National Library of Energy BETA

Sample records for ri dge bir

  1. Department of energy oak riDge office

    Office of Environmental Management (EM)

    energy oak riDge office of environmental management economic impact analysis The Oak Ridge Office of Environmental Management was established to remove environmental legacies resulting from more than 60 years of nuclear weapons development and government-sponsored nuclear energy research. Each of Oak Ridge's three primary cleanup sites faces unique challenges that present risk and hinder the Department's missions. 2 DEpaRTMEnT Of EnERgy Oak RiDgE EnviROnMEnTal ManagEMEnT The Oak Ridge Office of

  2. OAiC RiDGE NATIONAL LABORAl-ORY LKCKKBSP HAITI MANA%ED AND OPERATED BY

    Office of Legacy Management (LM)

    OH42 -7 / i3-y OAiC RiDGE NATIONAL LABORAl-ORY LKCKKBSP HAITI MANA%ED AND OPERATED BY vxKHEEpyARluEwERoY fEsEARcHcxHtPoM~RN R3RmEuMYED~Am DEPMl' MEU?#bBgKiY . ORNL/TpvI-12968 Results of the Independent Radiological Verification Survey of the Remedial Action l?erformed at the Former Alba Craft Laboratory Site Oxford, Ohio (0x0001) K. R. Kleinhans M. E. Murray R. F. Carrier - This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office

  3. ORISE "AK RlDGE lNSTlT"TE FOR SCIENCE AND EDUCATION

    Office of Legacy Management (LM)

    t\i,;;; il.,. (' . d ORISE "AK RlDGE lNSTlT"TE FOR SCIENCE AND EDUCATION August 1,200l Robert Atkin U.S. Department of Energy Oak Ridge Operations Office P.O. Box 2001 Oak Ridge, TN 3783 1 SUBJECT: CONTRACT NO. DE-AC05000R22750 FINAL REPORT-VERIFICATION SURVEY OF THE NEW BRUNSWICK LABORATORY SITE, NEW BRUNSWICK, NEW JERSEY Dear Mr. Atkin: The Environmental Survey and Site Assessment Program (ESSAP) of the Oak Ridge Institute for Science and Education (ORISE) conducted verification

  4. Category:Providence, RI | Open Energy Information

    Open Energy Info (EERE)

    Providence, RI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Providence, RI" The following 16 files are in this category, out of 16 total....

  5. QER- Comment of RI Office of Energy Resources

    Broader source: Energy.gov [DOE]

    Hi Matt, Please find additional materials from the RI Office of Energy Resources for the DOE QER. The documents attached include: 1) A powerpoint providing an overview of the RI State Energy Plan - the plan will be officially released in Fall, 2014; 2) Testimony to the RI Senate which outlines the need for coordinated work on the gas and electric infrastructure in New England; 3) A powerpoint version of the written testimony; 4) The 2013 Annual Report on the RI Energy Efficiency Program.

  6. 2012 APS-DPP Plasma Science Expo, Providence, RI | Princeton...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    APS-DPP Plasma Science Expo, Providence, RI View larger image IMG 1847 View larger image IMG 1598 View larger image IMG 1608 View larger image IMG 1609 View larger image IMG 1614...

  7. DOE - Office of Legacy Management -- C I Haynes Inc - RI 02

    Office of Legacy Management (LM)

    I Haynes Inc - RI 02 FUSRAP Considered Sites Site: C. I. Haynes, Inc. (RI.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: C.I. Hayes, Incorporated RI.02-1 Location: Cranston , Rhode Island RI.02-1 Evaluation Year: 1994 RI.02-2 RI.02-3 Site Operations: Performed limited scale tests on heat treating uranium in a vacuum cold-wall furnace in 1964 RI.02-1 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited

  8. THE UBV(RI){sub C} COLORS OF THE SUN

    SciTech Connect (OSTI)

    Ramirez, I.; Michel, R.; Schuster, W. J.; Sefako, R.; Van Wyk, F.; Tucci Maia, M.; Melendez, J.; Castilho, B. V.

    2012-06-10

    Photometric data in the UBV(RI){sub C} system have been acquired for 80 solar analog stars for which we have previously derived highly precise atmospheric parameters T{sub eff}, log g, and [Fe/H] using high-resolution, high signal-to-noise ratio spectra. UBV and (RI){sub C} data for 46 and 76 of these stars, respectively, are published for the first time. Combining our data with those from the literature, colors in the UBV(RI){sub C} system, with {approx_equal} 0.01 mag precision, are now available for 112 solar analogs. Multiple linear regression is used to derive the solar colors from these photometric data and the spectroscopically derived T{sub eff}, log g, and [Fe/H] values. To minimize the impact of systematic errors in the model-dependent atmospheric parameters, we use only the data for the 10 stars that most closely resemble our Sun, i.e., the solar twins, and derive the following solar colors: (B - V){sub Sun} = 0.653 {+-} 0.005, (U - B){sub Sun} = 0.166 {+-} 0.022, (V - R){sub Sun} = 0.352 {+-} 0.007, and (V - I){sub Sun} = 0.702 {+-} 0.010. These colors are consistent, within the 1{sigma} errors, with those derived using the entire sample of 112 solar analogs. We also derive the solar colors using the relation between spectral-line-depth ratios and observed stellar colors, i.e., with a completely model-independent approach, and without restricting the analysis to solar twins. We find (B - V){sub Sun} = 0.653 {+-} 0.003, (U - B){sub Sun} = 0.158 {+-} 0.009, (V - R){sub Sun} = 0.356 {+-} 0.003, and (V - I){sub Sun} = 0.701 {+-} 0.003, in excellent agreement with the model-dependent analysis.

  9. QER Public Meeting in Providence, RI & Hartford, CT: New England Regional

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Infrastructure Constraints | Department of Energy Providence, RI & Hartford, CT: New England Regional Infrastructure Constraints QER Public Meeting in Providence, RI & Hartford, CT: New England Regional Infrastructure Constraints Meeting Date and Location: April 21, 2014 9:00A.M.. to 1:00 P.M. EST (Providence, RI) - 1:00 P.M. EST to 5:00 P.M. EST (Hartford, CT) Providence: Rhode Island Convention Center, 1 Sabin St., Ballroom B, Providence, RI Hartford: Connecticut Department of

  10. SwRI's HEDGE Technology for High Efficiency, Low Emissions Gasoline...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Efficiency Engine Technologies and an Introduction to SwRI's Dedicated EGR Concept Development of Dual-Fuel Engine for Class 8 Applications Gasoline Ultra Fuel Efficient Vehicle...

  11. Portsmouth RI/FS Report for the Process Buildings and Complex Facilities

    Energy Savers [EERE]

    Decontamination and Decommissioning Evaluation Project | Department of Energy Process Buildings and Complex Facilities Decontamination and Decommissioning Evaluation Project Portsmouth RI/FS Report for the Process Buildings and Complex Facilities Decontamination and Decommissioning Evaluation Project This remedial investigation/feasibility study (RI/FS), the Remedial Investigation and Feasibility Study Report for the Process Buildings and Complex Facilities Decontamination and

  12. Remedial Investigation/Feasibility Study (RI/FS) process, elements and techniques guidance

    SciTech Connect (OSTI)

    Not Available

    1993-12-01

    This manual provides detailed guidance on Remedial Investigation/Feasibility Studies (RI/FSs) conducted pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) at Department of Energy (DOE) facilities. The purpose of the RI/FS, to assess the risk posed by a hazardous waste site and to determine the best way to reduce that risk, and its structure (site characterization, risk assessment, screening and detailed analysis of alternatives, etc.) is defined in the National Oil and Hazardous Substances Pollution Contingency Plan (NCP) and further explained in the Environmental Protection Agency`s (EPA`s) Guidance for Conducting Remedial Investigations and Feasibility Studies Under CERCLA (Interim Final) 540/G-89/004, OSWER Directive 9355.3-01, October 1988. Though issued in 1988, the EPA guidance remains an excellent source of information on the conduct and structure of an RI/FS. This document makes use of supplemental RI/FS-related guidance that EPA has developed since its initial document was issued in 1988, incorporates practical lessons learned in more than 12 years of experience in CERCLA hazardous site remediation, and drawing on those lessons, introduces the Streamlined Approach For Environmental Restoration (SAFER), developed by DOE as a way to proceed quickly and efficiently through the RI/FS process at DOE facilities. Thus as its title implies, this guidance is intended to describe in detail the process and component elements of an RI/FS, as well as techniques to manage the RI/FS effectively.

  13. A New Path Forward for WTP AL Boldt and RI Smith

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dick Smith and Al Boldt - thoughts to share with the Tank Waste Committee Not a committee work product A New Path Forward for WTP AL Boldt and RI Smith February 3, 2014 ...

  14. RFI/RI work plan for the Road A Chemical Basin 904-111G

    SciTech Connect (OSTI)

    Kmetz, T.F.

    2000-03-07

    This Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI)/Remedial Investigation (RI) Work Plan has been prepared for the Road A Chemical Basin Operable Unit (RdACB OU) (904-111G). This unit is subject to the requirements of both RCRA and the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA). This Work Plan presents the initial evaluation of existing unit data, applicable background data, the regulatory framework for the unit investigation, and the evaluations and decisions made during the determination of the scope and objectives of the planned Remedial Investigation/Feasibility Study (RI/FS) activities.

  15. DOE Zero Energy Ready Home Case Study, Caldwell and Johnson, Exeter, RI,

    Energy Savers [EERE]

    Custom Home | Department of Energy Study, Caldwell and Johnson, Exeter, RI, Custom Home DOE Zero Energy Ready Home Case Study, Caldwell and Johnson, Exeter, RI, Custom Home Case study of a DOE Zero Energy Ready Home in Exeter, Rhode Island, that scored HERS 43 without PV. This 2,000 ft2 custom home has a spray- foamed attic and walls, plus rigid foam sheathing, ducted mini-split heat pumps, and an HRV. PDF icon BA_ZeroEnergyReady_CaldwellJohnson_062314.pdf More Documents & Publications

  16. DOE Zero Energy Ready Home Case Study: Caldwell and Johnson, Charlestown, RI

    Broader source: Energy.gov [DOE]

    Case study of a DOE Zero Energy Ready affordable home in Charlestown, RI, that achieved a HERS Index of 47 without PV. The 2,244-ft2 two-story home with basement has 2x6 walls filled with 5.5 in. ...

  17. WA_01_018_IBM_Waiver_of_Governement_US_and_Foreign_Patent_Ri.pdf |

    Broader source: Energy.gov (indexed) [DOE]

    Department of Energy 1_018_IBM_Waiver_of_Governement_US_and_Foreign_Patent_Ri.pdf More Documents & Publications WA_04_053_IBM_CORP_Waiver_of_the_Government_U.S._and_Foreign.pdf WA_00_015_COMPAQ_FEDERAL_LLC_Waiver_Domestic_and_Foreign_Pat.pdf Advance Patent Waiver W(A)2002-023

  18. Update on Progress of APBF-DEC EGR/DPF/SCR Demonstration Program at SwRI |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Progress of APBF-DEC EGR/DPF/SCR Demonstration Program at SwRI Update on Progress of APBF-DEC EGR/DPF/SCR Demonstration Program at SwRI 2004 Diesel Engine Emissions Reduction (DEER) Conference Presentation: Southwest Research Institute PDF icon 2004_deer_khair.pdf More Documents & Publications Final Update on APBF-DEC EGR/DPF/SCR Demonstration Project at SwRI Low Emissions Potential of EGR-SCR-DPF and Advanced Fuel Formulation - A Progress Report Low Emisssions

  19. DOE Zero Energy Ready Home Case Study 2013: Caldwell and Johnson, Exeter, RI

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Caldwell and Johnson Exeter, RI BUILDING TECHNOLOGIES OFFICE The U.S. Department of Energy invites home builders across the country to meet the extraordinary levels of excellence and quality specified in DOE's Zero Energy Ready Home program (formerly known as Challenge Home). Every DOE Zero Energy Ready Home starts with ENERGY STAR for Homes Version 3 for an energy-efficient home built on a solid foundation of building science research. Advanced technologies are designed in to give you superior

  20. DOE Zero Ready Home Case Study: Caldwell and Johnson, Church Community Housing Corporation, Charlestown, RI

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Caldwell and Johnson Church Community Housing Corporation Charlestown, RI DOE ZERO ENERGY READY HOME(tm) The U.S. Department of Energy invites home builders across the country to meet the extraordinary levels of excellence and quality specified in DOE's Zero Energy Ready Home program (formerly known as Challenge Home). Every DOE Zero Energy Ready Home starts with ENERGY STAR Certified Homes Version 3.0 for an energy-efficient home built on a solid foundation of building science research.

  1. Portsmouth RI/FS Report for the Site-Wide Waste Disposition Evaluation

    Energy Savers [EERE]

    Project | Department of Energy Site-Wide Waste Disposition Evaluation Project Portsmouth RI/FS Report for the Site-Wide Waste Disposition Evaluation Project This Remedial Investigation and Feasibility Study Report for the Site-Wide Waste Disposition Evaluation Project at the Portsmouth Gaseous Diffusion Plant, Piketon, Ohio, presents the information necessary to select a Site-wide disposal alternative for the waste generated under the Director's Final Findings and Orders (DFF&O) for

  2. 2012 APS-DPP Plasma Science Expo, Providence, RI | Princeton Plasma Physics

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lab APS-DPP Plasma Science Expo, Providence, RI View larger image IMG 1847 View larger image IMG 1598 View larger image IMG 1608 View larger image IMG 1609 View larger image IMG 1614 View larger image IMG 1647 View larger image IMG 1650 View larger image IMG 1651 View larger image IMG 1657 View larger image IMG 1659 View larger image IMG 1662 View larger image IMG 1663 View larger image IMG 1664 View larger image IMG 1668 View larger image IMG 1672 View larger image IMG 1675 View larger

  3. DOE Challenge Home Case Study, Caldwell and Johnson, Exeter, RI, Custom Home

    Broader source: Energy.gov (indexed) [DOE]

    Caldwell and Johnson Exeter, RI BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-e cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to

  4. NEW BV(RI){sub C} PHOTOMETRY FOR PRAESEPE: FURTHER TESTS OF BROADBAND PHOTOMETRIC CONSISTENCY

    SciTech Connect (OSTI)

    Joner, Michael D.; Taylor, Benjamin J.; Laney, C. David; Van Wyk, Francois

    2011-11-15

    New BV(RI){sub C} measurements of Praesepe made at the South African Astronomical Observatory (SAAO) are presented. When those measurements are combined with those reported in previous papers in this series, it is found that they support previously determined V zero points for Praesepe, M67, and the Hyades. Support is also found for joint (V - R){sub C} and (R - I){sub C} zero points established previously for Praesepe and NGC 752. For the SAAO system of standard stars, a B - V correction to the Johnson system of about -9 mmag appears to be reasonably well established. The preferred (though not definitive) V correction is about +7 mmag. For the Landolt V system, zero-point identity with the Johnson system at a 2{sigma} level of 4.8 mmag is found, and no color term as large as 4 mmag (mag){sup -1} is detected. Updated CDS data files for Praesepe are briefly described.

  5. Low-energy RI beam technology and nuclear clusters in the explosive pp-chain breakout process

    SciTech Connect (OSTI)

    Kubono, S. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0 (Japan); Yamaguchi, H.; Kahl, D. M.; Ohshiro, Y.; Watanabe, S.; Yamazaki, N. [Center for Nuclear Study, University of Tokyo, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Teranishi, T. [Department of Physics, Kyushu University, 6-10-1 Hakozaki, Fukuoka 812-858 (Japan); Yanagisawa, Y.; Wakabayashi, Y.; Kase, M. [RIKEN Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Hayakawa, S. [Laboratori Nazionali del Sud, Istituto Nazionale di Fisica Nucleare, Via S. Sofia 62, 95125 Catania (Italy); Kwon, Y. K. [Institute for Basic Science, 70, Yuseong-daero 1689-gil, Yuseong-gu, Daejeon 305-81 (Korea, Republic of); Hashimoto, T.; Fukuda, Y. [Research Center for Nuclear Physics, Osaka University, 10-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); He, J. J. [Institute of Modern Physics, Chinese Academy of Sciences, Nanchang Road 509, Lanzhou 73000 (China); Goto, A. [Faculty of Medcine, Yamagata University, Yamagata 990-2331 (Japan); Muto, H. [Center of General Education, Tokyo University of Science at Suwa, Chino, Nagano 391-0292 (Japan)

    2014-05-09

    The lecture includes two parts: One is a discussion on the technology for developing RIB beam facility based on the in-flight method and relevant experimental technology. The second part is a discussion on experimental efforts for studying the breakout process from the pp-chain region based on recent works with low energy RI beams. The discussion of the second part specifically covers the problem of the vp-process in type II supernovae in terms of alpha cluster nature for the reactions.

  6. Microsoft PowerPoint - Marion Gold.Providence.Infrastructure Needs for Reliability and Affordability_RI OER April 21 2104.pptx

    Broader source: Energy.gov (indexed) [DOE]

    Reliability and Affordability DOE Quadrennial Energy Review Providence, Rhode Island Monday, April 21, 2014 Marion S. Gold, Ph.D. Commissioner Rhode Island Office of Energy Resources RI Office of Energy Resources (OER) Overview The OER is the lead state agency on energy policy and programmatic matters The OER works closely with diverse partners to advance Rhode Island as a national leader in the new clean energy economy "Leading Rhode Island to a secure, cost-effective, and sustainable

  7. Risk-Informed Monitoring, Verification and Accounting (RI-MVA). An NRAP White Paper Documenting Methods and a Demonstration Model for Risk-Informed MVA System Design and Operations in Geologic Carbon Sequestration

    SciTech Connect (OSTI)

    Unwin, Stephen D.; Sadovsky, Artyom; Sullivan, E. C.; Anderson, Richard M.

    2011-09-30

    This white paper accompanies a demonstration model that implements methods for the risk-informed design of monitoring, verification and accounting (RI-MVA) systems in geologic carbon sequestration projects. The intent is that this model will ultimately be integrated with, or interfaced with, the National Risk Assessment Partnership (NRAP) integrated assessment model (IAM). The RI-MVA methods described here apply optimization techniques in the analytical environment of NRAP risk profiles to allow systematic identification and comparison of the risk and cost attributes of MVA design options.

  8. 2016 Energy Exchange (Providence, RI)

    Broader source: Energy.gov [DOE]

    The 2016 Energy Exchange in Providence, Rhode Island, will provide training to energy managers and sustainability professionals who are working to improve facility performance, advance the use of renewable energy, and reduce greenhouse gas emissions at federal sites.

  9. Training Session: East Greenwich, RI

    Broader source: Energy.gov [DOE]

    This 3.5-hour training provides builders with a comprehensive review of zero net-energy-ready home construction including the business case, detailed specifications, and opportunities to be...

  10. Small-Scale Solar Grants (Commerce RI)

    Broader source: Energy.gov [DOE]

    Commerce RI provides incentives for renewable-energy projects. Incentive programs are funded by the Rhode Island Renewable Energy Fund (REF) and alternative compliance payments (ACPs) from the...

  11. Making History

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    YGG 05-0181 Making History It's hard to imagine . . . . . . an entire city existing in secret. . . . 60,000 acres set aside for one, top-secret purpose. . . . a discovery so huge it could end a World War. It's hard to imagine - but it's true. Ray Smith * Y-12 Projects Division; Historian * oak riDge, tennessee Calutron: Designed by ernest orlando (e.o.) Lawrence to separate the isotopes of Uranium 235 (U-235) from naturally occurring uranium, where the majority is Uranium 238 (U-238). U-235 is

  12. QER Public Meeting in Providence, RI & Hartford, CT: New England...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Power Company Remarks of John F. Bilda, General Manager, ... of the United States, Canada & Australia 1 - The ... PDF icon Remarks of Kevin R. Hennessy PDF icon Remarks of ...

  13. Materials Data on Y(BIr)2 (SG:70) by Materials Project

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Kristin Persson

    2015-02-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  14. Microsoft Word - RM1_Tidal Turbine_NREL Bir, Lawson, Li_2011...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on Ocean, Offshore and Arctic Engineering OMAE2011 June 19-24, 20111, Rotterdam, the Netherland OMAE2011-50063 STRUCTURAL DESIGN OF A HORIZONTAL-AXIS TIDAL CURRENT TURBINE ...

  15. Microsoft Word - RM1_Tidal Turbine_NREL Bir, Lawson, Li_2011 1.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    11 by ASME Proceedings of the ASME 30th International Conference on Ocean, Offshore and Arctic Engineering OMAE2011 June 19-24, 20111, Rotterdam, the Netherland OMAE2011-50063 STRUCTURAL DESIGN OF A HORIZONTAL-AXIS TIDAL CURRENT TURBINE COMPOSITE BLADE ABSTRACT This paper describes the structural design of a tidal turbine composite blade. The structural design is preceded by two steps: hydrodynamic design and determination of extreme loads. The hydrodynamic design provides the blade external

  16. Materials Data on Ba7(BIr)12 (SG:166) by Materials Project

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Kristin Persson

    2015-02-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  17. Materials Data on ScBIr3 (SG:221) by Materials Project

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  18. Materials Data on LiBIr (SG:70) by Materials Project

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Kristin Persson

    2015-02-09

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  19. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    gas (LNG) used in motor vehicles is also subject to a state motor fuel tax of 0.24 on a diesel gallon equivalent (DGE) basis. For taxation purposes, one DGE of LNG is equal ...

  20. Draft Title 40 CFR 191 compliance certification application for the Waste Isolation Pilot Plant. Volume 3: Appendix BIR Volume 1

    SciTech Connect (OSTI)

    1995-03-31

    The Waste Isolation Pilot Plant (WIPP) Transuranic Waste Baseline Inventory Report (WTWBIR) establishes a methodology for grouping wastes of similar physical and chemical properties, from across the US Department of Energy (DOE) transuranic (TRU) waste system, into a series of ``waste profiles`` that can be used as the basis for waste form discussions with regulatory agencies. The majority of this document reports TRU waste inventories of DOE defense sites. An appendix is included which provides estimates of commercial TRU waste from the West Valley Demonstration Project. The WIPP baseline inventory is estimated using waste streams identified by the DOE TRU waste generator/storage sites, supplemented by information from the Mixed Waste Inventory Report (MWIR) and the 1994 Integrated Data Base (IDB). The sites provided and/or authorized all information in the Waste Stream Profiles except the EPA (hazardous waste) codes for the mixed inventories. These codes were taken from the MWIR (if a WTWBIR mixed waste stream was not in MWIR, the sites were consulted). The IDB was used to generate the WIPP radionuclide inventory. Each waste stream is defined in a waste stream profile and has been assigned a waste matrix code (WMC) by the DOE TRU waste generator/storage site. Waste stream profiles with WMCs that have similar physical and chemical properties can be combined into a waste matrix code group (WMCG), which is then documented in a site-specific waste profile for each TRU waste generator/storage site that contains waste streams in that particular WMCG.

  1. Draft Title 40 CFR 191 compliance certification application for the Waste Isolation Pilot Plant. Volume 4: Appendix BIR Volume 2

    SciTech Connect (OSTI)

    1995-03-31

    This report consists of the waste stream profile for the WIPP transuranic waste baseline inventory at Lawrence Livermore National Laboratory. The following assumptions/modifications were made by the WTWBIR team in developing the LL waste stream profiles: since only current volumes were provided by LL, the final form volumes were assumed to be the same as the current volumes; the WTWBIR team had to assign identification numbers (IDs) to those LL waste streams not given an identifier by the site, the assigned identification numbers are consistent with the site reported numbers; LL Final Waste Form Groups were modified to be consistent with the nomenclature used in the WTWBID, these changes included word and spelling changes, the assigned Final Waste Form Groups are consistent with the information provided by LL; the volumes for the year 1993 were changed from an annual rate of generation (m{sup 3}/year) to a cumulative value (m{sup 3}).

  2. Portsmouth RI/FS Report for the Process Buildings and Complex...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Study Report for the Process Buildings and Complex ... Gaseous Diffusion Plant, Piketon, Ohio, presents ... Study and Remedial Design and Remedial Action ("D&D ...

  3. 2011 Organometallic Chemistry (July 10-15, 2011, Salve Regina University, Newport, RI)

    SciTech Connect (OSTI)

    Dr. Emilio Bunel

    2011-07-15

    Organometallic chemistry has played and will continue to play a significant role in helping us understand the way bonds are made or broken in the presence of a transition metal complex. Current challenges range from the efficient exploitation of energy resources to the creative use of natural and artificial enzymes. Most of the new advances in the area are due to our extended understanding of processes at a molecular level due to new mechanistic studies, techniques to detect reaction intermediates and theory. The conference will bring the most recent advances in the field including nanocatalysis, surface organometallic chemistry, characterization techniques, new chemical reactivity and theoretical approaches along with applications to organic synthesis and the discovery of new materials. The Conference will bring together a collection of investigators who are at the forefront of their field, and will provide opportunities for junior scientists and graduate students to present their work in poster format and exchange ideas with leaders in the field. Six outstanding posters will be selected for short talks. The collegial atmosphere of this Conference, with programmed discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings, provides an avenue for scientists from different disciplines to brainstorm and promotes cross-disciplinary collaborations in the various research areas represented. Graduate students and postdoctoral fellows should also consider participating in the Gordon Research Seminar on Organometallic Chemistry (July 9-10, same location) which is specially designed to promote interaction and discussion between junior scientists.

  4. Risk Assessment in the RI/FS process, and derivation of cleanup...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    - Conceptual Site Model, fate and transport, remedial action objectives Human Health Risk Assessment * Multiple "scenarios" were evaluated, each with different exposure assumptions...

  5. http://www.hss.energy.gov/csa/analysis/rems/rems/ri.htm

    National Nuclear Security Administration (NNSA)

    Renewable Energy National Nuclear Security Administration Office of Civilian Radioactive Waste Management Office of Environmental Management Office of Fossil Energy Operations...

  6. Dissecting the cAMP-inducible allosteric switch in protein kinase A RI alpha

    SciTech Connect (OSTI)

    Sjoberg, T.J.; Kornev, A.P.; Taylor, S.S.; /SLAC

    2012-08-23

    The regulatory subunits of cAMP-dependent protein kinase (PKA) are the major receptors of cAMP in most eukaryotic cells. As the cyclic nucleotide binding (CNB) domains release cAMP and bind to the catalytic subunit of PKA, they undergo a major conformational change. The change is mediated by the B/C helix in CNB-A, which extends into one long helix that now separates the two CNB domains and docks onto the surface of the catalytic subunit. We explore here the role of three key residues on the B/C helix that dock onto the catalytic subunit, Arg226, Leu233, and Met 234. By replacing each residue with Ala, we show that each contributes significantly to creating the R:C interface. By also deleting the second CNB domain (CNB-B), we show furthermore that CNB-B is a critical part of the cAMP-induced conformational switch that dislodges the B/C helix from the surface of the catalytic subunit. Without CNB-B the K{sub a} for activation by cAMP increases from 80 to 1000 nM. Replacing any of the key interface residues with Ala reduces the K{sub a} to 25-40 nM. Leu233 and M234 contribute to a hydrophobic latch that binds the B/C helix onto the large lobe of the C-subunit, while Arg226 is part of an electrostatic switch that couples the B/C helix to the phosphate binding cassette where the cAMP docks.

  7. SwRI's HEDGE Technology for High Efficiency, Low Emissions Gasoline Engines

    Broader source: Energy.gov [DOE]

    Presentation given at the 16th Directions in Engine-Efficiency and Emissions Research (DEER) Conference in Detroit, MI, September 27-30, 2010.

  8. http://www.hss.energy.gov/csa/analysis/rems/rems/ri.htm

    National Nuclear Security Administration (NNSA)

    6th 7th 8th 9th Year 2010 2009 2008 2007 2006 2005 Program Office All Energy Efficiency and Renewable Energy National Nuclear Security Administration Office of Civilian ...

  9. Portsmouth RI/FS Report for the Site-Wide Waste Disposition Evaluation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    for the Site-Wide Waste Disposition Evaluation Project at the Portsmouth Gaseous Diffusion Plant, Piketon, Ohio, presents the information necessary to select a Site-wide...

  10. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    Gasoline and Diesel Fuel Update (EIA)

    1994 January ... 89.6 91.0 90.2 83.8 88.4 80.4 87.3 88.8 92.1 102.5 February ... 92.9 94.6 93.8 90.4 91.3 86.6 91.4 92.3 91.5 105.5...

  11. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1993 January ... 94.3 95.7 94.9 85.2 94.0 87.1 91.7 93.4 91.2 105.2 February ... 94.6 95.9 96.2 85.4 94.4 86.9 91.8 93.3 90.8 106.8...

  12. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    1995 January ... 86.9 87.6 86.7 77.8 84.8 78.4 87.3 85.7 88.4 102.4 February ... 87.4 88.2 87.8 77.4 84.9 78.5 87.3 85.9 88.5 103.4...

  13. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    Gasoline and Diesel Fuel Update (EIA)

    1996 January ... 94.6 96.1 94.5 93.0 92.0 89.1 94.9 92.6 94.7 111.7 February ... 95.9 97.5 96.2 93.2 93.8 90.8 95.6 93.7 94.4 112.9...

  14. Year Month U.S. Average PAD District I Average CT ME MA NH RI

    U.S. Energy Information Administration (EIA) Indexed Site

    1997 January ... 107.9 109.0 108.6 105.2 106.5 102.1 107.0 104.4 106.5 130.4 February ... 105.1 106.0 105.2 102.2 103.4 101.0 104.5...

  15. Scoping Document: Quarry Residuals Remedial Investigation/Feasibility Study (RI/FS) Scoping Document.

    Office of Legacy Management (LM)

  16. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2 1 Locations of Smart Grid Demonstration and Large-Scale Energy Storage Projects NH 32 Awards Support Projects in 24 States 6 11 MA...

  17. DOE Zero Energy Ready Home Case Study: Caldwell and Johnson Church Community and Housing Corporation, Charlestown, RI

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This DOE Zero Energy Ready Home garnered an Affordable Builder award in the 2014 Housing Innovation Awards, for its highly insulated construction, minisplit heat pump and water heater, and triple pane windows.

  18. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2 1 Locations of Smart Grid Demonstration and Large-Scale Energy Storage Projects NH 32 Awards Support Projects in 24 States 6 11 MA

  19. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2 1 Smart Grid Demonstration Project Locations NH MA 16 Awards Support Projects in 21 States

  20. VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    7 2 1 Energy Storage Demonstration Project Locations NH 16 Awards Support Projects in 9 States MA

  1. Quality control summary report for the RFI/RI assessment of the submerged sediment core samples taken at Par Pond, Pond C, and L-Lake

    SciTech Connect (OSTI)

    Koch, J. II

    1996-12-01

    This report presents a summary of the sediment characterization performed under the direction of the Westinghouse Savannah River Company`s (WSRC) Environmental Protection Department/Environmental Monitoring Section (EPD/EMS) in support of Par Pond, Pond C, and L- Lake. This characterization will be a screening study and will enable the Environmental Sciences Section (ESS) to develop a defensible contaminants of concern list for more extensive characterization of the Par Pond, Pond C, and L-Lake.

  2. Work Plan: Work Plan for the Remedial Investigation/Feasibility Study - Environmental Assessment (RI/FS-EA) for the Quarry Residuals Operable Unit at the Weldon Spring Site.

    Office of Legacy Management (LM)

  3. QROU Questions Fax: Fax transmits questions on the Quarry Residuals Operable Unit - Remedial Investigation Report (QROU - RI) for technical meeting set for August 14, 1997.

    Office of Legacy Management (LM)

  4. China’s Emergence and Its Impact on the Global Economy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    EIA April 08, 2008 2 Oil Shocks and Oil Shocks and External Adjustment External Adjustment By By Bodenstein Bodenstein , , Erceg Erceg , , And And Guerrieri Guerrieri (Fed Board) (Fed Board) Discussion Discussion Alessandro Alessandro Rebucci Rebucci IMF RES IMF RES 3 Paper Contribution Paper Contribution n n DGE analysis of international transmission DGE analysis of international transmission of oil shocks of oil shocks n n Alternative assumptions on trade Alternative assumptions on trade

  5. DOE - Office of Legacy Management -- Brown University - Metcalf Research

    Office of Legacy Management (LM)

    Lab - RI 01 Brown University - Metcalf Research Lab - RI 01 FUSRAP Considered Sites Site: Brown University (Metcalf Research Lab.) (RI.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Providence , Rhode Island RI.01-1 Evaluation Year: 1987 RI.01-1 Site Operations: Research/Development on the preparation of pure halides of heavy metals, Bench Scale Process, and Sample & Analysis. RI.01-1 Site Disposition: Eliminated -

  6. DOE Zero Energy Ready Home Case Study: Caldwell and Johnson,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Caldwell and Johnson, Charlestown, RI DOE Zero Energy Ready Home Case Study: Caldwell and Johnson, Charlestown, RI DOE Zero Energy Ready Home Case Study: Caldwell and Johnson, ...

  7. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    (Commerce RI) seeks to fund commercial scale renewable energy projects to generate electricity for onsite consumption. Commerce RI provides incentives for... Eligibility:...

  8. Commercial-Scale Renewable-Energy Grants

    Broader source: Energy.gov [DOE]

    The Rhode Island Commerce Corporation (Commerce RI) seeks to fund commercial scale renewable energy projects to generate electricity for onsite consumption. Commerce RI provides incentives for...

  9. Tax Credits, Rebates & Savings | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Income Residential Savings Category: Comprehensive MeasuresWhole Building Small-Scale Solar Grants (Commerce RI) Commerce RI provides incentives for renewable-energy projects....

  10. EV Community Readiness projects: New York City and Lower Hudson Valley Clean Communities, Inc. (NY, MA, PA); NYSERDA (ME, NH, VT, MA, RI, CT, NY, NJ, PA, DE, MD, DC)

    Broader source: Energy.gov [DOE]

    2013 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting

  11. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Alternative Fuel Excise Tax Liquefied petroleum gas (propane) and compressed natural gas are subject to a federal excise tax of $0.183 per gasoline gallon equivalent (GGE). The liquefied natural gas tax rate is $0.243 per diesel gallon equivalent (DGE). For taxation purposes, one GGE is equal to 5.75 pounds (lbs.) of propane and 5.66 lbs. of CNG. One DGE is equal to 6.06 lbs. of LNG. (Reference Public Law 114-41 and 26 U.S. Code 4041 and 4081) Point of Contact Excise Tax Branch U.S. Internal

  12. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Alternative Fuels Tax The state motor fuel tax on liquefied natural gas (LNG) is imposed based on the diesel gallon equivalent (DGE) and the tax on compressed natural gas (CNG) is based on the gasoline gallon equivalent (GGE). Beginning January 1, 2016, the state motor fuel tax on propane is imposed based on a GGE basis. For taxation purposes, one GGE of propane and CNG is equal to 5.75 pounds (lbs.) and 5.66 lbs., respectively, and one DGE of LNG is equal to 6.06 lbs. The North Carolina

  13. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Natural Gas and Hydrogen Tax Compressed natural gas (CNG) and hydrogen are taxed at a rate of $0.105 per gasoline gallon equivalent (GGE) until June 30, 2016; this rate will increase by $0.02 per year until July 2018. Liquefied natural gas (LNG) is taxed at a rate of $0.105 per diesel gallon equivalent (DGE) until June 30, 2016; this rate will increase by $0.02 per year until July 2018. One GGE is equal to 5.660 pounds (lbs.) of CNG or 2.198 lbs. of hydrogen. One DGE is equal to 6.06 lbs. of

  14. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Alternative Fuel Tax Rate A license tax of $0.24 per gasoline gallon equivalent (GGE) or diesel gallon equivalent (DGE) is collected on all alternative fuel used, sold, or distributed for sale or use in Wyoming. Alternative fuels include compressed natural gas (CNG), liquefied natural gas (LNG), liquefied petroleum gas (propane), electricity, and renewable diesel. For taxation purposes, one GGE of CNG is equal to 5.66 pounds (lbs.), one DGE of LNG is equal to 6.06 lbs, one GGE of propane is

  15. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Natural Gas Measurement Effective July 1, 2015, compressed natural gas (CNG) and liquefied natural gas (LNG) used for transportation must be sold in gasoline gallon equivalents (GGE) or diesel gallon equivalents (DGE) prescribed by the state, unless equivalent measures are established by the National Conference on Weights and Measures. According to current state law, one GGE is equal to 5.66 pounds (lbs.) of CNG. One DGE is equal to 6.38 lbs. of CNG or 6.06 lbs. of LNG. (Reference Senate Bill

  16. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Natural Gas Tax Beginning July 1, 2015, compressed natural gas (CNG) and liquefied natural gas (LNG) used as motor fuel must be sold in gasoline gallon equivalents (GGE) or diesel gallon equivalents (DGE). A GGE of CNG is equal to 5.66 pounds (lbs.) and a DGE of LNG is equal to 6.06 lbs. Operators of motor vehicles capable of using natural gas must pay an annual flat rate privilege tax if the vehicle has a gross vehicle weight rating (GVWR) of 10,000 lbs. or less. Natural gas vehicles (NGVs)

  17. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Natural Gas Tax Compressed natural gas (CNG) and liquefied natural gas (LNG) dispensed into a motor vehicle is taxed at a rate of $0.15 per gasoline gallon equivalent (GGE) or diesel gallon equivalent (DGE), depending on how the dispenser lists the price. A GGE is defined as 5.66 pounds (lbs.) of CNG or 5.37 lbs. of LNG. A DGE is defined as 6.380 lbs. of CNG or 6.06 lbs. of LNG. Exemptions may apply. (Reference Texas Statutes, Tax Code 162.001, and 162.351 through 162.356

  18. F

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... to h alo c ells, a nd h igher t he c ommunica0on c osts. 3. M PAS---Ocean C omputa0onal S trategies Current p erformance o p0miza0on e fforts: * Intra---block cell a nd e dge r ...

  19. ITP Aluminum: Technical Working Group on Inert Anode Technologies

    Office of Environmental Management (EM)

    HSRUWRIWKH $PHULFDQ6RFLHW\RI 0HFKDQLFDO(QJLQHHUV* 7HFKQLFDO:RUNLQJ*URXSRQ ,QHUW$QRGH7HFKQRORJLHV XQGHUFRQWUDFWWR 7KH86'HSDUWPHQWRI(QHUJ\ 2IILFHRI,QGXVWULDO7HFKQRORJLHV -XO\ CRTD - Vol. 53 5HSRUWRIWKH $PHULFDQ6RFLHW\RI 0HFKDQLFDO(QJLQHHUV* 7HFKQLFDO:RUNLQJ*URXSRQ ,QHUW$QRGH7HFKQRORJLHV

  20. What Does a Scattering Pattern Tell US?

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    amplitude e iwt Phase difference Phase difference S e i (ri Q) A(DK) fi A(Q) Fourier Transform ( ri ) DK Q 4p sin(q) l Lensless Imaging Sample Space Scattering Space...

  1. DOE Zero Energy Ready Home Case Study, Caldwell and Johnson,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Study, Caldwell and Johnson, Exeter, RI, Custom Home DOE Zero Energy Ready Home Case Study, Caldwell and Johnson, Exeter, RI, Custom Home Case study of a DOE Zero Energy Ready Home ...

  2. TCAP Summary

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    WR DGGLWLRQDO LQIRUPDWLRQ 7KLV ZHEVLWH LV XSGDWHG DV PRUH LQIRUPDWLRQ EHFRPHV DYDLODEOH HUH DUH VRPH H DPSOHV RI WKH W SHV RI LQIRUPDWLRQ RX FDQ IQG WKHUH * Experiment Planning...

  3. Update on Progress of APBF-DEC EGR/DPF/SCR Demonstration Program...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Progress of APBF-DEC EGRDPFSCR Demonstration Program at SwRI Update on Progress of APBF-DEC EGRDPFSCR Demonstration Program at SwRI 2004 Diesel Engine Emissions Reduction...

  4. Final Update on APBF-DEC EGR/DPF/SCR Demonstration Project at...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Final Update on APBF-DEC EGRDPFSCR Demonstration Project at SwRI Final Update on APBF-DEC EGRDPFSCR Demonstration Project at SwRI 2005 Diesel Engine Emissions Reduction (DEER)...

  5. Section 54

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    eT ' A (z T &z b ) )s vT m zT zB wNsN v dz BIR' I z C z B (wNsN v ) dz I z T z C (wNsN v ) dz < BIR max , q wM z T z B q w s v )s vT s v w eB z c BIR max z B BIR max 2 q v Session Papers 227 Development of an Elevated Mixed Layer Model for Parameterizing Altocumulus Cloud Layers S. Liu and S. K. Krueger Department of Meteorology University of Utah, Salt Lake City, Utah Introduction Altocumulus (Ac) clouds play an important role in the earth's energy budget through their effects on solar

  6. Microsoft PowerPoint - ACTIVE_NYC_2006_1.ppt

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ros bud sir bir 16 16.5 17 17.5 18 18.5 -65 -60 -55 -50 -45 -40 T ( C) TIME (hrs) Emerald-2 Anvil microphysics? * Recent theory lets us describe the freezing of soluble...

  7. DOE Zero Energy Ready Home Case Study: Caldwell and Johnson, Charlestown,

    Energy Savers [EERE]

    RI | Department of Energy Caldwell and Johnson, Charlestown, RI DOE Zero Energy Ready Home Case Study: Caldwell and Johnson, Charlestown, RI DOE Zero Energy Ready Home Case Study: Caldwell and Johnson, Charlestown, RI Case study of a DOE Zero Energy Ready affordable home in Charlestown, RI, that achieved a HERS Index of 47 without PV. The 2,244-ft2 two-story home with basement has 2x6 walls filled with 5.5 in. (R-23) 2-lb open-cell spray foam, R-12 closed-cell spray foam under the slab, and

  8. Comments on Draft Final Remedial Investigation (RI) for the Quarry Residuals Operable Unit, and Draft Final Baseline Risk Assessment (BRA) for the Quarry Residuals Operable Unit of the Weldon Spring Site, Both Dated April 1997. QY-500-501-1.03.

    Office of Legacy Management (LM)

  9. Document Number Q0029500 Introduction

    Office of Legacy Management (LM)

    Introduction 1.0 Introduction This Remedial Investigation (RI) AddendumRocused Feasibility Study (FFS) report updates the 1998 final RI and presents the results of a FFS conducted for Operable Unit (OU) 111, contaminated surface water and ground water, of the Monticello Mill Tailings Site (MMTS). These documents are combined to promote better reference between the updated RI information and the remedy comparisons of the FFS. This document is prepared by the U.S. Department of Energy (DOE) Grand

  10. THE AEROSPACE CORPORATION

    Office of Legacy Management (LM)

    ... LOCATION Waynesboro, PA McKeesport, PA Philadelphia, PA Williamsport, PA Philadelphia, PA Cranston, RI Fort Worth, TX Dallas, TX ''. Nitro, HV NLO Contract NLO Contract DOD DOD ...

  11. Energy Revolving Loan Fund | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Revolving Loan Fund (ELF) which provides low interest loans for RI business for energy saving investments. This loan program is funded by reprogrammed stimulus money from the...

  12. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Agricultural, Institutional Savings Category: Wind (All), Wind (Small) Local Option- Property Tax Exemption for Renewable Energy Systems Note that a separate statute (R.I....

  13. Sensitivity of a global climate model to the critical Richardson number in the boundary layer parameterization

    SciTech Connect (OSTI)

    Zhang, Ning; Liu, Yangang; Gao, Zhiqiu; Li, Dan

    2015-04-27

    The critical bulk Richardson number (Ricr) is an important parameter in planetary boundary layer (PBL) parameterization schemes used in many climate models. This paper examines the sensitivity of a Global Climate Model, the Beijing Climate Center Atmospheric General Circulation Model, BCC_AGCM to Ricr. The results show that the simulated global average of PBL height increases nearly linearly with Ricr, with a change of about 114 m for a change of 0.5 in Ricr. The surface sensible (latent) heat flux decreases (increases) as Ricr increases. The influence of Ricr on surface air temperature and specific humidity is not significant. The increasing Ricr may affect the location of the Westerly Belt in the Southern Hemisphere. Further diagnosis reveals that changes in Ricr affect stratiform and convective precipitations differently. Increasing Ricr leads to an increase in the stratiform precipitation but a decrease in the convective precipitation. Significant changes of convective precipitation occur over the inter-tropical convergence zone, while changes of stratiform precipitation mostly appear over arid land such as North Africa and Middle East.

  14. H.E.; Correia, R.J.; Kestin, J. 15 GEOTHERMAL ENERGY; 21 SPECIFIC...

    Office of Scientific and Technical Information (OSTI)

    energy resources are found in reasonable proximity. Dep. NTIS, PC A03MF A01. Brown Univ., Providence, RI (USA). Div. of Engineering Not Available United States...

  15. Small-Scale Solar Grants | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Sector Name State Administrator Commerce RI Website http:www.commerceri.comfinanceREF-Small%20Scale.php Funding Source Rhode Island Renewable Energy Fund (RIREF);...

  16. Expression of the tumor suppressor gene, p53, during the development...

    Office of Scientific and Technical Information (OSTI)

    Authors: Cora, E. ; Kane, A. 1 + Show Author Affiliations (Brown Univ., Providence, RI (United States)) Publication Date: 1991-03-15 OSTI Identifier: 5172651 Report Number(s): ...

  17. Hanford Site - 200-BP-5 | Department of Energy

    Office of Environmental Management (EM)

    RI decisional draft in preparation Sole Source Aquifer? No Basis for Exit Strategy: Other Environmental Indicators (EIs) Groundwater Migration Under Control? More Information...

  18. Lawrence Livermore National Laboratory Federal Facility Agreement...

    Office of Environmental Management (EM)

    requirements for the performance of a Remedial Investigation (RI). * Identify the nature, objective, and schedule of response actions to be taken at the Site. ESTABLISHING...

  19. 11th LANSCE School on Neutron Scattering | Hands-On Experiments

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    State University Institute for Materials Science Los Alamos Neutron Science Center MaRiE Los Alamos Neutron Science Center Matter Radiation Interactions in Extremes CINT...

  20. 11th LANSCE School on Neutron Scattering | About the School

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in Extremes program. Los Alamos National Laboratory Institute for Materials Science MaRiE Los Alamos National Laboratory Institute for Materials Science Matter Radiation...

  1. 11th LANSCE School on Neutron Scattering | Free-Day Excursion

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    State University Institute for Materials Science Los Alamos Neutron Science Center MaRiE Los Alamos Neutron Science Center Matter Radiation Interactions in Extremes CINT...

  2. MIT Plasma Science & Fusion Center: research, alcator, publications...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4th Annual Meeting of the APS Division of Plasma Physics, Providence, RI - 2012 Alcator Introduction Facility Information Tokamak Data & Real-Time Information Computer & Data...

  3. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Commercial-Scale Renewable-Energy Grants The Rhode Island Commerce Corporation (Commerce RI) seeks to fund commercial scale renewable energy projects to generate electricity for...

  4. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Small-Scale Solar Grants Commerce RI provides incentives for renewable-energy projects. Incentive programs are funded by the Rhode Island Renewable Energy Fund (REF) and...

  5. Tax Credits, Rebates & Savings | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Credits, Rebates & Savings Tax Credits, Rebates & Savings Small-Scale Solar Grants Commerce RI provides incentives for renewable-energy projects. Incentive programs are funded...

  6. Block Island Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    energy Facility Type Commercial Scale Wind Facility Status Proposed Developer Deepwater Wind Location Offshore from Block Island RI Coordinates 41.1, -71.53 Show Map Loading...

  7. Pascoag Utility District | Open Energy Information

    Open Energy Info (EERE)

    search Name: Pascoag Utility District Place: Rhode Island Website: www.pud-ri.org Twitter: @PascoagUtility Facebook: https:www.facebook.comPascoagUtilityDistrict Outage...

  8. Developments in High Efficiency Engine Technologies and an Introductio...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Developments in High Efficiency Engine Technologies and an Introduction to SwRI's Dedicated EGR Concept Developments in High Efficiency Engine Technologies and an Introduction to...

  9. Bluewater Wind Rhode Island | Open Energy Information

    Open Energy Info (EERE)

    Island Sector Wind energy Facility Type Offshore Wind Facility Status Proposed Owner NRG Bluewater Wind Developer NRG Bluewater Wind Location Atlantic Ocean RI Coordinates...

  10. QER- Comment of Elaine Mroz

    Broader source: Energy.gov [DOE]

    Elaine Mroz Quadrennial Energy Review: Comment on the Public Meetings Infrastructure Restraints- New England held April 21, 2014, in Providence, RI and Hartford, CT. Please see attached file.

  11. Microsoft PowerPoint - RCBRA Eco 10.12.11.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RCBRA Ecological Risk Assessment Overview Hanford Advisory Board River and Plateau Committee October 2011 Purpose * River Corridor Baseline Risk Assessment - Ecological Risk f ( ) h b b d h Assessment Draft C (RCBRA-Eco) has been submitted to the Regulators * Information presented forms the basis for ecological risk in th Ri C id RI/FS d t the River Corridor RI/FS documents - The RCBRA-Eco is an evaluation across the River Corridor - The RI/FS documents use Operable Unit-specific information

  12. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Terminal Woodbridge, NJ 1,000 Williams Energy Services New Haven, CT 500 Motiva Enterprises LLC New Haven, CT 250 Motiva Enterprises LLC Providence, RI 250 Source: Energy...

  13. NETL F 451.1/1-1, Categorical Exclusion Designation Form

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TBD Gordon Research Confer Kingston, RI Conference Hotel for 2016 Conference - Hotel Galvez, Galveston, TX Conference Hotel for 2018, 2020 occurrence of Conference - TBD FESCNGO...

  14. BPA-2012-01350-FOIA Request

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    r ri S'&'ri H - Ex 6 11 TI I I.'ii. *. - I 1 24 r V I It9P H 41h I -J T 806 1: 4... I U Lol 7 - p ---.. I 41 7 It oil - Lol 5136.O5 I 1 In Aft- law 1200 X. I I I...

  15. NUG-Teleconference-Nov.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Job Analytics --- 1 --- November 8, 2012 The NERSC Ecosystem is Highly Complex --- 2 --- Intricate, fi rst---of---a---kind systems and so;ware Unexplored scales InnovaAve a nd experimental a pplicaAons and w orkflows 6,000 scienAsts 600 cuEng edge codes CuEng E dge S ystems SomeAmes UnconvenAonal User Behavior Observing the Ecosystem * Through o bservaAon w e can l earn a l ot a bout h ow scienAsts use our systems and how our systems react * ScienAsts c an l ikewise learn a l ot a bout t heir

  16. II

    Office of Legacy Management (LM)

    II c )3 c F r c L LI L rr c - r I P- c OAK RlDGE NATIONAL LABORATORY h U W -l\ &?ir;; ITi' m . 8 ORNL/RASA-92/l Results of the Radiological Survey at the Former Chapman Valve Manufacturing Company, Indian Orchard, Massachusetts (cIooo1) R. D. Foley M . S. Uziel MANAGED BY MARTIN MARIETTA ENERGY SYSTEMS, INC. FOR THE UNITED STATES DEPARTMENT OF ENERGY ORNLJRASA-92/l /- HEALTH AND SAFETY RESEARCH DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Activity No. EX 20

  17. I L S-V I I I J* I LI

    Office of Legacy Management (LM)

    L - S-V I I I J* I LI 11. LI L - OAK RlDGE NATBONAL LABORATORY <;> "J :-: ,rj _ .- ORNLnM- 12225 I: ?, .,I Radiological Survey Results at the Former Bridgeport Brass Company Facility Seymour, Connecticut R. D. Foley R. F . Carrier c MANAGED BY MARTIN MARIETTA ENERGY SYSTERlS, INC. - FOR TRE UNITED STATES DEPARTMENT OF ENERGY / l- _I. _ --..--.- This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Cffice of Scientific and

  18. I I)

    Office of Legacy Management (LM)

    I) c Y LI c L II I Y c m c m ic w m c F OAK RtDGE NATIONAl LABORATORY QBfilATEO fly ~TIN MANIETTA ENEaGY SYSTEMS, INC. FOR THE UNUEO STATES DEPARTMENT of ENERGY ., / "I <: Li i * m . ORNL/TM-10439 RESULTS OF THE INDOOR RADIOLOGICAL SURVEY AT THE W . R. GRACE CO. CURTIS BAY SITE BALTIMORE, MARYLAND W . D. Cottrell R. D. Foley C. A. Johnson This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office of Scientific and Techni-

  19. Automated genome mining of ribosomal peptide natural products

    SciTech Connect (OSTI)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  20. Energy Programs at the Johns Hopkins University Applied Physics Laboratory, Quarterly Report, January-March 1980

    SciTech Connect (OSTI)

    Entingh, Daniel J.

    1980-03-01

    The Johns Hopkins University Applied Physics Laboratory, under contracts with several agencies of the federal government and an agency of the State of Maryland, is engaged in developing energy resources, utilization concepts, and monitoring and storage methods. This Quarterly Report summarizes the work on the various tasks as of 31 March 1980. The Energy Quarterly Report is divided into four sections. The first, Geothermal Energy Development Planning and Technical Assistance, supported by the Department of Energy/Division of Geothermal Energy (DOE/DGE), contains reports on the progress of geothermal-related tasks on which effort was concentrated during the quarter. The second section, Operational Research, Hydroelectric Power Development, supported by the Department of Energy/Resource Applications (DOE/DGE), contains reports on small-scale hydroelectric investigations in the southeastern states. The third section, Seismotectonic Investigation, supported by the Reactor Safety Research Division of the Nuclear Regulatory Commission, reports on a neotectonic investigation in Connecticut. The fourth section, Energy Conversion and Storage Techniques, contains two articles, the first on OTEC core unit testing supported by the Department of Energy/Division of Central Solar Technology (DOE/CST), and the second on an analysis of the Community Annual Storage Energy System at the U.S. Naval Air Station, Norfolk, Va. This work is supported by the Department of Energy and the Department of Defense, Naval Facilities Engineering Command/Atlantic Division.

  1. Slide 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    START of Process RI/FS Work Plan is finalized RI/FS Report is finalized Proposed Plan is issued for Public Comment ROD is issued Required Actions Required Notifications Publish a Notice of availability of Proposed Plan in a major local newspaper Publish a Notice of availability of ROD in a major local newspaper Optional activities for high-interest topics Solicit informal public input on the Work Plan Solicit informal public input on the RI/FS Solicit informal public input on the Proposed Plan

  2. Developments in High Efficiency Engine Technologies and an Introduction to

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SwRI's Dedicated EGR Concept | Department of Energy Developments in High Efficiency Engine Technologies and an Introduction to SwRI's Dedicated EGR Concept Developments in High Efficiency Engine Technologies and an Introduction to SwRI's Dedicated EGR Concept Provides overview of high efficiency engine technologies and introduces a dedicated exhaust gas recirculation concept where EGR production and gas stream is separate from the rest of the exhaust2012-11-06 PDF icon deer12_alger.pdf More

  3. Microsoft PowerPoint - 2011_1012_Hansen_100-K_Remediation.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    K Area Remediation Summary of Draft Su a y o a t Remedial Investigation/Feasibility Study and Proposed Plan Study and Proposed Plan October 2011 Purpose * The 100-K Remedial Investigation/Feasibility Study (RI/FS) and Proposed Plan has been submitted to the Regulators Proposed Plan has been submitted to the Regulators * This presentation provides an informational overview of the RI/FS d P d Pl RI/FS and Proposed Plan * The documents are still considered draft, and we will be working , g with the

  4. EV Community Readiness projects: New York City and Lower Hudson...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    projects: New York City and Lower Hudson Valley Clean Communities, Inc. (NY, MA, PA); NYSERDA (ME, NH, VT, MA, RI, CT, NY, NJ, PA, DE, MD, DC) EV Community Readiness...

  5. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Property Tax Exemption for Renewable Energy Systems Note that a separate statute (R.I. Gen. Laws 44-57-4) specifies that for purposes of local municipal property tax...

  6. DOE Zero Energy Ready Home Case Study, Caldwell and Johnson,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Exeter, RI, Custom Home Case study of a DOE Zero Energy Ready Home in Exeter, Rhode Island, that scored HERS 43 without PV. This 2,000 ft2 custom home has a spray- foamed...

  7. THE AEROSPACE CORPORATION

    Office of Legacy Management (LM)

    ... LOCATION Waynesboro, PA McKeesport, PA Philadelphia, 'PA f Williamsport, PA Philadelphia, PA Cranston, RI Fort Worth, TX Dallas, TX Nitro, WV REMARKS NLO Contract NLO Contract DOD ...

  8. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    statute (R.I. Gen. Laws 44-57-4) specifies that for purposes of local municipal property tax assessment, certain residential solar-energy systems may not be assessed at...

  9. Local Option- Property Tax Exemption for Renewable Energy Systems

    Broader source: Energy.gov [DOE]

    Note that a separate statute (R.I. Gen. Laws § 44-57-4) specifies that for purposes of local municipal property tax assessment, certain residential solar-energy systems may not be assessed at more...

  10. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    :00Z",6548336,"10.21726548336","COO-4051-18","EY-76-S-02-4051",,"Technical Report",,,,"Brown Univ., Providence, RI (USA). Div. of Engineering","Not Available","15 GEOTHERMAL...

  11. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    geothermal energy resources are found in reasonable proximity Dep NTIS PC A03 MF A01 Brown Univ Providence RI USA Div of Engineering Not Available United States English...

  12. Microsoft PowerPoint - NEAC Rpt of Fuel Cycle comm slides

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    R t f th F l C l Report of the Fuel Cycle Research and Development p Subcommittee of NEAC B Ri h (Ch i ) Burton Richter (Chairman) Margaret Chu Darleane Hoffman Ray Juzaitis Ray ...

  13. 100-D/H Remedial Investigation/ Feasibility Study /Proposed...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ...H RIFSPP * Received Draft RIFSPP on December 14, 2012 * Submitted comments to DOE on March 12, 2013 * DOE and Ecology are meeting to start the resolution process 100-DH RI...

  14. Geothermal resources of the Upper San Luis and Arkansas valleys...

    Open Energy Info (EERE)

    resources of the Upper San Luis and Arkansas valleys, Colorado Authors R.H. Pearl and J.K. Barrett Editors Epis, R.C. & Weimer and R.I. Published Colorado School of Mines:...

  15. The Mount Princeton geothermal area, Chaffee County, Colorado...

    Open Energy Info (EERE)

    Book Section: The Mount Princeton geothermal area, Chaffee County, Colorado Authors H.J. Olson and F. Dellechaie Editors Epis, R.C. & Weimer and R.I. Published Colorado School...

  16. BPA-2013-00088-FOIA Request

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Kirk Brown Sent: Thursday, October 18, 2012 2:13 PM To: Winn,Kim S (BPA) - DK-7 Ri CE VEt) flY BPA Subject: FOIA Request- BPA FOLA OFFICE Tftf I DATE: 'Ci, To Whom it May...

  17. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    8 Water Heating in U.S. Homes in Northeast Region, Divisions, and States, 2009" " Million ... Northeast",,,"CT, ME, NH, RI, VT" "Water Heating",,,,"MA",,,"NY","PA","NJ" "Total ...

  18. Renewable Energy Professional Certification

    Office of Energy Efficiency and Renewable Energy (EERE)

    Department of Labor and Training issues Renewable Energy Professional (REP) Certificate to any individual who is currently registered contractor in RI and fulfills at least one of the qualifications:

  19. ALS Evidence Confirms Combustion Theory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    during these next phases of combustion. Research conducted by: D.S.N. Parker and R.I. Kaiser (University of Hawaii at Manoa ), T.P. Troy and M. Ahmed (Lawrence Berkeley National...

  20. A=9Be (59AJ76)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The angular correlation of ground-state -particles with those resulting from breakup of 5He indicate J 52- (RI56D), J 32- (FA57A), for the 9Be level mainly...

  1. Solar and Wind Easements

    Broader source: Energy.gov [DOE]

    In April 2011, the provisions related to wind easements were repealed by House Bill 295 (2011) and replaced with more extensive wind easements provisions.  This legislation defines wind energy ri...

  2. A=14N (1981AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for 14N) GENERAL: See also (1976AJ04) and Table 14.10 Table of Energy Levels (in PDF or PS). Model calculations: (1976CO1R, 1978FU13). Special states: (1977GO1H, 1977RI08,...

  3. SRO-NERP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Jomes G. Wiener and MIchael H. Smith A Publication of the Savannah RI ....r Plant Notional ... SOUTH CAROLINA: A BIBLIOGRAPHY James G. Wiener 1 and Michael H. Smith Savannah River ...

  4. Renewable Energy Growth Program

    Broader source: Energy.gov [DOE]

    NOTE: In July 2015, National Grid filed its rate design proposal as specified by RI General Laws § 39-26.6-24 (S0081) which requires utilities to consider rate design that would appropriately...

  5. Energy Efficiency Standard for State Buildings

    Broader source: Energy.gov [DOE]

    In December 2015, Governor Raimondo issued an executive order establishing a renewable energy and an energy efficiency goal for the State facilities. The order directs the RI state government: 1)...

  6. Green Power Purchasing for State Facilities

    Broader source: Energy.gov [DOE]

    In December 2015, Governor Raimondo issued an executive order establishing a renewable energy and an energy efficiency goal for the State facilities. The order directs the RI state government: 1)...

  7. HEATRESV.CHP:Corel VENTURA

    Gasoline and Diesel Fuel Update (EIA)

    Terminal Woodbridge, NJ 1,000 Williams Energy Services New Haven, CT 500 Motiva Enterprises LLC New Haven, CT 250 Motiva Enterprises LLC Providence, RI 250 Total 2,000 Source:...

  8. Microsoft Word - sakai_abstract

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    will be served at 3:30 pm New Result from RIKEN RIBF Dr. H. Sakai RIKEN, Wako. Japan Abstract: Very recent experimental results from RI Beam Factory(RIBF) of RIKEN will be...

  9. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","112015" ,"Release Date:","1292016" ,"Next Release Date:","2292016" ,"Excel File Name:","n3020ri3m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavng...

  10. Microsoft Word - Tacoma-Raver-Substation-Antenna-CX.doc

    Office of Environmental Management (EM)

    EH ZRUNLQJ ZLWKLQ WKH HLVWLQJ&15; JUDYHOHG VXEVWDWLRQ DUGV DQG FRQWURO KRXVHV&30; WKHUH LV QR YHJHWDWLRQ LQ WKH DUGV DQG QR KDELWDW RU VSHFLDO DUHDV RI LQWHUHVW WKDW ZRXOG EH...

  11. Microsoft PowerPoint - Top 3 Issues_1 Accomplishment_1 Activity_Presentation 052311.ppt [Compatibility Mode]

    Office of Environmental Management (EM)

    Chairs Meeting June 15-16, 2011 ◊ North Las Vegas, Nevada Hanford Solid Waste Burial Grounds 450,000 cubic meters radioactive solid waste in unlined trenches Draft Tank Closure & Waste Management Environmental Impact Statement identified unacceptable impacts to groundwater DOE preparing 200-SWBG RCRA Facility Investigation/ Corrective Measures Study and Remedial Investigation/ Feasibility Study (RI/FS) Work Plan that will Study and Remedial Investigation/ Feasibility Study (RI/FS) Work

  12. Central Plateau Inner Area Cleanup Principles

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Inner Area Cleanup Principles * Cleanup Principles are the initial conditions and approaches to developing cleanup decisions in the Inner Area * These Principles will guide the development of the Remedial Investigations and Feasibility Studies (RI/FS) * These Principles will help DOE produce RI/FS documents to better meet regulator expectations * Formal agreement on cleanup, as influenced by these Principles, does not happen until the Record of Decision What are Cleanup Principles? 2 * The Inner

  13. Fernald Environmental Management Project Director's Final Findings & Orders, September 10, 1993 Summary

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    9/10/1993 State Ohio Agreement Type Compliance Order Legal Driver(s) CERCLA Scope Summary Integrate the groundwater monitoring activities required by OAC rules with the site-wide RI/FS groundwater characterization Parties DOE; Fernald Environmental Restoration Management Corporation (FERMCO); Ohio Environmental Protection Agency Date 9/10/1993 SCOPE * Avoid duplication and integrate the groundwater monitoring activities required by OAC rules with the site-wide RI/FS groundwater characterization.

  14. A=19F (72AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RI67J, SH67K, ZA67C, EI68A, HA68M, RI68N, UN68, BE69G, BH69, CU69B, KR69A, WA70B, LE72). Cluster model: (WI59D, SH60C, MA63Q, MA64HH, ME68H, BA69E, HI69, ME69K, TA69G, BA70F)....

  15. Appendix A Annotated Executive Summary

    Office of Legacy Management (LM)

    Annotated Executive Summary from the 1998 Final Remedial Investigation for Operable Unit I11 of the Monticello Mill Tailings Site This page intentionally left blank Document Number Q0003300 Executive Summary Executive Summary mare to'Volume I ol Introduction 1 on 1.1 { onl. . of Ulc Investigation, pg 1-1 ) This report presents results of the remedial investigation (RI) conducted for Operable Unit (OU) III of the Monticello Mill Tailings Site (MMTS). The purpose of the RI was to collect

  16. Document Number Q0029500 Significant Activities

    Office of Legacy Management (LM)

    Significant Activities 2.0 Significant Activities Since Preparation of the 1998 RI Document Since data collection for the purposes of preparing the 1998 RI report ended in 1996, several significant activities have occurred on the Millsite and surrounding peripheral properties. The following subsections provide a brief description of these activities. At the conclusion of each subsection, a summary indicates whether the described activity invalidates or results in significant changes to the

  17. Remedial investigation work plan for the Groundwater Operable Unit at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Not Available

    1994-03-01

    This Remedial Investigation (RI) Work Plan has been developed as part of the US Department of Energy`s (DOE`s) investigation of the Groundwater Operable Unit (GWOU) at Oak Ridge National Laboratory (ORNL) located near Oak Ridge, Tennessee. The first iteration of the GWOU RI Work Plan is intended to serve as a strategy document to guide the ORNL GWOU RI. The Work Plan provides a rationale and organization for groundwater data acquisition, monitoring, and remedial actions to be performed during implementation of environmental restoration activities associated with the ORNL GWOU. It Is important to note that the RI Work Plan for the ORNL GWOU is not a prototypical work plan. The RI will be conducted using annual work plans to manage the work activities, and task reports will be used to document the results of the investigations. Sampling and analysis results will be compiled and reported annually with a review of data relative to risk (screening level risk assessment review) for groundwater. This Work Plan outlines the overall strategy for the RI and defines tasks which are to be conducted during the initial phase of investigation. This plan is presented with the understanding that more specific addenda to the plan will follow.

  18. AWEA4-98A.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 This work was supported by the United States Department of Energy under Contract DE-AC04-94AL85000. Sandia is a multiprogram laboratory operated by Sandia Corp., a Lockheed Martin Company, for the United States Department of Energy. Paul Veers Sandia National Laboratories Wind Energy Technology Department Albuquerque, New Mexico, 87185-0708 Gunjit Bir National Renewable Energy Laboratory National Wind Technology Center Golden, Colorado, 80401-3393

  19. Microsoft Word - SAND2001.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1-1303 Unlimited Release Printed May 2001 The Use of Twist-Coupled Blades to Enhance the Performance of Horizontal Axis Wind Turbines Don W. Lobitz Structural Dynamics Engineering Paul S. Veers Wind Energy Technology G. Richard Eisler Engineering and Manufacturing Software Sandia National Laboratories P.O.Box 5800 Albuquerque, NM 87185-0847 David J. Laino Windward Engineering Salt Lake City, Utah 84117 Paul G. Migliore and Gunjit Bir National Renewable Energy Laboratory Golden, Colorado 80401

  20. The Spectrum of the Isotropic Diffuse Gamma-Ray Emission Derived From First-Year Fermi Large Area Telescope Data

    SciTech Connect (OSTI)

    Abdo, A. A.

    2011-08-19

    We report on the first Fermi Large Area Telescope (LAT) measurements of the so-called 'extra-galactic' diffuse {gamma}-ray emission (EGB). This component of the diffuse {gamma}-ray emission is generally considered to have an isotropic or nearly isotropic distribution on the sky with diverse contributions discussed in the literature. The derivation of the EGB is based on detailed modelling of the bright foreground diffuse Galactic {gamma}-ray emission (DGE), the detected LAT sources and the solar {gamma}-ray emission. We find the spectrum of the EGB is consistent with a power law with differential spectral index {gamma} = 2.41 {+-} 0.05 and intensity, I(> 100 MeV) = (1.03 {+-} 0.17) x 10{sup -5} cm{sup -2} s{sup -1} sr{sup -1}, where the error is systematics dominated. Our EGB spectrum is featureless, less intense, and softer than that derived from EGRET data.

  1. Microsoft Word - GreenScienceforPARC.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Proposal: G reen S cience, E vents & O ffices i n P ARC Purpose: E nergy C onsumption R eduction Rationale: A s a n E FRC w e a re o n t he c utting o f e dge o f r enewable e nergy r esearch. W e a re l eaders i n t he field. W ith t his p osition, w e c an b e b etter e xamples o f e nergy c onsumers i n o ur o wn p ractices. W e a ll recognize t hat t he s olutions t o g lobal e nergy n eeds c ome i n m any f orms; o ne o f w hich i s r educing o ur own e nergy c onsumption. Being s aid,

  2. I I LI I L I

    Office of Legacy Management (LM)

    LI - I L I 1 II C c - ORNL/RASA-9618 OAK RlDGE NATlONAl. LA8ORATORY Results of the Independent Radiological Verification Survey at B&T Metals, 425 West Town Street, Columbus, Ohio (cooolv) M . E. Murray V. P. Patania C. A. Johnson M N M E D *wD OPEbM~ B V WUCNEEDllW?ME IWiARCH CoRpoRAng FoRTHEwITf@%tATeB ltEpAAMwTmBMeR(Ly ORNL-27 (34el ~~- L._~ This report has been reproduced directly from the best available copy. Avaiiable to DOE and DOE contractors from the Office of Scientific and

  3. Fire Safety Tests for Spherical Resorcinol Formaldehyde Resin: Data Summary Report

    SciTech Connect (OSTI)

    Kim, Dong-Sang; Peterson, Reid A.; Schweiger, Michael J.

    2012-07-30

    A draft safety evaluation of the scenario for spherical resorcinol-formaldehyde (SRF) resin fire inside the ion exchange column was performed by the Hanford Tank Waste Treatment and Immobilization Plant (WTP) Fire Safety organization. The result of this draft evaluation suggested a potential change of the fire safety classification for the Cesium Ion Exchange Process System (CXP) emergency elution vessels, equipment, and piping, which may be overly bounding based on the fire performance data from the manufacturer of the ion exchange resin selected for use at the WTP. To resolve this question, the fire properties of the SRF resin were measured by Southwest Research Institute (SwRI), following the American Society for Testing and Materials (ASTM) standard procedures, through a subcontract managed by Pacific Northwest National Laboratory (PNNL). For some tests, the ASTM standard procedures were not entirely appropriate or practical for the SRF resin material, so the procedures were modified and deviations from the ASTM standard procedures were noted. This report summarizes the results of fire safety tests performed and reported by SwRI. The efforts by PNNL were limited to summarizing the test results provided by SwRI into one consolidated data report. All as-received SwRI reports are attached to this report in the Appendix. Where applicable, the precision and bias of each test method, as given by each ASTM standard procedure, are included and compared with the SwRI test results of the SRF resin.

  4. Remedial Investigation Work Plan for Chestnut Ridge Operable Unit 1 (Chestnut Ridge Security Pits) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Not Available

    1993-09-01

    This Remedial Investigation (RI) Work Plan specifically addresses Chestnut Ridge Operable Unit 1, (OU1) which consists of the Chestnut Ridge Security Pits (CRSP). The CRSP are located {approximately}800 ft southeast of the central portion of the Y-12 Plant atop Chestnut Ridge, which is bounded to the northwest by Bear Creek Valley and to the southeast by Bethel Valley. Operated from 1973 to 1988, the CRSP consisted of a series of trenches used for the disposal of classified hazardous and nonhazardous waste materials. Disposal of hazardous waste materials was discontinued in December 1984, while nonhazardous waste disposal ended on November 8, 1988. An RI is being conducted at this site in response to CERCLA regulations. The overall objectives of the RI are to collect data necessary to evaluate the nature and extent of contaminants of concern (COC), support an ecological risk assessment (ERA) and a human health risk assessment (HHRA), support the evaluation of remedial alternatives, and ultimately develop a Record of Decision for the site. The purpose of this Work Plan is to outline RI activities necessary to define the nature and extent of suspected contaminants at Chestnut Ridge OU1. Potential migration pathways also will be investigated. Data collected during the RI will be used to evaluate the overall risk posed to human health and the environment by OU1.

  5. TRU Waste Management Program. Cost/schedule optimization analysis

    SciTech Connect (OSTI)

    Detamore, J.A.; Raudenbush, M.H.; Wolaver, R.W.; Hastings, G.A.

    1985-10-01

    This Current Year Work Plan presents in detail a description of the activities to be performed by the Joint Integration Office Rockwell International (JIO/RI) during FY86. It breaks down the activities into two major work areas: Program Management and Program Analysis. Program Management is performed by the JIO/RI by providing technical planning and guidance for the development of advanced TRU waste management capabilities. This includes equipment/facility design, engineering, construction, and operations. These functions are integrated to allow transition from interim storage to final disposition. JIO/RI tasks include program requirements identification, long-range technical planning, budget development, program planning document preparation, task guidance development, task monitoring, task progress information gathering and reporting to DOE, interfacing with other agencies and DOE lead programs, integrating public involvement with program efforts, and preparation of reports for DOE detailing program status. Program Analysis is performed by the JIO/RI to support identification and assessment of alternatives, and development of long-term TRU waste program capabilities. These analyses include short-term analyses in response to DOE information requests, along with performing an RH Cost/Schedule Optimization report. Systems models will be developed, updated, and upgraded as needed to enhance JIO/RI's capability to evaluate the adequacy of program efforts in various fields. A TRU program data base will be maintained and updated to provide DOE with timely responses to inventory related questions.

  6. Report on the remedial investigation of Bear Creek Valley at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Volume 6: Appendix G -- Baseline ecological risk assessment report

    SciTech Connect (OSTI)

    1996-09-01

    This Remedial Investigation (RI) Report characterizes the nature and extent of contamination, evaluates the fate and transport of contaminants, and assesses risk to human health and the environment resulting from waste disposal and other US Department of Energy (DOE) operations in Bear Creek Valley (BCV). BCV, which is located within the DOE Oak Ridge Reservation (ORR) encompasses multiple waste units containing hazardous and radioactive wastes arising from operations at the adjacent Oak Ridge Y-12 Plant. The primary waste units discussed in this RI Report are the S-3 Site, Oil Landfarm (OLF), Boneyard/Burnyard (BYBY), Sanitary Landfill 1 (SL 1), and Bear Creek Burial Grounds (BCBG). These waste units, plus the contaminated media resulting from environmental transport of the wastes from these units, are the subject of this RI. This BCV RI Report represents the first major step in the decision-making process for the BCV watershed. The RI results, in concert with the follow-on FS will form the basis for the Proposed Plan and Record of Decision for all BCV sites. This comprehensive decision document process will meet the objectives of the watershed approach for BCV. Appendix G contains ecological risks for fish, benthic invertebrates, soil invertebrates, plants, small mammals, deer, and predator/scavengers (hawks and fox). This risk assessment identified significant ecological risks from chemicals in water, sediment, soil, and shallow ground water. Metals and PCBs are the primary contaminants of concern.

  7. Incorporating ecological risk assessment into remedial investigation/feasibility study work plans

    SciTech Connect (OSTI)

    Not Available

    1994-06-01

    This guidance document (1) provides instructions on preparing the components of an ecological work plan to complement the overall site remedial investigation/feasibility study (RI/FS) work plan and (2) directs the user on how to implement ecological tasks identified in the plan. Under the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA), as amended by the Superfund Amendments and Reauthorization Act of 1986 (SARA), and RI/FS work plan will have to be developed as part of the site-remediation scoping process. Specific guidance on the RI/FS process and the preparation of work plans has been developed by the US Environmental Protection Agency (EPA 1988a). This document provides guidance to US Department of Energy (DOE) staff and contractor personnel for incorporation of ecological information into environmental remediation planning and decision making at CERCLA sites.

  8. Microsoft Word - figure_14.doc

    Gasoline and Diesel Fuel Update (EIA)

    42 Figure 14. Net interstate movements, imports, and exports of natural gas in the United States, 2014 (million cubic feet) Norway Trinidad/ Tobago Yemen Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI Other TX IN MA RI MA MA CT VA DC MD DC VT MA NH MA WA M T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K Mexico C a n a d a C a n a d a Canada

  9. ITP Aluminum: Energy and Environmental Profile of the U.S. Aluminum Industry

    Energy Savers [EERE]

    and Environmental Profile of the U.S. Aluminum Industry July 1997 Prepared by , Inc. Columbia, Maryland Prepared for U.S. Department of Energy Office of Industrial Technologies $&.12:/('*0(176 7KLVUHSRUWZDVZULWWHQE\1DQF\0DUJROLVRI(QHUJHWLFV,QFRUSRUDWHGLQ&ROXPELD0DU\ODQG 7KHUHSRUWZDVSUHSDUHGXQGHUWKHJHQHUDOGLUHFWLRQRI/RXLV6RXVD86'HSDUWPHQWRI(QHUJ\

  10. Remedial investigation report on Waste Area Group 5 at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Volume 1: Technical summary

    SciTech Connect (OSTI)

    1995-03-01

    A remedial investigation (RI) was performed to support environmental restoration activities for Waste Area Grouping (WAG) 5 at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The WAG 5 RI made use of the observational approach, which concentrates on collecting only information needed to assess site risks and support future cleanup work. This information was interpreted and is presented using the framework of the site conceptual model, which relates contaminant sources and release mechanisms to migration pathways and exposure points that are keyed to current and future environmental risks for both human and ecological receptors. The site conceptual model forms the basis of the WAG 5 remedial action strategy and remedial action objectives. The RI provided the data necessary to verify this model and allows recommendations to be made to accomplish those objectives.

  11. Principles of providing inherent self-protection and passive safety characteristics of the SVBR-75/100 type modular reactor installation for nuclear power plants of different capacity and purpose

    SciTech Connect (OSTI)

    Toshinsky, G.I.; Komlev, O.G.; Novikova, N.N.; Tormyshev, I.V.; Stepanov, V.S.; Klimov, N.N.; Dedoul, A.V.

    2007-07-01

    The report presents a brief description of the reactor installation SVBR-75/100, states a concept of providing the RI safety and presents the basic results of the analysis of the most dangerous pre-accidental situations and beyond the design basis accidents, which have been obtained in the process of validating the RI safety. It has been shown that the safety functions concerning the accidental shutdown of the reactor, total blacking out of the NPP and localization of the accidental situation relating to the postulated simultaneous rupture of several steam-generator tubes are not subject to influence of the human factor and are entirely realized in a passive way. (authors)

  12. HANFORD ADVISORY BOARD A Site Specific Advisory Board, Chartered under the Federal Advisory Committee Act

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Subject: 300 Area RI/FS & Proposed Plan Adopted: June 8, 2012 Page 1 June 8, 2012 Matt McCormick, Manager U.S. Department of Energy, Richland Operations P.O. Box 550 (A7-50) Richland, WA 99352 Dennis Faulk, Manager U.S. Environmental Protection Agency, Region 10 309 Bradley Blvd, Suite 115 Richland WA 99352 Re: 300 Area RI/FS and Proposed Plan Dear Messrs. McCormick and Faulk, Background Final decisions about cleanup at Hanford's 300 Area are important because of their potential impacts to

  13. HANFORD ADVISORY BOARD A Site Specific Advisory Board, Chartered under the Federal Advisory Committee Act

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8 Subject: 100 D/H RI/FS, Draft A Adopted: June 5, 2014 Page 1 June 5, 2014 Doug Shoop, Acting Manager U.S. Department of Energy, Richland Operations P.O. Box 550 (A7-75) Richland, WA 99352 Dennis Faulk, Manager U.S. Environmental Protection Agency, Region 10 309 Bradley Blvd., Suite 115 Richland, WA 99352 Jane Hedges, Manager Washington State Department of Ecology 3100 Port of Benton Blvd. Richland, WA 99354 Re: 100 D/H RI/FS, Draft A Dear Messrs. Shoop, Faulk and Ms. Hedges, Background A

  14. PROJECT PROFILE: Southwest Research Institute | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Southwest Research Institute PROJECT PROFILE: Southwest Research Institute Funding Opportunity: CSP: APOLLO SunShot Subprogram: CSP Location: San Antonio, TX Amount Awarded: $5,350,000 Awardee Cost Share: $3,440,874 SWRI Logo.jpg The Southwest Research Institute (SwRI) will design, manufacture, and test an ultra-high efficiency supercritical carbon dioxide (sCO2) compressor-expander, or "compander," for power generation at CSP plants. SwRI will collaborate with Samsung Techwin America

  15. All-dielectric three-dimensional broadband Eaton lens with large refractive index range

    SciTech Connect (OSTI)

    Yin, Ming; Yong Tian, Xiao, E-mail: leoxyt@mail.xjtu.edu.cn; Ling Wu, Ling; Chen Li, Di [State Key Laboratory for Manufacturing Systems Engineering, Xi'an Jiaotong University, Xi'an 710049 (China)

    2014-03-03

    We proposed a method to realize three-dimensional (3D) gradient index (GRIN) devices requiring large refractive index (RI) range with broadband performance. By combining non-resonant GRIN woodpile photonic crystals structure in the metamaterial regime with a compound liquid medium, a wide RI range (16.32) was fulfilled flexibly. As a proof-of-principle for the low-loss and non-dispersive method, a 3D Eaton lens was designed and fabricated based on 3D printing process. Full-wave simulation and experiment validated its omnidirectional wave bending effects in a broad bandwidth covering Ku band (12?GHz18?GHz)

  16. novel-concepts | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Large Volume Carbon Dioxide Compression Novel Concepts for the Compression of Large Volumes of Carbon Dioxide Project No.: FC26-05NT42650 The Southwest Research Institute (SwRI) will design an efficient and cost-effective compression system to reduce the overall cost of carbon dioxide (CO2) capture and storage for coal-based power plants. SwRI will develop two novel concepts that have the potential to reduce CO2 compression power requirements by 35 percent compared to conventional compressor

  17. Microsoft PowerPoint - E1111057_A.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ri d Pl t C itt DOE's Largest Environmental Cleanup Closure Project River and Plateau Committee 618-10/11 Burial Grounds and 324 Ri C id Grounds and 324 Building Update River Corridor Closure Project River Corridor Closure Project Mark French and Jamie Zeisloft U.S. Department of Energy D b 7 2011 December 7, 2011 Protecting the Columbia River U.S. Department of Energy Richland Operations Office RIVER CORRIDOR CLOSURE PROJECT One Team for Safe, Visible Cleanup of the River Corridor 618-10 Burial

  18. Document Number Q0029500 Summary and Conclusions

    Office of Legacy Management (LM)

    Summary and Conclusions 6.0 Summary and Conclusions In 1990, a RIBS and ROD were completed for MMTS OUs I and 11. A RI was completed for OU I11 in 1998 and subsequent interim action performed. This report presents the results of the interim remedial action and completes' the remedial investigatiodfeasibility study process. Info~mation presented in this RI A d d e n d u d F S for OU 111 of MMTS is summarized in the following sections. 6.1 Physical Site Characteristics The hydrostratigraphic units

  19. CABLE AOORIs*. HICRONIZER. MOORLblOWN. NEW ,SRIEY

    Office of Legacy Management (LM)

    NEW ALBANY ROAD . MOORESTOWN . NEW ]ERSEY CABLE AOORIs*. HICRONIZER. MOORLblOWN. NEW ,SRIEY be returned further obliga- may desire any patent protection, provi#ed; however, that the costa in connectSo& with the pregaration;~~fillrig nnd prosecution of the same shall be entirely: at ?SG,~~e~enS.e ,of our..company. This provision, how- ever, ls.' subJect:to eny.~prlor'arra~cmont between your Institu- tion and the government with respect to inventions and p?j,tents. ,.: 3,ri 'I :: .:v:ri :!:!p,

  20. Federal Guidance Report No. 13

    National Nuclear Security Administration (NNSA)

    QLWHG 6WDWHV $LU DQG 5DGLDWLRQ (3$ 5 (QYLURQPHQWDO 3URWHFWLRQ - 6HSWHPEHU $JHQF\ &DQFHU5LVN&RHIILFLHQWVIRU (QYLURQPHQWDO([SRVXUHWR 5DGLRQXFOLGHV )HGHUDO*XLGDQFH5HSRUW1R 7KLV UHSRUW ZDV SUHSDUHG DV DQ DFFRXQW RI ZRUN VSRQVRUHG E\ DJHQFLHV RI WKH 8QLWHG 6WDWHV *RYHUQPHQW 1HLWKHU WKH 8QLWHG 6WDWHV *RYHUQPHQW QRU DQ\ DJHQF\ WKHUHRI

  1. I'

    Office of Legacy Management (LM)

    N.y.%2 ,.; 1 - VF :' ,. .., . ., .' !..' I' t ,f. : ._ : II . .."W ,.I , : 3~4k-~%d . !3cx #TO ._ I' _' >. ._ .:f$ -7 : _ ..:.>, .a ._ 5 &[&,v# 24+4&&3 7-&i 4 ?. 6. Bpp, chaof, Tonrrrrprda 8ub-offioo .-. bgwt16, 1980 L P. Y. Bolwro, D@oetos, Prodwtiam Dlriaicai, Bow York c MX-808 RM B&B BTLIBXB , 8YMmr mo8Dom8rr - 1' _, ~q,< Roforonao ir wdo' to ymr amno- 'oononminc; (L qrorrrttty af hpw-'b'lub arida Vndor It8 domestio wanltr pmgrk, OIo Carirrloa bir

  2. I'

    Office of Legacy Management (LM)

    Fou4 ,...-, ,/' / / I' ,/* ,I ,/' 4 ft ,,/- ,/ ./ "' /, 3: :GSD : mh Sylvania Electric Products, Inc. Cantiague Z.oad, P.O. Uox 75 iiicksvill~, I.cng Island. :!.a~ York <; 1. 5,756 lbs. of Fernsld rojeot slugs. 2. 10,000 lbs. rujeoted powder metallurgy slugs. 3. 5,3!;5 lbs. uranium scrap and sludge*. *Th'Ls material, we unc?srstanct, h4S alreedy been shi$ped and this cmfims nuthor.jeatioiito do 80.. %rthar,~in ncxord with the conver&ntion with bir. IStz ws are cancelling your order

  3. Identification of 300 Area Contaminants of Potential Concern for Soil

    SciTech Connect (OSTI)

    R.W. Ovink

    2010-04-05

    This report documents the process used to identify source area contaminants of potential concern (COPCs) in support of the 300 Area remedial investigation/feasibility study (RI/FS) work plan. This report also establishes the exclusion criteria applicable for 300 Area use and the analytical methods needed to analyze the COPCs.

  4. Atterbury,Laura M DK-7 From: Ex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    March 09, 2010 1234 PM To, FOIA Subject: FO(A Request i:l ( 11% 1) ON RI I % t t 11 I TIUS 1tt4 :- '' to e'a The following is a New FOJA request: Name: Torn Jacobs No...

  5. Fact #775: April 15, 2013 Top Ten Urban Areas for Fuel Wasted...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    IL-IN 127 4 Miami FL 94 5 Washington DC-VA-MD 85 6 Philadelphia PA-NH-DE-MD 76 7 Dallas-Fort Worth-Arlington TX 75 8 Boston MA-NH-RI 67 9 Houston TX 66 10 San ...

  6. 100-K Target Analyte List Development for Soil

    SciTech Connect (OSTI)

    Ovink, R.

    2012-09-18

    This report documents the process used to identify source area target analytes in support of the 100-K Area remedial investigation/feasibility study (RI/FS) addendum to the Integrated 100 Area Remedial Investigation/Feasibility Study Work Plan (DOE/RL-2008-46, Rev. 0).

  7. Ecological risk assessment guidance for preparation of remedial investigation/feasibility study work plans

    SciTech Connect (OSTI)

    Pentecost, E.D.; Vinikour, W.S.

    1993-08-01

    This guidance document (1) provides instructions on preparing the components of an ecological work plan to complement the overall site remedial assessment investigation/feasibility study (RI/FS) work plan and (2) directs the user on how to implement ecological tasks identified in the plan. Under the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA), as amended by the Superfired Amendments and Reauthorization Act of 1986 (SARA), an RI/FS work plan win have to be developed as part of the site-remediation scoping the process. Specific guidance on the RI/FS process and the preparation of work plans has been developed by the US Environmental Protection Agency (EPA 1988a). This document provides guidance to US Department of Energy (DOE) staff and contractor personnel for incorporation of ecological information into environmental remediation planning and decision making at CERCLA sites. An overview analysis of early ecological risk assessment methods (i.e., in the 1980s) at Superfund sites was conducted by the EPA (1989a). That review provided a perspective of attention given to ecological issues in some of the first RI/FS studies. By itself, that reference is of somewhat limited value; it does, however, establish a basis for comparison of past practices in ecological risk with current, more refined methods.

  8. Airborne aerosol in situ measurements during TCAP: A closure study of total scattering

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kassianov, Evgueni; Sedlacek, Arthur; Berg, Larry K.; Pekour, Mikhail; Barnard, James; Chand, Duli; Flynn, Connor; Ovchinnikov, Mikhail; Schmid, Beat; Shilling, John; et al

    2015-07-31

    We present a framework for calculating the total scattering of both non-absorbing and absorbing aerosol at ambient conditions from aircraft data. Our framework is developed emphasizing the explicit use of chemical composition data for estimating the complex refractive index (RI) of particles, and thus obtaining improved ambient size spectra derived from Optical Particle Counter (OPC) measurements. The feasibility of our framework for improved calculations of total scattering is demonstrated using three types of data collected by the U.S. Department of Energy’s (DOE) aircraft during the Two-Column Aerosol Project (TCAP). Namely, these data types are: (1) size distributions measured by amore » suite of OPC’s; (2) chemical composition data measured by an Aerosol Mass Spectrometer and a Single Particle Soot Photometer; and (3) the dry total scattering coefficient measured by a integrating nephelometer and scattering enhancement factor measured with a humidification system. We demonstrate that good agreement (~10%) between the observed and calculated scattering can be obtained under ambient conditions (RH < 80%) by applying chemical composition data for the RI-based correction of the OPC-derived size spectra. We also demonstrate that ignoring the RI-based correction or using non-representative RI values can cause a substantial underestimation (~40%) or overestimation (~35%) of the calculated scattering, respectively.« less

  9. Revised Manuscript

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1956PA23 E.B. Paul, Physica 22 (1956) 1140A 1956PU41 T.M. Putnam, J.E. Brolley and Jr., L. Rosen, Phys. Rev. 104 (1956) 1303 1956RI37 A.C. Riviere, Nucl. Phys. 2 (1956) 81...

  10. Remedial Investigation Work Plan for Chestnut Ridge Operable Unit 1 (Chestnut Ridge Security Pits) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Not Available

    1994-03-01

    This document outlines the activities necessary to conduct a Remedial Investigation (RI) of the Chestnut Ridge Security Pits (CRSP) at the Oak Ridge Y-12 Plant. The CRSP, also designated Chestnut Ridge Operable Unit (OU) 1, is one of four OUs along Chestnut Ridge on the Oak Ridge Reservation (ORR). The purpose of the RI is to collect data to (1) evaluate the nature and extent of known and suspected contaminants, (2) support an Ecological Risk Assessment (ERA) and a Human Health Risk Assessment (HHRA), (3) support the feasibility study in the development and analysis of remedial alternatives, and (4) ultimately, develop a Record of Decision (ROD) for the site. This chapter summarizes the regulatory background of environmental investigation on the ORR and the approach currently being followed and provides an overview of the RI to be conducted at the CRSP. Subsequent chapters provide details on site history, sampling activities, procedures and methods, quality assurance (QA), health and safety, and waste management related to the RI.

  11. F-1 U.S. Energy Information Administration | Annual Energy Outlook...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH...

  12. F-5 U.S. Energy Information Administration | Annual Energy Outlook...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT ME RI MA NH VA WI MI OH NE...

  13. BPA-2013-01305-FOIA Request

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Van Cleve pc TEL (503) 241-7242 * FAX (503) 241-8160 * maildvlaw.com Suite 400 333 SW Taylor Portland, OR 97204 RI(FII) BY Bll,x FOI,4 OFHCE 1'1IIS July 11, 2013 ).TE 753...

  14. Remedial investigation report for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Remedial investigation results

    SciTech Connect (OSTI)

    Yuen, C. R.; Martino, L. E.; Biang, R. P.; Chang, Y. S.; Dolak, D.; Van Lonkhuyzen, R. A.; Patton, T. L.; Prasad, S.; Quinn, J.; Rosenblatt, D. H.; Vercellone, J.; Wang, Y. Y.

    2000-03-14

    This report presents the results of the remedial investigation (RI) conducted at J-Field in the Edgewood Area of Aberdeen Proving Ground (APG), a U.S. Army installation located in Harford County, Maryland. Since 1917, activities in the Edgewood Area have included the development, manufacture, and testing of chemical agents and munitions and the subsequent destruction of these materials at J-Field by open burning and open detonation. These activities have raised concerns about environmental contamination at J-Field. This RI was conducted by the Environmental Conservation and Restoration Division, Directorate of Safety, Health and Environmental Division of APG, pursuant to requirements outlined under the Comprehensive Environmental Response, Compensation, and Liability Act, as amended (CERCLA). The RI was accomplished according to the procedures developed by the U.S. Environmental Protection Agency (EPA 1988). The RI provides a comprehensive evaluation of the site conditions, nature of contaminants present, extent of contamination, potential release mechanisms and migration pathways, affected populations, and risks to human health and the environment. This information will be used as the basis for the design and implementation of remedial actions to be performed during the remedial action phase, which will follow the feasibility study (FS) for J-Field.

  15. 100-N Area Decision Unit Target Analyte List Development for Soil

    SciTech Connect (OSTI)

    Ovink, R.

    2012-09-18

    This report documents the process used to identify source area target analytes in support of the 100-N Area remedial investigation/feasibility study (RI/FS) addendum to the Integrated 100 Area Remedial Investigation/Feasibility Study Work Plan (DOE/RL-2008-46, Rev. 0).

  16. Feed'Pump Hydraulic Performance and Design Improvement, Phase...

    Office of Scientific and Technical Information (OSTI)

    by means of theoretical 3-3 DISPLACEMENT ( y i L S . P K - P K ) PHASE LAG (DEGREES) JTHi-i y'l q-tr it T3F- :r;i - p ' 111 H O G m I 1-3 tD 05 rt DISPLACEMENT (MILS PK-PK)...

  17. Final Meeting Summary Page 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6, 2014 FINAL MEETING SUMMARY HANFORD ADVISORY BOARD RIVER AND PLATEAU COMMITTEE May 6, 2014 Richland, WA Topics in this Meeting Summary Opening ......................................................................................................................................................... 1 Advice Development: 100-F Remedial Investigation and Feasibility Study (RI/FS) and Proposed Plan Revision 0

  18. Remedial investigation/feasibility study Work Plan and addenda for Operable Unit 4-12: Central Facilities Area Landfills II and III at the Idaho National Engineering Laboratory

    SciTech Connect (OSTI)

    Keck, K.N.; Stormberg, G.J.; Porro, I.; Sondrup, A.J.; McCormick, S.H.

    1993-07-01

    This document is divided into two main sections -- the Work Plan and the addenda. The Work Plan describes the regulatory history and physical setting of Operable Unit 4-12, previous sampling activities, and data. It also identifies a preliminary conceptual model, preliminary remedial action alternatives, and preliminary applicable or relevant and appropriate requirements. In addition, the Work Plan discusses data gaps and data quality objectives for proposed remedial investigation activities. Also included are tasks identified for the remedial investigation/feasibility study (RI/FS) and a schedule of RI/FS activities. The addenda include details of the proposed field activities (Field Sampling Plan), anticipated quality assurance activities (Quality Assurance Project Plan), policies and procedures to protect RI/FS workers and the environment during field investigations (Health and Safety Plan), and policies, procedures, and activities that the Department of Energy will use to involve the public in the decision-making process concerning CFA Landfills II and III RI/FS activities (Community Relations Plan).

  19. Development of a rotary engine powered APU for a medium duty hybrid shuttle bus. Interim report July 1995--July 1996

    SciTech Connect (OSTI)

    McBroom, S.T.

    1998-07-01

    Under contract to the TARDEC Petroleum and Water Business Area, sponsored by the Defense Advanced Research Projects Agency, SwRI has procured and installed a rotary Auxiliary Power Unit on a medium-duty series hybrid electric bus. This report covers the specification and distillation of the APU and the lessons learned from those efforts.

  20. Revised Manuscript

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Phys. Rev. 101 (1956) 158 1956RI37 A.C. Riviere, Nucl. Phys. 2 (1956) 81 1956RO06 A.B. Robbins, Phys. Rev. 101 (1956) 1373 1956SC01 J.P. Schiffer, T.W. Bonner, R.H. Davis and F.W....

  1. Combustion Targets for Low Emissions and High Efficiency | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Targets for Low Emissions and High Efficiency Combustion Targets for Low Emissions and High Efficiency 2005 Diesel Engine Emissions Reduction (DEER) Conference Presentations and Posters PDF icon 2005_deer_ryan.pdf More Documents & Publications Diesel Engine Alternatives An Experimental Investigation of Low Octane Gasoline in Diesel Engines SwRI's HEDGE Technology for High Efficiency, Low Emissions Gasoline Engines

  2. A=17O (1977AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1973KU04, 1973LA1D, 1973RE17, 1973SM1C, 1974LO04, 1974RI09, 1976PO01). Collective and cluster models: (1969FE1A, 1971AR1R, 1972LE1L, 1972NE1B). Special levels: (1968KA1C,...

  3. A=11B (1985AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    PDF or PS). Shell and deformed models:(1981BO1Y, 1981RA06, 1982BO01, 1983VA31, 1984VA06). Cluster model:(1979NI06, 1980FU1G, 1983SH38). Special states:(1979NI06, 1980RI06,...

  4. A=18F (72AJ02)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    WA70U, AR71O, EL71, GU71I, HO71C, JA71D, LO71H, PE71, PR71D, QU71A, WI71B, KA72, LE72). Cluster, collective and deformed models:(KE64D, MA64HH, PI66A, RI66G, FE67A, PA67Q, EL68,...

  5. Waste Management Plan for the Oak Ridge National Remedial Investigation/Feasibility Study

    SciTech Connect (OSTI)

    Not Available

    1988-04-01

    In accordance with the requirements of the Remedial Investigation/Feasibility Study (RI/FS) Project Quality Assurance Plan, this Waste Management Plan establishes clear lines of responsibility and authority, documentation requirements, and operational guidance for the collection, identification, segregation, classification, packaging, certification, and storage/disposal of wastes. These subjects are discussed in the subsequent sections of this document.

  6. Microsoft Word - HAB_2010_0616_RAP_FINAL.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6, 2010 FINAL MEETING SUMMARY HANFORD ADVISORY BOARD RIVER AND PLATEAU COMMITTEE MEETING June 16, 2010 Richland, WA Topics in this Meeting Summary Welcome and introductions ................................................................................................ 1 Comprehensive Land Use Plan (CULP) ............................................................................. 1 100-N Remedial Investigation/Feasibility Study (RI/FS) Work Plan Advice .................... 5 Action Items /

  7. Slide 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ER RI I W Wi in nt te er r S Su ur rf fa ac ce e G Gr re ee en nh ho ou us se e F Fl lu ux xe es s Greenhouse Gas Emission Band (cm -1 ) GL Flux (Wm 2 ) AERI Flux (Wm 2 ) CFC-11...

  8. WA_00_015_COMPAQ_FEDERAL_LLC_Waiver_Domestic_and_Foreign_Pat.pdf |

    Broader source: Energy.gov (indexed) [DOE]

    Department of Energy 0_015_COMPAQ_FEDERAL_LLC_Waiver_Domestic_and_Foreign_Pat.pdf More Documents & Publications WA_01_018_IBM_Waiver_of_Governement_US_and_Foreign_Patent_Ri.pdf Advance Patent Waiver W(A)2002-023 WC_1997_004_CLASS_ADVANCE_WAIVER_Under_Domestic_First_and_Se.pdf

  9. WA_97_027_GENERAL_ATOMICS__CORPORATION_Waiver_of_Domestic_an.pdf |

    Broader source: Energy.gov (indexed) [DOE]

    Department of Energy 97_027_GENERAL_ATOMICS__CORPORATION_Waiver_of_Domestic_an.pdf More Documents & Publications WA_99_014_UNITED_SOLAR_SYSTEMS_CORP_Waiver_of_Domestic_and_F.pdf WA_97_006_MOTOROLA_MANUFACTURING_SYSTEMS_Waiver_of_Patent_Ri.pdf Inspection Report: INS-O-00-02

  10. Airborne aerosol in situ measurements during TCAP: A closure study of total scattering

    SciTech Connect (OSTI)

    Kassianov, Evgueni; Sedlacek, Arthur; Berg, Larry K.; Pekour, Mikhail; Barnard, James; Chand, Duli; Flynn, Connor; Ovchinnikov, Mikhail; Schmid, Beat; Shilling, John; Tomlinson, Jason; Fast, Jerome

    2015-07-31

    We present a framework for calculating the total scattering of both non-absorbing and absorbing aerosol at ambient conditions from aircraft data. Our framework is developed emphasizing the explicit use of chemical composition data for estimating the complex refractive index (RI) of particles, and thus obtaining improved ambient size spectra derived from Optical Particle Counter (OPC) measurements. The feasibility of our framework for improved calculations of total scattering is demonstrated using three types of data collected by the U.S. Department of Energy’s (DOE) aircraft during the Two-Column Aerosol Project (TCAP). Namely, these data types are: (1) size distributions measured by a suite of OPC’s; (2) chemical composition data measured by an Aerosol Mass Spectrometer and a Single Particle Soot Photometer; and (3) the dry total scattering coefficient measured by a integrating nephelometer and scattering enhancement factor measured with a humidification system. We demonstrate that good agreement (~10%) between the observed and calculated scattering can be obtained under ambient conditions (RH < 80%) by applying chemical composition data for the RI-based correction of the OPC-derived size spectra. We also demonstrate that ignoring the RI-based correction or using non-representative RI values can cause a substantial underestimation (~40%) or overestimation (~35%) of the calculated scattering, respectively.

  11. Remedial investigation work plan for Chestnut Ridge Operable Unit 4 (Rogers Quarry/Lower McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Not Available

    1993-09-01

    The Oak Ridge Y-12 Plant includes - 800 acres near the northeast comer of the reservation and adjacent to the city of Oak Ridge (Fig. 1-1). The plant is a manufacturing and developmental engineering facility that produced components for various nuclear weapons systems and provides engineering support to other Energy Systems facilities. More than 200 contaminated sites have been identified at the Y-12 Plant that resulted from past waste management practices. Many of the sites have operable units (OUs) based on priority and on investigative and remediation requirements. This Remedial Investigation RI work plan specifically addresses Chestnut Ridge OU 4. Chestnut Ridge OU 4 consists of Rogers Quarry and Lower McCoy Branch (MCB). Rogers Quarry, which is also known as Old Rogers Quarry or Bethel Valley Quarry was used for quarrying from the late 1940s or early 1950s until about 1960. Since that time, the quarry has been used for disposal of coal ash and materials from Y-12 production operations, including classified materials. Disposal of coal ash ended in July 1993. An RI is being conducted at this site in response to CERCLA regulations. The overall objectives of the RI are to collect data necessary to evaluate the nature and extent of contaminants of concern, support an Ecological Risk Assessment and a Human Health Risk Assessment, support the evaluation of remedial alternatives, and ultimately develop a Record of Decision for the site. The purpose of this work plan is to outline RI activities necessary to define the nature and extent of suspected contaminants at Chestnut Ridge OU 4. Potential migration pathways also will be investigated. Data collected during the RI will be used to evaluate the risk posed to human health and the environment by OU 4.

  12. Semiquantitative Analysis Using Thallium-201 SPECT for Differential Diagnosis Between Tumor Recurrence and Radiation Necrosis After Gamma Knife Surgery for Malignant Brain Tumors

    SciTech Connect (OSTI)

    Matsunaga, Shigeo; Shuto, Takashi; Takase, Hajime; Ohtake, Makoto; Tomura, Nagatsuki; Tanaka, Takahiro; Sonoda, Masaki

    2013-01-01

    Purpose: Semiquantitative analysis of thallium-201 chloride single photon emission computed tomography ({sup 201}Tl SPECT) was evaluated for the discrimination between recurrent brain tumor and delayed radiation necrosis after gamma knife surgery (GKS) for metastatic brain tumors and high-grade gliomas. Methods and Materials: The medical records were reviewed of 75 patients, including 48 patients with metastatic brain tumor and 27 patients with high-grade glioma who underwent GKS in our institution, and had suspected tumor recurrence or radiation necrosis on follow-up neuroimaging and deteriorating clinical status after GKS. Analysis of {sup 201}Tl SPECT data used the early ratio (ER) and the delayed ratio (DR) calculated as tumor/normal average counts on the early and delayed images, and the retention index (RI) as the ratio of DR to ER. Results: A total of 107 tumors were analyzed with {sup 201}Tl SPECT. Nineteen lesions were removed surgically and histological diagnoses established, and the other lesions were evaluated with follow-up clinical and neuroimaging examinations after GKS. The final diagnosis was considered to be recurrent tumor in 65 lesions and radiation necrosis in 42 lesions. Semiquantitative analysis demonstrated significant differences in DR (P=.002) and RI (P<.0001), but not in ER (P=.372), between the tumor recurrence and radiation necrosis groups, and no significant differences between metastatic brain tumors and high-grade gliomas in all indices (P=.926 for ER, P=.263 for DR, and P=.826 for RI). Receiver operating characteristics analysis indicated that RI was the most informative index with the optimum threshold of 0.775, which provided 82.8% sensitivity, 83.7% specificity, and 82.8% accuracy. Conclusions: Semiquantitative analysis of {sup 201}Tl SPECT provides useful information for the differentiation between tumor recurrence and radiation necrosis in metastatic brain tumors and high-grade gliomas after GKS, and the RI may be the most valuable index for this purpose.

  13. Report on the remedial investigation of Bear Creek Valley at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Volume 2: Appendix A -- Waste sites, source terms, and waste inventory report; Appendix B -- Description of the field activities and report database; Appendix C -- Characterization of hydrogeologic setting report

    SciTech Connect (OSTI)

    1996-09-01

    This Remedial Investigation (RI) Report characterizes the nature and extent of contamination, evaluates the fate and transport of contaminants, and assesses risk to human health and the environment resulting from waste disposal and other US Department of Energy (DOE) operations in Bear Creek Valley (BCV). BCV, which is located within the DOE Oak Ridge Reservation (ORR) encompasses multiple waste units containing hazardous and radioactive wastes arising from operations at the adjacent Oak Ridge Y-12 Plant. The primary waste units discussed in this RI Report are the S-3 Site, Oil Landfarm (OLF), Boneyard/Burnyard (BYBY), Sanitary Landfill 1 (SL 1), and Bear Creek Burial Grounds (BCBG). These waste units, plus the contaminated media resulting from environmental transport of the wastes from these units, are the subject of this RI. This BCV RI Report represents the first major step in the decision-making process for the BCV watershed. The RI results, in concert with the follow-on FS will form the basis for the Proposed Plan and Record of Decision for all BCV sites. This comprehensive decision document process will meet the objectives of the watershed approach for BCV. Appendix A includes descriptions of waste areas and estimates of the current compositions of the wastes. Appendix B contains an extensive database of environmental data for the Bear Creek Valley Characterization Area. Information is also presented about the number and location of samples collected, the analytes examined, and the extent of data validation. Appendix C describes the hydrogeologic conceptual model for Bear Creek Valley. This model is one of the principal components of the conceptual site models for contaminant transport in BCV.

  14. Cloud Properties and Radiative Heating Rates for TWP

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Comstock, Jennifer

    2013-11-07

    A cloud properties and radiative heating rates dataset is presented where cloud properties retrieved using lidar and radar observations are input into a radiative transfer model to compute radiative fluxes and heating rates at three ARM sites located in the Tropical Western Pacific (TWP) region. The cloud properties retrieval is a conditional retrieval that applies various retrieval techniques depending on the available data, that is if lidar, radar or both instruments detect cloud. This Combined Remote Sensor Retrieval Algorithm (CombRet) produces vertical profiles of liquid or ice water content (LWC or IWC), droplet effective radius (re), ice crystal generalized effective size (Dge), cloud phase, and cloud boundaries. The algorithm was compared with 3 other independent algorithms to help estimate the uncertainty in the cloud properties, fluxes, and heating rates (Comstock et al. 2013). The dataset is provided at 2 min temporal and 90 m vertical resolution. The current dataset is applied to time periods when the MMCR (Millimeter Cloud Radar) version of the ARSCL (Active Remotely-Sensed Cloud Locations) Value Added Product (VAP) is available. The MERGESONDE VAP is utilized where temperature and humidity profiles are required. Future additions to this dataset will utilize the new KAZR instrument and its associated VAPs.

  15. Cloud Properties and Radiative Heating Rates for TWP

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Comstock, Jennifer

    A cloud properties and radiative heating rates dataset is presented where cloud properties retrieved using lidar and radar observations are input into a radiative transfer model to compute radiative fluxes and heating rates at three ARM sites located in the Tropical Western Pacific (TWP) region. The cloud properties retrieval is a conditional retrieval that applies various retrieval techniques depending on the available data, that is if lidar, radar or both instruments detect cloud. This Combined Remote Sensor Retrieval Algorithm (CombRet) produces vertical profiles of liquid or ice water content (LWC or IWC), droplet effective radius (re), ice crystal generalized effective size (Dge), cloud phase, and cloud boundaries. The algorithm was compared with 3 other independent algorithms to help estimate the uncertainty in the cloud properties, fluxes, and heating rates (Comstock et al. 2013). The dataset is provided at 2 min temporal and 90 m vertical resolution. The current dataset is applied to time periods when the MMCR (Millimeter Cloud Radar) version of the ARSCL (Active Remotely-Sensed Cloud Locations) Value Added Product (VAP) is available. The MERGESONDE VAP is utilized where temperature and humidity profiles are required. Future additions to this dataset will utilize the new KAZR instrument and its associated VAPs.

  16. Remedial investigation/feasibility study for the David Witherspoon, Inc., 901 Site, Knoxville, Tennessee: Volume 1

    SciTech Connect (OSTI)

    1996-10-01

    This remedial investigation (RI)/feasibility study (FS) supports the selection of remedial actions for the David Witherspoon, Inc. 901 Maryville Pike Site in Knoxville, Tennessee. Operations at the site, used as a recycling center, have resulted in past, present, and potential future releases of hazardous substances in to the environment. This Site is a Tennessee Superfund site. A phased approach was planned to (1) gather existing data from previous investigations managed by the Tenn. Dept. of Environment and Conservation; (2) perform a preliminary RI, including risk assessments, and an FS with existing data to identify areas where remedial action may be necessary; (3) gather additional field data to adequately define the nature and extent of risk-based contaminants that present identifiable threats to human and/or ecological receptors; and (4) develop remedial action alternatives to reduce risks to acceptable levels.

  17. 100-OL-1 Operable Unit Field Portable X-Ray Fluorescence (XRF) Analyzer Pilot Study Plans

    SciTech Connect (OSTI)

    Bunn, Amoret L.; Fritz, Brad G.; Wellman, Dawn M.

    2014-07-15

    A pilot study is being conducted to support the approval of the Remedial Investigation/Feasibility Study (RI/FS) Work Plan to evaluate the 100-OL-1 Operable Unit (OU) pre-Hanford orchard lands. Based on comments received by the U.S. Environmental Protection Agency (EPA) and Washington State Department of Ecology, the pilot study will evaluate the use of field portable X-ray fluorescence (XRF) spectrometry measurements for evaluating lead and arsenic concentrations on the soil surface as an indicator of past use of lead arsenate pesticide residue in the OU. The work will be performed in the field during the summer of 2014, and assist in the planning for the characterization activities in the RI/FS.

  18. A=15O (70AJ04)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    70AJ04) (See Energy Level Diagrams for 15O) GENERAL: See Table 15.18 [Table of Energy Levels] (in PDF or PS) here. Model calculations:(TA60H, TA60L, CO63B, KU63I, AL64P, AM64, BR64Z, RI64B, CO65I, GI65D, GR65E, GU65A, HU65D, BO66J, EL66B, RI66G, SO66A, BO67B, EL67C, DE68K, EL68E, HO68, MA68DD, SH68D, WO68D, ZH68, ZU68, DE69M, EL69B, GU69, SA69). General calculations and reviews:(EV64, FA67A, NE67B, BI68C). Electromagnetic transitions:(RO65O, PO66F, RO66C, WA66D, KU67J, PO67G, WA67I, BI68C,

  19. Remedial investigation work plan for Bear Creek Valley Operable Unit 2 (Rust Spoil Area, SY-200 Yard, Spoil Area 1) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Environmental Restoration Program

    SciTech Connect (OSTI)

    Not Available

    1993-05-01

    The enactment of the Resource Conservation and Recovery Act (RCRA) in 1976 and the Hazardous and Solid Waste Amendments (HSWA) to RCRA in 1984 created management requirements for hazardous waste facilities. The facilities within the Oak Ridge Reservation (ORR) were in the process of meeting the RCRA requirements when ORR was placed on the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) National Priorities List (NPL) on November 21, 1989. Under RCRA, the actions typically follow the RCRA Facility Assessment (RFA)/RCRA Facility Investigation (RFI)/Corrective Measures Study (CMS)/Corrective Measures implementation process. Under CERCLA the actions follow the PA/SI/Remedial Investigation (RI)/Feasibility Study (FS)/Remedial Design/Remedial Action process. The development of this document will incorporate requirements under both RCRA and CERCLA into an RI work plan for the characterization of Bear Creek Valley (BCV) Operable Unit (OU) 2.

  20. ,"Rhode Island Natural Gas Industrial Consumption (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3035ri2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3035ri2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:24:40 PM" "Back to

  1. ,"Rhode Island Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3035ri3m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3035ri3m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:24:41 PM" "Back to

  2. ,"Rhode Island Natural Gas Residential Consumption (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3010ri2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3010ri2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:21:52 PM" "Back to

  3. ,"Rhode Island Natural Gas Deliveries to Electric Power Consumers (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3045ri2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3045ri2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:25:43 PM" "Back to

  4. ,"Rhode Island Natural Gas Industrial Consumption (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3035ri2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3035ri2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:24:40 PM" "Back to

  5. ,"Rhode Island Natural Gas Industrial Price (Dollars per Thousand Cubic Feet)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3035ri3a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3035ri3a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:24:40 PM" "Back to

  6. ,"Rhode Island Natural Gas Price Sold to Electric Power Consumers (Dollars per Thousand Cubic Feet)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3045ri3a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3045ri3a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:25:44 PM" "Back to

  7. ,"Rhode Island Natural Gas Residential Consumption (MMcf)"

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3010ri2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3010ri2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:21:51 PM" "Back to

  8. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3010ri3m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3010ri3m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:21:52 PM" "Back to

  9. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3020ri2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3020ri2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:23:14 PM" "Back to

  10. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3020ri4m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3020ri4m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:23:15 PM" "Back to

  11. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3050ri3m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3050ri3m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:26:20 PM" "Back to

  12. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Monthly","12/2015" ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3060ri2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3060ri2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:26:47 PM" "Back to

  13. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3010ri3a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3010ri3a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:21:52 PM" "Back to

  14. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3020ri2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3020ri2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:23:14 PM" "Back to

  15. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3020ri3a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3020ri3a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:23:14 PM" "Back to

  16. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3020ri4a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3020ri4a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:23:15 PM" "Back to

  17. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3050ri3a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3050ri3a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:26:20 PM" "Back to

  18. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Annual",2015 ,"Release Date:","2/29/2016" ,"Next Release Date:","3/31/2016" ,"Excel File Name:","n3060ri2a.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n3060ri2a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"2/26/2016 2:26:47 PM" "Back to

  19. Microsoft PowerPoint - RIMA_McCourt_21Apr2014.Providence.pptx

    Broader source: Energy.gov (indexed) [DOE]

    Meeting: New England Regional Infrastructure Constraints Infrastructure Needs for Reliability and Affordability Bill McCourt, Executive Director RI Manufacturers Association Power Prices Highly Correlated to Gas Prices  Gas fired generation is a significant portion of the generation mix for New England  Lack of fuel diversity could create increased price volatility risk  Lack of adequate gas infrastructure in New England creates higher winter price volatility  There is long term

  20. Microsoft Word - Final Quadrennial Energy Review Comments, Providence - DePasquale, Scott.docx

    Broader source: Energy.gov (indexed) [DOE]

    Quadrennial Energy Review: Comment on the New England Regional Infrastructure Constraints Public Meeting" (Part 1 - Providence, RI) Scott DePasquale - Chairman and CEO, Utilidata Good morning ladies and gentlemen and thank you for giving me the opportunity to present to you today. My name is Scott DePasquale and I am the Chairman and CEO of Providence-based Utilidata. My company specializes in equipment and software that allows utility companies to better automate and manage their power

  1. Microsoft Word - QER Dave Caldwell 21 April 2014.doc

    Broader source: Energy.gov (indexed) [DOE]

    Dept of Energy Quadrennial Energy Review April 21, 2014 Dave Caldwell Secretary, RI Builders Association Chair, North Kingstown Economic Advisory Board Vice President, Caldwell & Johnson Custom Builder, U.S. Dept of Energy Challenge Home Partner About a year ago, Caldwell & Johnson completed the first U.S. Dept of Energy Challenge Home in Rhode Island (See attached DOE profile). The Department of Energy Challenge Home program requires new construction to document 40-50% more energy

  2. Microsoft Word - RIMA_McCourt_21Apr2014.Providence.docx

    Broader source: Energy.gov (indexed) [DOE]

    Reliability & Affordability Bill McCourt, Executive Director, RI Manufacturers Association INTRO: Energy and natural resources are the life blood of manufacturing. Manufacturers need adequate, secure and affordable energy and raw materials to compete in the global marketplace. Manufacturers use one- third of our nation's energy and are directly affected by the cost of energy not only in making the products we sell, but also in the cost of maintaining our administrative and warehousing

  3. UC-700 Envi

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    UC-700 Envi low and Ri Division i l ination unlimi U.S. Department of Energy Nevada Operations Office DOE NV--477 Nevada ronmental Restoration Project Regional Groundwater F and Tritium Transport Modeling sk Assessment of the Underground Test Area, Nevada Test Site, Nevada October 1997 Environmental Restoration Approved for publ c re ease; further dissem ted. This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office of Scientific

  4. ADVANCED COMPRESSOR ENGINE CONTROLS TO ENHANCE OPERATION, RELIABILITY AND INTEGRITY

    SciTech Connect (OSTI)

    Gary D. Bourn; Jess W. Gingrich; Jack A. Smith

    2004-03-01

    This document is the final report for the ''Advanced Compressor Engine Controls to Enhance Operation, Reliability, and Integrity'' project. SwRI conducted this project for DOE in conjunction with Cooper Compression, under DOE contract number DE-FC26-03NT41859. This report addresses an investigation of engine controls for integral compressor engines and the development of control strategies that implement closed-loop NOX emissions feedback.

  5. BIGHORN SHEEP: SUPPLEMENTAL ANALYSIS TO THE FOREST PLAN ENVIRONMENTAL IMPACT STATEMENT„INTERDISCIPLINARY TEAM MEETING

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Page 1 of 2 RIVER AND PLATEAU COMMITTEE - 3 MONTH WORK PLAN (SUBJECT TO REVISION) February Committee meeting placeholder: Tuesday, February 12 Committee call placeholder: Tuesday February 19 @ 1:30 p.m. * Framing discussion: Groundwater modeling, consistency and methodology, transport (joint w/ TWC) * 2015 Vision and beyond * Land transition between programs and contractors * 300 Area Final Proposed Plan and RI/FS * [joint topic on HSEP agenda - radiation damage to concrete (WESF)] * [possible

  6. CX-100 Final Report

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SAND2008-4648 Unlimited Release Printed July 2008 Blade System Design Studies Phase II: Final Project Report Derek S. Berry TPI Composites, Inc. 373 Market Street Warren, RI 02885 Abstract This report details the work completed under Phase II of the Sandia National Laboratories Blade System Design Study blade design and manufacturing project; an integrated 9 meter blade design, tooling design and manufacturing, assembly fixture design and fabrication, blade production, blade instrumentation and

  7. BandelierDirections2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a r k i n g M E R G E T o T o w n s it e D ia m o n d D ri v e To Sa n ta Fe T o J e m e z M ts . Co mm ut er Bu s Dr op Of f P a r k i n g M E R G E M E R G E T o T o w n s i t e...

  8. Novel Electrolytes for Lithium Ion Batteries

    Office of Scientific and Technical Information (OSTI)

    Electrolytes for Lithium Ion Batteries Brett L. Lucht Department of Chemistry University of Rhode Island 51 Lower College Rd. Kingston, RI 02881 Tel (401)874-5071 Fax (401) 874-5072 blucht@chm. uri. edu Final Report December 12th, 2014 Accomplishments While commercial lithium-ion batteries (LIBs) perform well for most home electronic applications, currently available LIB technology does not satisfy some of the performance goals for Plug- in Hybrid Electric Vehicles (PHEV). In particular,

  9. Work plan for the remedial investigation/feasibility study for the groundwater operable units at the Chemical Plant Area and the Ordnance Works Area, Weldon Spring, Missouri

    SciTech Connect (OSTI)

    1995-08-01

    US Department of Energy (DOE) and the US Army Corps of Engineers (CE) are conducting cleanup activities at two properties, the chemical plant area and the ordnance works area, located adjacent to one another in St. Charles County, Missouri. In accordance with the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended, DOE and CE are evaluating conditions and potential responses at the chemical plant area and at the ordnance works area, respectively, to address groundwater and surface water contamination. This work plan provides a comprehensive evaluation of areas that are relevant to the (GWOUs) of both the chemical plant and the ordnance works area. Following areas or media are addressed in this work plan: groundwater beneath the chemical plant area (including designated vicinity properties described in Section 5 of the RI for the chemical plant area [DOE 1992d]) and beneath the ordnance works area; surface water and sediment at selected springs, including Burgermeister Spring. The organization of this work plan is as follows: Chapter 1 discusses the objectives for conducting the evaluation, including a summary of relevant site information and overall environmental compliance activities to be undertaken; Chapter 2 presents a history and a description of the site and areas addressed within the GWOUs, along with currently available data; Chapter 3 presents a preliminary evaluation of areas included in the GWOUs, which is based on information given in Section 2, and discusses data requirements; Chapter 4 presents rationale for data collection or characterization activities to be carried out in the remedial investigation (RI) phase, along with brief summaries of supporting documents ancillary to this work plan; Chapter 5 discusses the activities planned for GWOUs under each of the 14 tasks for an remedial (RI/FS); Chapter 6 presents proposed schedules for RI/FS for the GWOUS; and Chapter 7 explains the project management structure.

  10. " Million Housing Units, Final"

    U.S. Energy Information Administration (EIA) Indexed Site

    8 Home Appliances in Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Home

  11. " Million Housing Units, Final"

    U.S. Energy Information Administration (EIA) Indexed Site

    8 Household Demographics of Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" ,,"Total Northeast",,,"CT, ME, NH, RI, VT" "Household

  12. Environmental Management Performance Reports - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reports Documents Documents Hanford Site Cleanup Completion Framework Tri-Party Agreement Freedom of Information and Privacy Act Hanford Site Budget Hanford Site Safety Standards DOE - ORP Contracts/Procurements DOE - RL Contracts/Procurements Integrated Waste Feed Delivery Plan Single-Shell Tank Evaluations Deep Vadose Zone 100-F RI/FS Sitewide Probabilistic Seismic Hazard Analysis Environmental CERCLA Five-Year Review NEPA - Categorical Exclusions NEPA - Environmental Assessments NEPA -

  13. Hanford Site Safety Standards - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hanford Site Safety Standards Documents Documents Hanford Site Cleanup Completion Framework Tri-Party Agreement Freedom of Information and Privacy Act Hanford Site Budget Hanford Site Safety Standards Hanford Hoisting and Rigging Manual DOE - ORP Contracts/Procurements DOE - RL Contracts/Procurements Integrated Waste Feed Delivery Plan Single-Shell Tank Evaluations Deep Vadose Zone 100-F RI/FS Sitewide Probabilistic Seismic Hazard Analysis Environmental Hanford Site Safety Standards Email Email

  14. Integrated Waste Feed Delivery Plan - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Documents Integrated Waste Feed Delivery Plan Documents Documents Hanford Site Cleanup Completion Framework Tri-Party Agreement Freedom of Information and Privacy Act Hanford Site Budget Hanford Site Safety Standards DOE - ORP Contracts/Procurements DOE - RL Contracts/Procurements Integrated Waste Feed Delivery Plan Single-Shell Tank Evaluations Deep Vadose Zone 100-F RI/FS Sitewide Probabilistic Seismic Hazard Analysis Environmental Integrated Waste Feed Delivery Plan Email Email Page | Print

  15. Mr. Todd Martin, Chair Hanford Advisory Board

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ri-Party Mr. Todd Martin, Chair Hanford Advisory Board 1933 Jadwin Avenue, Suite 135 Richland, Washington 99352 Dear Mr. Martin: HANFORD ADVISORY BOARD (HAB) ADVICE #158 -300 AREA EXPLANATION OF SIGNIFICANT DIFFERENCE (ESD) HAB ietter from T. Martin to K. Klein, RL; R. Schepens, ORP; J. lani, EP A; and L. Hoffman, Ecology, "300 Area Explanation of Significant Difference," dated April 2, 2004. Reference: This letter is in response to HAB advice #158 in the reference. This advice

  16. Mound Plant Federal Facility Agreement, July 15, 1993 Summary

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    United States Environmental Protection Agency Region V and the State of Ohio Federal Facility Agreement State Ohio Agreement Type Federal Facility Agreement Legal Driver(s) CERCLA Scope Summary DOE shall identify Interim Remedial Actions (IRAs) alternatives and implement US EPA and OEPA approved remedies for the site in accordance with CERCLA Parties EPA; Ohio EPA (OEPA); DOE Date 07/15/1993 SCOPE * Identify Interim Remedial Action (IRA) alternatives which include Remedial Investigations (RI)

  17. C C3 C

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    cq4-o ta o c NC oo M0t - 00 C)W)0 N 0 ' O m C C -t-W0 en "C 0 - () o viw; c c; 6 C; 4 r'i6 ien61 r r C ' (0 t- V) t 00W Np 0W )a ot)I > 000000 000 0 C0 00C>0 ct- M0 00)...

  18. Development of Dual-Fuel Engine for Class 8 Applications | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Dual-Fuel Engine for Class 8 Applications Development of Dual-Fuel Engine for Class 8 Applications Highlights roadmap towards 55% brake thermal efficiency and progress to meet engine development goals PDF icon deer12_zhang.pdf More Documents & Publications SwRI's HEDGE Technology for High Efficiency, Low Emissions Gasoline Engines Supertruck - Development and Demonstration of a Fuel-Efficient Class 8 Tractor & Trailer High-Efficiency Clean Combustion in Light-Duty

  19. ETA-UTP009 - Measurement and Evaluation of Magnetic Fields (EMF) and Electromagnetic Radiation (EMI) Generated by Electric Vehicles

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    9 Revision 0 Effective March 23, 2001 Measurement and Evaluation of Magnetic Fields (EMF) and Electromagnetic Radiation (EMI) Generated by Electric Vehicles Prepared by Electric Transportation Applications Prepared by: _______________________________ Date:__________ Steven R. Ryan Approved by: ___________________________________________________ Date: _______________ Jude M. Clark ETA-UTP009 Revision 0 © ©2 20 00 01 1 Electric Transportation Applications A Al ll l R Ri ig gh ht ts s R Re es se

  20. Microsoft Word - CX-100 Final Report - SAND2007-6065.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    CX-100 Manufacturing Final Project Report Derek S. Berry TPI Composites, Inc. 373 Market Street Warren, RI 02885 Sandia Technical Manager: Tom Ashwill Abstract This report details the work completed under the CX-100 blade manufacturing project. It presents the tooling design and manufacturing, blade production, blade instrumentation, blade shipping and adapter plate design and fabrication. The CX-100 blade was designed to demonstrate the efficient use of carbon fiber in the spar cap of a wind

  1. Microsoft Word - TX-100 Final Report - SAND2007-6066.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TX-100 Manufacturing Final Project Report Derek S. Berry TPI Composites, Inc. 373 Market Street Warren, RI 02885 Sandia Technical Manager: Tom Ashwill Abstract This report details the work completed under the TX-100 blade manufacturing portion of the Carbon-Hybrid Blade Developments: Standard and Twist-Coupled Prototype project. The TX-100 blade is a 9 meter prototype blade designed with bend-twist coupling to augment the mitigation of peak loads during normal turbine operation. This structural

  2. Microsoft PowerPoint - 2011_1012_Hansen_ColumbiaRiverComponent_Eco.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Component Risk Assessment Volume I: Screening Level Ecological Risk Assessment (DOE/RL-2010-117, Draft A) Ri C id (DOE/RL 2010 117, Draft A) Overview and key findings River Corridor Closure Project River Corridor Closure Project y g O t b 2011 October, 2011 Protecting the Columbia River U.S. Department of Energy Richland Operations Office RIVER CORRIDOR CLOSURE PROJECT Columbia River Component Columbia River Component Ecological Risk Assessment * Scope - Screening level ecological risk

  3. Microsoft PowerPoint - E1202028_A.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Vertical Pipe Unit Vertical Pipe Unit (VPU) Remediation Ri C id River Corridor Closure Project River Corridor Closure Project Cathy Louie DOE RL Cathy Louie, DOE-RL Jamie Zeisloft, DOE-RL Warren Bryant, Washington Closure Hanford February 15, 2012 y g Protecting the Columbia River U.S. Department of Energy Richland Operations Office RIVER CORRIDOR CLOSURE PROJECT DOE's Largest Environmental Cleanup Closure Project Vertical Pipe Unit Remediation Vertical Pipe Unit Remediation * Scope is to

  4. si

    Office of Legacy Management (LM)

    si :ri; .-.- ..~ -- The Orrk R&e Ins@@& for Science aud EduWion (ORISE) was established by the U.S. Department of Energy to undertake national aud international programs in science and engineering education, training and management systems, energy and environment systems, and medical sciences. ORISE and its programs are operated by Oak Ridge Associated Universities (ORAU) through a management and operating contract with the U.S. Department of Energy. Established in 1946, ORAU is a

  5. Document Number Q0029500 Baseline Risk Assessment Update 4.0 Baseline Risk Assessment Update

    Office of Legacy Management (LM)

    Baseline Risk Assessment Update 4.0 Baseline Risk Assessment Update This section updates the human health and the ecological risk assessments that were originally presented in the 1998 RI (DOE 1998a). The impacts on the 1998 risk assessments are summarized in Section 2.9. 4.1 Human Health Risk Assessment Several activities completed since 1998 have contributed to changes in surface water and ground water concentrations. Activities that have impacted, or likely impacted surface water and ground

  6. Effect of Gasoline Properties on Exhaust Emissions from Tier 2 Light-Duty Vehicles -- Final Report: Phases 4, 5, & 6; July 28, 2008 - July 27, 2013

    SciTech Connect (OSTI)

    Whitney, K.; Shoffner, B.

    2014-06-01

    This report covers work the Southwest Research Institute (SwRI) Office of Automotive Engineering has conducted for the National Renewable Energy Laboratory (NREL) in support of the Energy Policy Act of 2005 (EPAct). Section 1506 of EPAct requires the EPA to produce an updated fuel effects model representing the 2007 light-duty gasoline fleet, including determination of the emissions impacts of increased renewable fuel use.

  7. AWEA Offshore WINDPOWER 2016 | Department of Energy

    Energy Savers [EERE]

    Offshore WINDPOWER 2016 AWEA Offshore WINDPOWER 2016 October 25, 2016 8:00AM EDT to October 26, 2016 5:00PM EDT Warwick, Rhode Island Crowne Plaza Hotel Providence-Warwick 801 Greenwich Ave Warwick, RI 02886 United States The American Wind Energy Association (AWEA) Offshore WINDPOWER 2016 Conference & Exhibition program gathers top developers and experts in offshore wind energy to define the next steps in maintaining a positive trend for the industry. An exciting program awaits this year

  8. Audit Report: OAS-L-04-22 | Department of Energy

    Energy Savers [EERE]

    2 Audit Report: OAS-L-04-22 September 22, 2004 Completion of the Terascale Simulation Facility Project PDF icon OAS-L-04-22.pdf More Documents & Publications Audit Report: OAS-M-10-02 WA_01_018_IBM_Waiver_of_Governement_US_and_Foreign_Patent_Ri.pdf WA_00_015_COMPAQ_FEDERAL_LLC_Waiver_Domestic_and_Foreign_Pat.pdf

  9. DOE - Office of Legacy Management -- Mound_Benefits

    Office of Legacy Management (LM)

    Ohio > Mound_Benefits Mound, Ohio, Site Former Workers' Employment Verification and Benefits Administration Contractor Employment Verification Mercer, Mound Benefits Center (866) 296-5036 Medical and Life Insurance for Former EG&G, BWXTO, and CH2M HILL Employees For questions about health insurance coverage and/or dependent information, life insurance and/or beneficiaries, etc.: Mercer, Mound Benefits Center P.O. Box 9735, Providence, RI 02940 Benefit Center Website (866) 296-5036 9:00

  10. DOE - Office of Legacy Management -- Rocky Benefits

    Office of Legacy Management (LM)

    Colorado > Rocky Benefits Rocky Flats Site, Colorado Benefits Administration Rocky Flats Benefits Administration Rocky Flats Benefits Center P.O Box 9735 Providence, RI 02940 Phone - (866) 296-5036 Fax - (888) 501-9768 Medical and Life Insurance Administration Pension Administration General Benefits Questions Death Reporting Address Changes Benefits Issue Resolutions Leanna Nighswonger (509) 373-1419 Leanna_c_Nighswonger@rl.gov Last Updated: 11/20/2014

  11. 2013 Annual Merit Review Results Report - Technology Integration |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Technology Integration 2013 Annual Merit Review Results Report - Technology Integration Merit review of DOE Vehicle Technologies research activities PDF icon 2013_amr_08.pdf More Documents & Publications EV Community Readiness projects: New York City and Lower Hudson Valley Clean Communities, Inc. (NY, MA, PA); NYSERDA (ME, NH, VT, MA, RI, CT, NY, NJ, PA, DE, MD, DC) Vehicle Technologies Office Merit Review 2014: Penn State DOE Graduate GATE Program for In-Vehicle,

  12. TO: FILE

    Office of Legacy Management (LM)

    , TO: FILE ---w-o----- SUBJECT: 1 CITY: STATE: fld -------------------------- OWNER(S) -------_ Past: _----------------------- curr,ent : --------------------______ Owner cnntakted 0 yes RI-IO; if yes, date contacted----- ~TYPE OF OPERATION .: ,. 0. Research & Development n Facility Type 0 Production scale testing 0 Pilot Scale 0 Manufacturing 0 Ben&i Scale Process 0 University 0 Theoretical Studies IJ Research Organizatian a 0 Government Sample & Analysis .' 0 Production 0. Disposal

  13. Microsoft Word - CX-Driscoll Sustation Tower.doc

    Office of Environmental Management (EM)

    Official File United States Government Department of Energy Bonneville Power Administration DATE: 6HSWHPEHU REPLY TO ATTN OF: .(& SUBJECT: (QYLURQPHQWDO &OHDUDQFH 0HPRUDQGXP -LP 0DPPDUHOOD 3URMHFW 0DQDJHU ± 7(&7 &6% Proposed Action: 'ULVFROO 6XEVWDWLRQ 5DGLR 7RZHU DQG $QWHQQD ,QVWDOODWLRQ Budget Information: :RUN 2UGHU 7DVN Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): % 6LWLQJ FRQVWUXFWLRQ DQG RSHUDWLRQ RI PLFURZDYH DQG UDGLR FRPPXQLFDWLRQ WRZHUV DQG

  14. Department of Energy Announces Quadrennial Energy Review Public Meeting in

    Office of Environmental Management (EM)

    Rhode Island, Connecticut | Department of Energy Quadrennial Energy Review Public Meeting in Rhode Island, Connecticut Department of Energy Announces Quadrennial Energy Review Public Meeting in Rhode Island, Connecticut April 16, 2014 - 4:09pm Addthis News Media Contact 202-586-4940 WASHINGTON, DC - The Department's Office of Energy Policy and Systems Analysis will host a two part public meeting in Providence, R.I., and Hartford, Conn., on Monday to receive stakeholder input to the

  15. Applying a Modified Triad Approach to Investigate Wastewater lines

    SciTech Connect (OSTI)

    Pawlowicz, R.; Urizar, L.; Blanchard, S.; Jacobsen, K.; Scholfield, J.

    2006-07-01

    Approximately 20 miles of wastewater lines are below grade at an active military Base. This piping network feeds or fed domestic or industrial wastewater treatment plants on the Base. Past wastewater line investigations indicated potential contaminant releases to soil and groundwater. Further environmental assessment was recommended to characterize the lines because of possible releases. A Remedial Investigation (RI) using random sampling or use of sampling points spaced at predetermined distances along the entire length of the wastewater lines, however, would be inefficient and cost prohibitive. To accomplish RI goals efficiently and within budget, a modified Triad approach was used to design a defensible sampling and analysis plan and perform the investigation. The RI task was successfully executed and resulted in a reduced fieldwork schedule, and sampling and analytical costs. Results indicated that no major releases occurred at the biased sampling points. It was reasonably extrapolated that since releases did not occur at the most likely locations, then the entire length of a particular wastewater line segment was unlikely to have contaminated soil or groundwater and was recommended for no further action. A determination of no further action was recommended for the majority of the waste lines after completing the investigation. The modified Triad approach was successful and a similar approach could be applied to investigate wastewater lines on other United States Department of Defense or Department of Energy facilities. (authors)

  16. White Oak Creek Watershed: Melton Valley Area Remedial Investigation Report, Oak Ridge National Laboratory, Oak Ridge, Tennessee: Volume 3 Appendix C

    SciTech Connect (OSTI)

    1996-11-01

    This report provides details on the baseline ecological risk assessment conducted in support of the Remedial Investigation (RI) Report for the Melton Valley areas of the White Oak Creek watershed (WOCW). The RI presents an analysis meant to enable the US Department of Energy (DOE) to pursue a series of remedial actions resulting in site cleanup and stabilization. The ecological risk assessment builds off of the WOCW screening ecological risk assessment. All information available for contaminated sites under the jurisdiction of the US Department of Energy`s Comprehensive Environmental Response, Compensation, and Liability Act Federal Facilities Agreement within the White Oak Creek (WOC) RI area has been used to identify areas of potential concern with respect to the presence of contamination posing a potential risk to ecological receptors within the Melton Valley area of the White Oak Creek watershed. The risk assessment report evaluates the potential risks to receptors within each subbasin of the watershed as well as at a watershed-wide scale. The WOC system has been exposed to contaminant releases from Oak Ridge National Laboratory and associated operations since 1943 and continues to receive contaminants from adjacent waste area groupings.

  17. Strain and localization effects in InGaAs(N) quantum wells: Tuning the magnetic response

    SciTech Connect (OSTI)

    Lopes-Oliveira, V. Herval, L. K. S.; Orsi Gordo, V.; Cesar, D. F.; Godoy, M. P. F. de; Galvo Gobato, Y.; Henini, M.; Khatab, A.; Sadeghi, M.; Wang, S.; Schmidbauer, M.

    2014-12-21

    We investigated effects of localization and strain on the optical and magneto-optical properties of diluted nitrogen IIIV quantum wells theoretically and experimentally. High-resolution x-ray diffraction, photoluminescence (PL), and magneto-PL measurements under high magnetic fields up to 15?T were performed at low temperatures. Bir-Pikus Hamiltonian formalism was used to study the influence of strain, confinement, and localization effects. The circularly polarized magneto-PL was interpreted considering localization aspects in the valence band ground state. An anomalous behavior of the electron-hole pair magnetic shift was observed at low magnetic fields, ascribed to the increase in the exciton reduced mass due to the negative effective mass of the valence band ground state.

  18. I

    Office of Legacy Management (LM)

    ?am-3 . ,' .*. . - yp: -.* : .- ., ._ ' Yi * <. ? :+". thfa prcbputir. 80,UUU lb. of tmmiuu, J.m,cDu lb. of 3wukdlw crper' tiwu 5.8 t&i8 l atr:irur ral u&d i.Wttd&?# Bir;n8 i;orammant end rUl rid nrtrlcial by uo&utboFlwd putqlm. ). The ~&&a, ' 8m ;altielJ 79 p-rmlt arrgora ted and ttw tap t.ha aikalini~, . L pokotlal brlf)r, bU88M 8-i .ii.i co# sat8 awtaet wltb the mBtmtl8a. aada q*iast fb a8v0-*..u @ow +.ta p-?Y h&al. . .; . ' 6 G.. ..*... . ,,z.. ,. ..*,::

  19. Constructing a resilience index for the Enhanced Critical Infrastructure Protection Program

    SciTech Connect (OSTI)

    Fisher, R. E.; Bassett, G. W.; Buehring, W. A.; Collins, M. J.; Dickinson, D. C.; Eaton, L. K.; Haffenden, R. A.; Hussar, N. E.; Klett, M. S.; Lawlor, M. A.; Millier, D. J.; Petit, F. D.; Peyton, S. M.; Wallace, K. E.; Whitfield, R. G.; Peerenboom, J P

    2010-10-14

    Following recommendations made in Homeland Security Presidential Directive 7, which established a national policy for the identification and increased protection of critical infrastructure and key resources (CIKR) by Federal departments and agencies, the U.S. Department of Homeland Security (DHS) in 2006 developed the Enhanced Critical Infrastructure Protection (ECIP) program. The ECIP program aimed to provide a closer partnership with state, regional, territorial, local, and tribal authorities in fulfilling the national objective to improve CIKR protection. The program was specifically designed to identify protective measures currently in place in CIKR and to inform facility owners/operators of the benefits of new protective measures. The ECIP program also sought to enhance existing relationships between DHS and owners/operators of CIKR and to build relationships where none existed (DHS 2008; DHS 2009). In 2009, DHS and its protective security advisors (PSAs) began assessing CIKR assets using the ECIP program and ultimately produced individual protective measure and vulnerability values through the protective measure and vulnerability indices (PMI/VI). The PMI/VI assess the protective measures posture of individual facilities at their 'weakest link,' allowing for a detailed analysis of the most vulnerable aspects of the facilities (Schneier 2003), while maintaining the ability to produce an overall protective measures picture. The PMI has six main components (physical security, security management, security force, information sharing, protective measures assessments, and dependencies) and focuses on actions taken by a facility to prevent or deter the occurrence of an incident (Argonne National Laboratory 2009). As CIKR continue to be assessed using the PMI/VI and owners/operators better understand how they can prevent or deter incidents, academic research, practitioner emphasis, and public policy formation have increasingly focused on resilience as a necessary component of the risk management framework and infrastructure protection. This shift in focus toward resilience complements the analysis of protective measures by taking into account the three other phases of risk management: mitigation, response, and recovery (Figure 1). Thus, the addition of a robust resilience index (RI) to the established PMI/VI provides vital information to owners/operators throughout the risk management process. Combining a pre-incident focus with a better understanding of resilience, as well as potential consequences from damaged CIKR, allows owners/operators to better understand different ways to decrease risk by (1) increasing physical security measures to prevent an incident, (2) supplementing redundancy to mitigate the effects of an incident, and (3) enhancing emergency action and business continuity planning to increase the effectiveness of recovery procedures. Information provided by the RI methodology is also used by facility owners/operators to better understand how their facilities compare to similar sector/subsector sites and to help them make risk-based decisions. This report provides an overview of the RI methodology developed to estimate resilience and provide resilience comparisons for sectors and subsectors. The information will be used to (1) assist DHS in analyzing existing response and recovery methods and programs at facilities and (2) identify potential ways to increase resilience. The RI methodology is based on principles of Appreciative Inquiry, which is 'the coevolutionary search for the best in people, their organizations, and the relevant world around them' (Cooperrider et al. 2005). Appreciative Inquiry identifies the best of 'what is' and helps to envision 'what might be.' The ECIP program and the RI represent a new model (using Appreciative Inquiry principles) for information sharing between government and industry (Fisher and Petit 2010). A 'dashboard' display, which provides an interactive tool - rather than a static report, presents the results of the RI in a convenient format. Additional resilience measures c

  20. Derivation of general analytic gradient expressions for density-fitted post-Hartree-Fock methods: An efficient implementation for the density-fitted second-order MllerPlesset perturbation theory

    SciTech Connect (OSTI)

    Bozkaya, U?ur

    2014-09-28

    General analytic gradient expressions (with the frozen-core approximation) are presented for density-fitted post-HF methods. An efficient implementation of frozen-core analytic gradients for the second-order MllerPlesset perturbation theory (MP2) with the density-fitting (DF) approximation (applying to both reference and correlation energies), which is denoted as DF-MP2, is reported. The DF-MP2 method is applied to a set of alkanes, conjugated dienes, and noncovalent interaction complexes to compare the computational cost of single point analytic gradients with MP2 with the resolution of the identity approach (RI-MP2) [F. Weigend and M. Hser, Theor. Chem. Acc. 97, 331 (1997); R. A. Distasio, R. P. Steele, Y. M. Rhee, Y. Shao, and M. Head-Gordon, J. Comput. Chem. 28, 839 (2007)]. In the RI-MP2 method, the DF approach is used only for the correlation energy. Our results demonstrate that the DF-MP2 method substantially accelerate the RI-MP2 method for analytic gradient computations due to the reduced input/output (I/O) time. Because in the DF-MP2 method the DF approach is used for both reference and correlation energies, the storage of 4-index electron repulsion integrals (ERIs) are avoided, 3-index ERI tensors are employed instead. Further, as in case of integrals, our gradient equation is completely avoid construction or storage of the 4-index two-particle density matrix (TPDM), instead we use 2- and 3-index TPDMs. Hence, the I/O bottleneck of a gradient computation is significantly overcome. Therefore, the cost of the generalized-Fock matrix (GFM), TPDM, solution of Z-vector equations, the back transformation of TPDM, and integral derivatives are substantially reduced when the DF approach is used for the entire energy expression. Further application results show that the DF approach introduce negligible errors for closed-shell reaction energies and equilibrium bond lengths.

  1. Results of 1995 characterization of Gunite and Associated Tanks at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-02-01

    This technical memorandum (TM) documents the 1995 characterization of eight underground radioactive waste tanks at Oak Ridge National Laboratory (ORNL). These tanks belong to the Gunite and Associated Tanks (GAAT) operable unit, and the characterization is part of the ongoing GAAT remedial investigation/feasibility study (RI/FS) process. This TM reports both field observations and analytical results; analytical results are also available from the Oak Ridge Environmental Information System (OREIS) data base under the project name GAAT (PROJ-NAME = GAAT). This characterization effort (Phase II) was a follow-up to the {open_quotes}Phase I{close_quotes} sampling campaign reported in Results of Fall 1994 Sampling of Gunite and Associated Tanks at the Oak Ridge National Laboratory, Oak Ridge, Tennessee, ORNL/ER/Sub/87-99053/74, June 1995. The information contained here should be used in conjunction with that in the previous TM. The sampling plan is documented in ORNL Inactive Waste Tanks Sampling and Analysis Plan, ORNL/RAP/LTR-88/24, dated April 1988, as amended by Addendum 1, Revision 2: ORNL Inactive Tanks Sampling and Analysis Plan, DOE/OR/02-1354&D2, dated February 1995. Field team instructions are found in ORNL RI/FS Project Field Work Guides 01-WG-20, Field Work Guide for Sampling of Gunite and Associated Tanks, and 01-WG-21, Field Work Guide for Tank Characterization System Operations at ORNL. The field effort was conducted under the programmatic and procedural umbrella of the ORNL RI/FS Program, and the analysis was in accordance with ORNL Chemical and Analytical Sciences Division (CASD) procedures. The characterization campaign is intended to provide data for criticality safety, engineering design, and waste management as they apply to the GAAT treatability study and remediation. The Department of Energy (DOE) Carlsbad office was interested in results of this sampling campaign and provided funding for certain additional sample collection and analysis.

  2. Phase 1 remedial investigation report for 200-BP-1 operable unit. Volume 1

    SciTech Connect (OSTI)

    Not Available

    1993-09-01

    The US Department of Energy (DOE) Hanford Site, in Washington State is organized into numerically designated operational areas including the 100, 200, 300, 400, 600, and 1100 Areas. The US Environmental Protection Agency (EPA), in November 1989 included the 200 Areas of the Hanford Site on the National Priority List (NPL) under the Comprehensive Environmental Response, Compensation and Liability Act of 1980 (CERCLA). Inclusion on the NPL initiated the remedial investigation (RD process for the 200-BP-1 operable unit. These efforts are being addressed through the Hanford Federal Facility Agreement and Consent Order (Ecology et al. 1989) which was negotiated and approved by the DOE, the EPA, and the State of Washington Department of Ecology (Ecology) in May 1989. This agreement, known as the Tri-Party Agreement, governs all CERCLA efforts at Hanford. In March of 1990, the Department of Energy, Richland Operations (DOE-RL) issued a Remedial Investigation/Feasibility Study (RI/FS) work plan (DOE-RL 1990a) for the 200-BP-1 operable unit. The work plan initiated the first phase of site characterization activities associated with the 200-BP-1 operable unit. The purpose of the 200-BP-1 operable unit RI is to gather and develop the necessary information to adequately understand the risks to human health and the environment posed by the site and to support the development and analysis of remedial alternatives during the FS. The RI analysis will, in turn, be used by Tri-Party Agreement signatories to make a risk-management-based selection of remedies for the releases of hazardous substances that have occurred from the 200-BP-1 operable unit.

  3. Evaluation of the Eological Management and Enhancement Alernative for Remediation of the K1007-P1 Pond

    SciTech Connect (OSTI)

    Peterson, M.J.

    2005-10-31

    An evaluation of the human and ecological risks associated with the P1 Pond and surrounding environs was conducted as part of the ETTP Site-Wide Remedial Investigation. The RI provides the basis for the focus on PCBs as the most important unacceptable risk to human and ecological health in the pond. Other P1 contaminants, media, or pathways of risk to receptors are identified in the RI, but are not addressed as a major risk reduction goal for the ETTP Site-Wide Feasibility Study. Therefore, the goal of the Ecological Management alternative is to reduce unacceptable risks associated with PCBs in fish. Many of the actions proposed for this alternative, however, are likely to reduce risks associated with other contaminants and their pathways. The high PCB concentrations in fish from the P1 Pond are most certainly due in part to the current ecological condition of the pond that maximizes PCB biomagnification. This basic assumption and the factors contributing to it were evaluated by conducting an intensive field study of the P1 Pond in the summer of 2004 (for a thorough presentation of current P1 Pond biological conditions, see Peterson et al. 2005). Major hypotheses regarding the P1 Pond's current fish community, PCB fate and transport processes, pond vegetation, and limnological conditions that contribute to the high PCB levels in fish were validated by the study (Appendix A), The results of the 2004 ecological assessment, in concert with long-term datasets obtained as part of the ETTP Biological Monitoring and Abatement Program (BMAP) and recent abiotic sampling for the RI, provide the basis for the assessment of current conditions.

  4. Reference manual for toxicity and exposure assessment and risk characterization. CERCLA Baseline Risk Assessment

    SciTech Connect (OSTI)

    1995-03-01

    The Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA, 1980) (CERCLA or Superfund) was enacted to provide a program for identifying and responding to releases of hazardous substances into the environment. The Superfund Amendments and Reauthorization Act (SARA, 1986) was enacted to strengthen CERCLA by requiring that site clean-ups be permanent, and that they use treatments that significantly reduce the volume, toxicity, or mobility of hazardous pollutants. The National Oil and Hazardous Substances Pollution Contingency Plan (NCP) (USEPA, 1985; USEPA, 1990) implements the CERCLA statute, presenting a process for (1) identifying and prioritizing sites requiring remediation and (2) assessing the extent of remedial action required at each site. The process includes performing two studies: a Remedial Investigation (RI) to evaluate the nature, extent, and expected consequences of site contamination, and a Feasibility Study (FS) to select an appropriate remedial alternative adequate to reduce such risks to acceptable levels. An integral part of the RI is the evaluation of human health risks posed by hazardous substance releases. This risk evaluation serves a number of purposes within the overall context of the RI/FS process, the most essential of which is to provide an understanding of ``baseline`` risks posed by a given site. Baseline risks are those risks that would exist if no remediation or institutional controls are applied at a site. This document was written to (1) guide risk assessors through the process of interpreting EPA BRA policy and (2) help risk assessors to discuss EPA policy with regulators, decision makers, and stakeholders as it relates to conditions at a particular DOE site.

  5. BIGHORN SHEEP: SUPPLEMENTAL ANALYSIS TO THE FOREST PLAN ENVIRONMENTAL IMPACT STATEMENT„INTERDISCIPLINARY TEAM MEETING

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6/11/13 Page 1 of 2 RIVER AND PLATEAU COMMITTEE - 3 MONTH WORK PLAN (SUBJECT TO REVISION) July Committee meeting placeholder: No July Committee Meetings Committee call placeholder: Tuesday, July 16 @ 1:30 p.m. (to further frame up August agenda) * Advice responses? * Committee Business August Committee meeting placeholder: Tuesday, September 10 Committee call placeholder: Tuesday, September 17 @ 1:30 p.m. * 100 N RI/FS and Proposed Plan Draft A (delivered to regulators end of June) * Groundwater

  6. 10.0 COMMUNITY RELATIONS/PUBLIC INVOLVEMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0-1 10.0 COMMUNITY RELATIONS/PUBLIC INVOLVEMENT 10.1 INTRODUCTION This section describes, in general, the way in which the public will be involved with the implementation of this action plan. The CERCLA, as amended, requires that a community relations plan (CRP) be approved by the EPA prior to initiation of field work related to an RI/FS. The parties have agreed that the CRP is also the proper mechanism to address the public involvement process for all of the RCRA activity to be conducted

  7. River and Plateau Committee

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    November 2012) Page 1 Area RAP Committee Area of Interest Issue Manager(s) (*denotes lead) Other interested committee members Focus/Product For FY2012 Framing Questions/Issues (Articulated by Issue Managers) Cross- cutting River Corridor 100 & 300 Areas (in order of expected document release) * 300 Area * 100 K Area * 100 F Area * 100 D & H Areas * 100 N Area * 100 B/C Area Shelley Cimon Dale Engstrom* Liz Mattson Jean Vanni Gerry Pollet Bob Suyama Wade Riggsbee 6 RODs RI/FS and Proposed

  8. River and Plateau Committee

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    December 2011) Page 1 Area RAP Committee Area of Interest Issue Manager(s) (*denotes lead) Other interested committee members Focus/Product For FY2012 Framing Questions/Issues (Articulated by Issue Managers) Cross- cutting River Corridor 100 & 300 Areas * 100 B/C Area * 100 K Area * 100 N Area * 100 D & H Areas * 100 F Area * 300 Area Shelley Cimon Dale Engstrom* Liz Mattson Jean Vanni Gerry Pollet Bob Suyama Wade Riggsbee 6 RODs RI/FS and Proposed Plans to be issued between now &

  9. SAND2007-5792

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    $1',$ 5(3257 6$1' 8QOLPLWHG 5HOHDVH 6HSWHPEHU 7KUHDW $QDO\VLV )UDPHZRUN 'DYLG 3 'XJJDQ DQG -RKQ 7 0LFKDOVNL 3UHSDUHG E\ 6DQGLD 1DWLRQDO /DERUDWRULHV $OEXTXHUTXH 1HZ 0H[LFR DQG /LYHUPRUH &DOLIRUQLD 6DQGLD LV D PXOWLSURJUDP ODERUDWRU\ RSHUDWHG E\ 6DQGLD &RUSRUDWLRQ D /RFNKHHG 0DUWLQ &RPSDQ\ IRU WKH 8QLWHG 6WDWHV 'HSDUWPHQW RI (QHUJ\¶V 1DWLRQDO 1XFOHDU 6HFXULW\ $GPLQLVWUDWLRQ XQGHU &RQWUDFW '( $& $/ $SSURYHG IRU SXEOLF UHOHDVH IXUWKHU GLVVHPLQDWLRQ XQOLPLWHG Printed Threat

  10. 6-Month Work Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    January 9, 2011 Page 1 of 1 RIVER & PLATEAU COMMITTEE - 6 MONTH WORK PLAN January * River Corridor Cleanup, using 100 K as an Example * Draft A, 100 K Proposed Plan * PW-1,3,6/CW-5 ROD: Draft letter February * TPA Milestone Delays for Central Plateau - 30 month delay on interim milestones driven by funding. Information session. * TRU Burial Grounds in 200 W (PU Waste Excavated from Z9 in 1973) * Barriers discussion (follow up from workshop) * 300 Area RI/FS (document due in December) *

  11. A=10C (1984AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4AJ01) (See Energy Level Diagrams for 10C) GENERAL: (See also (1979AJ01).) and Table 10.19 [Table of Energy Levels] (in PDF or PS) here. Model calculations: (1981DE2G, 1982SA1U). Electromagnetic transitions: (1982RI04). Astrophysical questions: (1979MO04, 1979RA1C). Complex reactions involving 10C: (1979BO22, 1981MO20). Reactions involving pions (See also reactions 2 and 6.): (1979AL1J, 1979LI1D, 1980LE02, 1981AU1C, 1982COZV, 1982RO04). Other topics: (1979NO1B, 1980NO1A, 1982DE1N, 1982NG01).

  12. Print

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    < 5k 0 < 50k < 100k < 250k < 500k < 1M > 1M > 5M > 10M DE MD DC MA RI NJ AZ UT WY ID OR WA CA TX OK KS CO NE SD ND MN WI IL IA MO AR LA MS AL FL GA TN KY IN OH MI ME NH CT VT NY PA WV VA NC SC MT AK HI NV NM Princeton Plasma Physics Laboratory Procured Materials and Services 2015 (> $35M) Small business procurements in US: $14.73M

  13. RAP Committee 3-Month Work Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Updated 10/08/2013 December (no committee mtgs) January February PNNL update on geophysics characterization (where does this fit into the HAB FY2014 Work Plan?) Update on 100-N RI/FS and Proposed Plan Rev 0; advice development o Review of recommendations of proposed plans o Draft A = Committee Round Robin; Rev 0 = Advice 100-N Groundwater Modeling Tutorial Update on Orchard Lands Work Plan o Review of recommendations of proposed plans o Draft A = Committee Round Robin; Rev 0 = Advice Online

  14. RAP Committee 3-Month Work Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    5/12/15 Facilitator notes in blue June Committee meeting placeholder: Tuesday, June 16 Call placeholder: Tuesday, June 23, 1:30 p.m. August Committee meeting placeholder: Tuesday, August 4 Call placeholder: Tuesday, August 11, 1:30 p.m. September Committee meeting placeholder: Tuesday, Sept. 22 Call placeholder: Tuesday, Sept. 29, 1:30 p.m.  No topics planned for June meeting  RI/FS work plans for SW-2, WA-1, and DV-1  200 Area groundwater remediation (follow up, 100-N)  Call planned

  15. RAP Meeting Transcribed Flipcharts

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    October 9, 2012 NRDA IAP - Next Steps  November Board meeting update, notice of comment period  20 minute presentation  Outline of Plan o Final Plan by mid-January 2013 Page 1 100 K Sampling Plan and Overall Update Follow up: - RI/FS Proposed Plan ready for comment in May 2013 - D/H, F - Draft A (regulators) in December - 100N - Draft A in June 2013 - 300 Area - Jan/Feb 2013 - B/C  way out, drilling wells Page 2 Groundwater/Vadoze Zone Executive Council Follow up  Issue manager

  16. RECEIVED

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    40 ri,if--,r7n11-74"vtl Lit0 tait":,0 RECEIVED FFII 2 8 S96 OSTI The Winds of (Evolutionary) Change: Breathing New Life into Microbiology Gary J. Olsen,* Carl R. Woese,* and Ross A. Overbeekt DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsi- bility for

  17. Analysis of postulated unscrammed loss of flow in SAFR using SSC

    SciTech Connect (OSTI)

    Slovik, G.C.; Van Tuyle, G.J. )

    1988-01-01

    Brookhaven National Laboratory is providing technical assistance to the US Nuclear Regulatory Commission in reviewing two advanced liquid-metal reactor (LMR) designs in order to address the licensability of these innovative concepts. The designs, PRISM and SAFR are being proposed by General Electric Company and Rockwell International (RI), respectively. Brookhaven National Laboratory has utilized the super system code (SSC) to independently evaluate the LMR reactor system response during several postulated unscrammed events. This paper describes the SAFR reactor responses to a beyond-design base event where forced cooling is lost. A similar transient analysis has already been reported for PRISM.

  18. Annual Energy Outlook 2015 - Appendix B

    Gasoline and Diesel Fuel Update (EIA)

    5 U.S. Energy Information Administration | Annual Energy Outlook 2015 Regional maps Figure F4. Oil and gas supply model regions F-5 U.S. Energy Information Administration | Annual Energy Outlook 2014 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT ME RI MA NH VA WI MI OH NE SD MN ND AR OR CA VT East (1) Gulf of Mexico LA Gulf Coast (2)

  19. Annual Energy Outlook 2015 - Appendix F

    Gasoline and Diesel Fuel Update (EIA)

    7 U.S. Energy Information Administration | Annual Energy Outlook 2015 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin

  20. Governor JOH

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    lI Si\N" MARTINEZ. Governor JOH r-I A. SANCHEZ. Lieutenant Governor November 1,2012 Jose Franco, Manager Carlsbad Field Office Department of Energy P.O. Box 3090 NEW MEXICO ENVIRONMENT DEPARTMENT Harold Runnels BI,ilding 11 90 Saint Francis Drive (87505) P.O. Box 5469, Santa Fe. NM 87502-5469 Phone (505) 827-0419 Fax (505) 827-03 10 www.nmenv.sto!e.!lIn.lIs CERTIFIED MAIl. - RETURN RECEIPT REQUESTED Farok Sharif, Project Manager Nuclear Waste Partnership LLC P.O. Box 2078 Carlsbad, New

  1. HAB response letter to the 100-F ROD

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    response letter to the 100-F ROD The Board has received and is disappointed by the response from the Tri-Party Agencies provided to HAB Advice 280 on the 100-F RI/FS, and Proposed Plan. The response comments the Tri-Party Agencies provided show that none of the advice provided by the Board was accepted in the formulation of the record of decision (ROD) and remedial approach. The Board takes this opportunity to advise the Tri-Parties on a policy level about the Board's view on remediation

  2. Microsoft PowerPoint - 2012CCS_Duan.pptx

    Office of Scientific and Technical Information (OSTI)

    Predictions of the thermodynamic Properties of Solid thermodynamic Properties of Solid Sorbents Capture CO 2 Applications Y. Duan 1 , D. C. Sorescu 1 , D. R. Luebke 1 , H. W. Pennline 1 L. Li 2 , D. King 2 , L. F. Zhao 3 , Y. H. Xiao 3 1 DOE-National Energy Technology Lab. Pittsburgh, PA 15236 2 I tit t f I t f i l C t l i P ifi N th t N ti l L b t Ri hl d WA 99354 11 st Ann. Conf. on Carbon Capture Utilization & Sequestration (May 2, 2012, Pittsburgh, PA) 2 Institute for Interfacial

  3. Microsoft PowerPoint - 2012PCC_Duan.pptx

    Office of Scientific and Technical Information (OSTI)

    Thermodynamic Properties of CO 2 Capture Reaction by Solid Sorbents: Theoretical Reaction by Solid Sorbents: Theoretical Predictions and Experimental Validations Yuhua Duan 1 , David Luebke 1 , Henry Pennline 1 Liyu Li 2 , David King 2 , Keling Zhang 2 , Lifeng Zhao 3 , Yunhan Xiao 3 1 DOE-National Energy Technology Lab. Pittsburgh, PA 15236 2 I tit t f I t f i l C t l i P ifi N th t N ti l L b t Ri hl d WA 99354 2012 International Pittsburgh Coal Conference (Oct. 17, 2012, Pittsburgh, PA) 2

  4. Low Emissions Potential of EGR-SCR-DPF and Advanced Fuel Formulation - A

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Progress Report | Department of Energy Emissions Potential of EGR-SCR-DPF and Advanced Fuel Formulation - A Progress Report Low Emissions Potential of EGR-SCR-DPF and Advanced Fuel Formulation - A Progress Report 2003 DEER Conference Presentation: Southwest Research Institute PDF icon deer_2003_khair.pdf More Documents & Publications Final Update on APBF-DEC EGR/DPF/SCR Demonstration Project at SwRI Low Emisssions Potential of EGR-SCR-DPF and Advanced Fuel Formulations - A Progress

  5. Vapor Pressures and Heats of Vaporization of Primary Coal Tars

    Office of Scientific and Technical Information (OSTI)

    / PC92544-18 VAPOR PRESSURES AND HEATS OF VAPORIZATION OF PRIMARY COAL TARS FINAL REPORT Grant Dates: August, 1992 - November, 1996 Principal Authors: Eric M. Suuberg (PI) and Vahur Oja Report Submitted: April, 1997 Revised: July, 1997 Grant Number: DE-FG22-92PC92544 Report Submitted by: ERIC M. SUUBERG DIVISION OF ENGINEERING BROWN UNIVERSITY PROVIDENCE, RI 02912 TEL. (401) 863-1420 Prepared For: U. S. DEPT. OF ENERGY FEDERAL ENERGY TECHNOLOGY CENTER P.O. BOX 10940 PITTSBURGH, PA 15236 DR.

  6. " Million Housing Units, Final"

    U.S. Energy Information Administration (EIA) Indexed Site

    8 Structural and Geographic Characteristics of Homes in Northeast Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Northeast Census Region" ,,,"New England Census Division",,,"Middle Atlantic Census Division" ,"Total U.S.1 (millions)",,"Total New England",,,"Total Middle Atlantic" "Structural and Geographic Characteristics",,"Total Northeast",,,"CT, ME, NH, RI, VT"

  7. DEAR 952

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    XJXVW 3DJH RI %6' &6 ([KLELW & ± ,7(5 Ref: DEAR 952.227-11 3$7(17 5,*+76 5(7(17,21 %< 7+( 6(//(5 6+257 )250 ,7(5 $XJXVW (a) Definitions. (1) "Invention" means any invention or discovery which is or may be patentable or otherwise protectable under title 35 of the United States Code, or any novel variety of plant which is or may be protected under the Plant Variety Protection Act (7 U.S.C. 2321, et seq.). (2) "Made" when used in relation to any invention means the

  8. padd map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    FL PADD 4: Rocky Mountain PADD 5: West Coast PADD 2: Midwest PADD 1: East Coast PADD 3: Gulf Coast PADD1A: New England PADD1B: Central Atlantic PADD1C: Lower Atlantic Petroleum Administration for Defense Districts AK HI WA OR CA NV AZ MT WY CO UT ID ND SD NE KS OK MO MN WI MI IL IN OH KY TN IA NM TX AR LA AL MS WV VA NC SC GA FL ME NH VT NY PA NJ MD DE MA CT RI

  9. Cimon, Engstrom, Mattson, Pollet, Vanni, Suyama Page 1 of 3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2014 RAP Committee: Draft Advice re: 100-N Draft A, v.2 Cimon, Engstrom, Mattson, Pollet, Vanni, Suyama Page 1 of 3 Draft Advice re: Proposed Plan for Remediation of the 100-NR-1 and 100-NR-2 Operable Units (DOE/RL-2012-68, Draft A) Background The 100-N area is the last of the 100 Area, River Corridor, RI/FS and Proposed Plans for submittal. The 100-N area consists of two Decision Units, NR-1, which is the source unit, and NR-2, the groundwater unit. There are 234 facilities, of which 76% have

  10. Cimon, Engstrom, Serres, Vanni, Pollet

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RI/FS and Proposed Plan for 100-F, v.4 (8/13/14) Page 1 of 2 Cimon, Engstrom, Serres, Vanni, Pollet DRAFT Advice: Remedial Investigation/Feasibility Study and Proposed Plan for the 100-FR-1, 100-FR-2, 100-FR-3, 100-IU-2 and 100-IU-6 Operable Units; DOE/RL The Hanford Advisory Board (Board) has greatly appreciated all of the opportunities that have been extended by the Tri-Party Agencies (TPA) to allow early comment on the 100-F Area Proposed Plan. On June 7th 2013, the Board submitted Advice

  11. Exploring Plasma Science Advances from Fusion Findings to Astrophysical

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Achievements | Princeton Plasma Physics Lab Exploring Plasma Science Advances from Fusion Findings to Astrophysical Achievements By John Greenwald December 4, 2012 Tweet Widget Google Plus One Share on Facebook The latest advances in plasma physics were the focus of more than 1,000 scientists from around the world who gathered in Providence, R.I., from Oct. 29 through Nov. 2 for the 54th Annual Meeting of the American Physical Society's Division of Plasma Physics (APS-DPP). Papers, posters

  12. N A

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    _ Loblolly Pine _ Longleaf Pine D Mixed Pine/Hardwood D Carolina Bay Wetland _Water D Sandhill Scrub oakiPine N Site Boundary IV. Streams ';f({; Roads .* TES Plants (1) D TES Plants (2) D SRS Bays a Hydric Soils 430 Soils Soil Series and Phase DAnB DBaB DLaB 13]Og c:J Rm Vegetation Compartment 29 ooo~ooZZZgggggg~ggggg 0000000000000000000000 0000000000000000000000 o 0 CIQ'~""\~ ~O!.> 'p.:**~~ <DX-ri'.v 0 :0 0O"'()~:)<:0 6000'6 ~',-~'D 6.y6~ 0 00000000000000000000001

  13. Issue framework for potential 100-N advice (lead Issue Manager: Engstrom

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    framework for potential 100-N advice (lead Issue Manager: Engstrom) Background information The 100-N area is the last of the 100 Area, River Corridor, RI/FS and Proposed Plans for submittal. The 100-N area consists of two Decision Units, NR-1, which is the source unit, and NR-2, the groundwater unit. There are 234 facilities, of which 76% have been demolished, and there are 175 waste sites and four RCRA TSD sites. Of these waste sites, 18 have been cleaned up and 78 have been scheduled for start

  14. Preliminary Analysis of Modules Deployed at PV-USA for 18-24 Years |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Preliminary Analysis of Modules Deployed at PV-USA for 18-24 Years Preliminary Analysis of Modules Deployed at PV-USA for 18-24 Years Presented at the PV Module Reliability Workshop, February 26 - 27 2013, Golden, Colorado PDF icon pvmrw13_ps1_pvusa_pineda.pdf More Documents & Publications Cost of Capital Developments in High Efficiency Engine Technologies and an Introduction to SwRI's Dedicated EGR Concept Vehicle Technologies Office Merit Review 2014: Trip

  15. Microsoft PowerPoint - NEAC Rpt of Fuel Cycle comm slides

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    R t f th F l C l Report of the Fuel Cycle Research and Development p Subcommittee of NEAC B Ri h (Ch i ) Burton Richter (Chairman) Margaret Chu Darleane Hoffman Ray Juzaitis Ray Juzaitis Sekazi Mtingwa Ronald P. Omberg Joy L. Rempe Joy L. Rempe Dominique Warin June 12, 2012 Washington, D.C. Context for the Meeting Context for the Meeting * Fukushima - Increased fault tolerance for Fukushima Increased fault tolerance for reactor systems * Used Fuel Disposal - Response to BRC is being Used Fuel

  16. 200 North Aggregate Area source AAMS report

    SciTech Connect (OSTI)

    Not Available

    1993-06-01

    This report presents the results of an aggregate area management study (AAMS) for the 200 North Aggregate Area in the 200 Areas of the US Department of Energy (DOE) Hanford Site in Washington State. This scoping level study provides the basis for initiating Remedial Investigation/Feasibility Study (RI/FS) activities under the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) or Resource Conservation and Recovery Act (RCRA) Facility Investigations (RFI) and Corrective Measures Studies (CMS) under RCRA. This report also integrates select RCRA treatment, storage, or disposal (TSD) closure activities with CERCLA and RCRA past practice investigations.

  17. DOE Hydrogen and Fuel Cell Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOE Hydrogen & Fuel Cell Overview Dr. Sunita Satyapal Program Manager U.S. Department of Energy Fuel Cell Technologies Program DOE/CESA/TTC Hydrogen and Fuel Cells Webinar December 14, 2010 2 Examples of DOE-funded Partners and Locations - Fuel Cell Technologies Program TX NM AZ NC AR CA CO HI WA IL KY MA MN MO MS AL NV TN UT WV ID FL MI ND OR OH IN MT WY IO NE KS OK AK LA GA WI SC VA PA DE MD DC NJ NY RI CT VT NH ME SD Source: US DOE 12/2010 2 3 Fuel Cells: Addressing Energy Challenges 4

  18. United States Government Department of Eney

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    l 'vl/OU Wy) :jJ. rI A o Aooa IUL u. * * .. - DOE F 13218 United States Government Department of Eney memorandum DATE: November 28, 2006 Audit Report Number: OAS-L-07-03 REPLY TO ATT OF: IG-32 (A06PR022) SUBJECT: Audit of the "Department of Energy's Carbon Sequestration Program" TO: Assistant Secretary, Office of Fossil Energy INTRODUCTION AND OBJECTIVE Carbon sequestration is the capture and storage of carbon dioxide and other greenhouse gases that would otherwise be emitted into the

  19. Microsoft Word - HAB RAP Briefing 08-12-09.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RI Status Meeting August 12, 2009 Surface Water/Sediment/Core Sampling - Integral Consulting Inc. Spring Surface Water sampling campaign completed on June 11 All other sampling has now been completed Draft Field Summary report received for WCH review on July 15 Split sampling was performed for EPA, and Ecology/WA Department of Health for both surface water and sediment. Sample Tally (as of 8/7/09) Media # of Locations # of Samples Shallow/Deep Sediment 35 172 Shoreline Sediment 39 183 Island

  20. Microsoft Word - RAP_IssuesTable_August2011.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Preliminary FY 2012 Issues Table Updated August 2011 Page 1 Area RAP Committee Area of Interest Issue Manager(s) (*denotes lead) Other interested committee members Focus/Product For FY2012 Framing Questions (Articulated by Issue Managers) Cross- cutting River Corridor 100 & 300 Areas * 100 B/C Area * 100 K Area * 100 N Area * 100 D & H Areas * 100 F Area * 300 Area Shelley Cimon Dale Engstrom Bob Suyama Wade Riggsbee 6 RODs RI/FS & RD/RA to be issued between now & 2012 Are there

  1. Microsoft Word - 14th_rf_conf.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lower Hybrid Antenna for Current Drive Experiments on MST J.A. Goetz, M.A. Thomas, C.B. Forest, S.C. Prager, E. Uchimoto a) , F.W. Baity b) , and R.I. Pinsker c) Department of Physics, University of Wisconsin, Madison, WI 53706 a) Department of Physics and Astronomy, University of Montana, Missoula, MT 59812 b) Oak Ridge National Laboratory, Oak Ridge, TN 37831 c) General Atomics, San Diego, CA 92186 Abstract. RF current drive has been proposed as a mechanism for reducing the tearing

  2. Microsoft Word - 2012_0307_RAP_flipcharts.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    March 7, 2012 200 UP-1 1. Provide Dale with any issues on 200 UP-1 (thru Susan H.) -Dale w/track 2. Wait until RI/FS released to determine how issues were addressed and need for advice (potentially June Board mtg) 3. HAB provided a letter to EPA to provide to R.R.B. - referenced HAB advice relevant to this. Page 1 200 UP-1 (cont'd) 4. HAB members should keep an eye on budget support for GW cleanup 5. Look for agencies to make commitment to add more wells as needed (such a commitment could be

  3. Microsoft Word - 2016_0107_RAP_100-DH-PP_advice_DRAFTv5.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RAP Committee: Draft Advice: 100-D/H, Draft A, v.5 (1/7/16) Page 1 of 2 Engstrom, Mattson, Pollet, Vanni, Suyama, Cimon, Serres Draft Advice: Proposed Plan for Remediation of the 100-DR-1, 100-DR-2, 100-HR-1, 100-HR-2, and 100-HR-3 Operable Units (Draft A) Background A Remedial Investigation/Feasibility Study (Draft A) has been completed for the 100-DR-1, 100-DR-2, 100-HR-1, 100-HR-2, and 100-HR-3 Operable Units (DOE/RL-2010-95; 100-D/H RI/FS) and a Proposed Plan was prepared with the preferred

  4. CHEMISTRY AND CHEMICAL ENGINEERING DIVISION

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Exponent, Inc. 2 SwRI Project No. 01.19142.01.001 1.0 INTRODUCTION The objective of this test program was to perform a custom fire test to measure the heat release rate (HRR) and burning behavior of an Electric Vehicle Lithium Ion Battery, when subjected to a propane fueled fire, for Exponent, Inc., located in Bowie, MD. Additionally, the products of combustion were sampled and analyzed using Fourier Transform Infrared (FTIR) spectroscopy for various gases. Testing was conducted March 13, 2013,

  5. M

    Office of Legacy Management (LM)

    mrrtnr M ilniteb States Government memorandum 069397 id j ' 4 Department of Enek sue DATE: JUNE 25.1990 -"To Nmcf? EN-231 - ExPedlted Roeeci~res for Remedial ActIons at Small Sites n, J. Flare. RI-423 OxrenC protocol and proce&xes for lmplementlng the remedial acllon ind awoclated envIronmental revlev process un&?r the Formerly Utlllzed SItea Program (FUSR4P) were developed with primary conslderstlon @ven to the larger and higher prlorlty sites. These procedures drc deslgned to

  6. Microsoft Word - S00416.doc

    Office of Legacy Management (LM)

    ;: A~1ENDED NOTICE OF RESIDUAL RADIOACTIVE CONTAMINATION T HIS NOTICE IS TO A L ERT B UYERS O R DE VELOPERS THAT RESIDU AL RAD IO A CT IVE CONTA MI NATIO N mrs O N THE P RO PERTY HERE IN DESC RI B ED . / EXISTS RECITALS A. WH EREAS , the current owner of the property known as the Salt Lake Vitro Site situated in the ~ county of Salt Lake , Salt Lake City , Utah . and more particularly described on Exhibit 1 attached herelol~'j,\ isC entral Valley Water Reclamation Facility Board located at 800

  7. Operational Area Monitoring Plan

    Office of Legacy Management (LM)

    ' SECTION 11.7B Operational Area Monitoring Plan for the Long -Term H yd rol og ical M o n i to ri ng - Program Off The Nevada Test Site S . C. Black Reynolds Electrical & Engineering, Co. and W. G. Phillips, G. G. Martin, D. J. Chaloud, C. A. Fontana, and 0. G. Easterly Environmental Monitoring Systems Laboratory U. S. Environmental Protection Agency October 23, 1991 FOREWORD This is one of a series of Operational Area Monitoring Plans that comprise the overall Environmental Monitoring Plan

  8. TITLE

    Office of Legacy Management (LM)

    902 GEN-BKS - - - . I 111 111 111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 l l Ill SHL 000024 United States Office of Radiation and EPA-402-R-94-001 Environmental Protection Indoor Air January 2004 Agency Washington, DC 20460 Annual Water Sampling and Analysis, Calendar Year 2003: SHOAL Test Site Area FAULTLESS Test Site Area RULISON Test Site Area RI0 BLANCO Test Site Area GASBUGGY Test Site Area GNOME Test Site Area Annual Water Sampling and Analysis, Calendar Year 2003 SHOAL Test Site Area

  9. The History of DEER | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The History of DEER The History of DEER Presentation given at the 2007 Diesel Engine-Efficiency & Emissions Research Conference (DEER 2007). 13-16 August, 2007, Detroit, Michigan. Sponsored by the U.S. Department of Energy's (DOE) Office of FreedomCAR and Vehicle Technologies (OFCVT). PDF icon deer07_eberhardt.pdf More Documents & Publications Update on Progress of APBF-DEC EGR/DPF/SCR Demonstration Program at SwRI After Petroleum Fuels of the Future for Cars and Trucks

  10. WA_98_001_REYNOLDS_METALS_COMPANY_Waiver_of_Domestic_and_For.pdf |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy 8_001_REYNOLDS_METALS_COMPANY_Waiver_of_Domestic_and_For.pdf WA_98_001_REYNOLDS_METALS_COMPANY_Waiver_of_Domestic_and_For.pdf PDF icon WA_98_001_REYNOLDS_METALS_COMPANY_Waiver_of_Domestic_and_For.pdf More Documents & Publications WA_98_014_ALUMINUM_COMPANY_OF_AMERICA_(ALCOA)_Waiver_of_Dome.pdf WA_00_023_ALCOA_INC_Waiver_of_Domestic_and_Foreign_Patent_Ri.pdf U.S. Energy Requirements for Aluminum Production

  11. # Energy Measuremenfs Group

    Office of Legacy Management (LM)

    ri EECE # Energy Measuremenfs Group SUMMARY REPORT . AiRIAL R4DIOLOGICAL SURVEY - NIAGARA FALLS AREA NIAGARA FALLS, NEh' YORK DATE OF SURVEY: SEPTEMBER 1979 APPROVED FOR DISTRIBUTION: P Stuart, EC&G, Inc. . . Herbirt F. Hahn, Department of Energy PERFDRflED BY EGtf, INC. UNDER CONTRACT NO. DE-AHO&76NV01163 WITH THE UNITED STATES DEPARTMENT OF ENERGY II'AFID 010 November 30, 1979 - The Aerial Measurements System (A%), operated by EC&t, Inc< for the Un i ted States Department of

  12. CEKRM. FILES

    Office of Legacy Management (LM)

    *:-I c-Y,- -.>A - L z.23 ' ,gQ+ CEKRM. FILES : -- i" ry .' ;,:;;:i ;- ' _ :;, I' -. .-,- p.." * .i' ' --yr:,? ,5 .Y' :?!, .I I >L L qgy~T.5 ,-:,,. \>,' yt r, .,-:,7 ,A : _ . . T_ 31' :;:: . .' : z ^., - -; &.' -" ' \-,-y . ..L' .:"A .:1i2*;,1 1- .,: _.,-.- 1 ,... _ . , , 2; J..i"!w , . . . .' _ \ ' d>; : r. . _ " ' . ;I 2: a : ..i. ,. 7, I . :ri cij?TL-i; 12, ;;,2;-,: ;. ." * 1. 1 .:1 : :: .' I .-=-. I. Iv-.. . . . . - i. ; i -2. ./ ..l,..- '

  13. Dear Mayor Riley: I

    Office of Legacy Management (LM)

    ~. Washington, DC 20585 ' . . aaAq 3 .A , Tbs %z;y;bl& &r& Ri!ey !llll Brookshire Avenue Downey, California 90247 ' Dear Mayor Riley: I Secretary of.Energy Hazel O!.Leary has announced a new approach, to openness in the Department of Energy (DOE) and its communications with the pubTic. In support of this initiative, we are pleased to forward the enclosed 'info'rmation related to:the former North American Aviation site in your jurisdiction that performed work for DOE or its

  14. Dear Mr. Dunr:

    Office of Legacy Management (LM)

    Dear Mr. Dunr: responded to &as L I am in a recci t of our correspondence dated 22 July 1992, truments in which you (TI) request for remediatton funding at a formerly utilixedburialsita at our Attleboro; Massachusetts facility. Though your letter discussed FUSRAP' s (Formerly Utilized Sites Re~@;q;r Action Program) protccol as determined by the De rtment of Ene failed to addres? potdial mechanisms for funding w le. Materials& ri F ontrola 1;:. Fi$tflI) was rnvolved with the U.S.

  15. ELECTRIC

    Office of Legacy Management (LM)

    ELECTRIC cdrtrokArJclaeT 3 I+ &i, y$ \I &OF I*- j< t j,fci..- ir )(yiT !E-li, ( \-,v? Cl -p/4.4 RESEARCH LABORATORIES EAST PITTSBURGH, PA. 8ay 22, 1947 Mr. J. Carrel Vrilson General ?!!mager Atomic Qxzgy Commission 1901 Constitution Avenue Kashington, D. C. Dear Sir: In the course of OUT nuclenr research we are planning to study the enc:ri;y threshold anti cross section for fission. For thib program we require a s<>piAroted sample of metallic Uranium 258 of high purity. A

  16. EVG USAIX, Svergreen chalk River Liaison Office Ontario, Canada

    Office of Legacy Management (LM)

    and Special Nuc.lear ?kk?rials kcc+ntabilitg EVG USAIX, Svergreen chalk River Liaison Office Ontario, Canada iulff USAEC, Washington Office See Div. of Rak Materials c~!:KRGO O?ER.i~TIONS ---.-- :ri:i!k USAZC, Ctricago Opnrations Office AGT General Electric Company AN? Project A.J,I Argonne Nat'1 Lab. AYL Al-tonne Nat'1 Lab. B XI Battelle Xfemorial Inst. CKX Vi.l;ro Carp, of America Em USAEC, East Hartford Area a TSC Ioxa State College ITS General Electric Company ANP Jk!pt, -%IAO IJSAK;,

  17. FROti:

    Office of Legacy Management (LM)

    p.1, , 1' 3 ' - j ttEMORANDUtl TO: FILE - FJ+u? /WI - /3 DATE 2 /I/ / 9 / ----------^--______ FROti: D. s-f&J ---------------- SUBJECT: SITE NAME: --_-__----__-_--- _____ &----w' I+& - f*/crq ALTERNATE A t=l r---i ted ____ NAME: -----------__-________ CITY: ~+ZZL------ _______ STATE: ------ ff+$- OWNER(S) --y;;g-- && - /??#A~ ------------------------ Current: &v CA-J--;cJ Owner contacted ~--yes 0 noi -.-------me-we------- if yes, date contacted _ //t*/4/ -e-----N------

  18. Windpower

    Broader source: Energy.gov (indexed) [DOE]

    Chilocco Wind Park Cherokee Nation (other nations as well) Cherokee Nation Businesses, LLC And PNE Wind Cherokee Chilocco Wind North Central Oklahoma Location KA W PA W N EE TO NK AW A PO NC A OT OE -M IS S OU RI CH E RO KE E Acr es: 2,633 .348 CH E RO KE E Acr es: 1,641 .687 CHEROKEE NATION Kay County Chilocco Property DATA SOU RC ES: US Census Bureau (T iger Files ) D OQQ's , USGS D RG's, USGS Cherokee Nation Realty D epartment C herokee N ation GeoD ata C enter Date: 12/19/01

  19. M'

    Office of Legacy Management (LM)

    M' i. l-2 C-CT NO. AT(30-1)4405, hi. lo. 9 SUPPLEMENTALAGRE?WM THIS SUPPLEMENTAL AGREXUENT , entered into theloth day of February 195Lr by and between TEE UNITED STATES OF AMERICA'~lnafter referred & as the 'Government"), ar represented by the UNITED STATES ATOMIC l!3l8GY CQ4MISSfON (hereinafter referred to as the Wmmi~el~ri@), and BUDGW(RT BRASS COMPANY (hereinafter referred to ae the Qmtractor"); UITHESSETH THAT: WHERElls, the Governmen t and the Contractor entered Into Contract

  20. ORNL/RASA-86/66

    Office of Legacy Management (LM)

    6 0£W'^b^^t~~~~~fl0 *(LN002V) OAK RIDGE NATIONAL LABORATORY ~LABORATORY RESULTS OF THE INDEPENDENT RADIOLOGICAL ri r ''f r-- *VERIFICATION SURVEY AT 59 TRUDY DRIVE, LODI, NEW JERSEY (LN002V) M. G. Yalcintas C. A. Johnson Access to the information in this report is limited to those indicated on the distribution list and to Department of Energy and Department of Energy Contractors OPERATED BY MARTIN MARIETTA ENERGY SYSTEMS, INC. FOR THE UNITED STATES DEPARTMENT OF ENERGY This report was prepared

  1. I

    Office of Legacy Management (LM)

    of Etieigy Washingtpn, DC 20585 : ,i ' 'FEB 17 1995 The Honorable Terry Frizzel 3900 Main Street Ri,verside,, California. '92507 DearMayor Frizzel: '. Secretary of Energy Hazel O'Leary has announced a new approach to.openness in the Department'of Energy (DDE)' and its cotiunications with the public. I! support of this,initiative, we are pleased to forward the enclosed information related to the former.Hunter Douglas Aluminum Plant site in your jurisdiction that performed work for

  2. I

    Office of Legacy Management (LM)

    -/' ,4&y &yL I Ri $4 p 7.3 $ c p/. -9 i Mr. Roger Boyd Ohio Environmental Protection Agency P.O. Box 1049 Columbus, Ohio 43266-0149 Mr. Kevin Driesbach Radiological Health Program Department of Health 1224 Kinnear Road Columbus, Ohio 43212 Mr. William Franz Federal Facility Coordinator EPA Region V 230 South Dearborn Street Chicago, Illinois 60604 Gentlemen: The U.S. Department of Energy (DOE) established its Formerly Utilized Sites Remedial Action Program (FUSRAP) to (1) identify,

  3. I

    Office of Legacy Management (LM)

    c+dRiICE CONTRACT -* sem..-. "-""' ~* ~b-copies, Series...E-- No. 7401-37-93 * This Subcontract is entered into this && day of February, 1944, and between The University of Chicago, a corporation not for peouniar organized under the laws of the State of Illinois, located in Chicago, (hereinafter called the Vontractor"), and Quality Hardware & Machine tion, a corporation or anized in Chicago, Illinois, $ under the laws of the State of Illinois, hereinafter called

  4. I L

    Office of Legacy Management (LM)

    f- r a-.--+ _ . . .* i_ : CI r . : . . I . f" b" ? ' ,' ' , I L $.. . 0. .' ?, : _' . *r: :,: : .,: ' , . r:. i ' 3"' 3. L SURVEY F THE DITCHES AT THE ST t lJl@ ,bilRPORT STORAGE SITE, ' , :I (SLAPSS) .;' :: ,, .s . .I 1, :' ,., I,: AUGUST 1983 :' PARED FOR THE U.S.DEPARTME?W OF ENERGY &#$nEEi .Ct+TRACT NOa DE-ACOS-8 tOR20722 */, ? 8. ' By 8EGHi' El. NATIONAL, INC. NUGL&YAR FU& O%RAtlONS. .i -.- I 9.0, Box 360 t" OAK RI-. TN. 37830, jl c the united swee

  5. It, Le. requeoted thet Contmot no

    Office of Legacy Management (LM)

    It, Le. requeoted thet Contmot no. AT( 30~l)-1661 be mended to include additional development work oovered i,n the attaohed proposal. &?.EiO &,tQ ~mo~vOd b +),i' o.' am&&-t.,+ a&, follm, i:::., ,,I,: .,,,, Y, ,,, , _ i..! C:-I 2' :. ' ..I: ' :..t ,,., :I; ' :' Z : ,I' ..' ., i. :: ' ,,. Contraotor snd~Maili~~Addre6et ' ,. ;:, ' 5," :r:i,. ..I. . ( ' .:;>:i' :," ,,y _,,, I,' ,, ' :,-:,.:, ., ?I ., i..' ,, / I ,, : I 1 j: :: ; De To produoe boron of as fine a

  6. LCriu OoYCrtR"/

    Office of Legacy Management (LM)

    I\J v. 1 Ah??-2 a/i, / sq _.. ,F-- & ,; ( 1 , i c ;" ,I f ' f- ' (" ." I, ( f c ,F ,td ,,' :, i -+ 1 ,?-' : '" " 4: i' ,-) c ' 3 J' b F ' : ) )j\,J\ :I "vE-', P-)ri 1 I 'r>)r\ L LCriu OoYCrtR"/ i tj~~3iscr,a,..),r\'~'i':riii "1 . _._ .- __ . . .._-.------ PURCHASE ORDER. \ ORDER No. ----zz-7-- - .-.. __~--- ___ -_ - __--. -+?=w. *u*, .. i ' NATIONAL LEAD COMPANY OF OHIO I=--- . BOX 1538, MT. HEALTHY STATION, CINCI' NNATI 31. OHIO iwe-.---- ___-

  7. NATIONAL KAD CO. OF OHIO - HEALTH & SAFETY DIVISION

    Office of Legacy Management (LM)

    KAD CO. OF OHIO - HEALTH & SAFETY DIVISION NC) 1602 c ! 9 Hygionm or Medical Dapt. h 2 44 - - =.- Hour Sample Description 6 \ : ' _/ *. I I . ..$$$ +ri, I- .' i C "I. I I I I . 1 I * ,' z Analytical Cha4dA -K-F- Counting D&a: 4; 9 7.' __-__--__ ' T ..__ . . -~ -- --- ---_ . NATIONAL MAD CO. OP OHIO - HEALTH & SAFWY DIVISION N ? ,299 Industrial Hygiene or Medical D8pt. 1. H.#581kmph Nos. D8t8 Cobxted 3 +%ay Rtis Route to RHs Location Uaah-Rite CO- Type of Smpl8~nslyz8d for$m

  8. NATIONAL LF.hD COMPANY OF C4IIO

    Office of Legacy Management (LM)

    LF.hD COMPANY OF C4IIO Cincinnati 39, Ohio March 21, I1960 " ;:ri[l,!Im TRIP FRPCRT TO NATlO>!AL TUBE DIVISION, CIIRISTY PARK \~ORKS, K' CKEESPORT, ?ENNSYLVANXA, ON PFBRiJARY 15 TO t.WICII 2.: 196U ' II \' I .Ja A. Quigley; M.D. : ' ,. .' ,, we pirrpose of thi.s trip was to observe ' the' health and sn li ety aspects of i::i.er:cing normnl uraniuni bi.llets by thc..three roll Assel Mill process, nod 1:~ supervise and i.nsure tlecon.~amlnstion of the Christ; Park Works factLi.ti.es.

  9. OFFICE,

    Office of Legacy Management (LM)

    OFFICE, . . . . . ..-..__. _ --.-.__.. .-..I............ !..-... bUmME. wArl&l ' rrsldu*. in the dw6lopmQt pmgrwh : Be ostiamts Uuat not man lf+ .b%'o,Q~~~ds. cik'e%ah of the eevenl reel&~ will be require& In : 'ri~ofthehereiabefor6notedeopreodo~ of puriata~tio.aadap :, Iv ve unbntend you vi11 not obj.& to:tha aoe " ai spoh +ant+lea of the mirloua real&es ,, ', ',"" ': ., .,.. i. : /~. ,".. .I,: /, . . ' .* ,; ., ,' ,:.' . .-;. ,-Y .b4 P-0 : ,.

  10. PRODUCTIOR"OF TRORI~JW~IETALIWES PROCESS F6R RB)IJCIRO T&Old 2 ':

    Office of Legacy Management (LM)

    PRODUCTIOR"OF TRORI~JW~IETALIWES PROCESS F6R RB)IJCIRO T&Old 2 ': am wm ..,. :I.::. ? ; \: :.:, .,, : ,. / 1. ..ri:,:,.:, :/ I 8yblBOLa PPaJPT i: >. ,,;.;~:,,; ,;.. !,., ,ip; ,,,:. ;., -. , ^ , . . 3 '>) ! .,:<;:,,..,. ; : :..,, ,,.+ -../ ,:,; I,:;?: ..: : ,, ,,: ; !. (' '; ::, Durine,~~~v%eit'to Amae &8Htate~Coliegd on Mar6h 4 and 2 to dl&ni& prinalpally~~asl~~prd~ess~~~1 also r&&&d wltlvDii 8. Wilhelm and Dr. D. Peterson of An~?e Iowa State College

  11. REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support

    Office of Legacy Management (LM)

    x:Y" . .' 3023 I\ \ 'a' '. Unita? -&&s Coverament , ,Q,.l. ),&, ,(>.. Department of Energy riGmorandum / d6a 2/. $3 DATE: JL(L 2 8 ;;$5 co. /3 .-J/ co,/3 REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decommissioning Projects (DFSD) is responsible for managing the

  12. Buildings Energy Data Book: 3.9 Educational Facilities

    Buildings Energy Data Book [EERE]

    6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning

  13. Fiscal year 1995 progress in implementing Section 120 of the Comprehensive Environmental Response, Compensation, and Liability Act. Ninth annual report to Congress

    SciTech Connect (OSTI)

    1996-09-01

    Congress passed the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) (Public Law 96-510), commonly known as Superfund, in 1980. The Superfund Amendments and Reauthorization Act (SARA) which amended CERCLA in 1986, added Section 120 regarding the cleanup of contaminated sites at Federal facilities. Under Section 120(e)(5) of CERCLA, each department, agency, or instrumentality of the Federal government responsible for compliance with Section 120 must submit an annual report to Congress concerning its progress in implementing the requirements of Section 120. The report must include information on the progress in reaching Interagency Agreements (IAGs), conducting Remedial Investigation and Feasibility Studies (RI/FSs), and performing remedial action. Federal agencies that own or operate facilities on the National priorities List (NPL) are required to begin an RI/FS for these facilities within 6 months after being placed on the NPL. Remediation of these facilities is addressed in an IAG between the Federal agency, the US Environmental Protection Agency (EPA), and in some instances the state within which the facility is located. This report provides the status of ongoing activities being performed in support of CERCLA Section 120 at DOE facilities. This includes activities conducted to reach IAGs and progress in conducting remedial actions.

  14. Fiscal year 1996 progress in implementing Section 120 of the Comprehensive Environmental Response, Compensation, and Liability Act. Tenth annual report to Congress

    SciTech Connect (OSTI)

    1997-12-01

    Congress passed the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) (Public Law 96-510), commonly known as Superfund, in 1980. The Superfund Amendments and Reauthorization Act (SARA) (Public Law 99-499), which amended CERCLA in 1986, added Section 120 regarding the cleanup of contaminated sites at Federal facilities. Under Section 120(e)(5) of CERCLA, each department, agency, or instrumentality of the Federal government responsible for compliance with Section 120 must submit an annual report to Congress concerning its progress in implementing the requirements of Section 120. The report must include information on the progress in reaching Interagency Agreements (IAGs), conducting remedial investigation and feasibility studies (RI/FSs), and performing remedial actions. Federal agencies that own or operate facilities on the National Priorities List (NPL) are required to begin an RI/FS for these facilities within 6 months after being placed on the NPL. Remediation of these facilities is addressed in an IAG between the Federal agency, the US Environmental Protection Agency (EPA), and in some instances the state within which the facility is located.

  15. Remedidal investigation and feasibility study report for the Environmental Restoration Disposal Facility

    SciTech Connect (OSTI)

    Roeck, F.V.

    1994-06-01

    The purpose of the remedial investigation (RI) is to collect data necessary to adequately characterize the site for the purpose of developing and evaluating effective remedial alternatives. To characterize the site, the lead agency shall, as appropriate, conduct field investigations, including treatability studies, and conduct a baseline risk assessment. The RI provides information to assess the risks to human health and the environment and to support the development, evaluation, and selection of appropriate response alternatives. The primary objective of the feasibility study (FS) is to ensure that appropriate remedial alternatives are developed and evaluated such that relevant information concerning the remedial action options can be presented to a decision-maker and an appropriate remedy selected. The lead agency may develop a feasibility study to address a specific site problem or the entire site. The development and evaluation of alternatives shall reflect the scope and complexity of the remedial action under consideration and the site problems being addressed. Development of alternatives shall be fully integrated with the site characterization activities of the remedial investigation described in paragraph (d) of this section. The lead agency shall include an alternatives screening step, when needed, to select a reasonable number of alternatives for detailed analysis.

  16. Cost of presumptive source term Remedial Actions Laboratory for energy-related health research, University of California, Davis

    SciTech Connect (OSTI)

    Last, G.V.; Bagaasen, L.M.; Josephson, G.B.; Lanigan, D.C.; Liikala, T.L.; Newcomer, D.R.; Pearson, A.W.; Teel, S.S.

    1995-12-01

    A Remedial Investigation/Feasibility Study (RI/FS) is in progress at the Laboratory for Energy Related Health Research (LEHR) at the University of California, Davis. The purpose of the RI/FS is to gather sufficient information to support an informed risk management decision regarding the most appropriate remedial actions for impacted areas of the facility. In an effort to expedite remediation of the LEHR facility, the remedial project managers requested a more detailed evaluation of a selected set of remedial actions. In particular, they requested information on both characterization and remedial action costs. The US Department of Energy -- Oakland Office requested the assistance of the Pacific Northwest National Laboratory to prepare order-of-magnitude cost estimates for presumptive remedial actions being considered for the five source term operable units. The cost estimates presented in this report include characterization costs, capital costs, and annual operation and maintenance (O&M) costs. These cost estimates are intended to aid planning and direction of future environmental remediation efforts.

  17. Live Cells as Dynamic Laboratories: Time Lapse Raman Spectral Microscopy of Nanoparticles with Both IgE Targeting and pH-Sensing Functions

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Nowak-Lovato, Kristy L.; Rector, Kirk D.

    2012-01-01

    Tmore » his review captures the use of live cells as dynamic microlaboratories through implementation of labeled nanoparticles (nanosensors) that have both sensing and targeting functions. The addition of 2,4-ε-dinitrophenol-L-lysine (DNP) as a FcεRI targeting ligand and 4-mercaptopyridine (4-MPy) as a pH-sensing ligand enables spatial and temporal monitoring of FcεRI receptors and their pH environment within the endocytic pathway. To ensure reliability, the sensor is calibrated in vivo using the ionophore nigericin and standard buffer solutions to equilibrate the external [ H + ] concentration with that of the cell compartments. This review highlights the nanosensors, ability to traffic and respond to pH of receptor-bound nanosensors (1) at physiological temperature ( 37 ° C ) versus room temperature ( 25 ° C ) , (2) after pharmacological treatment with bafilomycin, an H + ATPase pump inhibitor, or amiloride, an inhibitor of Na + / H + exchange, and (3) in response to both temperature and pharmacological treatment. Whole-cell, time lapse images are demonstrated to show the ability to transform live cells into dynamic laboratories to monitor temporal and spatial endosomal pH. The versatility of these probes shows promise for future applications relevant to intracellular trafficking and intelligent drug design.« less

  18. Cost-Effective Method for Producing Self Supported Palladium Alloy Membranes for Use in Efficient Production of Coal Derived Hydrogen

    SciTech Connect (OSTI)

    K. Coulter

    2008-03-31

    Southwest Research Institute{reg_sign} (SwRI{reg_sign}) has utilized its expertise in large-area vacuum deposition methods to conduct research into the fabrication of dense, freestanding Pd-alloy membranes that are 3-5 microns thick and over 100 in{sup 2} in area. The membranes were deposited onto flexible and rigid supports that were subsequently removed and separated using novel techniques developed over the course of the project. Using these methods, the production of novel alloy compositions centered around the Pd-Cu system were developed with the objective of producing a thermally stable, nano-crystalline grain structure with the highest flux recorded as 242 SCFH/ft{sup 2} for a 2 {micro}m thick Pd{sub 53}Cu{sub 47} at 400 C and 20 psig feed pressure which when extrapolated is over twice the 2010 Department of Energy pure H{sub 2} flux target. Several membranes were made with the same permeability, but with different thicknesses and these membranes were highly selective. Researchers at the Colorado School of Mines supported the effort with extensive testing of experimental membranes as well as design and modeling of novel alloy composite structures. IdaTech provided commercial bench testing and analysis of SwRI-manufactured membranes. The completed deliverables for the project include test data on the performance of experimental membranes fabricated by vacuum deposition and several Pd-alloy membranes that were supplied to IdaTech for testing.

  19. Human interleukin 2 receptor. beta. -chain gene: Chromosomal localization and identification of 5 prime regulatory sequences

    SciTech Connect (OSTI)

    Gnarra, J.R.; Otani, Hiroki; Wang, M.G.; McBride, O.W.; Sharon, M.; Leonard, W.J. )

    1990-05-01

    Interleukin 2 (IL-2) binds to and stimulates activated T cells through high-affinity IL-2 receptors (IL-2Rs). Such receptors represent a complex consisting of at least two proteins, the 55-kDa IL-2R{alpha} chain and the 70-kDa IL-2R{beta} chain. The low-affinity, IL-2R{alpha} chain cannot by itself transduce a mitogenic signal, whereas IL-2 stimulates resting lymphocytes through the intermediate-affinity, IL-2R{beta} receptor. The authors report here identification of the genomic locus for IL-2R{beta}. The exons are contained on four EcoRI fragments of 1.1, 9.2, 7.2, and 13.7 kilobases. The 1.1-kilobase EcoRI fragment lies at the 5{prime}-most end of the genomic locus and contains promoter sequences. The promoter contains no TATA box-like elements but does contain the d(GT){sub n} class of middle repetitive elements, which may play an interesting regulatory role. The IL-2R{beta} gene is localized to chromosome 22q11.2-q12, a region that is the locus for several lymphoid neoplasias.

  20. Improved NLDAS-2 Noah-simulated Hydrometeorological Products with an Interim Run

    SciTech Connect (OSTI)

    Xia, Youlong; Peter-Lidard, Christa; Huang, Maoyi; Wei, Helin; Ek, Michael

    2015-02-28

    In NLDAS-2 Noah simulation, the NLDAS team introduced an intermediate fix suggested by Slater et al. (2007) and Livneh et al. (2010) to reduce large sublimation. The fix is used to constraint surface exchange coefficient (CH) using CH =CHoriginal x max (1.0-RiB/0.5, 0.05) when atmospheric boundary layer is stable. RiB is Richardson number. In NLDAS-2 Noah version, this fix was used for all stable cases including snow-free grid cells. In this study, we simply applied this fix to the grid cells in which both stable atmospheric boundary layer and snow exist simultaneously excluding the snow-free grid cells as we recognize that the fix constraint in NLDAS-2 is too strong. We make a 31-year (1979-2009) Noah NLDAS-2 interim (NoahI) run. We use observed streamflow, evapotranspiration, land surface temperature, soil temperature, and ground heat flux to evaluate the results simulated from NoahI and make the reasonable comparison with those simulated from NLDAS-2 Noah (Xia et al., 2012). The results show that NoahI has the same performance as Noah does for snow water equivalent simulation. However, NoahI significantly improved the other hydrometeorological products simulation as described above when compared to Noah and the observations. This simple modification is being installed to the next Noah version. The hydrometeorological products simulated from NoahI will be staged on NCEP public server for the public in future.

  1. Remedial investigation concept plan for the groundwater operable units at the chemical plant area and the ordnance works area, Weldon Spring, Missouri

    SciTech Connect (OSTI)

    1999-07-15

    The U.S. Department of Energy (DOE) and the U.S. Department of the Army (DA) are conducting cleanup activities at two properties--the DOE chemical plant area and the DA ordnance works area (the latter includes the training area)--located in the Weldon Spring area in St. Charles County, Missouri. These areas are on the National Priorities List (NPL), and cleanup activities at both areas are conducted in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. DOE and DA are conducting a joint remedial investigation (RI) and baseline risk assessment (BRA) as part of the remedial investigation/feasibility study (RI/FS) for the groundwater operable units for the two areas. This joint effort will optimize further data collection and interpretation efforts and facilitate overall remedial decision making since the aquifer of concern is common to both areas. A Work Plan issued jointly in 1995 by DOE and the DA discusses the results of investigations completed at the time of preparation of the report. The investigations were necessary to provide an understanding of the groundwater system beneath the chemical plant area and the ordnance works area. The Work Plan also identifies additional data requirements for verification of the evaluation presented.

  2. The Residential Building Characteristics On-Site Inspection: summary Report

    SciTech Connect (OSTI)

    Weakley, S.A.; Darwin, R.F.; Howe, T.L.

    1990-06-01

    The Residential Building Characteristics On-Site Inspection (RI) was sponsored by the Bonneville Power Administration (BPA), and implemented by Energy Counselors, Inc., of Beaverton, Oregon. The purpose of the inspection was to collect detailed information on the structural characteristics and capital equipment of residences participating in BPA's End-Use Load and Conservation Assessment Program (ELCAP). ELCAP is a long-term program to collect information on the structural characteristics of residences in the Pacific Northwest as well as the attitudinal, behavioral, and demographic characteristics of the residences' occupants. Combined with other data collection efforts, the information obtained by the RI will be used to assess and evaluate energy use and conservation within the region's residential sector. This report documents the design of the inspection instruments (forms), the implementation of the inspection, and some of the results from the data base. The number of residences inspected was 416 or 93% of the potential sample of 447 residences. 1 ref., 2 figs., 38 tabs.

  3. Cholesky-decomposed density MP2 with density fitting: Accurate MP2 and double-hybrid DFT energies for large systems

    SciTech Connect (OSTI)

    Maurer, Simon A.; Clin, Lucien; Ochsenfeld, Christian

    2014-06-14

    Our recently developed QQR-type integral screening is introduced in our Cholesky-decomposed pseudo-densities Mller-Plesset perturbation theory of second order (CDD-MP2) method. We use the resolution-of-the-identity (RI) approximation in combination with efficient integral transformations employing sparse matrix multiplications. The RI-CDD-MP2 method shows an asymptotic cubic scaling behavior with system size and a small prefactor that results in an early crossover to conventional methods for both small and large basis sets. We also explore the use of local fitting approximations which allow to further reduce the scaling behavior for very large systems. The reliability of our method is demonstrated on test sets for interaction and reaction energies of medium sized systems and on a diverse selection from our own benchmark set for total energies of larger systems. Timings on DNA systems show that fast calculations for systems with more than 500 atoms are feasible using a single processor core. Parallelization extends the range of accessible system sizes on one computing node with multiple cores to more than 1000 atoms in a double-zeta basis and more than 500 atoms in a triple-zeta basis.

  4. White Oak Creek Watershed: Melton Valley Area Remedial Investigation Report, Oak Ridge National Laboratory, Oak Ridge, Tennessee: Volume 1 Main Text

    SciTech Connect (OSTI)

    NONE

    1996-11-01

    The purpose of this Remedial Investigation (RI) report is to present an analysis of the Melton Valley portion of the White Oak Creek (WOC) watershed, which will enable the US Department of Energy (DOE) to pursue a series of cost-effective remedial actions resulting in site cleanup and stabilization. In this RI existing levels of contamination and radiological exposure are compared to levels acceptable for future industrial and potential recreational use levels at the site. This comparison provides a perspective for the magnitude of remedial actions required to achieve a site condition compatible with relaxed access restrictions over existing conditions. Ecological risk will be assessed to evaluate measures required for ecological receptor protection. For each subbasin, this report will provide site-specific analyses of the physical setting including identification of contaminant source areas, description of contaminant transport pathways, identification of release mechanisms, analysis of contaminant source interactions with groundwater, identification of secondary contaminated media associated with the source and seepage pathways, assessment of potential human health and ecological risks from exposure to contaminants, ranking of each source area within the subwatershed, and outline the conditions that remedial technologies must address to stop present and future contaminant releases, prevent the spread of contamination and achieve the goal of limiting environmental contamination to be consistent with a potential recreational use of the site.

  5. Evaluation of the feasibility of a pipeline field weld real-time radiography (radioscopy) inspection system

    SciTech Connect (OSTI)

    Tucker, J.E.; Rudarmel, M.W.; Sayler, G.C.; Garrison, L.E.

    1996-02-01

    Inspection of pipeline field girth welds during pipeline construction is accomplished by film radiographic methods. Film radiography of materials is a 70 year old technology. There have been many advances in that 70 year history in equipment and films, but the process of making the radiograph is essentially the same. The film radiography process is time-consuming, costly, environmentally impacting and very operator (inspector) dependent. There are recent and almost daily advances in technologies using x-ray imaging other than film. Double-jointed pipe welds at pipe mills and at double-joint operations have been inspected with stationary real-time radioscopic systems for many years. This electronic imaging technology, known as {open_quotes}radioscopy{close_quotes}, has the potential to significantly improve pipeline project schedules and cost by eliminating some of the shortcomings of film radiography. Radioscopy is currently accepted for use by many nationally accepted standards including API-5L, Specification for Line Pipe, and API-1104, Welding of Pipelines and Related Facilities. Seven years ago PRC contracted Southwest Research Institute (SwRI) to research radioscopy for field application. This effort did not yield a suitable field system even though the study by SwRI concluded that it was feasible and would be cost effective.

  6. Updated Conceptual Model for the 300 Area Uranium Groundwater Plume

    SciTech Connect (OSTI)

    Zachara, John M.; Freshley, Mark D.; Last, George V.; Peterson, Robert E.; Bjornstad, Bruce N.

    2012-11-01

    The 300 Area uranium groundwater plume in the 300-FF-5 Operable Unit is residual from past discharge of nuclear fuel fabrication wastes to a number of liquid (and solid) disposal sites. The source zones in the disposal sites were remediated by excavation and backfilled to grade, but sorbed uranium remains in deeper, unexcavated vadose zone sediments. In spite of source term removal, the groundwater plume has shown remarkable persistence, with concentrations exceeding the drinking water standard over an area of approximately 1 km2. The plume resides within a coupled vadose zone, groundwater, river zone system of immense complexity and scale. Interactions between geologic structure, the hydrologic system driven by the Columbia River, groundwater-river exchange points, and the geochemistry of uranium contribute to persistence of the plume. The U.S. Department of Energy (DOE) recently completed a Remedial Investigation/Feasibility Study (RI/FS) to document characterization of the 300 Area uranium plume and plan for beginning to implement proposed remedial actions. As part of the RI/FS document, a conceptual model was developed that integrates knowledge of the hydrogeologic and geochemical properties of the 300 Area and controlling processes to yield an understanding of how the system behaves and the variables that control it. Recent results from the Hanford Integrated Field Research Challenge site and the Subsurface Biogeochemistry Scientific Focus Area Project funded by the DOE Office of Science were used to update the conceptual model and provide an assessment of key factors controlling plume persistence.

  7. Variational principles with Pad approximants for tearing mode analysis

    SciTech Connect (OSTI)

    Cole, Andrew J.; Finn, John M.

    2014-03-15

    Tearing modes occur in several distinct physical regimes, and it is often important to compute the inner layer response for these modes with various effects. There is a need for an approximate and efficient method of solving the inner layer equations in all these regimes. In this paper, we introduce a method of solving the inner layer equations based on using a variational principle with Pad approximants. For all the regimes considered, the main layer equations to be solved are inhomogeneous, and Pad approximants give a convenient and efficient method of satisfying the correct asymptotic behavior at the edge of the layer. Results using this variational principlePad approximant method in three of these regimes is presented. These regimes are the constant-? resistive-inertial (RI) regime, the constant-? viscoresistive regime, and the non-constant-? inviscid tearing regime. The last regime includes the constant-? RI regime and the inertial regime. The results show that reasonable accuracy can be obtained very efficiently with Pad approximants having a small number of parameters.

  8. Work plan for the remedial investigation/feasibility study-environmental assessment for the quarry residuals operable unit at the Weldon Spring Site

    SciTech Connect (OSTI)

    Not Available

    1994-01-01

    The US Department of Energy (DOE) is conducting cleanup activities at the Weldon Spring site, which is located in St. Charles County, Missouri, about 48 km (30 mi) west of St. Louis. The Weldon Spring site consists of two noncontiguous areas -- the chemical plant area, which includes four raffinate pits, and the quarry. Cleanup activities at the Weldon Spring site are conducted in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended, incorporating the values of the National Environmental Policy Act (NEPA). The contents of the documents prepared for the project are not intended to represent a statement regarding the legal applicability of NEPA to remedial actions conducted under CERCLA. In accordance with the integrated CERCLA/NEPA approach, a remedial investigation/feasibility study-environmental assessment (RI/FS-EA) is being conducted to evaluate conditions and potential responses for the quarry residuals operable unit (QROU). This operable unit consists of the following areas and/or media: the residual material remaining at the Weldon Spring quarry after removal of the pond water and bulk waste; underlying groundwater; and other media located in the surrounding vicinity of the quarry, including adjacent soil, surface water, and sediment in Femme Osage Slough. This work plan identifies the activities within the RI/FS-EA process that are being proposed to address contamination remaining at the quarry area.

  9. An Optimized Nanoparticle Separator Enabled by Electron Beam Induced Deposition

    SciTech Connect (OSTI)

    Fowlkes, Jason Davidson [ORNL; Doktycz, Mitchel John [ORNL; Rack, P. D. [University of Tennessee, Knoxville (UTK)

    2010-01-01

    Size based separations technologies will inevitably benefit from advances in nanotechnology. Direct write nanofabrication provides a useful mechanism to deposit/etch nanoscale elements in environments otherwise inaccessible to conventional nanofabrication techniques. Here, electron beam induced deposition (EBID) was used to deposit an array of nanoscale features in a 3D environment with minimal material proximity effects outside the beam interaction region (BIR). Specifically, the membrane component of a nanoparticle separator was fabricated by depositing a linear array of sharply tipped nanopillars, with a singular pitch, designed for sub 50nm nanoparticle permeability. The nanopillar membrane was used in a dual capacity to control the flow of nanoparticles in the transaxial direction of the array while facilitating the sealing of the cellular sized compartment in the paraxial direction. An optimized growth recipe resulted which (1) maximized the growth efficiency of the membrane (which minimizes proximity effects), (2) preserved the fidelity of spacing between nanopillars (which maximizes the size based gating quality of the membrane) while (3) maintaining sharp nanopillar apexes for impaling an optically transparent polymeric lid critical for device sealing.

  10. Feasibility study for remedial action for the groundwater operable units at the chemical plant area and the ordnance works area, Weldon Spring, Missouri

    SciTech Connect (OSTI)

    1999-07-15

    The U.S. Department of Energy (DOE) and the U.S. Department of Army (DA) are conducting an evaluation to identify the appropriate response action to address groundwater contamination at the Weldon Spring Chemical Plant (WSCP) and the Weldon Spring Ordnance Works (WSOW), respectively. The two areas are located in St. Charles County, about 48 km (30 rni) west of St. Louis. The groundwater operable unit (GWOU) at the WSCP is one of four operable units being evaluated by DOE as part of the Weldon Spring Site Remedial Action Project (WSSRAP). The groundwater operable unit at the WSOW is being evaluated by the DA as Operable Unit 2 (OU2); soil and pipeline contamination are being managed under Operable Unit 1 (OU1). Remedial activities at the WSCP and the WSOW are being conducted in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA). Consistent with DOE policy, National Environmental Policy Act (NEPA) values have been incorporated into the CERCLA process. A remedial investigation/feasibility study (RI/FS) work plan summarizing initial site conditions and providing site hydrogeological and exposure models was published in August of 1995 (DOE 1995). The remedial investigation (RI) and baseline risk assessment (BRA) have also recently been completed. The RI (DOE and DA 1998b) discusses in detail the nature, extent, fate, and transport of groundwater and spring water contamination. The BRA (DOE and DA 1998a) is a combined baseline assessment of potential human health and ecological impacts and provides the estimated potential health risks and ecological impacts associated with groundwater and springwater contamination if no remedial action were taken. This feasibility study (FS) has been prepared to evaluate potential options for addressing groundwater contamination at the WSCP and the WSOW. A brief description of the history and environmental setting of the sites is presented in Section 1.1, key information relative to the nature and extent of contamination is presented in Section 1.2, and the results of the BRA are summarized in Section 1.3. The objective of this FS is discussed in Section 1.4, and preliminary remediation goals are identified in Section 1.5. The organization of the remaining chapters of this FS is outlined in Section 1.6.

  11. Utilizing a simple CT dosimetry phantom for the comprehension of the operational characteristics of CT AEC systems

    SciTech Connect (OSTI)

    Tsalafoutas, Ioannis A.; Varsamidis, Athanasios; Thalassinou, Stella; Efstathopoulos, Efstathios P.

    2013-11-15

    Purpose: To investigate the utility of the nested polymethylacrylate (PMMA) phantom (which is available in many CT facilities for CTDI measurements), as a tool for the presentation and comparison of the ways that two different CT automatic exposure control (AEC) systems respond to a phantom when various scan parameters and AEC protocols are modified.Methods: By offsetting the two phantom's components (the head phantom and the body ring) half-way along their longitudinal axis, a phantom with three sections of different x-ray attenuation was created. Scan projection radiographs (SPRs) and helical scans of the three-section phantom were performed on a Toshiba Aquilion 64 and a Philips Brilliance 64 CT scanners, with different scan parameter selections [scan direction, pitch factor, slice thickness, and reconstruction interval (ST/RI), AEC protocol, and tube potential used for the SPRs]. The dose length product (DLP) values of each scan were recorded and the tube current (mA) values of the reconstructed CT images were plotted against the respective Z-axis positions on the phantom. Furthermore, measurements of the noise levels at the center of each phantom section were performed to assess the impact of mA modulation on image quality.Results: The mA modulation patterns of the two CT scanners were very dissimilar. The mA variations were more pronounced for Aquilion 64, where changes in any of the aforementioned scan parameters affected both the mA modulations curves and DLP values. However, the noise levels were affected only by changes in pitch, ST/RI, and AEC protocol selections. For Brilliance 64, changes in pitch affected the mA modulation curves but not the DLP values, whereas only AEC protocol and SPR tube potential selection variations affected both the mA modulation curves and DLP values. The noise levels increased for smaller ST/RI, larger weight category AEC protocol, and larger SPR tube potential selection.Conclusions: The nested PMMA dosimetry phantom can be effectively utilized for the comprehension of CT AEC systems performance and the way that different scan conditions affect the mA modulation patterns, DLP values, and image noise. However, in depth analysis of the reasons why these two systems exhibited such different behaviors in response to the same phantom requires further investigation which is beyond the scope of this study.

  12. TECHNOLOGIES TO ENHANCE THE OPERATION OF EXISTING NATURAL GAS COMPRESSION INFRASTRUCTURE

    SciTech Connect (OSTI)

    Anthony J. Smalley; Ralph E. Harris; Gary D. Bourn; Danny M. Deffenbaugh

    2005-10-27

    This quarterly report documents work performed under Tasks 15, 16, and 18 through 23 of the project entitled: ''Technologies to Enhance the Operation of Existing Natural Gas Compression Infrastructure''. The project objective is to develop and substantiate methods for operating integral engine/compressors in gas pipeline service, which reduce fuel consumption, increase capacity, and enhance mechanical integrity. The report first summarizes key results from survey site tests performed on an HBA-6 installed at Duke Energy's Bedford compressor station, and on a TCVC10 engine/compressor installed at Dominion's Groveport Compressor Station. The report then presents results of design analysis performed on the Bedford HBA-6 to develop options and guide decisions for reducing pulsations and enhancing compressor system efficiency and capacity. The report further presents progress on modifying and testing the laboratory GMVH6 at SwRI for correcting air imbalance.

  13. TECHNOLOGIES TO ENHANCE THE OPERATION OF EXISTING NATURAL GAS COMPESSION INFRASTRUCTURE

    SciTech Connect (OSTI)

    Anthony J. Smalley; Ralph E. Harris; Gary D. Bourn; Danny M. Deffenbaugh

    2006-01-24

    This quarterly report documents work performed under Tasks 15, 16, and 18 through 23 of the project entitled: ''Technologies to Enhance the Operation of Existing Natural Gas Compression Infrastructure''. The project objective is to develop and substantiate methods for operating integral engine/compressors in gas pipeline service, which reduce fuel consumption, increase capacity, and enhance mechanical integrity. The report presents results of design analysis performed on the TCVC10 engine/compressor installed at Dominion's Groveport Compressor Station to develop options and guide decisions for reducing pulsations and enhancing compressor system efficiency and capacity. The report further presents progress on modifying and testing the laboratory GMVH6 at SwRI for correcting air imbalance.

  14. An SAR-compliant radionuclide inventory management system for a DOE research and development laboratory

    SciTech Connect (OSTI)

    O'Kula, K.R.; Lux, C.R.; Clements, J.A.

    2000-07-01

    The US Department of Energy Complex contains many laboratories that require inventory management and control of large stores of radionuclides. While the overall quantities of radionuclides are bounded by Authorization-Basis (AB) documents, the spatial distribution may change rapidly according to facility experimentation and storage limits. Thus, the consequences of postulated accident events may be difficult to quantify as the location of radiological species becomes uncertain. Furthermore, a situation of this nature may be compounded by management of fissile materials in the same laboratory. Although radionuclide inventory management, fissile material control, and compliance with AB limits may be handled individually, a systematic and consistent approach would be to integrate all three functions. A system with these characteristics, an upgraded Radionuclide Inventory and Administrative Control (RI-AC) System, has been implemented for the Savannah River Technology Center (SRTC) located on the Savannah River Site (SRS), and is summarized in this paper.

  15. Gasrail 2001

    SciTech Connect (OSTI)

    Mike Bogdanoff

    2001-01-31

    Air Quality Issues--Alameda Corridor - 19 miles - $2.4B; Alameda Corridor East - 35 miles - $0.95B; 65% increase in rail traffic next 20 years; Environmental Justice issues; Electrification not cost- effective; and Need to reduce locomotive emissions. Background--GasRail USA 1993- 1998; Develop LNG EMD 12- 710 commuter locomotive; 75% red. in NOx, opt. power & efficiency; Selected & developed LaCHIP; 1998 project halted - EMD withdrew; and Need to develop & demonstrate a low- emission locomotive. GasRail 2001 Objectives--Complete GasRail USA; SCAQMD, MetroLink, SwRI; 2- 3 year project; $4 M (estimated); Freight? Commercialization?; and Seeking partners/alternatives?

  16. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Prices of No. 2 Distillate to Residences by PAD District and Selected States a (Cents per Gallon Excluding Taxes) Year Month U.S. Average PAD District I Average CT ME MA NH RI VT DE DC 1983 .................................... 107.8 109.0 109.1 102.8 109.1 104.1 110.5 112.9 106.0 117.0 1984 .................................... 109.1 111.3 112.1 103.9 111.6 108.4 111.4 111.9 109.6 118.7 1985 .................................... 105.3 106.8 108.0 99.7 107.0 102.4 106.7 107.7 104.6 114.3 1986

  17. Historic contamination along Oakland Inner Harbor

    SciTech Connect (OSTI)

    Bird, J.C.; Shafer, D.L.

    1995-09-01

    As part of the ongoing remedial investigations (RI) at the Navy`s fleet and Industrial Supply Center, Oakland (FISCO)-Alameda Facility/Alameda Annex (the facility), FISC Oakland, and NAS Alameda, the presence of widespread historic chemical contaminants along the interface between the fill material and the former marshland deposits has been discovered. The historic contaminants are believed to have accumulated within the marshland areas prior to the filling activities along the Oakland Inner Harbor. The historic contaminants consist of heavy petroleum hydrocarbons, aromatic hydrocarbons, and polynuclear aromatic hydrocarbons (PAH), apparently generated by the former industries in the area. Three solid waste management units (SWMUs) and eight areas of concern ( AOCs) were identified at the facility. Three SWMUs and 1 AOC were recommended for site investigations as high-priority.

  18. Work plan addendum for David Witherspoon, Inc., 901 Site Building Characterization, Knoxville, Tennessee

    SciTech Connect (OSTI)

    1997-01-01

    This building characterization plan was developed as an addendum to the existing site characterization work plan documents, which are in Appendix B of the David Witherspoon, Inc., (DWI) preliminary remedial investigation (RI)/feasibility study (FS). All building characterization activities will be conducted in accordance with the rules of the Hazardous Substance Remedial Action Program under the direction of the Tennessee Department of Environment and Conservation, Division of Superfund (TN Rules 1200-1-3) and its implementing regulations. Additional rules of the state of Tennessee, Comprehensive Environmental Response, Compensation, and Liability Act of 1980, and the U.S. Environmental Protection Agency guidance were consulted during development of this plan. Activities at the DWI site were concerned with scrap metal processing and scrap metal resale.

  19. Technology catalogue. Second edition

    SciTech Connect (OSTI)

    1995-04-01

    The Department of Energy`s (DOE`s) Office of Environmental Management (EM) is responsible for remediating DOE contaminated sites and managing the DOE waste inventory in a safe and efficient manner. EM`s Office of Technology Development (OTD) supports applied research and demonstration efforts to develop and transfer innovative, cost-effective technologies to its site clean-up and waste-management programs within EM. The purpose of the Technology Catalogue is to: (a) provide performance data on OTD-developed technologies to scientists and engineers responsible for preparing Remedial Investigation/Feasibility Studies (RI/FSs) and other compliance documents for the DOE`s clean-up and waste-management programs; and (b) identify partnering and commercialization opportunities with industry, other federal and state agencies, and the academic community.

  20. TECHNOLOGIES TO ENHANCE THE OPERATION OF EXISTING NATURAL GAS COMPRESSION INFRASTRUCTURE - MANIFOLD DESIGN FOR CONTROLLING ENGINE AIR BALANCE

    SciTech Connect (OSTI)

    Gary D. Bourn; Ford A. Phillips; Ralph E. Harris

    2005-12-01

    This document provides results and conclusions for Task 15.0--Detailed Analysis of Air Balance & Conceptual Design of Improved Air Manifolds in the ''Technologies to Enhance the Operation of Existing Natural Gas Compression Infrastructure'' project. SwRI{reg_sign} is conducting this project for DOE in conjunction with Pipeline Research Council International, Gas Machinery Research Council, El Paso Pipeline, Cooper Compression, and Southern Star, under DOE contract number DE-FC26-02NT41646. The objective of Task 15.0 was to investigate the perceived imbalance in airflow between power cylinders in two-stroke integral compressor engines and develop solutions via manifold redesign. The overall project objective is to develop and substantiate methods for operating integral engine/compressors in gas pipeline service, which reduce fuel consumption, increase capacity, and enhance mechanical integrity.

  1. 13N

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    N β+-Decay Evaluated Data Measurements 1950HO01: 13N. 1953CH34: 13N. 1954GR66: 13N. 1955WI43: 13N. 1957DA08: 13N. 1957DE22: 13N. 1957NO17: 13N. 1958AR15: 13N. 1958DA09: 13N. 1960JA12: 13N; measured not abstracted; deduced nuclear properties. 1960KI02: 13N; measured not abstracted; deduced nuclear properties. 1965BO42: 13N; measured T1/2. 1965EB01: 13N; measured T1/2. 1968RI15: 13N; measured not abstracted; deduced nuclear properties. 1971GO40: 13N. 1973SIYS: 13N; measured T1/2. 1977AZ01: 13N;

  2. AMENDMENT OF SOLIr ATI ON/MODIFI CATION OF CONTRACT 1. CONTRACT ID CODE PAGE OF PAGES

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SOLIr ATI ON/MODIFI CATION OF CONTRACT 1. CONTRACT ID CODE PAGE OF PAGES 2 AMENDMENT/lIVDDIFICATiON NC 3. EFFECTIVE DATE [4 REDUISITION/PURCHASE REC NO IE PR3JECT NC (if applicable) 09 ISoe Bloo , 16- - ISee Soheoule S ISSUED D> CODE 7 ~ ADMINISTERED BY (if otnertrian ItemS CO DE Of fice of Ri-.er PoDLecOLODn office of Riv'er P-oCQ-ec-.iQ .S. Cet:F O<men of E-nerov,, I.S. Deparo:merio c-' Enrgv P.O. Box 4'5C 0 ... Box 45C .io ao 1 31 W YS: (-876 B. NAME AND ADDRESS CF CONTRACTOR (No seve

  3. AMENDMENT OF SOUClTAnONJMODIFICAnON OF CONTRACT I

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SOUClTAnONJMODIFICAnON OF CONTRACT I t. CONTRACT 10 CODE I PAGE i PAGtli 1 14 2. AMl:NOM£NTmoIOOIflCATIOIf NO. 3. EFFECTIVE DATE 4. REQUISITIONlPIIRCHAlE RI:O. NO. _ r- PROJECT NO. {It antcel>lJJ 063 See Block 16C 09SC002137 6. ISSUED II" CODE 00518 7. BY rUGIhM /II4It IIllm OJ COOE 100518 oak Ridge Oak Ridge U.S. Department of Energy U.S. Department of Enerqy P.O. Box 2001 P.O. Box 2001 Oak Ridqe TN 31831 Oak Ridge TN 37831 .. NAMliANO ADDReSS OF CONTRACTOR"... . . __

  4. Microsoft Word - figure_99.doc

    Gasoline and Diesel Fuel Update (EIA)

    7 U.S. Energy Information Administration | Natural Gas Annual Figure 6. Natural gas processing in the United States and the Gulf of Mexico, 2014 (million cubic feet) None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over Sources: Energy Information Administration (EIA), Form EIA-64A, "Annual Report of the Origin of Natural Gas Liquids Production." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL MS LA MO AR TX NM OK CO KS UT AZ WY NE IL IA MN

  5. Annual Energy Outlook 2015 - Appendix F

    Gasoline and Diesel Fuel Update (EIA)

    8 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1

  6. B

    Gasoline and Diesel Fuel Update (EIA)

    B l a c k H i l l s R e g io n Northern Anthracite Field S o u t h e r n A n t h r a c i t e F i e l d E. Middle Anthracite F ield Rhode Island Meta-Anthrac ite Terling ua Coal Field Coos Bay Coal Field Turtle Montain Coal Field North Central Coal Region San Juan Basin G u l f C o a s t C o a l R e g i o n Ft. Union Coal Re gion (Willist on Basin) Northern Appalachian Ba sin Powder Rive r Ba sin Uinta Basin Cheroke e P la tform Ce nt ra l Appalachian Ba sin Gr ea te r Gr ee n Ri ve r Ba si n T e

  7. Word Pro - Untitled1

    Gasoline and Diesel Fuel Update (EIA)

    State-Level Energy Consumption Estimates and Estimated Consumption per Capita, 2010 Consumption Consumption per Capita 14 U.S. Energy Information Administration / Annual Energy Review 2011 TX CA FL LA IL OH PA NY GA IN MI NC VA NJ TN WA KY AL MO MN WI SC OK CO IA MD AZ MA MS KS AR OR NE UT CT WV NM NV AK WY ID ND ME MT SD NH HI DE RI DC VT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 0 2 4 6 8 10

  8. ACES4BGC Applying Computationally Efficient Schemes for BioGeochemical Cycles

    Office of Scientific and Technical Information (OSTI)

    ACES4BGC Applying Computationally Efficient Schemes for BioGeochemical Cycles Principal Investigator: Fo r r es t M. H o ff m a n ( O R N L ) Co-Investigators: Pavel B. B o c h e v ( SN L) , Philip J. C a m e r o n - S m i t h ( LLNL) , Ri chard C. East er , Jr. ( P N N L ) , S c o t t M. Elliott ( LANE ) , S t e v e n J. G h a n ( P N N L ) , X i a o h o n g Liu ( f or me rl y P N N L , U. W y o m i n g ) , R o b e r t B. Lowrie ( LA N L ) , D o n a l d D. Lu ca s ( LLNL) , P o - l un Ma ( P N

  9. Determination of alternative fuels combustion products: Phase 2 final report

    SciTech Connect (OSTI)

    Whitney, K.A.

    1997-06-01

    This report describes the laboratory efforts to accomplish four independent tasks: (1) speciation of hydrocarbon exhaust emissions from a light-duty vehicle operated over the chassis dynamometer portion of the light-duty FTP after modifications for operation on butane and butane blends; (2) evaluation of NREL`s Variable Conductance Vacuum Insulated Catalytic Converter Test Article 4 for the reduction of cold-start FTP exhaust emissions after extended soak periods for a Ford FFV Taurus operating on E85; (3) support of UDRI in an attempt to define correlations between engine-out combustion products identified by SwRI during chassis dynamometer testing, and those found during flow tube reactor experiments conducted by UDRI; and (4) characterization of small-diameter particulate matter from a Ford Taurus FFV operating in a simulated fuel-rich failure mode on CNG, LPG, M85, E85, and reformulated gasoline. 22 refs., 18 figs., 17 tabs.

  10. Table 20. Coal Imports by Customs District

    Gasoline and Diesel Fuel Update (EIA)

    0. Coal Imports by Customs District (short tons) Year to Date Customs District July - September 2015 April - June 2015 July - September 2014 2015 2014 Percent Change Eastern Total 234,865 114,560 146,505 869,484 1,223,431 -28.9 Baltimore, MD 356 - - 356 60,692 -99.4 Boston, MA 148,334 52,801 104,452 597,508 958,257 -37.6 Buffalo, NY - 251 122 260 158 64.6 New York City, NY 22 445 42 910 851 6.9 Portland, ME 41,186 45,470 41,889 179,717 171,376 4.9 Providence, RI 44,967 15,572 - 90,712 32,077

  11. Evaluation of aftermarket LPG conversion kits in light-duty vehicle applications. Final report

    SciTech Connect (OSTI)

    Bass, E.A.

    1993-06-01

    SwRI was contracted by NREL to evaluate three LPG conversion kits on a Chevrolet Lumina. The objective of the project was to measure the Federal Test Procedure (FTP) emissions and fuel economy of these kits, and compare their performance to gasoline-fueled operation and to each other. Varying LPG fuel blends allowed a preliminary look at the potential for fuel system disturbance. The project required kit installation and adjustment according to manufacturer`s instructions. A limited amount of trouble diagnosis was also performed on the fuel systems. A simultaneous contract from the Texas Railroad Commission, in cooperation with NREL, provided funds for additional testing with market fuels (HD5 propane and industry average gasoline) and hydrocarbon (HC) emissions speciation to determine the ozone-forming potential of LPG HC emissions. This report documents the procurement, installation, and testing of these LPG conversion kits.

  12. Superfund Record of Decision (EPA Region 2): Hooker-102nd Street Landfill, Niagara Falls, NY. (First remedial action), September 1990. Final report

    SciTech Connect (OSTI)

    Not Available

    1990-09-26

    The 22-acre Hooker-102nd Street site is a former industrial landfill in the city of Niagara Falls, Niagara County, New York. The site is adjacent to, and partially within the Niagara River's 100-year floodplain. These studies and the Remedial Investigation (RI) initiated in 1984, identified contamination in ground water, onsite and offsite soil, rivershore sediment, and within a storm sewer. Additionally, the presence of a leachate plume of non-aqueous phase liquids (NAPLs) was discovered emanating from the landfill area. The Record of Decision (ROD) is the final remedy which addresses all of the contaminated media. The primary contaminants of concern affecting the soil, sediment, and ground water are VOCs including benzene, TCE, and toluene; other organics including PCBs and phenols; and metals including arsenic.

  13. Work plan for support to Upper East Fork Poplar Creek east end VOC plumes well installation project at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1998-03-01

    Under the Resource Conservation and Recovery Act of 1976 guidelines and requirements from the Tennessee Department of Environment and Conservation (TDEC), the Y-12 Plant initiated investigation and monitoring of various sites within its boundaries in the mid-1980s. The entire Oak Ridge Reservation (ORR) was placed on the National Priorities List of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) sites in November 1989. Following CERCLA guidelines, sites within the ORR require a remedial investigation (RI) to define the nature and extent of contamination, evaluate the risks to public health and the environment, and determine the goals for a feasibility study (FS) or an engineering evaluation/cost analysis (EE/CA) of potential remedial actions. Data from monitoring wells at the east end of the Y-12 Plant have identified an area of groundwater contamination dominated by the volatile organic compound (VOC) carbon tetrachloride; other VOCs include chloroform, tetrachloroethene, and trichloroethene.

  14. A

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a bility t o p rint c onduc&ve m icroelectrodes i n planar a nd t hree---dimensional f orms o pens u p a n ew avenue in photovoltaics and electronics. Significance and Impact Visualiza&on o f t his p rin&ng t echnique i s c ri&cal a s the i nk o p&miza&on a nd p rin&ng e xper&se a ffect the quality of printed structures and devices. Research D etails - Visualized i nk s ynthesis a nd r heology c ontrol. - Visualized p rin5ng o f p lanar, s panning, a nd 3 D

  15. Remedial investigation/feasibility study work plan for the 100-KR-4 operable unit, Hanford Site, Richland, Washington

    SciTech Connect (OSTI)

    Not Available

    1992-09-01

    Four areas of the Hanford Site (the 100, 200, 300, and 1100 Areas) have been included on the US Environmental Protection Agency`s (EPA`s) National Priorities List (NPL) under the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA). This work plan and the attached supporting project plans establish the operable unit setting and the objectives, procedures, tasks, and schedule for conducting the CERCLA remedial investigation/feasibility study (RI/FS) for the 100-KR-4 operable unit. The 100-K Area consists of the 100-KR-4 groundwater operable unit and three source operable units. The 100-KR-4 operable unit includes all contamination found in the aquifer soils and water beneath the 100-K Area. Source operable units include facilities and unplanned release sites that are potential sources of contamination.

  16. Departmenl

    Office of Legacy Management (LM)

    Departmenl of EnergY @k Ridgc OPcntlonr P.O. Box 2001 Ork Rkfge, Tcnnorrcc E7/Efl14723 Septcnrbcr 22, 1993 Dear l'1r. l'lahl : BETATR'* BurtDrrc - c'ltpLETr'lt 0F 'EcollTAllrtlATl'll - r*Allsl'llfiAl 0F PREttHrllARY l? I?,rri'riHurli'lrelllii"iliiu ii 6.ir'ter .t (6rs) ':o-"^il VERIFICATIOII ogical exPosure' Sinqerely, Dav{ d nJl-::.:*:.T:l'fli;, t on Enclosure tI-32 illi[t irlls-nistoratl on Dr. W. A Williams c: D. G. Adler (DOE-ORO) W. D. Cottrell (ORNL) R D. Foley (ORNL) G. L Palau

  17. Sr:s I

    Office of Legacy Management (LM)

    Sr:s I ] t _ . DOE/EV-0005/43 AN L.OHS/H P.83.107 rL.06 - {03 / { b lii; t-. pr .S Fi ,i i!1 l';, ln ti V: iii li4 i.:l tf,i 'Jt ru' ,,\: :.5/ i i l t:' i:t s:l !3 E.\ il t; ,:; #; Fr.. li{ L-i ;i! ,tA 4 1.: $rg [ , ili k: ".,I k,, i,:. $ rji i:iii [".' ! . , F, iir il' ?:, 'i:' ir: *, Fr, }i.r |ir :y. ri FoRMERLYUTIL|ZEDMED/AEcS|TES REMEDIAL ACTION PROGRAM POST,REMEDIAL.AGTION RADIOLOGICAL SU RVEY OF KENT CH EMICAL LABORATORY THE UNIVERSITY OF CHICAGO CHICAGO, ILLINOIS MaY 1983 o c c

  18. TITLE

    Office of Legacy Management (LM)

    amv. I.. - - DESlON CRITERIA FOR f ORMERLV UTILIZISU 81TEb REMEDIAL ACTIUN PROORAM [FUmRAP) AND BURPLUS FACILITIES MANAOEMENT D E S I G N C R I T E R I A POR FORMERLY U T I L I Z E D S I T E S REHEDIAL ACTION PROGRAM (?USRAP). AlPD SURPLUS FACILITIES MUINAGEHEIT P R O C R U (SFHP) ( I S S U E D FOR C L I E N T APPROVAL) FEBRUARY 1 9 8 6 ~pproved by: a . CI, Director 2- 24-86 Date T e c h n i c a l Services Division Oak RiPge Operations Office Approved by: 2-24-86 Date Construction and E n g i n

  19. P U S T O

    Office of Legacy Management (LM)

    ."<"! . , . A , * 4 04 04 b ' s- . r EYNOLD; riI,ECTRRCC& l, ENGINEERING CO., INC. P U S T O r - F I L E O O X 1 4 4 0 0 L A S V C G A S . N E V A D A 0 4 1 i 4 l~lr, D, TJ. Ileazdri clca , Dis-ecf;or Radiolo@.cnl 0por;ltinng Divio5.aiz U . S . Atonric Ekier&y Co!lxni.ssion % Nevada Opcxna-tions Office Post Office Box 14 100 La9 Vegaa , I\Jevada 6'91 14 Attention: M r . It, J, ' W 1 . l i t m . n mC)3ECT SHOAL CWLQTJP SURVEY K!FC;i'F. Dear M r . Hendricka: Attached is the

  20. AIIEJIIDIENTOF IOLICITA~TIOit OF CONTRACT

    National Nuclear Security Administration (NNSA)

    AIIEJIIDIENTOF IOLICITA~TIOit OF CONTRACT 2. IIMENIIMENTMlDIFICA'I10H NO. 3. EfFECINE Do\TE 2'10 See Block 16C S.IS&UEDBY CODE 05008 NNSA/Oakridge Site Office U.S. Department of Energy NNSA/Y-1?. Site Office P.O. Box 2050 Building 9'104-2 Oak Ridge TN 37831 a NAME AND MlORIESS 01' CONl'RACTOR.-. _...,.. --*c-.. BA8C A OCK 4 WILCOX TECHNICAL ttn: WILLIE J. WILSON PO BOX 2009 SERVICES Y-12, LLC r* -*-' IDCOIIE I PAGE OF NOES 1 I 1 4. REOIJIII110NIIIUR REQ. NO. ri'ROJECTNO (II~ 7.~8Y(Il.,._ . .

  1. High Permeability Ternary Palladium Alloy Membranes with Improved Sulfur and Halide Tolerances

    SciTech Connect (OSTI)

    K. Coulter

    2010-12-31

    The project team consisting of Southwest Research Institute{reg_sign} (SwRI{reg_sign}), Georgia Institute of Technology (GT), the Colorado School of Mines (CSM), TDA Research, and IdaTech LLC was focused on developing a robust, poison-tolerant, hydrogen selective free standing membrane to produce clean hydrogen. The project completed on schedule and on budget with SwRI, GT, CSM, TDA and IdaTech all operating independently and concurrently. GT has developed a robust platform for performing extensive DFT calculations for H in bulk palladium (Pd), binary alloys, and ternary alloys of Pd. Binary alloys investigated included Pd96M4 where M = Li, Na, Mg, Al, Si, Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, Y, Zr, Nb, Mo, Tc, Ru, Rh, Ag, Cd, In, Sn, Sb, Te, Hf, Ta, W, Re, Os, Ir, Pt, Au, Tl, Pb, Bi, Ce, Sm, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu. They have also performed a series of calculations on Pd{sub 70}Cu{sub 26}Ag{sub 4}, Pd{sub 70}Cu{sub 26}Au{sub 4}, Pd{sub 70}Cu{sub 26}Ni{sub 4}, Pd{sub 70}Cu{sub 26}Pt{sub 4}, and Pd{sub 70}Cu{sub 26}Y{sub 4}. SwRI deposited and released over 160 foils of binary and ternary Pd alloys. There was considerable work on characterizing and improving the durability of the deposited foils using new alloy compositions, post annealing and ion bombardment. The 10 and 25 {micro}m thick films were sent to CSM, TDA and IdaTech for characterization and permeation testing. CSM conducted over 60 pure gas permeation tests with SwRI binary and ternary alloy membranes. To date the PdAu and PdAuPt membranes have exhibited the best performance at temperatures in the range of 423-773 C and their performance correlates well with the predictions from GT. TDA completed testing under the Department of Energy (DOE) WGS conditions on over 16 membranes. Of particular interest are the PdAuPt alloys that exhibited only a 20% drop in flux when sulfur was added to the gas mixture and the flux was completely recovered when the sulfur flow was stopped. IdaTech tested binary and ternary membranes on a simulated flue gas stream and experienced significant difficulty in mounting and testing the sputter deposited membranes. IdaTech was able to successfully test PdAu and PdAuPt membranes and saw similar sulfur tolerance to what TDA found. The Program met all the deliverables on schedule and on budget. Over ten presentations at national and international conferences were made, four papers were published (two in progress) in technical journals, and three students (2 at GT and 1 at CSM) completed their doctorates using results generated during the course of the program. The three major findings of program were; (1) the DFT modeling was verified as a predictive tool for the permeability of Pd based ternary alloys, (2) while magnetron sputtering is useful in precisely fabricating binary and ternary alloys, the mechanical durability of membranes fabricated using this technique are inferior compared to cold rolled membranes and this preparation method is currently not ready for industrial environments, (3) based on both modeling and experimental verification in pure gas and mixed gas environments PdAu and PdAuPt alloys were found to have the combination of the highest permeability and tolerance to sulfur.

  2. Better Buildings Network View

    Energy Savers [EERE]

    HZV)URPWKH)LHOG 1(::HHNO\3HHU([FKDQJH&DOOV2SHQWR$OO :LWK(DV\DQG'LUHFW5HJLVWUDWLRQ/LQNV 7KH%HWWHU%XLOGLQJV5HVLGHQWLDO1HWZRUNҋVVFKHGXOHIRU3HHU ([FKDQJH&DOOVZLOOFKDQJHIURPWZRFDOOVHDFKVHFRQGDQGIRXUWK 7KXUVGD\VRIWKHPRQWKWRRQHFDOOSHUZHHNIRXUWLPHVDPRQWK)RXU

  3. A.

    Office of Legacy Management (LM)

    , ' ,' c...: ' ,;c ' ? / /- r;*,,1. ..$ r;?; -. . 1 ., ! \1_~ *+ri t,i;e? 7 -? :Lj_r'c ;~_<;:::I; >rg _ _, __ -- . I I .-, :-- _ ..' .." ,eTCPT.!.i'iC t KG jiT(Sc-1_2-1405 --__,.: . . ..---.I _ .-__ _-_-... -- .-.-- +- ,i~.aZb.ili~." cor:t,rr:ct. .-.w- -2 _ __u___eu,- u .,-- --..-..Z-. f&,X&A. ,:.f r-L'?ic ..-a 1-1 an .i ': 12 --II .,-.w --- -- A. 2 2. 4 :, c d 6 t 5. 9 xc Ii. G, A 0, File z-~-E~ nr-tmkhnvon S-6-53 Cont3.V~toF by hand 3-5-55 Belnore ~Snama 3-6-53 As&

  4. FORMERLY UTILIZED SITES REMEDIAL ACTION PROGRAM ELIMINATION REPORT

    Office of Legacy Management (LM)

    WINCHESTER ENGINEERING AND ANALYTICAL CENTER (NORTHEASTERN RADIOLOGICAL HEALTH LABORATORY) WINCHESTER, MASSACHUSE'ITS Department of Energy Office of Nuclear Energy Office of Remedial Action and Waste Technology Division of Facility and Site Decommissioning Projects . . I . I C O N T E N T S IN T R O D U C T IO N B A C K G R O U N D S i te F u n c ti o n S i te D e s c ri p ti o n R a d i o l o g i c a l H i s to ry a n d S ta tu s E L IM IN A T IO N A N A L Y S IS R E F E R E N C E S - P a g e 1

  5. Cherokee Wind

    Office of Environmental Management (EM)

    Cherokee Wind Presenter: Carol Wyatt Cherokee Nation Businesses, Inc. DOE Tribal Energy Program October 26, 2010 KA W PA W N EE TO NK AW A PO NC A OT OE -M IS S OU RI CH E RO KE E Acr es: 2,633 .348 CH E RO KE E Acr es: 1,641 .687 CHEROKEE NATION Kay County Chilocco Property DATA SOU RC ES: US Census Bureau (T iger Files ) D OQQ's , USGS D RG's, USGS Cherokee Nation Realty D epartment C herokee N ation GeoD ata C enter Date: 12/19/01 e:\project\land\c hilocc o N E W S Tribal Land Chilocco

  6. To: J. Chipman Frm: John P. Howe In Her Visit to Graseelli Laboratories, Cleveland, Ohio, August 30, 1943

    Office of Legacy Management (LM)

    ij& 3-l v-y m Consisting of % pages containing 0 figures copy No.&of 12 copies. Series A' . September 9, 1943 To: J. Chipman Frm: John P. Howe In Her Visit to Graseelli Laboratories, Cleveland, Ohio, August 30, 1943 This meeting was the usual biweekly review of the coating work dono at the Grascrelli Laboratories. LOT DIP - reported by 3. R. bl&er 1 ' 2 / r; 4 I-I 3 -4 cn 14 CD 4 E L> -4 v) 4 -+ CT :2 z -J L3 t 4 F=o Q) A Cl ri z + 2 k fi ii lr= e.2 v i $ & k 0 2 5 c w s .G 0

  7. i: a

    Office of Legacy Management (LM)

    i: a ,-I > II c I 3 - I' 3 3 t s' j ] ~- i I, 0 0 p 7 ; : 1 _ * ' , i ,..' I $J - y,' n;:*? -jeer , 3potoctio:-; ::. 13 Se?;3 ~escriati:zc G I ii.?j.?J 4 ,fk;e ori,;iz::.? -1 'I>:: : .-I tJ ,, ' "1 .i:Fi!@ai'l..':: pyLt~lG_Yi 70 fiA;ea 53.. t; T ;; 'lyr;JJcbl for tLlo test;; L&i x!-,eq;or :;=pc m*,.,.:* 'Y';;? ,3qJ~os.:.?;: ! I >'. II '3 Qqllipp&d >;it;k sal3i;y .:3agaZ zag veni;ad to ::.a ,I8 JTSCS i:;c:-.Li::::; ri;! c:<pl~-,s.i~sii 73 iiQf syste;y ',i ';:-:c

  8. r~& 23, u77

    Office of Legacy Management (LM)

    ! :-!!r~& 23, u77 :.*, ' =1* y, ikck, ~Lkneral Ykia3~er 9. 3. 9, A~i.-ih4C.~~ Post Office ;r3x 150 ijertchl, i;'iorida 33;33i) T;lifj yfll confirm 0-u r$3cent tcfephone Ciscussloes nrrtic,zln~~ for rl. 3. SAC rg? :;a5earcn and r;k~vafa;~~~2at AdalcFstrutiibn rqzc;~Clitfctfv-es I;0 ViSiti t;looo -;ri-C;tc,> 2lcti raicxctie6 2.1ic2 ~;%z-i? ditizeti fn t;ie 1,51-53 ;:rriod for uork ml&r kt6:l$c ihF!r&~; t;l~;:xILjsion cmltract~ i-z-(3s-1)-13;12, k'r-(3i)-1)-1LLJ4, cizl~

  9. Corrective Action Investigation Plan for Corrective Action Unit 447: Project Shoal Area, Nevada Subsurface Site

    Office of Legacy Management (LM)

    13 8161#'HSDUWPHQW#RI#(QHUJ\ 1HYDGD#2SHUDWLRQV#2IILFH )08+410/'06#.#6'5614#6+10# (+8+5+10 2'8#&# )08+410/'06#. 6'5614#6+10 441,'%6 '144'%6+8'#%%6+10#-08'56+)#6+10#4.#0# (14#'144'%6+8'#%%6+10#90+6#HHKU 441,'%6#7*1#.#%4'#X#2'8#&# 77$574(#%'#7+6' '10641..'&#'12;#21TU##90%10641..'& 6'8+5+10#21TU##E 218'/$'4#EMML Approved for public release; further dissemination unlimited. Available to the public from - U.S. Department of Commerce National Technical Information Service 5285 Port

  10. Microsoft Word - Tri-State Case Study.docx

    Office of Environmental Management (EM)

    Tri---State's s ervice a rea includes parts of Fannin County, G eorgia; P olk County, T ennessee; a nd Cherokee County, N orth C arolina. Smarter M eters H elp C ustomers B udget E lectric S ervice C osts T ri---State E lectric M embership C ooperative ( Tri---State) i s a d istribution r ural e lectric c ooperative t hat primarily s erves m ore t han 1 2,000 r ural c ustomers, m any o f w hom h ave l ow---incomes l iving a t o r n ear poverty l evel a cross a m ulti---state r egion ( see m ap).

  11. PBi3aws

    Office of Legacy Management (LM)

    ' ' - " r PBi3aws llpdpcLli 23, lm --+sr As & IikWxt&, 4r. : ' I ,' .i A t E12m Twm IT rprtnw, ?-&wa iLB c mm& DC., l-MuA3, ym2.?, & hr L" _ p,ru /! /" ??I". . .-Ah-J: 5nlBIJLa Atmrab r,<' ! ' ) . i-F ,.,J.l I- 7-t ' . _ +' rj .) c 5 ' 11, , L At- - cRi88~a--~3ilil k&c. #6uIDL - Alit-mm !z!imE& si r, md % & htmma L EUtun, &. n, k l%oxmck,h' . c. mJa.ffer Q . ' Lo CzlGoa E< ti+-#RclAl maw 8l.r t&lad to &tam the fu&hlU~ of

  12. StPln-5;.

    Office of Legacy Management (LM)

    3, z biuatL66ed Ywmb Dr, wipe *1&w af um the kbnd teobnalog ai llww lmmb unmr 8laterws. ,'T$$s tbkirablsr: fir, v'bw of' tb 3'm-t that ma II;FO &mn~ a&d Feraarohba cl& mlxub ri lsamv l&&hmdale 2n th@ n th#atar. ' ( \ and lsaw~*~falrPbttifusuaxrlPacrbare af vfdJ2wa gm&3le l&m 8tnaCfwtrcl~ ww% fss%ewf, Thww tat0 * $h&ylit3*Jey* oh6 QXPdtm of thclk qt&M%htta~* 'a6 ~lldl a* 'the ~~~~~~1~~* odblte %a T#twllua uk&bll) 8wcI 2s ami m. The [Al&J& z*wgll

  13. Fiscal Year 1994 progress in implementing Section 120 of the Comprehensive Environmental Rresponse, Compensation, and Liability Act. Eighth annual report to Congress

    SciTech Connect (OSTI)

    1995-07-01

    Congress passed the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) (Public Law 96-510), commonly known as Superfund, in 1980. The Superfund Amendments and Reauthorization Act (SARA) (Public Law 99-499), which amended CERCLA in 1986, added Section 120 regarding the cleanup of contaminated sites at Federal facilities. Under Section 120(e)(5) of CERCLA, each department, agency, or instrumentality of the Federal government responsible for compliance with Section 120 must submit an annual report to Congress concerning its progress in implementing the requirements of Section 120. The report must include information on the progress in reaching Interagency Agreements (IAGs), conducting Remedial Investigation and Feasibility Studies (RI/FSs), and performing remedial actions. Federal agencies that own or operate facilities on the National Priorities List (NPL) are required to begin an RI/FS for these facilities within 6 months after being placed on the NPL. Remediation of these facilities is addressed in an IAG between the Federal agency, the U.S. Environmental Protection Agency (EPA), and in some instances the state within which the facility is located. This report, prepared by the U.S. Department of Energy`s (DOE`s) Office of Environmental Management, is being submitted to Congress in accordance with Section 120(e)(5) of CERCLA. It is DOE`s Eighth Annual Report to Congress and provides information on DOE`s progress in implementing CERCLA Section 120 in Fiscal Year 1994 (FY 94), i.e., from October 1, 1993, to September 30, 1994. In this report the words {open_quotes}site{close_quotes} and {open_quotes}facility{close_quotes} are used interchangeably.

  14. Transmittal of the Calculation Package that Supports the Analysis of Performance of the Environmental Management Waste Management Facility Oak Ridge, Tennessee (Based 5-Cell Design Issued 8/14/09)

    SciTech Connect (OSTI)

    Williams M.J.

    2009-09-14

    This document presents the results of an assessment of the performance of a build-out of the Environmental Management Waste Management Facility (EMWMF). The EMWMF configuration that was assessed includes the as-constructed Cells 1 through 4, with a groundwater underdrain that was installed beneath Cell 3 during the winter of 2003-2004, and Cell 5, whose proposed design is an Addendum to Remedial Design Report for the Disposal of Oak Ridge Reservation Comprehensive Environmental Response, Compensation, and Liability Act of 1980 Waste, Oak Ridge, Tennessee, DOE/OR/01-1873&D2/A5/R1. The total capacity of the EMWMF with 5 cells is about 1.7 million cubic yards. This assessment was conducted to determine the conditions under which the approved Waste Acceptance Criteria (WAC) for the EMWMF found in the Attainment Plan for Risk/Toxicity-Based Waste Acceptance Criteria at the Oak Ridge Reservation, Oak Ridge, Tennessee [U.S. Department of Energy (DOE) 2001a], as revised for constituents added up to October 2008, would remain protective of public health and safety for a five-cell disposal facility. For consistency, the methods of analyses and the exposure scenario used to predict the performance of a five-cell disposal facility were identical to those used in the Remedial Investigation and Feasibility Study (RI/FS) and its addendum (DOE 1998a, DOE 1998b) to develop the approved WAC. To take advantage of new information and design changes departing from the conceptual design, the modeling domain and model calibration were upaded from those used in the RI/FS and its addendum. It should be noted that this analysis is not intended to justify or propose a change in the approved WAC.

  15. Amorphous Alloy Membranes for High Temperature Hydrogen Separation

    SciTech Connect (OSTI)

    Coulter, K

    2013-09-30

    At the beginning of this project, thin film amorphous alloy membranes were considered a nascent but promising new technology for industrial-scale hydrogen gas separations from coal- derived syngas. This project used a combination of theoretical modeling, advanced physical vapor deposition fabricating, and laboratory and gasifier testing to develop amorphous alloy membranes that had the potential to meet Department of Energy (DOE) targets in the testing strategies outlined in the NETL Membrane Test Protocol. The project is complete with Southwest Research Institute (SwRI), Georgia Institute of Technology (GT), and Western Research Institute (WRI) having all operated independently and concurrently. GT studied the hydrogen transport properties of several amorphous alloys and found that ZrCu and ZrCuTi were the most promising candidates. GT also evaluated the hydrogen transport properties of V, Nb and Ta membranes coated with different transition-metal carbides (TMCs) (TM = Ti, Hf, Zr) catalytic layers by employing first-principles calculations together with statistical mechanics methods and determined that TiC was the most promising material to provide catalytic hydrogen dissociation. SwRI developed magnetron coating techniques to deposit a range of amorphous alloys onto both porous discs and tubular substrates. Unfortunately none of the amorphous alloys could be deposited without pinhole defects that undermined the selectivity of the membranes. WRI tested the thermal properties of the ZrCu and ZrNi alloys and found that under reducing environments the upper temperature limit of operation without recrystallization is ~250 C. There were four publications generated from this project with two additional manuscripts in progress and six presentations were made at national and international technical conferences. The combination of the pinhole defects and the lack of high temperature stability make the theoretically identified most promising candidate amorphous alloys unsuitable for application as hydrogen separation membranes in coal fire systems.

  16. Waste Area Grouping 2 Remedial Investigation Phase 1 Seep Task data report: Contaminant source area assessment

    SciTech Connect (OSTI)

    Hicks, D.S.

    1996-03-01

    This report presents the findings of the Waste Area Grouping (WAG) 2, Phase 1 Remedial Investigation (RI) Seep Task efforts during 1993 and 1994 at Oak Ridge National Laboratory (ORNL). The results presented here follow results form the first year of sampling, 1992, which are contained in the Phase 1 RI report for WAG 2 (DOE 1995a). The WAG 2 Seep Task efforts focused on contaminants in seeps, tributaries, and main streams within the White Oak Creek (WOC) watershed. This report is designed primarily as a reference for contaminants and a resource for guiding remedial decisions. Additional in-depth assessments of the Seep Task data may provide clearer understandings of contaminant transport from the different source areas in the WOC watershed. WAG 2 consists of WOC and its tributaries downstream of the ORNL main plant area, White Oak Lake, the White Oak Creek Embayment of the Clinch River, and the associated flood plains and subsurface environment. The WOC watershed encompasses ORNL and associated WAGs. WAG 2 acts as an integrator for contaminant releases from the contaminated sites at ORNL and as the conduit transporting contaminants to the Clinch River. The main objectives of the Seep Task were to identify and characterize seeps, tributaries and source areas that are responsible for the contaminant releases to the main streams in WAG 2 and to quantify their input to the total contaminant release from the watershed at White Oak Dam (WOD). Efforts focused on {sup 90}Sr, {sup 3}H, and {sup 137}Cs because these contaminants pose the greatest potential human health risk from water ingestion at WOD. Bimonthly sampling was conducted throughout the WOC watershed beginning in March 1993 and ending in August 1994. Samples were also collected for metals, anions, alkalinity, organics, and other radionuclides.

  17. TRANSFORMING THE SRS ENVIRONMENTAL BUSINESS: COMMUNICATION AND APPLIED PROJECT MANAGEMENT PRINCIPLES

    SciTech Connect (OSTI)

    Saldivar, E.

    2010-01-20

    A process for communicating information relating to core business functions that also encourages improving internal communications has been established at SRS. This process continues to grow and strengthen as the multiple Contractors, Regulators and DOE-SR relationships mature. A number of management communication tools have been initiated, retooled, rebooted or continued with enhancements to ensure appropriate information is communicated to all levels with environmental responsibility at SRS. The types of information that are the focus of this improved process are feedback from the customer and from informational exchange forums (i.e., Challenge Opportunity and Resolution (COR), SRS Regulatory Integration Team (SRIT), Environmental Quality Management Division (EQMD), Senior Environmental Managers Council (SEMC), etc.). These forums, SRS environmental functions centralization, and the creation of a Regulatory Integration process allows for cross-functional decision making, problem solving and information sharing that involves the field organizations, Environmental Compliance Authorities (ECA), Subject Matter Experts (SME), DOE and the Regulators. Numerous examples of effective decision-making and problem solving will be shared. Lessons Learned involving inadequate communications and the resulting impacts on the environment, customer satisfaction, and relationships will also be discussed. Additionally, the focus on improved communications also includes maintaining awareness of business activities. The tools being utilized to facilitate the continuing improvement of internal communications include weekly staff meetings for all individuals within the organization, quarterly ECA and SME meeting, quarterly Regulatory Integration & Environmental Services (RI&ES) All-Hands meetings hosted by the Director, bi-weekly EQMD and EQMD Lite meetings with the customer, bi-annual SRIT meetings, and COR meetings on an as need basis. In addition, an existing Required Reading Program is being formally utilized in RI&ES to ensure all individuals get formal notification of new/revised business documents. In all cases, the development of environmental communication topics that occur at SRS have a cost-scope-schedule basis that can be linked to delivery of environmental services.

  18. Effects of fuel type and equivalence ratios on the flickering of triple flames

    SciTech Connect (OSTI)

    Sahu, K.B.; Kundu, A.; Ganguly, R.; Datta, A.

    2009-02-15

    An experimental study has been conducted in axisymmetric, co-flowing triple flames with different equivalence ratios of the inner and outer reactant streams (2<{phi}{sub in}<3 and 0{<=}{phi}{sub out}<0.7). Different fuel combinations, like propane/propane, propane/methane or methane/methane in the inner and outer streams respectively, have been used in the experiments. The structures of the triple flames have been compared for the different fuel combinations and equivalence ratios. The conditions under which triple flames exhibit oscillation have been identified. During the oscillation, the non-premixed flame and the outer lean premixed flame flicker strongly, while the inner rich premixed flame remains more or less stable. The flickering frequency has been evaluated through image processing and fast Fourier transform (FFT) of the average pixel intensity of the image frames. It is observed that, for all the fuel combinations, the frequency decreases with the increase in the outer equivalence ratio, while it is relatively invariant with the change in the inner equivalence ratio. However, an increase in the inner equivalence ratio affects the structure of the flame by increasing the heights of the inner premixed flame and non-premixed flame and also enlarges the yellow soot-laden zone at the tip of the inner flame. A scaling analysis of the oscillating flames has been performed based on the measured parameters, which show a variation of Strouhal number (St) with Richardson number (Ri) as St {proportional_to} Ri{sup 0.5}. The fuel type is found to have no influence on this correlation. (author)

  19. Limited field investigation report for the 100-HR-1 Operable Unit

    SciTech Connect (OSTI)

    Not Available

    1994-08-01

    This limited field investigation (LFI) report summarizes the data collection and analysis activities conducted during the 100-HR-1 Source Operable Unit LFI and the associated qualitative risk assessment (QRA) (WHC 1993a), and makes recommendations on the continued candidacy of high-priority sites for interim remedial measures (IRM). The results and recommendations presented in this report are generally independent of future land use scenarios. A LFI Report is required, in accordance with the HPPS, when waste sites are to be considered for IRMs. The LFI is an integral part of the remedial investigation/feasibility study (RI/FS) or Resource Conservation and Recovery Act (RCRA) facility investigation/corrective measures study (RFI/CMS) and process and functions as a focused RI or RFI for selection of IRMs. The purpose of the report is to identify those sites that are recommended to remain as candidates for IRMs, provide a preliminary summary of site characterization studies, refine the conceptual model as needed, identify contaminant- and location-specific applicable or relevant and appropriate requirements (ARA), and provide a qualitative assessment of the risks associated with the sites. This assessment includes consideration of whether contaminant concentrations pose an unacceptable risk that warrants action through IRMs. The 100-HR-1 unit encompasses approximately 100 acres adjacent to the Columbia River shoreline. It contains waste units associated with the original plant facilities constructed to support the H Reactor. The area also contains evaporation basins which received liquid process wastes and nonroutine deposits of chemical wastes from the 300 Area, where fuel elements for the N Reactor were produced.

  20. FEASIBILITY STUDY REPORT FOR THE 200-ZP-1 GROUNDWATER OPERABLE UNIT

    SciTech Connect (OSTI)

    BYRNES ME

    2008-07-18

    The Hanford Site, managed by the U.S. Department of Energy (DOE), encompasses approximately 1,517 km{sup 2} (586 mi{sup 2}) in the Columbia Basin of south-central Washington State. In 1989, the U.S. Environmental Protection Agency (EPA) placed the 100, 200, 300, and 1100 Areas of the Hanford Site on the 40 Code of Federal Regulations (CFR) 300, 'National Oil and Hazardous Substances Pollution Contingency Plan' National Contingency Plan [NCPD], Appendix B, 'National Priorities List' (NPL), pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA). The 200 Areas NPL sites consist of the 200 West and 200 East Areas (Figure 1-1). The 200 Areas contain waste management facilities, inactive irradiated fuel reprocessing facilities, and the 200 North Area (formerly used for interim storage and staging of irradiated fuel). Several waste sites in the 600 Area, located near the 200 Areas, also are included in the 200 Areas NPL site. The 200 Areas NPL site is in a region referred to as the 'Central Plateau' and consists of approximately 700 waste sites, excluding sites assigned to the tank farm waste management areas (WMAs). The 200-ZP-1 Groundwater Operable Unit (OU) consists of the groundwater located under the northern portion of the 200 West Area. Waste sources that contributed to the 200-ZP-1 OU included cribs and trenches that received liquid and/or solid waste in the past from the Z Plant and T Plant aggregate areas, WMA-T, WMA-TX/TY, and the State-Approved Land Disposal Site (SALDS). This feasibility study (FS) for the 200-ZP-1 Groundwater OU was prepared in accordance with the requirements of CERCLA decision documents. These decision documents are part of the Administrative Record for the selection of remedial actions for each waste site and present the selected remedial actions that are chosen in accordance with CERCLA, as amended by the Superfund Amendments and Reauthorization Act of 1986, and to the extent practicable, the NCP. This FS conforms to the conditions set forth in the Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) (Ecology et al. 2003) and amendments, signed by the Washington State Department of Ecology (Ecology), EPA, and DOE Richland Operations Office (RL). This also includes Tri-Party Agreement Milestone M-015-00C for completing all 200 Area non-tank farm OU pre-Record of Decision (ROD) documents on or before December 31, 2011. This FS supports the final remedy selection for the 200-ZP-1 OU, as described in the Remedial Investigation/Feasibility Study Work Plan for the 200-ZP-1 Groundwater Operable Unit (referred to as the 200-ZP-1 RI/FS work plan) (DOE/RL-2003-55), as agreed upon by RL and EPA. Tri-Party Agreement Milestone M-015-48B required Draft A of the 200-ZP-1 OU FS and proposed plan to be transmitted to EPA by September 30, 2007. As agreed to with EPA in the 200 Area Unit Managers Meeting Groundwater Operable Unit Status (FH-0503130), the baseline risk assessment (BRA) was delayed from inclusion in the remedial investigation (RI) report and is completed and documented in this FS. The Remedial Investigation Report for 200-ZP-1 Groundwater Operable Unit (referred to as the 200-ZP-1 RI report) (DOE/RL-2006-24) included an evaluation of human health and ecological risks and hazards. The RI report identified the radiological and chemical contaminants of potential concern (COPCs) that represent the primary risks to human health and the environment. The complete risk assessment in this FS incorporates additional analytical data from the unconfined aquifer that were obtained during or after preparation of the RI report, particularly for carbon tetrachloride and technetium-99. This FS also includes the initial results from an ongoing study of technetium-99 contamination near WMA-T, the sampling of new wells near the 216-W-LC laundry waste crib and T Plant, updated Hanford vadose zone fate and transport modeling, and groundwater particle-tracking analysis. The purpose of this FS is to develop and evaluate alternatives for remediation of the groundwater in the 200-ZP-1 OU. The alternatives considered provide a range of potential response actions (i.e., no action; institutional controls and monitored natural attenuation [MNA]; and pump-and-treat with MNA, flow-path control, and institutional controls) that are appropriate to address site-specific conditions. The alternatives are evaluated against seven of the nine CERCLA evaluation criteria defined in Guidance for Conducting Remedial Investigations and Feasibility Studies Under CERCLA (EPA/540/G-891004). The remaining two CERCLA criteria will be formally assessed during the public comment period. The FS evaluation serves as the basis for identifying a remedy to mitigate potential risks to human health and the environment. A preferred alternative (or alternatives) will be presented to the public for review and comment in the proposed plan.

  1. Bonded Radii and the Contraction of the Electron Density of the Oxygen Atom by Bonded Interactions

    SciTech Connect (OSTI)

    Gibbs, Gerald V.; Ross, Nancy L.; Cox, David F.; Rosso, Kevin M.; Iversen, Bo B.; Spackman, M. A.

    2013-02-21

    The bonded radii for more than 550 bonded pairs of atoms, comprising more than 50 crystals, determined from experimental and theoretical electron density distributions, are compared with the effective ionic, ri(M), and crystal radii, rc(M), for metal atoms, M, bonded to O atoms. At odds with the fixed ionic radius of 1.40 , assumed for the O atom in the compilation of the ionic radii, the bonded radius for the atom, rb(O), is not fixed but displays a relatively wide range of values as the O atom is progressively polarized by the M-O bonded interactions: as such, rb(O) decreases systematically from 1.40 (the Pauling radius of the oxide anion) as bond lengths decrease when bonded to an electropositive atom like sodium, to 0.64 (Braggs atomic radius of the O atom) when bonded to an electronegative atom like nitrogen. Both rb(M) and rb(O) increase in tandum with the increasing coordination number of the M atom. The bonded radii of the M atoms are highly correlated with both ri(M) and rc(M), but they both depart systematically from rb(M) and become smaller as the electronegativity of the M atom increases and the M-O bond length decreases. The well-developed correlations between both sets of radii and rb(M) testifies to the relative precision of both sets of radii and the fact that both sets are highly correlated the M-O bond 1 lengths. On the other hand, the progressive departure of rb(O) from the fixed ionic radius of the O atom with the increasing electronegativity of the bonded M atom indicates that any compilation of sets of ionic radii, assuming that the radius for the oxygen atom is fixed in value, is problematical and impacts on the accuracy of the resulting sets of ionic and crystal radii thus compiled. The assumption of a fixed O atom radius not only results in a negative ionic radii for several atoms, but it also results in values of rb(M) that are much as ~ 0.6 larger than the ri(M) and rc(M) values, respectively, particularly for the more electronegative M atoms. On the other hand, the ionic radii are in closer agreement with rb(M) for the more electropositive atoms. Notwithstanding that ionic radii are typically smaller than bonded radii, particularly for the more electronegative atoms, they have been used with considerable success in understanding and rationalizing problems and properties in crystal chemistry primarily because both ionic and crystal radii are highly correlated on a one-to-one basis with both the bonded radii and the associated M-O bond lengths. The lack of agreement between the effective ionic and crystal radii and the bonded radii for the more shared bonded interactions is ascribed to the progressive increase in the polarization of the O atom by the bonded atoms with a concomitant decrease in its radius, a factor that was neglected in the compilation of ionic and crystal radii for fluorides, oxides, sulfides and nitrides. This accounts for ionic radii for these materials being smaller than the bonded radii for the more electronegative atoms.

  2. Lessons Learned from a Complex FUSRAP Site - Sylvania Corning FUSRAP Site - 12269

    SciTech Connect (OSTI)

    Ewy, Ann; Hays, David

    2012-07-01

    Since its addition to the Formerly Utilized Sites Remedial Action Program (FUSRAP) in 2005, the Sylvania Corning FUSRAP Site (the Site) in Hicksville, New York, has provided challenges and opportunities from which to gain lessons learned for conducting investigation work at a complex multi-contaminant FUSRAP Site. The United States Army Corps of Engineers (USACE) and its contractors conducted a Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) Remedial Investigation (RI) and are currently in the Feasibility Study (FS) phase at the Site. This paper presents the planning, execution, and reporting lessons learned by USACE during the RI/FS. The Site, operated from 1952 to 1967 for the research, development, and fabrication of nuclear elements under the Atomic Energy Commission, and other government and commercial contracts. Previous investigations performed by the New York State Department of Environmental Conservation (NYSDEC) and the current property owner have identified uranium, thorium, nickel, and chlorinated solvents, as Site contaminants [1]. The property owner is currently under two separate voluntary agreements with NYSDEC to investigate and remediate the Site. USACE's work at the site has been independent of this voluntary agreement and has moved on a parallel path with any work the property owner has completed. The project at the Site is complex because of the radiological and chemical concerns in both soils and groundwater, high hydraulically conductive soils, lack of a shallow aquiclude/aquitard, and a principal water table aquifer underlying the site. Contaminants are migrating from the Site and may potentially impact local drinking water supplies (municipal wells). During the RI/FS process the project team has encountered many issues and has thus developed many resolutions. The issues are organized into three categories: Planning and Contracting, Execution, and Reporting. Planning and Contracting lessons learned include: how to incorporate an overwhelming volume of historical data; how to manage a complex team of three prime contractors innovatively, and how to implement a project under an Award Fee task order. Execution lessons learned include: characterization of investigation derived wastes, and proper approach to radiological scanning of direct-push borings and soil cores. Reporting lessons learned include: coordinating multiple phase (iterative) reporting, large dataset presentation, and the National Priorities List (NPL) designation. The goal of this paper is to provide a resource for other project delivery teams that encounter similar situations on their projects to optimize cost savings, realization of efficiency, shorten schedules, or simply ensure higher quality deliverables. Each FUSRAP project is unique but there are many lessons we can apply to each site to gain efficiency and work more effectively. The Sylvania Corning FUSRAP site is a complex site with both soils and groundwater contamination, contamination to depths of 182 meters, and a highly politically charged environment of PRP involvement. Many of the lessons the project team has learned during the life of the project to date are being shared with others as well as being applied back to this project for future work. (authors)

  3. Radiation-induced refraction artifacts in the optical CT readout of polymer gel dosimeters

    SciTech Connect (OSTI)

    Campbell, Warren G.; Jirasek, Andrew; Wells, Derek M.

    2014-11-01

    Purpose: The objective of this work is to demonstrate imaging artifacts that can occur during the optical computed tomography (CT) scanning of polymer gel dosimeters due to radiation-induced refractive index (RI) changes in polyacrylamide gels. Methods: A 1 L cylindrical polyacrylamide gel dosimeter was irradiated with 3 3 cm{sup 2} square beams of 6 MV photons. A prototype fan-beam optical CT scanner was used to image the dosimeter. Investigative optical CT scans were performed to examine two types of rayline bending: (i) bending within the plane of the fan-beam and (ii) bending out the plane of the fan-beam. To address structured errors, an iterative SavitzkyGolay (ISG) filtering routine was designed to filter 2D projections in sinogram space. For comparison, 2D projections were alternatively filtered using an adaptive-mean (AM) filter. Results: In-plane rayline bending was most notably observed in optical CT projections where rays of the fan-beam confronted a sustained dose gradient that was perpendicular to their trajectory but within the fan-beam plane. These errors caused distinct streaking artifacts in image reconstructions due to the refraction of higher intensity rays toward more opaque regions of the dosimeter. Out-of-plane rayline bending was observed in slices of the dosimeter that featured dose gradients perpendicular to the plane of the fan-beam. These errors caused widespread, severe overestimations of dose in image reconstructions due to the higher-than-actual opacity that is perceived by the scanner when light is bent off of the detector array. The ISG filtering routine outperformed AM filtering for both in-plane and out-of-plane rayline errors caused by radiation-induced RI changes. For in-plane rayline errors, streaks in an irradiated region (>7 Gy) were as high as 49% for unfiltered data, 14% for AM, and 6% for ISG. For out-of-plane rayline errors, overestimations of dose in a low-dose region (?50 cGy) were as high as 13 Gy for unfiltered data, 10 Gy for AM, and 3.1 Gy for ISG. The ISG routine also addressed unrelated artifacts that previously needed to be manually removed in sinogram space. However, the ISG routine blurred reconstructions, causing losses in spatial resolution of ?5 mm in the plane of the fan-beam and ?8 mm perpendicular to the fan-beam. Conclusions: This paper reveals a new category of imaging artifacts that can affect the optical CT readout of polyacrylamide gel dosimeters. Investigative scans show that radiation-induced RI changes can cause significant rayline errors when rays confront a prolonged dose gradient that runs perpendicular to their trajectory. In fan-beam optical CT, these errors manifested in two ways: (1) distinct streaking artifacts caused by in-plane rayline bending and (2) severe overestimations of opacity caused by rays bending out of the fan-beam plane and missing the detector array. Although the ISG filtering routine mitigated these errors better than an adaptive-mean filtering routine, it caused unacceptable losses in spatial resolution.

  4. Assessment of Potential Flood Events and Impacts at INL's Proposed Remote-Handled Low-Level Waste Disposal Facility Sites

    SciTech Connect (OSTI)

    A. Jeff Sondrup; Annette L. Schafter

    2010-09-01

    Rates, depths, erosion potential, increased subsurface transport rates, and annual exceedance probability for potential flooding scenarios have been evaluated for the on-site alternatives of Idaho National Laboratorys proposed remote handled low-level waste disposal facility. The on-site disposal facility is being evaluated in anticipation of the closure of the Radioactive Waste Management Complex at the INL. An assessment of flood impacts are required to meet the Department of Energys Low-Level Waste requirements (DOE-O 435.1), its natural phenomena hazards assessment criteria (DOE-STD-1023-95), and the Radioactive Waste Management Manual (DOE M 435.1-1) guidance in addition to being required by the National Environmental Policy Act (NEPA) environmental assessment (EA). Potential sources of water evaluated include those arising from (1) local precipitation events, (2) precipitation events occurring off of the INL (off-site precipitation), and (3) increased flows in the Big Lost River in the event of a Mackay Dam failure. On-site precipitation events include potential snow-melt and rainfall. Extreme rainfall events were evaluated for the potential to create local erosion, particularly of the barrier placed over the disposal facility. Off-site precipitation carried onto the INL by the Big Lost River channel was evaluated for overland migration of water away from the river channel. Off-site precipitation sources evaluated were those occurring in the drainage basin above Mackay Reservoir. In the worst-case scenarios, precipitation occurring above Mackay Dam could exceed the dams capacity, leading to overtopping, and eventually complete dam failure. Mackay Dam could also fail during a seismic event or as a result of mechanical piping. Some of the water released during dam failure, and contributing precipitation, has the potential of being carried onto the INL in the Big Lost River channel. Resulting overland flows from these flood sources were evaluated for their erosion potential, ability to overflow the proposed disposal facility, and for their ability to increase migration of contaminants from the facility. The assessment of available literature suggests that the likelihood of detrimental flood water impacting the proposed RH-LLW facility is extremely low. The annual exceedance probability associated with uncontrolled flows in the Big Lost River impacting either of the proposed sites is 1x10-5, with return interval (RI) of 10,000yrs. The most probable dam failure scenario has an annual exceedance probability of 6.3x10-6 (1.6x105 yr RI). In any of the scenarios generating possible on-site water, the duration is expected to be quite short, water depths are not expected to exceed 0.5 m, and the erosion potential can easily be mitigated by emplacement of a berm (operational period), and an engineered cover (post closure period). Subsurface mobilization of radionuclides was evaluated for a very conservative flooding scenario resulting in 50 cm deep, 30.5 day on-site water. The annual exceedance probability for which is much smaller than 3.6x10-7 (2.8x106 yr RI). For the purposes of illustration, the facility was assumed to flood every 500 years. The periodically recurring flood waters were predicted to marginally increase peak radionuclide fluxes into the aquifer by at most by a factor of three for non-sorbing radionuclides, and to have limited impact on peak radionuclide fluxes into the aquifer for contaminants that do sorb.

  5. Ecological risk assessment of elemental pollution in sediment from Tunku Abdul Rahman National Park, Sabah

    SciTech Connect (OSTI)

    Elias, Md Suhaimi; Hamzah, Mohd Suhaimi; Rahman, Shamsiah Ab; Salim, Nazaratul Ashifa Abdullah; Siong, Wee Boon; Sanuri, Ezwiza

    2014-02-12

    Eleven (11) surface sediment samples were collected from Tunku Abdul Rahman National Park, Sabah. The neutron activation analysis (NAA) and inductively coupled plasma-mass spectrometry (ICP-MS) techniques were applied for the determinations metal contents and their distributions in sediment samples. The results shown that Arsenic (As) concentrations are enriched at all sampling stations except for station TAR 09, with enrichment factor (EF) values ranged from 1.1 to 7.2. The elements such as Cd, Cr, Sb and U showed enrichment at a few stations and other elements (Cr, Cu, Pb, Th, Zn) shown as background levels in all stations. Degrees of contamination in this study were calculated base on concentrations of six elements (As, Cd, Cr, Cu, Pb, and Zn). TAR 11 station can be categorized as very high degree of contamination with degree of contamination value of 43.2. TAR 07 station can be categorized as a considerable degree of contamination (contamination value of 16.9). Six stations (TAR 01, 03, 04, 05, 06, 08, 10) showed moderate degree of contamination, with contamination values ranging from 8.0 to 16.0. TAR 02 and TAR 09 stations showed low degree of contaminations (< 8.0). TAR 11 showed very high ecological risk index (R{sub I}) with RI value is 916. TAR 07 and TAR 10 showed moderate ecological risk index with R{sub I} value 263 and 213, respectively. Other stations showed low ecological risk with RI values ranging from 42.3 to 117 (< 150). Very high ecological risk index could give an adverse effect to the benthic organism. The data obtained from the enrichment factor, degree of contamination and ecological risk index provided vital information, which can be used for future comparison. Information from the present study will be useful to the relevant government agencies and authorities in preparing preventive action to control direct discharge of heavy metals from industries, agro-base activities and domestic waste to the rivers and the sea.

  6. Baseline risk assessment for groundwater operable units at the Chemical Plant Area and the Ordnance Works Area, Weldon Spring, Missouri

    SciTech Connect (OSTI)

    1999-07-14

    The U.S. Department of Energy (DOE) and the U.S. Department of the Army (DA) are evaluating conditions in groundwater and springs at the DOE chemical plant area and the DA ordnance works area near Weldon Spring, Missouri. The two areas are located in St. Charles County, about 48 km (30 mi) west of St. Louis. The 88-ha (217-acre) chemical plant area is chemically and radioactively contaminated as a result of uranium-processing activities conducted by the U.S. Atomic Energy Commission in the 1950s and 1960s and explosives-production activities conducted by the U.S. Army (Army) in the 1940s. The 6,974-ha (17,232-acre) ordnance works area is primarily chemically contaminated as a result of trinitrotoluene (TNT) and dinitrotoluene (DNT) manufacturing activities during World War II. This baseline risk assessment (BRA) is being conducted as part of the remedial investigation/feasibility study (RUFS) required under the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) of 1980, as amended. The purpose of the BRA is to evaluate potential human health and ecological impacts from contamination associated with the groundwater operable units (GWOUs) of the chemical plant area and ordnance works area. An RI/FS work plan issued jointly in 1995 by the DOE and DA (DOE 1995) analyzed existing conditions at the GWOUs. The work plan included a conceptual hydrogeological model based on data available when the report was prepared; this model indicated that the aquifer of concern is common to both areas. Hence, to optimize further data collection and interpretation efforts, the DOE and DA have decided to conduct a joint RI/BRA. Characterization data obtained from the chemical plant area wells indicate that uranium is present at levels slightly higher than background, with a few concentrations exceeding the proposed U.S. Environmental Protection Agency (EPA) maximum contaminant level (MCL) of 20 {micro}g/L (EPA 1996c). Concentrations of other radionuclides (e.g., radium and thorium) were measured at back-ground levels and were eliminated from further consideration. Chemical contaminants identified in wells at the chemical plant area and ordnance works area include nitroaromatic compounds, metals, and inorganic anions. Trichloroethylene (TCE) and 1,2-dichloroethylene (1,2 -DCE) have been detected recently in a few wells near the raffinate pits at the chemical plant.

  7. COST-EFFECTIVE METHOD FOR PRODUCING SELF SUPPORTED PALLADIUM ALLOY MEMBRANES FOR USE IN EFFICIENT PRODUCTION OF COAL DERIVED HYDROGEN

    SciTech Connect (OSTI)

    J. Arps; K. Coulter

    2006-09-30

    In the past quarter, we have conducted additional characterization and permeation tests on different Pd alloy membranes including PdCuTa ternary alloy materials. We attempted to address some discrepancies between SwRI{reg_sign} and CSM relating to PdCu stoichiometry by preparing a range of PdCu membranes with compositions from {approx}58-65 at% Pd (bal. Cu). While some difficulties in cutting and sealing these thin membranes at CSM continue, some progress has been made in identifying improved membrane support materials. We have also completed an initial cost analysis for large-scale vacuum deposition and fabrication of thin Pd ally membranes and project that the process can meet DOE cost targets. Minimal progress was made in the past quarter relating to the testing of prototype membrane modules at Idatech. In the past quarter Idatech was acquired by a UK investment firm, which we believe may have impacted the ability of key technical personnel to devote sufficient time to support this effort. We are hopeful their work can be completed by the end of the calendar year.

  8. FY2008 Report on GADRAS Radiation Transport Methods.

    SciTech Connect (OSTI)

    Mattingly, John K.; Mitchell, Dean James; Harding, Lee; Varley, Eric S.; Hilton, Nathan R.

    2008-10-01

    The primary function of the Gamma Detector Response and Analysis Software (GADRAS) is the solution of inverse radiation transport problems, by which the con-figuration of an unknown radiation source is inferred from one or more measured radia-tion signatures. GADRAS was originally developed for the analysis of gamma spec-trometry measurements. During fiscal years 2007 and 2008, GADRAS was augmented to implement the simultaneous analysis of neutron multiplicity measurements. This report describes the radiation transport methods developed to implement this new capability. This work was performed at the direction of the National Nuclear Security Administration's Office of Nonproliferation Research and Development. It was executed as an element of the Proliferation Detection Program's Simulation, Algorithm, and Modeling element. Acronyms BNL Brookhaven National Laboratory CSD Continuous Slowing-Down DU depleted uranium ENSDF Evaluated Nuclear Structure Data Files GADRAS Gamma Detector Response and Analysis Software HEU highly enriched uranium LANL Los Alamos National Laboratory LLNL Lawrence Livermore National Laboratory NA-22 Office of Nonproliferation Research and Development NNDC National Nuclear Data Center NNSA National Nuclear Security Administration ODE ordinary differential equation ONEDANT One-dimensional diffusion accelerated neutral particle transport ORNL Oak Ridge National Laboratory PARTISN Parallel time-dependent SN PDP Proliferation Detection Program RADSAT Radiation Scenario Analysis Toolkit RSICC Radiation Safety Information Computational Center SAM Simulation, Algorithms, and Modeling SNL Sandia National Laboratories SNM special nuclear material ToRI Table of Radioactive Isotopes URI uniform resource identifier XML Extensible Markup Language

  9. Advanced Collaborative Emissions Study (ACES)

    SciTech Connect (OSTI)

    Greenbaum, Daniel; Costantini, Maria; Van Erp, Annemoon; Shaikh, Rashid; Bailey, Brent; Tennant, Chris; Khalek, Imad; Mauderly, Joe; McDonald, Jacob; Zielinska, Barbara; Bemis, Jeffrey; Storey, John; Hallberg, Lance; Clark, Nigel

    2013-12-31

    The objective of the Advanced Collaborative Emissions Study (ACES) was to determine before widespread commercial deployment whether or not the new, energy-efficient, heavy duty diesel engines (2007 and 2010 EPA Emissions Standards Compliant) may generate anticipated toxic emissions that could adversely affect the environment and human health. ACES was planned to take place in three phases. In Phase 1, extensive emissions characterization of four production-intent prototype engine and control systems designed to meet 2007 standards for nitrogen oxides (NOx) and particulate matter (PM) was conducted at an existing emissions characterization facility: Southwest Research Institute (SwRI). One of the tested engines was selected (at random, after careful comparison of results) for health testing in Phase 3. In Phase 2, extensive emission characterization of three production-intent prototype engine and control systems meeting the 2010 standards (including more advanced NOx controls to meet the more stringent 2010 NOx standards) was conducted at the same test facility. In Phase 3, one engine/aftertreatment system selected from Phase 1 was further characterized during health effects studies (at an existing inhalation toxicology laboratory: Lovelace Respiratory Research Institute, [LRRI]) to form the basis of the ACES safety assessment. The Department of Energy (DOE) award provided funding for emissions characterization in Phases 1 and 2 as well as exposure characterization in Phase 3. The main health analyses in Phase 3 were funded separately and are not reported here.

  10. Investigation summary and proposed alternative for lead remediation at a small arms trainfire range

    SciTech Connect (OSTI)

    Beekman, S.M.; Stemper, M.L. [Harding Lawson Associates, Novato, CA (United States)

    1995-12-31

    The small arms trainfire ranges are part of the former Fort Ord Army Base Superfund site in Monterey County, California. Trainees fired small caliber weapons at targets near the leeward dune faces along Monterey Bay. Monterey Bay is a National Marine Sanctuary and the dunes contain endangered species and endangered species habitat. This paper summarizes results of the remedial investigation, human health risk assessment, ecological risk assessment, and feasibility study, and presents the results of bench-scale studies and proposed pilot studies for the site. Results of the RI showed that lead is the primary chemical of concern in soil (i.e., dune sands) and was detected at the highest concentrations where surface coverage of spent ammunition was greater than 10 percent (areas of heavy bullet distribution). A regulatory-approved health-based level of 1,860 mg/kg was developed as an acceptable level for lead-bearing soil in areas of heavy deposition to be protective of human health and the environment for planned reuse. Concentrations near or above 1,860 mg/kg correspond to areas of heavy distribution of spent ammunition. Plant and animal species were sampled and tested to evaluate the potential risk to ecological receptors.

  11. Fire testing: A review of past, current and future methods

    SciTech Connect (OSTI)

    White, G.C.; Shirvill, L.C.

    1995-12-31

    The philosophy and current methods of fire testing elements of construction and the associated fire protection systems are reviewed. Particular attention is paid to offshore structures and the fire hazards associated with offshore operations. Fire testing is only one aspect in the attempt to ensure that the effects of fires are understood and that effective fire protection systems are developed. The historical development of fire tests is discussed, ending with the furnace test which follows the hydrocarbon temperature versus time curve. The limitations of these tests are discussed, in particular when they are applied to offshore fire scenarios where they are not representative of the potential fire loading and conditions identified for typical platforms. The identification of the jet fire as a common fire scenario on offshore platforms, together with the criticisms made by Lord Cullen in his report on the Piper Alpha disaster, has driven the development of more realistic fire tests. Two such tests are now available and are described in the paper. Also discussed is the development of a smaller scale test that has formed the basis of the recently issued Interim Jet Fire Test Procedure, produced by a working group comprising the UK Health and Safety Executive (HSE); the Norwegian Petroleum Directorate (NPD); Lloyd`s Register; the UK Offshore Operator`s Association (UKOOA); the Norwegian Fire Research Laboratory (SINTEF NBL); the Southwest Research Institute (SwRI); Shell Research Ltd.; and British Gas Research and Technology.

  12. Characterization, monitoring, and sensor technology catalogue

    SciTech Connect (OSTI)

    Matalucci, R.V.; Esparza-Baca, C.; Jimenez, R.D.

    1995-12-01

    This document represents a summary of 58 technologies that are being developed by the Department of Energy`s (DOE`s) Office of Science and Technology (OST) to provide site, waste, and process characterization and monitoring solutions to the DOE weapons complex. The information was compiled to provide performance data on OST-developed technologies to scientists and engineers responsible for preparing Remedial Investigation/Feasibility Studies (RI/FSs) and preparing plans and compliance documents for DOE cleanup and waste management programs. The information may also be used to identify opportunities for partnering and commercialization with industry, DOE laboratories, other federal and state agencies, and the academic community. Each technology is featured in a format that provides: (1) a description, (2) technical performance data, (3) applicability, (4) development status, (5) regulatory considerations, (6) potential commercial applications, (7) intellectual property, and (8) points-of-contact. Technologies are categorized into the following areas: (1) Bioremediation Monitoring, (2) Decontamination and Decommissioning, (3) Field Analytical Laboratories, (4) Geophysical and Hydrologic Characterization, (5) Hazardous Inorganic Contaminant Analysis, (6) Hazardous Organic Contaminant Analysis, (7) Mixed Waste, (8) Radioactive Contaminant Analysis, (9) Remote Sensing,(10)Sampling and Drilling, (11) Statistically Guided Sampling, and (12) Tank Waste.

  13. Addendum to the East Tennessee Technology Park Site-Wide Residual Contamination Remedial Investigation Work Plan Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    SAIC

    2011-04-01

    The East Tennessee Technology Park Site-Wide Residual Contamination Remedial Investigation Work Plan (DOE 2004) describes the planned fieldwork to support the remedial investigation (RI) for residual contamination at the East Tennessee Technology Park (ETTP) not addressed in previous Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) decisions. This Addendum describes activities that will be conducted to gather additional information in Zone 1 of the ETTP for groundwater, surface water, and sediments. This Addendum has been developed from agreements reached in meetings held on June 23, 2010, August 25, 2010, October 13, 2010, November 13, 2010, December 1, 2010, and January 13, 2011, with representatives of the U. S. Department of Energy (DOE), U. S. Environmental Protection Agency (EPA), and Tennessee Department of Environment and Conservation (TDEC). Based on historical to recent groundwater data for ETTP and the previously completed Sitewide Remedial Investigation for the ETTP (DOE 2007a), the following six areas of concern have been identified that exhibit groundwater contamination downgradient of these areas above state of Tennessee and EPA drinking water maximum contaminant levels (MCLs): (1) K-720 Fly Ash Pile, (2) K-770 Scrap Yard, (3) Duct Island, (4) K-1085 Firehouse Burn/J.A. Jones Maintenance Area, (5) Contractor's Spoil Area (CSA), and (6) Former K-1070-A Burial Ground. The paper presents a brief summary of the history of the areas, the general conceptual models for the observed groundwater contamination, and the data gaps identified.

  14. Remedial investigation report on Waste Area Grouping 5 at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Volume 2 -- Appendix A: Characterization methods and data summary

    SciTech Connect (OSTI)

    1995-09-01

    This document provides the Environmental Restoration Program with information about the results of investigations performed at Waste Area Grouping (WAG) 5. It includes information on risk assessments that have evaluated long-term impacts to human health and the environment. Information provided in this document forms the basis for decisions regarding the need for subsequent remediation work at WAG 5. This appendix presents background regulatory and technical information regarding the solid waste management units (SWMUs) at WAG 5 to address requirements established by the Federal Facility Agreement (FFA) for the Oak Ridge Reservation (ORR). The US Department of Energy (DOE) agreed to conduct remedial investigations (RIs) under the FFA at various sites at Oak Ridge National Laboratory (ORNL), including SWMUs and other areas of concern on WAG 5. The appendix gives an overview of the regulatory background to provide the context in which the WAG 5 RI was planned and implemented and documents how historical sources of data, many of which are SWMU-specific, were evaluated and used.

  15. Effects of an RTG power source on neutron spectroscopy measurements on the martian surface.

    SciTech Connect (OSTI)

    Lawrence, David J. ,; Elphic, R. C.; Wiens, R. C.

    2003-01-01

    A continuing goal of Mars science is to identify the exact locations of near-surface water and/or hydrated minerals using in situ measurements. Recent data from the Mars Odyssey mission has used both neutron and gamma-ray spectroscopy to measure large amounts of water ice near both polar regions . Furthermore, these data have also determined that in the mid-latitude regions, there likely exist relatively large amounts of hydrogen (-4-7 equivalent H2O wt.%), although it is not certain in which form this hydrogen exists . While these are exciting results, one drawback of these measurements is that they are averaged over a large (-400 km) footp ri nt and do not reflect any small (<1 km) inhomogenieties in hydrogen abundance that likely exist on the Martian surface. For any future in situ mission (e g, Mars Smart Lander (MSL)) that seeks to measure and characterize nearsurface H 2O, especially in the mid-latitude regions, is will be necessary to know th e locati ons of the H20.

  16. Description of work for 200-UP-1 characterization of monitoring wells

    SciTech Connect (OSTI)

    Innis, B.E.; Kelty, G.G.

    1994-02-01

    This description of work (DOW) details the field activities associated with the drilling, soil sampling, and construction of groundwater monitoring and dual-use wells in the 200-UP-1 Operable Unit (Tasks 2, 3, and 5 in the 200-UP-1 RI/FS Work Plan DOE/RL 1993a) and will serve as a field guide for those performing the work. It will be used in conjunction with the Remedial Investigation/Feasibility Study Work Plan for the 200-UP-1 Groundwater operable Unit (DOE-RL 1993a, [LFI]) and Site Characterization Manual (WHC 1988a). Groundwater wells are being constructed to characterize the vertical and horizontal extent of the Uranium and {sup 99}{Tc} plumes and to define aquifer properties such as hydraulic communication between aquifers and hydrostratigraphy. Some of these wells may be utilized for extraction purposes during the IRM phase anticipated at this operable unit and are being designed with a dual use in mind. These data will be used to optimize the Interim Remedial Measures (IRM) for the cleanup of these two plumes. The data will also be used with later Limited Field Investigation (LFI) data to perform a Qualitative Risk Assessment (QRA) for the operable unit. The locations for the proposed groundwater wells are presented in Figure 1. The contaminants of concern for the project are presented ih Table 1.

  17. Remote inspection system for hazardous sites

    SciTech Connect (OSTI)

    Redd, J.; Borst, C.; Volz, R.A.; Everett, L.J.

    1999-04-01

    Long term storage of special nuclear materials poses a number of problems. One of these is a need to inspect the items being stored from time to time. Yet the environment is hostile to man, with significant radiation exposure resulting from prolonged presence in the storage facility. This paper describes research to provide a remote inspection capability, which could lead to eliminating the need for humans to enter a nuclear storage facility. While there are many ways in which an RI system might be created, this paper describes the development of a prototype remote inspection system, which utilizes virtual reality technology along with robotics. The purpose of this system is to allow the operator to establish a safe and realistic telepresence in a remote environment. In addition, it was desired that the user interface for the system be as intuitive to use as possible, thus eliminating the need for extensive training. The goal of this system is to provide a robotic platform with two cameras, which are capable of providing accurate and reliable stereographic images of the remote environment. One application for the system is that it might be driven down the corridors of a nuclear storage facility and utilized to inspect the drums inside, all without the need for physical human presence. Thus, it is not a true virtual reality system providing simulated graphics, but rather an augmented reality system, which performs remote inspection of an existing, real environment.

  18. Remedial investigation plan for Waste Area Grouping 1 at Oak Ridge National Laboratory, Oak Ridge, Tennessee: Responses to regulator comments

    SciTech Connect (OSTI)

    Not Available

    1991-05-01

    This document, ES/ER-6 D2, is a companion document to ORNL/RAP/Sub-87/99053/4 R1, Remedial Investigation Plan for ORNL Waste Area Grouping 1, dated August 1989. This document lists comments received from the Environmental Protection Agency, Region 4 (EPA) and the Tennessee Department of Health and Environment (TDHE) and responses to each of these comments. As requested by EPA, a revised Remedial Investigation (RI) Plan for Waste Area Grouping (WAG) 1 will not be submitted. The document is divided into two Sections and Appendix. Section I contains responses to comments issued on May 22, 1990, by EPA's Region 4 program office responsible for implementing the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA). Section 2 contains responses to comments issued on April 7, 1989, by EPA's program office responsible for implementing the Resource Conservation and Recovery Act (RCRA); these comments include issues raised by the TDHE. The Appendix contains the attachments referenced in a number of the responses. 35 refs.

  19. Particle image velocimetry measurements for opposing flow in a vertical channel with a differential and asymmetric heating condition

    SciTech Connect (OSTI)

    Martinez-Suastegui, L. [Graduate Student, Facultad de Ingenieria, Universidad Nacional Autonoma de Mexico, C.U., Mexico 04510 D.F. (Mexico); Trevino, C. [Facultad de Ciencias, Universidad Nacional Autonoma de Mexico, C.U., Mexico 04510 D.F. (Mexico)

    2007-10-15

    Particle image velocimetry (PIV) measurements were carried out in an experimental investigation of laminar mixed convection in a vertical duct with a square cross-section. The main downward water-flow is driven by gravity while a portion of a lateral side is heated, and buoyancy forces produce non-stationary vortex structures close to the heated region. Various ranges of the Grashof number, Gr are studied in combination with the Reynolds number, Re varying from 300 to 700. The values of the generalized buoyancy parameter or Richardson number, Ri = Gr/Re{sup 2} parallel to the Grashof number are included in the results. The influence of these nondimensional parameters and how they affect the fluid flow structure and vortex sizes and locations are reported. The flow patterns are nonsymmetric, periodic, and exhibit increasing complexity and frequency for increasing buoyancy. For the averaged values of the resulting vortex dimensions, it was found that a better and more congruent representation occurs when employing the Grashof and Reynolds numbers as independent parameters. (author)

  20. Low level tank waste disposal study

    SciTech Connect (OSTI)

    Mullally, J.A.

    1994-09-29

    Westinghouse Hanford Company (WHC) contracted a team consisting of Los Alamos Technical Associates (LATA), British Nuclear Fuel Laboratories (BNFL), Southwest Research Institute (SwRI), and TRW through the Tank Waste Remediation System (TWRS) Technical Support Contract to conduct a study on several areas concerning vitrification and disposal of low-level-waste (LLW). The purpose of the study was to investigate how several parameters could be specified to achieve full compliance with regulations. The most restrictive regulation governing this disposal activity is the National Primary Drinking Water Act which sets the limits of exposure to 4 mrem per year for a person drinking two liters of ground water daily. To fully comply, this constraint would be met independently of the passage of time. In addition, another key factor in the investigation was the capability to retrieve the disposed waste during the first 50 years as specified in Department of Energy (DOE) Order 5820.2A. The objective of the project was to develop a strategy for effective long-term disposal of the low-level waste at the Hanford site.

  1. Report for Westinghouse Hanford Company: Makeup procedures and characterization data for modified DSSF and modified remaining inventory simulated tank waste

    SciTech Connect (OSTI)

    Lokken, R.O.

    1996-03-01

    The majority of defense wastes generated from reprocessing spent reactor fuel at Hanford are stored in underground Double-Shell Tanks (DST) and in older Single-Shell Tanks (SST). The Tank Waste Remediation System (TWRS) Program has the responsibility of safely managing and immobilizing these tank wastes for disposal. A reference process flowsheet is being developed that includes waste retrieval, pretreatment, and vitrification. Melter technologies for vitrifying low-level tank wastes are being evaluated by Westinghouse Hanford Company. Chemical simulants are being used in the technology testing. For the first phase of low-level waste (LLW) vitrification simulant development, two waste stream compositions were investigated. The first waste simulant was based on the analyses of six tanks of double-shell slurry feed (DSSF) waste and on the projected composition of the wastes exiting the pretreatment operations. A simulant normalized to 6 M sodium was based on the anticipated chemical concentrations after ion exchange and initial separations. The same simulant concentrated to 10 M sodium would represent a waste that had been concentrated by evaporation to reduce the overall volume. The second LLW simulant, referred to as the remaining inventory (RI), included wastes not included in the DSSF tanks and the projected LLW fraction of single-shell tank wastes.

  2. Environmental Restoration Program pollution prevention performance measures for FY 1993 and 1994 remedial investigations

    SciTech Connect (OSTI)

    Not Available

    1993-03-01

    The Martin Marietta Energy Systems, Inc., Environmental Restoration (ER) Program adopted a Pollution Prevention Program in March 1991. The program's mission is to minimize waste and prevent pollution in remedial investigations (RI), feasibility studies (FS), decontamination and decommissioning (D D), and surveillance and maintenance (S M) site program activities. Mission success will result in volume and/or toxicity reduction of generated waste. Energy Systems is producing a fully developed a Numerical Scoring System (NSS) and actually scoring the generators of Investigation Derived Waste (IDW) at six ER sites: Oak Ridge National Laboratory (ORNL), the Oak Ridge Y-12 Plant, the Oak Ridge K-25 site, Paducah Gaseous Diffusion Plant (Paducah), and Portsmouth Uranium Enrichment Complex (Portsmouth). This report summarizes the findings of this initial numerical scoring evaluation and shows where improvements in the overall ER Pollution prevention program may be required. This report identifies a number of recommendations that, if implemented, would help to improve site-performance measures. The continued development of the NSS will support generators in maximizing their Pollution Prevention/Waste Minimization efforts. Further refinements of the NSS, as applicable suggest comments and/or recommendations for improvement.

  3. Environmental Restoration Program pollution prevention performance measures for FY 1993 and 1994 remedial investigations

    SciTech Connect (OSTI)

    Not Available

    1993-03-01

    The Martin Marietta Energy Systems, Inc., Environmental Restoration (ER) Program adopted a Pollution Prevention Program in March 1991. The program`s mission is to minimize waste and prevent pollution in remedial investigations (RI), feasibility studies (FS), decontamination and decommissioning (D&D), and surveillance and maintenance (S&M) site program activities. Mission success will result in volume and/or toxicity reduction of generated waste. Energy Systems is producing a fully developed a Numerical Scoring System (NSS) and actually scoring the generators of Investigation Derived Waste (IDW) at six ER sites: Oak Ridge National Laboratory (ORNL), the Oak Ridge Y-12 Plant, the Oak Ridge K-25 site, Paducah Gaseous Diffusion Plant (Paducah), and Portsmouth Uranium Enrichment Complex (Portsmouth). This report summarizes the findings of this initial numerical scoring evaluation and shows where improvements in the overall ER Pollution prevention program may be required. This report identifies a number of recommendations that, if implemented, would help to improve site-performance measures. The continued development of the NSS will support generators in maximizing their Pollution Prevention/Waste Minimization efforts. Further refinements of the NSS, as applicable suggest comments and/or recommendations for improvement.

  4. The hybrid rich-burn/lean burn engine. Part 2

    SciTech Connect (OSTI)

    Smith, J.A.; Podnar, D.; Meyers, D.P.

    1996-12-31

    Southwest Research Institute (SwRI) has developed a unique engine technology called Hybrid Rich-Burn/Lean-Burn (HRBLB) that capitalizes on the low production of oxides of nitrogen (NO{sub x}) during extremely rich and lean combustion. The HRBLB concept is predicated on simultaneous combustion of extremely rich and lean natural gas-air mixtures in separate cylinders. Rich exhaust products undergo a catalytic water-gas shift reaction to form an intermediate combustible fuel composed of carbon monoxide, water vapor, hydrogen, and carbon dioxide. All of the intermediate fuel is added to lean natural gas-air mixtures in other cylinders to enhance ignitability that would otherwise result in misfire. This paper presents results obtained during the development of a stationary, turbocharged, and intercooled, 18-liter HRBLB engine. Results show that NO{sub x} can be reduced by a factor of 2.5 to 3.5 relative to stock engine emissions at equivalent efficiency. The HRBLB engine has demonstrated corrected NO{sub x} (15% O{sub 2}) levels of 23 ppm at rated load with thermal efficiencies of 35%.

  5. Options for converting excess plutonium to feed for the MOX fuel fabrication facility

    SciTech Connect (OSTI)

    Watts, Joe A; Smith, Paul H; Psaras, John D; Jarvinen, Gordon D; Costa, David A; Joyce, Jr., Edward L

    2009-01-01

    The storage and safekeeping of excess plutonium in the United States represents a multibillion-dollar lifecycle cost to the taxpayers and poses challenges to National Security and Nuclear Non-Proliferation. Los Alamos National Laboratory is considering options for converting some portion of the 13 metric tons of excess plutonium that was previously destined for long-term waste disposition into feed for the MOX Fuel Fabrication Facility (MFFF). This approach could reduce storage costs and security ri sks, and produce fuel for nuclear energy at the same time. Over the course of 30 years of weapons related plutonium production, Los Alamos has developed a number of flow sheets aimed at separation and purification of plutonium. Flow sheets for converting metal to oxide and for removing chloride and fluoride from plutonium residues have been developed and withstood the test oftime. This presentation will address some potential options for utilizing processes and infrastructure developed by Defense Programs to transform a large variety of highly impure plutonium into feedstock for the MFFF.

  6. Automatic UT inspection of economizer at TVA`s Paradise plant

    SciTech Connect (OSTI)

    Brophy, J.W.; Chang, P.

    1995-12-31

    In March 1995, Tennessee Valley Authority (TVA) and Southwest Research Institute (SwRi) conducted testing of a multi-element ultrasonic probe designed to inspect economizer tubing in the Paradise power plant during the spring outage. This evaluation was to determine general loss of wall thickness due to erosion/corrosion and preferential inside diameter (ID) corrosion at butt welds in straight sections of the tube. The erosion/corrosion wall loss occurs during service while the butt weld corrosion occurs out-of-service when water collects in the weld groove during outages and results in localized pitting in the weld groove. The ultrasonic (UT) probe was designed to acquire thickness measurements from the ID of the economizer tubes and to be accurate, very rapid UT inspection. To attain a high rate of speed inside the tubes, an eight-element circular array of transducers were designed into the probe head. Thickness data and location data are collected automatically by a portable computer.

  7. MASTER Atomic Energy of Canada Limited

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Canada Limited ENERGY DISTRIBUTIONS OF NEUTRONS SCATTERED FROM GRAPHITE, LIGHT AND HEAVY WATER,ICE,ZIRCONIUM HY0RI0E,1ITHIUM HYORIOE,SOOIUM HYDRIDE AND CHLORIDE BY THE BERYLLIUM DETECTOR METHOD C R N P 9 4 8 b y A . D . B . W O O D S , B . N . B R O C K H O U S E , M. S A K A M O T O A N D R . N . S I N C L A I R P a p e r f o r P r e s e n t a t i o n a t t h e I A E A S y m p o s i u m on I n e l a s t i c S c a t t e r i n g o f N e u t r o n s i n S o l i d s a n d L i q u i d s , V i e n n

  8. Microsoft PowerPoint - HAB 2012 Final.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    fe a n d E ff e c ti v e C le a n u p th a t P ro te c ts th e C o lu m b ia R iv e r Re du ce s th e Ac tiv e Sit e Fo ot pr int of Cl ea nu p to 75 Sq ua re Mi les (5 86 to 75 ) Sig ni fic an tly Re du ce s Lo ng -T erm Mo rtg ag e Co st s At Co m pl eti on , Sh ift s Em ph as is an d Re so ur ce s to Fu ll of th e Ce nt ra l Pla tea u (7 5 sq ua re m ile s) Re du ce s Co st s by "R i Mi ss io Ri ch la nd O pe ra tio ns Of fic e B & C Ar ea Inte rim Saf e Sto rag e f N Ar ea Inte rim

  9. Microsoft PowerPoint - HAB1111-Dowellfinalnobu.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    fe a n d E ff e c ti v e C le a n u p th a t P ro te c ts th e C o lu m b ia R iv e r ¾ Re du ce s th e Ac tiv e Sit e Fo ot pr int of Cl ea nu p to 75 Sq ua re Mi les (5 86 to 75 ) ¾ Sig ni fic an tly Re du ce s Lo ng -T erm Mo rtg ag e Co st s ¾ At Co m pl eti on , Sh ift s Em ph as is an d Re so ur ce s to Fu ll of th e Ce nt ra l Pla tea u (7 5 sq ua re m ile s) ¾ Re du ce s Co st s by "R i Mi ss io Ri ch la nd O pe ra tio ns Of fic e B & C Ar ea 9 Inte rim Saf e Sto rag e f 9 N

  10. Effect of Gasoline Properties on Exhaust Emissions from Tier 2 Light-Duty Vehicles -- Final Report: Phase 3; July 28, 2008 - July 27, 2013

    SciTech Connect (OSTI)

    Whitney, K.

    2014-05-01

    This report covers work the Southwest Research Institute (SwRI) Office of Automotive Engineering has conducted for the U.S. Environmental Protection Agency (EPA), the National Renewable Energy Laboratory (NREL), and the Coordinating Research Council (CRC) in support of the Energy Policy Act of 2005 (EPAct). Section 1506 of EPAct requires EPA to produce an updated fuel effects model representing the 2007 light - duty gasoline fleet, including determination of the emissions impacts of increased renewable fuel use. This report covers the exhaust emissions testing of 15 light-duty vehicles with 27 E0 through E20 test fuels, and 4 light-duty flexible fuel vehicles (FFVs) on an E85 fuel, as part of the EPAct Gasoline Light-Duty Exhaust Fuel Effects Test Program. This program will also be referred to as the EPAct/V2/E-89 Program based on the designations used for it by the EPA, NREL, and CRC, respectively. It is expected that this report will be an attachment or a chapter in the overall EPAct/V2/E-89 Program report prepared by EPA and NREL.

  11. Organization of the multiple polymorphic sites of the D19S11 locus within a 650-kb cosmid contig

    SciTech Connect (OSTI)

    Tynan, K.; Hoffman, S.M.G.; Tsujimoto, S.; Brandriff, B.; Gordon, L.; Carrano, A.V.; Mohrenweiser, H.W. (Lawrence Livermore National Lab., CA (United States))

    1993-08-01

    The D19S11 locus has been previously described as consisting of a complex set of six nonallelic polymorphic sites detected with a combination of four restriction enzymes and three probes that were subcloned from a single cosmid. These probes also hybridized to additional nonvariant fragments on Southern blots of human genomic DNA. In the course of establishing a contig map of human chromosome 19, a set of cosmids that were positive for at least one of the probes defining this locus was identified. These cosmids, along with additional cosmids, were assembled using a combination of strategies, including fluorescence in situ hybridization studies using G1 interphase nuclei and sperm pronuclei as chromatin targets, into a single overlapping set of cosmids that spans [approximately]650 kb. Cosmids that are positive for the MEL gene probe are localized at the centromeric end of the spanning path, with some cosmids being positive for both the MEL gene probe and one of the D19S11 probes. The EcoRI fragments with homology to the various probes have been identified; some cosmids have homology to all three D19S11 probes. The positions for five of the six polymorphic sites were localized within a 40-kb region, with four sites within 15 kb. 21 refs., 3 figs., 2 tabs.

  12. Cancer Facts & Figures - 2010

    National Nuclear Security Administration (NNSA)

    AL 23,640 AZ 29,780 AR 15,320 CA 157,320 CO 21,340 CT 20,750 DE 4,890 FL 107,000 GA 40,480 ID 7,220 IL 63,890 IN 33,020 IA 17,260 KS 13,550 KY 24,240 LA 20,950 ME 8,650 MD 27,700 MA 36,040 MN 25,080 MS 14,330 MO 31,160 MT 5,570 NE 9,230 NV 12,230 NH 7,810 NJ 48,100 NM 9,210 NY 103,340 NC 45,120 ND 3,300 OH 64,450 OK 18,670 OR 20,750 PA 75,260 RI 5,970 SC 23,240 SD 4,220 TN 33,070 TX 101,120 UT 9,970 VT 3,720 VA 36,410 WA 34,500 WV 10,610 WI 29,610 WY 2,540 DC 2,760 HI 6,670 AK 2,860 MI 55,660 PR

  13. Baseline risk assessment for exposure to contaminants at the St. Louis Site, St. Louis, Missouri

    SciTech Connect (OSTI)

    Not Available

    1993-11-01

    The St. Louis Site comprises three noncontiguous areas in and near St. Louis, Missouri: the St. Louis Downtown Site (SLDS), the St. Louis Airport Storage Site (SLAPS), and the Latty Avenue Properties. The main site of the Latty Avenue Properties includes the Hazelwood Interim Storage Site (HISS) and the Futura Coatings property, which are located at 9200 Latty Avenue. Contamination at the St. Louis Site is the result of uranium processing and disposal activities that took place from the 1940s through the 1970s. Uranium processing took place at the SLDS from 1942 through 1957. From the 1940s through the 1960s, SLAPS was used as a storage area for residues from the manufacturing operations at SLDS. The materials stored at SLAPS were bought by Continental Mining and Milling Company of Chicago, Illinois, in 1966, and moved to the HISS/Futura Coatings property at 9200 Latty Avenue. Vicinity properties became contaminated as a result of transport and movement of the contaminated material among SLDS, SLAPS, and the 9200 Latty Avenue property. This contamination led to the SLAPS, HISS, and Futura Coatings properties being placed on the National Priorities List (NPL) of the US Environmental Protection Agency (EPA). The US Department of Energy (DOE) is responsible for cleanup activities at the St. Louis Site under its Formerly Utilized Sites Remedial Action Program (FUSRAP). The primary goal of FUSRAP is the elimination of potential hazards to human health and the environment at former Manhattan Engineer District/Atomic Energy Commission (MED/AEC) sites so that, to the extent possible, these properties can be released for use without restrictions. To determine and establish cleanup goals for the St. Louis Site, DOE is currently preparing a remedial investigation/feasibility study-environmental impact statement (RI/FS-EIS). This baseline risk assessment (BRA) is a component of the process; it addresses potential risk to human health and the environment associated wi

  14. Correct implementation of the Argonne Expedited Site Characterization (ESC) process for preremedial site investigations.

    SciTech Connect (OSTI)

    Burton, J. C.; Cook, S.; Sedivy, R.; Walker, J. L.

    1997-12-12

    The Argonne Expedited Site Characterization (ANL ESC) methodology, developed by Argonne National Laboratory and popularly known as ESC, is an effective, cost- and time-saving approach for technically successful preremedial site characterizations. The major objective of the ANL ESC is to determine whether a site containing contamination requires remediation. The methodology is equivalent to a CERCLA RI/FS or a RCRA RFI/CMS investigation. The ANL ESC methodology is an interactive, integrated process emphasizing the use of existing data, multiple complementary characterization methods, and on-site decision making to optimize site investigations. The ANL ESC is the basis for the expedited site characterization standard of the ASTM (American Society for Testing and Materials). The methodology has been registered under the service mark QuickSite{trademark} to offer both clients and providers a mechanism for ensuring that they receive the ANL ESC methodology developed by Argonne. The ANL ESC is a flexible process and is neither site nor contaminant dependent. It can be tailored to fit the unique characteristics that distinguish one site from the next, in contrast to the traditional approach of making all sites conform to the same rigid, inflexible investigation regimen. The ANL ESC has been applied successfully to remedial site investigations of landfills with multiple contaminants in the southwestern US for the Department of Interior (DOI), to former grain storage facilities in the Midwest for the Commodity Credit Corporation of the Department of Agriculture (CCC/USDA), to weapons production facilities in Texas for the Department of Energy (DOE), and to closing and active military bases in several locations for the Department of Defense (DOD). The process can be applied both at sites that have seen little investigation and at sites that have undergone numerous previous site characterizations without reaching closure. In the latter case (e.g., at many DOE and DOD sites), the ANL ESC offers a rapid solution, frequently with little additional field work.

  15. Brookhaven National Laboratory site environmental report for calendar year 1993

    SciTech Connect (OSTI)

    Naidu, J.R.; Royce, B.A.

    1994-05-01

    This report documents the results of the Environmental Monitoring Program at BNL and presents summary information about environmental compliance for 1993. To evaluate the effect of BNL operations on the local environment, measurements of direct radiation, and a variety of radionuclides and chemical compounds in ambient air, soil, sewage effluent, surface water, ground water and vegetation were made at the BNL site and at sites adjacent to the Laboratory. Brookhaven National Laboratory`s compliance with all applicable guides, standards, and limits for radiological and nonradiological emissions to the environment were evaluated. Among the permitted facilities, two instances, of pH exceedances were observed at recharge basins, possible related to rain-water run-off to these recharge basins. Also, the discharge from the Sewage Treatment Plant (STP) to the Peconic River exceeded on five occasions, three for residual chlorine and one each for iron and ammonia nitrogen. The chlorine exceedances were related to a malfunctioning hypochlorite dosing pump and ceased when the pump was repaired. While the iron and ammonia-nitrogen could be the result of disturbances to the sand filter beds during maintenance. The environmental monitoring data has identified site-specific contamination of ground water and soil. These areas are subject to Remedial Investigation/Feasibility Studies (RI/FS) under the Inter Agency Agreement (IAG). Except for the above, the environmental monitoring data has continued to demonstrate that compliance was achieved with applicable environmental laws and regulations governing emission and discharge of materials to the environment, and that the environmental impacts at BNL are minimal and pose no threat to the public or to the environment. This report meets the requirements of DOE Orders 5484. 1, Environmental Protection, Safety, and Health Protection Information reporting requirements and 5400.1, General Environmental Protection Programs.

  16. MULTI-COLOR OPTICAL AND NEAR-INFRARED LIGHT CURVES OF 64 STRIPPED-ENVELOPE CORE-COLLAPSE SUPERNOVAE

    SciTech Connect (OSTI)

    Bianco, F. B.; Modjaz, M. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Hicken, M.; Friedman, A.; Kirshner, R. P.; Challis, P.; Marion, G. H. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Bloom, J. S. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Wood-Vasey, W. M. [PITT PACC, Department of Physics and Astronomy, 3941 O'Hara Street, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Rest, A., E-mail: fb55@nyu.edu [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2014-08-01

    We present a densely sampled, homogeneous set of light curves of 64 low-redshift (z ? 0.05) stripped-envelope supernovae (SNe of Type IIb, Ib, Ic, and Ic-BL). These data were obtained between 2001 and 2009 at the Fred L. Whipple Observatory (FLWO) on Mount Hopkins in Arizona, with the optical FLWO 1.2 m and the near-infrared (NIR) Peters Automated Infrared 1.3 m telescopes. Our data set consists of 4543 optical photometric measurements on 61 SNe, including a combination of U BV RI, U BV r{sup ?}i{sup ?}, and u{sup ?} BV r{sup ?}i{sup ?}, and 1919 JHK{sub s} NIR measurements on 25 SNe. This sample constitutes the most extensive multi-color data set of stripped-envelope SNe to date. Our photometry is based on template-subtracted images to eliminate any potential host-galaxy light contamination. This work presents these photometric data, compares them with data in the literature, and estimates basic statistical quantities: date of maximum, color, and photometric properties. We identify promising color trends that may permit the identification of stripped-envelope SN subtypes from their photometry alone. Many of these SNe were observed spectroscopically by the Harvard-Smithsonian Center for Astrophysics (CfA) SN group, and the spectra are presented in a companion paper. A thorough exploration that combines the CfA photometry and spectroscopy of stripped-envelope core-collapse SNe will be presented in a follow-up paper.

  17. High-throughput behavioral phenotyping of drug and alcohol susceptibility traits in the expanded panel of BXD recombinant inbred strains

    SciTech Connect (OSTI)

    Philip, Vivek M [ORNL; Ansah, T [University of Tennessee Health Science Center, Memphis; Blaha, C, [University of Tennessee Health Science Center, Memphis; Cook, Melloni N. [University of Memphis; Hamre, Kristin M. [University of Tennessee Health Science Center, Memphis; Lariviere, William R [University of Pittsburgh; Matthews, Douglas B [Baylor University; Goldowitz, Daniel [University of British Columbia, Vancouver; Chesler, Elissa J [ORNL

    2010-01-01

    Genetic reference populations, particularly the BXD recombinant inbred strains, are a valuable resource for the discovery of the bio-molecular substrates and genetic drivers responsible for trait variation and co- ariation. This approach can be profitably applied in the analysis of susceptibility and mechanisms of drug and alcohol use disorders for which many predisposing behaviors may predict occurrence and manifestation of increased preference for these substances. Many of these traits are modeled by common mouse behavioral assays, facilitating the detection of patterns and sources of genetic co-regulation of predisposing phenotypes and substance consumption. Members of the Tennessee Mouse Genome Consortium have obtained behavioral phenotype data from 260 measures related to multiple behavioral assays across several domains: self-administration, response to, and withdrawal from cocaine, MDMA, morphine and alcohol; novelty seeking; behavioral despair and related neurological phenomena; pain sensitivity; stress sensitivity; anxiety; hyperactivity; and sleep/wake cycles. All traits have been measured in both sexes and the recently expanded panel of 69 additional BXD recombinant inbred strains (N=69). Sex differences and heritability estimates were obtained for each trait, and a comparison of early (N = 32) and recent BXD RI lines was performed. Primary data is publicly available for heritability, sex difference and genetic analyses using www.GeneNetwork.org. These analyses include QTL detection and genetic analysis of gene expression. Stored results from these analyses are available at http://ontologicaldiscovery.org for comparison to other genomic analysis results. Together with the results of related studies, these data form a public resource for integrative systems genetic analysis of neurobehavioral traits.

  18. Remedial Investigation/Feasibility Study Work Plan for the 200-UP-1 Groundwater Operable Unit, Hanford Site, Richland, Washington. Revision

    SciTech Connect (OSTI)

    Not Available

    1994-01-01

    This work plan identifies the objectives, tasks, and schedule for conducting a Remedial Investigation/Feasibility Study for the 200-UP-1 Groundwater Operable Unit in the southern portion of the 200 West Groundwater Aggregate Area of the Hanford Site. The 200-UP-1 Groundwater Operable Unit addresses contamination identified in the aquifer soils and groundwater within its boundary, as determined in the 200 West Groundwater Aggregate Area Management Study Report (AAMSR) (DOE/RL 1992b). The objectives of this work plan are to develop a program to investigate groundwater contaminants in the southern portion of the 200 West Groundwater Aggregate Area that were designated for Limited Field Investigations (LFIs) and to implement Interim Remedial Measures (IRMs) recommended in the 200 West Groundwater AAMSR. The purpose of an LFI is to evaluate high priority groundwater contaminants where existing data are insufficient to determine whether an IRM is warranted and collect sufficient data to justify and implement an IRM, if needed. A Qualitative Risk Assessment (QRA) will be performed as part of the LFI. The purpose of an IRM is to develop and implement activities, such as contaminant source removal and groundwater treatment, that will ameliorate some of the more severe potential risks of groundwater contaminants prior to the RI and baseline Risk Assessment (RA) to be conducted under the Final Remedy Selection (FRS) at a later date. This work plan addresses needs of a Treatability Study to support the design and implementation of an interim remedial action for the Uranium-{sup 99}{Tc}-Nitrate multi-contaminant IRM plume identified beneath U Plant.

  19. Site characterization summary report for dry weather surface water sampling upper East Fork Poplar Creek characterization area Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    NONE

    1996-08-01

    This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.

  20. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Field Sampling Plan

    SciTech Connect (OSTI)

    Benioff, P.; Biang, R.; Dolak, D.; Dunn, C.; Martino, L.; Patton, T.; Wang, Y.; Yuen, C.

    1995-03-01

    The Environmental Management Division (EMD) of Aberdeen Proving Ground (APG), Maryland, is conducting a remedial investigation and feasibility study (RI/FS) of the J-Field area at APG pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. J-Field is within the Edgewood Area of APG in Harford County, Maryland (Figure 1. 1). Since World War II activities in the Edgewood Area have included the development, manufacture, testing, and destruction of chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). Considerable archival information about J-Field exists as a result of efforts by APG staff to characterize the hazards associated with the site. Contamination of J-Field was first detected during an environmental survey of the Edgewood Area conducted in 1977 and 1978 by the US Army Toxic and Hazardous Materials Agency (USATHAMA) (predecessor to the US Army Environmental Center [AEC]). As part of a subsequent USATHAMA -environmental survey, 11 wells were installed and sampled at J-Field. Contamination at J-Field was also detected during a munitions disposal survey conducted by Princeton Aqua Science in 1983. The Princeton Aqua Science investigation involved the installation and sampling of nine wells and the collection and analysis of surficial and deep composite soil samples. In 1986, a Resource Conservation and Recovery Act (RCRA) permit (MD3-21-002-1355) requiring a basewide RCRA Facility Assessment (RFA) and a hydrogeologic assessment of J-Field was issued by the US Environmental Protection Agency (EPA). In 1987, the US Geological Survey (USGS) began a two-phased hydrogeologic assessment in data were collected to model, groundwater flow at J-Field. Soil gas investigations were conducted, several well clusters were installed, a groundwater flow model was developed, and groundwater and surface water monitoring programs were established that continue today.

  1. Site descriptions of environmental restoration units at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Kuhaida, A.J. Jr.; Parker, A.F.

    1997-02-01

    This report provides summary information on Oak Ridge National Laboratory (ORNL) Environmental Restoration (ER) sites as listed in the Oak Ridge Reservation Federal Facility Agreement (FFA), dated January 1, 1992, Appendix C. The Oak Ridge National Laboratory was built in 1943 as part of the World War II Manhattan Project. The original mission of ORNL was to produce and chemically separate the first gram-quantities of plutonium as part of the national effort to produce the atomic bomb. The current mission of ORNL is to provide applied research and development in support of the U.S. Department of Energy (DOE) programs in nuclear fusion and fission, energy conservation, fossil fuels, and other energy technologies and to perform basic scientific research in selected areas of the physical, life, and environmental sciences. ER is also tasked with clean up or mitigation of environmental impacts resulting from past waste management practices on portions of the approximately 37,000 acres within the Oak Ridge Reservation (ORR). Other installations located within the ORR are the Gaseous Diffusion Plant (K-25) and the Y-12 plant. The remedial action strategy currently integrates state and federal regulations for efficient compliance and approaches for both investigations and remediation efforts on a Waste Area Grouping (WAG) basis. As defined in the ORR FFA Quarterly Report July - September 1995, a WAG is a grouping of potentially contaminated sites based on drainage area and similar waste characteristics. These contaminated sites are further divided into four categories based on existing information concerning whether the data are generated for scoping or remedial investigation (RI) purposes. These areas are as follows: (1) Operable Units (OU); (2) Characterization Areas (CA); (3) Remedial Site Evaluation (RSE) Areas; and (4) Removal Site Evaluation (RmSE) Areas.

  2. Remedial investigation/feasibility study work plan for the 100-BC-2 operable unit, Hanford Site, Richland, Washington

    SciTech Connect (OSTI)

    Not Available

    1993-05-01

    This work plan and attached supporting project plans establish the operable unit setting and the objectives, procedures, tasks, and schedule for conducting the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) remedial investigation/feasibility study (RI/FS) for the 100-BC-2 operable unit in the 100 Area of the Hanford Site. The 100 Area is one of four areas at the Hanford Site that are on the US Environmental Protection Agency`s (EPA) National Priorities List under CERCLA. The 100-BC-2 operable unit is one of two source operable units in the 100-B/C Area (Figure ES-1). Source operable units are those that contain facilities and unplanned release sites that are potential sources of hazardous substance contamination. The 100-BC-2 source operable unit contains waste sites that were formerly in the 100-BC-2, 100-BC-3, and 100-BC-4 operable units. Because of their size and geographic location, the waste sites from these two operable units were added to 100-BC-2. This allows for a more efficient and effective investigation of the remaining 100-B/C Reactor area waste sites. The investigative approach to waste sites associated with the 100-BC-2 operable unit are listed in Table ES-1. The waste sites fall into three general categories: high priority liquid waste disposal sites, low priority liquid waste disposal sites, and solid waste burial grounds. Several sites have been identified as candidates for conducting an IRM. Two sites have been identified as warranting additional limited field sampling. The two sites are the 116-C-2A pluto crib, and the 116-C-2C sand filter.

  3. Tunneling splitting in double-proton transfer: Direct diagonalization results for porphycene

    SciTech Connect (OSTI)

    Smedarchina, Zorka; Siebrand, Willem; Fernndez-Ramos, Antonio

    2014-11-07

    Zero-point and excited level splittings due to double-proton tunneling are calculated for porphycene and the results are compared with experiment. The calculation makes use of a multidimensional imaginary-mode Hamiltonian, diagonalized directly by an effective reduction of its dimensionality. Porphycene has a complex potential energy surface with nine stationary configurations that allow a variety of tunneling paths, many of which include classically accessible regions. A symmetry-based approach is used to show that the zero-point level, although located above the cis minimum, corresponds to concerted tunneling along a direct trans ? trans path; a corresponding cis ? cis path is predicted at higher energy. This supports the conclusion of a previous paper [Z. Smedarchina, W. Siebrand, and A. Fernndez-Ramos, J. Chem. Phys. 127, 174513 (2007)] based on the instanton approach to a model Hamiltonian of correlated double-proton transfer. A multidimensional tunneling Hamiltonian is then generated, based on a double-minimum potential along the coordinate of concerted proton motion, which is newly evaluated at the RI-CC2/cc-pVTZ level of theory. To make it suitable for diagonalization, its dimensionality is reduced by treating fast weakly coupled modes in the adiabatic approximation. This results in a coordinate-dependent mass of tunneling, which is included in a unique Hermitian form into the kinetic energy operator. The reduced Hamiltonian contains three symmetric and one antisymmetric mode coupled to the tunneling mode and is diagonalized by a modified Jacobi-Davidson algorithm implemented in the Jadamilu software for sparse matrices. The results are in satisfactory agreement with the observed splitting of the zero-point level and several vibrational fundamentals after a partial reassignment, imposed by recently derived selection rules. They also agree well with instanton calculations based on the same Hamiltonian.

  4. A comparison of experimental and numerical results on convective thermal mixing of three vertical, quasi-planar jets

    SciTech Connect (OSTI)

    Tokuhiro, A.T.; Kimura, N.; Nishimura, M.; Kobayashi, J.; Miyakoshi, H.

    1999-07-01

    The thermal-hydraulic mixing of three quasi-planar vertical water jets was experimentally and numerically investigated. The central jet was initially 5 C lower in temperature than the other two. The hydraulic diameter and average exit velocity-based Reynolds and Richardson numbers were, Re{sub D} = 2 x 10{sup 4}, Ri{sub D} = 0.002. Besides temperature measurements from a traversing array of 37 thermocouples, velocity measurements were made using laser and ultrasound Doppler velocimetries (LDV and UDV). In parallel the in-house code, CASCADE, featuring a {kappa}-{epsilon} turbulence model was used to simulate the experimental flow configuration. A comparison of the experimental and numerical results showed that code validation by LDV/UDV was possible and in particular that time-averaged field and frequency characteristics of transversely swaying jets, even under Reynolds averaging of the conservation equations, could be simulated. A representative comparison of the amplitude of oscillation is shown in Figure A-1 with an inset of the visualized flow and sample time-series of the temperature fluctuations at the position indicated. The difference in the predominant frequency, the numerically predicted {approximately}1.6 Hz versus the experimental {approximately}2.25 Hz, is attributed to the turbulence model that overestimate thus effective fluid viscosity. Development of an accurate numerical simulation is of relevance to the design of the liquid metal fast breeder reactor (LMFBR), where the lack of mixing of the cold sodium may initiate thermal striping; that is, poorly mixed hot and cold streams may thermally stress the components onto which they impinge. Turbulent mixing of jets is equally of general interest to environmental and material processing flows.

  5. Remedial investigation/feasibility study of the Clinch River/Poplar Creek operable unit. Volume 1, main text

    SciTech Connect (OSTI)

    1996-03-01

    This document is the combined Remedial Investigation/Feasibility Study (RI/FS) Report for the Clinch River/Poplar Creek Operable Unit (CR/PC OU), an off-site OU associated with environmental restoration activities at the U.S. Department of Energy (DOE) Oak Ridge Reservation (ORR). As a result of past, present, and potential future releases of hazardous substances into the environment, the ORR was placed on the National Priorities List in December 1989 (54 FR 48184). Sites on this list must be investigated for possible remedial action, as required by the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA, 42 U.S.C. 9601, et seq.). This report documents the findings of the remedial investigation of this OU and the feasibility of potential remedial action alternatives. These studies are authorized by Sect. 117 of CERCLA and were conducted in accordance with the requirements of the National Contingency Plan (40 CFR Part 300). DOE, the U.S. Environmental Protection Agency (EPA), and the Tennessee Department of Environment and Conservation (TDEC) have entered into a Federal Facility Agreement (FFA), as authorized by Sect. 120 of CERCLA and Sects. 3008(h) and 6001 of the Resource Conservation and Recovery Act (RCRA) (42 U.S.C. 6901, et seq.). The purpose of this agreement is to ensure a coordinated and effective response for all environmental restoration activities occurring at the ORR. In addition to other responsibilities, the FFA parties mutually define the OU boundaries, set remediation priorities, establish remedial investigation priorities and strategies, and identify and select remedial actions. A copy of this FFA is available from the DOE Information Resource Center in Oak Ridge, Tennessee.

  6. A life-cycle model approach to multimedia waste reduction measuring performance for environmental cleanup projects

    SciTech Connect (OSTI)

    Phifer, B.E. Jr.; George, S.M.

    1993-07-01

    The Martin Marietta Energy Systems, Inc. (Energy Systems), Environmental Restoration (ER) Program adopted a Pollution Prevention Program in March 1991. The program`s mission is to minimize waste and prevent pollution in remedial investigations (RIs), feasibility studies, decontamination and decommissioning, and surveillance and maintenance site program activities. Mission success will result in volume and/or toxicity reduction of generated waste. The ER Program waste generation rates are projected to steadily increase through the year 2005 for all waste categories. Standard production units utilized to measure waste minimization apply to production/manufacturing facilities. Since ER inherited contaminated waste from previous production processes, no historical production data can be applied. Therefore, a more accurate measure for pollution prevention was identified as a need for the ER Program. The Energy Systems ER Program adopted a life-cycle model approach and implemented the concept of numerically scoring their waste generators to measure the effectiveness of pollution prevention/waste minimization programs and elected to develop a numerical scoring system (NSS) to accomplish these measurements. The prototype NSS, a computerized, user-friendly information management database system, was designed to be utilized in each phase of the ER Program. The NSS was designed to measure a generator`s success in incorporating pollution prevention in their work plans and reducing investigation-derived waste (IDW) during RIs. Energy Systems is producing a fully developed NSS and actually scoring the generators of IDW at six ER Program sites. Once RI waste generators are scored utilizing the NSS, the numerical scores are distributed into six performance categories: training, self-assessment, field implementation, documentation, technology transfer, and planning.

  7. INCREASED FLEXIBILITY OF TURBO-COMPRESSORS IN NATURAL GAS TRANSMISSION THROUGH DIRECT SURGE CONTROL

    SciTech Connect (OSTI)

    Robert J. McKee

    2003-05-01

    This preliminary phase 1 report summarizes the background and the work on the ''Increased Flexibility of Turbo-Compressors in Natural Gas Transmission through Direct Surge Control'' project to date. The importance of centrifugal compressors for natural gas transmission is discussed, and the causes of surge and the consequences of current surge control approaches are explained. Previous technology development, including findings from early GMRC research, previous surge detection work, and selected publications, are presented. The project is divided into three Phases to accomplish the project objectives of verifying near surge sensing, developing a prototype surge control system (sensor and controller), and testing/demonstrating the benefits of direct surge control. Specification for the direct surge control sensor and controller developed with guidance from the industry Oversight Committee is presented in detail. Results of CFD modeling conducted to aid in interpreting the laboratory test results are shown and explained. An analysis of the system dynamics identified the data sampling and handling requirements for direct surge control. A detailed design process for surge detection probes has been developed and explained in this report and has been used to prepare drag probes for the laboratory compressor test and the first field test. The surge detection probes prepared for testing have been bench tested and flow tested to determine and calibrate their sensitivity to flow forces as shown in data presented in this report. The surge detection drag probes have been shown to perform as expected and as required to detect approaching surge. Laboratory test results of surge detection in the SwRI centrifugal compressor demonstrated functionality of the surge detection probes and a change in the impeller inlet flow pattern prior to surge. Although the recirculation cannot be detected because of the specific geometry of this compressor, there are changes that indicate the approach of surge that can be detected. Preparations for a field test had been completed at one point in the project. However, a failure of the surge probe wiring just inside the compressor case has caused a delay in the field testing. Repairs for the wiring in the compressor have been scheduled and the field test will take place shortly after the repairs.

  8. TEXAS LPG FUEL CELL DEVELOPMENT AND DEMONSTRATION PROJECT Full-Text - Submission contains both citation data and full-text of the journal article. Full-text can be either a pre-print or post-print, but not the copyrighted article.

    SciTech Connect (OSTI)

    SOUTHWEST RESEARCH LABORATORY SUBMITTED BY SUBCONTRACTOR, RAILROAD COMMISSION OF TEXAS

    2004-07-26

    The State Energy Conservation Office has executed its first Fuel Cell Project which was awarded under a Department of Energy competitive grant process. The Texas LPG Fuel Processor Development and Fuel Cell Demonstration Program is a broad-based public/private partnership led by the Texas State Energy Conservation Office (SECO). Partners include the Alternative Fuels Research and Education Division (AFRED) of the Railroad Commission of Texas; Plug Power, Inc., Latham, NY, UOP/HyRadix, Des Plaines, IL; Southwest Research Institute (SwRI), San Antonio, TX; the Texas Natural Resource Conservation Commission (TNRCC), and the Texas Department of Transportation (TxDOT). The team proposes to mount a development and demonstration program to field-test and evaluate markets for HyRadix?s LPG fuel processor system integrated into Plug Power?s residential-scale GenSys? 5C (5 kW) PEM fuel cell system in a variety of building types and conditions of service. The program?s primary goal is to develop, test, and install a prototype propane-fueled residential fuel cell power system supplied by Plug Power and HyRadix in Texas. The propane industry is currently funding development of an optimized propane fuel processor by project partner UOP/HyRadix through its national checkoff program, the Propane Education and Research Council (PERC). Following integration and independent verification of performance by Southwest Research Institute, Plug Power and HyRadix will produce a production-ready prototype unit for use in a field demonstration. The demonstration unit produced during this task will be delivered and installed at the Texas Department of Transportation?s TransGuide headquarters in San Antonio, Texas. Simultaneously, the team will undertake a market study aimed at identifying and quantifying early-entry customers, technical and regulatory requirements, and other challenges and opportunities that need to be addressed in planning commercialization of the units. For further information please contact Mary-Jo Rowan at mary-jo.rowan@cpa.state.tx.us

  9. Status of an advanced radioisotope space power system using free-piston Stirling technology

    SciTech Connect (OSTI)

    White, M.A,; Qiu, S.; Erbeznik, R.M.; Olan, R.W.; Welty, S.C.

    1998-07-01

    This paper describes a free-piston Stirling engine technology project to demonstrate a high efficiency power system capable of being further developed for deep space missions using a radioisotope (RI) heat source. The key objective is to develop a power system with an efficiency exceeding 20% that can function with a high degree of reliability for 10 years or longer on deep space missions. Primary issues being addressed for Stirling space power systems are weight and the vibration associated with reciprocating pistons. Similar weight and vibration issues have been successfully addressed with Stirling cryocoolers, which are the accepted standard for cryogenic cooling in space. Integrated long-life Stirling engine-generator (or convertor) operation has been demonstrated by the terrestrial Radioisotope Stirling Generator (RSG) and other Stirling Technology Company (STC) programs. Extensive RSG endurance testing includes more than 40,000 maintenance-free, degradation-free hours for the complete convertor, in addition to several critical component and subsystem endurance tests. The Stirling space power convertor project is being conducted by STC under DOE Contract, and NASA SBIR Phase II contracts. The DOE contract objective is to demonstrate a two-convertor module that represents half of a nominal 150-W(e) power system. Each convertor is referred to as a Technology Demonstration Convertor (TDC). The ultimate Stirling power system would be fueled by three general purpose heat source (GPHS) modules, and is projected to produce substantially more electric power than the 150-watt target. The system is capable of full power output with one failed convertor. One NASA contract, nearing completion, uses existing 350-W(e) RG-350 convertors to evaluate interactivity of two back-to-back balanced convertors with various degrees of electrical and mechanical interaction. This effort has recently provided the first successful synchronization of two convertors by means of parallel alternator electrical connections, thereby reducing vibration levels by more than an order of magnitude. It will also demonstrate use of an artificial neural network to monitor system health without invasive instrumentation. The second NASA contract, begun in January 1998, will develop an active adaptive vibration reduction system to be integrated with the DOE-funded TDC convertors. Preliminary descriptions and specifications of the Stirling convertor design, as well as program status and plans, are included.

  10. Remedial Investigation Report on Chestnut Ridge Operable Unit 2 (Filled Coal Ash Pond/Upper McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Volume 1. Main Text

    SciTech Connect (OSTI)

    Not Available

    1994-08-01

    This document is a report on the remedial investigation (RI) of Chestnut Ridge Operable Unit (OU) 2 at the Oak Ridge Y-12 Plant. Chestnut Ridge OU 2 consists of Upper McCoy Branch (UMB), the Filled Coal Ash Pond (FCAP), and the area surrounding the Sluice Channel formerly associated with coal ash disposal in the FCAP. Chestnut Ridge OU 2 is located within the U.S. Department of Energy`s (DOE`s) Oak Ridge Reservation in Anderson County, Tennessee, approximately 24 miles west of Knoxville. The pond is an 8.5-acre area on the southern slope of Chestnut Ridge, 0.5 mile south of the main Y-12 Plant and geographically separated from the Y-12 Plant by Chestnut Ridge. The elevation of the FCAP is {approximately} 950 ft above mean sea level (msl), and it is relatively flat and largely vegetated. Two small ponds are usually present at the northeast and northwest comers of the FCAP. The Sluice Channel Area extends {approximately}1000 ft from the northern margin of the FCAP to the crest of Chestnut Ridge, which has an elevation of {approximately}1100 ft above msl. The Sluice Channel Area is largely vegetated also. McCoy Branch runs from the top of Chestnut Ridge across the FCAP into Rogers Quarry and out of the quarry where it runs a short distance into Milton Hill Lake at McCoy Embayment, termed UMB. The portion south of Rogers Quarry, within Chestnut Ridge OU 4, is termed Lower McCoy Branch. The DOE Oak Ridge Y-12 Plant disposed of coal ash from its steam plant operations as a slurry that was discharged into an ash retention impoundment; this impoundment is the FCAP. The FCAP was built in 1955 to serve as a settling basin after coal ash slurried over Chestnut Ridge from the Y-12 Plant. The FCAP was constructed by building an earthen dam across the northern tributary of McCoy Branch. The dam was designed to hold 20 years of Y-12 steam plant ash. By July 1967, ash had filled up the impoundment storage behind the dam to within 4 ft of the top.

  11. EPRI/NRC-RES fire human reliability analysis guidelines.

    SciTech Connect (OSTI)

    Lewis, Stuart R.; Cooper, Susan E.; Najafi, Bijan; Collins, Erin; Hannaman, Bill; Kohlhepp, Kaydee; Grobbelaar, Jan; Hill, Kendra; Hendrickson, Stacey M. Langfitt; Forester, John Alan; Julius, Jeff

    2010-03-01

    During the 1990s, the Electric Power Research Institute (EPRI) developed methods for fire risk analysis to support its utility members in the preparation of responses to Generic Letter 88-20, Supplement 4, 'Individual Plant Examination - External Events' (IPEEE). This effort produced a Fire Risk Assessment methodology for operations at power that was used by the majority of U.S. nuclear power plants (NPPs) in support of the IPEEE program and several NPPs overseas. Although these methods were acceptable for accomplishing the objectives of the IPEEE, EPRI and the U.S. Nuclear Regulatory Commission (NRC) recognized that they required upgrades to support current requirements for risk-informed, performance-based (RI/PB) applications. In 2001, EPRI and the USNRC's Office of Nuclear Regulatory Research (RES) embarked on a cooperative project to improve the state-of-the-art in fire risk assessment to support a new risk-informed environment in fire protection. This project produced a consensus document, NUREG/CR-6850 (EPRI 1011989), entitled 'Fire PRA Methodology for Nuclear Power Facilities' which addressed fire risk for at power operations. NUREG/CR-6850 developed high level guidance on the process for identification and inclusion of human failure events (HFEs) into the fire PRA (FPRA), and a methodology for assigning quantitative screening values to these HFEs. It outlined the initial considerations of performance shaping factors (PSFs) and related fire effects that may need to be addressed in developing best-estimate human error probabilities (HEPs). However, NUREG/CR-6850 did not describe a methodology to develop best-estimate HEPs given the PSFs and the fire-related effects. In 2007, EPRI and RES embarked on another cooperative project to develop explicit guidance for estimating HEPs for human failure events under fire generated conditions, building upon existing human reliability analysis (HRA) methods. This document provides a methodology and guidance for conducting a fire HRA. This process includes identification and definition of post-fire human failure events, qualitative analysis, quantification, recovery, dependency, and uncertainty. This document provides three approaches to quantification: screening, scoping, and detailed HRA. Screening is based on the guidance in NUREG/CR-6850, with some additional guidance for scenarios with long time windows. Scoping is a new approach to quantification developed specifically to support the iterative nature of fire PRA quantification. Scoping is intended to provide less conservative HEPs than screening, but requires fewer resources than a detailed HRA analysis. For detailed HRA quantification, guidance has been developed on how to apply existing methods to assess post-fire fire HEPs.

  12. PROCEEDINGS OF THE RIKEN BNL RESEARCH CENTER WORKSHOP ON LARGE SCALE COMPUTATIONS IN NUCLEAR PHYSICS USING THE QCDOC, SEPTEMBER 26 - 28, 2002.

    SciTech Connect (OSTI)

    AOKI,Y.; BALTZ,A.; CREUTZ,M.; GYULASSY,M.; OHTA,S.

    2002-09-26

    The massively parallel computer QCDOC (QCD On a Chip) of the RIKEN BNL Research Center (RI3RC) will provide ten-teraflop peak performance for lattice gauge calculations. Lattice groups from both Columbia University and RBRC, along with assistance from IBM, jointly handled the design of the QCDOC. RIKEN has provided $5 million in funding to complete the machine in 2003. Some fraction of this computer (perhaps as much as 10%) might be made available for large-scale computations in areas of theoretical nuclear physics other than lattice gauge theory. The purpose of this workshop was to investigate the feasibility and possibility of using a supercomputer such as the QCDOC for lattice, general nuclear theory, and other calculations. The lattice applications to nuclear physics that can be investigated with the QCDOC are varied: for example, the light hadron spectrum, finite temperature QCD, and kaon ({Delta}I = 1/2 and CP violation), and nucleon (the structure of the proton) matrix elements, to name a few. There are also other topics in theoretical nuclear physics that are currently limited by computer resources. Among these are ab initio calculations of nuclear structure for light nuclei (e.g. up to {approx}A = 8 nuclei), nuclear shell model calculations, nuclear hydrodynamics, heavy ion cascade and other transport calculations for RHIC, and nuclear astrophysics topics such as exploding supernovae. The physics topics were quite varied, ranging from simulations of stellar collapse by Douglas Swesty to detailed shell model calculations by David Dean, Takaharu Otsuka, and Noritaka Shimizu. Going outside traditional nuclear physics, James Davenport discussed molecular dynamics simulations and Shailesh Chandrasekharan presented a class of algorithms for simulating a wide variety of femionic problems. Four speakers addressed various aspects of theory and computational modeling for relativistic heavy ion reactions at RHIC. Scott Pratt and Steffen Bass gave general overviews of how qualitatively different types of physical processes evolve temporally in heavy ion reactions. Denes Molnar concentrated on the application of hydrodynamics, and Alex Krasnitz on a classical Yang-Mills field theory for the initial phase. We were pleasantly surprised by the excellence of the talks and the substantial interest from all parties. The diversity of the audience forced the speakers to give their talks at an understandable level, which was highly appreciated. One particular bonus of the discussions could be the application of highly developed three-dimensional astrophysics hydrodynamics codes to heavy ion reactions.

  13. REALTIME MONITORING OF PIPELINES FOR THIRD-PARTY CONTACT

    SciTech Connect (OSTI)

    Gary L. Burkhardt

    2005-12-31

    Third-party contact with pipelines (typically caused by contact with a digging or drilling device) can result in mechanical damage to the pipe, in addition to coating damage that can initiate corrosion. Because this type of damage often goes unreported and can lead to eventual catastrophic failure of the pipe, a reliable, cost-effective method is needed for monitoring the pipeline and reporting third-party contact events. The impressed alternating cycle current (IACC) pipeline monitoring method developed by Southwest Research Institute (SwRI) consists of impressing electrical signals on the pipe by generating a time-varying voltage between the pipe and the soil. The signal voltage between the pipe and ground is monitored continuously at receiving stations located some distance away. Third-party contact to the pipe that breaks through the coating (thus resulting in a signal path to ground) changes the signal received at the receiving stations. The IACC method was shown to be a viable method that can be used to continuously monitor pipelines for third-party contact. Electrical connections to the pipeline can be made through existing cathodic protection (CP) test points without the need to dig up the pipe. The instrumentation is relatively simple, consisting of (1) a transmitting station with a frequency-stable oscillator and amplifier and (2) a receiving station with a filter, lock-in amplifier, frequency-stable oscillator, and remote reporting device (e.g. cell phone system). Maximum distances between the transmitting and receiving stations are approximately 1.61 km (1 mile), although the length of pipeline monitored can be twice this using a single transmitter and one receiver on each side (since the signal travels in both directions). Certain conditions such as poor pipeline coatings or strong induced 60-Hz signals on the pipeline can degrade IACC performance, so localized testing should be performed to determine the suitability for an IACC installation at a given location. The method can be used with pipelines having active CP systems in place without causing interference with operation of the CP system. The most appropriate use of IACC is monitoring of localized high-consequence areas where there is a significant risk of third-party contact (e.g. construction activity). The method also lends itself to temporary, low-cost installation where there is a short-term need for monitoring.

  14. Nuclear Data Sheets for A = 84

    SciTech Connect (OSTI)

    Abriola, Daniel; Bostan, Melih; Erturk, Sefa; Fadil, Manssour; Galan, Monica; Juutinen, Sakari; Kibedi, Tibor; Kondev, Filip; Luca, Aurelian; Negret, Alexandru; Nica, Ninel; Pfeiffer, Bernd; Singh, Balraj; Sonzogni, Alejandro; Timar, Janos; Tuli, Jagdish; Venkova, Tsanka; Zuber, Kazimierz

    2009-11-15

    The evaluated spectroscopic data are presented for 12 known nuclides of mass 84 (Ga, Ge, As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo). Except for the stable nuclides {sup 84}Sr and {sup 84}Kr, extensive new data are available for all the other nuclides since the 1997 evaluation by J.K. Tuli (1997Tu02) of A = 84 nuclides. Many precise Penning-trap mass measurements since AME-2003 for A = 84 nuclides (2009Re03,2008Ha23,2008We10,2007Ke09,2006Ka48,2006De36,2006Ri15) have resulted in improved Q values and separation energies. However, many deficiencies still remain. Some examples are given below. Excited-state data for {sup 84}Ga and {sup 84}As are nonexistent, and those for {sup 84}Ge are scarce. The radioactive decay schemes of {sup 84}Ga, {sup 84}Ge, {sup 84}Se, {sup 84}Y (39.5 min), {sup 84}Y (4.6 s), {sup 84}Zr and {sup 84}Nb suffer from incompleteness and that for {sup 84}Mo decay is not known at all. The energy ordering of the two activities (39.5 min and and 4.6 s) of {sup 84}Y is not well established, although, high-spin with tentative spin-parity of (6+) is adopted here as the ground state of {sup 84}Y based on weak arguments. From a conference report published in 2000, it is clear that extensive experiments were done to investigate decays of {sup 84}Zr and {sup 84}Y, but details of these studies never appeared in literature and none were made available to the evaluators when requested from original authors. This evaluation was carried out as part of ENSDF workshop for Nuclear Structure and Decay Data Evaluators, organized and hosted by the 'Horia Hulubei' National Institute for Physics and Nuclear Engineering, Bucharest, Romania during March 30, 2009 - April 3, 2009. Names of the evaluators principally responsible for evaluation of individual nuclides are given under the respective Adopted data sets.

  15. Nuclear data sheets for A=84.

    SciTech Connect (OSTI)

    Abriola, D.; Bostan, M.; Erturk, S.; Fadil, M.; Galan, M; Juutinen, S.; Luca, A.; Negret, A.; Nica, N.; Pfeiffer, B.; Singh, B.; Sonzogni, A.; Timar, J.; Tuli, J.; Venkova, T.; Zuber, K.; Kondev, F.; Nuclear Engineering Division; IAEA, Austria; Istanbul Univ.; Nigde Univ.; GANIL, France; CIEMAT, Spain; Univ. Jyvaskyla; ANU, Austrialia; IFIN-HH, Romania; Texas A&M; GSI, Germany; McMaster,Canada; NNDC; ATOMKI, Hungary; INRNE, Bulgaria; IFJ-PAN, Poland

    2009-01-01

    The evaluated spectroscopic data are presented for 12 known nuclides of mass 84 (Ga, Ge, As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo). Except for the stable nuclides {sup 84}Sr and {sup 84}Kr, extensive new data are available for all the other nuclides since the 1997 evaluation by J.K. Tuli (1997Tu02) of A = 84 nuclides. Many precise Penning-trap mass measurements since AME-2003 for A = 84 nuclides (2009Re03,2008Ha23,2008We10,2007Ke09,2006Ka48,2006De36,2006Ri15) have resulted in improved Q values and separation energies. However, many deficiencies still remain. Some examples are given below. Excited-state data for {sup 84}Ga and {sup 84}As are nonexistent, and those for {sup 84}Ge are scarce. The radioactive decay schemes of {sup 84}Ga, {sup 84}Ge, {sup 84}Se, {sup 84}Y (39.5 min), {sup 84}Y (4.6 s), {sup 84}Zr and {sup 84}Nb suffer from incompleteness and that for {sup 84}Mo decay is not known at all. The energy ordering of the two activities (39.5 min and 4.6 s) of {sup 84}Y is not well established, although, high-spin with tentative spin-parity of (6+) is adopted here as the ground state of {sup 84}Y based on weak arguments. From a conference report published in 2000, it is clear that extensive experiments were done to investigate decays of {sup 84}Zr and {sup 84}Y, but details of these studies never appeared in literature and none were made available to the evaluators when requested from original authors. This evaluation was carried out as part of ENSDF workshop for Nuclear Structure and Decay Data Evaluators, organized and hosted by the 'Horia Hulubei' National Institute for Physics and Nuclear Engineering, Bucharest, Romania during March 30, 2009 - April 3, 2009. Names of the evaluators principally responsible for evaluation of individual nuclides are given under the respective Adopted data sets.

  16. Nuclear Data Sheets A = 84

    SciTech Connect (OSTI)

    Abriola, D.; Sonzogni, A.; Bostan,M. Erturk,S.; Fadi,M.; Galan,M.; Juutinen,S.; Kibed,T.; Kondev,F.; Luca,A.; Negret,A.; Nica,N.; Pfeiffer,B.; Singh.B.; Sonzogni,A.; Timar,J.; Tuli,J.; Venkova,T.; Zuber,K.

    2009-11-01

    The evaluated spectroscopic data are presented for 12 known nuclides of mass 84 (Ga, Ge, As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo). Except for the stable nuclides {sup 84}Sr and {sup 84}Kr, extensive new data are available for all the other nuclides since the 1997 evaluation by J.K. Tuli (1997Tu02) of A = 84 nuclides. Many precise Penning-trap mass measurements since AME-2003 for A = 84 nuclides (2009Re03,2008Ha23,2008We10,2007Ke09,2006Ka48,2006De36,2006Ri15) have resulted in improved Q values and separation energies. However, many deficiencies still remain. Some examples are given below. Excited-state data for {sup 84}Ga and {sup 84}As are nonexistent, and those for {sup 84}Ge are scarce. The radioactive decay schemes of {sup 84}Ga, {sup 84}Ge, {sup 84}Se, {sup 84}Y (39.5 min), {sup 84}Y (4.6 s), {sup 84}Zr and {sup 84}Nb suffer from incompleteness and that for {sup 84}Mo decay is not known at all. The energy ordering of the two activities (39.5 min and and 4.6 s) of {sup 84}Y is not well established, although, high-spin with tentative spin-parity of (6+) is adopted here as the ground state of {sup 84}Y based on weak arguments. From a conference report published in 2000, it is clear that extensive experiments were done to investigate decays of {sup 84}Zr and {sup 84}Y, but details of these studies never appeared in literature and none were made available to the evaluators when requested from original authors. This evaluation was carried out as part of ENSDF workshop for Nuclear Structure and Decay Data Evaluators, organized and hosted by the 'Horia Hulubei' National Institute for Physics and Nuclear Engineering, Bucharest, Romania during March 30, 2009 - April 3, 2009. Names of the evaluators principally responsible for evaluation of individual nuclides are given under the respective Adopted data sets.

  17. Determination of the origin of elevated uranium at a Former Air Force Landfill using non-parametric statistics analysis and uranium isotope ratio analysis

    SciTech Connect (OSTI)

    Weismann, J.; Young, C.; Masciulli, S.; Caputo, D.

    2007-07-01

    Lowry Air Force Base (Lowry) was closed in September 1994 as part of the Base Realignment and Closure (BRAC) program and the base was transferred to the Lowry Redevelopment Authority in 1995. As part of the due diligence activities conducted by the Air Force, a series of remedial investigations were conducted across the base. A closed waste landfill, designated Operable Unit 2 (OU 2), was initially assessed in a 1990 Remedial Investigation (RI; [1]). A Supplemental Remedial Investigation was conducted in 1995 [2] and additional studies were conducted in a 1998 Focused Feasibility Study. [3] The three studies indicated that gross alpha, gross beta, and uranium concentrations were consistently above regulatory standards and that there were detections of low concentrations other radionuclides. Results from previous investigations at OU 2 have shown elevated gross alpha, gross beta, and uranium concentrations in groundwater, surface water, and sediments. The US Air Force has sought to understand the provenance of these radionuclides in order to determine if they could be due to leachates from buried radioactive materials within the landfill or whether they are naturally-occurring. The Air Force and regulators agreed to use a one-year monitoring and sampling program to seek to explain the origins of the radionuclides. Over the course of the one-year program, dissolved uranium levels greater than the 30 {mu}g/L Maximum Contaminant Level (MCL) were consistently found in both up-gradient and down-gradient wells at OU 2. Elevated Gross Alpha and Gross Beta measurements that were observed during prior investigations and confirmed during the LTM were found to correlate with high dissolved uranium content in groundwater. If Gross Alpha values are corrected to exclude uranium and radon contributions in accordance with US EPA guidance, then the 15 pCi/L gross alpha level is not exceeded. The large dataset also allowed development of gross alpha to total uranium correlation factors so that gross alpha action levels can be applied to future long-term landfill monitoring to track radiological conditions at lower cost. Ratios of isotopic uranium results were calculated to test whether the elevated uranium displayed signatures indicative of military use. Results of all ratio testing strongly supports the conclusion that the uranium found in groundwater, surface water, and sediment at OU 2 is naturally-occurring and has not undergone anthropogenic enrichment or processing. U-234:U-238 ratios also show that a disequilibrium state, i.e., ratio greater than 1, exists throughout OU 2 which is indicative of long-term aqueous transport in aged aquifers. These results all support the conclusion that the elevated uranium observed at OU 2 is due to the high concentrations in the regional watershed. Based on the results of this monitoring program, we concluded that the elevated uranium concentrations measured in OU 2 groundwater, surface water, and sediment are due to the naturally-occurring uranium content of the regional watershed and are not the result of waste burials in the former landfill. Several lines of evidence indicate that natural uranium has been naturally concentrated beneath OU 2 in the geologic past and the higher of uranium concentrations in down-gradient wells is the result of geochemical processes and not the result of a uranium ore disposal. These results therefore provide the data necessary to support radiological closure of OU 2. (authors)

  18. Standardized Testing Program for Solid-State Hydrogen Storage Technologies

    SciTech Connect (OSTI)

    Miller, Michael A.; Page, Richard A.

    2012-07-30

    In the US and abroad, major research and development initiatives toward establishing a hydrogen-based transportation infrastructure have been undertaken, encompassing key technological challenges in hydrogen production and delivery, fuel cells, and hydrogen storage. However, the principal obstacle to the implementation of a safe, low-pressure hydrogen fueling system for fuel-cell powered vehicles remains storage under conditions of near-ambient temperature and moderate pressure. The choices for viable hydrogen storage systems at the present time are limited to compressed gas storage tanks, cryogenic liquid hydrogen storage tanks, chemical hydrogen storage, and hydrogen absorbed or adsorbed in a solid-state material (a.k.a. solid-state storage). Solid-state hydrogen storage may offer overriding benefits in terms of storage capacity, kinetics and, most importantly, safety.The fervor among the research community to develop novel storage materials had, in many instances, the unfortunate consequence of making erroneous, if not wild, claims on the reported storage capacities achievable in such materials, to the extent that the potential viability of emerging materials was difficult to assess. This problem led to a widespread need to establish a capability to accurately and independently assess the storage behavior of a wide array of different classes of solid-state storage materials, employing qualified methods, thus allowing development efforts to focus on those materials that showed the most promise. However, standard guidelines, dedicated facilities, or certification programs specifically aimed at testing and assessing the performance, safety, and life cycle of these emergent materials had not been established. To address the stated need, the Testing Laboratory for Solid-State Hydrogen Storage Technologies was commissioned as a national-level focal point for evaluating new materials emerging from the designated Materials Centers of Excellence (MCoE) according to established and qualified standards. Working with industry, academia, and the U.S. government, SwRI set out to develop an accepted set of evaluation standards and analytical methodologies. Critical measurements of hydrogen sorption properties in the Laboratory have been based on three analytical capabilities: 1) a high-pressure Sievert-type volumetric analyzer, modified to improve low-temperature isothermal analyses of physisorption materials and permit in situ mass spectroscopic analysis of the sample’s gas space; 2) a static, high-pressure thermogravimetric analyzer employing an advanced magnetic suspension electro-balance, glove-box containment, and capillary interface for in situ mass spectroscopic analysis of the sample’s gas space; and 3) a Laser-induced Thermal Desorption Mass Spectrometer (LTDMS) system for high thermal-resolution desorption and mechanistic analyses. The Laboratory has played an important role in down-selecting materials and systems that have emerged from the MCoEs.

  19. Argonne Liquid-Metal Advanced Burner Reactor : components and in-vessel system thermal-hydraulic research and testing experience - pathway forward.

    SciTech Connect (OSTI)

    Kasza, K.; Grandy, C.; Chang, Y.; Khalil, H.; Nuclear Engineering Division

    2007-06-30

    This white paper provides an overview and status report of the thermal-hydraulic nuclear research and development, both experimental and computational, conducted predominantly at Argonne National Laboratory. Argonne from the early 1970s through the early 1990s was the Department of Energy's (DOE's) lead lab for thermal-hydraulic development of Liquid Metal Reactors (LMRs). During the 1970s and into the mid-1980s, Argonne conducted thermal-hydraulic studies and experiments on individual reactor components supporting the Experimental Breeder Reactor-II (EBR-II), Fast Flux Test Facility (FFTF), and the Clinch River Breeder Reactor (CRBR). From the mid-1980s and into the early 1990s, Argonne conducted studies on phenomena related to forced- and natural-convection thermal buoyancy in complete in-vessel models of the General Electric (GE) Prototype Reactor Inherently Safe Module (PRISM) and Rockwell International (RI) Sodium Advanced Fast Reactor (SAFR). These two reactor initiatives involved Argonne working closely with U.S. industry and DOE. This paper describes the very important impact of thermal hydraulics dominated by thermal buoyancy forces on reactor global operation and on the behavior/performance of individual components during postulated off-normal accident events with low flow. Utilizing Argonne's LMR expertise and design knowledge is vital to the further development of safe, reliable, and high-performance LMRs. Argonne believes there remains an important need for continued research and development on thermal-hydraulic design in support of DOE's and the international community's renewed thrust for developing and demonstrating the Global Nuclear Energy Partnership (GNEP) reactor(s) and the associated Argonne Liquid Metal-Advanced Burner Reactor (LM-ABR). This white paper highlights that further understanding is needed regarding reactor design under coolant low-flow events. These safety-related events are associated with the transition from normal high-flow operation to natural circulation. Low-flow coolant events are the most difficult to design for because they involve the most complex thermal-hydraulic behavior induced by the dominance of thermal-buoyancy forces acting on the coolants. Such behavior can cause multiple-component flow interaction phenomena, which are not adequately understood or appreciated by reactor designers as to their impact on reactor performance and safety. Since the early 1990s, when DOE canceled the U.S. Liquid Metal Fast Breeder Reactor (LMFBR) program, little has been done experimentally to further understand the importance of the complex thermal-buoyancy phenomena and their impact on reactor design or to improve the ability of three-dimensional (3-D) transient computational fluid dynamics (CFD) and structures codes to model the phenomena. An improved experimental data base and the associated improved validated codes would provide needed design tools to the reactor community. The improved codes would also facilitate scale-up from small-scale testing to prototype size and would facilitate comparing performance of one reactor/component design with another. The codes would also have relevance to the design and safety of water-cooled reactors. To accomplish the preceding, it is proposed to establish a national GNEP-LMR research and development center at Argonne having as its foundation state-of-art science-based infrastructure consisting of: (a) thermal-hydraulic experimental capabilities for conducting both water and sodium testing of individual reactor components and complete reactor in-vessel models and (b) a computational modeling development and validation capability that is strongly interfaced with the experimental facilities. The proposed center would greatly advance capabilities for reactor development by establishing the validity of high-fidelity (i.e., close to first principles) models and tools. Such tools could be used directly for reactor design or for qualifying/tuning of lower-fidelity models, which now require costly experimental qualification for each different type of design

  20. F-AREA PUMP TANK 1 MIXING ANALYSIS

    SciTech Connect (OSTI)

    Tamburello, D; Richard Dimenna, R; Si Lee, S

    2008-11-05

    The F-area pump tanks are used to transfer supernate, sludge, and other materials. In any transfer, the solution must stay well mixed without allowing particulate matter to settle out of the liquid and, thus, accumulate in the bottom of the pump tank. Recently, the pulse jet mixing in F-area Pump Tank 1 (FPT1) has been decommissioned. An analysis of the liquid transfer through FPT1 has been performed using computational fluid dynamics (CFD) methods to assess whether or not the velocities throughout the tank will remain high enough to keep all particulate suspended using only transfer and recirculation pumps. The following paragraph is an abbreviated synopsis of the transfer procedure for FPT1 [1, 2]. Prior to a transfer, FPT1 begins to be filled with inhibited water through the inlet transfer line (TI). When the tank liquid level reaches 52.5 inches above the absolute tank bottom, the recirculation pump (RI and RO) is activated. At a tank liquid level of 72.5 inches above the absolute tank bottom, the outlet transfer line (TO) is activated to reduce the liquid level in FPT1 and transfer inhibited water to H-area Pump Tank 7 (HPT7). The liquid level is reduced down to 39.5 inches, with an allowable range from 37.5 to 41.5 inches above the absolute tank bottom. HPT7 goes through a similar procedure as FPT1 until both have tank liquid levels of approximately 39.5 inches above the absolute tank bottom. The transfer of inhibited water continues until a steady-state has been reached in both pump tanks. At this point, the supernate/sludge transfer begins with a minimum flow rate of 70 gpm and an average flow rate of 150 gpm. After the transfer is complete, the pump tanks (both FPT1 and HPT7) are pumped down to between 20.5 and 22.5 inches (above absolute bottom) and then flushed with 25,000 gallons of inhibited water to remove any possible sludge heal. After the flushing, the pump tanks are emptied. Note that the tank liquid level is measured using diptubes. Figure 2.1 provides a simplified sketch (not to scale) of FPT1 during the steady-state transfer condition, which consists of two inlet flows that impact the liquid surface as plunging jets and two outlet flows drawn from near the bottom of the tank. During the transfer, the supernate level is held at 39.5 inches above the absolute bottom of the tank [1, 2]. In addition, the FPT1 can contain up to 16.7 wt.% sludge particles within the supernate for a given transfer [2]. Test results from Tank 40 sludge Batch 3 [3] provide a typical range of particulate diameters between 0.1 and 25 {micro}m, with approximately 20 vol.% of the sludge distribution consisting of particles less than 1 {micro}m in diameter. The purpose of this analysis is to estimate FPT1 flow field during the steady-state transfer conditions to ensure that the tank remains mixed and that the velocities throughout the tank are sufficient to keep all sludge particulate suspended.

  1. Extending molecular simulation time scales: Parallel in time integrations for high-level quantum chemistry and complex force representations

    SciTech Connect (OSTI)

    Bylaska, Eric J.; Weare, Jonathan Q.; Weare, John H.

    2013-08-21

    Parallel in time simulation algorithms are presented and applied to conventional molecular dynamics (MD) and ab initio molecular dynamics (AIMD) models of realistic complexity. Assuming that a forward time integrator, f , (e.g. Verlet algorithm) is available to propagate the system from time ti (trajectory positions and velocities xi = (ri; vi)) to time ti+1 (xi+1) by xi+1 = fi(xi), the dynamics problem spanning an interval from t0 : : : tM can be transformed into a root finding problem, F(X) = [xi - f (x(i-1)]i=1;M = 0, for the trajectory variables. The root finding problem is solved using a variety of optimization techniques, including quasi-Newton and preconditioned quasi-Newton optimization schemes that are all unconditionally convergent. The algorithms are parallelized by assigning a processor to each time-step entry in the columns of F(X). The relation of this approach to other recently proposed parallel in time methods is discussed and the effectiveness of various approaches to solving the root finding problem are tested. We demonstrate that more efficient dynamical models based on simplified interactions or coarsening time-steps provide preconditioners for the root finding problem. However, for MD and AIMD simulations such preconditioners are not required to obtain reasonable convergence and their cost must be considered in the performance of the algorithm. The parallel in time algorithms developed are tested by applying them to MD and AIMD simulations of size and complexity similar to those encountered in present day applications. These include a 1000 Si atom MD simulation using Stillinger-Weber potentials, and a HCl+4H2O AIMD simulation at the MP2 level. The maximum speedup obtained by parallelizing the Stillinger-Weber MD simulation was nearly 3.0. For the AIMD MP2 simulations the algorithms achieved speedups of up to 14.3. The parallel in time algorithms can be implemented in a distributed computing environment using very slow TCP/IP networks. Scripts written in Python that make calls to a precompiled quantum chemistry package (NWChem) are demonstrated to provide an actual speedup of 8.2 for a 2.5 ps AIMD simulation of HCl+4H2O at the MP2/6-31G* level. Implemented in this way these algorithms can be used for long time high-level AIMD simulations at a modest cost using machines connected by very slow networks such as WiFi, or in different time zones connected by the Internet. The algorithms can also be used with programs that are already parallel. By using these algorithms we are able to reduce the cost of a MP2/6-311++G(2d,2p) simulation that had reached its maximum possible speedup in the parallelization of the electronic structure calculation from 32 seconds per time step to 6.9 seconds per time step.

  2. A Study Plan for Determining Recharge Rates at the Hanford Site Using Environmental Tracers

    SciTech Connect (OSTI)

    Murphy,, E. M.; Szecsody,, J. E.; Phillips,, S. J.

    1991-02-01

    This report presents a study plan tor estimating recharge at the Hanford Site using environmental tracers. Past operations at the Hanford Site have led to both soil and groundwater contamination, and recharge is one of the primary mechanisms for transporting contaminants through the vadose zone and into the groundwater. The prediction of contaminant movement or transport is one aspect of performance assessment and an important step in the remedial investigation/feasibility study (RI/FS) process. In the past, recharge has been characterized by collecting lysimeter data. Although lysimeters can generate important and reliable data, their limitations include 1) fixed location, 2) fixed sediment contents, 3) edge effects, 4) low rates, and 5) relatively short duration of measurement. These limitations impact the ability to characterize the spatial distribution of recharge at the Hanford Site, and thus the ability to predict contaminant movement in the vadose zone. An alternative to using fixed lysimeters for determining recharge rates in the vadose zone is to use environmental tracers. Tracers that have been used to study water movement in the vadose zone include total chloride, {sup 36}CI, {sup 3}H, and {sup 2}H/{sup 18}O. Atmospheric levels of {sup 36}CI and {sup 3}H increased during nuclear bomb testing in the Pacific, and the resulting "bomb pulse" or peak concentration can be measured in the soil profile. Locally, past operations at the Hanford Site have resu~ed in the atmospheric release of numerous chemical and isotopic tracers, including nitrate, {sup 129}I, and {sup 99}Tc. The radionuclides, in particular, reached a well-defined atmospheric peak in 1945. Atmospheric releases of {sup 129}I and {sup 99}Tc were greatly reduced by mid-1946, but nitrogen oxides continued to be released from the uranium separations facilities. As a result, the nitrate concentrations probably peaked in the mid-1950s, when the greatest number of separations facilities were operating. Seven study sites on the Hanford Site have been selected, in two primary soil types that are believed to represent the extremes in recharge, the Quincy sand and the Warden silt loam. An additional background study site upwind of the Hanford facilities has been chosen at the Yakima Firing Center. Study sites at Hanford were chosen close to micrometeorology stations on downwind transects from the operational facilities. Initial testing will be done on sites that lack perennial vegetation. Six tracer techniques (total chlortde, {sup 36}Cl, {sup 3}H, nitrate, {sup 129}I, and {sup 99}Tc) will be tested on at least one site in the Quincy sand, one site in the Warden si~ loam, and the background site, to determine which combination of tracers wortks best for a given soil type. In subsequent years, additional sites will be investigated to determine the effect of vegetation on recharge estimates and on the performance of individual tracers. The use of environmental tracers is perhaps the only cost-effective method for estimating the spatial vartability of recharge at a site as large as Hanford. The tracer techniques used at Hanford have wide applicability at other and sites operated by the U.S. Department of Energy as well as at low-level radioactive waste disposal sites.

  3. TECHNICAL EVALUATION OF SOIL REMEDIATION ALTERNATIVES AT THE BUILDING 812 OPERABLE UNIT, LAWRENCE LIVERMORE NATIONAL LABORATORY SITE 300

    SciTech Connect (OSTI)

    Eddy-Dilek, C.; Miles, D.; Abitz, R.

    2009-08-14

    The Department of Energy Livermore Site Office requested a technical review of remedial alternatives proposed for the Building 812 Operable Unit, Site 300 at the Lawrence Livermore National Laboratory. The team visited the site and reviewed the alternatives proposed for soil remediation in the draft RI/FS and made the following observations and recommendations. Based on the current information available for the site, the team did not identify a single technology that would be cost effective and/or ecologically sound to remediate DU contamination at Building 812 to current remedial goals. Soil washing is not a viable alternative and should not be considered at the site unless final remediation levels can be negotiated to significantly higher levels. This recommendation is based on the results of soil washing treatability studies at Fernald and Ashtabula that suggest that the technology would only be effective to address final remediation levels higher than 50 pCi/g. The technical review team identified four areas of technical uncertainty that should be resolved before the final selection of a preferred remedial strategy is made. Areas of significant technical uncertainty that should be addressed include: (1) Better delineation of the spatial distribution of surface contamination and the vertical distribution of subsurface contamination in the area of the firing table and associated alluvial deposits; (2) Chemical and physical characterization of residual depleted uranium (DU) at the site; (3) Determination of actual contaminant concentrations in air particulates to support risk modeling; and (4) More realistic estimation of cost for remedial alternatives, including soil washing, that were derived primarily from vendor estimates. Instead of conducting the planned soil washing treatability study, the team recommends that the site consider a new phased approach that combines additional characterization approaches and technologies to address the technical uncertainty in the remedial decision making. The site should redo the risk calculations as the future use scenario has changed for the site. As a result, the existing model is based on very conservative assumptions that result in calculation of unreasonably low cleanup goals. Specifically, the review team proposes that LLNL consider: (1) Revising the industrial worker scenario to a reasonable maximum exposure (RME) for a site worker that performs a weekly walk down of the area for two hours for 25 years (or an alternative RME if the exposure scenario changes); (2) Revising the ESSI of 2 mg U per kg soil for the deer mouse to account for less than 0.05 of the total ingested uranium being adsorbed by the gut; (3) Revising bioaccumulation factors (BAFs) for vegetation and invertebrates that are based on 100 mg of soluble uranium per kg of soil, as the uranium concentration in the slope soil does not average 100 mg/kg and it is not all in a soluble form; and (4) Measuring actual contaminant concentrations in air particulates at the site and using the actual values to support risk calculations. The team recommends that the site continue a phased approach during remediation. The activities should focus on elimination of the principal threats to groundwater by excavating (1) source material from the firing table and alluvial deposits, and (2) soil hotspots from the surrounding slopes with concentrations of U-235 and U-238 that pose unacceptable risk. This phased approach allows the remediation path to be driven by the results of each phase. This reduces the possibility of costly 'surprises', such as failure of soil treatment, and reduces the impact of remediation on endangered habitat. Treatment of the excavated material with physical separation equipment may result in a decreased volume of soil for disposal if the DU is concentrated in the fine-grained fraction, which can then be disposed of in an offsite facility at a considerable cost savings. Based on existing data and a decision to implement the recommended phased approach, the cost of characterization, excavation and physical

  4. RCRA Summary Document for the David Witherspoon 1630 Site, Knoxville, Tennessee

    SciTech Connect (OSTI)

    Pfeffer, J.

    2008-06-10

    The 48-acre David Witherspoon, Inc. (DWI) 1630 Site operated as an unregulated industrial landfill and scrap yard. The Tennessee Division of Superfund (TDSF) closed the landfill in 1974. During the period of operation, the site received solid and liquid wastes from salvage and industrial operations. The site consists of five separate tracts of land including a small portion located across the Norfolk Southern Railroad track. The landfill occupies approximately 5 acres of the site, and roughly 20 acres of the 48 acres contains surface and buried debris associated with the DWI dismantling business operation. Beginning in 1968, the state of Tennessee licensed DWI to receive scrap metal at the DWI 1630 Site, contaminated with natural uranium and enriched uranium (235U) not exceeding 0.1 percent by weight (TDSF 1990). The U.S. Department of Energy (DOE) has agreed to undertake remedial actions at the DWI 1630 Site as specified under a Consent Order with the Tennessee Department of Environment and Conservation (TDEC) (Consent Order No. 90-3443, April 4, 1991), and as further delineated by a Memorandum of Understanding (MOU) between DOE and the State of Tennessee (MOU Regarding Implementation of Consent Orders, October 6, 1994). The soil and debris removal at the DWI 1630 Site is being performed by Bechtel Jacobs Company LLC (BJC) on behalf of the DOE. Remediation consists of removing contaminated soil and debris from the DWI 1630 site except for the landfill area and repairing the landfill cap. The DWI 1630 remediation waste that is being disposed at the Environmental Management Waste Management Facility (EMWMF) as defined as waste lot (WL) 146.1 and consists primarily of soils and soil like material, incidental debris and secondary waste generated from the excavation of debris and soil from the DWI 1630 site. The WL 146.1 includes soil, soil like material (e.g., shredded or chipped vegetation, ash), discrete debris items (e.g., equipment, drums, large scrap metal, cylinders, and cable) and populations of debris type items (e.g., piles of bricks, small scrap metal, roofing material, scaffolding, and shelving) that are located throughout the DWI 1630 site. The project also generates an additional small volume of secondary waste [e.g., personal protective equipment (PPE), and miscellaneous construction waste] that is bagged and included in bulk soil shipments to the EMWMF. The Waste Acceptance Criteria (WAC) for the EMWMF does not allow for material that does not meet the Resource Conservation and Recovery Act (RCRA) Land Disposal Restrictions (LDRs). The waste being excavated in certain areas of the DWI 1630 site contained soil that did not meet RCRA LDR criteria; therefore this waste had to be segregated for treatment or alternate disposal offsite. This document identifies the approach taken by the DWI 1630 project to further characterize the areas identified during the Phase II Remedial Investigation (RI) as potentially containing RCRA-characteristic waste. This document also describes the methodology used to determine excavation limits for areas determined to be RCRA waste, post excavation sampling, and the treatment and disposal of this material.

  5. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect (OSTI)

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  6. QER- Comment of Liberty Goodwin

    Broader source: Energy.gov [DOE]

    As suggested by Sen. Jack Reed, below and attached are my comments on energy policy for now and the future: ***************************************************************************** AN OUTLINE FOR PRACTICAL & FRUITFUL ENERGY DEVELOPMENT WITH SPECIAL ATTENTION TO SENSIBLE PUBLIC INVESTMENT (Thoughts on intelligent action for energy that is abundant, affordable, associated with many jobs and economic health in New England and the nation) ** CLINGING TO OUTMODED & DESTRUCTIVE TECHNOLOGIES – WE DON'T NEED TO ARGUE ABOUT CLIMATE CHANGE TO SEE THE WAY FORWARD 1. Fossil fuels and nuclear have clear and present dangers and damaging effects, on human and environmental health. This includes the uncontestable pollution involved in production and use, and the risks of greater disasters, along with concerns about toxic waste that can contaminate our water and more. 2. Renewable sources offer a vast number of possibilities for energy production for a variety of uses. To not explore them is wasteful. To stick to same-old, same-old is foolish, and will leave us at the rear of the pack re: future energy development. **SMALL IS BEAUTIFUL – LESS RISKY – MORE PRODUCTIVE – MORE LOCAL 1 Solyndra is the bad apple that makes the point. Because something costs millions, or even billions of dollars doesn't mean it is the way to achieve huge results. The only thing that is huge about propping up mega-corporations is the risk. 2 Making the money available in far smaller amounts to a variety of solar efforts is both less risky and more promising – gives more chance of positive results. And, to anyone who can do the math – millions of small installations is as productive as one giant. 3 Smaller projects tend to be more labor-intensive – and offer local employment in a bunch of different places, benefiting the economies of all. **BENEFICIAL INNOVATION IS NOT BORN IN A CORPORATE THINK TANK, BUT IN THE MINDS OF INDIVIDUAL GENIUSES. 1. History tells us that great inventions have been developed by unknowns working in garages, bike shops, etc. We need to look beyond the elite in corporate money tanks and prestigious academia to find the gems in our own backyards. 2. One such, Paul Klinkman, has at least 50 inventions on hand, is developing several, has one patent and a few more in process, most related to alternative energy production. 3. The point is that we would find many like him – if we would only look. 4. Also, we should be seeking not just new technologies, but new business models. Check out the example from our greenhouse flyer, below. **SAVVY INVESTORS DON'T PUT THE BULK OF THEIR FORTUNES IN JUST A COUPLE OF STOCKS. THEY SPREAD THE RISK BY DIVERSIFYING. LET US BE LIKEWISE SMART IN USE OF PUBLIC MONEY 1 "Renewable energy" is not just about electricity, or even that and hot water. It is not even just those and wind, and certainly more than "solar panels". 2 We need to explore and use the many different types of alternatives, just as we do in most other aspects of our society. 3 Taking the kind of money that was allocated to Solyndra (or even to 38 Studios here in Rhode Island, and instead investing it in even 10 small projects, is a much wiser choice than betting it on another big boondoggle. **WHAT TO DO? PUT OUR MONEY INTO SUPPORT FOR WIDESPREAD USE OF CURRENT "GREEN" ENERGY TECHNOLOGY, AND EVALUATION & DEVELOPMENT OF NEW, TRULY INNOVATIVE OPTIONS 1 Make renewable energy credits available for all solar, wind and other technologies that show promise for meeting our energy needs. 2 Consider setting up an Important Innovations Center like the one described on the other side. TWO EXAMPLES OF NEW & EXCITING RESEARCH & BUSINESS MODELS A. PROPOSED NEW KSD NON-PROFIT IMPORTANT INNOVATIONS CENTER PURPOSES **Provide a place where small inventors can get help in evaluating and developing their ideas. **Provide a place which will focus specifically on inventions that have the potential to benefit the world and its people. **Provide a place which will especially focus on solutions to energy needs – and to environmental pollution and other damage. **Provide a place to enable people interested in doing good rather than getting rich to network and cooperate on accomplishing this kind of change in our world. MEANS **Invite ideas to be submitted and considered. **Focus on those inventors who don't have a large corporation or prestigious university behind them. **Vet the submissions for both efficacy and social value. **Locate funding sources that will support such work. **Locate local and regional businesses interested in marketing and/or manufacturing new and beneficial designs and products. **Connect resources with inventors and their ideas. **Support projects that utilize such innovations for good. WHAT NOT TO DO: Turn these to large multi-national corporations to exploit for their own gain. ****************************************************************************** **** B. THE UNIQUE KSD BUSINESS MODEL FOR SOLAR GREENHOUSE DEVELOPMENT **Provide a KSD design package kit that will allow farmers & other handy people to build their own greenhouses **Include expert consultation & tech support to assist them throughout the process of building.. **Train able local people as helpers to do the on-site assistance in various parts of the country. **Provide training to locally owned small businesses such as sheet metal shops to manufacture desired parts, such as the solar concentrating collectors. **Work to develop a network of local resources that could market, manufacture & install greenhouses. Some might also produce & sell biofuel from algae. **Include non-profit organizations, as partners that could raise money from selling the kits & subsidize or give units to community gardens, food banks, etc.) **Develop a residential version that could provide gardening & sun space, as well as supplementary heat to an adjacent house. ****************************************************************************** ********* SUBMITTED BY: LIBERTY GOODWIN, CO-OWNER, (WITH PAUL KLINKMAN) KLINKMAN SOLAR DESIGN (KSD), P.O. Box 40572, Providence, RI 02940, Tel. 401-351-9193, E-Mail: info@klinkmansolar.com, Website: www.klinkmansolar.com ******************************************************************************

  7. Novel Supercritical Carbon Dioxide Power Cycle Utilizing Pressured Oxy-combustion in Conjunction with Cryogenic Compression

    SciTech Connect (OSTI)

    Brun, Klaus; McClung, Aaron; Davis, John

    2014-03-31

    The team of Southwest Research Institute® (SwRI) and Thar Energy LLC (Thar) applied technology engineering and economic analysis to evaluate two advanced oxy-combustion power cycles, the Cryogenic Pressurized Oxy-combustion Cycle (CPOC), and the Supercritical Oxy-combustion Cycle. This assessment evaluated the performance and economic cost of the two proposed cycles with carbon capture, and included a technology gap analysis of the proposed technologies to determine the technology readiness level of the cycle and the cycle components. The results of the engineering and economic analysis and the technology gap analysis were used to identify the next steps along the technology development roadmap for the selected cycle. The project objectives, as outlined in the FOA, were 90% CO{sub 2} removal at no more than a 35% increase in cost of electricity (COE) as compared to a Supercritical Pulverized Coal Plant without CO{sub 2} capture. The supercritical oxy-combustion power cycle with 99% carbon capture achieves a COE of $121/MWe. This revised COE represents a 21% reduction in cost as compared to supercritical steam with 90% carbon capture ($137/MWe). However, this represents a 49% increase in the COE over supercritical steam without carbon capture ($80.95/MWe), exceeding the 35% target. The supercritical oxy-combustion cycle with 99% carbon capture achieved a 37.9% HHV plant efficiency (39.3% LHV plant efficiency), when coupling a supercritical oxy-combustion thermal loop to an indirect supercritical CO{sub 2} (sCO{sub 2}) power block. In this configuration, the power block achieved 48% thermal efficiency for turbine inlet conditions of 650°C and 290 atm. Power block efficiencies near 60% are feasible with higher turbine inlet temperatures, however a design tradeoff to limit firing temperature to 650°C was made in order to use austenitic stainless steels for the high temperature pressure vessels and piping and to minimize the need for advanced turbomachinery features such as blade cooling. The overall technical readiness of the supercritical oxy-combustion cycle is TRL 2, Technology Concept, due to the maturity level of the supercritical oxy-combustor for solid fuels, and several critical supporting components, as identified in the Technical Gap Analysis. The supercritical oxycombustor for solid fuels operating at pressures near 100 atm is a unique component of the supercritical oxy-combustion cycle. In addition to the low TRL supercritical oxy-combustor, secondary systems were identified that would require adaptation for use with the supercritical oxycombustion cycle. These secondary systems include the high pressure pulverized coal feed, high temperature cyclone, removal of post-combustion particulates from the high pressure cyclone underflow stream, and micro-channel heat exchangers tolerant of particulate loading. Bench scale testing was utilized to measure coal combustion properties at elevated pressures in a CO{sub 2} environment. This testing included coal slurry preparation, visualization of coal injection into a high pressure fluid, and modification of existing test equipment to facilitate the combustion properties testing. Additional bench scale testing evaluated the effectiveness of a rotary atomizer for injecting a coal-water slurry into a fluid with similar densities, as opposed to the typical application where the high density fluid is injected into a low density fluid. The swirl type supercritical oxy-combustor was developed from initial concept to an advanced design stage through numerical simulation using FLUENT and Chemkin to model the flow through the combustor and provide initial assessment of the coal combustion reactions in the flow path. This effort enabled the initial combustor mechanical layout, initial pressure vessel design, and the conceptual layout of a pilot scale test loop. A pilot scale demonstration of the supercritical oxy-combustion cycle is proposed as the next step in the technology development. This demonstration would advance the supercritical oxy-combustion cycle and the supercritical oxy-combustor from a current TRL of 2, Technology Concept, to TRL 6, Pilot Scale System Demonstrated in a Relevant Environment, and enable the evaluation and continued refinement of the supercritical oxy-combustor and critical secondary systems.

  8. 2013,1,"AK",3522,"Chugach Electric Assn Inc",0,,,,0,0,,,,0,0,,,,0

    U.S. Energy Information Administration (EIA) Indexed Site

    STATE_CODE","UTILITY_ID","UTILNAME","RESIDENTIAL_GPREVENUES","COMMERCIAL_GPREVENUES","INDUSTRIAL_GPREVENUES","TRANS_GPREVENUES","TOTAL_GPREVENUES","RESIDENTIAL_GPGENERATION","COMMERCIAL_GPGENERATION","INDUSTRIAL_GPGENERATION","TRANS_GPGENERATION","TOTAL_GPGENERATION","RESIDENTIAL_GPCUSTOMERS","COMMERCIAL_GPCUSTOMERS","INDUSTRIAL_GPCUSTOMERS","TRANS_GPCUSTOMERS","TOTAL_GPCUSTOMERS" 2013,1,"AK",3522,"Chugach Electric Assn Inc",0,,,,0,0,,,,0,0,,,,0 2013,1,"AL",195,"Alabama Power Co",2.507,0.063,,,2.57,55.7,1.4,,,57.1,628,12,,,640 2013,1,"AL",4958,"Decatur Utilities",0.14,0.1,0,0,0.24,5.25,3.75,0,0,9,19,1,0,0,20 2013,1,"AL",6422,"City of Florence - (AL)",0.368,0,0,0,0.368,13.8,0,0,0,13.8,50,0,0,0,50 2013,1,"AL",9094,"City of Huntsville - (AL)",8.632,1.64,0,0,10.272,323.7,61.5,0,0,385.2,1022,4,0,0,1026 2013,1,"AL",9739,"Joe Wheeler Elec Member Corp",0.188,0,0,0,0.188,7.05,0,0,0,7.05,20,0,0,0,20 2013,1,"AR",14063,"Oklahoma Gas & Electric Co",0.314,0.222,0.029,0,0.565,86.294,63.454,8.333,0,158.081,88,1,1,0,90 2013,1,"AZ",803,"Arizona Public Service Co",8.198,35.475,,,43.673,2049.62,8868.77,,,10918.39,2739,85,,,2824 2013,1,"AZ",16572,"Salt River Project",,5.429,,,5.429,,502,,,502,,8,,,8 2013,1,"AZ",19189,"Trico Electric Cooperative Inc",0.01,,,,0.01,0.25,,,,0.25,3,,,,3 2013,1,"AZ",19728,"UNS Electric, Inc",1.471,0.077,,,1.548,44.83,2.74,,,47.57,248,7,,,255 2013,1,"AZ",24211,"Tucson Electric Power Co",18.123,2.247,0.399,,20.769,657.86,173.23,5.3,,836.39,2619,62,2,,2683 2013,1,"CA",11208,"Los Angeles Department of Water & Power",64.746,109.462,0.47,,174.678,2158.218,3648.722,15.676,,5822.616,16536,614,28,,17178 2013,1,"CA",12745,"Modesto Irrigation District",0.122,,,,0.122,0.639,,,,0.639,1,,,,1 2013,1,"CA",14328,"Pacific Gas & Electric Co",0,0,0,0,0,0,0,0,0,0,0,0,0,,0 2013,1,"CA",14354,"PacifiCorp",5.272,0.451,0.016,0,5.739,274.699,23.147,0.8,0,298.646,1223,38,2,0,1263 2013,1,"CA",14534,"City of Pasadena - (CA)",16.888,14.845,0,0,31.733,675.458,593.795,0,0,1269.253,1043,53,0,0,1096 2013,1,"CA",16534,"Sacramento Municipal Util Dist",219.094,7.646,63.401,,290.141,33465.982,771.746,7565.049,,41802.777,53171,1423,646,,55240 2013,1,"CA",17612,"Bear Valley Electric Service",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"CA",18260,"Surprise Valley Electrificatio",0.045,0,0,0,0.045,1.8,0,0,0,1.8,9,0,0,0,9 2013,1,"CA",19281,"Turlock Irrigation District",0.015,,0.122,,0.137,2.99,,24.36,,27.35,6,,1,,7 2013,1,"CO",3989,"City of Colorado Springs - (CO)",2.513,0.654,,,3.167,235.6,33.8,,,269.4,743,16,,,759 2013,1,"CO",6604,"City of Fort Collins - (CO)",19.565,9.057,11.83,0,40.452,858.504,397.43,587.373,0,1843.307,1257,95,3,0,1355 2013,1,"CO",9336,"Intermountain Rural Elec Assn",0.418,,,,0.418,29,,,,29,43,,,,43 2013,1,"CO",12866,"Moon Lake Electric Assn Inc",0.036,,,,0.036,1.92,,,,1.92,4,,,,4 2013,1,"CO",15257,"Poudre Valley R E A, Inc",0.436,0.036,1.399,0,1.871,484.511,40.533,1554.178,0,2079.222,636,17,1,0,654 2013,1,"CO",15466,"Public Service Co of Colorado",277.472,142.981,,,420.453,12851.359,6623.167,,,19474.526,29441,788,,,30229 2013,1,"CO",16603,"San Luis Valley R E C, Inc",0.3,0.06,0.604,,0.964,75.1,15,151,,241.1,175,5,2,,182 2013,1,"CO",19499,"United Power, Inc",0.47,0.05,1.43,,1.95,527,50.4,1586.8,,2164.2,357,6,8,,371 2013,1,"CT",4176,"Connecticut Light & Power Co",181.909,23.844,0.747,0,206.5,19710.744,2410.9,75.421,0,22197.065,21408,371,7,0,21786 2013,1,"CT",7716,"Groton Dept of Utilities - (CT)",0.065,,,,0.065,5.9,,,,5.9,15,,,,15 2013,1,"CT",19497,"United Illuminating Co",41.54,,,,41.54,4237.62,,,,4237.62,5933,,,,5933 2013,1,"CT",20038,"Town of Wallingford - (CT)",1.688,0.113,0,0,1.801,153.447,10.274,0,0,163.721,230,4,0,0,234 2013,1,"DE",5070,"Delaware Electric Cooperative",0.059,,,,0.059,29.6,,,,29.6,35,,,,35 2013,1,"DE",13519,"City of Newark - (DE)",0.367,0,0,0,0.367,1751,0,0,0,1751,269,0,0,0,269 2013,1,"FL",18454,"Tampa Electric Co",13.23,2.89,0,0,16.12,529.2,115.6,0,0,644.8,2215,28,0,0,2243 2013,1,"GA",3408,"City of Chattanooga - (TN)",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"GA",3916,"Cobb Electric Membership Corp",1.029,0.026,0.443,,1.498,30.881,0.765,13.3,,44.946,151,3,1,,155 2013,1,"GA",7140,"Georgia Power Co",27.42,16.46,22.46,,66.34,670,1430,2346,,4446,4107,44,6,,4157 2013,1,"GA",9601,"Jackson Electric Member Corp - (GA)",2.282,0.075,0.646,0,3.003,76.05,3,25.84,0,104.89,507,2,2,0,511 2013,1,"IA",9417,"Interstate Power and Light Co",45.4,2.9,,,48.3,5570.9,144.7,,,5715.6,6107,568,,,6675 2013,1,"ID",9191,"Idaho Power Co",10.229,5.453,0.017,,15.699,1203,642,2,,1847,2034,67,2,,2103 2013,1,"ID",11273,"Lower Valley Energy Inc",0.105,,,,0.105,9.006,,,,9.006,23,,,,23 2013,1,"ID",14354,"PacifiCorp",4.106,0.431,0.002,0,4.539,211.627,23.68,0.1,0,235.407,1167,27,1,0,1195 2013,1,"ID",20169,"Avista Corp",3.747,0.748,0,0,4.495,1124.1,224.4,0,0,1348.5,965,40,0,0,1005 2013,1,"IN",9273,"Indianapolis Power & Light Co",6.442,0.571,14.835,,21.848,4294.886,380.52,9890.167,,14565.573,4170,129,24,,4323 2013,1,"IN",15470,"Duke Energy Indiana Inc",8.128,,,,8.128,406.5,,,,406.5,1309,,,,1309 2013,1,"KS",10000,"Kansas City Power & Light Co",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"KS",10005,"Kansas Gas & Electric Co",0.131,,,,0.131,13.1,,,,13.1,35,,,,35 2013,1,"KS",22500,"Westar Energy Inc",0.12,0.022,1.1,0,1.242,12,2.2,110,,124.2,37,1,1,,39 2013,1,"KY",10171,"Kentucky Utilities Co",2.69,0.085,0.004,0,2.779,795,25,1,0,821,536,18,1,0,555 2013,1,"KY",11249,"Louisville Gas & Electric Co",4.55,0.12,0,0,4.67,1330,38,0,0,1368,926,11,0,0,937 2013,1,"KY",14724,"Pennyrile Rural Electric Coop",0.212,0,0,0,0.212,7.95,0,0,0,7.95,37,0,0,0,37 2013,1,"KY",17564,"South Kentucky Rural E C C",0.539,0.003,,,0.542,19.6,0.1,,,19.7,172,1,,,173 2013,1,"KY",19446,"Duke Energy Kentucky",0.507,,,,0.507,47.6,,,,47.6,116,,,,116 2013,1,"KY",20130,"Warren Rural Elec Coop Corp",0.088,0.02,0,0,0.108,3.3,0.75,0,0,4.05,14,1,0,0,15 2013,1,"MA",11804,"Massachusetts Electric Co",74.761,2.618,0.018,0,77.397,3332.112,103.699,0.717,0,3436.528,5179,199,3,0,5381 2013,1,"MA",13206,"Nantucket Electric Co",0.342,0.243,0,0,0.585,13.526,9.159,0,0,22.685,31,8,0,0,39 2013,1,"MI",3828,"Cloverland Electric Co-op",0.1,,,,0.1,10.858,,,,10.858,36,,,,36 2013,1,"MI",4254,"Consumers Energy Co",41,14,7,,62,41,1817,88,,1946,14389,114,3,,14506 2013,1,"MI",5109,"The DTE Electric Company",97,5,18,0,120,4283,225,887,0,5395,23341,113,25,0,23479 2013,1,"MI",10704,"City of Lansing - (MI)",2.922,0.818,0.007,0,3.747,97.5,27.25,0.25,0,125,390,109,1,0,500 2013,1,"MI",13780,"Northern States Power Co",0.091,,,,0.091,7.595,,,,7.595,15,,,,15 2013,1,"MI",19578,"Upper Peninsula Power Co",0.613,0,0,0,0.613,25.55,0,0,0,25.55,119,0,0,0,119 2013,1,"MI",20847,"Wisconsin Electric Power Co",2.14,0.091,0,0,2.231,71,3,0,0,74,275,5,0,0,280 2013,1,"MI",20860,"Wisconsin Public Service Corp",0.073,0.005,0,0,0.078,4.7,0.3,0,0,5,17,1,0,0,18 2013,1,"MN",689,"Connexus Energy",1.807,0.092,5.968,0,7.867,371.7,15,978.296,0,1364.996,471,3,1,0,475 2013,1,"MN",5574,"East Central Energy",1.255,0.07,0,0,1.325,313.8,17.6,0,0,331.4,894,24,0,0,918 2013,1,"MN",9417,"Interstate Power and Light Co",4.2,0.1,,,4.3,556.5,5.3,,,561.8,549,55,,,604 2013,1,"MN",12647,"Minnesota Power Inc",2.843,0.608,,,3.451,113.7,22.3,,,136,618,16,,,634 2013,1,"MN",13781,"Northern States Power Co - Minnesota",299.015,244.218,,,543.233,8470.68,6918.365,,,15389.045,20885,240,,,21125 2013,1,"MN",14232,"Otter Tail Power Co",0.767,1.078,0,0,1.845,59,82.9,0,0,141.9,263,32,0,0,295 2013,1,"MN",16181,"Rochester Public Utilities",0.165,0.074,0,0,0.239,47.042,18.417,0,0,65.459,66,1,0,0,67 2013,1,"MN",20996,"Wright-Hennepin Coop Elec Assn",0.334,8.149,,,8.483,33.4,814.9,,,848.3,79,1,,,80 2013,1,"MN",25177,"Dakota Electric Association",2.238,0.059,1.557,,3.854,559.5,14.8,389.2,,963.5,1365,82,22,,1469 2013,1,"MO",4675,"Cuivre River Electric Coop Inc",0.943,0.035,,,0.978,37.7,1.4,,,39.1,142,2,,,144 2013,1,"MO",10000,"Kansas City Power & Light Co",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"MO",12698,"KCP&L Greater Missouri Operations Co.",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"MO",17833,"City Utilities of Springfield - (MO)",0.842,0.13,0,0,0.972,35.7,7.9,0,0,43.6,149,8,0,0,157 2013,1,"MO",19436,"Union Electric Co - (MO)",71.2,,,,71.2,4748,,,,4748,6868,,,,6868 2013,1,"MS",6641,"4-County Electric Power Assn",0.204,0,0,0,0.204,7.65,0,0,0,7.65,25,0,0,0,25 2013,1,"MS",12686,"Mississippi Power Co",0.02,,,,0.02,0.4,,,,0.4,2,,,,2 2013,1,"MS",19273,"City of Tupelo - (MS)",0.04,1,0,0,1.04,1.5,37.5,0,0,39,5,1,0,0,6 2013,1,"MT",6395,"Flathead Electric Coop Inc",1.63,,,,1.63,326,,,,326,326,,,,326 2013,1,"MT",12825,"NorthWestern Energy LLC - (MT)",1.952,3.266,0,0,5.218,97.6,163.3,0,0,260.9,307,19,0,0,326 2013,1,"MT",20997,"Yellowstone Valley Elec Co-op",0.02,,,,0.02,0.5,,,,0.5,12,,,,12 2013,1,"NC",3046,"Progress Energy Carolinas Inc",19.469,0.904,0.096,,20.469,486.729,36.16,3.84,,526.729,3298,83,2,,3383 2013,1,"NC",5416,"Duke Energy Carolinas, LLC",32.928,8.54,,,41.468,823.2,213.5,,,1036.7,5901,179,,,6080 2013,1,"NC",6235,"Public Works Comm-City of Fayetteville",0.308,0,0,0,0.308,7.7,0,0,0,7.7,57,0,0,0,57 2013,1,"NC",9837,"Jones-Onslow Elec Member Corp",0.196,,,,0.196,4.9,,,,4.9,49,,,,49 2013,1,"NC",16496,"Rutherford Elec Member Corp",0.14,,,,0.14,3.5,,,,3.5,24,,,,24 2013,1,"NC",24889,"Brunswick Electric Member Corp",0.329,0,0,0,0.329,8.225,0,0,0,8.225,71,0,0,0,71 2013,1,"ND",12087,"McKenzie Electric Coop Inc",0.001,,,,0.001,0.1,,,,0.1,1,,,,1 2013,1,"ND",14232,"Otter Tail Power Co",0.511,0.12,0,0,0.631,39.321,9.2,0,0,48.521,195,14,0,0,209 2013,1,"NH",13441,"New Hampshire Elec Coop Inc",1.689,0.057,0,0,1.746,56.3,1.9,0,0,58.2,236,7,0,0,243 2013,1,"NH",15472,"Public Service Co of NH",2.406,0.47,0.105,0,2.981,101.332,46.972,3.798,0,152.102,158,9,2,0,169 2013,1,"NH",24590,"Unitil Energy Systems",0.463,0.004,0,0,0.467,14.438,0.065,0,0,14.503,25,1,0,0,26 2013,1,"NH",26510,"Granite State Electric Co",1.135,0.074,,,1.209,29.382,2.324,,,31.706,103,7,,,110 2013,1,"NJ",963,"Atlantic City Electric Co",6.266,1.458,0,0,7.724,477.501,79.252,0,0,556.753,771,12,0,0,783 2013,1,"NJ",16213,"Rockland Electric Co",1.784,0.006,0,0,1.79,131.281,0.667,0,0,131.948,119,1,0,0,120 2013,1,"NM",5701,"El Paso Electric Co",0.671,2.023,0,0,2.694,11.5,64.6,0,0,76.1,62,15,0,0,77 2013,1,"NM",6204,"City of Farmington - (NM)",0.035,0,0,0,0.035,1.9,0,0,0,1.9,6,0,0,0,6 2013,1,"NM",11204,"Los Alamos County",0.885,0.052,,,0.937,157.6,11.039,,,168.639,3333,10,,,3343 2013,1,"NM",15473,"Public Service Co of NM",21.724,4.901,1.134,0,27.759,5172.37,1166.87,269.91,0,6609.15,12248,464,3,0,12715 2013,1,"NM",17718,"Southwestern Public Service Co",12.153,1.439,,,13.592,405.088,47.982,,,453.07,827,91,,,918 2013,1,"NV",13073,"Mt Wheeler Power, Inc",0.12,0.002,,,0.122,6.2,0.1,,,6.3,21,1,,,22 2013,1,"NY",11171,"Long Island Power Authority",11.169,1.617,,,12.786,409,587,,,996,540,140,,,680 2013,1,"NY",13511,"New York State Elec & Gas Corp",100.211,4.478,1.008,,105.697,4048,213,47,,4308,14873,255,6,,15134 2013,1,"NY",13573,"Niagara Mohawk Power Corp.",103.04,2.12,1.06,0,106.22,5970,123,62,0,6155,8045,166,83,0,8294 2013,1,"NY",16183,"Rochester Gas & Electric Corp",37.822,0.735,,,38.557,1535.1,40.692,,,1575.792,5567,73,,,5640 2013,1,"OH",3542,"Duke Energy Ohio Inc",2.756,,,,2.756,275.6,,,,275.6,634,,,,634 2013,1,"OH",14006,"Ohio Power Co",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"OK",7490,"Grand River Dam Authority",0,0,54.776,,54.776,0,0,13694,,13694,0,0,1,,1 2013,1,"OK",13734,"Northeast Oklahoma Electric Co",0.218,0.004,0,0,0.222,26.6,0.5,0,0,27.1,152,3,0,0,155 2013,1,"OK",14062,"Oklahoma Electric Coop Inc",0.824,0,0,0,0.824,164.9,0,0,0,164.9,1649,0,0,0,1649 2013,1,"OK",14063,"Oklahoma Gas & Electric Co",171.747,317.054,16.633,0,505.434,7733.377,19106.41,1935.612,0,28775.399,9681,837,38,0,10556 2013,1,"OK",15474,"Public Service Co of Oklahoma",15.434,0.336,0,0,15.77,457.587,9.634,0,0,467.221,673,8,0,0,681 2013,1,"OR",1738,"Bonneville Power Administration",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"OR",6022,"City of Eugene - (OR)",23.141,12.428,0,0,35.569,2226,1153,0,0,3379,2443,246,0,0,2689 2013,1,"OR",9191,"Idaho Power Co",0.093,,,,0.093,11,,,,11,18,,,,18 2013,1,"OR",14354,"PacifiCorp",408.297,81.386,27.237,0,516.92,35002.862,8816.17,3558.931,0,47377.963,41305,1371,65,0,42741 2013,1,"OR",15248,"Portland General Electric Co",806.261,27.751,101.307,0,935.319,76384.997,2622.585,5959.253,0,84966.835,85894,1947,145,0,87986 2013,1,"OR",40437,"Emerald People's Utility Dist",12.284,6.469,0,0,18.753,1535.477,808.62,0,0,2344.097,34,34,0,0,68 2013,1,"PA",14715,"PPL Electric Utilities Corp",2.59,,,,2.59,103.7,,,,103.7,335,,,,335 2013,1,"PA",14940,"PECO Energy Co",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"RI",13214,"The Narragansett Electric Co",60.105,1.484,0.044,0,61.633,2596.708,58.236,1.626,0,2656.57,4021,102,1,0,4124 2013,1,"SC",1613,"Berkeley Electric Coop Inc",1.317,0.03,0,0,1.347,43.9,0.439,0,0,44.339,333,4,,,337 2013,1,"SC",3046,"Progress Energy Carolinas Inc",0.229,0.028,,,0.257,5.723,1.12,,,6.843,47,2,,,49 2013,1,"SC",5416,"Duke Energy Carolinas, LLC",0.596,0.004,,,0.6,14.9,0.1,,,15,110,1,,,111 2013,1,"SC",14398,"Palmetto Electric Coop Inc",2.034,2.411,2.454,0,6.899,67.8,105.317,81.8,0,254.917,458,30,3,0,491 2013,1,"SC",17539,"South Carolina Electric&Gas Co",1.037,0,226.131,0,227.168,25.925,0,8228.212,0,8254.137,192,0,2,0,194 2013,1,"SC",17543,"South Carolina Public Service Authority",9.441,26.736,0.287,0,36.464,298.9,891.2,9.583,0,1199.683,1600,396,1,0,1997 2013,1,"SD",14232,"Otter Tail Power Co",0.315,0.23,0,0,0.545,8.2,6,0,0,14.2,41,5,0,0,46 2013,1,"SD",20401,"West River Electric Assn Inc",0.034,,,,0.034,17.1,,,,17.1,80,,,,80 2013,1,"TN",727,"Appalachian Electric Coop",0.292,0.1,0,0,0.392,10.95,3.75,0,0,14.7,36,1,0,0,37 2013,1,"TN",2247,"City of Bristol - (TN)",0.192,0.012,0,0,0.204,7.2,0.45,0,0,7.65,18,3,0,0,21 2013,1,"TN",3408,"City of Chattanooga - (TN)",5.912,6.292,0,0,12.204,221.7,235.95,0,0,457.65,816,29,0,0,845 2013,1,"TN",3704,"City of Clarksville - (TN)",0.696,1.74,0,0,2.436,26.1,65.25,0,0,91.35,91,5,0,0,96 2013,1,"TN",3758,"City of Cleveland - (TN)",0.208,0,0,0,0.208,7.8,0,0,0,7.8,34,0,0,0,34 2013,1,"TN",3812,"City of Clinton - (TN)",0.408,0.344,0,0,0.752,15.3,12.9,0,0,28.2,57,5,0,0,62 2013,1,"TN",4624,"Cumberland Elec Member Corp",1.152,0.152,0,0,1.304,43.2,5.7,0,0,48.9,165,7,0,0,172 2013,1,"TN",5399,"Duck River Elec Member Corp",1.324,2.296,0,0,3.62,49.65,86.1,0,0,135.75,175,8,0,0,183 2013,1,"TN",7174,"Gibson Electric Members Corp",0.2,0.1,0,0,0.3,7.5,3.75,0,0,11.25,39,1,0,0,40 2013,1,"TN",7625,"City of Greeneville - (TN)",0.052,0.1,0,0,0.152,1.95,3.75,0,0,5.7,10,1,0,0,11 2013,1,"TN",9777,"Johnson City - (TN)",2.552,0.472,0,0,3.024,95.7,17.7,0,0,113.4,335,8,0,0,343 2013,1,"TN",10421,"Knoxville Utilities Board",19.256,26.664,0,0,45.92,700.5,1262.4,0,0,1962.9,2245,69,0,0,2314 2013,1,"TN",10906,"City of Lenoir - (TN)",3.588,0.212,0,0,3.8,115.35,7.05,0,0,122.4,362,9,0,0,371 2013,1,"TN",12293,"City of Memphis - (TN)",17.07,1.986,4.812,0,23.868,426.75,49.65,120.3,0,596.7,1308,21,3,0,1332 2013,1,"TN",12470,"Middle Tennessee E M C",4.836,0.872,0,0,5.708,181.35,32.7,0,0,214.05,550,13,0,0,563 2013,1,"TN",13216,"Nashville Electric Service",21.372,7.504,0,0,28.876,801.45,281.4,0,0,1082.85,2429,63,0,0,2492 2013,1,"TN",17694,"Southwest Tennessee E M C",0.196,0.02,0,0,0.216,7.35,0.75,0,0,8.1,18,1,0,0,19 2013,1,"TN",19574,"Upper Cumberland E M C",0.392,0.048,0,0,0.44,14.7,1.8,0,0,16.5,29,3,0,0,32 2013,1,"TN",19898,"Volunteer Electric Coop",0.8,0.388,0,0,1.188,30,14.55,0,0,44.55,93,7,0,0,100 2013,1,"TX",5701,"El Paso Electric Co",2.823,0.088,0,0,2.911,79.9,2.5,0,0,82.4,370,6,0,0,376 2013,1,"TX",16604,"City of San Antonio - (TX)",48.654,51.084,0.384,0,100.122,4425.609,5090.967,38.376,0,9554.952,6462,557,1,0,7020 2013,1,"UT",12866,"Moon Lake Electric Assn Inc",0.148,0.022,,,0.17,7.99,1.212,,,9.202,17,1,,,18 2013,1,"UT",13073,"Mt Wheeler Power, Inc",0.021,,,,0.021,1.1,,,,1.1,2,,,,2 2013,1,"UT",14354,"PacifiCorp",158.394,33.901,9.139,0,201.434,8152.211,2846.716,1173.5,0,12172.427,35413,807,25,0,36245 2013,1,"UT",17874,"City of St George",0.084,0,0,0,0.084,2.84,0,0,0,2.84,8,0,0,0,8 2013,1,"VA",733,"Appalachian Power Co",0.221,,,,0.221,14.76,,,,14.76,11,,,,11 2013,1,"VA",17066,"Shenandoah Valley Elec Coop",0.213,0,0,0,0.213,14.246,0,0,0,14.246,12,0,0,0,12 2013,1,"VA",19876,"Virginia Electric & Power Co",166.416,14.353,0.762,0,181.531,12801.234,3064.185,58.615,0,15924.034,15248,226,1,0,15475 2013,1,"VT",7601,"Green Mountain Power Corp",39.65,10.83,0,0,50.48,1068,276,0,0,1344,3998,216,0,0,4214 2013,1,"WA",1738,"Bonneville Power Administration",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,1,"WA",14354,"PacifiCorp",10.666,3.788,0.006,0,14.46,547.74,316.508,0.3,0,864.548,2669,112,3,0,2784 2013,1,"WA",15500,"Puget Sound Energy Inc",334.185,64.655,0,0,398.84,26734.802,9103.828,0,0,35838.63,34030,959,0,0,34989 2013,1,"WA",17470,"Snohomish County PUD No 1",,2.091,,,2.091,,243.95,,,243.95,,16,,,16 2013,1,"WA",18429,"City of Tacoma - (WA)",6.11,2.57,0,0,8.68,509,214,0,0,723,1161,21,0,0,1182 2013,1,"WA",20169,"Avista Corp",9.34,5.835,0.144,0,15.319,2802,1750.5,43.2,0,4595.7,2374,64,2,0,2440 2013,1,"WI",5574,"East Central Energy",0.109,0,0,0,0.109,27.3,0,0,0,27.3,88,0,0,0,88 2013,1,"WI",11479,"Madison Gas & Electric Co",158,111,1,,270,5110,5939,29,,11078,12045,951,9,,13005 2013,1,"WI",13780,"Northern States Power Co",8.698,4.609,,,13.307,634.884,336.445,,,971.329,1277,55,,,1332 2013,1,"WI",20847,"Wisconsin Electric Power Co",166.97,40.3,44.391,0,251.661,9264,2329,3139,0,14732,18251,601,23,0,18875 2013,1,"WI",20856,"Wisconsin Power & Light Co",72.336,8.4,,,80.736,5682.6,417.2,,,6099.8,7122,971,,,8093 2013,1,"WI",20860,"Wisconsin Public Service Corp",13.098,8.448,0,0,21.546,545.77,352,0,0,897.77,1838,56,0,0,1894 2013,1,"WV",733,"Appalachian Power Co",0.011,,,,0.011,0.7,,,,0.7,2,,,,2 2013,1,"WY",3461,"Cheyenne Light Fuel & Power Co",0.291,0.581,,,0.872,8.314,16.6,,,24.914,28,7,,,35 2013,1,"WY",7222,"City of Gillette - (WY)",0.45,0.492,0,0,0.942,30,32.8,0,0,62.8,39,6,0,0,45 2013,1,"WY",11273,"Lower Valley Energy Inc",12.326,4.929,9.552,,26.807,1059.429,504.749,1138.606,,2702.784,1126,387,33,,1546 2013,1,"WY",14354,"PacifiCorp",15.753,0.84,0.903,0,17.496,814.892,43.2,110.8,0,968.892,3839,105,3,0,3947 2013,1,"WY",19156,"Powder River Energy Corp",0.032,0.028,,,0.06,16.2,13.8,,,30,24,2,,,26 2013,1,,99999,"National Total",4792.148,1589.407,655.869,0,7037.424,350819.302,108835.977,66013.422,0,525668.701,603911,18477,1249,0,623637 2013,2,"AL",195,"Alabama Power Co",2.558,0.072,,,2.63,56.85,1.6,,,58.45,634,12,,,646 2013,2,"AL",4958,"Decatur Utilities",0.14,0.1,0,0,0.24,5.25,3.75,0,0,9,19,1,0,0,20 2013,2,"AL",6422,"City of Florence - (AL)",0.36,0,0,0,0.36,13.5,0,0,0,13.5,49,0,0,0,49 2013,2,"AL",9094,"City of Huntsville - (AL)",8.544,1.64,0,0,10.184,320.4,61.5,0,0,381.9,1013,4,0,0,1017 2013,2,"AL",9739,"Joe Wheeler Elec Member Corp",0.188,0,0,0,0.188,7.05,0,0,0,7.05,20,0,0,0,20 2013,2,"AR",14063,"Oklahoma Gas & Electric Co",0.279,0.235,0.029,0,0.543,76.151,67.134,8.333,0,151.618,85,2,1,0,88 2013,2,"AZ",803,"Arizona Public Service Co",7.164,40.617,,,47.781,1791.018,10154.21,,,11945.228,2714,84,,,2798 2013,2,"AZ",16572,"Salt River Project",,5.044,,,5.044,,466,,,466,,8,,,8 2013,2,"AZ",19189,"Trico Electric Cooperative Inc",0.01,,,,0.01,0.25,,,,0.25,3,,,,3 2013,2,"AZ",19728,"UNS Electric, Inc",1.387,0.077,,,1.464,43.63,2.74,,,46.37,236,7,,,243 2013,2,"AZ",24211,"Tucson Electric Power Co",15.866,2.383,0.399,,18.648,575.93,180.79,5.3,,762.02,2533,60,2,,2595 2013,2,"CA",11208,"Los Angeles Department of Water & Power",67.077,105.929,0.395,,173.401,2235.918,3530.96,13.174,,5780.052,16512,627,17,,17156 2013,2,"CA",12745,"Modesto Irrigation District",0.116,,,,0.116,0.605,,,,0.605,1,,,,1 2013,2,"CA",14354,"PacifiCorp",5.193,0.449,0.016,0,5.658,267.638,23.03,0.8,0,291.468,1220,38,2,0,1260 2013,2,"CA",14534,"City of Pasadena - (CA)",9.243,6.621,,,15.864,369.68,264.838,,,634.518,567,23,,,590 2013,2,"CA",16534,"Sacramento Municipal Util Dist",194.815,6.859,60.348,,262.022,26474.29,693.025,6049.057,,33216.372,53268,1414,645,,55327 2013,2,"CA",17612,"Bear Valley Electric Service",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,2,"CA",18260,"Surprise Valley Electrificatio",0.03,0,0,0,0.03,1.2,0,0,0,1.2,6,0,0,0,6 2013,2,"CA",19281,"Turlock Irrigation District",0.015,,0.147,,0.162,2.995,,29.36,,32.355,6,,1,,7 2013,2,"CO",3989,"City of Colorado Springs - (CO)",5.488,0.512,10.578,,16.578,532.7,38.8,269.5,,841,1116,13,3,,1132 2013,2,"CO",6604,"City of Fort Collins - (CO)",16.784,10.696,0.557,0,28.037,659.762,420.421,21.875,0,1102.058,1185,92,2,0,1279 2013,2,"CO",9336,"Intermountain Rural Elec Assn",0.418,,,,0.418,30,,,,30,44,,,,44 2013,2,"CO",12866,"Moon Lake Electric Assn Inc",0.066,,,,0.066,3.58,,,,3.58,4,,,,4 2013,2,"CO",15257,"Poudre Valley R E A, Inc",0.421,0.036,1.316,,1.773,467.667,40.533,1462.156,,1970.356,635,17,1,,653 2013,2,"CO",15466,"Public Service Co of Colorado",218.716,126.556,,,345.272,10129.88,5862.309,,,15992.189,29402,784,,,30186 2013,2,"CO",16603,"San Luis Valley R E C, Inc",0.296,0.065,0.604,,0.965,73.9,16.2,151,,241.1,168,12,2,,182 2013,2,"CO",19499,"United Power, Inc",0.47,0.05,2.16,,2.68,520.4,50.5,2401,,2971.9,355,6,8,,369 2013,2,"CT",4176,"Connecticut Light & Power Co",174.364,22.601,0.693,0,197.658,18933.921,2287.732,69.942,0,21291.595,21539,368,10,0,21917 2013,2,"CT",7716,"Groton Dept of Utilities - (CT)",0.065,,,,0.065,5.9,,,,5.9,15,,,,15 2013,2,"CT",19497,"United Illuminating Co",42.21,,,,42.21,4305.87,,,,4305.87,5935,,,,5935 2013,2,"CT",20038,"Town of Wallingford - (CT)",1.547,0.121,0,0,1.668,140.6,11.027,0,0,151.627,228,4,0,0,232 2013,2,"DE",5070,"Delaware Electric Cooperative",0.059,,,,0.059,29.6,,,,29.6,35,,,,35 2013,2,"DE",13519,"City of Newark - (DE)",0.367,0,0,0,0.367,1751,0,0,0,1751,269,0,0,0,269 2013,2,"FL",18454,"Tampa Electric Co",13.18,2.88,0,0,16.06,527.2,115.2,0,0,642.4,2206,26,0,0,2232 2013,2,"GA",3408,"City of Chattanooga - (TN)",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,2,"GA",3916,"Cobb Electric Membership Corp",0.907,0.023,0.4,,1.33,27.202,0.69,12.013,,39.905,151,3,1,,155 2013,2,"GA",7140,"Georgia Power Co",27.53,17,22.46,,66.99,672,1431,2346,,4449,4122,42,6,,4170 2013,2,"GA",9601,"Jackson Electric Member Corp - (GA)",2.282,0.075,0.544,0,2.901,76.05,3,21.768,0,100.818,507,2,2,0,511 2013,2,"IA",9417,"Interstate Power and Light Co",39.3,2.9,,,42.2,4816,143.8,,,4959.8,6097,563,,,6660 2013,2,"ID",9191,"Idaho Power Co",10.104,5.557,0.017,0,15.678,1189,654,2,0,1845,2018,66,2,0,2086 2013,2,"ID",11273,"Lower Valley Energy Inc",0.105,,,,0.105,9.076,,,,9.076,23,,,,23 2013,2,"ID",14354,"PacifiCorp",4.172,0.401,0.002,0,4.575,213.241,23.797,0.1,0,237.138,1161,27,1,0,1189 2013,2,"ID",20169,"Avista Corp",3.735,0.748,0,0,4.483,1120.5,224.4,0,0,1344.9,968,40,0,0,1008 2013,2,"IN",9273,"Indianapolis Power & Light Co",4.498,0.444,8.201,,13.143,2998.883,293.547,5469.37,,8761.8,4188,128,25,,4341 2013,2,"IN",15470,"Duke Energy Indiana Inc",7.967,,,,7.967,796.7,,,,796.7,1304,,,,1304 2013,2,"KS",10000,"Kansas City Power & Light Co",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,2,"KS",10005,"Kansas Gas & Electric Co",0.131,,,,0.131,13.1,,,,13.1,34,,,,34 2013,2,"KS",22500,"Westar Energy Inc",0.117,0.022,1,,1.139,11.7,2.2,100,,113.9,36,1,1,,38 2013,2,"KY",10171,"Kentucky Utilities Co",6.795,0.212,0.009,0,7.016,3808,119,5,0,3932,536,18,1,0,555 2013,2,"KY",11249,"Louisville Gas & Electric Co",10.98,0.243,0.067,0,11.29,6149,137,38,0,6324,914,11,1,0,926 2013,2,"KY",14724,"Pennyrile Rural Electric Coop",0.212,0,0,0,0.212,7.95,0,0,0,7.95,37,0,0,0,37 2013,2,"KY",17564,"South Kentucky Rural E C C",0.539,0.003,0,0,0.542,19.6,0.1,0,0,19.7,172,1,0,0,173 2013,2,"KY",19446,"Duke Energy Kentucky",0.521,,,,0.521,49,,,,49,118,,,,118 2013,2,"KY",20130,"Warren Rural Elec Coop Corp",0.088,0.02,0,0,0.108,3.3,0.75,0,0,4.05,14,1,0,0,15 2013,2,"MA",11804,"Massachusetts Electric Co",69.404,2.75,0.014,0,72.168,3070.386,106.677,0.559,0,3177.622,5183,208,3,0,5394 2013,2,"MA",13206,"Nantucket Electric Co",0.336,0.245,0,0,0.581,13.056,9.301,0,0,22.357,32,7,0,0,39 2013,2,"MI",3828,"Cloverland Electric Co-op",0.1,,,,0.1,10.87,,,,10.87,34,,,,34 2013,2,"MI",4254,"Consumers Energy Co",40,13,1,,54,4013,1809,88,,5910,18636,95,2,,18733 2013,2,"MI",5109,"The DTE Electric Company",87,4,16,0,107,3785,177,799,0,4761,21658,109,25,0,21792 2013,2,"MI",10704,"City of Lansing - (MI)",2.874,0.818,0.008,0,3.7,95.75,27.25,0.25,0,123.25,383,109,1,0,493 2013,2,"MI",13780,"Northern States Power Co",0.079,,,,0.079,6.56,,,,6.56,15,,,,15 2013,2,"MI",19578,"Upper Peninsula Power Co",0.607,,,,0.607,25.3,,,,25.3,118,,,,118 2013,2,"MI",20847,"Wisconsin Electric Power Co",1.549,0.086,,,1.635,51,3,,,54,269,5,,,274 2013,2,"MI",20860,"Wisconsin Public Service Corp",0.073,0.005,,,0.078,4.7,0.3,,,5,17,1,,,18 2013,2,"MN",689,"Connexus Energy",1.837,0.092,6.024,0,7.953,376.7,15,987.58,0,1379.28,471,3,1,0,475 2013,2,"MN",5574,"East Central Energy",1.255,0.07,0,0,1.325,313.8,17.6,0,0,331.4,894,24,0,0,918 2013,2,"MN",9417,"Interstate Power and Light Co",3.6,0.1,,,3.7,472.9,5.3,,,478.2,549,55,,,604 2013,2,"MN",12647,"Minnesota Power Inc",2.819,0.508,,,3.327,112.3,20.3,,,132.6,582,15,,,597 2013,2,"MN",13781,"Northern States Power Co - Minnesota",242.939,158.251,,,401.19,6882.134,4483.034,,,11365.168,20895,240,,,21135 2013,2,"MN",14232,"Otter Tail Power Co",0.672,1.063,0,0,1.735,51.724,81.8,0,0,133.524,245,30,0,0,275 2013,2,"MN",16181,"Rochester Public Utilities",0.165,0.074,0,0,0.239,47.043,18.417,0,0,65.46,66,1,0,0,67 2013,2,"MN",20996,"Wright-Hennepin Coop Elec Assn",0.334,9.596,,,9.93,33.4,959.6,,,993,79,1,,,80 2013,2,"MN",25177,"Dakota Electric Association",2.241,0.059,1.075,,3.375,560.2,14.8,268.7,,843.7,1363,82,22,,1467 2013,2,"MO",4675,"Cuivre River Electric Coop Inc",0.943,0.035,0,0,0.978,37.7,1.4,0,0,39.1,142,2,0,0,144 2013,2,"MO",10000,"Kansas City Power & Light Co",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,2,"MO",12698,"KCP&L Greater Missouri Operations Co.",0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 2013,2,"MO",17833,"City Utilities of Springfield - (MO)",0.84,0.13,,,0.97,35.7,7.9,,,43.6,148,8,,,156 2013,2,"MO",19436,"Union Electric Co - (MO)",79.1,,,,79.1,5274,,,,5274,6871,,,,6871 2013,2,"MS",6641,"4-County Electric Power Assn",0.212,0,0,0,0.212,7.95,0,0,0,7.95,25,0,0,0,25 2013,2,"MS",12686,"Mississippi Power Co",0.02,,,,0.02,0.4,,,,0.4,2,,,,2 2013,2,"MS",19273,"City of Tupelo - (MS)",0.04,1,0,0,1.04,1.5,37.5,0,0,39,5,1,0,0,6 2013,2,"MT",6395,"Flathead Electric Coop Inc",1.63,,,,1.63,326,,,,326,326,,,,326 2013,2,"MT",12825,"NorthWestern Energy LLC - (MT)",1.954,3.266,0,0,5.22,97.7,163.3,0,0,261,307,19,0,0,326 2013,2,"MT",20997,"Yellowstone Valley Elec Co-op",0.02,,,,0.02,0.5,,,,0.5,12,,,,12 2013,2,"NC",3046,"Progress Energy Carolinas Inc",18.236,1.419,0.096,,19.751,455.892,56.772,3.84,,516.504,3285,84,2,,3371 2013,2,"NC",5416,"Duke Energy Carolinas, LLC",32.852,8.536,,,41.388,821.3,213.4,,,1034.7,5890,178,,,6068 2013,2,"NC",6235,"Public Works Comm-City of Fayetteville",0.34,0,0,0,0.34,8.5,0,0,0,8.5,57,0,0,0,57 2013,2,"NC",9837,"Jones-Onslow Elec Member Corp",0.188,0,0,0,0.188,4.7,0,0,0,4.7,47,0,0,0,47 2013,2,"NC",16496,"Rutherford Elec Member Corp",0.144,,,,0.144,3.6,,,,3.6,25,,,,25 2013,2,"NC",24889,"Brunswick Electric Member Corp",0.329,0,0,0,0.329,8.225,0,0,0,8.225,71,0,0,0,71 2013,2,"ND",12087,"McKenzie Electric Coop Inc",0.001,0,0,0,0.001,0.1,0,0,0,0.1,1,0,0,0,1 2013,2,"ND",14232,"Otter Tail Power Co",0.458,0.118,0,0,0.576,35.209,9.1,0,0,44.309,184,13,0,0,197 2013,2,"NH",13441,"New Hampshire Elec Coop Inc",1.683,0.057,0,0,1.74,56.1,1.9,0,0,58,236,7,0,0,243 2013,2,"NH",15472,"Public Service Co of NH",2.299,0.521,0.114,0,2.934,98.317,52.529,4.062,0,154.908,154,10,2,0,166 2013,2,"NH",24590,"Unitil Energy Systems",0.461,0.003,0,0,0.464,14.017,0.061,0,0,14.078,25,1,0,0,26 2013,2,"NH",26510,"Granite State Electric Co",1.135,0.074,0,0,1.209,29.382,2.324,0,0,31.706,103,7,0,0,110 2013,2,"NJ",963,"Atlantic City Electric Co",7.184,1.321,0,0,8.505,454.968,72.472,0,0,527.44,762,12,0,0,774 2013,2,"NJ",16213,"Rockland Electric Co",1.535,0.005,0,0,1.54,103.4,0.56,0,0,103.96,119,1,0,0,120 2013,2,"NM",5701,"El Paso Electric Co",0.671,2.023,0,0,2.694,11.5,64.6,0,0,76.1,61,15,0,0,76 2013,2,"NM",6204,"City of Farmington - (NM)",0.032,0,0,0,0.032,1.9,0,0,0,1.9,6,0,0,0,6 2013,2,"NM",11204,"Los Alamos County",0.682,0.097,,,0.779,118.828,17.435,,,136.263,293,11,,,304 2013,2,"NM",15473,"Public Service Co of NM",21.724,4.901,1.134,,27.759,5172.37,1166.87,269.91,,6609.15,12244,453,3,,12700 2013,2,"NM",17718,"Southwestern Public Service Co",8.89,1.962,,,10.852,296.337,65.408,,,361.745,820,91,,,911 2013,2,"NV",13073,"Mt Wheeler Power, Inc",0.12,0.002,,,0.122,6.2,0.1,,,6.3,21,1,,,22 2013,2,"NY",11171,"Long Island Power Authority",11.9,9.1,,,21,387,517,,,904,720,123,,,843 2013,2,"NY",13511,"New York State Elec & Gas Corp",100.014,4.473,1.008,0,105.495,4035,212,48,0,4295,14802,254,6,0,15062 2013,2,"NY",13573,"Niagara Mohawk Power Corp.",103.4,2.12,1.06,0,106.58,5970,123,62,0,6155,8045,166,83,0,8294 2013,2,"