 1991 semiannual postburn sampling at the RM1 UCG site, Hanna, Wyoming. [Quarterly report, January--March 1992

    SciTech Connect (OSTI)

    Lindblom, S.R.

    1992-01-01T23:59:59.000Z

    The Rocky Mountain 1 (RM1) underground coal gasification (UCG) test was conducted from November 16, 1987, through February 26, 1988 at a site approximately one mile south of Hanna, Wyoming. The test consisted of a dual-module operation to evaluate the controlled retracting injection point (CRIP) technology, the elongated linked well (ELW) technology, and the interaction of closely spaced modules operating simultaneously. The test caused two cavities to form in the Hanna No. 1 coal seam and associated overburden. The Hanna No. 1 coal seam was approximately 30 ft thick and lay at depths between 350 and 365 ft below the surface in the test area. The coal seam was overlain by sandstones, siltstones, and claystones deposited by various fluvial environments. The groundwater monitoring was designed to satisfy the requirements of the Wyoming Department of Environmental Quality (WDEQ) in addition to providing research data toward the development of UCG technology that minimizes environmental impacts. Further background material and the sampling and analytical procedures associated with the sampling task are described in the Rocky Mountain 1 Postburn Groundwater Monitoring Quality Assurance Plan (Mason and Johnson 1988).

  7. Long-range pseudorapidity dihadron correlations in $d$+Au collisions at $\\sqrt{s_{\\rm NN}}=200$ GeV

    E-Print Network [OSTI]

    L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; J. Bouchet; A. V. Brandin; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calder'on de la Barca S'anchez; J. M. campbell; D. Cebra; M. C. Cervantes; I. Chakaberia; P. Chaloupka; Z. Chang; S. Chattopadhyay; J. H. Chen; X. Chen; J. Cheng; M. Cherney; W. Christie; M. J. M. Codrington; G. Contin; H. J. Crawford; S. Das; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; B. di Ruzza; L. Didenko; C. Dilks; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; G. Eppley; R. Esha; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; P. Federic; J. Fedorisin; Feng; P. Filip; Y. Fisyak; C. E. Flores; L. Fulek; C. A. Gagliardi; D. Garand; F. Geurts; A. Gibson; M. Girard; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; S. Gupta; A. Gupta; W. Guryn; A. Hamad; A. Hamed; R. Haque; J. W. Harris; L. He; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; H. Z. Huang; X. Huang; B. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; K. Jiang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; X. Li; X. Li; W. Li; Z. M. Li; Y. Li; C. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; L. Ma; R. Ma; G. L. Ma; Y. G. Ma; N. Magdy; R. Majka; A. Manion; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; K. Meehan; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; V. Okorokov; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; A. Peterson; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; M. Posik; A. M. Poskanzer; N. K. Pruthi; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; M. K. Sharma; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; R. Sikora; M. Simko; M. J. Skoby; N. Smirnov; D. Smirnov; D. Solanki; L. Song; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; B. J. Summa; Y. Sun; Z. Sun; X. M. Sun; X. Sun; B. Surrow; D. N. Svirida; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; A. N. Tawfik; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; S. K. Tripathy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; I. Upsal; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; R. Varma; A. N. Vasiliev; R. Vertesi; F. Videbaek; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; Y. Wang; F. Wang; H. Wang; J. S. Wang; G. Wang; Y. Wang; J. C. Webb; G. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; Z. Xu; Q. H. Xu; N. Xu; H. Xu; Y. F. Xu; Y. Yang; C. Yang; S. Yang; Q. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I. -K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; X. P. Zhang; S. Zhang; J. Zhang; Z. Zhang; Y. Zhang; J. L. Zhang; F. Zhao; J. Zhao; C. Zhong; L. Zhou; X. Zhu; Y. Zoulkarneeva; M. Zyzak

    2015-02-26T23:59:59.000Z

    Dihadron angular correlations in $d$+Au collisions at $\\sqrt{s_{\\rm NN}}=200$ GeV are reported as a function of the measured zero-degree calorimeter neutral energy and the forward charged hadron multiplicity in the Au-beam direction. A finite correlated yield is observed at large relative pseudorapidity ($\\Delta\\eta$) on the near side (i.e. relative azimuth $\\Delta\\phi\\sim0$). This correlated yield as a function of $\\Delta\\eta$ appears to scale with the dominant, primarily jet-related, away-side ($\\Delta\\phi\\sim\\pi$) yield. The Fourier coefficients of the $\\Delta\\phi$ correlation, $V_{n}=\\langle\\cos n\\Delta\\phi\\rangle$, have a strong $\\Delta\\eta$ dependence. In addition, it is found that $V_{1}$ is approximately inversely proportional to the mid-rapidity event multiplicity, while $V_{2}$ is independent of it with similar magnitude in the forward ($d$-going) and backward (Au-going) directions.

  8. Rapidity and transverse-momentum dependence of the inclusive J/$\\mathbf{\\psi}$ nuclear modification factor in p-Pb collisions at $\\mathbf{\\sqrt{\\textit{s}_{NN}}}=5.02$ TeV

    E-Print Network [OSTI]

    Adam, Jaroslav; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahmed, Ijaz; Ahn, Sang Un; Aimo, Ilaria; Aiola, Salvatore; Ajaz, Muhammad; Akindinov, Alexander; Alam, Sk Noor; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Armesto Perez, Nestor; Arnaldi, Roberta; Aronsson, Tomas; Arsene, Ionut Cristian; Arslandok, Mesut; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Baltasar Dos Santos Pedrosa, Fernando; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Bartke, Jerzy Gustaw; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Belmont Iii, Ronald John; Belmont Moreno, Ernesto; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biswas, Saikat; Bjelogrlic, Sandro; Blanco, Fernando; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botje, Michiel; Botta, Elena; Boettger, Stefan; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Buxton, Jesse Thomas; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Chochula, Peter; Choi, Kyungeon; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Deisting, Alexander; Deloff, Andrzej; Denes, Ervin Sandor; D'Erasmo, Ginevra; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Dobrowolski, Tadeusz Antoni; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent

    2015-01-01T23:59:59.000Z

    We have studied the transverse-momentum ($p_{\\rm T}$) dependence of the inclusive J/$\\psi$ production in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 5.02$ TeV, in three center-of-mass rapidity ($y_{\\rm cms}$) regions, down to zero $p_{\\rm T}$. Results in the forward and backward rapidity ranges ($2.03 < y_{\\rm cms} < 3.53$ and $-4.46 rm cms}< -2.96$) are obtained by studying the J/$\\psi$ decay to $\\mu^+\\mu^-$, while the mid-rapidity region ($-1.37 < y_{\\rm cms} < 0.43$) is investigated by measuring the ${\\rm e}^+{\\rm e}^-$ decay channel. The $p_{\\rm T}$ dependence of the J/$\\psi$ production cross section and nuclear modification factor are presented for each of the rapidity intervals, as well as the J/$\\psi$ mean $p_{\\rm T}$ values. Forward and mid-rapidity results show a suppression of the J/$\\psi$ yield, with respect to pp collisions, which decreases with increasing $p_{\\rm T}$. At backward rapidity no significant J/$\\psi$ suppression is observed. Theoretical models including a combinatio...

  9. Facility Disposition Safety Strategy RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of.pdf6-OPAMDepartment6 FY 2007FY 2014Facilities

  10. MJJ RM Handbook-new

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment ofLetterEconomyDr. ErnestMID-CAREER RETIREMENTMISS-1-NMISUSE OF

  11. National Environmental Policy Act RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_Cost Estimating35.docMusings on|EnergyEnergy

  12. Earned Value Management System RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan Department ofNotices |Notice The Crystal CityofVehicles ||3 -3Earned Value

  13. Anomalous centrality evolution of two-particle angular correlations from Au-Au collisions at $\\sqrt{s_{\\rm NN}}$ = 62 and 200 GeV

    E-Print Network [OSTI]

    STAR Collaboration; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; A. V. Alakhverdyants; I. Alekseev; J. Alford; B. D. Anderson; C. D. Anson; D. Arkhipkin; G. S. Averichev; J. Balewski; D. R. Beavis; R. Bellwied; M. J. Betancourt; R. R. Betts; A. Bhasin; A. K. Bhati; H. Bichsel; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; E. Braidot; A. V. Brandin; S. G. Brovko; E. Bruna; S. Bueltmann; I. Bunzarov; T. P. Burton; X. Z. Cai; H. Caines; M. Calderon; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; S. Chattopadhyay; H. F. Chen; J. H. Chen; J. Y. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; P. Chung; M. J. M. Codrington; R. Corliss; J. G. Cramer; H. J. Crawford; X. Cui; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; L. Didenko; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; J. C. Dunlop; L. G. Efimov; M. Elnimr; J. Engelage; G. Eppley; M. Estienne; L. Eun; O. Evdokimov; R. Fatemi; J. Fedorisin; R. G. Fersch; P. Filip; E. Finch; V. Fine; Y. Fisyak; C. A. Gagliardi; D. R. Gangadharan; F. Geurts; P. Ghosh; Y. N. Gorbunov; A. Gordon; O. G. Grebenyuk; D. Grosnick; A. Gupta; S. Gupta; W. Guryn; B. Haag; O. Hajkova; A. Hamed; L-X. Han; J. W. Harris; J. P. Hays-Wehle; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; B. Huang; H. Z. Huang; T. J. Humanic; L. Huo; G. Igo; W. W. Jacobs; C. Jena; J. Joseph; E. G. Judd; S. Kabana; K. Kang; J. Kapitan; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; D. Kettler; D. P. Kikola; J. Kiryluk; A. Kisiel; V. Kizka; S. R. Klein; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. Koroleva; W. Korsch; L. Kotchenda; P. Kravtsov; K. Krueger; L. Kumar; M. A. C. Lamont; J. M. Landgraf; S. LaPointe; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; W. Leight; M. J. LeVine; C. Li; L. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; L. M. Lima; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; R. S. Longacre; Y. Lu; E. V. Lukashov; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; O. I. Mall; R. Manweiler; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; A. Meschanin; R. Milner; N. G. Minaev; S. Mioduszewski; M. K. Mitrovski; Y. Mohammed; B. Mohanty; M. M. Mondal; B. Morozov; D. A. Morozov; M. G. Munhoz; M. K. Mustafa; M. Naglis; B. K. Nandi; Md. Nasim; T. K. Nayak; L. V. Nogach; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; R. A. N. Oliveira; D. Olson; M. Pachr; B. S. Page; S. K. Pal; Y. Pandit; Y. Panebratsev; T. Pawlak; H. Pei; T. Peitzmann; C. Perkins; W. Peryt; P. Pile; M. Planinic; J. Pluta; D. Plyku; N. Poljak; J. Porter; C. B. Powell; D. Prindle; C. Pruneau; N. K. Pruthi; P. R. Pujahari; J. Putschke; H. Qiu; R. Raniwala; S. Raniwala; R. L. Ray; R. Redwine; R. Reed; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; L. Ruan; J. Rusnak; N. R. Sahoo; I. Sakrejda; S. Salur; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; J. Schaub; A. M. Schmah; N. Schmitz; T. R. Schuster; J. Seele; J. Seger; I. Selyuzhenkov; P. Seyboth; N. Shah; E. Shahaliev; M. Shao; M. Sharma; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; F. Simon; R. N. Singaraju; M. J. Skoby; N. Smirnov; D. Solanki; P. Sorensen; U. G. de Souza; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; S. G. Steadman; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; A. A. P. Suaide; M. C. Suarez; M. Sumbera; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; A. Szanto de Toledo; J. Takahashi; A. H. Tang; Z. Tang; L. H. Tarini; T. Tarnowsky; D. Thein; J. H. Thomas; J. Tian; A. R. Timmins; D. Tlusty; M. Tokarev; T. A. Trainor; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; F. Videbaek; Y. P. Viyogi; S. Vokal; M. Wada; M. Walker; F. Wang; G. Wang; H. Wang; J. S. Wang; Q. Wang; X. L. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; C. Whitten Jr.; H. Wieman; S. W. Wissink; R. Witt; W. Witzke; Y. F. Wu; Z. Xiao; W. Xie; H. Xu; N. Xu; Q. H. Xu; W. Xu; Y. Xu; Z. Xu; L. Xue; Y. Yang; Y. Yang; P. Yepes; K. Yip; I-K. Yoo; M. Zawisza; H. Zbroszczyk; W. Zhan; J. B. Zhang; S. Zhang; W. M. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva

    2012-06-13T23:59:59.000Z

    We present two-dimensional (2D) two-particle angular correlations on relative pseudorapidity $\\eta$ and azimuth $\\phi$ for charged particles from Au-Au collisions at $\\sqrt{s_{\\rm NN}} = 62$ and 200 GeV with transverse momentum $p_t \\geq 0.15$ GeV/$c$, $|\\eta| \\leq 1$ and $2\\pi$ azimuth. Observed correlations include a {same-side} (relative azimuth $< \\pi/2$) 2D peak, a closely-related away-side azimuth dipole, and an azimuth quadrupole conventionally associated with elliptic flow. The same-side 2D peak and away-side dipole are explained by semihard parton scattering and fragmentation (minijets) in proton-proton and peripheral nucleus-nucleus collisions. Those structures follow N-N binary-collision scaling in Au-Au collisions until mid-centrality where a transition to a qualitatively different centrality trend occurs within a small centrality interval. Above the transition point the number of same-side and away-side correlated pairs increases rapidly {relative to} binary-collision scaling, the $\\eta$ width of the same-side 2D peak also increases rapidly ($\\eta$ elongation) and the $\\phi$ width actually decreases significantly. Those centrality trends are more remarkable when contrasted with expectations of jet quenching in a dense medium. Observed centrality trends are compared to {\\sc hijing} predictions and to the expected trends for semihard parton scattering and fragmentation in a thermalized opaque medium. We are unable to reconcile a semihard parton scattering and fragmentation origin for the observed correlation structure and centrality trends with heavy ion collision scenarios which invoke rapid parton thermalization. On the other hand, if the collision system is effectively opaque to few-GeV partons the observations reported here would be inconsistent with a minijet picture.

  14. Energy Dependence of $K/?$, $p/?$, and $K/p$ Fluctuations in Au+Au Collisions from $\\rm \\sqrt{s_{NN}}$ = 7.7 to 200 GeV

    E-Print Network [OSTI]

    STAR Collaboration; N. M. Abdelwahab; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bültmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderón de la Barca Sánchez; J. M. Campbell; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; R. Esha; L. Eun; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; A. Hamad; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbæk; Y. P. Viyogi; S. Vokal; S. A. Voloshin; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; L. Wen; G. D. Westfall; H. Wieman; S. W. Wissink; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-10-21T23:59:59.000Z

    A search for the quantum chromodynamics (QCD) critical point was performed by the STAR experiment at the Relativistic Heavy Ion Collider, using dynamical fluctuations of unlike particle pairs. Heavy-ion collisions were studied over a large range of collision energies with homogeneous acceptance and excellent particle identification, covering a significant range in the QCD phase diagram where a critical point may be located. Dynamical $K/\\pi$, $p/\\pi$, and $K/p$ fluctuations as measured by the STAR experiment in central 0-5% Au+Au collisions from center-of-mass collision energies $\\rm \\sqrt{s_{NN}}$ = 7.7 to 200 GeV are presented. The observable $\\rm \

  15. Isolation of Flow and Nonflow Correlations by Two- and Four-Particle Cumulant Measurements of Azimuthal Harmonics in $\\sqrt{s_{_{\\rm NN}}} =$ 200 GeV Au+Au Collisions

    E-Print Network [OSTI]

    N. M. Abdelwahab; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bültmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderóndela Barca Sánchez; J. M. Campbell; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; L. Eun; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; A. Sandacz; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbæk; Y. P. Viyogi; S. Vokal; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; H. Wieman; S. W. Wissink; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-09-06T23:59:59.000Z

    A data-driven method was applied to measurements of Au+Au collisions at $\\sqrt{s_{_{\\rm NN}}} =$ 200 GeV made with the STAR detector at RHIC to isolate pseudorapidity distance $\\Delta\\eta$-dependent and $\\Delta\\eta$-independent correlations by using two- and four-particle azimuthal cumulant measurements. We identified a component of the correlation that is $\\Delta\\eta$-independent, which is likely dominated by anisotropic flow and flow fluctuations. It was also found to be independent of $\\eta$ within the measured range of pseudorapidity $|\\eta| 0.7$.

  16. Search for a Standard Model-like Higgs boson decaying into WW to l nu qqbar in exclusive jet bins in pp collisions at sqrt s = 8 TeV

    E-Print Network [OSTI]

    CMS Collaboration

    2015-01-01T23:59:59.000Z

    A search for a Standard Model Higgs boson decaying into the WW final state is performed with an integrated luminosity of up to 19.3~${\\rm fb}^{-1}$ of pp collisions at $\\sqrt{s}$~=~8~TeV in the high mass region $600 < m_{\\rm H} < 1000$~GeV.

  17. Laboratory Location (Bldg & Rm #): Principle Investigator

    E-Print Network [OSTI]

    Movileanu, Liviu

    of Hazardous Waste Management Manual (HWMM). Chemical(s) remaining in active lab or to different lab, EHO contacted for a Hazardous Waste Pick-up (Sec. 6.8 HWMM). Properly prepared (Sec.6.0 HWMM) any disposed. Removed all chemicals from shared storage areas (i.e. refrigerators, cold rooms) and properly

  18. Colorado Highlands Wind Project, Western's RM Environment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Colorado Highlands Wind Project Western Area Power Administration, Rocky Mountain Region (Western) has received a request from Colorado Highlands Wind to modify its Interconnection...

  19. Power Marketing and Contracts in RM

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    requirements for FERC Order 890 as outlined in Western's Open Access Transmission Tariff. Final Agenda - Meeting Transmission Challenges in the Rocky Mountain Region...

  20. RM methods for multiple fare structure environments

    E-Print Network [OSTI]

    Kayser, Matthew R. (Matthew Russell)

    2008-01-01T23:59:59.000Z

    The rapid growth of Low Cost Carriers (LCC) and their simplified fare structures has created "semi-restricted" fare structures where lower classes are undifferentiated except for price, while higher fare classes are still ...

  1. Commercial Grade Dedication RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube platformBuildingCoal CombustionSmart Grid RFI:onConsortiumCommercial Grade

  2. Final Design RM | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2: FinalOffers New Training on Energy6 Federalof EnergyThorium, and PotassiumFinal

  3. Construction Project Safety and Health Plan RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.AttachmentEnergyGenerating

  4. Risk Management RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy at Waste-to-Energy usingofRetrofittingFundA l i c e L i p p e r t S e

  5. Safety Design Strategy RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy atLLC - FE DKT. 10-160-LNG - ORDERSTATE0-1 CHAPTER1the1-2009 MaySafetySafety

  6. Quality Assurance for Critical Decision Reviews RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo. 195 -Pueblo de 2011NewslettersQuality

  7. Readiness Review RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo.FrequencyEO-05-01:RegulatoryReadiness

  8. Safeguards and Security and Cyber Security RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSARDevelopmental AssignmentAprilAND POWERADVANCEDSafeguards and

  9. Integrated Project Team RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732on ArmedManufacturing | Department

  10. Acquisition Strategy RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartmentDepartment of2 ofEmergency AcquisitionsAUTHORITY13,April

  11. Commercial Grade Dedication RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs the Department ofAARP,CommercialFebruaryThe

  12. Conceptual Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary 24,ofOctober 2013 PeerThis Review

  13. Conceptual Safety Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary 24,ofOctober 2013 PeerThisOil,

  14. Construction Readiness RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary09 FY1,The Construction

  15. Decommissioning Plan RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732 DOE F 243.2Dashboards Dashboards PublicDavidDeclaration

  16. Preliminary Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA Administrativeof Excellence BuildingDepartment ofSolutions -PD

  17. Preliminary Safety Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA AdministrativeofDepartment of-Department|EA-97-12

  18. Readiness Review RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010In addition to 1National Broadband

  19. Microsoft Word - RM Procedures.doc

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovemberi CONTENTS Executive U.S. Department of Energy,Records

  20. High Performance Sustainable Building Design RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM Flash2011-12Approved on 24 July 2008 1 Office ofHigh Performance

  1. Integrated Project Team RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment of EnergyIndustry Research ProjectIntegrated Project Team

  2. Search for $WH$ associated production in $p \\bar{p}$ collisions at $\\sqrt{s}=1.96\\,{\\rm TeV}$

    SciTech Connect (OSTI)

    Abazov, Victor Mukhamedovich; Abbott, Braden Keim; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Alexeev, Guennadi D.; Alkhazov, Georgiy D.; Alton, Andrew K.; Alverson, George O.; Aoki, Masato; Askew, Andrew Warren

    2012-03-01T23:59:59.000Z

    This report describes a search for associated production of W and Higgs bosons based on data corresponding to an integrated luminosity of L {approx} 5.3 fb{sup -1} collected with the D0 detector at the Fermilab Tevatron p{bar p} Collider. Events containing a W {yields} {ell}{nu} candidate (with {ell} corresponding to e or {mu}) are selected in association with two or three reconstructed jets. One or two of the jets are required to be consistent with having evolved from a b quark. A multivariate discriminant technique is used to improve the separation of signal and backgrounds. Expected and observed upper limits are obtained for the product of the WH production cross section and branching ratios and reported in terms of ratios relative to the prediction of the standard model as a function of the mass of the Higgs boson (M{sub H}). The observed and expected 95% C.L. upper limits obtained for an assumed M{sub H} = 115 GeV are, respectively, factors of 4.5 and 4.8 larger than the value predicted by the standard model.

  3. Rapidity and transverse-momentum dependence of the inclusive J/$\\mathbf?$ nuclear modification factor in p-Pb collisions at $\\mathbf{\\sqrt{\\textit{s}_{NN}}}=5.02$ TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-03-24T23:59:59.000Z

    We have studied the transverse-momentum ($p_{\\rm T}$) dependence of the inclusive J/$\\psi$ production in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 5.02$ TeV, in three center-of-mass rapidity ($y_{\\rm cms}$) regions, down to zero $p_{\\rm T}$. Results in the forward and backward rapidity ranges ($2.03 nuclear modification factor are presented for each of the rapidity intervals, as well as the J/$\\psi$ mean $p_{\\rm T}$ values. Forward and mid-rapidity results show a suppression of the J/$\\psi$ yield, with respect to pp collisions, which decreases with increasing $p_{\\rm T}$. At backward rapidity no significant J/$\\psi$ suppression is observed. Theoretical models including a combination of cold nuclear matter effects such as shadowing and partonic energy loss, are in fair agreement with the data, except at forward rapidity and low transverse momentum. The implications of the p-Pb results for the evaluation of cold nuclear matter effects on J/$\\psi$ production in Pb-Pb collisions are also discussed.

  4. Measurement of electrons from semileptonic heavy-flavor hadron decays in pp collisions at $\\sqrt{s} = 2.76$ TeV

    E-Print Network [OSTI]

    The ALICE Collaboration

    2014-05-16T23:59:59.000Z

    The $p_{\\rm T}$-differential production cross section of electrons from semileptonic decays of heavy-flavor hadrons has been measured at mid-rapidity in proton-proton collisions at $\\sqrt{s} = 2.76$ TeV in the transverse momentum range 0.5 < $p_{\\rm T}$ < 12 GeV/$c$ with the ALICE detector at the LHC. The analysis was performed using minimum bias events and events triggered by the electromagnetic calorimeter. Predictions from perturbative QCD calculations agree with the data within the theoretical and experimental uncertainties.

  5. Forward-backward multiplicity correlations in pp collisions at $\\sqrt{s}$=0.9, 2.76 and 7 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-02-01T23:59:59.000Z

    The strength of forward-backward (FB) multiplicity correlations is measured by the ALICE detector in proton-proton (pp) collisions at $\\sqrt{s}=0.9$, 2.76 and 7 TeV. The measurement is performed in the central pseudorapidity region ($|\\eta| 0.3$ GeV/$c$. Two separate pseudorapidity windows of width ($\\delta \\eta$) ranging from 0.2 to 0.8 are chosen symmetrically around $\\eta=0$. The multiplicity correlation strength ($b_{\\rm cor}$) is studied as a function of the pseudorapidity gap ($\\eta_{\\rm gap}$) between the two windows as well as the width of these windows. The correlation strength is found to decrease with increasing $\\eta_{\\rm gap}$ and shows a non-linear increase with $\\delta\\eta$. A sizable increase of the correlation strength with the collision energy, which cannot be explained exclusively by the increase of the mean multiplicity inside the windows, is observed. The correlation coefficient is also measured for multiplicities in different configurations of two azimuthal sectors selected within the symmetric FB $\\eta$-windows. Two different contributions, the short-range (SR) and the long-range (LR), are observed. The energy dependence of $b_{\\rm cor}$ is found to be weak for the SR component while it is strong for the LR component. Moreover, the correlation coefficient is studied for particles belonging to various transverse momentum intervals chosen to have the same mean multiplicity. Both SR and LR contributions to $b_{\\rm cor}$ are found to increase with $p_{\\rm T}$ in this case. Results are compared to PYTHIA and PHOJET event generators and to a string-based phenomenological model. The observed dependencies of $b_{\\rm cor}$ add new constraints on phenomenological models.

  6. Search for Neutrinoless Double-Beta Decay of $^{130}$Te with CUORE-0

    E-Print Network [OSTI]

    Alfonso, K; Avignone, F T; Azzolini, O; Balata, M; Banks, T I; Bari, G; Beeman, J W; Bellini, F; Bersani, A; Biassoni, M; Brofferio, C; Bucci, C; Caminata, A; Canonica, L; Cao, X G; Capelli, S; Cappelli, L; Carbone, L; Cardani, L; Casali, N; Cassina, L; Chiesa, D; Chott, N; Clemenza, M; Copello, S; Cosmelli, C; Cremonesi, O; Creswick, R J; Cushman, J S; Dafinei, I; Dally, A; Dell'Oro, S; Deninno, M M; DiDomizio, S; DiVacri, M L; Drobizhev, A; Ejzak, L; Fang, D Q; Faverzani, M; Fernandes, G; Ferri, E; Ferroni, F; Fiorini, E; Freedman, S J; Fujikawa, B K; Giachero, A; Gironi, L; Giuliani, A; Gorla, P; Gotti, C; Gutierrez, T D; Haller, E E; Han, K; Hansen, E; Heeger, K M; Hennings-Yeomans, R; Hickerson, K P; Huang, H Z; Kadel, R; Keppel, G; Kolomensky, Yu G; Lim, K E; Liu, X; Ma, Y G; Maino, M; Martinez, M; Maruyama, R H; Mei, Y; Moggi, N; Morganti, S; Nisi, S; Nones, C; Norman, E B; Nucciotti, A; O'Donnell, T; Orio, F; Orlandi, D; Ouellet, J L; Pagliarone, C E; Pallavicini, M; Palmieri, V; Pattavina, L; Pavan, M; Pedretti, M; Pessina, G; Pettinacci, V; Piperno, G; Pirro, S; Pozzi, S; Previtali, E; Rosenfeld, C; Rusconi, C; Sala, E; Sangiorgio, S; Santone, D; Scielzo, N D; Sisti, M; Smith, A R; Taffarello, L; Tenconi, M; Terranova, F; Tomei, C; Trentalange, S; Ventura, G; Vignati, M; Wagaarachchi, S L; Wang, B S; Wang, H W; Wielgus, L; Wilson, J; Winslow, L A; Wise, T; Zanotti, L; Zarra, C; Zhang, G Q; Zhu, B X; Zucchelli, S

    2015-01-01T23:59:59.000Z

    We report the results of a search for neutrinoless double-beta decay in a 9.8~kg$\\cdot$yr exposure of $^{130}$Te using a bolometric detector array, CUORE-0. The characteristic detector energy resolution and background level in the region of interest are $5.1\\pm 0.3{\\rm~keV}$ FWHM and $0.058 \\pm 0.004\\,(\\mathrm{stat.})\\pm 0.002\\,(\\mathrm{syst.})$~counts/(keV$\\cdot$kg$\\cdot$yr), respectively. The median 90%~C.L. lower-limit sensitivity of the experiment is $2.9\\times 10^{24}~{\\rm yr}$ and surpasses the sensitivity of previous searches. We find no evidence for neutrinoless double-beta decay of $^{130}$Te and place a Bayesian lower bound on the decay half-life, $T^{0\

  7. Search for Neutrinoless Double-Beta Decay of $^{130}$Te with CUORE-0

    E-Print Network [OSTI]

    K. Alfonso; D. R. Artusa; F. T. Avignone III; O. Azzolini; M. Balata; T. I. Banks; G. Bari; J. W. Beeman; F. Bellini; A. Bersani; M. Biassoni; C. Brofferio; C. Bucci; A. Caminata; L. Canonica; X. G. Cao; S. Capelli; L. Cappelli; L. Carbone; L. Cardani; N. Casali; L. Cassina; D. Chiesa; N. Chott; M. Clemenza; S. Copello; C. Cosmelli; O. Cremonesi; R. J. Creswick; J. S. Cushman; I. Dafinei; A. Dally; S. Dell'Oro; M. M. Deninno; S. DiDomizio; M. L. DiVacri; A. Drobizhev; L. Ejzak; D. Q. Fang; M. Faverzani; G. Fernandes; E. Ferri; F. Ferroni; E. Fiorini; S. J. Freedman; B. K. Fujikawa; A. Giachero; L. Gironi; A. Giuliani; P. Gorla; C. Gotti; T. D. Gutierrez; E. E. Haller; K. Han; E. Hansen; K. M. Heeger; R. Hennings-Yeomans; K. P. Hickerson; H. Z. Huang; R. Kadel; G. Keppel; Yu. G. Kolomensky; K. E. Lim; X. Liu; Y. G. Ma; M. Maino; M. Martinez; R. H. Maruyama; Y. Mei; N. Moggi; S. Morganti; S. Nisi; C. Nones; E. B. Norman; A. Nucciotti; T. O'Donnell; F. Orio; D. Orlandi; J. L. Ouellet; C. E. Pagliarone; M. Pallavicini; V. Palmieri; L. Pattavina; M. Pavan; M. Pedretti; G. Pessina; V. Pettinacci; G. Piperno; S. Pirro; S. Pozzi; E. Previtali; C. Rosenfeld; C. Rusconi; E. Sala; S. Sangiorgio; D. Santone; N. D. Scielzo; M. Sisti; A. R. Smith; L. Taffarello; M. Tenconi; F. Terranova; C. Tomei; S. Trentalange; G. Ventura; M. Vignati; S. L. Wagaarachchi; B. S. Wang; H. W. Wang; L. Wielgus; J. Wilson; L. A. Winslow; T. Wise; L. Zanotti; C. Zarra; G. Q. Zhang; B. X. Zhu; S. Zucchelli

    2015-04-09T23:59:59.000Z

    We report the results of a search for neutrinoless double-beta decay in a 9.8~kg$\\cdot$yr exposure of $^{130}$Te using a bolometric detector array, CUORE-0. The characteristic detector energy resolution and background level in the region of interest are $5.1\\pm 0.3{\\rm~keV}$ FWHM and $0.058 \\pm 0.004\\,(\\mathrm{stat.})\\pm 0.002\\,(\\mathrm{syst.})$~counts/(keV$\\cdot$kg$\\cdot$yr), respectively. The median 90%~C.L. lower-limit sensitivity of the experiment is $2.9\\times 10^{24}~{\\rm yr}$ and surpasses the sensitivity of previous searches. We find no evidence for neutrinoless double-beta decay of $^{130}$Te and place a Bayesian lower bound on the decay half-life, $T^{0\

  8. Publications of R.M. Kashaev Peer-reviewed articles.

    E-Print Network [OSTI]

    Genève, Université de

    of the dilogarithm. (Russian) Exactly solvable models in mathematical physics (Russian) (Chelyabinsk, 1998). Teoret

  9. Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

    SciTech Connect (OSTI)

    Yu, Y. H.; Jenne, D. S.; Thresher, R.; Copping, A.; Geerlofs, S.; Hanna, L. A.

    2015-01-01T23:59:59.000Z

    This report is an addendum to SAND2013-9040: Methodology for Design and Economic Analysis of Marine Energy Conversion (MEC) Technologies. This report describes an Oscillating Water Column Wave Energy Converter (OSWEC) reference model design in a complementary manner to Reference Models 1-4 contained in the above report. A conceptual design for a taut moored oscillating surge wave energy converter was developed. The design had an annual electrical power of 108 kilowatts (kW), rated power of 360 kW, and intended deployment at water depths between 50 m and 100 m. The study includes structural analysis, power output estimation, a hydraulic power conversion chain system, and mooring designs. The results were used to estimate device capital cost and annual operation and maintenance costs. The device performance and costs were used for the economic analysis, following the methodology presented in SAND2013-9040 that included costs for designing, manufacturing, deploying, and operating commercial-scale MEC arrays up to 100 devices. The levelized cost of energy estimated for the Reference Model 5 OSWEC, presented in this report, was for a single device and arrays of 10, 50, and 100 units, and it enabled the economic analysis to account for cost reductions associated with economies of scale. The baseline commercial levelized cost of energy estimate for the Reference Model 5 device in an array comprised of 10 units is $1.44/kilowatt-hour (kWh), and the value drops to approximately $0.69/kWh for an array of 100 units.

  10. Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    has a gently sloping seabed, free of irregularities that could disturb the local wave field. Thus, it is likely that the wave field is homogeneous over the deployment area of...

  11. 5:00-7:00 pm Humanities 1, Rm 210

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    Venezuela contest, on the well-traveled Caracas avenue where transgender women (transformistas) project-fashioning and identity. Venezuela has won more international beauty contests than any other. e femininity performedTransformistas,Beauty Queens,and the Performance of Femininity inVenezuela A chapter from the book will be available to read

  12. Facility Disposition Safety Strategy RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy Chinaof EnergyImpactOnSTATEMENT OF DAVID GEISEREnergy1 of 3 PPG Score MaturityThe

  13. Microsoft Word - RM 5 final June 2014.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE LMI-EFRCAddendumNo. 1REPRHUBC, Revision3412

  14. Microsoft Word - SANDIA REPORT - final RM6.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE LMI-EFRCAddendumNo.1-1303342 Unlimited311

  15. High Performance Sustainable Building Design RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To:Department of Energy CompletingPresentedGenerationBuilding

  16. Checkout, Testing, and Commissioning Plan RM | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO OverviewAttachments4 Chairs Meeting - April 2014 ENVIRONMENTALChapter2ChartCheckout,

  17. Facility Software Quality Assurance for Capital Project Decisions RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of.pdf6-OPAMDepartment6 FY 2007FYFacility Software Quality

  18. Safeguards and Security and Cyber Security RM | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy atLLC - FE DKT. 10-160-LNG - ORDERSTATE0-1 CHAPTER1the1-2009 May

  19. National Environmental Policy Act RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732onMake Your NextHowNQA-1.pdf

  20. Construction Project Safety and Health Plan RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary09 FY1,The Construction Project

  1. Earned Value Management System RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732 DOE FOrders ConcerningCleanupI ~ r hMayEnergyII) -Earned

  2. Preparation for Facility Operations RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA AdministrativeofDepartment DOE-STD-3009-94 July 1994A coolingThe

  3. Project Execution Plan Review Module (RM) | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010 | Department ofPlant |InterconnectionRecoveryThe

  4. Quality Assurance for Critical Decision Reviews RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010In addition to analysis3EnergyThe purpose of

  5. Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection RadiationRecord-SettingHead ofReference-Documents Sign InReference

  6. Microsoft Word - RM Handbook September 2006 final 1

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005 atthe DistrictIndependentDepartment4.doc Improving Project Management

  7. United States Department of the Interior - RM-53 - Reference Manual -

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown of Ladoga, IndianaTurtleCooperative Place: Beaver Redirect page JumpSpecial

  8. MOD By Date/Time Thursday Lisa 7/23/2014 Lec Rm A Lec Rm B

    E-Print Network [OSTI]

    Maczka William Serrano Michelle Helsel 10:00 Matthew Wade Sonia Dermer Jonathon Michelson Thomas Oeste 10 Moderator Tabbetha Dobbins Chris Kassner Brandi Toliver Isabel Beichl, ITL Cameron Miller C. White Moderator

  9. Measurement of the cross-section of high transverse momentum vector bosons reconstructed as single jets and studies of jet substructure in $pp$ collisions at ${\\sqrt{s}}$ = 7 TeV with the ATLAS detector

    E-Print Network [OSTI]

    ATLAS Collaboration

    2014-07-03T23:59:59.000Z

    This paper presents a measurement of the cross-section for high transverse momentum $W$ and $Z$ bosons produced in $pp$ collisions and decaying to all-hadronic final states. The data used in the analysis were recorded by the ATLAS detector at the CERN Large Hadron Collider at a centre-of-mass energy of $\\sqrt{s}=7~\\rm TeV$ and correspond to an integrated luminosity of $4.6~\\rm fb^{-1}$. The measurement is performed by reconstructing the boosted $W$ or $Z$ bosons in single jets. The reconstructed jet mass is used to identify the $W$ and $Z$ bosons, and a jet substructure method based on energy cluster information in the jet centre-of-mass frame is used to suppress the large multi-jet background. The cross-section for events with a hadronically decaying $W$ or $Z$ boson, with transverse momentum $p_{\\rm T}>320\\,{\\rm GeV}$ and pseudorapidity $|\\eta|leading-order calculations. The selected events are further used to study jet grooming techniques.

  10. TeV-PeV Neutrino Oscillation of Low-luminosity Gamma-ray Bursts

    E-Print Network [OSTI]

    Xiao, D

    2015-01-01T23:59:59.000Z

    There is a sign that long-duration gamma-ray bursts (GRBs) originate from the core collapse of massive stars. During a jet puncturing through the progenitor envelope, high energy neutrinos can be produced by the reverse shock formed at the jet head. It is suggested that low-luminosity GRBs (LL-GRBs) are possible candidates of this high energy neutrino precursor up to $\\sim {\\rm PeV}$. Before leaving the progenitor, these high energy neutrinos must oscillate from one flavor to another with matter effect in the envelope. Under the assumption of a power-law stellar envelope density profile $\\rho \\propto r^{-\\alpha}$ with an index $\\alpha$, we study the properties of ${\\rm TeV-PeV}$ neutrino oscillation. We find that adiabatic conversion is violated for these neutrinos so we do certain calibration of level crossing effect. The resonance condition is reached for different energies at different radii. We notice that the effective mixing angles in matter for ${\\rm PeV}$ neutrinos are close to zero so the transition ...

  11. Study of Jet Shapes in Inclusive Jet Production in ppbar Collisions at sqrt{s} = 1.96 TeV

    E-Print Network [OSTI]

    CDF Collaboration; D. Acosta

    2005-08-25T23:59:59.000Z

    We report on a study of jet shapes in inclusive jet production in $p \\bar{p}$ collisions at $\\sqrt{s} = 1.96 {\\rm TeV}$ using the upgraded Collider Detector at Fermilab in Run II (CDF II) based on an integrated luminosity of $170 \\rm pb^{-1}$. Measurements are carried out on jets with rapidity $0.1 jet}| jet} jets have been corrected to the hadron level. The measured jet shapes are compared to leading-order QCD parton-shower Monte Carlo predictions as implemented in the PYTHIA and HERWIG programs. PYTHIA, tuned to describe the underlying event as measured in CDF Run I, provides a better description of the measured jet shapes than does PYTHIA or HERWIG with their default parameters.

  12. Measurements of the Total and Differential Higgs Boson Production Cross Sections Combining the $H \\rightarrow \\gamma \\gamma$ and $H \\rightarrow ZZ ^{*}\\rightarrow 4\\ell$ Decay Channels at $\\sqrt{s}=8$ TeV with the ATLAS Detector

    E-Print Network [OSTI]

    Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; ?lvarez Piqueras, Damián; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James Baker; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Maurice; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis

    2015-01-01T23:59:59.000Z

    Measurements of the total and differential cross sections of Higgs boson production are performed using 20.3~fb$^{-1}$ of $pp$ collisions produced by the Large Hadron Collider at a center-of-mass energy of $\\sqrt{s} = 8$ TeV and recorded by the ATLAS detector. Cross sections are obtained from measured $H \\rightarrow \\gamma \\gamma$ and $H \\rightarrow ZZ ^{*}\\rightarrow 4\\ell$ event yields, which are combined accounting for detector efficiencies, fiducial acceptances and branching fractions. Differential cross sections are reported as a function of Higgs boson transverse momentum, Higgs boson rapidity, number of jets in the event, and transverse momentum of the leading jet. The total production cross section is determined to be $\\sigma_{pp \\to H} = 33.0 \\pm 5.3 \\, ({\\rm stat}) \\pm 1.6 \\, ({\\rm sys}) \\mathrm{pb}$. The measurements are compared to state-of-the-art predictions.

  13. EXPERIMENTING WITH FLUIDS OC-569a Winter 2010 GFD lab: Ocean Sciences Bldg. Rm 107; teaching lab: Ocean Teaching Building Rm 206

    E-Print Network [OSTI]

    , interactions of fluids with solid boundaries, with gases, or with membranes (opening on a vast topic might want to experiment with turbulence, or with fluid energy devices, like hydrogen fuel cells or basic Stirling engines. There are so few fluid dynamics labs in the world that meaningful and unique

  14. GeV-TeV gamma-ray light curves expected in the IC electron-positron pair cascade model for massive binaries: Application to LS 5039

    E-Print Network [OSTI]

    W. Bednarek

    2006-11-09T23:59:59.000Z

    TeV gamma-ray emission from two massive binaries of the microquasar type, LS 5039 and LS I +61$^{\\rm o}$ 303, show clear variability with their orbital periods. Our purpose is to calculate the GeV and TeV $\\gamma$-ray light curves from the massive binary LS 5039 which are expected in the specific Inverse Compton $e^\\pm$ pair cascade model. This model successfully predicted the basic features of the high energy $\\gamma$-ray emission from LS 5039 and LS I +61 303. In the calculations we apply the Monte Carlo code which follows the IC $e^\\pm$ pair cascade in the anisotropic radiation of the massive star. The $\\gamma$-ray light curves and spectra are obtained for different parameters of the acceleration scenario and the inclination angles of the binary system. It is found that the GeV and TeV $\\gamma$-ray light curves should be anti-correlated. This feature can be tested in the near future by the simultaneous observations of LS 5039 with the AGILE and GLAST telescopes in GeV energies and the Cherenkov telescopes in the TeV energies. Considered model also predicts a broad maximum in the TeV $\\gamma$-ray light curve between the phases $\\sim 0.4-0.8$ consistently with the observations of LS 5039 by the HESS telescopes. Moreover, we predict additional dip in the TeV light curve for large inclination angles $\\sim 60^{\\rm o}$. This feature could serve as a diagnostic for independent measuring of the inclination angle of this binary system indicating also on the presence of a neutron star in LS 5039.

  15. Collisionless Shocks and TeV Neutrinos before Supernova Shock Breakout from an Optically Thick Wind

    E-Print Network [OSTI]

    Giacinti, G

    2015-01-01T23:59:59.000Z

    During a supernova explosion, a radiation-dominated shock (RDS) travels through its progenitor. A collisionless shock (CS) is usually assumed to replace it during shock breakout (SB). We demonstrate here that for some realistic progenitors enshrouded in optically thick winds, such as possibly SN 2008D, a CS forms deep inside the wind, soon after the RDS leaves the core, and therefore significantly before SB. The RDS does not survive the transition from the core to the thick wind when the wind close to the core is not sufficiently dense to compensate for the $r^{-2}$ dilution of photons due to shock curvature. This typically happens when the shock velocity is $\\lesssim 0.1 {\\rm c} \\, (\\frac{u_{\\rm w}}{10\\,{\\rm km/s}}) (\\frac{\\dot{M}}{5 \\cdot 10^{-4} \\, {\\rm M}_\\odot {\\rm /yr}})^{-1} (\\frac{r_\\ast}{10^{13}\\,{\\rm cm}})$, where $u_{\\rm w}$, $\\dot{M}$ and $r_\\ast$ are respectively the wind velocity, mass-loss rate and radius of the progenitor star. The radiative CS results in a hard spectrum of the photon flash at...

  16. Western University Spencer Engineering Building, Rm. 3002 London, ON, Canada N6A 5B9

    E-Print Network [OSTI]

    Sinnamon, Gordon J.

    on synthesis and characterization of nanomaterials for fuel cell and Li battery applications. The successful

  17. BLDG. 80 (SU), RM. 106 561.297.1208 WWW.FAU.EDU/GOABROAD FFuukkuuookkaa,, JJaappaann

    E-Print Network [OSTI]

    Fernandez, Eduardo

    and is located on the northern shore of the island of Kyushu. It is a young, user-friendly city made up of seven of program, group transportation for excursions, homestay visit, admission fees and proposed group activities, Akihabara, Tokyo Oedo Museum), three group meals, language books, some group supplies, pre

  18. BREA Minutes Meeting Date and Place: Tuesday, July 10, 2012; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    had received from a representative of the Savannah River Site Retiree Association (SRSRA) Board of Directors. Apparently the Savannah River Site Contractor is in the process of significantly changing retirees' medical benefits and the SRSRA would like to know what is happening at other National Labs

  19. Interdisciplinary Requirements Analysis Using the Model-based RM Tool AUTORAID

    E-Print Network [OSTI]

    or airbag-control systems from the automotive do- main or, in addition, production systems in the automation

  20. BREA Minutes Meeting Date and Place: Tuesday, Dec 11, 2012; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    at two other National Labs ­ Savannah River and Lawrence Livermore were mentioned. Dave Cox said that Savannah River retirees have contacted one of their US Senators, and he has been responsive. Steve). Their retirees' organization has declared its independence from the laboratory, citing concerns over

  1. Institute for Systems Research A.V. Williams Bldg. Rm. 3111

    E-Print Network [OSTI]

    Justh, Eric

    the Intelligent Servosystems Lab (ISL) within the Institute for Systems Research and the Electronic Warfare for a class of signals of importance in electronic surveillance. The resulting system would be sufficiently

  2. DRAFT Walla Walla Subbasin Aquatic RM&E Plan 1 Developed by: WDFW

    E-Print Network [OSTI]

    . This plan will therefore, serve as an interim set of guidelines that will assure a systematic approach should provide data of known quality (accuracy and precision) - Validate EDT model as a reliable measure

  3. Walla Walla Subbasin DRAFT Aquatic RM&E Plan Prepared by: CTUIR

    E-Print Network [OSTI]

    as an interim set of guidelines that will assure a systematic approach to directing and funding RME. Further as a reliable measure of habitat and population response to recovery actions taken in the Walla Walla subbasin

  4. Microsoft Word - EE Tech RM Mar 2013 Appx B - pt 1b - front matter...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    sheets of thin nanonmaterial for practical applications such as flexible organic solar cells. Associated R&D strategy References Brookhaven National Laboratory (2010, Nov. 3)....

  5. Communicating Complex Systems Peter H. Welch, Frederick R.M. Barnes

    E-Print Network [OSTI]

    Kent, University of

    or their simulated equivalent, boids. Our example case study operates at a finer level of granularity: a nanite

  6. ULTRA HIGH ENERGY COSMIC RAY SPECTRUM Baltrusaitis, R.M., Cady7

    E-Print Network [OSTI]

    ' energy by the relation Figure 1. Raw Energy Distribution of Fly's Eye Data. Eem = å0/X0 f Ne(x)dx where å

  7. BREA Minutes Meeting Date and Place: Tuesday, Dec. 13, 2011; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    Engineering employees who took early retirement when it was offered in 1995. They remember meetings with department supervisors who assured people that if they accepted early retirement, they would not have to pay

  8. A Sub-$\\rm ?^{3}$-Volume Cantilever-based Fabry-Pérot Cavity

    E-Print Network [OSTI]

    Hrishikesh Kelkar; Daqing Wang; Diego Martín-Cano; Björn Hoffmann; Silke Christiansen; Stephan Götzinger; Vahid Sandoghdar

    2015-02-09T23:59:59.000Z

    We report on the realization of an open plane-concave Fabry-P\\'erot resonator with a mode volume of $\\lambda^3/2$ at optical frequencies. We discuss some of the unconventional features of this new microcavity regime and show that the ultrasmall mode volume allows us to detect cavity resonance shifts induced by single nanoparticles even at quality factors as low as $120$. Being based on low-reflectivity micromirrors fabricated on a silicon cantilever, our experimental arrangement provides broadband operation, tunability of the cavity resonance, lateral scanning and promise for optomechanical studies.

  9. Building Rm Last Name First Name Department Extension Armington (PEC) 135 Love Tom Athletic Trainer 2184

    E-Print Network [OSTI]

    Wilson, Mark A.

    Stephanie AdministrativeCoordinator 2575 214 Maclean Robert English 1907 215 Salerno Ali English 1929 216 Karen Biology Technician 2556 201 Boes Katie Biology 1950 205 Steven Craig Biology 1982 206 Lehtinen

  10. Microsoft Word - RM1_Tidal Turbine_NREL Lawson, Li Y, Sale_2011...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Proceedings of the 30th International Conference on Ocean, Offshore, and Arctic Engineering OMAE2011 June 19-24, 2011, Rotterdam, The Netherlands OMAE2011-49863 DEVELOPMENT AND...

  11. BREA Minutes Meeting Date and Place: Tuesday, Oct. 11, 2011; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    . The first order of business was a Powerpoint presentation on "Preserving Nikola Tesla's Historic the property that once comprised Nikola Tesla's Long Island laboratory in Shoreham (at that time, Shoreham Wardenclyffe Laboratory" by Christopher Wesselborg, Tesla Science Center at Wardenclyffe. The Tesla Science

  12. Nuclear Forensic Reference Materials (RM) for Attribution of Urban Nuclear Terrorism

    E-Print Network [OSTI]

    Perkins, Richard A.

    Transport Target Event Nonproliferation- Counterproliferation · Respond to illicit trafficking · Detection of illicit programs · Cooperative Threat Reduction Nuclear Materials · Fuel cycles · Limit fissile material · Identify transit routes · Monitor choke points · Monitor smuggling gaps · Nuclear detection programs

  13. Technical Basis Agreement Document for UGTA CAU 99 RM/SM

    National Nuclear Security Administration (NNSA)

    D.L. Finnegan, J.L. Thompson, C.M. Miller, P.L. Baca, L.F. Olivas, C.G. Geoffrion, D.K. Smith, W. Goishi, B.K. Esser, J.W. Meadows, N. Namboodiri, J.F. Wild. 2001. Nevada Test Site...

  14. BREA Minutes Meeting Date and Place: Tuesday, June 14, 2011; Bldg. 400, Rm RSB 2

    E-Print Network [OSTI]

    for the fall, to include a visit to the Solar Farm and an NSLS II update. A "lesson learned" from the May

  15. Microsoft Word - EE Tech RM Mar 2013 Appx B - pt 1b - front matter...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    power supply (UPS) interface hardware and control protocols to accept power from photovoltaic (PV) and other DC distributed generation sources. Capability Gap(s) Need for...

  16. U.S. Department of Energy Reference Model Program RM1: Experimental Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2,EHSS A-Zandofpoint motional%^6 Annual

  17. U.S. Department of Energy Reference Model Program RM2: Experimental Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2,EHSS A-Zandofpoint motional%^6 AnnualReference Model

  18. Sensorless Speed Control of Permanent Magnet-Assisted Synchronous Reluctance Motor (PMa-SynRM)

    E-Print Network [OSTI]

    Chakali, Anil K.

    2011-02-22T23:59:59.000Z

    synchronous AC machines in variable speed applications where previously asynchronous machines have been used [1-6]. Among the AC drives, the permanent magnet synchronous machine (PMSM) drives have been increasingly applied in a wide variety of industrial... applications. The reason comes from the advantages of PMSM which are high power density and efficiency, high torque to inertia ratio and high reliability. However, recently the high cost of magnet materials (e.g., samarium cobalt and neodymium-boron iron...

  19. Technical Basis Agreement Document for UGTA CAU 99 RM/SM

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. Hirsch SNLMay 20102 | NationalThis1QA:2 42 45

  20. http://www.nrc.gov/reading-rm/doc-collections/cfr/part020/full-

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. HirschOccurrence Reporting and2. TheAirA

  1. http://www.nrc.gov/reading-rm/doc-collections/cfr/part061/full-

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilAElectronic Input Options Gary L. HirschOccurrence Reporting and2.

  2. 10 CFR 850, Request for Information - Docket Number: HS-RM-10-CBDPP - Marc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: The Future of BadTHE U.S. DEPARTMENT OF ENERGY' SChapter

  3. U.S. Department of Energy Reference Model Program RM1: Experimental Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening aTurbulence may be key topatentMay 2015September 29, 2014 Prepared

  4. Microsoft Word - DOE_RM_DM-#100066-v1-Sitewide_Quarterly_Oct-Dec_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim

  5. Microsoft Word - DOE_RM_DM-#100069-v1-NAPL_Quarterly_Oct-Dec_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1 U.S.

  6. Microsoft Word - DOE_RM_DM-#101996-v1-Sitewide_jan_-_march_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1

  7. Microsoft Word - DOE_RM_DM-#341474-v1-NAPL_Quarterly_April_-_June_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166 2005

  8. Microsoft Word - DOE_RM_DM-#343505-v1-Sitewide_July_September_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166

  9. Microsoft Word - DOE_RM_DM-#345139-v1-NAPL_Quarterly_Oct-Dec_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1661 20055

  10. Microsoft Word - DOE_RM_DM-#345149-v1-Sitewide_Oct_Dec_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact

  11. Microsoft Word - DOE_RM_DM-#348497-v1-Sitewide_Semiannual_Report_January-Maƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuary through May

  12. Microsoft Word - DOE_RM_DM-#350832-v1-NAPL_Quarterly_April-June_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuary

  13. Microsoft Word - DOE_RM_DM-#359194-v1-Sitewide_report_June-Nov_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuarythrough

  14. Microsoft Word - DOE_RM_DM-#98960-v1-Sitewide_July_-_September_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official

  15. Microsoft Word - RM 1-3 Environmental Assessment_PNNL-Abstract.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The

  16. Microsoft Word - RM 1-3 Final Report Nov 2011 final.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The Prepared

  17. Microsoft Word - RM1_Tidal Turbine_ARL_PTO_OMAE_Paper-Abstract.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The Preparedxx

  18. Microsoft Word - RM1_Tidal Turbine_NREL Bir, Lawson, Li_2011 1.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form The

  19. Microsoft Word - RM1_Tidal Turbine_NREL Lawson, Li Y, Sale_2011-Abstract.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form TheProceedings

  20. Microsoft Word - RM1_Tidal Turbine_UW Tidal Resource-Abstract.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project0CentralProposal Form

  1. Two-particle Bose-Einstein correlations in $pp$ collisions at $\\mathbf {\\sqrt{s} =}$ 0.9 and 7 TeV measured with the ATLAS detector

    E-Print Network [OSTI]

    ATLAS Collaboration

    2015-02-27T23:59:59.000Z

    The paper presents studies of Bose-Einstein Correlations (BEC) for pairs of like-sign charged particles measured in the kinematic range $p_{\\rm T}>$ 100 MeV and $|\\eta|<$ 2.5 in proton--proton collisions at centre-of-mass energies of 0.9 and 7 TeV with the ATLAS detector at the CERN Large Hadron Collider. The integrated luminosities are approximately 7 $\\mu$b$^{-1}$, 190 $\\mu$b$^{-1}$ and 12.4 nb$^{-1}$ for 0.9 TeV, 7 TeV minimum-bias and 7 TeV high-multiplicity data samples, respectively. The multiplicity dependence of the BEC parameters characterizing the correlation strength and the correlation source size are investigated for charged-particle multiplicities of up to 240. A saturation effect in the multiplicity dependence of the correlation source size is observed using the high-multiplicity 7 TeV data sample. The dependence of the BEC parameters on the average transverse momentum of the particle pair is also investigated.

  2. Measurement of the production cross section for $Z/?^*$ in association with jets in pp collisions at $\\sqrt{s}$ = 7 TeV with the ATLAS Detector

    E-Print Network [OSTI]

    Evelin Meoni; for the ATLAS Collaboration

    2012-01-23T23:59:59.000Z

    We present results on the production of jets of particles in association with a $Z/\\gamma^*$ boson, in proton-proton collisions at $\\sqrt{s} = 7$ TeV with the ATLAS detector at the LHC. The analysis includes the full 2010 data set, collected with a low rate of multiple proton-proton collisions in the accelerator, corresponding to an integrated luminosity of $36 \\rm pb^{-1}$. Inclusive jet cross sections in $Z/\\gamma^*$ events, with $Z/\\gamma^*$ decaying into electron or muon pairs, are measured for jets with transverse momentum $p_T >$ 30 GeV and jet rapidity $|y| < 4.4$. The measurements are compared to next-to-leading-order perturbative QCD calculations, and to predictions from different Monte Carlo generators implementing leading-order matrix elements supplemented by parton showers.

  3. Measurement of jet quenching with semi-inclusive hadron-jet distributions in central Pb-Pb collisions at ${\\sqrt{\\bf{s}_{\\mathrm {\\bf{NN}}}}}$ = 2.76 TeV

    E-Print Network [OSTI]

    ALICE Collaboration

    2015-06-12T23:59:59.000Z

    We report the measurement of a new observable of jet quenching in central Pb-Pb collisions at $\\sqrt{s_{\\rm NN}} = 2.76$ TeV, based on the semi-inclusive rate of charged jets recoiling from a high transverse momentum (high-$p_{\\rm T}$) charged hadron trigger. Jets are measured using collinear-safe jet reconstruction with infrared cutoff for jet constituents of 0.15 GeV/$c$, for jet resolution parameters $R = 0.2$, 0.4 and 0.5. Underlying event background is corrected at the event-ensemble level, without imposing bias on the jet population. Recoil jet spectra are reported in the range $20jet}^\\mathrm{ch}jet yield in central Pb-Pb collisions is found to be suppressed relative to that in pp collisions. No significant medium-induced broadening of the intra-jet energy profile is observed within 0.5 radians relative to the recoil jet axis. The angular distribution of the recoil jet yield relative to the trigger axis is found to be similar in central Pb-Pb and pp collisions, with no significant medium-induced acoplanarity observed. Large-angle jet deflection, which may provide a direct probe of the nature of the quasi-particles in hot QCD matter, is explored.

  4. Th e Im p a c t o f P r e d ic tiv e In a c c u r a c ie s o n E x e c u tio n S c h e d u lin g S te p h e n A . Ja rv is, L ig a n g H e , D a n ie l P . S p o o n e r a n d G ra h a m R . N u d d

    E-Print Network [OSTI]

    Jarvis, Stephen

    Th e Im p a c t o f P r e d ic tiv e In a c c u r a c ie s o n E x e c u tio n S c h e d u lin g S te p h e n A . Ja rv is, L ig a n g H e , D a n ie l P . S p o o n e r a n d G ra h a m R . N u d d Hig h P e rfo rm a n c e S y ste m s G ro u p , D e p a rtm e n t o f C o m p u te r S c ie n c e , U

  5. Midrapidity antiproton-to-proton ratio in pp collisions at $\\sqrt{s} = 0.9$ and $7$~TeV measured by the ALICE experiment

    E-Print Network [OSTI]

    Authors; :; ALICE Collaboration; :; K. Aamodt; N. Abel; U. Abeysekara; A. Abrahantes Quintana; A. Abramyan; D. Adamova; M. M. Aggarwal; G. Aglieri Rinella; A. G. Agocs; S. Aguilar Salazar; Z. Ahammed; A. Ahmad; N. Ahmad; S. U. Ahn; R. Akimoto; A. Akindinov; D. Aleksandrov; B. Alessandro; R. Alfaro Molina; A. Alici; E. Almaraz Avina; J. Alme; T. Alt; V. Altini; S. Altinpinar; C. Andrei; A. Andronic; G. Anelli; V. Angelov; C. Anson; T. Anticic; F. Antinori; S. Antinori; K. Antipin; D. Antonczyk; P. Antonioli; A. Anzo; L. Aphecetche; H. Appelshauser; S. Arcelli; R. Arceo; A. Arend; N. Armesto; R. Arnaldi; T. Aronsson; I. C. Arsene; A. Asryan; A. Augustinus; R. Averbeck; T. C. Awes; J. Aysto; M. D. Azmi; S. Bablok; M. Bach; A. Badala; Y. W. Baek; S. Bagnasco; R. Bailhache; R. Bala; A. Baldisseri; A. Baldit; J. Ban; R. Barbera; G. G. Barnafoldi; L. Barnby; V. Barret; J. Bartke; F. Barile; M. Basile; V. Basmanov; N. Bastid; B. Bathen; G. Batigne; B. Batyunya; C. Baumann; I. G. Bearden; B. Becker; I. Belikov; R. Bellwied; E. Belmont-Moreno; A. Belogianni; L. Benhabib; S. Beole; I. Berceanu; A. Bercuci; E. Berdermann; Y. Berdnikov; L. Betev; A. Bhasin; A. K. Bhati; L. Bianchi; N. Bianchi; C. Bianchin; J. Bielcik; J. Bielcikova; A. Bilandzic; L. Bimbot; E. Biolcati; A. Blanc; F. Blanco; F. Blanco; D. Blau; C. Blume; M. Boccioli; N. Bock; A. Bogdanov; H. Boggild; M. Bogolyubsky; J. Bohm; L. Boldizsar; M. Bombara; C. Bombonati; M. Bondila; H. Borel; A. Borisov; C. Bortolin; S. Bose; L. Bosisio; F. Bossu; M. Botje; S. Bottger; G. Bourdaud; B. Boyer; M. Braun; P. Braun-Munzinger; L. Bravina; M. Bregant; T. Breitner; G. Bruckner; R. Brun; E. Bruna; G. E. Bruno; D. Budnikov; H. Buesching; P. Buncic; O. Busch; Z. Buthelezi; D. Caffarri; X. Cai; H. Caines; E. Camacho; P. Camerini; M. Campbell; V. Canoa Roman; G. P. Capitani; G. Cara Romeo; F. Carena; W. Carena; F. Carminati; A. Casanova Diaz; M. Caselle; J. Castillo Castellanos; J. F. Castillo Hernandez; V. Catanescu; E. Cattaruzza; C. Cavicchioli; P. Cerello; V. Chambert; B. Chang; S. Chapeland; A. Charpy; J. L. Charvet; S. Chattopadhyay; S. Chattopadhyay; M. Cherney; C. Cheshkov; B. Cheynis; E. Chiavassa; V. Chibante Barroso; D. D. Chinellato; P. Chochula; K. Choi; M. Chojnacki; P. Christakoglou; C. H. Christensen; P. Christiansen; T. Chujo; F. Chuman; C. Cicalo; L. Cifarelli; F. Cindolo; J. Cleymans; O. Cobanoglu; J. -P. Coffin; S. Coli; A. Colla; G. Conesa Balbastre; Z. Conesa del Valle; E. S. Conner; P. Constantin; G. Contin; J. G. Contreras; Y. Corrales Morales; T. M. Cormier; P. Cortese; I. Cortes Maldonado; M. R. Cosentino; F. Costa; M. E. Cotallo; E. Crescio; P. Crochet; E. Cuautle; L. Cunqueiro; J. Cussonneau; A. Dainese; H. H. Dalsgaard; A. Danu; I. Das; A. Dash; S. Dash; G. O. V. de Barros; A. De Caro; G. de Cataldo; J. de Cuveland; A. De Falco; M. De Gaspari; J. de Groot; D. De Gruttola; N. De Marco; S. De Pasquale; R. De Remigis; R. de Rooij; G. de Vaux; H. Delagrange; G. Dellacasa; A. Deloff; V. Demanov; E. Denes; A. Deppman; G. D'Erasmo; D. Derkach; A. Devaux; D. Di Bari; C. Di Giglio; S. Di Liberto; A. Di Mauro; P. Di Nezza; M. Dialinas; L. Diaz; R. Diaz; T. Dietel; R. Divia; O. Djuvsland; V. Dobretsov; A. Dobrin; T. Dobrowolski; B. Donigus; I. Dominguez; D. M. M. Don; O. Dordic; A. K. Dubey; J. Dubuisson; L. Ducroux; P. Dupieux; A. K. Dutta Majumdar; M. R. Dutta Majumdar; D. Elia; D. Emschermann; A. Enokizono; B. Espagnon; M. Estienne; S. Esumi; D. Evans; S. Evrard; G. Eyyubova; C. W. Fabjan; D. Fabris; J. Faivre; D. Falchieri; A. Fantoni; M. Fasel; O. Fateev; R. Fearick; A. Fedunov; D. Fehlker; V. Fekete; D. Felea; B. Fenton-Olsen; G. Feofilov; A. Fernandez Tellez; E. G. Ferreiro; A. Ferretti; R. Ferretti; M. A. S. Figueredo; S. Filchagin; R. Fini; F. M. Fionda; E. M. Fiore; M. Floris; Z. Fodor; S. Foertsch; P. Foka; S. Fokin; F. Formenti; E. Fragiacomo; M. Fragkiadakis; U. Frankenfeld; A. Frolov; U. Fuchs; F. Furano; C. Furget; M. Fusco Girard; J. J. Gaardhoje; S. Gadrat; M. Gagliardi; A. Gago; M. Gallio; P. Ganoti; M. S. Ganti; C. Garabatos; C. Garcia Trapaga; J. Gebelein; R. Gemme; M. Germain; A. Gheata; M. Gheata; B. Ghidini; P. Ghosh; G. Giraudo; P. Giubellino; E. Gladysz-Dziadus; R. Glasow; P. Glassel; A. Glenn; R. Gomez Jimenez; H. Gonzalez Santos; L. H. Gonzalez-Trueba; P. Gonzalez-Zamora; S. Gorbunov; Y. Gorbunov; S. Gotovac; H. Gottschlag; V. Grabski; R. Grajcarek; A. Grelli; A. Grigoras; C. Grigoras; V. Grigoriev; A. Grigoryan; S. Grigoryan; B. Grinyov; N. Grion; P. Gros; J. F. Grosse-Oetringhaus; J. -Y. Grossiord; R. Grosso; F. Guber; R. Guernane; B. Guerzoni; K. Gulbrandsen; H. Gulkanyan; T. Gunji; A. Gupta; R. Gupta; H. -A. Gustafsson; H. Gutbrod; O. Haaland; C. Hadjidakis; M. Haiduc; H. Hamagaki; G. Hamar; J. Hamblen; B. H. Han; J. W. Harris; M. Hartig; A. Harutyunyan; D. Hasch

    2010-06-28T23:59:59.000Z

    The ratio of the yields of antiprotons to protons in pp collisions has been measured by the ALICE experiment at $\\sqrt{s} = 0.9$ and $7$~TeV during the initial running periods of the Large Hadron Collider(LHC). The measurement covers the transverse momentum interval $0.45 < p_{\\rm{t}} < 1.05$~GeV/$c$ and rapidity $|y| < 0.5$. The ratio is measured to be $R_{|y| < 0.5} = 0.957 \\pm 0.006 (stat.) \\pm 0.014 (syst.)$ at $0.9$~TeV and $R_{|y| < 0.5} = 0.991 \\pm 0.005 (stat.) \\pm 0.014 (syst.)$ at $7$~TeV and it is independent of both rapidity and transverse momentum. The results are consistent with the conventional model of baryon-number transport and set stringent limits on any additional contributions to baryon-number transfer over very large rapidity intervals in pp collisions.

  6. The effects of the meat binding agent, Activa[TM] TG-RM, on fresh beef at the retail level

    E-Print Network [OSTI]

    Kolle, Dusty Shane

    2001-01-01T23:59:59.000Z

    Ribeye rolls and top blade roasts were fabricated from corresponding sides of twenty-four beef carcasses varying in USDA quality and yield grades. The kernel fat that lies between the Spinalis dorsi and the Longissimus thoracis was removed...

  7. RM12-2703 Advanced Rooftop Unit Control Retrofit Kit Field Demonstration: Hawaii and Guam Energy Improvement Technology Demonstration Project

    SciTech Connect (OSTI)

    Doebber, I.; Dean, J.; Dominick, J.; Holland, G.

    2014-03-01T23:59:59.000Z

    As part of its overall strategy to meet its energy goals, the Naval Facilities Engineering Command (NAVFAC) partnered with U.S. Department of Energy's (DOE) National Renewable Energy Laboratory (NREL) to rapidly demonstrate and deploy cost-effective renewable energy and energy efficiency technologies. This was one of several demonstrations of new and underutilized commercial energy efficiency technologies. The consistent year-round demand for air conditioning and dehumidification in Hawaii provides an advantageous demonstration location for advanced rooftop control (ARC) retrofit kits to packaged rooftop units (RTUs). This report summarizes the field demonstration of ARCs installed on nine RTUs serving a 70,000-ft2 exchange store (large retail) and two RTUs, each serving small office buildings located on Joint Base Pearl Harbor-Hickam (JBPHH).

  8. River Influences on Shelf Ecosystems: Introduction and Synthesis1 , B.M. and R.M. Kudela2

    E-Print Network [OSTI]

    Hickey, Barbara

    .M. Kudela2 , J.D. Nash3 , K.W. Bruland2 , W.T. Peterson4 , P.4 MacCready1 , E.J. Lessard1 , D.A. Jay5 , N

  9. Microsoft Word - EE Tech RM Mar 2013 Appx B - pt 1b - front matter - ELECTRONIC.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE SWPAURTeC:8CO 2Dances done at English NATIONAL

  10. OC)elRM(o-T/^ DOE/PC/60810-TIO TITLE: Superacid Catalyzed Coal Conversion Chemistry DE86 015045

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for Renewable Energy:Nanowire3627 Federal RegisterImplementation3DPhotostatLBL - 5

  11. Microsoft Word - DOE_RM_DM-#101993-v1-4_5_Acre_Quarterly_Jan-March_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1 U.S.5

  12. Microsoft Word - DOE_RM_DM-#102768-v1-NAPL_Quarterly_Report_Jan-March_2005.ƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim16 U.S.

  13. Microsoft Word - DOE_RM_DM-#103356-v1-4_5_Acre_Quarterly_Apr-June_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim16

  14. Microsoft Word - DOE_RM_DM-#103356-v1-4_5_Acre_Quarterly_Apr-June_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166 2005 -

  15. Microsoft Word - DOE_RM_DM-#343504-v1-4_5_Quarterly_July_Sept_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim166 20050

  16. Microsoft Word - DOE_RM_DM-#344133-v1-Final_NAPL_Quarterly_July-Sept_2005.Dƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1661 2005

  17. Microsoft Word - DOE_RM_DM-#345141-v1-4_5_Quarterly_Oct_Dec_2005.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official Contact ListInterim1661

  18. Microsoft Word - DOE_RM_DM-#348500-v1-4_5_Acre_Semiannual_Jan-May_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuary through

  19. Microsoft Word - DOE_RM_DM-#359195-v1-4_5_Acre_final_Jun-Nov_2006.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF Official ContactJanuarythroughthrough

  20. Microsoft Word - DOE_RM_DM-#98971-v1-4_5_Acre_July_-_September_2004.DOC

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF OfficialJuly Through September 2004

  1. Microsoft Word - DOE_RM_DM-#99768-v1-NAPL_Quarterly_Report_for_July-Sept_20ƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF OfficialJuly Through September

  2. Microsoft Word - DOE_RM_DM-#99942-v1-4_5_Acre_Quarterly_October_-_December_ƒ

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradleyTableSelling CorpNewCF OfficialJuly Through September0 U.S.

  3. Measurement of the Proton-Air Cross Section with Telescope Array's Middle Drum Detector and Surface Array in Hybrid Mode

    E-Print Network [OSTI]

    R. U. Abbasi; M. Abe; T. Abu-Zayyad; M. Allen; R. Anderson; R. Azuma; E. Barcikowski; J. W. Belz; D. R. Bergman; S. A. Blake; R. Cady; M. J. Chae; B. G. Cheon; J. Chiba; M. Chikawa; W. R. Cho; T. Fujii; M. Fukushima; T. Goto; W. Hanlon; Y. Hayashi; N. Hayashida; K. Hibino; K. Honda1; D. Ikeda; N. Inoue; T. Ishii; R. Ishimori; H. Ito; D. Ivanov; C. C. H. Jui; K. Kadota; F. Kakimoto; O. Kalashev; K. Kasahara; H. Kawai; S. Kawakami; S. Kawana; K. Kawata; E. Kido; H. B. Kim; J. H. Kim; J. H. Kim; S. Kitamura; Y. Kitamura; V. Kuzmin; Y. J. Kwon; J. Lan1; S. I. Lim; J. P. Lundquist; K. Machida; K. Martens; T. Matsuda; T. Matsuyama; J. N. Matthews; M. Minamino; K. Mukai; I. Myers; K. Nagasawa; S. Nagataki1; T. Nakamura; T. Nonaka; A. Nozato; S. Ogio; J. Ogura; M. Ohnishi; H. Ohoka; K. Oki; T. Okuda; M. Ono; A. Oshima; S. Ozawa; I. H. Park; M. S. Pshirkov; D. C. Rodriguez; G. Rubtsov; D. Ryu; H. Sagawa; N. Sakurai; A. L. Sampson; L. M. Scott; P. D. Shah; F. Shibata; T. Shibata; H. Shimodaira; B. K. Shin; J. D. Smith; P. Sokolsky; R. W. Springer; B. T. Stokes; S. R. Stratton; T. A. Stroman; T. Suzawa; M. Takamura; M. Takeda; R. Takeishi; A. Taketa; M. Takita; Y. Tameda; H. Tanaka; K. Tanaka; M. Tanaka; S. B. Thomas; G. B. Thomson; P. Tinyakov; I. Tkachev; H. Tokuno; T. Tomida; S. Troitsky; Y. Tsunesada; K. Tsutsumi; Y. Uchihori; S. Udo; F. Urban; G. Vasiloff; T. Wong; R. Yamane; H. Yamaoka; K. Yamazaki; J. Yang; K. Yashiro; Y. Yoneda; S. Yoshida; H. Yoshii; R. Zollinger; Z. Zundel

    2015-05-07T23:59:59.000Z

    In this work we are reporting on the measurement of the proton-air inelastic cross section $\\sigma^{\\rm inel}_{\\rm p-air}$ using the Telescope Array (TA) detector. Based on the measurement of the $\\sigma^{\\rm inel}_{\\rm p-air}$ the proton-proton cross section $\\sigma_{\\rm p-p}$ value is also determined at $\\sqrt{s} = 95$ TeV. Detecting cosmic ray events at ultra high energies with Telescope Array enables us to study this fundamental parameter that we are otherwise unable to access with particle accelerators. The data used in this report is collected over five years using hybrid events observed by the Middle Drum fluorescence detector together with the surface array detector. The value of the $\\sigma^{\\rm inel}_{\\rm p-air}$ is found to be equal to $ 567.0 \\pm 70.5 [{\\rm Stat.}] ^{+25}_{-29} [{\\rm Sys.}]$ mb. The total proton-proton cross section is subsequently inferred from Glauber Formalism and Block, Halzen and Stanev QCD inspired fit and is found to be equal to $170_{-44}^{+48} [{\\rm Stat.}] \\pm _{-19}^{+17} [{\\rm Sys.}] $mb.

  4. Student Career Centre Agora : Rm 7-153 Tel: 250-960-6598 hirestudents@unbc.ca www.unbc.ca/careercentre Revised: Oct 2007

    E-Print Network [OSTI]

    Northern British Columbia, University of

    and consultant for matters dealing with the management and preservation of cultural differences. SKILLS YOU.unbc.ca/careercentre Revised: Oct 2007 COMMUNICATION SKILLS INFORMATION MANAGEMENT The ability to communicate ideas clearly, and Special skills in communicating, generating, and defending apply knowledge. approaches to the subject

  5. Grant Title: NIH DIRECTOR'S EARLY INDEPENDENCE AWARDS (DP5) Funding Opportunity Number: RFA-RM-12-018. CFDA Number(s): 93.310.

    E-Print Network [OSTI]

    Farritor, Shane

    -018. CFDA Number(s): 93.310. Agency/Department: Department of Health and Human Services, Office of Strategic

  6. Session 6: Integrated Product Development and Project Management Hotel Monaco (Vienna rm) 501 Geary St San Francisco, CA April 14-17, 2014

    E-Print Network [OSTI]

    Soloveichik, David

    Sciences, Endo 8:35 am 60 Decision Analysis Tools and Techniques Patricia Evans, PhD, Independent Consultant 9:35 am 50 Product Development Decision Making John Celona, JD, Independent Consultant 10:25 am 15 Risk and Return in Portfolio Management Patricia Evans, PhD, Independent Consultant 2:35 pm 60 Role

  7. Student Career Centre Agora : Rm 7-153 Tel: 250-960-6598 hirestudents@unbc.ca www.unbc.ca/careercentre Revised: Oct 2007

    E-Print Network [OSTI]

    Northern British Columbia, University of

    companies achieve production goals. Determines methods of cutting and removing timber with minimum waste forestation and reforestation projects. Maps forest areas, estimates standing timber and future growth, and manages timber sales. Plans cutting programs to assure continuous production of timber or to assist timber

  8. Draft Title 40 CFR 191 compliance certification application for the Waste Isolation Pilot Plant. Volume 9: Appendices RM, SCR, SER, SUM, WRAC

    SciTech Connect (OSTI)

    NONE

    1995-03-31T23:59:59.000Z

    The Rock Mechanics Program is important to the establishment of a radioactive waste repository in salt because rock mechanics deals with the prediction of creep closure and eventual encapsulation of the waste. The intent of this paper is to give the current status of the program. This program consists of three major modeling efforts: continuum creep, fracture, and the disturbed rock zone. These models, together with laboratory material parameters, plastic flow potentials, initial and boundary input data, and other peripheral information forms the predictive technology. The extent to which the predictive technology is validated against in situ test data adds certainty to the method. Application of the technology is through simulations of the test results, design, or performance using numerical codes. In summary, the predictive capabilities are technically sound and reasonable. The current status of the program is that which would be advanced for compliance.

  9. IEMS 305 Statistical Methods for Quality Improvement Instructor: Prof. Daniel Apley; Rm. C150; 491-2397; apley@northwestern.edu; office

    E-Print Network [OSTI]

    Hazen, Gordon

    .g. financial services or health care. Six-sigma programs, the focus of which is reducing variability methods used in six-sigma, with the material covered at a level consistent with the strong analytical.5 weeks) Process Optimization and Robust Design (Ch. 14, ~ 1 week) Other Useful Six Sigma topics (~ 1 week

  10. Date Days OCE Title Presenter / Sponsoring Organization Time Location 1 1/23/13 Wednesday Classroom Success Kate Forynna 6:00PM Downtown Library Rm. 104 Yes

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    Unconventional Shale R&D: Flow back/Produced Water Treatment," MAE/ Jason Trembly 1:30PM ESB 201 Yes 36 3

  11. The Sloan Bright Arcs Survey : Discovery of Seven New Strongly Lensed Galaxies from $\\rm{z}=0.66-2.94$

    SciTech Connect (OSTI)

    Kubo, Jeffrey M.; Allam, Sahar S.; Annis, James; Buckley-Geer, Elizabeth J.; Diehl, H.Thomas; Drabek, Emily; Frieman, Joshua A.; Hao, Jiangang; Kubik, Donna; Lin, Huan; Soares-Santos, Marcelle

    2010-10-01T23:59:59.000Z

    We report the discovery of seven new, very bright gravitational lens systems from our ongoing gravitational lens search, the Sloan Bright Arcs Survey (SBAS). Two of the systems are confirmed to have high source redshifts z = 2.19 and z = 2.94. Three other systems lie at intermediate redshift with z = 1.33, 1.82, 1.93 and two systems are at low redshift z = 0.66, 0.86. The lensed source galaxies in all of these systems are bright, with i-band magnitudes ranging from 19.73-22.06. We present the spectrum of each of the source galaxies in these systems along with estimates of the Einstein radius for each system. The foreground lens in most systems is identified by a red sequence based cluster finder as a galaxy group; one system is identified as a moderately rich cluster. In total the SBAS has now discovered nineteen strong lens systems in the SDSS imaging data, eight of which are among the highest surface brightness z {approx_equal} 2-3 galaxies known.

  12. THE STRUCTURE OF EAS AT E > 0.1 EeV Baltrusaitis, R.M., Cassiday, G.L., Cooper, R., Elbert, J.W.,

    E-Print Network [OSTI]

    in the electromagnetic channel (Eem) to the size of the shower at maximum development (Nmax) from a direct measurement-electromagnetic channel. We present below the results of the Eem vs Nmax relationship obtained from a direct integration trajectories(1). Electromagnetic shower energy, Eem, and shower size at maximum Nmax is determined by fits made

  13. ENERGY CALIBRATION OF THE FLY'S EYE DETECTOR Baltrusaitis, R.M., Cassiday, G.L., Cooper, R., Elbert, J.W.,

    E-Print Network [OSTI]

    integrals of observed shower development curves(1). eg Eem = å0/X0 Ne(x)dx where Eem is the total energy

  14. Student Career Centre Agora : Rm 7-153 Tel: 250-960-6598 hirestudents@unbc.ca www.unbc.ca/careercentre Revised: Oct 2007

    E-Print Network [OSTI]

    Northern British Columbia, University of

    of museums, gallery exhibitions, and historical/heritage sites. Answers inquiries and provides information of historical material. Conducts tours and gives lectures and presentations on historical topics. Works for libraries, historical museums, and historical sites. MUSEUM INTERPRETER Museum interpreters conduct tours

  15. Elliptic flow of non-photonic electrons in Au+Au collisions at $\\sqrt{s_{\\rm NN}} = $ 200, 62.4 and 39 GeV

    E-Print Network [OSTI]

    STAR Collaboration; L. Adamczyk; J. K. Adkins; G. Agakishiev; M. M. Aggarwal; Z. Ahammed; I. Alekseev; J. Alford; C. D. Anson; A. Aparin; D. Arkhipkin; E. C. Aschenauer; G. S. Averichev; A. Banerjee; D. R. Beavis; R. Bellwied; A. Bhasin; A. K. Bhati; P. Bhattarai; H. Bichsel; J. Bielcik; J. Bielcikova; L. C. Bland; I. G. Bordyuzhin; W. Borowski; J. Bouchet; A. V. Brandin; S. G. Brovko; S. Bültmann; I. Bunzarov; T. P. Burton; J. Butterworth; H. Caines; M. Calderón de la Barca Sánchez; J. M. Campbell; D. Cebra; R. Cendejas; M. C. Cervantes; P. Chaloupka; Z. Chang; S. Chattopadhyay; H. F. Chen; J. H. Chen; L. Chen; J. Cheng; M. Cherney; A. Chikanian; W. Christie; J. Chwastowski; M. J. M. Codrington; G. Contin; J. G. Cramer; H. J. Crawford; X. Cui; S. Das; A. Davila Leyva; L. C. De Silva; R. R. Debbe; T. G. Dedovich; J. Deng; A. A. Derevschikov; R. Derradi de Souza; B. di Ruzza; L. Didenko; C. Dilks; F. Ding; P. Djawotho; X. Dong; J. L. Drachenberg; J. E. Draper; C. M. Du; L. E. Dunkelberger; J. C. Dunlop; L. G. Efimov; J. Engelage; K. S. Engle; G. Eppley; L. Eun; O. Evdokimov; O. Eyser; R. Fatemi; S. Fazio; J. Fedorisin; P. Filip; Y. Fisyak; C. E. Flores; C. A. Gagliardi; D. R. Gangadharan; D. Garand; F. Geurts; A. Gibson; M. Girard; S. Gliske; L. Greiner; D. Grosnick; D. S. Gunarathne; Y. Guo; A. Gupta; S. Gupta; W. Guryn; B. Haag; A. Hamed; L-X. Han; R. Haque; J. W. Harris; S. Heppelmann; A. Hirsch; G. W. Hoffmann; D. J. Hofman; S. Horvat; B. Huang; H. Z. Huang; X. Huang; P. Huck; T. J. Humanic; G. Igo; W. W. Jacobs; H. Jang; E. G. Judd; S. Kabana; D. Kalinkin; K. Kang; K. Kauder; H. W. Ke; D. Keane; A. Kechechyan; A. Kesich; Z. H. Khan; D. P. Kikola; I. Kisel; A. Kisiel; D. D. Koetke; T. Kollegger; J. Konzer; I. Koralt; L. K. Kosarzewski; L. Kotchenda; A. F. Kraishan; P. Kravtsov; K. Krueger; I. Kulakov; L. Kumar; R. A. Kycia; M. A. C. Lamont; J. M. Landgraf; K. D. Landry; J. Lauret; A. Lebedev; R. Lednicky; J. H. Lee; C. Li; W. Li; X. Li; X. Li; Y. Li; Z. M. Li; M. A. Lisa; F. Liu; T. Ljubicic; W. J. Llope; M. Lomnitz; R. S. Longacre; X. Luo; G. L. Ma; Y. G. Ma; D. P. Mahapatra; R. Majka; S. Margetis; C. Markert; H. Masui; H. S. Matis; D. McDonald; T. S. McShane; N. G. Minaev; S. Mioduszewski; B. Mohanty; M. M. Mondal; D. A. Morozov; M. K. Mustafa; B. K. Nandi; Md. Nasim; T. K. Nayak; J. M. Nelson; G. Nigmatkulov; L. V. Nogach; S. Y. Noh; J. Novak; S. B. Nurushev; G. Odyniec; A. Ogawa; K. Oh; A. Ohlson; V. Okorokov; E. W. Oldag; D. L. Olvitt Jr.; B. S. Page; Y. X. Pan; Y. Pandit; Y. Panebratsev; T. Pawlak; B. Pawlik; H. Pei; C. Perkins; P. Pile; M. Planinic; J. Pluta; N. Poljak; K. Poniatowska; J. Porter; A. M. Poskanzer; N. K. Pruthi; M. Przybycien; J. Putschke; H. Qiu; A. Quintero; S. Ramachandran; R. Raniwala; S. Raniwala; R. L. Ray; C. K. Riley; H. G. Ritter; J. B. Roberts; O. V. Rogachevskiy; J. L. Romero; J. F. Ross; A. Roy; L. Ruan; J. Rusnak; O. Rusnakova; N. R. Sahoo; P. K. Sahu; I. Sakrejda; S. Salur; J. Sandweiss; E. Sangaline; A. Sarkar; J. Schambach; R. P. Scharenberg; A. M. Schmah; W. B. Schmidke; N. Schmitz; J. Seger; P. Seyboth; N. Shah; E. Shahaliev; P. V. Shanmuganathan; M. Shao; B. Sharma; W. Q. Shen; S. S. Shi; Q. Y. Shou; E. P. Sichtermann; M. Simko; M. J. Skoby; D. Smirnov; N. Smirnov; D. Solanki; P. Sorensen; H. M. Spinka; B. Srivastava; T. D. S. Stanislaus; J. R. Stevens; R. Stock; M. Strikhanov; B. Stringfellow; M. Sumbera; X. Sun; X. M. Sun; Y. Sun; Z. Sun; B. Surrow; D. N. Svirida; T. J. M. Symons; M. A. Szelezniak; J. Takahashi; A. H. Tang; Z. Tang; T. Tarnowsky; J. H. Thomas; A. R. Timmins; D. Tlusty; M. Tokarev; S. Trentalange; R. E. Tribble; P. Tribedy; B. A. Trzeciak; O. D. Tsai; J. Turnau; T. Ullrich; D. G. Underwood; G. Van Buren; G. van Nieuwenhuizen; M. Vandenbroucke; J. A. Vanfossen, Jr.; R. Varma; G. M. S. Vasconcelos; A. N. Vasiliev; R. Vertesi; F. Videbæk; Y. P. Viyogi; S. Vokal; A. Vossen; M. Wada; F. Wang; G. Wang; H. Wang; J. S. Wang; X. L. Wang; Y. Wang; Y. Wang; G. Webb; J. C. Webb; G. D. Westfall; H. Wieman; S. W. Wissink; R. Witt; Y. F. Wu; Z. Xiao; W. Xie; K. Xin; H. Xu; J. Xu; N. Xu; Q. H. Xu; W. Xu; Y. Xu; Z. Xu; W. Yan; C. Yang; Y. Yang; Y. Yang; Z. Ye; P. Yepes; L. Yi; K. Yip; I-K. Yoo; N. Yu; H. Zbroszczyk; W. Zha; J. B. Zhang; J. L. Zhang; S. Zhang; X. P. Zhang; Y. Zhang; Z. P. Zhang; F. Zhao; J. Zhao; C. Zhong; X. Zhu; Y. H. Zhu; Y. Zoulkarneeva; M. Zyzak

    2014-05-24T23:59:59.000Z

    We present the measurements of elliptic flow ($v_2$) of non-photonic electrons (NPE) by the STAR experiment using 2- and 4-particle correlations, $v_2${2} and $v_2${4}, and the event plane method in Au+Au collisions at $\\sqrt{s_{NN}} = 200$ GeV, and $v_2${2} at 62.4 and 39 GeV. $v_2${2} and $v_2${4} are non-zero at low and intermediate transverse momentum ($p_T$) at 200 GeV, and $v_2${2} is consistent with zero at low $p_T$ at other energies. For Au+Au collisions at $p_T<1$ GeV/c, there is a statistically significant difference between $v_2${2} at 200 GeV and $v_2${2} at the two lower beam energies.

  16. Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu

    E-Print Network [OSTI]

    Production Managers Industry Relations Specialist Insurance Agent/Broker Inventory Control Specialist management, administrative theory, and international management emphasizes the processes of planning, organizing, leading and controlling organizations. The program is intended to help you develop

  17. Growth of cubic GaN on 3CSiC/Si (001) nanostructures R.M. Kemper a,n

    E-Print Network [OSTI]

    As, Donat Josef

    ) substrate. These anti-phase domains strongly influence the optimum growth of GaN layers in these regions are due to the lattice mismatch with the substrate. For c-GaN, 3C­SiC is the preferred substrate of GaN on post shaped nanostructures and analyze the influence of substrate domains on the defect

  18. Business Career Services Center | 1300 Sunnyside Ave. Rm. 125 | Lawrence, KS 66045 | (785) 864-5591 | www.business.ku.edu

    E-Print Network [OSTI]

    Management and Pricing · Procurement and Supply Management · Materials Planning · Inventory Management-5591 | www.business.ku.edu - 1 - What Can I Do With A Major In SUPPLY CHAIN MANAGEMENT? What is Supply Chain Management? Supply Chain Management (SCM) consists of a set of approaches to efficiently integrate the flow

  19. Department of Computer Science, University of Toronto, 10 King's College Road, Rm.3303, Toronto, Ontario CANADA M5S 3G4 www.cs.toronto.edu

    E-Print Network [OSTI]

    Zandstra, Peter W.

    -stream position in Computational Biology or Bioinformatics. The appointment is at the rank of Assistant Professor's strengths in biology and bioinformatics---and computational, medical and biological sciences more broadly, computational biology and quantitative biology), exceptional candidates with recent or imminently-expected Ph

  20. Search for a massive resonance decaying into a Higgs boson and a W or Z boson in hadronic final states in proton-proton collisions at sqrt(s) = 8 TeV

    E-Print Network [OSTI]

    CMS Collaboration

    2015-01-01T23:59:59.000Z

    A search for a massive resonance decaying into a standard model Higgs boson (H) and a W or Z boson is reported. The analysis is performed on a data sample corresponding to an integrated luminosity of 19.7~fb$^{-1}$, collected in proton-proton collisions at a centre-of-mass energy of 8~TeV with the CMS detector at the LHC. Signal events in which the decay products of Higgs, W or Z bosons at high Lorentz boost are contained within a single reconstructed jet are identified using jet substructure techniques, including the tagging of b hadrons. This is the first search for heavy resonances decaying into HW or HZ resulting in an all-jets final state, as well as the first application of jet substructure techniques to identify ${\\rm H\\to WW^*\\to 4q}$ decays at high Lorentz boost. No significant signal is observed and limits are set at the 95\\% confidence level on the production cross section of W' and Z' in a model with mass-degenerate charged and neutral spin-1 resonances. Resonance masses are excluded for W' in [1....

  1. Universality in W+Multijet Production

    E-Print Network [OSTI]

    Z. Bern; L. J. Dixon; F. Febres Cordero; S. Hoeche; H. Ita; D. A. Kosower; D. Maitre; K. J. Ozeren

    2014-07-24T23:59:59.000Z

    We study $W$-boson production accompanied by multiple jets at 7 TeV at the LHC. We study the jet-production ratio, of total cross sections for $W$+$n$- to $W$+($n-1$)-jet production, and the ratio of distributions in the total transverse hadronic jet energy $H_{\\rm T}^{\\rm jets}$. We use the ratios to extrapolate the total cross section, and the differential distribution in $H_{\\rm T}^{\\rm jets}$, to $W$+6-jet production. We use the BlackHat software library in conjunction with SHERPA to perform the computations.

  2. Measurement of the Proton-Air Cross Section with Telescope Array's Middle Drum Detector and Surface Array in Hybrid Mode

    E-Print Network [OSTI]

    Abbasi, R U; Abu-Zayyad, T; Allen, M; Anderson, R; Azuma, R; Barcikowski, E; Belz, J W; Bergman, D R; Blake, S A; Cady, R; Chae, M J; Cheon, B G; Chiba, J; Chikawa, M; Cho, W R; Fujii, T; Fukushima, M; Goto, T; Hanlon, W; Hayashi, Y; Hayashida, N; Hibino, K; Honda1, K; Ikeda, D; Inoue, N; Ishii, T; Ishimori, R; Ito, H; Ivanov, D; Jui, C C H; Kadota, K; Kakimoto, F; Kalashev, O; Kasahara, K; Kawai, H; Kawakami, S; Kawana, S; Kawata, K; Kido, E; Kim, H B; Kim, J H; Kitamura, S; Kitamura, Y; Kuzmin, V; Kwon, Y J; Lan1, J; Lim, S I; Lundquist, J P; Machida, K; Martens, K; Matsuda, T; Matsuyama, T; Matthews, J N; Minamino, M; Mukai, K; Myers, I; Nagasawa, K; Nagataki1, S; Nakamura, T; Nonaka, T; Nozato, A; Ogio, S; Ogura, J; Ohnishi, M; Ohoka, H; Oki, K; Okuda, T; Ono, M; Oshima, A; Ozawa, S; Park, I H; Pshirkov, M S; Rodriguez, D C; Rubtsov, G; Ryu, D; Sagawa, H; Sakurai, N; Sampson, A L; Scott, L M; Shah, P D; Shibata, F; Shibata, T; Shimodaira, H; Shin, B K; Smith, J D; Sokolsky, P; Springer, R W; Stokes, B T; Stratton, S R; Stroman, T A; Suzawa, T; Takamura, M; Takeda, M; Takeishi, R; Taketa, A; Takita, M; Tameda, Y; Tanaka, H; Tanaka, K; Tanaka, M; Thomas, S B; Thomson, G B; Tinyakov, P; Tkachev, I; Tokuno, H; Tomida, T; Troitsky, S; Tsunesada, Y; Tsutsumi, K; Uchihori, Y; Udo, S; Urban, F; Vasiloff, G; Wong, T; Yamane, R; Yamaoka, H; Yamazaki, K; Yang, J; Yashiro, K; Yoneda, Y; Yoshida, S; Yoshii, H; Zollinger, R; Zundel, Z

    2015-01-01T23:59:59.000Z

    In this work we are reporting on the measurement of the proton-air inelastic cross section $\\sigma^{\\rm inel}_{\\rm p-air}$ using the Telescope Array (TA) detector. Based on the measurement of the $\\sigma^{\\rm inel}_{\\rm p-air}$ the proton-proton cross section $\\sigma_{\\rm p-p}$ value is also determined at $\\sqrt{s} = 95$ TeV. Detecting cosmic ray events at ultra high energies with Telescope Array enables us to study this fundamental parameter that we are otherwise unable to access with particle accelerators. The data used in this report is collected over five years using hybrid events observed by the Middle Drum fluorescence detector together with the surface array detector. The value of the $\\sigma^{\\rm inel}_{\\rm p-air}$ is found to be equal to $ 567.0 \\pm 70.5 [{\\rm Stat.}] ^{+25}_{-29} [{\\rm Sys.}]$ mb. The total proton-proton cross section is subsequently inferred from Glauber Formalism and Block, Halzen and Stanev QCD inspired fit and is found to be equal to $170_{-44}^{+48} [{\\rm Stat.}] \\pm _{-19}^{+1...

  3. Comment on "Search for the Standard Model Higgs Boson in the Missing Energy and Acoplanar b-Jet Topology at $\\sqrt{s} = 1.96$ TeV"

    E-Print Network [OSTI]

    E. Donth

    2009-08-03T23:59:59.000Z

    A DO paper of 2008 is exemplarily commented to demonstrate the general risk that the development of a new paradigm for astroparticle physics can be hindered by the work of large collaborations. This paper allows sharp formulations because only the simplest Higgs variant is treated. PACS numbers: 01.10 Hx, 13.85 Rm, 14.80 Bn

  4. elsart-num.bst

    E-Print Network [OSTI]

    ... merlin.mbs (with options: %%`,seq-no,nm-init,ed-au,dt-end,yr-par,yrp-x,jttl-rm ... LaTeX Project Public License Distributed from CTAN % archives in directory ...

  5. Study of the Higgs boson decaying to $WW^*$ produced in association with a weak boson with the ATLAS detector at the LHC

    E-Print Network [OSTI]

    The ATLAS collaboration

    2015-01-01T23:59:59.000Z

    The search for Higgs boson production in association with a $W$ or a $Z$ boson, in the decay channel $H \\to WW^*$, is performed with a data sample collected with the ATLAS detector at the LHC in proton-proton collisions at centre-of-mass energies $\\sqrt{s}=7~{\\rm TeV}$ and $8~{\\rm TeV}$, corresponding to integrated luminosities of 4.5 ${\\rm fb}^{-1}$ and 20.3 ${\\rm fb}^{-1}$, respectively. The $WH$ production mode is studied in three and two lepton final states, while a four lepton final state is used to search for $ZH$ production. The observed significance is of 2.5 standard deviations while a significance of 0.9 standard deviations is expected for a Standard Model Higgs boson. The ratio of the combined $WH$ and $ZH$ signal yield to the Standard Model expectation, $\\mu_{\\rm VH}$, is found to be $\\mu_{\\rm VH} =3.0^{+1.3}_{-1.1}{\\, {(\\rm stat.)}}^{+1.0}_{-0.7}{\\,{(\\rm sys.)}}$ for a Higgs boson mass of 125.36 GeV. The $WH$ and $ZH$ channels are also combined with the gluon-gluon fusion and vector boson fusion ...

  6. Does Nursing Student Self-efficacy Correlate with Knowledge When Using Human Patient Simulation?

    E-Print Network [OSTI]

    Shinnick, MA; Woo, MA

    2014-01-01T23:59:59.000Z

    at Los Angeles, 700 Tiverton Ave. , Factor Building Rm. 3-at Los Angeles, 700 Tiverton Ave. , Factor Building Rm. 3-

  7. Weak topological insulators in PbTe/SnTe superlattices

    E-Print Network [OSTI]

    Yang, Gang

    It is desirable to realize topological phases in artificial structures by engineering electronic band structures. In this paper we investigate (PbTe)[subscript m](SnTe)[subscript 2n?m] superlattices along the [001] direction ...

  8. VICTORIA UNIVERSITY OF WELLINGTON Te Whare Wananga o te Upoko o te Ika a Maui

    E-Print Network [OSTI]

    Fernandez, Thomas

    VICTORIA UNIVERSITY OF WELLINGTON Te Whare Wananga o te Upoko o te Ika a Maui School Descent Will Smart and Mengjie Zhang Technical Report CS-TR-04/11 August 2004 School of Mathematical and Computing Sciences Victoria University PO Box 600, Wellington New Zealand Tel: +64 4 463 5341 Fax: +64 4 463

  9. Total Cross Section Measurements of Highly Enriched Isotopic Mo in the Resolved and Unresolved Energy Regions R.M. Bahran, A.M. Daskalakis, B.J. McDermott, E.J. Blain and Y. Danon

    E-Print Network [OSTI]

    Danon, Yaron

    Total Cross Section Measurements of Highly Enriched Isotopic Mo in the Resolved and Unresolved providing an evacuated pathway for the neutrons to travel. Isotopically-enriche advanced fuel [1,2]. High resolution neutron time-of-flight transmission measurements on highly enriched

  10. 1 V.A. Andreev, E.J. Barnes, R.M. Carey, W. Gohn, V.A. Ganzha, A. Gardestig, T. Gorringe, F.E. Gray, D.W. Hertzog,

    E-Print Network [OSTI]

    Titov, Anatoly

    Meeting of the APS Division of Nuclear Physics and the Physical Society of Japan Volume 59, Number 10 Help to Increase the Energy Output of Fusion Reactors? The 21st International Symposium on Spin Physics «- 2014», 1-4 2014, Book of abstracts, p. 218 2 .. - MUSUN 64 «- 2014», 1-4 2014, Book

  11. Nuclear Data for Criticality Safety and Reactor Applications at the Gaerttner LINAC Center Y. Danon, R.M. Bahran, E.J. Blain, A.M. Daskalakis, B.J. McDermott, D.G. Williams

    E-Print Network [OSTI]

    Danon, Yaron

    Nuclear Data for Criticality Safety and Reactor Applications at the Gaerttner LINAC Center Y. Danon used in reactor and nuclear criticality safety applications. The goal of this program is to provide to nuclear criticality, neutron shielding applications, nuclear reactor design, and to better understand

  12. PRECISION MEASUREMENT OF SINGLET CAPTURE IN HYDROGEN V.A. Andreev , T. Banks , L. Bonnet , R.M. Carey , T.A. Case , D. Chitwood , S.M. Clayton , K.M. Crowe , P.T. Debevec ,

    E-Print Network [OSTI]

    Kammel, Peter

    magnet which is a specially designed coil wound closely around the Alu vessel containing the TPC well-known of the nucleon charged current form factors, the induced pseudo- scalar "$# , to 7%. Mu detector (Aluminium pressure vessel housing the TPC) with magnetic field coil is retracted for preparing

  13. $\\eta$ meson production of high-energy nuclear collisions at NLO

    E-Print Network [OSTI]

    Dai, Wei; Zhang, Ben-Wei; Wang, Enke

    2015-01-01T23:59:59.000Z

    The transverse momentum spectrum of $\\eta$ meson in relativistic heavy-ion collisions is studied at the next-to-leading-order (NLO) within the perturbative QCD, where the jet quenching effect in the QGP is incorporated with the effectively medium-modified $\\eta$ fragmentation functions using the higher-twist approach. We show that the theoretical simulations could give nice descriptions of PHENIX data on $\\eta$ meson in both $\\rm p+p$ and central $\\rm Au+Au$ collisions at the RHIC, and also provide numerical predictions of $\\eta$ spectra in central $\\rm Pb+Pb$ collisions with $\\sqrt{s_{NN}}=2.76$~TeV at the LHC. The ratios of $\\eta/\\pi^0$ in $\\rm p+p$ and in central $\\rm Au+Au$ collisions at $200$~GeV are found to overlap in a wide $p_T$ region, which matches well the measured ratio $\\eta / \\pi^0$ by PHENIX. We demonstrate that, at the asymptotic region when $p_{T} \\rightarrow \\infty$ the ratios of $\\eta/\\pi^{0}$ in both $\\rm Au+Au$ and $\\rm p+p$ are almost determined only by quark jets fragmentation and thus...

  14. Transverse energy and charged particle production in heavy-ion collisions: From RHIC to LHC

    E-Print Network [OSTI]

    Raghunath Sahoo; Aditya Nath Mishra

    2014-04-30T23:59:59.000Z

    We study the charged particle and transverse energy production mechanism from AGS, SPS, RHIC to LHC energies in the framework of nucleon and quark participants. At RHIC and LHC energies, the number of nucleons-normalized charged particle and transverse energy density in pseudorapidity, which shows a monotonic rise with centrality, turns out to be an almost centrality independent scaling behaviour when normalized to the number of participant quarks. A universal function which is a combination of logarithmic and power-law, describes well the charged particle and transverse energy production both at nucleon and quark participant level for the whole range of collision energies. Energy dependent production mechanisms are discussed both for nucleonic and partonic level. Predictions are made for the pseudorapidity densities of transverse energy, charged particle multiplicity and their ratio (the barometric observable, $\\frac{dE_{\\rm{T}}/d\\eta}{dN_{\\rm{ch}}/d\\eta} ~\\equiv \\frac{E_{\\rm{T}}}{N_{\\rm{ch}}}$) at mid-rapidity for Pb+Pb collisions at $\\sqrt{s_{\\rm{NN}}}=5.5$ TeV. A comparison with models based on gluon saturation and statistical hadron gas is made for the energy dependence of $\\frac{E_{\\rm{T}}}{N_{\\rm{ch}}}$.

  15. Interference effects and the use of Higgs boson pair production to study the Higgs trilinear self coupling

    E-Print Network [OSTI]

    Dicus, Duane A; Repko, Wayne W

    2015-01-01T23:59:59.000Z

    We show that the dominant channel proposed for the determination of the Higgs boson trilinear coupling, $pp\\to HH+X$ via gluon fusion, exhibits an interference structure that is independent of the collider energy for collider energies in the range $8\\,{\\rm TeV}\\leq \\sqrt{s}\\leq 100\\,{\\rm TeV}$ and is almost maximally destructive. This insensitivity to the collider energy remains approximately true for a variety of other two Higgs production mechanisms although the magnitude of the interference varies widely.

  16. Isolation and characterization of microsatellite loci from blue-footed boobies (Sula nebouxii)

    E-Print Network [OSTI]

    Faircloth, Brant C.; Ramos, Alejandra; Drummond, Hugh; Gowaty, Patricia Adair

    2009-01-01T23:59:59.000Z

    CT)^8 A Range Repeat HO HE PIC Locus Sequence BOOB-RM2-F07U GTTTGCTAATCCCCTGGTGCAAGTG BOOB-RM2-F07 LAAAG)^35… (AAAG) ^5 BOOB-RM3-D07 U GTTTGGCCTACTGCCATCCAGGG

  17. DEPARTMENT: SESS CAT COMP START/END TIMES FACILITY

    E-Print Network [OSTI]

    Schulte, Mike

    302246108A1 W 25 0000 GA RM12:5512:05 25DIS304246108A1 F 25 0000 GA RM17:2516:35 245LEC001306108A1 M W 245 0000 GA RM08:3507:45 47DIS301306108A1 T 42 0000 GA RM15:1514:25 46DIS302306108A1 W 42 0000 GA RM15 RM16:1014:25 20LAB301370604A1 W 30 0000 GA RM10:4509:45 38LAB001414604A1 T R 38 0000 GA RM14

  18. Surgical resectability of pancreatic adenocarcinoma: CTA

    E-Print Network [OSTI]

    Wong, Jimmie C.; Raman, Steven

    2010-01-01T23:59:59.000Z

    2. Lu DSK, Vedantham S, Krasny RM, et al. (1996) Two-phaseMD 17. Lu DSK, Reber HA, Krasny RM, et al. (1997) Local

  19. An inter-laboratory study to test the ability of amendments to reduce the availability of Cd, Pb, and Zn in situ

    E-Print Network [OSTI]

    Brown, Sally

    (RM), cyclonic ashes (CA), biosolids (BIO), and water treatment residuals (WTR). Both soil solution Abbreviations: BIO, biosolids; WTR, water treatment residuals; RM, red mud; KAD, kaolin amorphous derivatives

  20. Energy Dependence of the Transverse Momentum Distributions of Charged Particles in pp Collisions Measured by ALICE

    E-Print Network [OSTI]

    ALICE Collaboration

    2014-11-04T23:59:59.000Z

    Differential cross sections of charged particles in inelastic pp collisions as a function of $p_{\\rm T}$ have been measured at $\\sqrt{s}=$ 0.9, 2.76 and 7 TeV at the LHC. The $p_{\\rm T}$ spectra are compared to NLO-pQCD calculations. Though the differential cross section for an individual $\\sqrt{s}$ cannot be described by NLO-pQCD, the relative increase of cross section with $\\sqrt{s}$ is in agreement with NLO-pQCD. Based on these measurements and observations, procedures are discussed to construct pp reference spectra at $\\sqrt{s} =$ 2.76 and 5.02 TeV up to $p_{\\rm T}$ = 50 GeV/$c$ as required for the calculation of the nuclear modification factor in nucleus-nucleus and proton-nucleus collisions.

  1. Recycling of CdTe photovoltaic waste

    DOE Patents [OSTI]

    Goozner, Robert E. (Charlotte, NC); Long, Mark O. (Charlotte, NC); Drinkard, Jr., William F. (Charlotte, NC)

    1999-01-01T23:59:59.000Z

    A method for extracting and reclaiming metals from scrap CdTe photovoltaic cells and manufacturing waste by leaching the waste with a leaching solution comprising nitric acid and water, skimming any plastic material from the top of the leaching solution, separating the glass substrate from the liquid leachate and electrolyzing the leachate to separate Cd from Te, wherein the Te is deposits onto a cathode while the Cd remains in solution.

  2. Recycling ZnTe, CdTe, and Other Compound Semiconductors by Ambipolar Electrolysis

    E-Print Network [OSTI]

    Osswald, Sebastian

    The electrochemical behavior of ZnTe and CdTe compound semiconductors dissolved in molten ZnCl[subscript 2] and equimolar CdCl[subscript 2]–KCl, respectively, was examined. In these melts dissolved Te is present as the ...

  3. A Search for Neutrinoless Double Beta Decay of Te-130

    E-Print Network [OSTI]

    Bryant, Adam Douglas

    2010-01-01T23:59:59.000Z

    Decay of Te by Adam Douglas Bryant A dissertation submitted2010 by Adam Douglas Bryant Te Abstract A Search forDecay of Te by Adam Douglas Bryant Doctor of Philosophy in

  4. Recycling of CdTe photovoltaic waste

    DOE Patents [OSTI]

    Goozner, R.E.; Long, M.O.; Drinkard, W.F. Jr.

    1999-04-27T23:59:59.000Z

    A method for extracting and reclaiming metals from scrap CdTe photovoltaic cells and manufacturing waste by leaching the metals in dilute nitric acid, leaching the waste with a leaching solution comprising nitric acid and water, skimming any plastic material from the top of the leaching solution, separating the glass substrate from the liquid leachate, adding a calcium containing base to the leachate to precipitate Cd and Te, separating the precipitated Cd and Te from the leachate, and recovering the calcium-containing base. 3 figs.

  5. Recycling of CdTe photovoltaic waste

    DOE Patents [OSTI]

    Goozner, Robert E. (Charlotte, NC); Long, Mark O. (Charlotte, NC); Drinkard, Jr., William F. (Charlotte, NC)

    1999-04-27T23:59:59.000Z

    A method for extracting and reclaiming metals from scrap CdTe photovoltaic cells and manufacturing waste by leaching the metals in dilute nitric acid, leaching the waste with a leaching solution comprising nitric acid and water, skimming any plastic material from the top of the leaching solution, separating the glass substrate from the liquid leachate, adding a calcium containing base to the leachate to precipitate Cd and Te, separating the precipitated Cd and Te from the leachate, and recovering the calcium-containing base.

  6. Solar variability of four sites across the state of Colorado

    E-Print Network [OSTI]

    Lave, Matthew; Kleissl, Jan

    2010-01-01T23:59:59.000Z

    and Technology 2005; 39: 1903– Denholm P, Margolis RM. Evaluating the limits of solar photovoltaics (PV)

  7. TEXAS A&M UNIVERSITY CHANGE ORDER REQUEST

    E-Print Network [OSTI]

    Behmer, Spencer T.

    /Parking Easterwood Airport SOFC MSC ­ Rm 221 Other ______________________________ For SBS and FMO use only

  8. Hadronic contributions to the muon anomalous magnetic moment Workshop. $(g-2)_?$: Quo vadis? Workshop. Mini proceedings

    E-Print Network [OSTI]

    Maurice Benayoun; Johan Bijnens; Tom Blum; Irinel Caprini; Gilberto Colangelo; Henryk Czy?; Achim Denig; Cesareo A. Dominguez; Simon Eidelman; Christian S. Fischer; Paolo Gauzzi; Yuping Guo; Andreas Hafner; Masashi Hayakawa; Gregorio Herdoiza; Martin Hoferichter; Guangshun Huang; Karl Jansen; Fred Jegerlehner; Benedikt Kloss; Bastian Kubis; Zhiqing Liu; William Marciano; Pere Masjuan; Harvey B. Meyer; Tsutomu Mibe; Andreas Nyffeler; Vladimir Pascalutsa; Vladyslav Pauk; Michael R. Pennington; Santiago Peris; Christoph F. Redmer; Pablo Sanchez-Puertas; Boris Shwartz; Evgeny Solodov; Dominik Stoeckinger; Thomas Teubner; Marc Unverzagt; Marc Vanderhaeghen; Magnus Wolke

    2014-07-21T23:59:59.000Z

    We present the mini-proceedings of the workshops Hadronic contributions to the muon anomalous magnetic moment: strategies for improvements of the accuracy of the theoretical prediction and $(g-2)_{\\mu}$: Quo vadis?, both held in Mainz from April 1$^{\\rm rst}$ to 5$^{\\rm th}$ and from April 7$^{\\rm th}$ to 10$^{\\rm th}$, 2014, respectively.

  9. Joint CQSE and CASTS Seminar Weekly Seminar

    E-Print Network [OSTI]

    Wu, Yih-Min

    -Ming Lu National Center for High Performance Computing PLACE Rm716, CCMS & New Physics Building, NTU

  10. arXiv:1106.3780v1[math.AP]19Jun2011 Energy Quantization for Willmore Surfaces

    E-Print Network [OSTI]

    Rivière, Tristan

    into Rm3 . We denote by g := gRm the pull back by of the flat canonical metric gRm of Rm , also called the first fundamental form of , and we let dvolg be its associated volume form. The Gauss map as the Dirichlet Energy of the Gauss map n with respect to the induced metric g. The Gauss Bonnet theorem implies

  11. Particle rapidity distribution in proton-nucleus collisions using the proton-contributor reference frame

    E-Print Network [OSTI]

    Gines Martinez-Garcia

    2014-08-14T23:59:59.000Z

    I define the proton-contributor reference frame in proton nucleus (p--A) collisions as the center of mass of the system formed by the proton and the participant nucleons of the nucleus. Assuming that the rapidity distribution of produced particles is symmetric in the proton-contributor reference frame, several measurements in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 5.02 {\\rm TeV}$ can be described qualitatively. These include rapidity distributions of charged particles, $J/\\psi$ and Z bosons.

  12. The PeTroleum InsTITuTe Annual report 2009 The PeTroleum InsTITuTe

    E-Print Network [OSTI]

    BERTEUSSEN, ACTING DIRECTOR THE PETROLEUM INSTITUTE Annual Report 2009 Health, Safety and EnvironmentThe PeTroleum InsTITuTe Annual report 2009 The PeTroleum InsTITuTe Annual report - 2009 online version #12;The PeTroleum InsTITuTe Annual report 2009 #12;The PeTroleum InsTITuTe Annual report 2009

  13. IMPROVEMENT OF CdMnTe DETECTOR PERFORMANCE BY MnTe PURIFICATION

    SciTech Connect (OSTI)

    Kim, K.H.; Bolotnikov, A.E.; Camarda, G.S.; Tappero, R.; Hossain, A.; Cui, Y.; Yang, G.; Gul, R.; and James, R.B.

    2011-04-25T23:59:59.000Z

    Residual impurities in manganese (Mn) are a big obstacle to obtaining high-performance CdMnTe (CMT) X-ray and gamma-ray detectors. Generally, the zone-refining method is an effective way to improve the material's purity. In this work, we purified the MnTe compounds combining the zone-refining method with molten Te, which has a very high solubility for most impurities. We confirmed the improved purity of the material by glow-discharge mass spectrometry (GDMS). We also found that CMT crystals from a multiply-refined MnTe source, grown by the vertical Bridgman method, yielded better performing detectors.

  14. Phonon blocking by two dimensional electron gas in polar CdTe/PbTe heterojunctions

    SciTech Connect (OSTI)

    Zhang, Bingpo; Cai, Chunfeng; Zhu, He; Wu, Feifei; Ye, Zhenyu; Chen, Yongyue; Li, Ruifeng; Kong, Weiguang; Wu, Huizhen, E-mail: hzwu@zju.edu.cn [Department of Physics and State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou, Zhejiang 310027 (China)

    2014-04-21T23:59:59.000Z

    Narrow-gap lead telluride crystal is an important thermoelectric and mid-infrared material in which phonon functionality is a critical issue to be explored. In this Letter, efficient phonon blockage by forming a polar CdTe/PbTe heterojunction is explicitly observed by Raman scattering. The unique phonon screening effect can be interpreted by recent discovery of high-density two dimensional electrons at the polar CdTe/PbTe(111) interface which paves a way for design and fabrication of thermoelectric devices.

  15. GaTe semiconductor for radiation detection

    DOE Patents [OSTI]

    Payne, Stephen A. (Castro Valley, CA); Burger, Arnold (Nashville, TN); Mandal, Krishna C. (Ashland, MA)

    2009-06-23T23:59:59.000Z

    GaTe semiconductor is used as a room-temperature radiation detector. GaTe has useful properties for radiation detectors: ideal bandgap, favorable mobilities, low melting point (no evaporation), non-hygroscopic nature, and availability of high-purity starting materials. The detector can be used, e.g., for detection of illicit nuclear weapons and radiological dispersed devices at ports of entry, in cities, and off shore and for determination of medical isotopes present in a patient.

  16. Facultad de Ciencias Departamento de Fsica Te

    E-Print Network [OSTI]

    Facultad de Ciencias Departamento de Fâ??�sica Te â?? orica Jet production in charged current deep Ciencias Fâ??�sicas'' by M â?? onica Luisa V â?? azquez Acosta Director : Juan Terr â?? on Cuadrado 16/12/2002 #12; #12; Facultad de Ciencias Departamento de Fâ??�sica Te â?? orica Producci â?? on de chorros hadr â?? onicos en

  17. Property measurement of Higgs boson in the gamma gamma final state with the ATLAS detector at the LHC

    E-Print Network [OSTI]

    Yanping , Huang; The ATLAS collaboration

    2014-01-01T23:59:59.000Z

    With $pp$ collision data sample recorded by the ATLAS experiment at the CERN Large Hadron Collider at center-of-mass energies of 7 TeV and 8 TeV, corresponding to an integrated luminosity of 25 ${\\rm fb}^{-1}$, an improved measurement of the mass of the Higgs boson is derived from a combined fit to the decay channels $H\\rightarrow\\gamma\\gamma$ and $H\\rightarrow ZZ^{*}\\rightarrow 4l$ with improved energy-scale calibrations for photons, electrons and muons as well as other analysis improvements. It is $m_{H}=125.36\\pm0.37{\\rm (stat)}\\pm0.18{\\rm (syst)}$ GeV. Furthermore, measurement of fiducial and differential cross sections are presented in the $H\\rightarrow\\gamma\\gamma$ decay channel using only the 8 TeV data sample with a luminosity of $20.3{\\rm fb}^{-1}$. The observed spectra are statistically limited but broadly in line with the theoretical expectations.

  18. The Politics of Parody: Rosa Montero's Te trataré como a una reina and Patrick Süskind's Perfume

    E-Print Network [OSTI]

    Jurney, Florence Ramond

    1999-01-01T23:59:59.000Z

    by Misreading: Rosa Montero's Te Anales de la Literaturarapport sur de Minuit, 1979. Montero, Rosa. Te trataré comovol. xxviii The Rosa Montero's Te trataré conto a Politics

  19. HgTe-low-field Strained HgTe: a textbook 3D topological insulator

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    HgTe-low-field Strained HgTe: a textbook 3D topological insulator Cl´ement Bouvier, Tristan Meunier martyrs 38054 Grenoble Cedex 9, France (Dated: December 9, 2011) Topological insulators can be seen-conductors and topological- insulators, other contributions make transport data more difficult to unravel. This letter

  20. A search for the Higgs Boson in H -> ZZ -> 4l mode

    E-Print Network [OSTI]

    Mario Pelliccioni for the CMS Collaboration

    2011-09-30T23:59:59.000Z

    A search for a Higgs boson in the decay channel ${\\rm H} \\rightarrow {\\rm ZZ}^{(*)}$ with each Z boson decaying to an electron or muon pair is presented using pp collisions from the LHC at $\\sqrt s$ = 7 TeV. The data analyzed correspond to an integrated luminosity of $1.13 \\pm 0.07$ fb$^{-1}$ recorded by the CMS detector in 2010 and 2011. The search covers Higgs boson mass ($m_{\\rm H}$) hypotheses of $110 Higgs boson with standard model-like decays exclude cross sections from about one to two times the expected standard model cross section for masses in the range $180 Higgs boson with a mass in the range 138 -162 $\\GeVcc$ and 178-502 $\\GeVcc$ is excluded at 95% CL.

  1. A Compromise between Neutrino Masses and Collider Signatures in the Type-II Seesaw Model

    E-Print Network [OSTI]

    Wei Chao; Shu Luo; Zhi-zhong Xing; Shun Zhou

    2007-09-07T23:59:59.000Z

    A natural extension of the standard $SU(2)_{\\rm L} \\times U(1)_{\\rm Y}$ gauge model to accommodate massive neutrinos is to introduce one Higgs triplet and three right-handed Majorana neutrinos, leading to a $6\\times 6$ neutrino mass matrix which contains three $3\\times 3$ sub-matrices $M_{\\rm L}$, $M_{\\rm D}$ and $M_{\\rm R}$. We show that three light Majorana neutrinos (i.e., the mass eigenstates of $\

  2. Study of the penguin-dominated decay $B_s^0 \\rightarrow K^{*0} \\overline{K}{}^{*0}$ at LHCb

    E-Print Network [OSTI]

    Alvarez Cartelle, Paula; Gallas Torreira, Abraham

    This thesis is devoted to the search for and subsequent analysis of the decay channel $B_s^0 \\rightarrow K^{*0} \\overline{K}{}^{*0}$, using the first data acquired by LHCb during 2010 and 2011 from the LHC proton-proton collisions at a centre-of-mass energy $\\sqrt{s}=7\\;{\\rm TeV}$, corresponding to an integrated luminosity of $37\\;{\\rm pb}^{-1}$ and $1.0\\;{\\rm fb}^{-1}$ respectively. As a result of the work presented here, the first observation of the $B_s^0 \\rightarrow K^{*0} \\overline{K}{}^{*0}$ decay was performed. With the extended data sample collected in 2011, a combined angular and mass analysis was carried out, in order to assess the longitudinal polarisation fractions of the $K^{*0}$, obtaining $f_L = 0.201 \\pm 0.057{\\rm (stat.)} \\pm 0.040{\\rm (syst.)}$. The branching fraction for this decay was also measured to be $\\mathcal{B}({B_s^0 \\rightarrow K^{*0} \\overline{K}{}^{*0}}) =$ (10.6 $\\pm$ 1.8(stat.) $\\pm$ 1.0(syst.) $\\pm$ 0.6 $(f_d/f_s)$) $\\times 10^{?6}$, in agreement with the Standard Model pre...

  3. A Search for Neutrinoless Double Beta Decay of Te-130

    E-Print Network [OSTI]

    Bryant, Adam Douglas

    2010-01-01T23:59:59.000Z

    A Search for Neutrinoless Double Beta Decay of Te by AdamA Search for Neutrinoless Double Beta Decay of CopyrightA Search for Neutrinoless Double Beta Decay of Te by Adam

  4. Transverse Feedback in a 100 TeV Storage Ring

    E-Print Network [OSTI]

    Lambertson, G.

    2011-01-01T23:59:59.000Z

    Proceedings Transverse Feedback in a 100 TeV Storage Ring G.DE93 001571 TRANSVERSE FEEDBACK IN A 100 TeV STORAGE RING*IS UNLIMITED r-t_9. TRANSVERSE FEEDBACK IN A 100 TeV STORAGE

  5. A Search for Neutrinoless Double Beta Decay of Te-130

    E-Print Network [OSTI]

    Bryant, Adam Douglas

    2010-01-01T23:59:59.000Z

    coupled-cluster method (CCM), Miller-Spencer Jastrow, and2 M 0? g A (R)QRPA [93] CCM SRC QRPA [94] Jastrow QRPA [94]Te Ge Te Ge Te (a) RQRPA [93] CCM CD-Bonn (b) RQRPA [93] CCM

  6. The PeTroleum InsTITuTe Annual report 2008 -2009 The PeTroleum InsTITuTe

    E-Print Network [OSTI]

    The PeTroleum InsTITuTe Annual report 2008 - 2009 The PeTroleum InsTITuTe Annual report - Academic Year 2008 - 2009 online version #12;The PeTroleum InsTITuTe Annual report 2008 - 2009 #12;The PeTroleum InsTITuTe Annual report 2008 - 2009 ConTenTs 1. InTroduCTIon offICe of The PresIdenT 4· 2. ACAdemIC de

  7. Influence of CdTe thickness on structural and electrical properties of CdTe/CdS solar cells

    E-Print Network [OSTI]

    Romeo, Alessandro

    Influence of CdTe thickness on structural and electrical properties of CdTe/CdS solar cells A a b s t r a c ta r t i c l e i n f o Available online xxxx Keywords: Solar cells CdCl2 CdTe Thin absorbers Due to its high scalability and low production cost, CdTe solar cells have shown a very strong

  8. Semitransparent ultrathin CdTe solar cells Semitransparent ultrathin CdTe solar cells and durabilityand durability

    E-Print Network [OSTI]

    Rollins, Andrew M.

    Semitransparent ultrathin CdTe solar cells Semitransparent ultrathin CdTe solar cells lines · Thinfilm CIGS--not available in transparent form · Dye sensitized solar thin films· Dye.E. McCandless, W.A. Buchanan. "High throughput processing of CdTe/CdS solar cells with thin absorber

  9. Study of $(W/Z)H$ production and Higgs boson couplings using $H \\rightarrow WW^{\\ast}$ decays with the ATLAS detector

    E-Print Network [OSTI]

    ATLAS Collaboration

    2015-01-01T23:59:59.000Z

    A search for Higgs boson production in association with a $W$ or $Z$ boson, in the $H \\rightarrow WW^{\\ast}$ decay channel, is performed with a data sample collected with the ATLAS detector at the LHC in proton-proton collisions at centre-of-mass energies $\\sqrt{s}=7$ TeV and 8 TeV, corresponding to integrated luminosities of 4.5 ${\\rm fb}^{-1}$ and 20.3 ${\\rm fb}^{-1}$, respectively. The $WH$ production mode is studied in two-lepton and three-lepton final states, while two-lepton and four-lepton final states are used to search for the $ZH$ production mode. The observed significance, for the combined $WH$ and $ZH$ production, is 2.5 standard deviations while a significance of 0.9 standard deviations is expected in the Standard Model Higgs boson hypothesis. The ratio of the combined $WH$ and $ZH$ signal yield to the Standard Model expectation, $\\mu_{VH}$, is found to be $\\mu_{VH} =3.0^{+1.3}_{-1.1}{\\, {(\\rm stat.)}}^{+1.0}_{-0.7}{\\,{(\\rm sys.)}}$ for the Higgs boson mass of 125.36 GeV. The $WH$ and $ZH$ produc...

  10. Thermal stability of thin disk with magnetically driven winds

    E-Print Network [OSTI]

    Li, Shuang-Liang

    2014-01-01T23:59:59.000Z

    The absence of thermal instability in the high/soft state of black hole X-ray binaries, in disagreement with the standard thin disk theory, is a long-standing riddle for theoretical astronomers. We have tried to resolve this question by studying the thermal stability of a thin disk with magnetically driven winds in the $\\dot{M}- \\Sigma$ plane. It is found that disk winds can greatly decrease the disk temperature and thus help the disk become more stable at a given accretion rate. The critical accretion rate $\\dot{M}_{\\rm crit}$ corresponding to the thermal instability threshold is increased significantly in the presence of disk winds. For $\\alpha=0.01$ and $B_{\\rm \\phi}=10B_{\\rm _p}$, the disk is quite stable even for a very weak initial poloidal magnetic field [$\\beta_{\\rm p,0}\\sim 2000, \\beta_{\\rm p}=(P_{\\rm {gas}}+P_{\\rm rad})/(B_{\\rm p}^2/8\\pi)$]. But when $B_{\\rm \\phi}=B_{\\rm _p}$ or $B_{\\rm \\phi}=0.1B_{\\rm _p}$, a somewhat stronger (but still weak) field ($\\beta_{\\rm p,0}\\sim 200$ or $\\beta_{\\rm p,0}\\si...

  11. High performance Zintl phase TE materials with embedded nanoparticles...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Zintl phase TE materials with embedded nanoparticles Performance of zintl phase thermoelectric materials with embedded particles are evaluated shakouri.pdf More Documents &...

  12. SOLAR SEMINAR SERIESS P R I N G 2 0 1 3 P H O T O V O L T A I C S E M I N A R S E R I E S YI CUIBirck Rm. 2001

    E-Print Network [OSTI]

    Ginzel, Matthew

    Energy Center Abstract Advanced photon management using nanostructures provides exciting opportunities for enhancing solar cell device performance. In this talk, I will present examples of photon management and Engineering at Stanford in 2005. He currently investigates nanomaterials for energy storage, photovoltaics

  13. Yager, P.L., R.M. Sherrell, S.E. Stammerjohn, A.-C. Alderkamp, O. Schofield, E.P. Abrahamsen, K.R. Arrigo, S. Bertilsson, D.L. Garay, R. Guerrero, K.E. Lowry, P.-O. Moksnes, K. Ndungu,

    E-Print Network [OSTI]

    for dramatic heat and air-sea gas exchange, greater light penetra- tion, and air-sea access for birds;Oceanography | September 2012 41 Sarmiento et al., 2004). The efficiency of the biological pump in high

  14. Structural phase transitions on the nanoscale: The crucial pattern in the phase-change materials Ge2Sb2Te5 and GeTe

    E-Print Network [OSTI]

    Structural phase transitions on the nanoscale: The crucial pattern in the phase-change materials Ge2Sb2Te5 and GeTe J. Akola1,2 and R. O. Jones1 1Institut für Festkörperforschung, Forschungszentrum to characterize the amorphous structure of the prototype materials Ge2Sb2Te5 and GeTe. In both, there is long

  15. TE Connectivity Finds Answers in Tomography

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposed Action(InsertAbout theSystems3, RevisionTE

  16. Te Mihi Power Station | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro Industries PvtStratosolar Jump to:Holdings Co08.0InformationBPLakeTaylors,Te Mihi Power

  17. TE Connectivity Finds Answers in Tomography

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening a solid ...SuccessSurprisingSynchrotronsPlasma Physics20, 2015TE

  18. Measurement of the Higgs Boson Mass in Decays into Four Leptons with the ATLAS Detector

    E-Print Network [OSTI]

    Röhrig, Rainer

    This master thesis presents a measurement of the mass of the observed Higgs boson candidate in the decay channel $H \\rightarrow ZZ^* \\rightarrow \\ell^+\\ell^-\\ell^{'+}\\ell^{'-}$, with $\\ell,\\ell' = e$ or $\\mu$. The result is based on the full 2011 and 2012 proton-proton collision dataset recorded with the ATLAS detector at the Large Hadron Collider, corresponding to an integrated luminosity of $4.5~\\mathrm{fb}^{-1}$ and $20.3~\\mathrm{fb}^{-1}$ at a center-of-mass energy of $\\sqrt{s} = 7~\\mathrm{TeV}$ and $8~\\mathrm{TeV}$, respectively. The mass is measured to be $m_H = 124.58 ^{+0.53}_{-0.47}{\\rm{~(stat)~}}\\pm0.06{\\rm{~(syst)~}} ~\\mathrm{GeV}$ using an analytical parametrization of the expected mass distribution on an event-by-event basis.

  19. On the Validity of the Effective Field Theory for Dark Matter Searches at the LHC, Part II: Complete Analysis for the s-channel

    E-Print Network [OSTI]

    Giorgio Busoni; Andrea De Simone; Johanna Gramling; Enrico Morgante; Antonio Riotto

    2014-06-30T23:59:59.000Z

    We generalize in several directions our recent analysis of the limitations to the use of the effective field theory approach to study dark matter at the LHC. Firstly, we study the full list of operators connecting fermion DM to quarks and gluons, corresponding to integrating out a heavy mediator in the $s$-channel; secondly, we provide analytical results for the validity of the EFT description for both $\\sqrt{s}=8$ {\\rm TeV} and $14$ {\\rm TeV}; thirdly, we make use of a MonteCarlo event generator approach to assess the validity of our analytical conclusions. We apply our results to revisit the current collider bounds on the ultraviolet cut-off scale of the effective field theory and show that these bounds are weakened once the validity conditions of the effective field theory are imposed.

  20. (GeTe){sub n}SbInTe{sub 3} (n?3)—Element distribution and thermal behavior

    SciTech Connect (OSTI)

    Fahrnbauer, Felix; Urban, Philipp; Welzmiller, Simon [Institute for Mineralogy, Crystallography and Materials Science, Leipzig University, Scharnhorststraße 20, 04275 Leipzig (Germany); Schröder, Thorsten; Rosenthal, Tobias [Department of Chemistry, Ludwig Maximilian University, Butenandtstraße 5-13, 81377 Munich (Germany); Oeckler, Oliver, E-mail: oliver.oeckler@gmx.de [Institute for Mineralogy, Crystallography and Materials Science, Leipzig University, Scharnhorststraße 20, 04275 Leipzig (Germany); Department of Chemistry, Ludwig Maximilian University, Butenandtstraße 5-13, 81377 Munich (Germany)

    2013-12-15T23:59:59.000Z

    Antimony in germanium antimony tellurides (GeTe){sub n}(Sb{sub 2}Te{sub 3}) can be substituted by indium. Homogeneous bulk samples of GeSbInTe{sub 4} (R3-bar m, Z=3, a=4.21324(5) Å, c=41.0348(10) Å) and Ge{sub 2}SbInTe{sub 5} (P3-bar m1, Z=1, a=4.20204(6) Å, c=17.2076(4) Å) were obtained; their structures were refined with the Rietveld method. Single-crystal X-ray diffraction using synchrotron radiation at the K edges of Sb and Te (exploiting anomalous dispersion) yields precise information on the element distribution in the trigonal layered structure of Ge{sub 3}SbInTe{sub 6} (R3-bar m, Z=3, a=4.19789(4) Å, c=62.1620(11) Å). The structure is characterized by van der Waals gaps between distorted rocksalt-type slabs of alternating cation and anion layers. The cation concentration is commensurately modulated with Sb preferring the positions near the gaps. In contrast to unsubstituted Ge{sub 3}Sb{sub 2}Te{sub 6}, quenching the NaCl-type high-temperature phase (stable above ?510 °C) easily yields a pseudocubic modification that is metastable at ambient conditions. Temperature-dependent powder diffraction reveals a broader stability range of the cubic high-temperature modification of Ge{sub 3}SbInTe{sub 6} compared to the ternary phases. In-containing samples partially decompose at ca. 300 °C but become homogeneous again when the high-temperature phase is formed. - Graphical abstract: Crystal structure of 33R-Ge{sub 3}SbInTe{sub 6} as determined by resonant X-ray diffraction, one example of the (GeTe){sub n}SbInTe{sub 3} series of compounds investigated. - Highlights: • The new compounds 21R-GeSbInTe{sub 4}, 9P-Ge{sub 2}SbInTe{sub 5} and 33R-Ge{sub 3}SbInTe are described. • The element distribution in 33R-Ge{sub 3}SbInTe{sub 6} was determined by resonant scattering. • The cation concentration in the crystal structure is strongly modulated. • The Sb substitution by In has a significant impact on phase transitions. • Results may be relevant for thermoelectrics and thin-film phase-change materials.

  1. Electric transport properties of the pentatelluride materials HfTe{sub 5} and ZrTe{sub 5}

    SciTech Connect (OSTI)

    Tritt, T.M.; Wilson, M.L.; Littleton, R.L. [and others

    1997-07-01T23:59:59.000Z

    The authors have measured the resistivity and thermopower of single crystals as well as polycrystalline pressed powders of the low-dimensional pentatelluride materials: HfTe{sub 5} and ZrTe{sub 5}. They have performed these measurements as a function of temperature between 5K and 320K. In the single crystals there is a peak in the resistivity for both materials at a peak temperature, T{sub p} where T{sub p} {approx} 80K for HfTe{sub 5} and T{sub p} {approx} 145K for ZrTe{sub 5}. Both materials exhibit a large p-type thermopower around room temperature which undergoes a change to n-type below the peak. These data are similar to behavior observed previously in these materials. They have also synthesized pressed powders of polycrystalline pentatelluride materials, HfTe{sub 5} and ZrTe{sub 5}. They have measured the resistivity and thermopower of these polycrystalline materials as a function of temperature between 5K and 320K. For the polycrystalline material, the room temperature thermopower for each of these materials is relatively high, +95 {micro}V/K and +65 {micro}V/K for HfTe{sub 5} and ZrTe{sub 5}, respectively. These values compare closely to thermopower values for single crystals of these materials. At 77 K, the thermopower is +55 {micro}V/K for HfTe{sub 5} and +35 {micro}V/K for ZrTe{sub 5}. In fact, the thermopower for the polycrystals decreases monotonically with temperature to T {approx} 5K, thus exhibiting p-type behavior over the entire range of temperature. As expected, the resistivity for the polycrystals is higher than the single crystal material, with values of 430 m{Omega}-cm and 24 m{Omega}-cm for HfTe{sub 5} and ZrTe{sub 5} respectively, compared to single crystal values of 0.35 m{Omega}-cm (HfTe{sub 5}) and 1.0 m{Omega}-cm (ZrTe{sub 5}). The authors have found that the peak in the resistivity evident in both single crystal materials is absent in these polycrystalline materials. They will discuss these materials in relation to their potential as candidates for thermoelectric applications.

  2. Use of separate ZnTe interface layers to form ohmic contacts to p-CdTe films

    DOE Patents [OSTI]

    Gessert, T.A.

    1999-06-01T23:59:59.000Z

    A method of is disclosed improving electrical contact to a thin film of a p-type tellurium-containing II-VI semiconductor comprising: depositing a first undoped layer of ZnTe on a thin film of p-type tellurium containing II-VI semiconductor with material properties selected to limit the formation of potential barriers at the interface between the p-CdTe and the undoped layer, to a thickness sufficient to control diffusion of the metallic-doped ZnTe into the p-type tellurium-containing II-VI semiconductor, but thin enough to minimize affects of series resistance; depositing a second heavy doped p-type ZnTe layer to the first layer using an appropriate dopant; and depositing an appropriate metal onto the outer-most surface of the doped ZnTe layer for connecting an external electrical conductor to an ohmic contact. 11 figs.

  3. Boosted Higgses from chromomagnetic $b$'s: $b\\bar{b}h$ at high luminosity

    E-Print Network [OSTI]

    Joseph Bramante; Antonio Delgado; Landon Lehman; Adam Martin

    2014-10-13T23:59:59.000Z

    This paper examines detection prospects and constraints on the chromomagnetic dipole operator for the bottom quark. This operator has a flavor, chirality and Lorentz structure that is distinct from other dimension six operators considered in Higgs coupling studies. Its non-standard Lorentz structure bolsters boosted $b \\bar{b} h$ events, providing a rate independent signal of new physics. To date, we find this operator is unconstrained by $p p \\rightarrow h + {\\rm jets}$ and $pp \\rightarrow \\bar b b $ searches: for order-one couplings the permitted cutoff $\\Lambda$ for this operator can be as low as $\\Lambda \\sim 1~{\\rm TeV}$. We show how to improve this bound with collider cuts that allow a $b$-tagged Higgs plus dijet search in the Higgs to diphoton decay channel to exclude cutoffs as high as $\\sim 6~{\\rm TeV}$ at $2 \\sigma$ with 3 $\\text{ab}^{-1}$ of luminosity at the 14 TeV LHC. Cuts on the $p_T$ of the Higgs are key to this search, because the chromomagnetic dipole yields a non-standard fraction of boosted Higgses.

  4. Phylogenetics and Taxonomy of the Fungal Vascular Wilt Pathogen Verticillium, with the Descriptions of Five New Species

    E-Print Network [OSTI]

    Subbarao, Krishna V

    2011-01-01T23:59:59.000Z

    alfalfae Inderb. , H. W. Platt, R. M. Bostock, R. M. Davis &RM, Davis RM, Usami T, Platt HW, et al. (2011) Phylogeneticsnonalfalfae Inderb. , H. W. Platt, R. M. Bostock, R. M.

  5. Use of green fluorescent protein for the analysis of protein-protein and protein-DNA interactions 

    E-Print Network [OSTI]

    Chen, Kai

    2011-01-01T23:59:59.000Z

    Restriction modification (RM) systems play a crucial role in preventing the entry of foreign DNA into the bacterial cell. The best studied Type I RM system is EcoKI from Escherichia coli K12. Both bacteriophage and ...

  6. Boundary lubrication of articular cartilage : contribution of hyaluronan in health and injury

    E-Print Network [OSTI]

    Antonacci, Jennifer M.

    2011-01-01T23:59:59.000Z

    J Vet Res 43:1096-9, 1982. Saari H, Konttinen YT, Tulamo RM,J Vet Res 43:1096-9, 1982. Saari H, Konttinen YT, Tulamo RM,

  7. Intercomparison of 14C Analysis of Carbonaceous Aerosols: Exercise 2009

    E-Print Network [OSTI]

    2013-01-01T23:59:59.000Z

    Laboratory D applied water extraction before the thermalAll Milan/Ispra Milan/Ispra Acid fumigation Water extractionWater extraction E F F G RM 8785 RM 8785 Milan/Ispra All

  8. Investigating genetic determinants of phenotypic variation in natural isolates of Saccharomyces cerevisiae

    E-Print Network [OSTI]

    Lee, Hana

    2012-01-01T23:59:59.000Z

    UWOPS05.227.2; WE1, RM11-1; WE2, BC187); each row shows dataUWOPS05.217.3; WE1, RM11-1; WE2, BC187), and each row shows

  9. Revisiting Modes of energy generation in sulfate reducing bacteria

    E-Print Network [OSTI]

    Joachimiak, Marcin

    2010-01-01T23:59:59.000Z

    ro ge Py Py r rm H Energy Production and Conversion: NumberGenes Up- regulated Energy Production and Conversion: NumberFo rm Py Fo yd ro Energy Production and ate uv La ate La

  10. An Efficient Augmented Lagrangian Method with Applications to ...

    E-Print Network [OSTI]

    2012-08-13T23:59:59.000Z

    Aug 13, 2012 ... x at pixel i, A ? Rm×n (mRm is the ..... [2] S. Becker, J. Bobin and E. Cand`es, NESTA: A fast and accurate ...

  11. Foran Hall Directory PLANT BIOLOGY & PATHOLOGY

    E-Print Network [OSTI]

    Neimark, Alexander V.

    Miller, Stephen 26290 273 Minnis, Andrew (301) 504-5364 Molnar, Tom 26330 164 Morath, Shannon 26375. Office: Ext. Rm. Lab: Ext. Rm. 12/5/2011 Maliga, Pal 5-5329 Waksman Manning, Tom (908) 310-0244 Mansue

  12. Process Development for High Voc CdTe Solar Cells

    SciTech Connect (OSTI)

    Ferekides, C. S.; Morel, D. L.

    2011-05-01T23:59:59.000Z

    This is a cumulative and final report for Phases I, II and III of this NREL funded project (subcontract # XXL-5-44205-10). The main research activities of this project focused on the open-circuit voltage of the CdTe thin film solar cells. Although, thin film CdTe continues to be one of the leading materials for large-scale cost-effective production of photovoltaics, the efficiency of the CdTe solar cells have been stagnant for the last few years. This report describes and summarizes the results for this 3-year research project.

  13. Constraints on the primordial gravitational waves with variable sound speed from current CMB data

    E-Print Network [OSTI]

    Cheng Cheng; Qing-Guo Huang; Xiao-Dong Li; Yin-Zhe Ma

    2012-10-26T23:59:59.000Z

    We make a comprehensive investigation of the observational effect of the inflation consistency relation. We focus on the general single-field inflation model with the consistency relation $r=-8c_s n_t$, and investigate the observational constraints of sound speed $c_s$ by using the Seven-Year WMAP data, the BICEP tensor power spectrum data, and the constraints on $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$ from the Five-Year WMAP observations. We find that the constraints on the tensor-to-scalar ratio $r$ is much tighter if $c_s$ is small, since a large tilt $n_t$ is strongly constrained by the observations. We obtain $rsound speed $c_s$, it is not well constrained if only the CMB power spectrum data is used, while the constraints are obtainable by taking $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$ priors into account. With the constraining data of $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$, we find that, $c_s\\lesssim 0.01$ region is excluded at 99.7% CL, and the $c_s=1$ case (the single-field slow-roll inflation) is slightly disfavored at 68.3% CL. In addition, the inclusion of $f_{\\rm NL}^{\\rm equil.}$ and $f_{\\rm NL}^{\\rm orth.}$ into the analysis can improve the constraints on $r$ and $n_s$. We further discuss the implications of our constraints on the test of inflation models.

  14. Rulemaking, Public Hearing in Oak Ridge, TN (2/3/1999)

    Broader source: Energy.gov [DOE]

    Chronic Beryllium Diease Prevention Program Notice of Proposed Rulemaking (NOPR) Docket Number EH-RM-98-BRYLM

  15. AHDELUETTELO L AHDELUETTELO

    E-Print Network [OSTI]

    Kurimo, Mikko

    . [Linde et al. 1980] Y. Linde, A. Buzo, R.M. Gray. An algorithm for vector quan­ tizer design. IEEE

  16. Exploring the Texture of Ocean-Atmosphere Redox Evolution on the Early Earth

    E-Print Network [OSTI]

    Reinhard, Christopher Thomas

    2012-01-01T23:59:59.000Z

    1989) Geochemistry and sedimentology of a facies transitionML, Bustin RM (1998) Sedimentology and sequence stratigraphy

  17. In-well pumped mid-infrared PbTe/CdTe quantum well vertical external cavity surface emitting lasers

    SciTech Connect (OSTI)

    Khiar, A., E-mail: amir.khiar@jku.at; Witzan, M.; Hochreiner, A.; Eibelhuber, M.; Springholz, G. [Institute of Semiconductor and Solid State Physics, Johannes Kepler University, Altenbergerstr. 69, A-4040 Linz (Austria); Volobuev, V. [Institute of Semiconductor and Solid State Physics, Johannes Kepler University, Altenbergerstr. 69, A-4040 Linz (Austria); National Technical University “Kharkiv Polytechnic Institute,” Frunze str. 21, 61002 Kharkiv (Ukraine)

    2014-06-09T23:59:59.000Z

    Optical in-well pumped mid-infrared vertical external cavity surface emitting lasers based on PbTe quantum wells embedded in CdTe barriers are realized. In contrast to the usual ternary barrier materials of lead salt lasers such as PbEuTe of PbSrTe, the combination of narrow-gap PbTe with wide-gap CdTe offers an extremely large carrier confinement, preventing charge carrier leakage from the quantum wells. In addition, optical in-well pumping can be achieved with cost effective and readily available near infrared lasers. Free carrier absorption, which is a strong loss mechanism in the mid-infrared, is strongly reduced due to the insulating property of CdTe. Lasing is observed from 85?K to 300?K covering a wavelength range of 3.3–4.2??m. The best laser performance is achieved for quantum well thicknesses of 20?nm. At low temperature, the threshold power is around 100 mW{sub P} and the output power more than 700 mW{sub P}. The significance of various charge carrier loss mechanisms are analyzed by modeling the device performance. Although Auger losses are quite low in IV–VI semiconductors, an Auger coefficient of C{sub A}?=?3.5?×?10{sup ?27} cm{sup 6} s{sup ?1} was estimated for the laser structure, which is attributed to the large conduction band offset.

  18. TeV Blazars and Cosmic Infrared Background Radiation

    E-Print Network [OSTI]

    F. A. Aharonian

    2001-12-13T23:59:59.000Z

    The recent developments in studies of TeV radiation from blazars are highlighted and the implications of these results for derivation of cosmologically important information about the cosmic infrared background radiation are discussed.

  19. Summary of the TeV33 working group

    SciTech Connect (OSTI)

    Bagley, P.P.; Bieniosek, F.M.; Colestock, P. [and others

    1996-10-01T23:59:59.000Z

    This summary of the TeV33 working group at Snowmass reports on work in the areas of Tevatron store parameters, the beam-beam interaction, Main Injector intensity (slip stacking), antiproton production, and electron cooling.

  20. TheerbInsTITuTeSectionname The Erb Institute

    E-Print Network [OSTI]

    Edwards, Paul N.

    [ ]Year in Review 2012 #12;ii TheerbInsTITuTeSectionname Social Enterprise 4 Local Impact 7 Energy 10ItutE YEar In rEvIEw 2012 Director Andrew J. Hoffman Managing Director Rick Bunch Editorial, Creative

  1. Extreme solid state refrigeration using nanostructured Bi-Te alloys.

    SciTech Connect (OSTI)

    Lima Sharma, Ana L. (San Jose State University, San Jose, CA); Spataru, Dan Catalin; Medlin, Douglas L.; Sharma, Peter Anand; Morales, Alfredo Martin

    2009-09-01T23:59:59.000Z

    Materials are desperately needed for cryogenic solid state refrigeration. We have investigated nanostructured Bi-Te alloys for their potential use in Ettingshausen refrigeration to liquid nitrogen temperatures. These alloys form alternating layers of Bi{sub 2} and Bi{sub 2}Te{sub 3} blocks in equilibrium. The composition Bi{sub 4}Te{sub 3} was identified as having the greatest potential for having a high Ettingshausen figure of merit. Both single crystal and polycrystalline forms of this material were synthesized. After evaluating the Ettingshausen figure of merit for a large, high quality polycrystal, we simulated the limits of practical refrigeration in this material from 200 to 77 K using a simple device model. The band structure was also computed and compared to experiments. We discuss the crystal growth, transport physics, and practical refrigeration potential of Bi-Te alloys.

  2. Academic Resources UNIVERSITY CLASSROOM INVENTORY

    E-Print Network [OSTI]

    Academic Resources UNIVERSITY CLASSROOM INVENTORY Capacity Order Spring 2014 BLDG RM CAP. ENH. AV UNIVERSITY CLASSROOM INVENTORY Capacity Order Spring 2014 BLDG RM CAP. ENH. AV(01)* TAB ARM(02) GEOG MAP(03/28/2014 #12;Academic Resources UNIVERSITY CLASSROOM INVENTORY Capacity Order Spring 2014 BLDG RM CAP. ENH. AV

  3. ISV FACT SHEET SINGLE ENSUITE: 198 sq.ft.

    E-Print Network [OSTI]

    Southampton, University of

    ISV FACT SHEET SINGLE ENSUITE: 198 sq.ft. STANDARD ROOM: (NO AIRCOND, NO WATER HEATER, FREE WIFI): RM 590 PER MONTH PER BED PREMIER ROOM: : (AIRCOND WITH WATER HEATER, FREE WIFI) : RM740 PER MONTH PER BED TWIN SHARING: 283 sq.ft. STANDARD ROOM: (NO AIRCOND, NO WATER HEATER, FREE WIFI): RM 490 PER MONTH

  4. Quantum Searches in a Hard 2SAT Ensemble

    E-Print Network [OSTI]

    Neuhaus Thomas

    2014-12-17T23:59:59.000Z

    Using a recently constructed ensemble of hard 2SAT realizations, that has a unique ground-state we calculate for the quantized theory the median gap correlation length values $\\xi_{GAP}$ along the direction of the quantum adiabatic control parameter $\\lambda$. We use quantum annealing (QA) with transverse field and a linear time schedule in the adiabatic control parameter $\\lambda$. The gap correlation length diverges exponentially $\\xi_{\\rm GAP} \\propto {\\rm exp} [+r_{\\rm GAP}N]$ in the median with a rate constant $r_{\\rm GAP}=0.553(6)$, while the run time diverges exponentially $\\tau_{\\rm QA} \\propto {\\rm exp} [+r_{\\rm QA}N]$ with $r_{\\rm QA}=1.184(16)$. Simulated classical annealing (SA) exhibits a run time rate constant $r_{\\rm SA}=0.340(5)$ that is small and thus finds ground-states exponentially faster than QA. There are no quantum speedups in ground state searches on constant energy surfaces that have exponentially large volume. We also determine gap correlation length distribution functions $P(\\xi_{\\rm GAP})d\\xi_{\\rm GAP} \\approx W_k$ over the ensemble that at $N=18$ are close to Weibull functions $W_k$ with $k \\approx 1.2$ i.e., the problems show thin catastrophic tails in $\\xi_{\\rm GAP}$. The inferred success probability distribution functions of the quantum annealer turn out to be bimodal.

  5. Confirmation of the $\\eps$ -- $\\eiso$ (Amati) relation from the X-ray flash XRF 050416A observed by Swift/BAT

    E-Print Network [OSTI]

    Sakamoto, T; Barthelmy, S D; Cummings, J R; Fenimore, E E; Gehrels, N; Hullinger, D; Krimm, H A; Markwardt, C B; Palmer, D M; Parsons, A M; Sato, G; Tüller, J

    2006-01-01T23:59:59.000Z

    We report Swift Burst Alert Telescope (BAT) observations of the X-ray Flash (XRF) XRF 050416A. The fluence ratio between the 15-25 keV and 25-50 keV energy bands of this event is 1.5, thus making it the softest gamma-ray burst (GRB) observed by BAT so far. The spectrum is well fitted by the Band function with E^{\\rm obs}_{\\rm peak} of 15.0_{-2.7}^{+2.3} keV. Assuming the redshift of the host galaxy (z = 0.6535), the isotropic-equivalent radiated energy E_{\\rm iso} and the peak energy at the GRB rest frame (E^{\\rm src}_{\\rm peak}) of XRF 050416A are not only consistent with the correlation found by Amati et al. and extended to XRFs by Sakamoto et al., but also fill-in the gap of this relation around the 30 - 80 keV range of E^{\\rm src}_{\\rm peak}. This result tightens the validity of the E^{\\rm src}_{\\rm peak} - E_{\\rm iso} relation from XRFs to GRBs. We also find that the jet break time estimated using the empirical relation between E^{\\rm src}_{\\rm peak} and the collimation corrected energy E_{\\gamma} is inc...

  6. NEW CLASSIFICATION METHODS FOR GATHERING PATTERNS IN THE CONTEXT OF GENETIC

    E-Print Network [OSTI]

    Fernandez, Thomas

    approaches: Repository Method (RM), Evolv- ing Decision Rules (EDR) and Scenario Method (SM). We use Genetic of RM and EDR are: to predict the minority class in imbalanced environ- ments, to generate a range for achieving our goals. RM and EDR were compared to a standard Genetic Programming, EDDIE-Arb and C5

  7. Energy Quantization for Willmore Surfaces and Applications

    E-Print Network [OSTI]

    Rivière, Tristan

    := gRm the pull back by of the flat canonical metric gRm of Rm , also called the first fundamental form of , and we let dvolg be its associated volume form. The Gauss map of the immersion is the map ) is independent of this extension. 1 #12;The energy E may accordingly be seen as the Dirichlet Energy of the Gauss

  8. Strategies for recycling CdTe photovoltaic modules

    SciTech Connect (OSTI)

    Eberspacher, C.; Gay, C.F. [UNISUN, Newbury Park, CA. (United States); Moskowitz, P.D. [Brookhaven National Lab., Upton, NY (United States)

    1994-12-31T23:59:59.000Z

    Recycling end-of-life cadmium telluride (CdTe) photovoltaic (PV) modules may enhance the competitive advantage of CdTe PV in the marketplace, but the experiences of industries with comparable Environmental, Health and Safety (EH&S) challenges suggest that collection and recycling costs can impose significant economic burdens. Customer cooperation and pending changes to US Federal law may improve recycling economics.

  9. Phonon self-energy and origin of anomalous neutron scattering spectra in SnTe and PbTe thermoelectrics

    SciTech Connect (OSTI)

    Li, Chen [ORNL] [ORNL; Ma, Jie [ORNL] [ORNL; May, Andrew F [ORNL] [ORNL; Cao, Huibo [ORNL] [ORNL; Christianson, Andrew D [ORNL] [ORNL; Ehlers, Georg [ORNL] [ORNL; Singh, David J [ORNL] [ORNL; Sales, Brian C [ORNL] [ORNL; Delaire, Olivier A [ORNL] [ORNL

    2014-01-01T23:59:59.000Z

    The anharmonic lattice dynamics of rock-salt thermoelectric compounds SnTe and PbTe are investigated with inelastic neutron scattering (INS) and first-principles calculations. The experiments show that, surprisingly, although SnTe is closer to the ferroelectric instability, phonon spectra in PbTe exhibit a more anharmonic character. This behavior is reproduced in first-principles calculations of the temperature-dependent phonon self-energy. Our simulations reveal how the nesting of phonon dispersions induces prominent features in the self-energy, which account for the measured INS spectra and their temperature dependence. We establish that the phase-space for three-phonon scattering processes, rather than just the proximity to the lattice instability, is the mechanism determining the complex spectrum of the transverse-optical ferroelectric mode.

  10. Coulomb interaction of acceptors in Cd{sub 1?x}Mn{sub x}Te/CdTe quantum dot

    SciTech Connect (OSTI)

    Kalpana, P.; Nithiananthi, P., E-mail: kjkumar-gri@rediffmail.com; Jayakumar, K., E-mail: kjkumar-gri@rediffmail.com [Department of Physics, Gandhigram Rural University, Gandhigram-624302, TamilNadu (India); Reuben, A. Merwyn Jasper D. [Department of Physics, School of Engineering, Saveetha University, Thandalam, Chennai- 600104, TamilNadu (India)

    2014-04-24T23:59:59.000Z

    The investigation on the effect of confining potential like isotropic harmonic oscillator type potential on the binding and the Coulomb interaction energy of the double acceptors in the presence of magnetic field in a Cd{sub 1?x}Mn{sub x}Te/CdTe Spherical Quantum Dot has been made for the Mn ion composition x=0.3 and compared with the results obtained from the square well type potential using variational procedure in the effective mass approximation.

  11. Micro-Raman spectroscopy of mechanically exfoliated few-quintuple layers of Bi2Te3, Bi2Se3, and Sb2Te3 materials

    E-Print Network [OSTI]

    Micro-Raman spectroscopy of mechanically exfoliated few-quintuple layers of Bi2Te3, Bi2Se3, and Sb2-like" exfoliated few-quintuple layers of Bi2Te3, Bi2Se3, and Sb2Te3. It is found that crystal symmetry breaking

  12. Metallurgy, thermal stability, and failure mode of the commercial Bi-Te-based thermoelectric modules.

    SciTech Connect (OSTI)

    Yang, Nancy Y. C.; Morales, Alfredo Martin

    2009-02-01T23:59:59.000Z

    Bi-Te-based thermoelectric (TE) alloys are excellent candidates for power generation modules. We are interested in reliable TE modules for long-term use at or below 200 C. It is known that the metallurgical characteristics of TE materials and of interconnect components affect the performance of TE modules. Thus, we have conducted an extensive scientific investigation of several commercial TE modules to determine whether they meet our technical requirements. Our main focus is on the metallurgy and thermal stability of (Bi,Sb){sup 2}(Te,Se){sup 3} TE compounds and of other materials used in TE modules in the temperature range between 25 C and 200 C. Our study confirms the material suite used in the construction of TE modules. The module consists of three major components: AlN cover plates; electrical interconnects; and the TE legs, P-doped (Bi{sub 8}Sb{sub 32})(Te{sub 60}) and N-doped (Bi{sub 37}Sb{sub 3})(Te{sub 56}Se{sub 4}). The interconnect assembly contains Sn (Sb {approx} 1wt%) solder, sandwiched between Cu conductor with Ni diffusion barriers on the outside. Potential failure modes of the TE modules in this temperature range were discovered and analyzed. The results show that the metallurgical characteristics of the alloys used in the P and N legs are stable up to 200 C. However, whole TE modules are thermally unstable at temperatures above 160 C, lower than the nominal melting point of the solder suggested by the manufacture. Two failure modes were observed when they were heated above 160 C: solder melting and flowing out of the interconnect assembly; and solder reacting with the TE leg, causing dimensional swelling of the TE legs. The reaction of the solder with the TE leg occurs as the lack of a nickel diffusion barrier on the side of the TE leg where the displaced solder and/or the preexisting solder beads is directly contact the TE material. This study concludes that the present TE modules are not suitable for long-term use at temperatures above 160 C due to the reactivity between the Sn-solder and the (Bi,Sb){sup 2}(Te,Se){sup 3} TE alloys. In order to deploy a reliable TE power generator for use at or below 200 C, alternate interconnect materials must be used and/or a modified module fabrication technique must be developed.

  13. Milagro Observations of Potential TeV Emitters

    E-Print Network [OSTI]

    Abdo, A A; Allen, B T; Aune, T; Barber, A S; Berley, D; Braun, J; Chen, C; Christopher, G E; DeYoung, T; Dingus, B L; Ellsworth, R W; Gonzalez, M M; Goodman, J A; Hays, E; Hoffman, C M; Huntemeyer, P H; Imran, A; Kolterman, B E; Linnemann, J T; McEnery, J E; Morgan, T; Mincer, A I; Nemethy, P; Pretz, J; Ryan, J M; Parkinson, P M Saz; Schneider, M; Shoup, A; Sinnis, G; Smith, A J; Vasileiou, V; Walker, G P; Williams, D A; Yodh, G B

    2014-01-01T23:59:59.000Z

    This paper reports the results from three targeted searches of Milagro TeV sky maps: two extragalactic point source lists and one pulsar source list. The first extragalactic candidate list consists of 709 candidates selected from the Fermi-LAT 2FGL catalog. The second extragalactic candidate list contains 31 candidates selected from the TeVCat source catalog that have been detected by imaging atmospheric Cherenkov telescopes (IACTs). In both extragalactic candidate lists Mkn 421 was the only source detected by Milagro. This paper presents the Milagro TeV flux for Mkn 421 and flux limits for the brighter Fermi-LAT extragalactic sources and for all TeVCat candidates. The pulsar list extends a previously published Milagro targeted search for Galactic sources. With the 32 new gamma-ray pulsars identified in 2FGL, the number of pulsars that are studied by both Fermi-LAT and Milagro is increased to 52. In this sample, we find that the probability of Milagro detecting a TeV emission coincident with a pulsar increase...

  14. Large Extra Dimension effects through Light-by-Light Scattering at the CERN LHC

    E-Print Network [OSTI]

    Hao Sun

    2014-07-31T23:59:59.000Z

    Observing light-by-light scattering at the Large Hadron Collider (LHC) has received quite some attention and it is believed to be a clean and sensitive channel to possible new physics. In this paper, we study the diphoton production at the LHC via the process $\\rm pp\\rightarrow p\\gamma\\gamma p\\rightarrow p\\gamma\\gamma p$ through graviton exchange in the Large Extra Dimension (LED) model. Typically, when we do the background analysis, we also study the Double Pomeron Exchange (DPE) of $\\gamma\\gamma$ production. We compare its production in the quark-quark collision mode to the gluon-gluon collision mode and find that contributions from the gluon-gluon collision mode are comparable to the quark-quark one. Our result shows, for extra dimension $\\delta=4$, with an integrated luminosity $\\rm {\\cal L} = 200 fb^{-1}$ at the 14 TeV LHC, that diphoton production through graviton exchange can probe the LED effects up to the scale $\\rm M_S=5.06 (4.51, 5.11) TeV$ for the forward detector acceptance $\\xi_1 (\\xi_2, \\xi_3)$, respectively, where $0.00150.5$, $0.10.5$ and $0.0015<\\xi_3<0.15$.

  15. A 3 TeV Muon Collider Lattice Design

    SciTech Connect (OSTI)

    Alexahin, Y.; Gianfelice-Wendt, E.; /Fermilab

    2012-05-01T23:59:59.000Z

    A new lattice for 3 TeV c.o.m. energy with {beta}* = 5mm was developed which follows the basic concept of the earlier 1.5 TeV design but uses quad triplets for the final focus in order to keep the maximum magnet strength and aperture close to those in 1.5 TeV case. Another difference is employment of combined-function magnets with the goal to lower heat deposition in magnet cold mass and to eliminate bending field free regions which produce 'hot spots' of neutrino radiation that can be an issue at higher energy. The proposed lattice is shown to satisfy the requirements on luminosity, dynamic aperture and momentum acceptance.

  16. Isovector EMC effect explains the NuTeV anomaly

    E-Print Network [OSTI]

    I. C. Cloët; W. Bentz; A. W. Thomas

    2009-01-22T23:59:59.000Z

    A neutron or proton excess in nuclei leads to an isovector-vector mean-field which, through its coupling to the quarks in a bound nucleon, implies a shift in the quark distributions with respect to the Bjorken scaling variable. We show that this result leads to an additional correction to the NuTeV measurement of sin^2(Theta_W). The sign of this correction is largely model independent and acts to reduce their result. Explicit calculation within a covariant and confining Nambu--Jona-Lasinio model predicts that this vector field correction accounts for approximately two-thirds of the NuTeV anomaly. We are therefore led to offer a new interpretation of the NuTeV measurement, namely, that it is further evidence for the medium modification of the bound nucleon wavefunction.

  17. Isovector EMC Effect and the NuTeV Anomaly

    SciTech Connect (OSTI)

    Cloeet, I. C. [Department of Physics, University of Washington, Seattle, Washington 98195-1560 (United States); Bentz, W. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan); Thomas, A. W. [Jefferson Lab, 12000 Jefferson Avenue, Newport News, Virginia 23606, USA and College of William and Mary, Williamsburg, Virginia 23187 (United States)

    2009-06-26T23:59:59.000Z

    A neutron or proton excess in nuclei leads to an isovector-vector mean field which, through its coupling to the quarks in a bound nucleon, implies a shift in the quark distributions with respect to the Bjorken scaling variable. We show that this result leads to an additional correction to the NuTeV measurement of sin{sup 2}theta{sub W}. The sign of this correction is largely model independent and acts to reduce their result. Explicit calculation in nuclear matter within a covariant and confining Nambu-Jona-Lasinio model predicts that this vector field correction may account for a substantial fraction of the NuTeV anomaly. We are therefore led to offer a new interpretation of the NuTeV measurement, namely, that it provides further evidence for the medium modification of the bound nucleon wave function.

  18. arond te dual-axis: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    than the resolution achieved or foreseen in experimental searches for neutrinoless double-beta decay. The 128Te and 120Te Q values were found to be 865.87(131) keV and...

  19. Thin Metal Oxide Films to Modify a Window Layer in CdTe-Based...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Thin Metal Oxide Films to Modify a Window Layer in CdTe-Based Solar Cells for Improved Performance. Thin Metal Oxide Films to Modify a Window Layer in CdTe-Based Solar Cells for...

  20. Is the Universe transparent to TeV photons?

    E-Print Network [OSTI]

    W. Kluzniak

    1999-05-26T23:59:59.000Z

    If Lorentz invariance is broken at an energy scale Eq, as has recently been suggested in the context of attempts to quantize gravity, the kinematics of photon-photon collisions would be profoundly affected at lower energies. Specifically, electron-positron pair creation on soft photons may be forbidden at photon energies as low as 30 TeV times square root of (Eq/10**17 GeV) and the Universe would then be transparent to high energy photons. The proposition that Lorentz invariance is broken may be falsified by the techniques of TeV astronomy.

  1. High contrast, CdTe portal scanner for radiation therapy

    SciTech Connect (OSTI)

    Entine, G.; Squillante, M.R.; Hahn, R.; Cirignano, L.J.; McGann, W. (Radiation Monitoring Devices, Inc., Watertown, MA (United States)); Biggs, P.J. (Massachusetts General Hospital, Boston, MA (United States))

    1992-10-01T23:59:59.000Z

    This paper reports on one of the most promising new technologies for improving the qualify of radiation therapy, the use of real-time systems to produce portal images. In the authors' approach, they are constructing a linear array of 256 CdTe photovoltaic detectors attached to a very compact linear scanner, all of which will be mounted in a cassette shaped package to be located under the patient table. The high stopping power of the CdTe allows a high contrast image to be made using only a single Linac pulse per line, resulting in a high contrast image in under 5 seconds.

  2. Optically induced magnetic polarons in EuTe

    SciTech Connect (OSTI)

    Henriques, A. B.; Galgano, G. D. [Instituto de Física, Universidade de São Paulo, Caixa Postal 66318, 05315-970, São Paulo (Brazil); Abramof, E.; Rappl, P. H. O. [LAS - INPE, Av. Dos Astronautas, 1758, 12227-010, São José dos Campos (Brazil)

    2013-12-04T23:59:59.000Z

    Direct measurements of the photoinduced magnetization in EuTe, using a two color pump-and-probe technique, are presented. The photoinduced effect was pumped using photons of above-the-bandgap energy, and detected by the Faraday rotation of a probe beam of energy below-the-bandgap. The photoinduced Faraday rotation changes sign, as expected from our model for the optically induced magnetic polaron. The EuTe spin-flop transition at low fields is also detected as a sharp step in the photoinduced Faraday rotation, and its observation provides additional supports for the photoinduced polaron model.

  3. Reversed argininosuccinate lyase activity in fumarate hydratase-deficient cancer cells

    E-Print Network [OSTI]

    Zheng, Liang; MacKenzie, Elaine D; Karim, Saadia A; Hedley, Ann; Blyth, Karen; Kalna, Gabriela; Watson, David G; Szlosarek, Peter; Frezza, Christian; Gottlieb, Eyal

    2013-03-21T23:59:59.000Z

    edley1, Karen Blyth1, Gabriela Kalna1, David G Watson2, he mitochondrial tumor suppressor and tricarboxylic ant form of papillary and collecting duct renal cell n linked to the tumorigenic process. However, little is r metabolism. lyses of urine from Fh1... PCA Mapping (25.6%) Fh1fl/fl AhCreFh1fl/fl AhCreFh1+/fl AhCreFh1+/+ Ah Cre Fh 1fl /fl Ah Cre Fh 1+ /+ Ah Cre Fh 1fl /fl Ah Cre Fh 1+ /+ a rg in in os uc cin at e (no rm ali se d t o A hC re Fh 1+ /+ ) 1 234 1 23 4 4 fu m ar a te (no rm ali se d t o A...

  4. Indication of Te segregation in laser-irradiated ZnTe observed by in situ coherent-phonon spectroscopy

    SciTech Connect (OSTI)

    Shimada, Toru [Fritz Haber Institute of the Max Planck Society, Faradayweg 4-6, 14195 Berlin (Germany); Hirosaki University, 1 Bunkyo-cho, Hirosaki, Aomori 036-8152 (Japan); Kamaraju, N., E-mail: nkamaraju@lanl.gov [Fritz Haber Institute of the Max Planck Society, Faradayweg 4-6, 14195 Berlin (Germany); Los Alamos National Laboratory, Center for Integrated Nanotechnologies, Los Alamos, New Mexico 87545 (United States); Frischkorn, Christian [Department of Physics, Free University of Berlin, Arnimallee 14, 14195 Berlin (Germany); Wolf, Martin; Kampfrath, Tobias [Fritz Haber Institute of the Max Planck Society, Faradayweg 4-6, 14195 Berlin (Germany)

    2014-09-15T23:59:59.000Z

    We irradiate a ZnTe single crystal with 10-fs laser pulses at a repetition rate of 80?MHz and investigate its resulting gradual modification by means of coherent-phonon spectroscopy. We observe the emergence of a phonon mode at about 3.6?THz whose amplitude and lifetime grow monotonously with irradiation time. The speed of this process depends sensitively on the pump-pulse duration. Our observations strongly indicate that the emerging phonon mode arises from a Te phase induced by multiphoton absorption of incident laser pulses. A potential application of our findings is laser-machining of microstructures in the bulk of a ZnTe crystal, a highly relevant electrooptic material.

  5. Sub-TeV Gamma-Ray Astrophysics using Large Air Cerenkov Toru Tanimori3)

    E-Print Network [OSTI]

    Enomoto, Ryoji

    detection of persistent TeV gamma-ray emission from the Crab in 1989, several type of TeV gamma-ray sources the huge black holes at the center of galaxies. Recent detections of TeV gamma- ray emission from several+514, SN1006 Fig. 2. GeV gamma-ray source catalog detected by EGRET in galactic coordinates, where six Te

  6. SMT CO (2-1) Observations of Nearby Star-Forming Galaxies

    E-Print Network [OSTI]

    Jiang, Xue-Jian; Gu, Qiusheng; Wang, Junzhi; Zhang, Zhi-Yu

    2014-01-01T23:59:59.000Z

    We present CO $J$=2-1 observations towards 32 nearby gas-rich star-forming galaxies selected from the ALFALFA and WISE catalogs, using the Sub-millimeter Telescope. Our sample is selected to be dominated by intermediate-$M_{\\rm *}$ galaxies. The scaling-relations between molecular gas, atomic gas and galactic properties (stellar mass, NUV$- r$ and WISE color W3$-$W2) are examined and discussed. Our results show that (1). In the galaxies with stellar mass $M_{\\rm *}$ $\\leqslant 10^{10}$ $M_{\\odot}$, HI fraction ($f_{\\rm HI}$ $\\equiv$ $M_{\\rm HI}$/$M_{\\rm *}$) is significantly higher than that of more massive galaxies, while H$_2$ gas fraction ($f_{\\rm H_2}$ $\\equiv$ $M_{\\rm H_2}$/$M_{\\rm *}$) remain nearly unchanged. (2). Comparing with $f_{\\rm H_2}$, $f_{\\rm HI}$ correlates better with both $M_{\\rm *}$ and NUV$- r$. (3). A new parameter, WISE color W3$-$W2 (12\\,$\\mu$m$-$4.6\\,$\\mu$m) is introduced, which is similar to NUV$- r$ in tracing star formation activity, and we find that W3$-$W2 has a tighter anti-corr...

  7. Solar Energy Materials & Solar Cells 91 (2007) 13881391 Bifacial configurations for CdTe solar cells

    E-Print Network [OSTI]

    Romeo, Alessandro

    2007-01-01T23:59:59.000Z

    Solar Energy Materials & Solar Cells 91 (2007) 1388­1391 Bifacial configurations for CdTe solar We present a different back contact for CdTe solar cell by the application of only a transparent that acts as a free-Cu stable back contact and at the same time allows to realize bifacial CdTe solar cells

  8. Surveying the TeV Sky with Milagro C.P. Lansdell for the Milagro Collaboration

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    .9°, the Cygnus region of the galaxy becomes the most luminous source of TeV gamma rays in the Northern skySurveying the TeV Sky with Milagro C.P. Lansdell for the Milagro Collaboration University sky. In addition to detecting the known TeV sources of the Crab Nebula and Markarian 421, Milagro has

  9. Carbon Sequestration in Terrestrial Ecosystems (CSiTE) PRINCIPAL INVESTIGATOR: Stan D. Wullschleger

    E-Print Network [OSTI]

    Carbon Sequestration in Terrestrial Ecosystems (CSiTE) PRINCIPAL INVESTIGATOR: Stan D. Wullschleger://csite.eds.ornl.gov PROJECT DESCRIPTION The Carbon Sequestration in Terrestrial Ecosystems (CSiTE) project conducts research of switchgrass growing in the field. #12;Carbon Sequestration in Terrestrial Ecosystems (CSiTE) tion of inputs

  10. NREL study may provide future guidance in improving CdS/CdTe photovoltaic device performance.

    E-Print Network [OSTI]

    NREL study may provide future guidance in improving CdS/CdTe photovoltaic device performance. The majority of minority carrier lifetime (MCL) studies performed on CdS/CdTe photovoltaic (PV) devices have Carrier Lifetime Measurements in Superstrate and Substrate CdTe PV Devices." Proc. 37th IEEE Photovoltaic

  11. DISSERTATION ELECTRON-REFLECTOR STRATEGY FOR CdTe THIN-FILM SOLAR CELLS

    E-Print Network [OSTI]

    Sites, James R.

    DISSERTATION ELECTRON-REFLECTOR STRATEGY FOR CdTe THIN-FILM SOLAR CELLS Submitted by Kuo-Jui Hsiao ELECTRON- REFLECTOR STRATEGY FOR CdTe THIN-FILM SOLAR CELLS BE ACCEPTED AS FULFILLING IN PART REQUIREMENTS-FILM SOLAR CELLS The CdTe thin-film solar cell has a large absorption coefficient and high theoretical

  12. AL TE X 2" The macro package for TEX

    E-Print Network [OSTI]

    Mintmire, John W.

    such as xdvi, which actually uses the `.dvi' file. 2.A "transcript" or `.log' file that contains summary-201-13448-9, published jointly by the American Mathemat* *ical Society and Addison-Wesley Publishing Company-Wesley Publ* *ish- ing Company, 2nd edition, 1994. The LaTeX Companion, by Michel Goossens, Frank

  13. Simple shear processing of bulk BI?TE? alloys

    E-Print Network [OSTI]

    Im, Jae-taek

    2001-01-01T23:59:59.000Z

    The objective of this work is to determine the appropriate extrusion conditions of cast Bi?Te? alloys via equal channel angular extrusion (ECAE) to produce material that has a fine grain size (5~30[]m), uniform grain morphology and low grain...

  14. TeV Particle Astrophysics II: Summary comments

    E-Print Network [OSTI]

    Thomas K. Gaisser

    2006-12-11T23:59:59.000Z

    A unifying theme of this conference was the use of different approaches to understand astrophysical sources of energetic particles in the TeV range and above. In this summary I review how gamma-ray astronomy, neutrino astronomy and (to some extent) gravitational wave astronomy provide complementary avenues to understanding the origin and role of high-energy particles in energetic astrophysical sources.

  15. Reverse Monte Carlo simulation of Se{sub 80}Te{sub 20} and Se{sub 80}Te{sub 15}Sb{sub 5} glasses

    SciTech Connect (OSTI)

    Abdel-Baset, A. M.; Rashad, M. [Physics Department, Faculty of Science , Assiut University, Assiut, P.O. Box 71516 (Egypt); Moharram, A. H. [Faculty of Science, King Abdul Aziz Univ., Rabigh Branch, P.O. Box 433 (Saudi Arabia)

    2013-12-16T23:59:59.000Z

    Two-dimensional Monte Carlo of the total pair distribution functions g(r) is determined for Se{sub 80}Te{sub 20} and Se{sub 80}Te{sub 15}Sb{sub 5} alloys, and then it used to assemble the three-dimensional atomic configurations using the reverse Monte Carlo simulation. The partial pair distribution functions g{sub ij}(r) indicate that the basic structure unit in the Se{sub 80}Te{sub 15}Sb{sub 5} glass is di-antimony tri-selenide units connected together through Se-Se and Se-Te chain. The structure of Se{sub 80}Te{sub 20} alloys is a chain of Se-Te and Se-Se in addition to some rings of Se atoms.

  16. Measurement of the Single Top Quark Cross Section in the Lepton Plus Jets Final State in Proton-Antiproton Collisions at a Center of Mass Energy of 1.96 TeV Using the CDF II Detector

    SciTech Connect (OSTI)

    Wu, Zhenbin

    2012-01-01T23:59:59.000Z

    We present a measurement of the single top quark cross section in the lepton plus jets final state using an integrated luminosity corresponding to 7.5~\\text{fb}^{-1} of p\\bar p collision data collected by the Collider Detector at Fermilab. The single top candidate events are identified by the signature of a charged lepton, large missing transverse energy, and two or three jets with at least one of them identified as originating from a bottom quark. A new Monte Carlo generator \\textsc{powheg} is used to model the single top quark production processes, which include {s}-channel, {t}-channel, and {Wt}-channel. A neural network multivariate method is exploited to discriminate the single top quark signal from the comparatively large backgrounds. We measure a single top production cross section of $3.04^{+0.57}_{-0.53}$ (\\mathrm{stat.~+~syst.}) pb assuming $m_{\\rm top}=172.5$~GeV/$c^2$. In addition, we extract the CKM matrix element value $|V_{tb}|=0.96\\pm 0.09~(\\mathrm{stat.~+~syst.})\\pm 0.05~(\\mathrm{theory})$ and set a lower limit of |V_{tb}|>0.78 at the 95\\% credibility level.

  17. THE PERFORMANCE OF THIN FILM SOLAR CELLS EMPLOYING PHOTOVOLTAIC Cu22014x Te-CdTe HETEROJUNCTIONS (1)

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    195 THE PERFORMANCE OF THIN FILM SOLAR CELLS EMPLOYING PHOTOVOLTAIC Cu22014x Te the theore- tical optimum for conversion of solar energy by the intrinsic photovoltaic effect and lower degradation rates to penetrating radiation and 2) shorter minority carrier lifetimes are per

  18. HIGH SPATIAL-RESOLUTION IMAGING OF TE INCLUSIONS IN CZT MATERIAL.

    SciTech Connect (OSTI)

    CAMARDA, G.S.; BOLOTNIKOV, A.E.; CARINI, G.A.; CUI, Y.; KOHMAN, K.T.; LI, L.; JAMES, R.B.

    2006-08-13T23:59:59.000Z

    We present new results from our studies of defects in current single-crystal CdZnTe material. Our previous measurements, carried out on thin ({approx}1 mm) and long (>12 mm) CZT detectors, indicated that small (1-20 {micro}m) Te inclusions can significantly degrade the device's energy resolution and detection efficiency. We are conducting detailed studies of the effects of Te inclusions by employing different characterization techniques with better spatial resolution, such as quantitative fluorescence mapping, X-ray micro-diffraction, and TEM. Also, IR microscopy and gamma-mapping with pulse-shape analysis with higher spatial resolution generated more accurate results in the areas surrounding the micro-defects (Te inclusions). Our results reveal how the performance of CdZnTe detectors is influenced by Te inclusions, such as their spatial distribution, concentration, and size. We also discuss a model of charge transport through areas populated with Te inclusions.

  19. High Efficiency CdTe/CdS Thin Film Solar Cells Prepared by Treating CdTe Films with a Freon Gas in Substitution of CdCl2

    E-Print Network [OSTI]

    Romeo, Alessandro

    High Efficiency CdTe/CdS Thin Film Solar Cells Prepared by Treating CdTe Films with a Freon Gas process. A further simplification has been done by substituting the CdCl2 step by treating CdTe films to treat CdTe. In this case CdCl2 vapor is obtained by a source facing the CdTe film or conveyed from

  20. Inverse Compton e-p pair cascade model for the gamma-ray production in massive binary LSI +61^o 303

    E-Print Network [OSTI]

    W. Bednarek

    2006-07-13T23:59:59.000Z

    We apply an inverse Compton $e^\\pm$ pair cascade model for $\\gamma$-ray production in massive binary system LSI +61$^{\\rm o}$ 303 assuming that electrons are accelerated already inside the inner part of the jet launched by the compact object. $\\gamma$-ray spectra, affected by the cascade process, and lower energy spectra, from the synchrotron cooling of the highest energy electrons in the jet, are calculated as a function of the phase of this binary system. $\\gamma$-ray spectra expected in such model have different shape than that ones produced by electrons in the jet directly to observer. Moreover, the model predicts clear anti-correlation between $\\gamma$-ray fluxes in the GeV (1-10 GeV) and TeV ($>200$ GeV) energy ranges with the peak of the TeV emission at the phase $\\sim$0.5 (the peak half width ranges between the phases $\\sim$0.4-0.9 for the inclination of the binary system equal to $60^{\\rm o}$, and $\\sim$0.4-0.1 for $30^{\\rm o}$). The fine features of TeV $\\gamma$-ray emission (fluxes and spectral shapes) as a function of the phase of the binary system are consistent with recent observations reported by the MAGIC collaboration. Future simultaneous observations in the GeV energies (by the GLAST and AGILE telescopes) and in the TeV energies (by the MAGIC and VERITAS telescopes) should test other predictions of the considered model supporting or disproving the hypothersis of acceleration of electrons already in the inner part of the microquasar jets.

  1. High-efficiency large-area CdTe panels

    SciTech Connect (OSTI)

    Albright, S.P.; Chamberlin, R.R.; Jordan, J.F. (Photon Energy, Inc., El Paso, TX (USA))

    1990-11-01T23:59:59.000Z

    The objective of this three year effort has been to develop an improved materials technology and fabrication process for limited volume production of 1 ft{sup 2} and 4 ft{sup 2} CdS/CdTe photovoltaic modules. The module stability objective by the end of this three year subcontract was to develop techniques to provide ten year life exploration with no greater than 10% degradation. In order to achieve these efficiency and stability objectives, the research program has been separated into tasks including: (1) analysis and characterization of CdS/CdTe Devices; (2) performance optimization on small cells; (3) encapsulation and stability testing; and (4) module efficiency optimization. 27 refs., 18 figs., 3 tabs.

  2. Charge transport properties of CdMnTe radiation detectors

    SciTech Connect (OSTI)

    Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

    2012-04-11T23:59:59.000Z

    Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

  3. Evidence for TeV Emission from GRB 970417a

    E-Print Network [OSTI]

    Atkins, R; Berley, D; Chen, M L; Coyne, D G; Dingus, B L; Dorfan, D E; Ellsworth, R W; Evans, D; Falcone, A D; Fleysher, L; Fleysher, R; Gisler, G; Goodman, J A; Haines, T J; Hoffman, C M; Hugenberger, S; Kelley, L A; Leonor, I; McConnell, M; McCullough, J F; McEnery, J E; Miller, R S; Mincer, A I; Morales, M F; Némethy, P; Ryan, J M; Shen, B; Shoup, A L; Sinnis, C; Smith, A J; Sullivan, G W; Tümer, T O; Wang, K; Wascko, M O; Westerhoff, S; Williams, D A; Yang, T; Yodh, G B

    2000-01-01T23:59:59.000Z

    Milagrito, a detector sensitive to very high energy gamma rays, monitored the northern sky from February 1997 through May 1998. With a large field of view and a high duty cycle, this instrument was well suited to perform a search for TeV gamma-ray bursts (GRBs). We report on a search made for TeV counterparts to GRBs observed by BATSE. BATSE detected 54 GRBs within the field of view of Milagrito during this period. An excess of events coincident in time and space with one of these bursts, GRB 970417a, was observed by Milagrito. The excess has a chance probability of $2.8 \\times 10^{-5}$ of being a fluctuation of the background. The probability for observing an excess at least this large from any of the 54 bursts is $1.5 \\times 10^{-3}$. No significant correlations were detected from the other bursts.

  4. Evidence for TeV Emission from GRB 970417a

    E-Print Network [OSTI]

    The Milagro Collaboration; R. Atkins; W. Benbow; D. Berley; M. L. Chen; D. G. Coyne; B. L. Dingus; D. E. Dorfan; R. W. Ellsworth; D. Evans; A. Falcone; L. Fleysher; R. Fleysher; G. Gisler; J. A. Goodman; T. J. Haines; C. M. Hoffman; S. Hugenberger; L. A. Kelley; I. Leonor; M. McConnell; J. F. McCullough; J. E. McEnery; R. S. Miller; A. I. Mincer; M. F. Morales; P. Nemethy; J. M. Ryan; B. Shen; A. Shoup; C. Sinnis; A. J. Smith; G. W. Sullivan; T. Tumer; K. Wang; M. O. Wascko; S. Westerhoff; D. A. Williams; T. Yang; G. B. Yodh

    2000-01-07T23:59:59.000Z

    Milagrito, a detector sensitive to very high energy gamma rays, monitored the northern sky from February 1997 through May 1998. With a large field of view and a high duty cycle, this instrument was well suited to perform a search for TeV gamma-ray bursts (GRBs). We report on a search made for TeV counterparts to GRBs observed by BATSE. BATSE detected 54 GRBs within the field of view of Milagrito during this period. An excess of events coincident in time and space with one of these bursts, GRB 970417a, was observed by Milagrito. The excess has a chance probability of $2.8 \\times 10^{-5}$ of being a fluctuation of the background. The probability for observing an excess at least this large from any of the 54 bursts is $1.5 \\times 10^{-3}$. No significant correlations were detected from the other bursts.

  5. Density functional simulations of phase change materials: disordered phases of Ge8Sb2Te11 and Ag/In/Sb/Te alloys

    E-Print Network [OSTI]

    E*PCOS2009 Density functional simulations of phase change materials: disordered phases of Ge8Sb2Te75.0Te17.7 (AIST). These represent two families used widely as phase change materials: pseudobinary and more flexible than those of Ag. Key words: Phase change materials, density functional calculations

  6. Milagrito Detection of TeV Emission from Mrk 501

    E-Print Network [OSTI]

    Atkins, R; Berley, D; Chen, M L; Coyne, D G; Delay, R S; Dingus, B L; Dorfan, D E; Ellsworth, R W; Evans, D; Falcone, A D; Fleysher, L; Fleysher, R; Gisler, G; Goodman, J A; Haines, T J; Hoffman, C M; Hugenberger, S; Kelley, L A; Leonor, I; Macri, J R; McConnell, M; McCullough, J F; McEnery, J E; Miller, R S; Mincer, A I; Morales, M F; Némethy, P; Ryan, J M; Schneider, M; Shen, B; Shoup, A L; Sinnis, G; Smith, A J; Sullivan, G W; Thompson, T N; Tümer, T O; Wang, K; Wascko, M O; Westerhoff, S; Williams, D A; Yang, T; Yodh, G B

    1999-01-01T23:59:59.000Z

    The Milagro water Cherenkov detector near Los Alamos, New Mexico, has been operated as a sky monitor at energies of a few TeV between February 1997 and April 1998. Serving as a test run for the full Milagro detector, Milagrito has taken data during the strong and long-lasting 1997 flare of Mrk 501. We present results from the analysis of Mrk 501 and compare the excess and background rates with expectations from the detector simulations.

  7. Milagrito Detection of TeV Emission from Mrk 501

    E-Print Network [OSTI]

    R. Atkins; W. Benbow; D. Berley; M. -L. Chen; D. G. Coyne; R. S. Delay; B. L. Dingus; D. E. Dorfan; R. W. Ellsworth; D. Evans; A. Falcone; L. Fleysher; R. Fleysher; G. Gisler; J. A. Goodman; T. J. Haines; C. M. Hoffman; S. Hugenberger; L. A. Kelley; I. Leonor; J. Macri; M. McConnell; J. F. McCullough; J. E. McEnery; R. S. Miller; A. I. Mincer; M. F. Morales; P. Nemethy; J. M. Ryan; M. Schneider; B. Shen; A. Shoup; G. Sinnis; A. J. Smith; G. W. Sullivan; T. N. Thompson; O. T. Tumer; K. Wang; M. O. Wascko; S. Westerhoff; D. A. Williams; T. Yang; G. B. Yodh

    1999-06-24T23:59:59.000Z

    The Milagro water Cherenkov detector near Los Alamos, New Mexico, has been operated as a sky monitor at energies of a few TeV between February 1997 and April 1998. Serving as a test run for the full Milagro detector, Milagrito has taken data during the strong and long-lasting 1997 flare of Mrk 501. We present results from the analysis of Mrk 501 and compare the excess and background rates with expectations from the detector simulations.

  8. Directional correlation measurements for gamma transitions in /sup 127/Te

    SciTech Connect (OSTI)

    de Souza, M.O.M.D.; Saxena, R.N.

    1985-02-01T23:59:59.000Z

    The directional correlation of coincident ..gamma.. transitions in /sup 127/Te has been measured following the ..beta../sup -/ decay of /sup 127/Sb (T/sub 1/2/ = 3.9 d) using Ge(Li)-Ge(Li) and Ge(Li)-NaI(T1) gamma spectrometers. Measurements have been carried out for 14 gamma cascades resulting in the determination of multipole mixing ratios delta(E2/M1) for 15 ..gamma.. transitions. The present results permitted a definite spin assignment of (7/2) for the 785 keV level and confirmation of several previous assignments to other levels in /sup 127/Te. The g factor of the 340 keV ((9/2)/sup -/) level has also been measured using the integral perturbed angular correlation method in the hyperfine magnetic field of a Te in Ni matrix. The results of the g factor as well as the mixing ratio for the 252 keV ((9/2)/sup -/..-->..(11/2)/sup -/) transition support the earlier interpretation of this state as an anomalous coupling state.

  9. TeV Scale Lepton Number Violation and Baryogenesis

    E-Print Network [OSTI]

    Dev, P S Bhupal; Mohapatra, R N

    2015-01-01T23:59:59.000Z

    Contrary to the common lore based on naive dimensional analysis, the seesaw scale for neutrino masses can be naturally in the TeV range, with small parameters coming from radiative corrections. We present one such class of type-I seesaw models, based on the left-right gauge group $SU(2)_L\\times SU(2)_R\\times U(1)_{B-L}$ realized at the TeV scale, which fits the observed neutrino oscillation parameters as well as other low energy constraints. We discuss how the small parameters of this scenario can arise naturally from one loop effects. The neutrino fits in this model use quasi-degenerate heavy Majorana neutrinos, as also required to explain the matter-antimatter asymmetry in our Universe via resonant leptogenesis mechanism. We discuss the constraints implied by the dynamics of this mechanism on the mass of the right-handed gauge boson in this class of models with enhanced neutrino Yukawa couplings compared to the canonical seesaw model and find a lower bound of $m_{W_R}\\geq 9.9$ TeV for successful leptogenesi...

  10. Development of ZnTe:Cu Contacts for CdTe Solar Cells: Cooperative Research and Development Final Report, CRADA Number CRD-08-320

    SciTech Connect (OSTI)

    Dhere, R.

    2012-04-01T23:59:59.000Z

    The main focus of the work at NREL was on the development of Cu-doped ZnTe contacts to CdTe solar cells in the substrate configuration. The work performed under the CRADA utilized the substrate device structure used at NREL previously. All fabrication was performed at NREL. We worked on the development of Cu-doped ZnTe as well as variety of other contacts such as Sb-doped ZnTe, CuxTe, and MoSe2. We were able to optimize the contacts to improve device parameters. The improvement was obtained primarily through increasing the open-circuit voltage, to values as high as 760 mV, leading to device efficiencies of 7%.

  11. SubTeV GammaRay Astrophysics using Large Air Toru Tanimori 3)

    E-Print Network [OSTI]

    Enomoto, Ryoji

    detection of persistent TeV gamma­ray emission from the Crab in 1989, several type of TeV gamma­ray sources the huge black holes at the center of galaxies. Recent detections of TeV gamma­ ray emission from severalES2344+514, SN1006 Fig. 2. GeV gamma­ray source catalog detected by EGRET in galactic coordinates

  12. High Efficiency Single Crystal CdTe Solar Cells: November 19, 2009 - January 31, 2011

    SciTech Connect (OSTI)

    Carmody, M.; Gilmore, A.

    2011-05-01T23:59:59.000Z

    The goal of the program was to develop single crystal CdTe-based top cells grown on Si solar cells as a platform for the subsequent manufacture of high efficiency tandem cells for CPV applications. The keys to both the single junction and the tandem junction cell architectures are the ability to grow high quality single-crystal CdTe and CdZnTe layers on p-type Si substrates, to dope the CdTe and CdZnTe controllably, both n and p-type, and to make low resistance ohmic front and back contacts. EPIR demonstrated the consistent MBE growth of CdTe/Si and CdZnTe/Si having high crystalline quality despite very large lattice mismatches; epitaxial CdTe/Si and CdZnTe/Si consistently showed state-of-the-art electron mobilities and good hole mobilities; bulk minority carrier recombination lifetimes of unintentionally p-doped CdTe and CdZnTe grown by MBE on Si were demonstrated to be consistently of order 100 ns or longer; desired n- and p-doping levels were achieved; solar cell series specific resistances <10 ?-cm2 were achieved; A single-junction solar cell having a state-of-the-art value of Voc and a unverified 16.4% efficiency was fabricated from CdZnTe having a 1.80 eV bandgap, ideal for the top junction in a tandem cell with a Si bottom junction.

  13. A model for dark matter, naturalness and a complete gauge unification

    E-Print Network [OSTI]

    Kainulainen, Kimmo; Virkajärvi, Jussi

    2015-01-01T23:59:59.000Z

    We consider dark matter in a minimal extension of the Standard Model (SM) which breaks electroweak symmetry dynamically and leads to a complete unification of the SM and technicolor coupling constants. The unification scale is determined to be $M_{\\rm U} \\approx 2.2 \\times 10^{15}$ GeV and the unified coupling $\\alpha_{\\rm U} \\approx 0.0304$. Moreover, unification strongly suggest that the technicolor sector of the model must become strong at the scale of ${\\cal O}$(TeV). The model also contains a tightly constrained sector of mixing neutral fields stabilized by a discrete symmetry. We find the lightest of these states can be DM with a mass in the range $m_{\\rm DM} \\approx 30-800$ GeV. We find a large set of parameters that satisfy all available constraints from colliders and from dark matter search experiments. However, most of the available parameter space is within the reach of the next generation of DM search experiments. The model is also sensitive to a modest improvement in the measurement of the precis...

  14. A coordinated X-ray and Optical Campaign of the Nearest Massive Eclipsing Binary, $\\delta$ Orionis Aa: IV. A multiwavelength, non-LTE spectroscopic analysis

    E-Print Network [OSTI]

    Shenar, T; Hamann, W -R; Corcoran, M F; Moffat, A F J; Pablo, H; Richardson, N D; Waldron, W L; Huenemoerder, D P; Apellániz, J Maíz; Nichols, J S; Todt, H; Nazé, Y; Hoffman, J L; Pollock, A M T; Negueruela, I

    2015-01-01T23:59:59.000Z

    Eclipsing systems of massive stars allow one to explore the properties of their components in great detail. We perform a multi-wavelength, non-LTE analysis of the three components of the massive multiple system $\\delta$ Ori A, focusing on the fundamental stellar properties, stellar winds, and X-ray characteristics of the system. The primary's distance-independent parameters turn out to be characteristic for its spectral type (O9.5 II), but usage of the ${\\rm \\it Hipparcos}$ parallax yields surprisingly low values for the mass, radius, and luminosity. Consistent values follow only if $\\delta$ Ori lies at about twice the ${\\rm \\it Hipparcos}$ distance, in the vicinity of the $\\sigma$-Orionis cluster. The primary and tertiary dominate the spectrum and leave the secondary only marginally detectable. We estimate the V-band magnitude difference between primary and secondary to be $\\Delta V \\approx 2.\\!\\!^{\\rm m}8$. The inferred parameters suggest the secondary is an early B-type dwarf ($\\approx$ B1 V), while the te...

  15. Inclusive Jet Spectra in p-Pb Collisions at ALICE

    E-Print Network [OSTI]

    Megan Connors; for the ALICE Collaboration

    2014-09-11T23:59:59.000Z

    Jet suppression has been observed in central heavy ion collisions. This suppression is attributed to partonic energy loss in the Quark Gluon Plasma (QGP) formed in such collisions. However, this measurement is influenced by all stages of the collision. It is expected that in p-Pb collisions similar initial conditions occur as in Pb-Pb collisions without creating a QGP, allowing modification to the jet spectra due to cold nuclear matter effects to be quantified. Inclusive jet spectra in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 5.02$ TeV measured by ALICE are presented. Jets are reconstructed via the anti-k$_{\\rm T}$ algorithm with different resolution parameters by combining charged tracks measured in the ALICE tracking system with the neutral energy deposited in the electromagnetic calorimeter. The jet spectra can be used to determine a nuclear modification factor $R_{\\rm pPb}$ while the jet profile in p-Pb is studied by dividing spectra measured with different resolution parameters and comparing to the same ratio measured in pp collisions.

  16. A Warm Near-Infrared High-Resolution Spectrograph with Very High Throughput (WINERED)

    E-Print Network [OSTI]

    Kondo, Sohei; Kobayashi, Naoto; Yasui, Chikako; Mito, Hiroyuki; Fukue, Kei; Nakanishi, Kenshi; Kawanishi, Takafumi; Nakaoka, Tetsuya; Otsubo, Shogo; Kinoshita, Masaomi; Kitano, Ayaka; Hamano, Satoshi; Mizumoto, Misaki; Yamamoto, Ryo; Izumi, Natsuko; Matsunaga, Noriyuki; Kawakita, Hideyo

    2015-01-01T23:59:59.000Z

    WINERED is a newly built high-efficiency (throughput$ > 25-30\\%$) and high-resolution spectrograph customized for short NIR bands at 0.9-1.35 ${\\rm \\mu}$m. WINERED is equipped with ambient temperature optics and a cryogenic camera using a 1.7 ${\\rm \\mu}$m cut-off HgCdTe HAWAII-2RG array detector. WINERED has two grating modes: one with a conventional reflective echelle grating (R$\\sim$28,300), which covers 0.9-1.35 $\\mu$m simultaneously, the other with ZnSe or ZnS immersion grating (R$\\sim$100,000). We have completed the development of WINERED except for the immersion grating, and started engineering and science observations at the Nasmyth platform of the 1.3 m Araki Telescope at Koyama Astronomical Observatory of Kyoto-Sangyo University in Japan. We confirmed that the spectral resolution ($R\\sim$ 28,300) and the throughput ($>$ 40\\% w/o telescope/atmosphere/array QE) meet our specifications. We measured ambient thermal backgrounds (e.g., 0.06 ${\\rm [e^{-}/sec/pixel]}$ at 287 K), which are roughly consistent ...

  17. OpTeC Annual Meeting Agenda 1 11 Sept. 2014 Optical Science & Engineering Conference

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    in an SOFC #12;OpTeC Annual Meeting Agenda 2 11 Sept. 2014 9:40 am Alexander Mikhaylov,a Lauren Bennett

  18. Characterization and Analysis of CIGS and CdTE Solar Cells: December 2004 - July 2008

    SciTech Connect (OSTI)

    Sites, J. R.

    2009-01-01T23:59:59.000Z

    The work reported here embodies a device-physics approach based on careful measurement and interpretation of data from CIGS and CdTe solar cells.

  19. MHK Projects/TE4 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose Bend < MHK Projects Jump to: navigation, searchJintangTE4 <

  20. PVA TePla AG | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |JilinLuOpenNorthOlympiaAnalysis) Jump to:PUD No 1 ofPV SolarPVA TePla

  1. Constraints on the TeV source population and its contribution to the galactic diffuse TeV emission

    E-Print Network [OSTI]

    Casanova, Sabrina

    2007-01-01T23:59:59.000Z

    The detection by the HESS atmospheric Cerenkov telescope of fourteen new sources from the Galactic plane makes it possible to estimate the contribution of unresolved sources like those detected by HESS to the diffuse Galactic emission measured by the Milagro Collaboration. The number-intensity relation and the luminosity function for the HESS source population are investigated. By evaluating the contribution of such a source population to the diffuse emission we conclude that a significant fraction of the TeV energy emission measured by the Milagro experiment could be due to unresolved sources like HESS sources. Predictions concerning the number of sources which Veritas, Milagro, and HAWC should detect are also given.

  2. Constraints on the TeV source population and its contribution to the galactic diffuse TeV emission

    E-Print Network [OSTI]

    Sabrina Casanova; Brenda L. Dingus

    2007-11-19T23:59:59.000Z

    The detection by the HESS atmospheric Cerenkov telescope of fourteen new sources from the Galactic plane makes it possible to estimate the contribution of unresolved sources like those detected by HESS to the diffuse Galactic emission measured by the Milagro Collaboration. The number-intensity relation and the luminosity function for the HESS source population are investigated. By evaluating the contribution of such a source population to the diffuse emission we conclude that a significant fraction of the TeV energy emission measured by the Milagro experiment could be due to unresolved sources like HESS sources. Predictions concerning the number of sources which Veritas, Milagro, and HAWC should detect are also given.

  3. ZnO/Sn:In2O3 and ZnO/CdTe band offsets for extremely thin absorber...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ZnOSn:In2O3 and ZnOCdTe band offsets for extremely thin absorber photovoltaics . ZnOSn:In2O3 and ZnOCdTe band offsets for extremely thin absorber photovoltaics . Abstract: Band...

  4. Post-Synthesis Crystallinity Tailoring of Water-Soluble Polymer Encapsulated CdTe Nanoparticles using Rapid Thermal Annealing

    E-Print Network [OSTI]

    Post-Synthesis Crystallinity Tailoring of Water-Soluble Polymer Encapsulated CdTe Nanoparticles CdTe NPs have been demonstrated suitable for use in applications involving efficient solar cells

  5. Search for Short Duration Bursts of TeV Gamma Rays with the Milagrito Telescope

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    OG 2.3.07 Search for Short Duration Bursts of TeV Gamma Rays with the Milagrito Telescope Gus for short duration bursts of TeV photons. Such bursts may result from "traditional" gamma-ray bursts to gamma-ray bursts, the final stages of black hole evaporation) the most compelling reason may

  6. Rabobank Eindhoven-Veldhoven Coperatieve Rabobank Eindhoven-Veldhoven U.A., gevestigd te Eindhoven

    E-Print Network [OSTI]

    Franssen, Michael

    Rabobank Eindhoven-Veldhoven Coöperatieve Rabobank Eindhoven-Veldhoven U.A., gevestigd te Eindhoven Ingeschreven bij de K.v.K. Oost-Brabant te Eindhoven onder nr. 17008015/BTW-identificatienummer NL0013.43.087.B.01 Postal address Postbus 301, 5600 AH Eindhoven To the student Office Address Kronehoefstraat 87

  7. Rabobank Eindhoven-Veldhoven Coperatieve Rabobank Eindhoven-Veldhoven U.A., gevestigd te Eindhoven

    E-Print Network [OSTI]

    Franssen, Michael

    Rabobank Eindhoven-Veldhoven Coöperatieve Rabobank Eindhoven-Veldhoven U.A., gevestigd te Eindhoven Ingeschreven bij de K.v.K. Oost-Brabant te Eindhoven onder nr. 17008015/BTW-identificatienummer NL0013.43.087.B.01 Office Address Kronehoefstraat 87, Eindhoven Telephone Fax E-mail Website (040) 293 60 00 (040

  8. A Search for TeV Emission from Active Galaxies using the Milagro Observatory

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    that observes very high energy gamma rays (100 GeV to 100 TeV) using the water-Cerenkov technique Mexico, Milagro observes most of the Northern Hemisphere over the course of a day. The high duty cycleV candidates. Active galaxies have been observed to be highly variable at TeV energies. To test for episodic

  9. NUMERICAL MODELING OF CIGS AND CdTe SOLAR CELLS: SETTING THE BASELINE

    E-Print Network [OSTI]

    Sites, James R.

    NUMERICAL MODELING OF CIGS AND CdTe SOLAR CELLS: SETTING THE BASELINE M. Gloeckler, A important complications that are often found in experimental CIGS and CdTe solar cells. 1. INTRODUCTION Numerical modeling of polycrystalline thin-film solar cells is an important strategy to test the viability

  10. $?$ and $?$ Production in Proton-Proton Collisions at E=13 TeV

    E-Print Network [OSTI]

    Leonard S. Kisslinger; Debasish Das

    2015-05-27T23:59:59.000Z

    This article is an extension of our recent studies of $\\Psi$ and $\\Upsilon$ production cross sections in proton-proton collisions at the LHC with E=$\\sqrt{s}$=8.0 TeV to E=13 TeV

  11. Field emission cooling of thermoelectric semiconductor PbTe M. S. Chung,1,a

    E-Print Network [OSTI]

    Mayer, Alexandre

    Field emission cooling of thermoelectric semiconductor PbTe M. S. Chung,1,a A. Mayer,2 B. L. Weiss due to field emission from n-type PbTe, a typical thermoelectric material. We show that, by calculating the average energies of field and replacement electrons, the energy exchange in field emission

  12. Thermoelectric Properties Modeling of Bi2Te3 Seungwon Lee and Paul von Allmen

    E-Print Network [OSTI]

    Goddard III, William A.

    Thermoelectric Properties Modeling of Bi2Te3 Seungwon Lee and Paul von Allmen Jet propulsion/23/2005 Overview · Introduce EZTB a modeling tool for thermoelectric properties using a tight-binding model-binding parameters for Bi2Te3. · Present the accuracy of the modeling tool with the thermoelectric properties of Bi2

  13. Industrial Upscaling of CdTe/CdS Thin Film Solar Cells , A. Bosioa

    E-Print Network [OSTI]

    Romeo, Alessandro

    , these devices are already produced in modules of 60x120 cm2 by two companies, namely Antec Solar in GermanyIndustrial Upscaling of CdTe/CdS Thin Film Solar Cells N. Romeoa , A. Bosioa , A. Romeob , S, ABSTRACT: CdTe/CdS thin film solar cells, since they are made with easily scalable techniques

  14. Unusual Otto excitation dynamics and enhanced coupling of light to TE plasmons in graphene

    E-Print Network [OSTI]

    Park, Namkyoo

    Unusual Otto excitation dynamics and enhanced coupling of light to TE plasmons in graphene Daniel R are a unique and unusual aspect of graphene's plasmonic response that are predicted to manifest when the sign plasmons in graphene. We show that TE plasmons supported by graphene in an Otto configuration unusually

  15. Interconnected Slums: Water, Sanitation and Health in Abidjan, Co^te d'Ivoire

    E-Print Network [OSTI]

    Richner, Heinz

    Interconnected Slums: Water, Sanitation and Health in Abidjan, Co^te d'Ivoire BRIGIT OBRIST, GUE contributed to this paper are: Gue´ladio Cisse´ (Centre Suisse de Recherches Scientifiques, Abidjan, Co^te d'Ivoire´tude de cas comparative, il examine les re´ponses aux proble`mes environnementaux dans un contexte aussi

  16. Research Overview Seminar Extreme astrophysics: mapping the TeV gamma ray sky

    E-Print Network [OSTI]

    and a R&D Array is currently under construction + some neutrino and dark matter experiment R&D · Recent duty cycle, TeV -ray detector · Possibly essential input to the indirect detection of dark matter experiment · Which experiments: High Altitude Water Cherenkov (HAWC) TeV -ray experiment in Mexico (with

  17. $?$ and $?$ Production in Proton-Proton Collisions at E=13 TeV

    E-Print Network [OSTI]

    Leonard S. Kisslinger; Debasish Das

    2015-02-02T23:59:59.000Z

    This article is an extension of our recent studies of $\\Psi$ and $\\Upsilon$ production cross sections in proton-proton collisions at the LHC with E=$\\sqrt{s}$=8.0 TeV to E=13 TeV

  18. Charge transport in mixed CdSe and CdTe colloidal nanocrystal films

    E-Print Network [OSTI]

    Bawendi, Moungi G.

    We report the influence of trap states on charge transport through films of mixed CdTe and CdSe nanocrystals (NCs) between lateral electrodes, through layered films of CdTe and CdSe NCs in a layered geometry, and through ...

  19. THROUGH-THE-GLASS SPECTROSCOPIC ELLIPSOMETRY OF CdTe SOLAR CELLS

    E-Print Network [OSTI]

    Rockett, Angus

    THROUGH-THE-GLASS SPECTROSCOPIC ELLIPSOMETRY OF CdTe SOLAR CELLS Jie Chen 1 , Jian Li 1 , Courtney of the optical structure of CdTe solar cells on transparent conducting oxide (TCO) coated glass superstrates. SE components from the coated glass before solar cell fabrication. A step-by-step fitting procedure identifies

  20. Coplanar grid CdZnTe detectors for space science applications Benjamin W. Sturm*a

    E-Print Network [OSTI]

    He, Zhong

    Coplanar grid CdZnTe detectors for space science applications Benjamin W. Sturm*a , Zhong Hea of the latest coplanar grid CdZnTe detectors, which use the third- generation coplanar grid design into the material properties as well as the charge induction uniformity of the detector. Keywords: coplanar grid, Cd

  1. IMPROVEMENTS IN THE MANUFACTURE OF CdTe GAMMA RAY DETECTORS

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    been made in the quality of chlorine-doped CdTe crystals manufactured by the traveling heater method discussing the process modifications studied in the program, the steps (formation, purification, and doping. - The reaction step of Cd and Te begins when the two elements are melted in the quartz ampule at temperatures

  2. Advanced CdTe Photovoltaic Technology: September 2007 - March 2009

    SciTech Connect (OSTI)

    Barth, K.

    2011-05-01T23:59:59.000Z

    During the last eighteen months, Abound Solar (formerly AVA Solar) has enjoyed significant success under the SAI program. During this time, a fully automated manufacturing line has been developed, fabricated and commissioned in Longmont, Colorado. The facility is fully integrated, converting glass and semiconductor materials into complete modules beneath its roof. At capacity, a glass panel will enter the factory every 10 seconds and emerge as a completed module two hours later. This facility is currently undergoing trials in preparation for large volume production of 120 x 60 cm thin film CdTe modules. Preceding the development of the large volume manufacturing capability, Abound Solar demonstrated long duration processing with excellent materials utilization for the manufacture of high efficiency 42 cm square modules. Abound Solar prototype modules have been measured with over 9% aperture area efficiency by NREL. Abound Solar demonstrated the ability to produce modules at industry leading low costs to NREL representatives. Costing models show manufacturing costs below $1/Watt and capital equipment costs below $1.50 per watt of annual manufacturing capacity. Under this SAI program, Abound Solar supported a significant research and development program at Colorado State University. The CSU team continues to make progress on device and materials analysis. Modeling for increased device performance and the effects of processing conditions on properties of CdTe PV were investigated.

  3. Does the BICEP2 Observation of Cosmological Tensor Modes Imply an Era of Nearly Planckian Energy Densities?

    E-Print Network [OSTI]

    Chiu Man Ho; Stephen D. H. Hsu

    2014-07-19T23:59:59.000Z

    BICEP2 observations, interpreted most simply, suggest an era of inflation with energy densities of order ($10^{16}\\, {\\rm GeV})^4$, not far below the Planck density. However, models of TeV gravity with large extra dimensions might allow a very different interpretation involving much more modest energy scales. We discuss the viability of inflation in such models, and conclude that existing scenarios do not provide attractive alternatives to single field inflation in four dimensions. Because the detection of tensor modes strengthens our confidence that inflation occurred, it disfavors models of large extra dimensions, at least for the moment.

  4. The inheritance of photoperiodic response in short day X day neutral cotton hybrids

    E-Print Network [OSTI]

    Waddle, Billy Mack

    1954-01-01T23:59:59.000Z

    . Populations also were grown in the greenhouse in the winter of 1951-52. These plantings consisted of the following: 6 plants each of the P^, Pg and F^; 26 of the Fg; 18 of the BC^-P^; and 17 of the THE IN2 . These were classified for photoperiodic response... of da ys fr om pl an ti ng da te to ap pe ar an ce of th e fi rs t fl ow er un de r no rm al an d co nt ro ll ed da y leng ths in 19 50 -5 1, 19 51 , an d 19 51 -5 2 at Co...

  5. Review of short-range gravity experiments in the LHC era

    E-Print Network [OSTI]

    Jiro Murata; Saki Tanaka

    2014-08-19T23:59:59.000Z

    This document briefly reviews recent short-range gravity experiments that were performed at below laboratory scales to test the Newtonian inverse square law of gravity. To compare sensitivities of these measurements, estimates using the conventional Yukawa parametrization are introduced. Since these experiments were triggered by the prediction of the large extra-dimension model, experiments performed at different length scales are compared with this prediction. In this paper, a direct comparison between laboratory-scale experiments and the LHC results is presented for the first time. A laboratory experiment is shown to determine the best limit at $M_D > 4.6 \\;\\rm{TeV}$ and $\\lambdagravitational microlaboratories.

  6. Growth of CdTe thin films on graphene by close-spaced sublimation method

    SciTech Connect (OSTI)

    Jung, Younghun; Yang, Gwangseok; Kim, Jihyun, E-mail: hyunhyun7@korea.ac.kr [Department of Chemical and Biological Engineering, Korea University, Seoul 136-701 (Korea, Republic of)] [Department of Chemical and Biological Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Seungju; Kim, Donghwan [Department of Materials Science and Engineering, Korea University, Seoul 136-701 (Korea, Republic of)] [Department of Materials Science and Engineering, Korea University, Seoul 136-701 (Korea, Republic of)

    2013-12-02T23:59:59.000Z

    CdTe thin films grown on bi-layer graphene were demonstrated by using the close-spaced sublimation method, where CdTe was selectively grown on the graphene. The density of the CdTe domains was increased with increasing the number of the defective sites in the graphene, which was controlled by the duration of UV exposure. The CdTe growth rate on the bi-layer graphene electrodes was 400?nm/min with a bandgap energy of 1.45–1.49?eV. Scanning electron microscopy, micro-Raman spectroscopy, micro-photoluminescence, and X-ray diffraction technique were used to confirm the high quality of the CdTe thin films grown on the graphene electrodes.

  7. TenTen: A New Array of Multi-TeV Imaging Cherenkov Telescopes

    E-Print Network [OSTI]

    G. Rowell; V. Stamatescu; R. Clay; B. Dawson; J. Denman; R. Protheroe; A. G. K. Smith; G. Thornton; N. Wild

    2007-10-10T23:59:59.000Z

    The exciting results from H.E.S.S. point to a new population of gamma-ray sources at energies E > 10 TeV, paving the way for future studies and new discoveries in the multi-TeV energy range. Connected with these energies is the search for sources of PeV cosmic-rays (CRs) and the study of multi-TeV gamma-ray production in a growing number of astrophysical environments. TenTen is a proposed stereoscopic array (with a suggested site in Australia) of modest-sized (10 to 30m^2) Cherenkov imaging telescopes with a wide field of view (8 to 10deg diameter) optimised for the E~10 to 100 TeV range. TenTen will achieve an effective area of ~10 km^2 at energies above 10 TeV. We outline here the motivation for TenTen and summarise key performance parameters.

  8. Coupling between JET Pedestal ne-Te and Outer Target Plate Recycling: Consequences for JET ITER-Like-Wall Operation

    E-Print Network [OSTI]

    Coupling between JET Pedestal ne-Te and Outer Target Plate Recycling: Consequences for JET ITER-Like-Wall Operation

  9. CdTe Feedstock Development and Validation: Cooperative Research and Development Final Report, CRADA Number CRD-08-00280

    SciTech Connect (OSTI)

    Albin, D.

    2011-05-01T23:59:59.000Z

    The goal of this work was to evaluate different CdTe feedstock formulations (feedstock provided by Redlen) to determine if they would significantly improve CdTe performance with ancillary benefits associated with whether changes in feedstock would affect CdTe cell processing and possibly reliability of cells. Feedstock also included attempts to intentionally dope the CdTe with pre-selected elements.

  10. Convection and convective overshooting in stars more massive than 10 $M_\\odot$

    E-Print Network [OSTI]

    Jie, Jin; Lv, Guoliang

    2015-01-01T23:59:59.000Z

    In this paper, four sets of evolutionary models are computed with different values of the mixing length parameter $\\alpha_{\\rm p}$ and the overshooting parameter $\\delta_{\\rm ov}$. The properties of the convective cores and the convective envelopes are studied in the massive stars. We get three conclusions: First, the larger $\\alpha_{\\rm p}$ leads to enhancing the convective mixing, removing the chemical gradient, and increasing the convective heat transfer efficiency. Second, core potential $\\phi_{\\rm c} = M_{\\rm c} / R_{\\rm c}$ describes sufficiently the evolution of a star, whether it is a red or blue supergiant at central helium ignition. Third, the discontinuity of hydrogen profile above the hydrogen burning shell seriously affect the occurrence of blue loops in the Hertzsprung--Russell diagram.

  11. Search for a Light Sterile Neutrino at Daya Bay

    E-Print Network [OSTI]

    F. P. An; A. B. Balantekin; H. R. Band; W. Beriguete; M. Bishai; S. Blyth; I. Butorov; G. F. Cao; J. Cao; Y. L. Chan; J. F. Chang; L. C. Chang; Y. Chang; C. Chasman; H. Chen; Q. Y. Chen; S. M. Chen; X. Chen; X. Chen; Y. X. Chen; Y. Chen; Y. P. Cheng; J. J. Cherwinka; M. C. Chu; J. P. Cummings; J. de Arcos; Z. Y. Deng; Y. Y. Ding; M. V. Diwan; E. Draeger; X. F. Du; D. A. Dwyer; W. R. Edwards; S. R. Ely; J. Y. Fu; L. Q. Ge; R. Gill; M. Gonchar; G. H. Gong; H. Gong; M. Grassi; W. Q. Gu; M. Y. Guan; X. H. Guo; R. W. Hackenburg; G. H. Han; S. Hans; M. He; K. M. Heeger; Y. K. Heng; P. Hinrichs; Y. K. Hor; Y. B. Hsiung; B. Z. Hu; L. M. Hu; L. J. Hu; T. Hu; W. Hu; E. C. Huang; H. Huang; X. T. Huang; P. Huber; G. Hussain; Z. Isvan; D. E. Jaffe; P. Jaffke; K. L. Jen; S. Jetter; X. P. Ji; X. L. Ji; H. J. Jiang; J. B. Jiao; R. A. Johnson; L. Kang; S. H. Kettell; M. Kramer; K. K. Kwan; M. W. Kwok; T. Kwok; W. C. Lai; K. Lau; L. Lebanowski; J. Lee; R. T. Lei; R. Leitner; A. Leung; J. K. C. Leung; C. A. Lewis; D. J. Li; F. Li; G. S. Li; Q. J. Li; W. D. Li; X. N. Li; X. Q. Li; Y. F. Li; Z. B. Li; H. Liang; C. J. Lin; G. L. Lin; P. Y. Lin; S. K. Lin; Y. C. Lin; J. J. Ling; J. M. Link; L. Littenberg; B. R. Littlejohn; D. W. Liu; H. Liu; J. L. Liu; J. C. Liu; S. S. Liu; Y. B. Liu; C. Lu; H. Q. Lu; K. B. Luk; Q. M. Ma; X. Y. Ma; X. B. Ma; Y. Q. Ma; K. T. McDonald; M. C. McFarlane; R. D. McKeown; Y. Meng; I. Mitchell; J. Monari Kebwaro; Y. Nakajima; J. Napolitano; D. Naumov; E. Naumova; I. Nemchenok; H. Y. Ngai; Z. Ning; J. P. Ochoa-Ricoux; A. Olshevski; S. Patton; V. Pec; J. C. Peng; L. E. Piilonen; L. Pinsky; C. S. J. Pun; F. Z. Qi; M. Qi; X. Qian; N. Raper; B. Ren; J. Ren; R. Rosero; B. Roskovec; X. C. Ruan; B. B. Shao; H. Steiner; G. X. Sun; J. L. Sun; Y. H. Tam; X. Tang; H. Themann; K. V. Tsang; R. H. M. Tsang; C. E. Tull; Y. C. Tung; B. Viren; V. Vorobel; C. H. Wang; L. S. Wang; L. Y. Wang; M. Wang; N. Y. Wang; R. G. Wang; W. Wang; W. W. Wang; X. Wang; Y. F. Wang; Z. Wang; Z. Wang; Z. M. Wang; D. M. Webber; H. Y. Wei; Y. D. Wei; L. J. Wen; K. Whisnant; C. G. White; L. Whitehead; T. Wise; H. L. H. Wong; S. C. F. Wong; E. Worcester; Q. Wu; D. M. Xia; J. K. Xia; X. Xia; Z. Z. Xing; J. Y. Xu; J. L. Xu; J. Xu; Y. Xu; T. Xue; J. Yan; C. C. Yang; L. Yang; M. S. Yang; M. T. Yang; M. Ye; M. Yeh; Y. S. Yeh; B. L. Young; G. Y. Yu; J. Y. Yu; Z. Y. Yu; S. L. Zang; B. Zeng; L. Zhan; C. Zhang; F. H. Zhang; J. W. Zhang; Q. M. Zhang; Q. Zhang; S. H. Zhang; Y. C. Zhang; Y. M. Zhang; Y. H. Zhang; Y. X. Zhang; Z. J. Zhang; Z. Y. Zhang; Z. P. Zhang; J. Zhao; Q. W. Zhao; Y. Zhao; Y. B. Zhao; L. Zheng; W. L. Zhong; L. Zhou; Z. Y. Zhou; H. L. Zhuang; J. H. Zou

    2014-10-08T23:59:59.000Z

    A search for light sterile neutrino mixing was performed with the first 217 days of data from the Daya Bay Reactor Antineutrino Experiment. The experiment's unique configuration of multiple baselines from six 2.9~GW$_{\\rm th}$ nuclear reactors to six antineutrino detectors deployed in two near (effective baselines 512~m and 561~m) and one far (1579~m) underground experimental halls makes it possible to test for oscillations to a fourth (sterile) neutrino in the $10^{\\rm -3}~{\\rm eV}^{2} < |\\Delta m_{41}^{2}| < 0.3~{\\rm eV}^{2}$ range. The relative spectral distortion due to electron antineutrino disappearance was found to be consistent with that of the three-flavor oscillation model. The derived limits on $\\sin^22\\theta_{14}$ cover the $10^{-3}~{\\rm eV}^{2} \\lesssim |\\Delta m^{2}_{41}| \\lesssim 0.1~{\\rm eV}^{2}$ region, which was largely unexplored.

  12. Thermo-elastic induced phase noise in the LISA Pathfinder spacecraft

    E-Print Network [OSTI]

    Ferran Gibert; Miquel Nofrarias; Nikolaos Karnesis; Lluís Gesa; Víctor Martín; Ignacio Mateos; Alberto Lobo; Reinhold Flatscher; Domenico Gerardi; Johannes Burkhardt; Ruediger Gerndt; David Robertson; Henry Ward; Paul William McNamara; Felipe Guzmán; Martin Hewitson; Ingo Diepholz; Jens Reiche; Gerhard Heinzel; Karsten Danzmann

    2014-12-12T23:59:59.000Z

    During the On-Station Thermal Test campaign of the LISA Pathfinder the data and diagnostics subsystem was tested in nearly space conditions for the first time after integration in the satellite. The results showed the compliance of the temperature measurement system, obtaining temperature noise around $10^{-4}\\,{\\rm K}\\, {\\rm Hz}^{-1/2}$ in the frequency band of $1-30\\;{\\rm mHz}$. In addition, controlled injection of heat signals to the suspension struts anchoring the LISA Technology Package (LTP) Core Assembly to the satellite structure allowed to experimentally estimate for the first time the phase noise contribution through thermo-elastic distortion of the LTP interferometer, the satellite's main instrument. Such contribution was found to be at $10^{-12}\\,{\\rm m}\\, {\\rm Hz}^{-1/2}$, a factor of 30 below the measured noise at the lower end of the measurement bandwidth ($1\\,{\\rm mHz}$).

  13. Synchrotron spectral index and interstellar medium densities of star-forming galaxies

    E-Print Network [OSTI]

    Basu, Aritra; Schmidt, Philip; Roy, Subhashis

    2015-01-01T23:59:59.000Z

    The spectral index of synchrotron emission is an important parameter in understanding the properties of cosmic ray electrons (CREs) and the interstellar medium (ISM). We determine the synchrotron spectral index ($\\alpha_{\\rm nt}$) of four nearby star-forming galaxies, namely NGC 4736, NGC 5055, NGC 5236 and NGC 6946 at sub-kpc linear scales. The $\\alpha_{\\rm nt}$ was determined between 0.33 and 1.4 GHz for all the galaxies. We find the spectral index to be flatter ($\\gtrsim -0.7$) in regions with total neutral (atomic + molecular) gas surface density, $\\Sigma_{\\rm gas} \\gtrsim \\rm 50~M_\\odot pc^{-2}$, typically in the arms and inner parts of the galaxies. In regions with $\\Sigma_{\\rm gas} \\lesssim \\rm 50~M_\\odot pc^{-2}$, especially in the interarm and outer regions of the galaxies, the spectral index steepens sharply to $emitting a...

  14. The exponentiated Hencky-logarithmic strain energy. Part III: Coupling with idealized isotropic finite strain plasticity

    E-Print Network [OSTI]

    Patrizio Neff; Ionel-Dumitrel Ghiba

    2014-10-08T23:59:59.000Z

    We investigate an immediate application in finite strain multiplicative plasticity of the family of isotropic volumetric-isochoric decoupled strain energies \\begin{align*} F\\mapsto W_{_{\\rm eH}}(F):=\\hat{W}_{_{\\rm eH}}(U):=\\{\\begin{array}{lll} \\frac{\\mu}{k}\\,e^{k\\,\\|{\\rm dev}_n\\log {U}\\|^2}+\\frac{\\kappa}{{\\text{}}{2\\, {\\hat{k}}}}\\,e^{\\hat{k}\\,[{\\rm tr}(\\log U)]^2}&\\text{if}& {\\rm det}\\, F>0,\\\\ +\\infty &\\text{if} &{\\rm det} F\\leq 0, \\end{array}.\\quad \\end{align*} based on the Hencky-logarithmic (true, natural) strain tensor $\\log U$. Here, $\\mu>0$ is the infinitesimal shear modulus, $\\kappa=\\frac{2\\mu+3\\lambda}{3}>0$ is the infinitesimal bulk modulus with $\\lambda$ the first Lam\\'{e} constant, $k,\\hat{k}$ are dimensionless fitting parameters, $F=\

  15. Key experimental information on intermediate-range atomic structures in amorphous Ge2Sb2Te5 phase change material

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    .1063/1.3657139 Nature of phase transitions in crystalline and amorphous GeTe-Sb2Te3 phase change materials J. Chem. Phys on intermediate-range atomic structures in amorphous Ge2Sb2Te5 phase change material Shinya Hosokawa,1,2,a) Wolf change material Shinya Hosokawa, Wolf-Christian Pilgrim, Astrid Höhle, Daniel Szubrin, Nathalie Boudet

  16. Binary Alloys of Ge and Te: Order, Voids, and the Eutectic Composition J. Akola1,2

    E-Print Network [OSTI]

    Binary Alloys of Ge and Te: Order, Voids, and the Eutectic Composition J. Akola1,2 and R. O. Jones1 and amorphous structures of Ge0:15Te0:85 and GeTe alloys are characterized using combined density functional,'' and Ge atoms (fourfold coordinated) show octahedral and tetrahedral bonding angles. Cubic local

  17. Thermoelectric Properties of Nb3SbxTe7-x Compounds Sidney Wang, G. Jeff Snyder, and Thierry Caillat

    E-Print Network [OSTI]

    Thermoelectric Properties of Nb3SbxTe7-x Compounds Sidney Wang, G. Jeff Snyder, and Thierry Caillat antimony telluride, Nb3SbxTe7-x, was synthesized and tested for thermoelectric properties in the Thermoelectrics group at the Jet Propulsion Laboratory. The forty atoms per unit cell of Nb3Sb2Te5 and its varied

  18. FORESTRY 347 MULTIPLE RESOURCE SILVICULTURE

    E-Print Network [OSTI]

    Vonessen, Nikolaus

    FORESTRY 347 MULTIPLE RESOURCE SILVICULTURE Autumn 2008 Instructor: John Goodburn Office: Rm. 409 Science Complex Telephone: 243-4295 Email: goodburn@forestry.umt.edu Office hours: Mon. 3:00 - 5:00 pm.m. Rm. 301 Forestry Bldg. Lab/Field Work Wed or Thur. 2:10 - 6:00 p.m. In Field or Rm. 106 (W) & 206(H

  19. NEUTRON-RICH NUCLEAR STUDIES 1. M.W. Simon, C.Y. Wu, D. Cline, R.W. Gray, M.A. Stoyer, K. Vetter, A. Macchiavelli, K. Gregorich, R.W.

    E-Print Network [OSTI]

    Cline, Douglas

    , Ed Paul Fallon, LBNL-41700 1998 4. H. Hua, C.Y. Wu, D. Cline, A.B. Hayes, R. Teng, R.M. Clark, P.J. Barton, M. Shawcross, A. Aprahamian, C.W. Beausang, M.A. Caprio, R.F. Casten, W,T. Chou, R.M. Clark, D,T. Chou, R.M. Clark, D. Cline, M. Cromaz, A.A.Hecht, A.O. Macchiavelli, N. Pietralla, M.A. Stoyer, C.Y. Wu

  20. Crystal orientation mechanism of ZnTe epilayers formed on different orientations of sapphire substrates by molecular beam epitaxy

    SciTech Connect (OSTI)

    Nakasu, T., E-mail: n-taizo.nakasu@asagi.waseda.jp; Yamashita, S.; Aiba, T.; Hattori, S.; Sun, W.; Taguri, K.; Kazami, F. [Department of Electrical Engineering and Bioscience, Waseda University, Tokyo 169-8555 (Japan); Kobayashi, M. [Department of Electrical Engineering and Bioscience, Waseda University, Tokyo 169-8555 (Japan); Kagami Memorial Research Institute for Materials and Technology, Waseda University, Tokyo 169-0051 (Japan)

    2014-10-28T23:59:59.000Z

    The electrooptic effect in ZnTe has recently attracted research attention, and various device structures using ZnTe have been explored. For application to practical terahertz wave detector devices based on ZnTe thin films, sapphire substrates are preferred because they enable the optical path alignment to be simplified. ZnTe/sapphire heterostructures were focused upon, and ZnTe epilayers were prepared on highly mismatched sapphire substrates by molecular beam epitaxy. Epitaxial relationships between the ZnTe thin films and the sapphire substrates with their various orientations were investigated using an X-ray diffraction pole figure method. (0001) c-plane, (1-102) r-plane, (1-100) m-plane, and (11-20) a-plane oriented sapphire substrates were used in this study. The epitaxial relationship between ZnTe and c-plane sapphire was found to be (111) ZnTe//(0001) sapphire with an in-plane orientation relationship of [?211] ZnTe//[1-100] sapphire. It was found that the (211)-plane ZnTe layer was grown on the m-plane of the sapphire substrates, and the (100)-plane ZnTe layer was grown on the r-plane sapphire. When the sapphire substrates were inclined from the c-plane towards the m-axis direction, the orientation of the ZnTe thin films was then tilted from the (111)-plane to the (211)-plane. The c-plane of the sapphire substrates governs the formation of the (111) ZnTe domain and the ZnTe epilayer orientation. These crystallographic features were also related to the atom arrangements of ZnTe and sapphire.

  1. Plasma graviton production in TeV-scale gravity

    E-Print Network [OSTI]

    E. Yu. Melkumova

    2010-12-14T23:59:59.000Z

    We develop the theory of interaction of classical plasma with Kaluza-Klein (KK) gravitons in the ADD model of TeV-scale gravity. Plasma is described within the kinetic approach as the system of charged particles and Maxwell field both confined on the brane. Interaction with multidimensional gravity living in the bulk with $n$ compact extra dimensions is introduced within the linearized theory. The KK gravitons emission rates are computed taking into account plasma collective effects through the two-point correlation functions of the fluctuations of the plasma energy-momentum tensor. Apart from known mechanisms (such as bremsstrahlung and gravi-Primakoff effect) we find essentially collective channels such as the coalescence of plasma waves into gravitons which may be manifest in turbulent plasmas. Our results indicate that commonly used rates of the KK gravitons production in stars and supernovae may be underestimated.

  2. Particle-acceleration timescales in TeV blazar flares

    E-Print Network [OSTI]

    Joni Tammi; Peter Duffy

    2008-12-01T23:59:59.000Z

    Observations of minute-scale flares in TeV Blazars place constraints on particle acceleration mechanisms in those objects. The implications for a variety of radiation mechanisms have been addressed in the literature; in this paper we compare four different acceleration mechanisms: diffusive shock acceleration, second-order Fermi, shear acceleration and the converter mechanism. When the acceleration timescales and radiative losses are taken into account, we can exclude shear acceleration and the neutron-based converted mechanism as possible acceleration processes in these systems. The first-order Fermi process and the converter mechanism working via SSC photons are still practically instantaneous, however, provided sufficient turbulence is generated on the timescale of seconds. We propose stochastic acceleration as a promising candidate for the energy-dependent time delays in recent gamma-ray flares of Markarian 501.

  3. Development of Prototype Pixellated PIN CdZnTe Detectors

    E-Print Network [OSTI]

    T. Narita; P. Bloser; J. Grindlay; R. Sudharsanan; C. Reiche; C. Stenstrom

    1998-06-12T23:59:59.000Z

    We report initial results from the design and evaluation of two pixellated PIN Cadmium Zinc Telluride detectors and an ASIC-based readout system. The prototype imaging PIN detectors consist of 4X4 1.5 mm square indium anode contacts with 0.2 mm spacing and a solid cathode plane on 10X10 mm CdZnTe substrates of thickness 2 mm and 5 mm. The detector readout system, based on low noise preamplifier ASICs, allows for parallel readout of all channels upon cathode trigger. This prototype is under development for use in future astrophysical hard X-ray imagers with 10-600 keV energy response. Measurements of the detector uniformity, spatial resolution, and spectral resolution will be discussed and compared with a similar pixellated MSM detector. Finally, a prototype design for a large imaging array is outlined.

  4. Studies on optoelectronic properties of DC reactive magnetron sputtered CdTe thin films

    SciTech Connect (OSTI)

    Kumar, B. Rajesh, E-mail: rajphyind@gmail.com [Department of Physics, Sri Venkateswara University, Tirupati - 517 502, A.P, India and Department of Physics, Sri Krishnadevaraya University, Anantapur - 515 003, A.P (India); Hymavathi, B.; Rao, T. Subba [Department of Physics, Sri Krishnadevaraya University, Anantapur - 515 003, A.P (India)

    2014-01-28T23:59:59.000Z

    Cadmium telluride continues to be a leading candidate for the development of cost effective photovoltaics for terrestrial applications. In the present work two individual metallic targets of Cd and Te were used for the deposition of CdTe thin films on mica substrates from room temperature to 300 °C by DC reactive magnetron sputtering method. XRD patterns of CdTe thin films deposited on mica substrates exhibit peaks at 2? = 27.7°, 46.1° and 54.6°, which corresponds to reflection on (1 1 1), (2 2 0) and (3 1 1) planes of CdTe cubic structure. The intensities of XRD patterns increases with the increase of substrate temperature upto 150 °C and then it decreases at higher substrate temperatures. The conductivity of CdTe thin films measured from four probe method increases with the increase of substrate temperature. The activation energies (?E) are found to be decrease with the increase of substrate temperature. The optical transmittance spectra of CdTe thin films deposited on mica have a clear interference pattern in the longer wavelength region. The films have good transparency (T > 85 %) exhibiting interference pattern in the spectral region between 1200 – 2500 nm. The optical band gap of CdTe thin films are found to be in the range of 1.48 – 1.57. The refractive index, n decreases with the increase of wavelength, ?. The value of n and k increases with the increase of substrate temperature.

  5. Development of Substrate Structure CdTe Photovoltaic Devices with Performance Exceeding 10%: Preprint

    SciTech Connect (OSTI)

    Dhere, R. G.; Duenow, J. N.; DeHart, C. M.; Li, J. V.; Kuciauskas, D.; Gessert, T. A.

    2012-08-01T23:59:59.000Z

    Most work on CdTe-based solar cells has focused on devices with a superstrate structure. This focus is due to the early success of the superstrate structure in producing high-efficiency cells, problems of suitable ohmic contacts for lightly doped CdTe, and the simplicity of the structure for manufacturing. The development of the CdCl2 heat treatment boosted CdTe technology and perpetuated the use of the superstrate structure. However, despite the beneficial attributes of the superstrate structure, devices with a substrate structure are attractive both commercially and scientifically. The substrate structure eliminates the need for transparent superstrates and thus allows the use of flexible metal and possibly plastic substrates. From a scientific perspective, it allows better control in forming the junction and direct access to the junction for detailed analysis. Research on such devices has been limited. The efficiency of these devices has been limited to around 8% due to low open-circuit voltage (Voc) and fill factor. In this paper, we present our recent device development efforts at NREL on substrate-structure CdTe devices. We have found that processing parameters required to fabricate high-efficiency substrate CdTe PV devices differ from those necessary for traditional superstrate CdTe devices. We have worked on a variety of contact materials including Cu-doped ZnTe and CuxTe. We will present a comparative analysis of the performance of these contacts. In addition, we have studied the influence of fabrication parameters on junction properties. We will present an overview of our development work, which has led to CdTe devices with Voc values of more than 860 mV and NREL-confirmed efficiencies approaching 11%.

  6. Detection of Ks-excess stars in the 14Myr open cluster NGC4755

    E-Print Network [OSTI]

    Bonatto, C; Ortolani, S; Barbuy, B

    2006-01-01T23:59:59.000Z

    We derive the structure, distribution of MS and PMS stars and dynamical state of the young open cluster NGC 4755. We explore the possibility that, at the cluster age, some MS and PMS stars still present infrared excesses related to dust envelopes and proto-planetary discs. The radial density profile follows King's law with a core radius $\\rm\\rc=0.7\\pm0.1 pc$ and a limiting radius $\\rm\\rl=6.9\\pm0.1 pc$; the cluster age is $\\rm14\\pm2 Myr$. Field-star decontamination reveals a low-MS limit at $\\rm\\approx1.4 \\ms$. The core MF ($\\chi=0.94\\pm0.16$) is flatter than the halo's ($\\chi=1.58\\pm0.11$). NGC 4755 contains $\\rm\\sim285$ candidate PMS stars of age $\\rm\\sim1 - 15 Myr$, and a few evolved stars. The mass locked up in PMS, MS and evolved stars amounts to $\\rm\\sim1150 \\ms$. Proper motions show that \\ks-excess MS and PMS stars are cluster members. \\ks-excess fractions in PMS and MS stars are $\\rm5.4\\pm2.1%$ and $\\rm3.9\\pm1.5%$ respectively, consistent with the cluster age. The core is deficient in PMS stars, as com...

  7. Rocky Mountain's Home page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RM sells power in Colorado, most of Wyoming, Nebraska and northeastern Kansas to wholesale customers such as towns, rural electric cooperatives, public utility and irrigation...

  8. Sandia Energy - EC Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    but are expected to have minimal effects on surface mounted devices like the vertical axis turbine device designed for RM2. A simple methodology for obtaining an approximate...

  9. Three dimensional magnetic field structure of six parsec-scale active galactic nuclei jets

    E-Print Network [OSTI]

    Shane P. O'Sullivan; Denise C. Gabuzda

    2009-02-11T23:59:59.000Z

    The parsec-scale Faraday rotation measure (RM) distribution of six "blazars" is investigated using multi-frequency (4.6--43 GHz) polarization observations taken on 2006 July 2 with the VLBA. Analysis of the RM provides the direction of the line-of-sight (LoS) magnetic field component, as well as the intrinsic 2-D polarization distribution on the plane of the sky. Our results show that the magnitude of the core RM increases systematically with frequency, and is well described by a power-law, where |RM_{core}| \\propto \

  10. PERSONAL CON NOMBRAMIENTO VIGENTE Calificacin

    E-Print Network [OSTI]

    Rapaport, Iván

    Zorricueta Luis 11 Sin Información Conservador De Inventarios RM 01-06-2006 31-12-2099 Planta Administrativo

  11. Cytomegalovirus pp65 limits dissemination but is dispensable...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    effect of natural infection. Citation: Malouli D, SG Hansen, ES Nakayasu, EE Marshall, CM Hughes, AB Ventura, RM Gilbride, MS Lewis, G Xu, CN Kreklywich, N Whizin, M...

  12. APS COLLOQUIUM 2008

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Presentation (47:02), video (rm) (47:02), Poster (jpg) dresselhaus New Composite Thermoelectric Materials for Macro-size Applications SPETEMBER 3, 2008 Mildred Dresselhaus, MIT...

  13. EV Guideline Assessment Templates | Department of Energy

    Energy Savers [EERE]

    EV Guideline Assessment Templates More Documents & Publications EV Guideline Assessment Templates NDIAPMSCEVMSIntentGuideNov2006.pdf Earned Value Management System RM...

  14. ash deposition propensities: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Environments (>3.5 km), banded iron, volcanic ashes Summary diagrams available Clastic depositional environments Harbor, David 57 Ash Dump Site Manager: EHS&RM Biology and...

  15. area space telescope: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    telescope. Stellar-image data in a typical exposure determines secondary-mirror positions as precisely as 20 rm nm. The PSF ellipticities and size, which are...

  16. Proposed rule for Interconnection for Wind Energy and Other Alternativ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ENERGY REGULATORY COMMISSION 18 CFR Part 35 (Docket No. RM05-4-000) Interconnection for Wind Energy and Other Alternative Technologies (January 24, 2005) AGENCY: Federal Energy...

  17. Do Investors Forecast Fat Firms? Evidence from the Gold Mining Industry

    E-Print Network [OSTI]

    Borenstein, Severin; Farrell, Joseph

    2006-01-01T23:59:59.000Z

    2002). “When are Real Options Exercised? An Empirical Studya simple application of real option theory; it requires noprices, consistent with real-option analysis. Since the ?rm

  18. Origin of atmospheric aerosols at the Pierre Auger Observatory using studies of air mass trajectories in South America

    E-Print Network [OSTI]

    Curci, Gabriele

    2014-01-01T23:59:59.000Z

    The Pierre Auger Observatory is making significant contributions towards understanding the nature and origin of ultra-high energy cosmic rays. One of its main challenges is the monitoring of the atmosphere, both in terms of its state variables and its optical properties. The aim of this work is to analyze aerosol optical depth $\\tau_{\\rm a}(z)$ values measured from 2004 to 2012 at the observatory, which is located in a remote and relatively unstudied area of the Pampa Amarilla, Argentina. The aerosol optical depth is in average quite low - annual mean $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.04$ - and shows a seasonal trend with a winter minimum - $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.03$ -, and a summer maximum - $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.06$ -, and an unexpected increase from August to September - $\\tau_{\\rm a}(3.5~{\\rm km})\\sim 0.055$). We computed backward trajectories for the years 2005 to 2012 to interpret the air mass origin. Winter nights with low aerosol concentrations show air masses originating from t...

  19. Office of the Chief Information Officer DOERM@hq.doe.gov

    Office of Environmental Management (EM)

    a Records Management Field Officer (RMFO) to represent each Field site or office to support their respective RM processes. RMFOs are officials at the Field level who provide...

  20. Passenger Name Record Data Mining Based Cancellation ...

    E-Print Network [OSTI]

    2008-04-16T23:59:59.000Z

    Apr 16, 2008 ... Revenue management (RM) enhances the revenues of a company by ... A revenue management system collects and stores booking records ...

  1. S-semigoodness for Low-Rank Semidefinite Matrix Recovery

    E-Print Network [OSTI]

    2013-01-14T23:59:59.000Z

    Jan 14, 2013 ... ensemble) and b ? Rm (known measurement), X ? 0 says that X is .... Gross, Liu, Flammia, Becker, and Eisert [11] successfully used SDP.

  2. SEAS Peer Review Lab Inspection Report Nov. 20, 2013

    E-Print Network [OSTI]

    bins and broken glass container blocking access to emergency shower control bottle of tetrahydrofuran dating back to 2005; may require disposal. Rm 329a

  3. Quasi-normal modes of Pop III binary black holes can confirm or refute the Einstein theory in the strong gravity region

    E-Print Network [OSTI]

    Tomoya Kinugawa; Akinobu Miyamoto; Nobuyuki Kanda; Takashi Nakamura

    2015-05-26T23:59:59.000Z

    Using our population synthesis code, we found that the typical chirp mass defined by $(m_1m_2)^{3/5}/(m_1+m_2)^{1/5}$ of Pop III binary black holes (BH-BHs) is $\\sim30~\\rm M_{\\odot}$ with the total mass of $\\sim60~\\rm M_{\\odot}$ so that the inspiral chirp signal as well as quasi normal mode (QNM) of the merged black hole (BH) are interesting targets of KAGRA, Adv. LIGO, Adv. Virgo and GEO network. The detection rate of the coalescing Pop III BH-BHs is 262 $\\rm events~yr^{-1}$$(\\rm SFR_P/(10^{-2.5}~\\rm M_{\\odot} \\rm~yr^{-1}~Mpc^{-3}))\\cdot Err_{sys}$ in our standard model where $\\rm SFR_{p}$ and $\\rm Err_{sys}$ are the peak value of the Pop III star formation rate and the systematic error with $\\rm Err_{sys}=1$ for our standard model, respectively. To evaluate the robustness of chirp mass distribution and the range of $\\rm Err_{sys}$, we examine the dependence of the results on the unknown parameters and the distribution functions in the population synthesis code. We found that the chirp mass has a peak at $\\sim 30 ~\\rm M_{\\odot}$ in most of parameters and distribution functions as well as $\\rm Err_{sys}$ ranges from 0.05577 to 2.289. Therefore, the detection rate of the coalescing Pop III BH-BHs ranges $14.6-599.3\\ {\\rm events~yr^{-1} ~(SFR_p/(10^{-2.5}~M_{\\odot}~yr^{-1}~Mpc^{-3}))}$. The minimum rate corresponds to the worst model which we think unlikely so that unless $ {\\rm ~(SFR_p/(10^{-2.5}~M_{\\odot}~yr^{-1}~Mpc^{-3})) \\ll 0.1}$, we expect the Pop III BH-BHs merger rate of at least one event per year by KAGRA, Adv. LIGO, Adv. Virgo and GEO network. Since the expected frequency of the QNM of the merged BH of mass $\\sim60~\\rm M_{\\odot}$ is $\\sim 200~{\\rm Hz}$ where the interferometers have good sensitivity, there is a good chance to check if the Einstein theory is correct or not in the strong gravity region.

  4. Northwestern Charles Deering McCormick University Library Library of Special Collections

    E-Print Network [OSTI]

    .d. Hitler's American ambitions. n.d. R.M. Hutchins. America and the war. January 23, 1941. E. Lundeen. Six

  5. Subduction Controls of Hf and Nd Isotopes in Lavas of the Aleutian Island Arc

    E-Print Network [OSTI]

    Yogodzinski, Gene

    2011-01-01T23:59:59.000Z

    Pratt, R.M. , 1973. Petrology of volcanic rocks recovered onGlassley, W.R. , 1973. Petrology of Volcanic Rocks Recovered

  6. Dynamic analysis in productivity, oil shock, and recession

    E-Print Network [OSTI]

    Katayama, Munechika

    2008-01-01T23:59:59.000Z

    displays the share of oil consumption in the transportationis a major source of oil consumption. Any investigation ofrepresents ?rm i’s oil consumption for capital utilization

  7. Variability in Ultrasound Education among Emergency Medicine Residencies

    E-Print Network [OSTI]

    Ahern, Matthew; Mallin, Michael P; Weitzel, Scott; Madsen, Troy; Hunt, Pat

    2010-01-01T23:59:59.000Z

    Journal of Emergency Medicine Variability in UltrasoundDivision of Emergency Medicine, 30 South 1500 East Rm1C026,Training in Emergency Medicine Resideny Programs. Acad Emerg

  8. Thin-film CdTe and CuInSe{sub 2} photovoltaic technologies

    SciTech Connect (OSTI)

    Ullal, H.S.; Zweibel, K.; von Roedern, B.G.

    1993-08-01T23:59:59.000Z

    Total-area conversion efficiency of 15%--15.8% have been achieved for thin-film CdTe and CIS solar cells. Modules with power output of 5--53 W have been demonstrated by several groups world-wide. Critical processes and reaction pathways for achieving excellent PV devices have been eluciated. Research, development and technical issues have been identified, which could result in potential improvements in device and module performance. A 1-kW thin-film CdTe array has been installed and is being tested. Multimegawatt thin-film CdTe manufacturing plants are expected to be completed in 1-2 years.

  9. Development of Bi-Sb-Te ternary alloy with compositionally graded structure

    SciTech Connect (OSTI)

    Yamamoto, A.; Ohta, T.

    1997-07-01T23:59:59.000Z

    Compositionally graded p-type Bi-Sb-Te thermoelectric material was synthesized by PIES (Pulverized and Intermixed Elements Sintering) method. The materials consisted of three segmented regions of different alloy composition, i.e., y = 0.8/0.825/0.9 in (Bi{sub 2}Te{sub 3}){sub 1{minus}y} (Sb{sub 2}Te{sub 3}){sub y} system. It was found that the electrical power output of the compositionally graded material was larger than that of the best single composition material when the temperature difference was the designed value.

  10. ,Jet)TE( 0 0.5 1 1.5 2 2.5 3

    E-Print Network [OSTI]

    Quigg, Chris

    #12;1b _ 1b g g g 0 1 0 1 _ _ b b b b _ q q #12;#12;#12;#12;,Jet)TE( 0 0.5 1 1.5 2 2.5 3 TaggedJets 0 5 10 15 20 ,Jet)TE( 0 0.5 1 1.5 2 2.5 3 TaggedJets 0 5 10 15 20 Data QCD-multijet Top W/Z+jets,Diboson -1 CDF Run II Preliminary, 156pb b1b ~ Search for Gluino Jet) st ,1TE( 0 0.5 1 1.5 2 2.5 3 Tagged

  11. Chapter 1.19: Cadmium Telluride Photovoltaic Thin Film: CdTe

    SciTech Connect (OSTI)

    Gessert, T. A.

    2012-01-01T23:59:59.000Z

    The chapter reviews the history, development, and present processes used to fabricate thin-film, CdTe-based photovoltaic (PV) devices. It is intended for readers who are generally familiar with the operation and material aspects of PV devices but desire a deeper understanding of the process sequences used in CdTe PV technology. The discussion identifies why certain processes may have commercial production advantages and how the various process steps can interact with each other to affect device performance and reliability. The chapter concludes with a discussion of considerations of large-area CdTe PV deployment including issues related to material availability and energy-payback time.

  12. XPS and AES Studies of Cu/CdTe(111)-B

    SciTech Connect (OSTI)

    Teeter, G.; Gessert, T. A.; Asher, S. E.

    2005-01-01T23:59:59.000Z

    Copper is frequently used as a p-type dopant to improve the performance of back contacts in CdTe thin-film solar cells. In this study, surface-analysis techniques are used to probe fundamental interactions between Cu and the CdTe(111)-B surface. The results presented here were facilitated by the newly constructed surface-analysis cluster tool in the Measurements and Characterization Division at NREL; they reveal a host of fundamental phenomena that occur in the Cu/CdTe system.

  13. Superconductivity in textured Bi clusters/Bi{sub 2}Te{sub 3} films

    SciTech Connect (OSTI)

    Le, Phuoc Huu [Department of Materials Science and Engineering, National Chiao Tung University, Hsinchu 30049, Taiwan (China); Faculty of Basic Sciences, Can Tho University of Medicine and Pharmacy, 179 Nguyen Van Cu Street, Can Tho (Viet Nam); Tzeng, Wen-Yen; Chen, Hsueh-Ju; Luo, Chih Wei, E-mail: cwluo@mail.nctu.edu.tw [Department of Electrophysics, National Chiao Tung University, Hsinchu 300, Taiwan (China); Lin, Jiunn-Yuan [Institute of Physics, National Chiao Tung University, Hsinchu 300, Taiwan (China); Leu, Jihperng, E-mail: jimleu@mail.nctu.edu.tw [Department of Materials Science and Engineering, National Chiao Tung University, Hsinchu 30049, Taiwan (China)

    2014-09-01T23:59:59.000Z

    We report superconductivity at an onset critical temperature below 3.1 K in topological insulator ?200-nm-thick Bi{sub 2}Te{sub 3} thin films grown by pulsed laser deposition. Using energy-dispersive X-ray spectroscopy elemental mapping and Auger electron spectroscopy elemental depth profiling, we clearly identified bismuth (Bi) precipitation and Bi cluster signatures. Superconductivity in the Bi{sub 2}Te{sub 3} films was attributed to the proximity effect of Bi clusters precipitated on the surface of the Bi{sub 2}Te{sub 3} films.

  14. Search for a TeV Component of GRBs using the Milagrito Detector

    E-Print Network [OSTI]

    Atkins, R; Berley, D; Chen, M L; Coyne, D G; Delay, R S; Dingus, B L; Dorfan, D E; Ellsworth, R W; Evans, D; Falcone, A D; Fleysher, L; Fleysher, R; Gisler, G; Goodman, J A; Haines, T J; Hoffman, C M; Hugenberger, S; Kelley, L A; Leonor, I; Macri, J R; McConnell, M; McCullough, J F; McEnery, J E; Miller, R S; Mincer, A I; Morales, M F; Némethy, P; Ryan, J M; Schneider, M; Shen, B; Shoup, A L; Sinnis, G; Smith, A J; Sullivan, G W; Thompson, T N; Tümer, T O; Wang, K; Wascko, M O; Westerhoff, S; Williams, D A; Yang, T; Yodh, G B

    1999-01-01T23:59:59.000Z

    Observing gamma ray bursts (GRBs) in the TeV energy range can be extremely valuable in providing insight to GRB radiation mechanisms and in constraining source distances. The Milagrito detector was an air shower array which used the water Cherenkov technique to search for TeV sources. Data from this detector was analyzed to look for a TeV component of GRBs coincident with low energy -rays detected by the BATSE instrument on the Compton Gamma Ray Observatory. A sample of 54 BATSE GRBs which were in the field of view of the Milagrito detector during its lifetime (February 1997 to May 1998) was used.

  15. Semiconductor quantum dots enhanced graphene/CdTe heterostructure solar cells by photo-induced doping

    E-Print Network [OSTI]

    Li, Xiaoqiang; Wang, Peng; Xu, Zhijuan; Zhong, Huikai; Wu, Zhiqian; Lin, Shisheng

    2015-01-01T23:59:59.000Z

    Photo-induced doping is employed into graphene based solar cell through designing of a novel type of solar cell based on graphene/CdTe Schottky heterostructure. By coating a layer of ultrathin CdSe quantum dots onto graphene/CdTe heterostructure, the performance of the graphene/CdTe solar cell is improved by about 50%. Photo-induced doping is mainly accounted for this enhancement, as evidenced by resistance, photoluminescence and quantum efficiency measurements. This work demonstrates a general and feasible way of designing novel type of solar cells based on two dimensional materials/semiconductor heterostructures.

  16. Search for a TeV Component of GRBs using the Milagrito Detector

    E-Print Network [OSTI]

    R. Atkins; W. Benbow; D. Berley; M. -L. Chen; D. G. Coyne; R. S. Delay; B. L. Dingus; D. E. Dorfan; R. W. Ellsworth; D. Evans; A. Falcone; L. Fleysher; R. Fleysher; G. Gisler; J. A. Goodman; T. J. Haines; C. M. Hoffman; S. Hugenberger; L. A. Kelley; I. Leonor; J. Macri; M. McConnell; J. F. McCullough; J. E. McEnery; R. S. Miller; A. I. Mincer; M. F. Morales; P. Nemethy; J. M. Ryan; M. Schneider; B. Shen; A. Shoup; G. Sinnis; A. J. Smith; G. W. Sullivan; T. N. Thompson; O. T. Tumer; K. Wang; M. O. Wascko; S. Westerhoff; D. A. Williams; T. Yang; G. B. Yodh

    1999-06-24T23:59:59.000Z

    Observing gamma ray bursts (GRBs) in the TeV energy range can be extremely valuable in providing insight to GRB radiation mechanisms and in constraining source distances. The Milagrito detector was an air shower array which used the water Cherenkov technique to search for TeV sources. Data from this detector was analyzed to look for a TeV component of GRBs coincident with low energy -rays detected by the BATSE instrument on the Compton Gamma Ray Observatory. A sample of 54 BATSE GRBs which were in the field of view of the Milagrito detector during its lifetime (February 1997 to May 1998) was used.

  17. Origin of the phase transition in IrTe2: structural modulation and local bonding instability

    SciTech Connect (OSTI)

    Cao, Huibo [ORNL; Chakoumakos, Bryan C [ORNL; Yan, Jiaqiang [ORNL; Zhou, Haidong [ORNL; Custelcean, Radu [ORNL; Mandrus, D. [University of Tennessee (UTK) and Oak Ridge National Laboratory (ORNL); McGuire, Michael A [ORNL; Singh, David J [ORNL; Chen, Xin [ORNL; Yang, Hui [University of Tennessee, Knoxville (UTK)

    2013-01-01T23:59:59.000Z

    We used X-ray/neutron diffraction to determine the low temperature (LT) structure of IrTe2. A structural modulation was observed with a wavevector of k =(1/5, 0, 1/5) below Ts285 K, accompanied by a structural transition from a trigonal to a triclinic lattice. We also performed the first principles calculations for high temperature (HT) and LT structures, which elucidate the nature of the phase transition and the LT structure. A local bonding instability associated with the Te 5p states is likely the origin of the structural phase transition in IrTe2.

  18. Multi-channel Absorption of Photons at Energies above 1 TeV

    E-Print Network [OSTI]

    A. Subramanian

    2006-07-24T23:59:59.000Z

    It is shown that the absorption of photons at energies > 1 TeV (much higher than the mass of the Higgs boson ~ 100 GeV) is a multi-channel one as opposed to the purely electron pair like absorption at lower energies. The observation on muons and gamma rays from Cygnus X-3 point source at these energies (1 TeV to 10 TeV) is quantitatively accounted for. The expected multi-channel cross-sections of photons in air as a function of energy is given both for Coulomb dissociation and nuclear absorption upto limiting energies of 10^9 GeV.

  19. Phase relationships in the pseudo-binary 2(ZnTe)-CuInTe{sub 2} system

    SciTech Connect (OSTI)

    Roussak, Liudmila [University of Leipzig, Faculty of Chemistry and Mineralogy, Institute of Mineralogy, Crystallography and Materials Science, Linnestrasse 3-5 (TA), D-04103 Leipzig (Germany)]. E-mail: roussak@rz.uni-leipzig.de; Wagner, Gerald [University of Leipzig, Faculty of Chemistry and Mineralogy, Institute of Mineralogy, Crystallography and Materials Science, Linnestrasse 3-5 (TA), D-04103 Leipzig (Germany); Schorr, Susan [University of Leipzig, Faculty of Chemistry and Mineralogy, Institute of Mineralogy, Crystallography and Materials Science, Linnestrasse 3-5 (TA), D-04103 Leipzig (Germany); Bente, Klaus [University of Leipzig, Faculty of Chemistry and Mineralogy, Institute of Mineralogy, Crystallography and Materials Science, Linnestrasse 3-5 (TA), D-04103 Leipzig (Germany)

    2005-11-15T23:59:59.000Z

    Subsolidus phase relationships in the 2(ZnTe){sub x}(CuInTe{sub 2}){sub 1-x} system were investigated by TEM experiments combined with EDX analysis. The samples were prepared by the solid-state reaction of the elements during long annealing times, followed by either quenching in ice-cold water, or by controlled cooling at different rates. Using the chemical compositions of single and coexisting phases at various temperatures, the boundaries of the two-phase region have been determined. At room temperature, the two-phase region extends from x=0.10 to 0.31. For x<0.10 only mixed crystals with tetragonal structure exist. Between x=0.31 and 1 alloys with the cubic structure are stable. The morphology of the tetragonal domains and their orientation relationship to the cubic matrix were determined by SAD, TEM and HRTEM experiments. The tetragonal phase embedded within the cubic matrix has a flat ellipsoidal shape, whose short axis coincides with the tetragonal c-axis. The three topotaxial orientation relationships between the tetragonal domains and the surrounding cubic matrix were found to be: [001]{sub tetr.}-bar [100]{sub cub.}, [001]{sub tetr.}-bar [010]{sub cub.} and [001]{sub tetr.}-bar [001]{sub cub.}. There is an indication that the nucleation starts from small regions displaying cation ordering according to the CuPt-type structure. Reaching the two-phase equilibrium, the tetragonal domains as well as the surrounding cubic phase are free of this cation ordering.

  20. Intrinsic Rashba-like splitting in asymmetric Bi{sub 2}Te{sub 3}/Sb{sub 2}Te{sub 3} heterogeneous topological insulator films

    SciTech Connect (OSTI)

    Liu, Xiaofei; Guo, Wanlin, E-mail: wlguo@nuaa.edu.cn [State Key Laboratory of Mechanics and Control for Mechanical Structures and Key Laboratory for Intelligent Nano Materials and Devices (MOE), Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China)

    2014-08-25T23:59:59.000Z

    We show by density functional theory calculations that asymmetric hetero-stacking of Bi{sub 2}Te{sub 3}/Sb{sub 2}Te{sub 3} films can modulate the topological surface states. Due to the structure inversion asymmetry, an intrinsic Rashba-like splitting of the conical surface bands is aroused. While such splitting in homogeneous Bi{sub 2}Te{sub 3}-class topological insulators can be realized in films with more than three quintuple layers under external electric fields, the hetero-stacking breaks the limit of thickness for preserving the topological nature into the thinnest two quintuple layers. These results indicate that the hetero-stacking can serve as an efficient strategy for spin-resolved band engineering of topological insulators.