Powered by Deep Web Technologies
Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analysis of Energy Consumption of Duplex Residences in College Station, Texas  

E-Print Network (OSTI)

This paper characterizes the variability of energy consumption due to a series of construction, occupant, and weather-related effects in duplex residences in College Station, Texas. In this paper, spline regression was used to estimate cooling...

Kim, S. B.; Woods, P. K.



Taipei apartment  

E-Print Network (OSTI)

To accommodate the rapid modernization and urbanization between 1960s and 1980s, a large number of mid-rise apartments has been built in Taipei. Today, these poorly designed apartments represent about 40 percent of the ...

Hsu, Andy Chien-Che



Warren Place Apartment Community (287 Students / Co-ed by Apartment / Tier 3 Single Occupancy Fee)  

E-Print Network (OSTI)

, 72"wide x 24"deep x 30"high. Desks are designed with three modular components to allow the resident, a dishwasher, a microwave, a full-size refrigerator and a stove to be shared by all residents in the apartment. Extra microwaves and/or refrigerators brought by students are not allowed. #12;Bathrooms: Apartments

Kunkle, Tom


Designing for apartment access  

E-Print Network (OSTI)

Although social conflicts in corridor housing have long been acknowledged, few useful alternatives have been developed. The corridor remains a standard of apartment design. As a catalyst to the development of new alternatives, ...

Graham, John David Trevor



apartment | OpenEI  

Open Energy Info (EERE)

apartment apartment Dataset Summary Description The following data-set is for a benchmark residential home for all TMY3 locations across all utilities in the US. The data is indexed by utility service provider which is described by its "unique" EIA ID ( Source National Renewable Energy Laboratory Date Released April 05th, 2012 (2 years ago) Date Updated April 06th, 2012 (2 years ago) Keywords AC apartment CFL coffeemaker Computer cooling cost demand Dishwasher Dryer Furnace gas HVAC Incandescent Laptop load Microwave model NREL Residential television tmy3 URDB Data text/csv icon Residential Cost Data for Common Household Items (csv, 14.5 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Annually Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)


Air Conditioner User Behavior in a Master-Metered Apartment Building  

E-Print Network (OSTI)

instrumented in eight apartments, and interviews were conducted with the residents about their operation of the units. The predominant mode of operation was to switch the unit on and off manually; only one resident consistently let it operate thermostatically...

Kempton, W.; Feuermann, D.; McGarity, A. E.



Duplexing the Atlantic Cable  

Science Journals Connector (OSTI)

... it is implied that the application of the duplex method of signalling to an Atlantic cable has now for the first time been successfully accomplished by Mr. Stearns. The publication ... to Mr. Stearns' predecessors jn the application of the duplex system to long submarine cables, and that their success has been something more than "only partial"in the opinion ...




Category:MidriseApartment | Open Energy Information  

Open Energy Info (EERE)

MidriseApartment MidriseApartment Jump to: navigation, search Go Back to PV Economics By Building Type Media in category "MidriseApartment" The following 77 files are in this category, out of 77 total. SVMidriseApartment Atlantic City NJ Public Service Elec & Gas Co.png SVMidriseApartment Atl... 62 KB SVMidriseApartment Bismarck ND Montana-Dakota Utilities Co (North Dakota).png SVMidriseApartment Bis... 74 KB SVMidriseApartment Burlington VT Central Vermont Pub Serv Corp.png SVMidriseApartment Bur... 68 KB SVMidriseApartment Cedar City UT Moon Lake Electric Assn Inc (Utah).png SVMidriseApartment Ced... 60 KB SVMidriseApartment Charleston SC South Carolina Electric&Gas Co.png SVMidriseApartment Cha... 66 KB SVMidriseApartment Cheyenne WY Powder River Energy Corporation.png


Contract Periods for 2012-2013 Residence Halls  

E-Print Network (OSTI)

Contract Periods for 2012-2013 Residence Halls All of the residence halls are on Fall/Spring Contracts. THERE IS NO FALL ONLY CONTRACT. 路 The residence halls open for the fall semester on September 1 rate for the number of days they stay. Apartments Your contract entitles you to an apartment space

Minnesota, University of


Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

E-Print Network (OSTI)

Measured Airflows in a Multifamily Building," AirflowPerformance of Building Envelopes, Components, and Systems,APARTMENTS AND COMMERCIAL BUILDINGS Price, P.N. ; Shehabi,

Price, P.N.



Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

E-Print Network (OSTI)

the existing multi-family building stock in California, inand (2) multi-family residences. Commercial buildings (as we

Price, P.N.



Heating Facilities, Virginia Lake Townhouses and Apartments, Reno, Nevada.  

SciTech Connect

The Virginia Lake Townhouses and Apartments are located in a 12 acre parcel in the geographic center of Reno, Nevada. There are 148 apartments, consisting of 70 single story garden apartments in 10 buildings, 40 two story townhouses in six buildings, and 38 two story apartments in five buildings. All apartments are presently heated with individual natural gas fired forced air furnaces. Hot water is provided by gas fired water heaters, except for the 40 older townhouses which are using water directly from a geothermal source. This water has now been found to be unsuitable for potable use. Located on the property are two geothermal wells, complete with pumps. The larger well can deliver 500 gallons per min., and the smaller well 65 gallons per min., of the 135/sup 0/F geothermal water. The Geo-Heat Utilization Center has been asked to determine a scheme for using the geothermal water from these wells to provide the needed space and hot water heating for the 148 apartments. An outdoor swimming pool also requires heating. Space heating in all three types of apartments will be accomplished through the installation of finned water coils in existing ductwork or furnaces. Geothermal water will be pumped from Well No. 2 through a main distribution system and used directly in the coils. Piping system specifics are available in the Appendix.

Not Available



Analyzing Ventilation Effects of Different Apartment Styles by CFD  

E-Print Network (OSTI)

ICEBO2006, Shenzhen, China Renewable Renewable Energy Resources and a Greener Future Vol.VIII-3-5 Analyzing Ventilation Effects of Different Apartment Styles by CFD Xiaodong Li Lina Wang Zhixing Ye Associate Professor School...

Li, X.; Wang, L.; Ye, Z.



Klamath Apartment Buildings (13) Space Heating Low Temperature Geothermal  

Open Energy Info (EERE)

Apartment Buildings (13) Space Heating Low Temperature Geothermal Apartment Buildings (13) Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Klamath Apartment Buildings (13) Space Heating Low Temperature Geothermal Facility Facility Klamath Apartment Buildings (13) Sector Geothermal energy Type Space Heating Location Klamath Falls, Oregon Coordinates 42.224867掳, -121.7816704掳 Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Methods And Devices For Characterizing Duplex Nucleic Acid Molecules  

DOE Patents (OSTI)

Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.

Akeson, Mark (Santa Cruz, CA); Vercoutere, Wenonah (Santa Cruz, CA); Haussler, David (Santa Cruz, CA); Winters-Hilt, Stephen (Santa Cruz, CA)



Indoor environmental quality benefits of apartment energy retrofits  

NLE Websites -- All DOE Office Websites (Extended Search)

Indoor environmental quality benefits of apartment energy retrofits Indoor environmental quality benefits of apartment energy retrofits Title Indoor environmental quality benefits of apartment energy retrofits Publication Type Journal Article LBNL Report Number LBNL-6373E Year of Publication 2013 Authors Noris, Federico, Gary Adamkiewicz, William W. Delp, Toshifumi Hotchi, Marion L. Russell, Brett C. Singer, Michael Spears, Kimberly Vermeer, and William J. Fisk Journal Building Environment Volume 68 Pagination 170-178 Date Published 10/2013 Keywords Apartments; Energy; Indoor environmental quality; Retrofit; Selection Abstract Sixteen apartments serving low-income populations in three buildings were retrofit with the goal of simultaneously reducing energy consumption and improving indoor environmental quality (IEQ). Retrofit measures varied among apartments and included, among others, envelope sealing, installation of continuous mechanical ventilation systems, upgrading bathroom fans and range hoods, attic insulation, replacement of heating and cooling systems, and adding wall-mounted particle air cleaners. IEQ parameters were measured, generally for two one-week periods before and after the retrofits. The measurements indicate an overall improvement in IEQ conditions after the retrofits. Comfort conditions, bathroom humidity, and concentrations of carbon dioxide, acetaldehyde, volatile organic compounds, and particles generally improved. Formaldehyde and nitrogen dioxide levels decreased in the building with the highest concentrations, were unchanged in a second building, and increased in a third building. IEQ parameters other than particles improved more in apartments with continuous mechanical ventilation systems installed. In general, but not consistently, larger percent increases in air exchange rates were associated with larger percent decreases in indoor levels of the pollutants that primarily come from indoor sources.


Stay Warm in Your Apartment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Stay Warm in Your Apartment Stay Warm in Your Apartment Stay Warm in Your Apartment October 19, 2009 - 11:43am Addthis Eric Barendsen Energy Technology Program Specialist, Office of Energy Efficiency and Renewable Energy Yes, the Ghost of Winters Future has officially knocked on our front doors again. The leaves here in Washington, D.C., have started to turn toward their colorful crescendo, that spectacular finish before their end on the chilly ground. It makes me cold just thinking about it. Like me, you're probably not opening your windows much at night anymore. I'm holding out still, surrendering a little more of my beloved fresh air each night and dreading that first night when I have to pop the heater on. Last night, I only open my window about an inch. I guess that means it's time to think about locking out the cold air once and for all this year.


Stay Warm in Your Apartment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Stay Warm in Your Apartment Stay Warm in Your Apartment Stay Warm in Your Apartment October 19, 2009 - 11:43am Addthis Eric Barendsen Energy Technology Program Specialist, Office of Energy Efficiency and Renewable Energy Yes, the Ghost of Winters Future has officially knocked on our front doors again. The leaves here in Washington, D.C., have started to turn toward their colorful crescendo, that spectacular finish before their end on the chilly ground. It makes me cold just thinking about it. Like me, you're probably not opening your windows much at night anymore. I'm holding out still, surrendering a little more of my beloved fresh air each night and dreading that first night when I have to pop the heater on. Last night, I only open my window about an inch. I guess that means it's time to think about locking out the cold air once and for all this year.


Apartment Hunting - Part II - Keeping those Energy Bills Down |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Part II - Keeping those Energy Bills Down - Part II - Keeping those Energy Bills Down Apartment Hunting - Part II - Keeping those Energy Bills Down August 23, 2010 - 5:17pm Addthis Kyle Rudzinski Special Assistant to the Director of Technology Advancement and Outreach, EERE I recently went looking for a new apartment. And though my parents may say I'm stingy, I like to think I'm economical. Or better yet, I'm a bargain hunter. I asked myself three main questions when looking for my new place: How far is it from public transit and community businesses? Can I keep my energy bills to a minimum? What's the rent? In the second of two entries on apartment hunting, I discuss things to look for that might help keep your energy bills low. When you think about it, energy bills can, in effect, increase your rent


Indoor-outdoor air leakage of apartments and commercial buildings.  

NLE Websites -- All DOE Office Websites (Extended Search)

Indoor-outdoor air leakage of apartments and commercial buildings. Indoor-outdoor air leakage of apartments and commercial buildings. Title Indoor-outdoor air leakage of apartments and commercial buildings. Publication Type Report Year of Publication 2006 Authors Price, Phillip N., Arman Shehabi, Wanyu R. Chan, and Ashok J. Gadgil Publisher Lawrence Berkeley National Laboratory Abstract We compiled and analyzed available data concerning indoor-outdoor air leakage rates and building leakiness parameters for commercial buildings and apartments. We analyzed the data, and reviewed the related literature, to determine the current state of knowledge of the statistical distribution of air exchange rates and related parameters for California buildings, and to identify significant gaps in the current knowledge and data. Very few data were found from California buildings, so we compiled data from other states and some other countries. Even when data from other developed countries were included, data were sparse and few conclusive statements were possible. Little systematic variation in building leakage with construction type, building activity type, height, size, or location within the u.s. was observed. Commercial buildings and apartments seem to be about twice as leaky as single-family houses, per unit of building envelope area. Although further work collecting and analyzing leakage data might be useful, we suggest that a more important issue may be the transport of pollutants between units in apartments and mixed-use buildings, an under-studied phenomenon that may expose occupants to high levels of pollutants such as tobacco smoke or dry cleaning fumes.

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EIS-0050-S: Commercial and Apartment Conservation Service Program, Supplemental  

Energy.gov (U.S. Department of Energy (DOE))

The Office of Buildings Energy Research and Development prepared this SEIS to analyze the potential environmental impacts resulting from national implementation of the Commercial and Apartment Conservation Service Program. This SEIS is a supplement to DOE/EIS-0050, Residential Conservation Service Program.


Resonance Energy Transfer in DNA Duplexes Labeled with Localized Dyes  

Science Journals Connector (OSTI)

Resonance Energy Transfer in DNA Duplexes Labeled with Localized Dyes ... Toward optimizing efficiency in such structures, resonant energy transfer was systematically examined in a series of dye-labeled DNA duplexes where donor朼cceptor separation was incrementally changed from 0 to 16 base pairs. ... Steady state spectroscopy, single-pair fluorescence, time-resolved fluorescence, and ultrafast two-color pump杙robe methods were utilized to examine the energy transfer processes. ...

Paul D. Cunningham; Ani Khachatrian; Susan Buckhout-White; Jeffrey R. Deschamps; Ellen R. Goldman; Igor L. Medintz; Joseph S. Melinger



ITP Industrial Distributed Energy: Boa Vista Apartments: New Bedford Housing Authority/ New Bedford, MA  

Energy.gov (U.S. Department of Energy (DOE))

Overview of Boa Vista Apartments housing development, with CHP system to provide electricity and hot water.


Commercial Reference Building: Midrise Apartment | OpenEI  

Open Energy Info (EERE)

Midrise Apartment Midrise Apartment Dataset Summary Description Commercial reference buildings provide complete descriptions for whole building energy analysis using EnergyPlus simulation software. Included here is data pertaining to the reference building type Midrise Apartment, for each of the 16 climate zones, and each of three construction categories: new construction, post-1980 construction existing buildings, pre-1980 construction existing buildings.The dataset includes four key components: building summary, zone summary, location summary and a picture. Building summary includes details about: form, fabric, and HVAC. Zone summary includes details such as: area, volume, lighting, and occupants for all types of zones in the building. Location summary includes key building information as it pertains to each climate zone, including: fabric and HVAC details, utility costs, energy end use, and peak energy demand.In total, DOE developed 16 reference building types that represent approximately 70% of commercial buildings in the U.S.; for each type, building models are available for the three construction categories. The commercial reference buildings (formerly known as commercial building benchmark models) were developed by the U.S. Department of Energy (DOE), in conjunction with three of its national laboratories.Additional data is available directly from DOE's Energy Efficiency & Renewable Energy (EERE) Website, including EnergyPlus software input files (.idf) and results of the EnergyPlus simulations (.html).


Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

SciTech Connect

We compiled and analyzed available data concerning indoor-outdoor air leakage rates and building leakiness parameters for commercial buildings and apartments. We analyzed the data, and reviewed the related literature, to determine the current state of knowledge of the statistical distribution of air exchange rates and related parameters for California buildings, and to identify significant gaps in the current knowledge and data. Very few data were found from California buildings, so we compiled data from other states and some other countries. Even when data from other developed countries were included, data were sparse and few conclusive statements were possible. Little systematic variation in building leakage with construction type, building activity type, height, size, or location within the u.s. was observed. Commercial buildings and apartments seem to be about twice as leaky as single-family houses, per unit of building envelope area. Although further work collecting and analyzing leakage data might be useful, we suggest that a more important issue may be the transport of pollutants between units in apartments and mixed-use buildings, an under-studied phenomenon that may expose occupants to high levels of pollutants such as tobacco smoke or dry cleaning fumes.

Price, P.N.; Shehabi, A.; Chan, R.W.; Gadgil, A.J.



www.uwindsor.ca/residence Residence Student Handbook Table of Contents  

E-Print Network (OSTI)

www.uwindsor.ca/residence Residence Student Handbook 1 Table of Contents #12;www.uwindsor.ca/residence Residence Student Handbook 2 Welcome Home to Residence ! #12;www.uwindsor.ca/residence Residence Student Handbook 3 Residence Services #12;www.uwindsor.ca/residence Residence Student Handbook 4 Residence Life


Green Student Residence Award Make your residence more sustainable  

E-Print Network (OSTI)

Green Student Residence Award Make your residence more sustainable OIKOS Luxembourg in collaboration with the Cell for Sustainable Development and SEVE Logement invites all students living in University-residences to participate in the Green Student Residence Award. How to participate? Build a Team

van der Torre, Leon


Advertising in Residence I. Who can Post / Advertise in Residence?  

E-Print Network (OSTI)

Advertising in Residence I. Who can Post / Advertise in Residence? All UTM departments, officially recognized student groups and organizations are permitted to advertise events / meetings / etc. in residence provided that they follow the Residence Advertising/Poster Policy below. Individual members

Sokolowski, Marla


Newporter Apartments: Deep Energy Retrofit Short-Term Results  

SciTech Connect

This project demonstrates a path to meet the goal of the Building America program to reduce home energy use by 30% in multi-family buildings. The project demonstrates cost effective energy savings targets as well as improved comfort and indoor environmental quality (IEQ) associated with deep energy retrofits by a large public housing authority as part of a larger rehabilitation effort. The project focuses on a typical 1960's vintage low-rise multi-family apartment community (120 units in three buildings).

Gordon, A.; Howard, L.; Kunkle, R.; Lubliner, M.; Auer, D.; Clegg, Z.



Concordia Residence Life GREY NUN'S  

E-Print Network (OSTI)

with picnic tables and pond. #12;#12;路 Residence Staff on site 路 Security cameras 路 Secure access 13' / 130sf / 12sm #12;Other amenities at Hingston Hall (HB) 路 Residence Staff on site 路 Security;#12;Other amenities at the Jesuit ResidenceResidence Staff on site 路 Security camera 路 Secure access

Doedel, Eusebius


West Village Student Housing Phase I: Apartment Monitoring and Evaluation  

SciTech Connect

Building America team Alliance for Residential Building Innovation (ARBI) worked with the University of California, Davis (UC Davis) and the developer partner West Village Community Partnership (WVCP) to evaluate performance on 192 student apartments completed in September, 2011 as part of Phase I of the multi-purpose West Village project. West Village, the largest planned zero net energy community in the United States. The campus neighborhood is designed to enable faculty, staff and students to affordably live near campus, take advantage of environmentally friendly transportation options, and participate fully in campus life. The aggressive energy efficiency measures that are incorporated in the design contribute to source energy reductions of 37% over the B10 Benchmark. The energy efficiency measures that are incorporated into these apartments include increased wall & attic insulation, high performance windows, high efficiency heat pumps for heating and cooling, central heat pump water heaters (HPWHs), 100% high efficacy lighting, and ENERGY STAR major appliances. Results discuss how measured energy use compares to modeling estimates over a 10 month monitoring period and includes a cost effective evaluation.

German, A.; Bell, C.; Dakin, B.; Hoeschele, M.




E-Print Network (OSTI)

apartments to energy use changes of control apartments, total measured savings of gas energy plus site.S. is implementing many energy retrofits in homes with the goal of reducing building energy consumption and carbon1 ENERGY IMPACTS OF ENERGY AND INDOOR ENVIRONMENTAL QUALITY RETROFITS OF APARTMENTS IN CALIFORNIA


How Do You Save Energy in Your Apartment or Rental? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Your Apartment or Rental? Your Apartment or Rental? How Do You Save Energy in Your Apartment or Rental? October 22, 2009 - 7:00am Addthis On Monday, Eric discussed how he plans to save energy in his apartment this winter. It's not always easy to find ways to save when you don't own your home, but there are simple things you can do to make your apartment or rental more comfortable and efficient. How do you save energy in your apartment or rental? Each Thursday, you have the chance to share your thoughts on a question about energy efficiency or renewable energy for consumers. Please comment with your answers, and also feel free to respond to other comments. Addthis Related Articles Easy Energy Tips for Apartments or Rental Homes How Do You Encourage Your Family to Use Less Water? Energy Tax Credits: Stay Warm and Save MORE Money!


The Residence GuideA GUIDE TO STANDARDS, EXPECTATIONS & SUPPORTS IN RESIDENCE Student Housing & Residence Life  

E-Print Network (OSTI)

Investigation Process & Sanctions 16 Safety & Emergencies 19 Residence Facilities 22 Communication & Technology) will communicate with students primarily through email and announcements on the intranet (https://intranet residence updates. Residence Life events and programs will be posted on the intranet. Repairs

Boonstra, Rudy



Office of Scientific and Technical Information (OSTI)



Laser Safety Method For Duplex Open Loop Parallel Optical Link  

DOE Patents (OSTI)

A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.

Baumgartner, Steven John (Zumbro Falls, MN); Hedin, Daniel Scott (Rochester, MN); Paschal, Matthew James (Rochester, MN)



Apartment Hunting with an Eye to Energy Savings: Part I | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Apartment Hunting with an Eye to Energy Savings: Part I Apartment Hunting with an Eye to Energy Savings: Part I Apartment Hunting with an Eye to Energy Savings: Part I August 10, 2010 - 5:30pm Addthis Kyle Rudzinski Special Assistant to the Director of Technology Advancement and Outreach, EERE Apartment hunting can be a long and stressful process. Finding that right place is difficult, let alone finding the right place with the right price. What's rent? What's the neighborhood like? How big is the closet? How long will my commute take? Was the kitchen recently re-finished? Are there hardwood floors? We think about so many things in hopes of finding the right fit. I recently went apartment hunting. After a few days and 15 apartment complexes, I finally found the right fit at the right price. Despite what my brothers say, I don't think I'm cheap. I'm frugal. Or


Residence Inn Chicago Midway Airport Residence Inn Chicago Midway Airport  

E-Print Network (OSTI)

Residence Inn Chicago 锟 Midway Airport Residence Inn Chicago 锟 Midway Airport 6638 S. Cicero Avenue by Marriott Chicago Midway Airport is located ten miles from downtown Chicago. The hotel offers free shuttle-suite, extended-stay hotel - 5 blocks from Midway Airport 锟 5 floors, 132 suites 锟 AAA 3 Diamonds 锟 Complimentary

Pritchard, Jonathan


Observation of duplex DNA-drug noncovalent complexes by electrospray ionization mass spectrometry  

SciTech Connect

We have observed by ESI-MS the noncovalent complex formed between a minor groove binding molecule and a 12 base pair self-complementary oligonucleotide. When the ratio of Distamycin Dm to oligonucleotide was varied, oligonucleotide duplex, 1:1 Dm/oligonucleotide duplex, and 2:1 Dm/oligonucleotide duplex noncovalent complexes were observed, consistent with NMR results for the same sequence and Dm to oligonucleotide duplex concentration ratios. These results indicate that ESI-MS is an effective analytical technique for the detection of specific drug-oligonucleotide duplex noncovalent complexes and that specific noncovalent complexes can be observed reflecting stoichiometry in solution. Additional experiments to determine if ESI-MS can provide information on the specificity and selectivity of additional minor groove binding and intercalating molecules are in progress. 19 refs., 1 fig.

Gale, D.C.; Goodlett, D.R.; Light-Wahl, K.J.; Smith, R.D. (Pacific Northwest Lab., Richland, WA (United States))



Resident Advisor Position Description Occupational Summary  

E-Print Network (OSTI)

Resident Advisor Position Description Occupational Summary The Resident Advisor (RA) is assigned and Residence Hall policies. The Resident Advisor provides programming based on an assessment of the community and individual needs. The responsibilities of the Resident Advisor position are implemented under the supervision

Bogaerts, Steven

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pull-Apart in Strike-Slip Fault Zone | Open Energy Information  

Open Energy Info (EERE)

Pull-Apart in Strike-Slip Fault Zone Pull-Apart in Strike-Slip Fault Zone Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Print PDF Pull-Apart in Strike-Slip Fault Zone Dictionary.png Pull-Apart in Strike-Slip Fault Zone: No definition has been provided for this term. Add a Definition Pull-aparts form in strike-slip fault zones. Arrows indicate direction of slip. (reference: http://myweb.cwpost.liu.edu/vdivener/notes/cont_transform.htm) Faulds uses this term as a structural control found in the Basin and Range province of the US. 4% of all Great Basin geothermal systems are located in pull-aparts but are more abundant within or along the margins of the Walker Lane. (reference: http://www.atlasgeoinc.com/wp-content/uploads/GRC2011-Faulds.pdf). Retrieved from "http://en.openei.org/w/index.php?title=Pull-Apart_in_Strike-Slip_Fault_Zone&oldid=599541"


Table HC1.2.4 Living Space Characteristics by Average Floorspace--Apartments, 2  

U.S. Energy Information Administration (EIA) Indexed Site

2.4 Living Space Characteristics by Average Floorspace--Apartments, 2005" 2.4 Living Space Characteristics by Average Floorspace--Apartments, 2005" ,,,"Average Square Feet per Apartment in a --" ," Housing Units (millions)" ,,,"2 to 4 Unit Building",,,"5 or More Unit Building" ,,"Apartments (millions)" "Living Space Characteristics",,,"Total","Heated","Cooled","Total","Heated","Cooled" "Total",111.1,24.5,1090,902,341,872,780,441 "Total Floorspace (Square Feet)" "Fewer than 500",3.1,2.3,403,360,165,366,348,93 "500 to 999",22.2,14.4,763,660,277,730,646,303 "1,000 to 1,499",19.1,5.8,1223,1130,496,1187,1086,696 "1,500 to 1,999",14.4,1,1700,1422,412,1698,1544,1348


Apartment Hunting with an Eye to Energy Savings: Part I | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

with an Eye to Energy Savings: Part I with an Eye to Energy Savings: Part I Apartment Hunting with an Eye to Energy Savings: Part I August 10, 2010 - 5:30pm Addthis Kyle Rudzinski Special Assistant to the Director of Technology Advancement and Outreach, EERE Apartment hunting can be a long and stressful process. Finding that right place is difficult, let alone finding the right place with the right price. What's rent? What's the neighborhood like? How big is the closet? How long will my commute take? Was the kitchen recently re-finished? Are there hardwood floors? We think about so many things in hopes of finding the right fit. I recently went apartment hunting. After a few days and 15 apartment complexes, I finally found the right fit at the right price. Despite what my brothers say, I don't think I'm cheap. I'm frugal. Or


Survey on Cooling Costs and Related Factors for Apartments in an Urban Area of Osaka  

E-Print Network (OSTI)

A questionnaire survey was carried out to assess cooling behaviors and cooling costs for 290 apartments in an urban area. 1) Cooling costs are strongly related to the number of air conditioners, the months of occupation, and the air conditioner...

Umemiya, N.; Lin, X.; Inoue, G.



An analysis model for wind resistance performance of automated exterior wall painting robots in apartment buildings  

Science Journals Connector (OSTI)

The painting of exterior walls on apartment buildings involves ... to fatalities. Although the market for domestic painting is expanding, painters tend to avoid the risk of painting exterior walls. Accordingly, m...

Ji-Won Cho; Jeong-Ho Lee; Young-Suk Kim



The case for micro-apartment housing in growing urban centers  

E-Print Network (OSTI)

Taking an analytical approach, this thesis will address how the unmet housing need of urban single-person households can be rectified by the introduction of micro-apartments. The existing housing stock has been built largely ...

Shore, Zachary, S.M. Massachusetts Institute of Technology



Table HC1.1.4 Housing Unit Characteristics by Average Floorspace--Apartments, 2  

U.S. Energy Information Administration (EIA) Indexed Site

4 Housing Unit Characteristics by Average Floorspace--Apartments, 2005" 4 Housing Unit Characteristics by Average Floorspace--Apartments, 2005" ,,,"Average Square Feet per Apartment in a --" ," Housing Units (millions)" ,,,"2 to 4 Unit Building",,,"5 or More Unit Building" ,,"Apartments (millions)" "Housing Unit Characteristics",,,"Total","Heated","Cooled","Total","Heated","Cooled" "Total",111.1,24.5,1090,902,341,872,780,441 "Census Region and Division" "Northeast",20.6,6.7,1247,1032,"Q",811,788,147 "New England",5.5,1.9,1365,1127,"Q",814,748,107 "Middle Atlantic",15.1,4.8,1182,978,"Q",810,800,159 "Midwest",25.6,4.6,1349,1133,506,895,810,346


The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes  

SciTech Connect

Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethyl glycine backbone. The crystal structures of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATGCC)2, and the other containing the same nucleobase pairs and a central pair of bipyridine ligands, have been solved with a resolution of 1.22 and 1.10 {angstrom}, respectively. The non-modified PNA duplex adopts a P-type helical structure similar to that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and the nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. Our results support the notion that whereas PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base-pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines bulge out of the duplex and are aligned parallel to the major groove of the PNA. In addition, two bipyridines from adjacent PNA duplexes form a p-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are p stacked with adjacent nucleobase pairs and adopt an intrahelical geometry. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes.

Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina (Pitt); (PSI); (Goettingen); (Durham); (CM)



LOUISIANA RESIDENCE REGULATIONS A resident student for tuition purposes is defined as one who has abandoned all prior domiciles  

E-Print Network (OSTI)

. ALIEN RESIDENT Alien Resident applicants must provide a Xerox copy of both sides of their alien resident


Encouraging energy conservation in multifamily housing: RUBS and other methods of allocating energy costs to residents  

SciTech Connect

Methods of encouraging energy conservation in multifamily housing by allocating energy costs to residents are discussed; specifically, methods appropriate for use in master metered buildings without equipment to monitor energy consumption in individual apartments are examined. Several devices available for monitoring individual energy consumption are also discussed plus methods of comparing the energy savings and cost effectiveness of monitoring devices with those of other means of promoting conservation. Specific information in Volume I includes a comparison study on energy use in master and individually metered buildings; types of appropriate conservation programs for master metered buildings; a description of the Resident Utility Billing System (RUBS); energy savings associated with RUBS; Resident reactions to RUBS; cost effectiveness of RUBS for property owners; potential abuses, factors limiting widespread use, and legal status of RUBS. Part I of Volume II contains a cost allocation decision guide and Part II in Volume II presents the RUBS Operations Manual. Pertinent appendices to some chapters are attached. (MCW)

McClelland, L.



Green Student Residence Award Make your residence more sustainable  

E-Print Network (OSTI)

to reduce environmental impacts and improve social cohesion in student residences. Students should define is organized in honour of students who are Interested in improving the environmental foot print of and social and their fellow students, to look into daily practices that have a positive impact on their surroundings and may

van der Torre, Leon


Motions of the Substrate Recognition Duplex in a Group I Intron...  

NLE Websites -- All DOE Office Websites (Extended Search)

the relationship between RNA structure, dynamics, and function. Citation: Grant GPG, N Boyd, D Herschlag, and PZ Qin.2009."Motions of the Substrate Recognition Duplex in a Group I...


Recognition of Duplex RNA by Helix-Threading Peptides Barry D. Gooch and Peter A. Beal*  

E-Print Network (OSTI)

Recognition of Duplex RNA by Helix-Threading Peptides Barry D. Gooch and Peter A. Beal 84112-0850 Received April 15, 2004; E-mail: beal@chem.utah.edu Abstract: Many important biological

Beal, Peter A.


90.1 Prototype Building Models Mid-rise Apartment | Building Energy Codes  

NLE Websites -- All DOE Office Websites (Extended Search)

Mid-rise Apartment Mid-rise Apartment The ASHRAE Standard 90.1 prototype building models were developed by Pacific Northwest National Laboratory in support of the U.S. Department of Energy's (DOE's) Building Energy Codes Program. These prototype buildings were derived from DOE's Commercial Reference Building Models. This suite of ASHRAE Standard 90.1 prototype buildings covers all the Reference Building types except supermarket, and also adds a new building prototype representing high-rise apartment buildings.The prototype models include 16 building types in 17 climate locations for ASHRAE Standards 90.1-2004, 90.1-2007 and 90.1-2010. This combination leads to a set of 816 building models (in EnergyPlus Version 6.0). Also included is a scorecard for each prototype building. The scorecard is a spreadsheet that summarizes the


Easy Energy Tips for Apartments or Rental Homes | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Easy Energy Tips for Apartments or Rental Homes Easy Energy Tips for Apartments or Rental Homes Easy Energy Tips for Apartments or Rental Homes October 6, 2008 - 12:08pm Addthis Elizabeth Spencer Communicator, National Renewable Energy Laboratory What does this mean for me? During winter months, try keeping your thermostat set at 68 degrees. You can save energy on hot water usage by cutting down on shower time and running the washing machine with cold water. Warm your home during the day by leaving the curtains on sun-facing windows open. Over the last few weeks we've talked about things like energy audits and energy-saving incentives, and now that we're in the midst of Energy Awareness Month we're going to be talking about ways to save energy this winter. But there's just one problem with all these super-cool resources:


Easy Energy Tips for Apartments or Rental Homes | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Easy Energy Tips for Apartments or Rental Homes Easy Energy Tips for Apartments or Rental Homes Easy Energy Tips for Apartments or Rental Homes October 6, 2008 - 12:08pm Addthis Elizabeth Spencer Communicator, National Renewable Energy Laboratory What does this mean for me? During winter months, try keeping your thermostat set at 68 degrees. You can save energy on hot water usage by cutting down on shower time and running the washing machine with cold water. Warm your home during the day by leaving the curtains on sun-facing windows open. Over the last few weeks we've talked about things like energy audits and energy-saving incentives, and now that we're in the midst of Energy Awareness Month we're going to be talking about ways to save energy this winter. But there's just one problem with all these super-cool resources:


Sustaining Our Investment Residency Communications  

E-Print Network (OSTI)

Sustaining Our Investment Residency Communications Session #141 October 6, 2009 WHEPSUG 2009 Oshkosh, WI #12;Sustaining Our Investment Your Presenter Aaron Apel University of Wisconsin 颅Madison 路 6 Section 2 #12;Sustaining Our Investment Overview 3 This presentation will focus primarily on the setup

Wisconsin at Madison, University of


Characterizing the bending and flexibility induced by bulges in DNA duplexes  

E-Print Network (OSTI)

Advances in DNA nanotechnology have stimulated the search for simple motifs that can be used to control the properties of DNA nanostructures. One such motif, which has been used extensively in structures such as polyhedral cages, two-dimensional arrays, and ribbons, is a bulged duplex, that is two helical segments that connect at a bulge loop. We use a coarse-grained model of DNA to characterize such bulged duplexes. We find that this motif can adopt structures belonging to two main classes: one where the stacking of the helices at the center of the system is preserved, the geometry is roughly straight and the bulge is on one side of the duplex, and the other where the stacking at the center is broken, thus allowing this junction to act as a hinge and increasing flexibility. Small loops favor states where stacking at the center of the duplex is preserved, with loop bases either flipped out or incorporated into the duplex. Duplexes with longer loops show more of a tendency to unstack at the bulge and adopt an open structure. The unstacking probability, however, is highest for loops of intermediate lengths, when the rigidity of single-stranded DNA is significant and the loop resists compression. The properties of this basic structural motif clearly correlate with the structural behavior of certain nano-scale objects, where the enhanced flexibility associated with larger bulges has been used to tune the self-assembly product as well as the detailed geometry of the resulting nanostructures.

John S. Schreck; Thomas E. Ouldridge; Flavio Romano; Ard A. Louis; Jonathan P. K. Doye



Time dependence of 50 Hz magnetic fields in apartment buildings with indoor transformer stations  

Science Journals Connector (OSTI)

......16 apartments (8 AAT, 2 FF, 2 SAT and 4 HF) in 8 buildings. For these continuous measurements, the metre (EMDEX II, Enertech Consultants, Campbell, CA, USA) was employed, using the broadband mode (40-800 Hz), with a dynamic range of 0.01-300......

Nir-Mordechay Yitzhak; Ronen Hareuveny; Shaiela Kandel; Raphael Ruppin



ALS Doctoral Fellowship in Residence  

NLE Websites -- All DOE Office Websites (Extended Search)

Doctoral Fellowship in Residence Print Doctoral Fellowship in Residence Print The Advanced Light Source (ALS), a division of Lawrence Berkeley National Laboratory, is a national user facility that generates intense x-ray radiation for scientific and technological research. As the world's first third-generation synchrotron radiation source, the ALS offers outstanding performance in the VUV-soft x-ray energy range and excellent performance into the hard x-ray region. The facility welcomes researchers from universities, industries, and government laboratories around the world. It is funded by the U.S. Department of Energy, Office of Basic Energy Sciences. Applications to Shape the Future of Synchrotron Radiation Science Synchrotron radiation is now an established tool in many areas of physical and biological science. The ALS Doctoral Fellowships will allow beginning researchers to work at the frontier of synchrotron radiation research and to help advance state-of-the-art applications.

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Housing & Conference Services Residence Life Office  

E-Print Network (OSTI)

/IRC in the assigned residence(s). Residence Orientation Advisors assist peers in making a successful transition are trained in event management, diversity, risk management, teambuilding, leadership, supervision environment. (i.e. camp, high school position, university position, ect.) 路 Demonstrated project management

Thompson, Michael


NMR and molecular modeling evidence for a G.A mismatch base pair in a purine-rich DNA duplex  

Science Journals Connector (OSTI)

...group is critical. Nuclear Overhauser effect...ATGAGC)]. The energy-minimized duplex...group is critical. Nuclear Overhauser effect...ATGAGC)]. The energy-minimized duplex...recycle delay. 1D nuclear Overhauser effect...Still (24) and energy minimizations were...

Y Li; G Zon; W D Wilson



Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through a theoretical link  

E-Print Network (OSTI)

Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through comprising 6 to 20 base pairs self-assemble into polydisperse semi- flexible chains due to hydrophobic on temperature and duplex length, such chains order into liquid crystal phases. Here, we investigate the self-assembly

Sciortino, Francesco


Building America Whole-House Solutions for Existing Homes: Conway Street Apartments- Greenfield, Massachusetts  

Energy.gov (U.S. Department of Energy (DOE))

Through recent research efforts, CARB has been evaluating strategies and technologies that can make dramatic improvements in energy performance in multifamily buildings. In this project, the team helped to transform a 100-year-old empty school building into 12 high performance apartments with low energy costs. The advanced features included an excellent thermal envelope of closed-cell spray foam and triple-pane windows, ductless heat pumps, solar thermal hot water system, and photovoltaic system.


Kelly House Apartment Community (236 Students, Co-ed by Apt. / Tier 3 Single or Double Occupancy Fee)  

E-Print Network (OSTI)

Kelly House Apartment Community (236 Students, Co-ed by Apt. / Tier 3 Single or Double Occupancy Fee) Kelly House is a four story an apartment complex for upperclassmen at the corner of St. Philip and Vanderhorst Streets. Constructed in 1995, Kelly house features a central courtyard and central laundry room

Kunkle, Tom


Resident Professionalism in the Emergency Department  

E-Print Network (OSTI)

Residencies and the Pharmaceutical Industry. Acad Emerg MedPrograms and the Pharmaceutical Industry. Acad Emerg MedPhysicians and the pharmaceutical industry: Is a gift ever

Tokhi, Rizwan; Garmel, Gus M



Computational mapping reveals dramatic effect of Hoogsteen breathing on duplex DNA reactivity  

E-Print Network (OSTI)

Computational mapping reveals dramatic effect of Hoogsteen breathing on duplex DNA reactivity Formaldehyde has long been recognized as a haz- ardous environmental agent highly reactive with DNA. Recently-ray and nuclear magnetic resonance techniques for observing weakly specific interactions of small organic

Vajda, Sandor


X-Ray Conformational Study of the DNA Duplex in Solution  

E-Print Network (OSTI)

X-Ray Conformational Study of the DNA Duplex in Solution V. GRASSIAN* and G. W. BRADY,f Rensselaer Earlier x-ray studies on dissolved linear DNA molecules were interpreted on the assumption engaged in x-ray diffraction studies of circular su- perhelical DNA. Some of our preliminary results have

Benham, Craig J.



E-Print Network (OSTI)

UNIVERSITY OF CONNECTICUT PEDIATRIC RESIDENCY PROGRAM Policy on Eligibility of Pediatric Residents In order to be eligible to be a pediatric resident in the University of Connecticut program, applicants a full unrestricted license to practice medicine in Connecticut. 4. Graduate of medical schools outside

Oliver, Douglas L.


HollyMcLellan,ColvilleConfederatedTribes Resident Fish Division Native resident fish persisted after  

E-Print Network (OSTI)

HollyMcLellan,ColvilleConfederatedTribes Resident Fish Division Native resident fish persistedMcLellan,ColvilleConfederatedTribes Resident Fish Division Surveys document increase in walleye and decrease in native fish abundance Native fish populations affected Sanpoil: wildkokanee and redband trout populations depressed Columbia


Staff summary of Issues & Recommendations Resident Fish  

E-Print Network (OSTI)

1 Staff summary of Issues & Recommendations Resident Fish *preliminary draft, please refer to full recommendations for complete review 10/29/2013 10:07 AM 2009 Fish and Wildlife Program Section Section D. 7 Title: Resident Fish Mitigation (pg 22-23) Overview Generally, entities recommend that the existing language


Airflow Characteristics of Direct-Type Kitchen Hood Systems in High-Rise Apartment Buildings  

E-Print Network (OSTI)

, Samsung C&T, South Korea 2 Introduction ? Today?s high-rise apartment buildings exhibit high degree of air-tightness. ? They are also subjected to stack effect and seasonal, unpredictable, wind pressure variations. ? Therefore, it is questionable... characteristics for alt0 16 32CMH 0Pa 42CMH 0Pa 74CMH 16Pa 477CMH 984CMH 355CMH 815CMH 173CMH 26Pa 0CMH 0CMH 0CMH 54CMH 0Pa 158CMH 1Pa 35CMH 0Pa 74CMH 18Pa (a)?On?3rd?floor?at?12:00,?Jan?1st 1.5m/s North 50CMH 1Pa 23CMH 0Pa 75CMH 18Pa...

Park, M.



Economic Comparison of Heating Facilities: 75 Unit Apartment, Stewart-Lennox Area, Klamath Falls, Oregon.  

SciTech Connect

The apartment building would consist of about 75 units of about 900 square feet each. Also included would be an outdoor swimming pool and an enclosed activity wing of about 11,000 square feet. Though no deep geothermal wells have been drilled in the immediate area, opinions were obtained that 150/sup 0/F water would be present at 2500 feet and 80/sup 0/F water at about 1000 feet. Based on this information the comparative economics of using geothermal as a heat source versus conventional electrical heating was developed. The purpose of this comparison is to determine if there is economic incentive for the expenditure necessary to define and prove the extent of the geothermal resource. Four systems were compared, each would provide space heating, supply domestic hot water, and heat the swimming pool. A brief description of each of the systems is given. (MHR)

Not Available



Duplex-like structures in submarine fan channels, Ouachita Mountains, Arkansas  

SciTech Connect

Submarine fan channel sequences of the Jackfork Formation (Lower Pennsylvanian) at DeGray Dam section in the Ouachita Mountains, Arkansas, contain discrete units (10-75 cm thick) with moderately dipping (25/sup 0/-40/sup 0/), sigmoidal imbricate slices. Adjacent units with opposing imbricate slices are common. The sigmoidal structures are similar in geometry to a tectonic feature known as a duplex. A tectonic origin of sigmoidal structures, however, seems unlikely because opposing directions of imbrication in adjacent units would require an unrealistic tectonic movement history for the area. The authors propose that the Jackfork sigmoidal structures were formed by a process kinematically similar to that responsible for generating duplex structures. Unlike tectonic duplexes, however, the sigmoidal structures were formed by soft-sediment deformation of sand and mud layers as high-energy sediment gravity flows glided over these layers. Sediment gravity flows, responsible for forming the sigmoidal deformation, were probably generated by slumping of adjacent channel walls. Dip direction of sigmoidal slices is perpendicular to channel axes. Thus, recognition of sigmoidal deformation structures may be useful in inferring the trend of channels in ancient submarine fan complexes.

Shanmugam, G.; Moiola, R.J.; Sales, J.K.



Microstructure/property relationships in dissimilar welds between duplex stainless steels and carbon steels  

SciTech Connect

The metallurgical characteristics, toughness and corrosion resistance of dissimilar welds between duplex stainless steel Alloy 2205 and carbon steel A36 have been evaluated. Both duplex stainless steel ER2209 and Ni-based Alloy 625 filler metals were used to join this combination using a multipass, gas tungsten arc welding (GTAW) process. Defect-free welds were made with each filler metal. The toughness of both the 625 and 2209 deposits were acceptable, regardless of heat input. A narrow martensitic region with high hardness was observed along the A36/2209 fusion boundary. A similar region was not observed in welds made with the 625 filler metal. The corrosion resistance of the welds made with 2209 filler metal improved with increasing heat input, probably due to higher levels of austenite and reduced chromium nitride precipitation. Welds made with 625 exhibited severe attack in the root pass, while the bulk of the weld was resistant. This investigation has shown that both filler metals can be used to joint carbon steel to duplex stainless steels, but that special precautions may be necessary in corrosive environments.

Barnhouse, E.J. [Weirton Steel Corp., WV (United States); Lippold, J.C. [Ohio State Univ., Columbus, OH (United States)



The Polytechnic Institute of NYU (NYU-Poly) Residence Life Handbook  

E-Print Network (OSTI)

Directory 3 Residence Life Personnel 2 Residence Hall Services 4 Philosophy of Residence Life 5 Residence RESIDENCE LIFE PERSONNEL The Director, Assistant Director, Residence Directors, Resident Assistants, and staff training. The Office of Residence Life is located at Room 103 in the Othmer Residence Hall. During

Aronov, Boris


Instituting a Flipped Classroom Design into an Emergency Medicine Residency Conference  

E-Print Network (OSTI)

Medicine Residency Conference House H, Van Heukelom J/Medicine (EM) Residency conference. Educational Objectives:of required residency conference time within an EM residency

House, H



Covalent Structure of the DNA-DNA Interstrand Cross-Link Formed by Reductively Activated FR66979 in Synthetic DNA Duplexes  

Science Journals Connector (OSTI)

Covalent Structure of the DNA-DNA Interstrand Cross-Link Formed by Reductively Activated FR66979 in Synthetic DNA Duplexes ...

Huifang Huang; Tom K. Pratum; Paul B. Hopkins



Measurement of the acoustic pressure distribution occurring around an aerial substation adjacent to apartment buildings  

Science Journals Connector (OSTI)

The subject matter of the research work presented in this paper refers to the measurements of the values of the acoustic pressure levels (noise) occurring around a main feeding?point aerial substation adjacent to apartment buildings. The paper presents the values of the noise accompanying the particular power devices mainly transformers during their regular operation. The main aim of this research work was the comparison and assessment of the acoustic pressure values measured with the permissible values defined by environmental standards binding in Poland. The research analysis carried out proved that during a long?term operation of power appliances installed in substations the acoustic pressure level that they emit into the environment is not constant but is subject to changes. Thus the increase of the noise level above the permissible values can be the cause of violation of environmental standards. Due to a significant increase of people's awareness and readiness to claim their rights the main consequence of violating the standards is a growing number of claims. Therefore it is imperative that the level of the acoustic pressure be monitored during routine tests especially around high?power transformers.

Sebastian Borucki; Tomasz Boczar; Andrzej Cichon



Survey of Threats and Assaults by Patients on Psychiatry Residents  

Science Journals Connector (OSTI)

The authors sought to determine the prevalence of threats and assaults by patients on psychiatry residents,...

Yael Dvir M.D.; Emiko Moniwa M.D.; Holly Crisp-Han M.D.


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Establishing a Residence for a Relocation Incentive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4, 2010 4, 2010 MEMORANDUM FOR HUMAN RESOURCES DIRECTORS c:::::::;...-~ l-- -- FROM: SARAH J. ILLA, DIRECTOR OFFICE OF MAN CAPITAL MANAGEMENT OFFICE OF THE CHIEF HUMAN CAPITAL OFFICER SUBJECT: POLICY GUIDANCE MEMORANDUM #14: ESTABLISHING A RESIDENCE FOR A RELOCATION INCENTIVE An employee who is relocating to a new commuting area must establish a temporary or permanent residence before s/he is eligible for a payment of a relocation incentive. Neither OPM's regulations or guidance nor GSA's Federal Travel Regulation address this issue. DOE guidance is as follows. This guidance will be incorporated in the DOE Handbook on Recruitment and Retention Incentives as an appendix during the next update. Temporary Residence. a. For a temporary change of station (TeS) of at least 6 months, but not more than 30


Identification of the building parameters that influence heating and cooling energy loads for apartment buildings in hot-humid climates  

Science Journals Connector (OSTI)

Identifying the building parameters that significantly impact energy performance is an important step for enabling the reduction of the heating and cooling energy loads of apartment buildings in the design stage. Implementing passive design techniques for these buildings is not a simple task in most dense cities; their energy performance usually depends on uncertainties in the local climate and many building parameters, such as window size, zone height, and features of materials. For this paper, a sensitivity analysis was performed to determine the most significant parameters for buildings in hot-humid climates by considering the design of an existing apartment building in Izmir, Turkey. The Monte Carlo method is selected for sensitivity and uncertainty analyses with the Latin hypercube sampling (LHC) technique. The results show that the sensitivity of parameters in apartment buildings varies based on the purpose of the energy loads and locations in the building, such as the ground, intermediate, and top floors. In addition, the total window area, the heat transfer coefficient (U) and the solar heat gain coefficient (SHGC) of the glazing based on the orientation have the most considerable influence on the energy performance of apartment buildings in hot-humid climates.

Yusuf Y?ld?z; Zeynep Durmu? Arsan



Gas metal arc welding of duplex stainless steel using flux cored wire  

SciTech Connect

The effect of chemical compositions and welding parameters on pitting corrosion resistance and notch toughness of duplex stainless steel weld metals by FCAW was investigated. And the effect of welding parameters on hot cracking susceptibility of the FCAW weld metals was also studied. Pitting corrosion resistance was improved with the increase of Cr, Mo and N content in the weld metal, and it was also proved that the corrosion resistance was greatly affected by welding heat input. Hot cracking susceptibility of the weld metal was increased with the increase of welding current and welding speed.

Maruyama, T.; Ogawa, T.; Nishiyama, S.; Ushijima, A.; Yamashita, K. [Kobe Steel, Ltd., Fujisawa (Japan)



DUPLEX: A molecular mechanics program in torsion angle space for computing structures of DNA and RNA  

SciTech Connect

DUPLEX produces energy minimized structures of DNA and RNA of any base sequence for single and double strands. The smallest subunits are deoxydinucleoside monophosphates, and up to 12 residues, single or double stranded can be treated. In addition, it can incorporate NMR derived interproton distances an constraints in the minimizations. Both upper and lower bounds for these distances can be specified. The program has been designed to run on a UNICOS Cray supercomputer, but should run, albeit slowly, on a laboratory computer such as a VAX or a workstation.

Hingerty, B.E.




E-Print Network (OSTI)

, Maintenance, Residential Security, Counseling and Psychological Services, Career Center, OASIS, Campus Community Centers, and various others. To assist students with general questions and referrals, when needed to the rights and/or health and welfare of resident students. 6. To interpret, explain and, when necessary

Russell, Lynn


Observation of a small oligonucleotide duplex by electrospray ionization mass spectrometry  

SciTech Connect

Electrospray ionization (ESI) has been demonstrated to be a soft ionization technique, allowing accurate molecular weight determination for biopolymers due to gas-phase multiple charging. Recent results have demonstrated that noncovalent associations can be preserved upon transfer into the gas phase with ESI, providing a new approach to the determination of both structurally-specific and nonspecific noncovalent associations in solution. The mass spectrometric experimental conditions necessary to preserve such noncovalent associations, and the physical constraints upon such, have yet to be elucidated, although it is clear that gentle interface conditions minimizing internal excitation of noncovalent complexes are helpful. Base-paired oligonucleotide hybridization constitutes one of the most important and thoroughly studied noncovalent associations of biopolymers. Initial attempts to observe duplex oligonucleotides resulted in detection of only the monomeric constituents. Since then, the authors have developed interface conditions that are more gentle and yet still provide sufficient molecular ion desolvation to preserve such associations using new instrumentation with a greatly extended m/z range. In this communication, the authors report the successful ionization of duplex oligonucleotides and the conditions necessary for detection by negative ion ESI-MS. 6 refs., 1 fig.

Light-Wahl, K.J.; Springer, D.L.; Winger, B.E.; Edmonds, C.G.; Thrall, B.D.; Smith, R.D. (Pacific Northwest Lab., Richland, WA (United States)); Camp, D.G. II (Eastern Oregon State College, La Grande (United States))



2001 Residential Energy Consumption Survey Form EIA-457C (2001)--Rental Agents, Landlords, and Apartment Managers Questionnaire  

U.S. Energy Information Administration (EIA) Indexed Site

Form EIA-457C (2001)--Rental Agents, Landlords, and Apartment Managers Questionnaire OMB No. 1905-0092, Expiring March 31, 200X i U.S. Department of Energy Energy Information Administration 2001 Residential Energy Consumption Survey Rental Agents, Landlords, and Apartment Managers Questionnaire INTRODUCTION TO INTERVIEW Hello, I am __________________________ from Roper Starch Worldwide Inc., a social science research firm. We are conducting a study for the U.S. Department of Energy about energy consumption in homes. Although your participation is voluntary, we hope you will participate in this important study of energy usage. Your identity and all the responses you give me will be kept strictly confidential. The survey will take about 15 minutes.


IEEE SIGNAL PROCESSING LETTERS, VOL. 19, NO. 12, DECEMBER 2012 793 A Method for Broadband Full-Duplex MIMO Radio  

E-Print Network (OSTI)

. A hardware based test of the TDTB method shows a 50 dB SIC over a bandwidth of 30 MHz. Index Terms-duplex radios include wireless base stations, wireless relays and personal-area wireless devices. A fundamental and the receive (Rx) antennas on the same radio unit. This can be done by increasing the distances between the Tx

Hua, Yingbo



E-Print Network (OSTI)

RESIDENT ADVISOR JOB CONTRACT 2013-2014 OFFICE COPY This contract provides information supplemental to that found in the Resident Advisor Job Description. After having reviewed the job description the position of Resident Advisor for the 2013-2014 academic year. In accepting this position I agree to all

Devoto, Stephen H.


AMS Elections 2013 Advertising and Posting in Residence Policy  

E-Print Network (OSTI)

AMS Elections 2013 Advertising and Posting in Residence Policy What is the purpose? Advertising can be useful to residents, but we recognize that residents also have a right to privacy and removal costs involved, and deny them future advertising privileges in Student Housing and Hospitality

Pulfrey, David L.



E-Print Network (OSTI)


Adali, Tulay


Long-range, full-duplex, modulated-reflector cell phone for voice/data transmission  

DOE Patents (OSTI)

A long-range communications apparatus utilizing modulated-reflector technology is described. The apparatus includes an energy-transmitting base station and remote units that do not emit radiation in order to communicate with the base station since modulated-reflector technology is used whereby information is attached to an RF carrier wave originating from the base station which is reflected by the remote unit back to the base station. Since the remote unit does not emit radiation, only a low-power power source is required for its operation. Information from the base station is transmitted to the remote unit using a transmitter and receiver, respectively. The range of such a communications system is determined by the properties of a modulated-reflector half-duplex link.

Neagley, Daniel L. (Albuquerque, NM); Briles, Scott D. (Los Alamos, NM); Coates, Don M. (Santa Fe, NM); Freund, Samuel M. (Los Alamos, NM)



Controlled short residence time coal liquefaction process  

DOE Patents (OSTI)

Normally solid dissolved coal product and a distillate liquid product are produced by continuously passing a feed slurry comprising raw feed coal and a recycle solvent oil and/or slurry together with hydrogen to a preheating-reaction zone (26, alone, or 26 together with 42), the hydrogen pressure in the preheating-reaction zone being at least 1500 psig (105 kg/cm.sup.2), reacting the slurry in the preheating-reaction zone (26, or 26 with 42) at a temperature in the range of between about 455.degree. and about 500.degree. C. to dissolve the coal to form normally liquid coal and normally solid dissolved coal. A total slurry residence time is maintained in the reaction zone ranging from a finite value from about 0 to about 0.2 hour, and reaction effluent is continuously and directly contacted with a quenching fluid (40, 68) to substantially immediately reduce the temperature of the reaction effluent to below 425.degree. C. to substantially inhibit polymerization so that the yield of insoluble organic matter comprises less than 9 weight percent of said feed coal on a moisture-free basis. The reaction is performed under conditions of temperature, hydrogen pressure and residence time such that the quantity of distillate liquid boiling within the range C.sub.5 -455.degree. C. is an amount at least equal to that obtainable by performing the process under the same conditions except for a longer total slurry residence time, e.g., 0.3 hour. Solvent boiling range liquid is separated from the reaction effluent and recycled as process solvent.

Anderson, Raymond P. (Overland Park, KS); Schmalzer, David K. (Englewood, CO); Wright, Charles H. (Overland Park, KS)



Exposure to 50 Hz magnetic field in apartment buildings with built-in transformer stations in Hungary  

Science Journals Connector (OSTI)

......between 8 and 13 h). Short-term spot measurements were taken in every room of the residence using ELF MF meter (EMDEX II, Enertech, Campbell, CA, USA). Broadband (Bb 40-800 Hz) component of MF was measured at selected measuring points. In each......

Gy鰎gy Thur骳zy; G醔or J醤ossy; No閙i Nagy; J髗sef Bakos; Judit Szab; G醔or Mezei



Building America Whole-House Solutions for Existing Homes: Cascade Apartments- Deep Energy Multifamily Retrofit (Fact Sheet)  

Energy.gov (U.S. Department of Energy (DOE))

In December of 2009-10, King County Housing Authority implemented energy retrofit improvements in the Cascade multifamily community, located in Kent, Washington, which resulted in annual energy cost savings of 22%, improved comfort and air quality for residents, and increased durability of the units.


Department of Residence Services 2013 SUMMER RESIDENCE HALL CONTRACT FOR ROOM  

E-Print Network (OSTI)

the age of eighteen (18). A. OFFER Kent State University offers to furnish space, in consideration(s) marked on the application portion of this document. This contract is for space in the residence halls. This contract is issued for the 2013 summer session(s) marked on the application portion, or balance thereof

Khan, Javed I.


Department of Residence Services 2011 SUMMER RESIDENCE HALL CONTRACT FOR ROOM  

E-Print Network (OSTI)

the age of eighteen (18). A. OFFER Kent State University offers to furnish space, in consideration(s) marked on the application portion of this document. This contract is for space in the residence halls. This contract is issued for the 2011 summer session(s) marked on the application portion, or balance thereof

Khan, Javed I.


Private Water Well Education for Adult Residents of Oklahoma.  

E-Print Network (OSTI)

??The scope of this study involved an investigation into the education of the adult residents of Oklahoma regarding private water wells. The groundwater supply for (more)

Robbins, Sharon Marie



The Denver Energy Challenge- Serving Moderate Income Residents  

Energy.gov (U.S. Department of Energy (DOE))

Provides an overview of the Denver Energy Challenge and how services were expanded to moderate income residents including challenges and next steps.


Effect of process parameters on metal transfer of hyperbaric GMAW of duplex stainless steels  

SciTech Connect

This work presents the preliminary results of a comprehensive and systematic evaluation of current rise and fall rates as well as shielding gas composition and their affect on the metal transfer, when duplex stainless steels are GMA welded under hyperbaric conditions using the short circuit metal transfer mode. The evaluation of the test results are based on an examination of the welding process signals recorded on a transient recorder. Over a time period of 500 ms, the signal was measured to assess the process instability, current rise and fall rates and their inter-relationship. The results presented in this study indicate that for a given welding condition, the appropriate selection of current rise and fall rates can minimize the effect of instabilities caused by high ambient pressure. The presence of active gases in the shielding did not significantly affect the metal transfer behavior. All the experiments described in this work have been carried out in the hyperbaric test facilities of the GKSS-Forschungszentrum in Germany.

Olsen, J.M.; Dos Santos, J.F. [GKSS-Forschungszentrum Geesthacht GmbH (Germany); Richardson, I.M. [Cranfield Univ. (United Kingdom)


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Why Become a Master By encouraging Connecticut residents to recycle  

E-Print Network (OSTI)

Why Become a Master Composter? By encouraging Connecticut residents to recycle organic waste Service Matt Freund, Freund's Farm Bob Jacquier, Laurelbrook Farm Connecticut Recycling Coalition The UConn Home & Garden Education Center is an informational resource for the residents of Connecticut who

Holsinger, Kent


Why Become a Master By encouraging Connecticut residents to recycle  

E-Print Network (OSTI)

Why Become a Master Composter? By encouraging Connecticut residents to recycle organic waste Connecticut Recycling Coalition The UConn Home & Garden Education Center is an informational resource for the residents of Connecticut who are urged to contact us for accurate, thorough and timely information on home

Alpay, S. Pamir


Nonprofit Helps Kansas City Residents Conserve Energy | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nonprofit Helps Kansas City Residents Conserve Energy Nonprofit Helps Kansas City Residents Conserve Energy Nonprofit Helps Kansas City Residents Conserve Energy April 30, 2010 - 2:32pm Addthis Metropolitan Energy Center helps Kansas City residents manage and control their energy use. | File illustration Metropolitan Energy Center helps Kansas City residents manage and control their energy use. | File illustration Stephen Graff Former Writer & editor for Energy Empowers, EERE To make her home energy efficient, the first thing Rita Norton had to do was "tighten the envelope." That meant stuffing more insulation between her walls and sealing cracks at the foundation to keep any unwanted air from sneaking in or valuable air from seeping out. "That's the phrase they call it," says the former


Establishing a Residence for a Relocation Incentive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Establishing a Residence for a Relocation Incentive Establishing a Residence for a Relocation Incentive Establishing a Residence for a Relocation Incentive POLICY GUIDANCE MEMORANDUM #14: An employee who is relocating to a new commuting area must establish a temporary or permanent residence before s/he is eligible for a payment of a relocation incentive. Neither OPM's regulations or guidance nor GSA's Federal Travel Regulation address this issue. DOE guidance is as follows. This guidance will be incorporated in the DOE Handbook on Recruitment and Retention Incentives as an appendix during the next update. Establishing a Residence for a Relocation Incentive Responsible Contacts Bruce Murray HR Policy Advisor E-mail bruce.murray@hq.doe.gov Phone 202-586-3372 More Documents & Publications DOE Handbook on Recruitment and Retention Incentives


Establishing a Residence for a Relocation Incentive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Establishing a Residence for a Relocation Incentive Establishing a Residence for a Relocation Incentive Establishing a Residence for a Relocation Incentive POLICY GUIDANCE MEMORANDUM #14: An employee who is relocating to a new commuting area must establish a temporary or permanent residence before s/he is eligible for a payment of a relocation incentive. Neither OPM's regulations or guidance nor GSA's Federal Travel Regulation address this issue. DOE guidance is as follows. This guidance will be incorporated in the DOE Handbook on Recruitment and Retention Incentives as an appendix during the next update. Establishing a Residence for a Relocation Incentive Responsible Contacts Bruce Murray HR Policy Advisor E-mail bruce.murray@hq.doe.gov Phone 202-586-3372 More Documents & Publications FAQ: Relocation Expenses


Florida Residents See Energy Bill Reductions | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Florida Residents See Energy Bill Reductions Florida Residents See Energy Bill Reductions Florida Residents See Energy Bill Reductions January 27, 2010 - 3:42pm Addthis Indiantown, Florida, has a lot of small-town charm. Its 7,000 residents have acres of citrus groves but only one traffic light in the town. It might be small in size, but Indiantown Non-Profit Housing is making quite an impact across its region. This nonprofit weatherizes the homes of qualifying residents free of charge, and demand for its services is on the rise. "One of the best outcomes is that we can hire additional employees" says Director Donna Carman, referring to the $5.2 million in Recovery Act funds Indiantown Non-Profit Housing has received. The staff has more than doubled from five to 16, meaning that Floridians like 72-year-old Edith


Pulling Apart Molecular Magnetism  

E-Print Network (OSTI)

A single molecule constitutes the ultimate nanometer-scale object through which electronic transport can take place. Being so small, molecules share many characteristics with atoms, such as discrete quantized energy spectra ...

Jarillo-Herrero, Pablo


Residence Rates 2014-2015 Effective February 1, 2014  

E-Print Network (OSTI)

(furnished) 路 Apartment style 路 Assoc. Fees: $25 路 Heat & water utilities included. Electricity NOT included; billed monthly. 路 Wireless internet included 路 Multiple-bedroom units are rented on a per-space basis* 路 Wireless internet included 路 Heat, water & power utilities included 路 Multiple-bedroom units are rented

Glover, Mark



E-Print Network (OSTI)

UNIVERSITY OF CONNECTICUT PRIMARY CARE INTERNAL MEDICINE RESIDENCY PROGRAM POSITIONS OBTAINED Alikhan 2009 Connecticut UConn PCIM Chief Resident Sharon Dowell 2009 Connecticut UConn PCIM Chief Hospitalist Mehdi Makki 2009 Connecticut UConn PCIM Chief Resident Edgar Naut 2009 Connecticut Hospitalist

Oliver, Douglas L.


Vale Residences Space Heating Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Residences Space Heating Low Temperature Geothermal Facility Residences Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Vale Residences Space Heating Low Temperature Geothermal Facility Facility Vale Residences Sector Geothermal energy Type Space Heating Location Vale, Oregon Coordinates 43.9821055掳, -117.2382311掳 Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Lakeview Residences Space Heating Low Temperature Geothermal Facility |  

Open Energy Info (EERE)

Lakeview Residences Space Heating Low Temperature Geothermal Facility Lakeview Residences Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Lakeview Residences Space Heating Low Temperature Geothermal Facility Facility Lakeview Residences Sector Geothermal energy Type Space Heating Location Lakeview, Oregon Coordinates 42.1887721掳, -120.345792掳 Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Van Norman Residences Space Heating Low Temperature Geothermal Facility |  

Open Energy Info (EERE)

Norman Residences Space Heating Low Temperature Geothermal Facility Norman Residences Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Van Norman Residences Space Heating Low Temperature Geothermal Facility Facility Van Norman Residences Sector Geothermal energy Type Space Heating Location Thermopolis, Wyoming Coordinates 43.6460672掳, -108.2120432掳 Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Mississippi Residents Save Through Appliance Rebate Program | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Residents Save Through Appliance Rebate Program Residents Save Through Appliance Rebate Program Mississippi Residents Save Through Appliance Rebate Program October 27, 2010 - 11:39am Addthis Mississippi's Cowboy Maloney stores saw increases of up to 90 percent on front-loading washing machines in April. | Photo courtesy of Flickr user Andrew Kelsall via the Creative Commons license Mississippi's Cowboy Maloney stores saw increases of up to 90 percent on front-loading washing machines in April. | Photo courtesy of Flickr user Andrew Kelsall via the Creative Commons license Lindsay Gsell What are the key facts? Mississippi rebate program issues 37,430 rebates to residents. Recovery Act helped consumers conserve energy and save millions of dollars. Program demand helps one Mississippi retailer see 90% increase in


Developing resident leadership : theory and practice in Boston's neighborhoods  

E-Print Network (OSTI)

For decades, Boston residents have worked together and organized to strengthen and protect their neighborhoods, often in response to encroaching government policy and local development. The South End's Villa Victoria housing ...

Alleyne, Kim L



Residence Hall Handbook Policies, Regulations, and Standards of Conduct  

E-Print Network (OSTI)

, educational community does not tolerate physical or psychological threats, harassment, intimidation1 Residence Hall Handbook Policies, Regulations, and Standards of Conduct Updated August 20, 2012 community member who works, lives, studies, teaches, does research, conducts business or is involved

Stowell, Michael


Residence Hall Handbook Policies, Regulations, and Standards of Conduct  

E-Print Network (OSTI)

, educational community does not tolerate physical or psychological threats, harassment, intimidation1 Residence Hall Handbook Policies, Regulations, and Standards of Conduct As members community member who works, lives, studies, teaches, does research, conducts business or is involved

Vasilyev, Oleg V.


Klamath Residence (500) Space Heating Low Temperature Geothermal Facility |  

Open Energy Info (EERE)

Residence (500) Space Heating Low Temperature Geothermal Facility Residence (500) Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Klamath Residence (500) Space Heating Low Temperature Geothermal Facility Facility Klamath Residence (500) Sector Geothermal energy Type Space Heating Location Klamath Falls, Oregon Coordinates 42.224867掳, -121.7816704掳 Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


DOE's Entrepreneur in Residence (EIR) Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Entrepreneur in Residence (EIR) Program Entrepreneur in Residence (EIR) Program DOE's Entrepreneur in Residence (EIR) Program October 24, 2007 - 3:45pm Addthis "It is in our vital interest to diversify America's energy supply - and the way forward is through technology." - President George W. Bush, 2007 State of the Union Address DOE's Commercialization Team The Commercialization Team is focused on broad market adoption of clean energy technologies. Crucial to this effort, is supporting the move of these technologies from DOE's National Laboratories to the private sector. About the EIR Program The Entrepreneur in Residence (EIR) Program will bring venture capital sponsored entrepreneurs into three of DOE's National Laboratories to develop plans to commercialize new clean energy technologies. The


Development of an instrument to assess residents? perceptions of equity  

E-Print Network (OSTI)

Development of an Instrument to Assess Residents? Perceptions of Equity. (December 2004) Stephanie Theresa West, B.S., Auburn University; M.S., Georgia Southern University Chair of Advisory Committee: Dr. John L. Crompton This study examined equity...

West, Stephanie Theresa



In-Training Practice Patterns of Combined Emergency Medicine/Internal Medicine Residents, 2003-2007  

E-Print Network (OSTI)

medicine residents during training. Ann Int Med. 2006;145:et al Table 3. Perceived training deficits of current (2008)specialty elective training during residency Administrative

Kessler, Chad S; Gonzalez, Andrew A; Stallings, Leonard A; Templeman, Todd A


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

RESIDENT FISH SECTION 10 FISH AND WILDLIFE PROGRAM 10-1 September 13, 1995 Section 10 RESIDENT FISH Resident fish are freshwater fish that live and migrate within the rivers, streams and lakes of the Columbia River Basin, but do not travel to the ocean. Resident fish exist throughout the basin


Office of Payroll Processing Requirements Business and Finance Non-Resident Alien  

E-Print Network (OSTI)

Office of Payroll Processing Requirements Business and Finance Non-Resident Alien The Ohio State University | Office of the Controller Page 1 of 2 Payroll Processing Guidelines 颅 Non-Resident Alien Revised May 2010 What should I know about payroll processing for a non-resident alien? 路 A Non-Resident Alien



E-Print Network (OSTI)

HUMAN RESOURCES MANUAL SECTION 6: GRADUATE ASSISTANT, VET RESIDENT, FELLOWSHIP GRANT TRAINEE 1 | P by the academic Department Head, the College and the Graduate School, with final appointment approval granted RESIDENT, FELLOWSHIP GRANT TRAINEE 2 | P a g e S e c t i o n 6 Veterinary Residents Veterinary residents


DOE Announces Expansion and Solicitation for Entrepreneur in Residence  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Expansion and Solicitation for Entrepreneur in Expansion and Solicitation for Entrepreneur in Residence Program DOE Announces Expansion and Solicitation for Entrepreneur in Residence Program November 19, 2008 - 4:58pm Addthis Entrepreneurs Accelerate Deployment of Advanced Clean Energy Technologies from DOE's Labs to the Marketplace WASHINGTON - U.S. Department of Energy (DOE) Secretary Samuel W. Bodman today announced a competitive solicitation for five venture capital firms to participate in the expansion of DOE's Entrepreneur in Residence (EIR) program, that aims to accelerate deployment and commercialization of advanced clean energy technologies from DOE's National Laboratories. EIR furthers President Bush's comprehensive strategy to reduce our nation's dependence on foreign oil and reduce greenhouse gas emissions by empowering


Educating Glendale, Arizona Residents About Energy Savings | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Educating Glendale, Arizona Residents About Energy Savings Educating Glendale, Arizona Residents About Energy Savings Educating Glendale, Arizona Residents About Energy Savings August 10, 2010 - 1:00pm Addthis A portion of Glendale, Arizona's Energy Efficiency and Conservation Block Grant was used to purchase programmable thermostats. | Department of Energy Photo | A portion of Glendale, Arizona's Energy Efficiency and Conservation Block Grant was used to purchase programmable thermostats. | Department of Energy Photo | Kevin Craft City officials in Glendale, Ariz. had a problem. Citizens were constantly asking them for information on how to reduce home energy consumption, but they did not have a staff member to answer the questions. That changed in June 2009, when the city hired Nancy Schwab to be the official energy education specialist.


Tallahassee Program Encourages Residents to Build Green | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tallahassee Program Encourages Residents to Build Green Tallahassee Program Encourages Residents to Build Green Tallahassee Program Encourages Residents to Build Green June 16, 2010 - 12:56pm Addthis The city of Tallahassee recently launched a Residential Green Building Program that city officials predict will help reduce the city's carbon footprint and stimulate the local economy. Cynthia Barber, executive director of Tallahassee's office of Environmental Policy and Energy Resources, says an increase in green construction will provide employment opportunities for trade specialists. "Workers, who specialize in green services, such as homebuilders and evaluators, will get more opportunities to construct green homes and carry out certifications," says Barber. "They will benefit as a result of having


Educating Glendale, Arizona Residents About Energy Savings | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Educating Glendale, Arizona Residents About Energy Savings Educating Glendale, Arizona Residents About Energy Savings Educating Glendale, Arizona Residents About Energy Savings August 10, 2010 - 1:00pm Addthis A portion of Glendale, Arizona's Energy Efficiency and Conservation Block Grant was used to purchase programmable thermostats. | Department of Energy Photo | A portion of Glendale, Arizona's Energy Efficiency and Conservation Block Grant was used to purchase programmable thermostats. | Department of Energy Photo | Kevin Craft City officials in Glendale, Ariz. had a problem. Citizens were constantly asking them for information on how to reduce home energy consumption, but they did not have a staff member to answer the questions. That changed in June 2009, when the city hired Nancy Schwab to be the official energy education specialist.


Costs for Academic Year 2012-2013 Tennessee Resident  

E-Print Network (OSTI)

Costs for Academic Year 2012-2013 Tennessee Resident Undergraduate tuition & fees $9,092 Graduate an average composite ACT score of 29.0. Alumni Information Graduates of the BS curricula offered Mechanical Engineering Nuclear Engineering Master of Science: Aerospace Engineering Aviation Systems

Wang, Xiaorui "Ray"


Division of Human Resources Pay to Non Resident Aliens  

E-Print Network (OSTI)

Division of Human Resources Pay to Non Resident Aliens Questions (813) 974-7955 Payroll a payment is made to a nonresident alien (NRA) or to a third party on their behalf. The following is a list is not comprehensive; therefore, prior to processing any type payment for a nonresident alien it is imperative that you

Meyers, Steven D.


Influence of Polymer Viscoelasticity on the Residence Distributions of Extruders  

E-Print Network (OSTI)

Keywords: twin-screw extruder, residence distributions, rheology, elasticity, polypro- pylene, polyethylene. An extruder is composed of a barrel that houses screws or shafts that convey and mix material over the length of the machine. An intermeshing, corotating twin-screw extruder (CoTSE) has two screws composed of different

Raghavan, Srinivasa



E-Print Network (OSTI)

APPLICATION FOR NON-RESIDENT TAX OFFSET CREDIT (For Missouri Taxpayers) I wish to apply for the Tax as of 6/18/2014 is Ellis Library 颅 Room 202) The following conditions must be met before any tax credit. Tax Offset Credit form must be completed, signed and notarized with appropriate supporting

Taylor, Jerry


Residence Hall Handbook Policies, Regulations, and Standards of Conduct  

E-Print Network (OSTI)

does not tolerate physical or psychological threats, harassment, intimidation, or violence directed1 Residence Hall Handbook Policies, Regulations, and Standards of Conduct Updated August 2013 member who works, lives, studies, teaches, does research, conducts business or is involved in the living

Stowell, Michael


Sustainability Evaluation of Resident Building in Bosnia and Herzegovina  

E-Print Network (OSTI)

. This evaluation will be based on the selection of a number of resident buildings as the potential options appropriate for the geographic, climate and cultural region. With multi-criteria method based on the selected number of indicators the sustainability index...

Zlomusica, E.; Afgan, N.



Hazard Assessment of Chemical Air Contaminants Measured in Residences  

NLE Websites -- All DOE Office Websites (Extended Search)

Hazard Assessment of Chemical Air Contaminants Measured in Residences Hazard Assessment of Chemical Air Contaminants Measured in Residences Title Hazard Assessment of Chemical Air Contaminants Measured in Residences Publication Type Journal Article LBNL Report Number LBNL-3650E Year of Publication 2011 Authors Logue, Jennifer M., Thomas E. McKone, Max H. Sherman, and Brett C. Singer Journal Indoor Air Volume 21 Start Page 92 Issue 2 Pagination 92-109 Date Published 04/2011 Keywords resave Abstract Identifying air pollutants that pose a potential hazard indoors can facilitate exposure mitigation. In this study, we compiled summary results from 77 published studies reporting measurements of chemical pollutants were representative of concentrations in residences in the United States. These data were used to calculate representative mid-range and upper bound concentrations relevant to chronic exposures for 267 pollutants and representative peak concentrations relevant to acute exposures for 5 activity-associated pollutants. Representative concentrations are compared to available chronic and acute health standards for 97 pollutants. Fifteen pollutants are identified as contaminants of concern for chronic health effects in a large fraction of homes. Nine pollutants are identified as potential chronic health hazards in a substantial minority of homes and an additional nine are identified as potential hazards in a very small percentage of homes. Nine pollutants are identified as priority hazards based on robustness of reported concentration data and fraction of residences that appear to be impacted: acetaldehyde; acrolein; benzene; 1,3- butadiene; 1,4-dichlorobenzene; formaldehyde; naphthalene; nitrogen dioxide; and PM2.5. Activity-based emissions are shown to pose potential acute health hazards for PM2.5, formaldehyde, CO, chloroform, and NO2.


Fostering a Translational Research Attitude Among Residents in Radiology/Nuclear Medicine  

Science Journals Connector (OSTI)

Innovative approaches to resident research training development are essential when the training is to supplement existing Radiology and Nuclear Medicine resident training programs so as not to overburden them and...

Aaron Fenster; Rethy K. Chhem



The Enzyme-mimic Activity of Ferric Nano-Core Residing in Ferritin...  

NLE Websites -- All DOE Office Websites (Extended Search)

The Enzyme-mimic Activity of Ferric Nano-Core Residing in Ferritin and Its Biosensing Applications. The Enzyme-mimic Activity of Ferric Nano-Core Residing in Ferritin and Its...


Office of Residential Life PreCollege Summer Resident Advisor Contract 2014  

E-Print Network (OSTI)

Office of Residential Life PreCollege Summer Resident Advisor Contract 颅 2014 This contract provides information supplemental to that found in the PreCollege Summer Program Resident Advisor Job the position of Resident Advisor for the summer of 2014. (print name) In accepting this position, I agree

Royer, Dana



E-Print Network (OSTI)

RESIDENT ALIEN VS NONRESIDENT ALIEN STATUS Immigration And Tax Law Definitions This handout. IMMIGRATION LAW: A nonresident alien is a person who is not a citizen or permanent resident of the U.S. who. A resident alien, for IMMIGRATION purposes, is the same as an immigrant, or a "greed card" holder--a non

Kasman, Alex


Annual Fire Report Page 1 of 4 Residence Hall/Historic Houses Fire Protection Equipment  

E-Print Network (OSTI)

Annual Fire Report Page 1 of 4 Residence Hall/Historic Houses Fire Protection Equipment 2012 Residence Hall/Historic Houses Fire Protection Equipment 2012 Calendar Year 24 Bull Street Annex-House X X X Calendar Year College of Charleston Residence Halls and Historic Housing Facilities Fire alarm monitoring

Kasman, Alex


Short residence time coal liquefaction process including catalytic hydrogenation  

DOE Patents (OSTI)

Normally solid dissolved coal product and a distillate liquid product are produced by continuously passing a feed slurry comprising raw feed coal and a recycle solvent oil and/or slurry together with hydrogen to a preheating-reaction zone (26, alone, or 26 together with 42), the hydrogen pressure in the preheating-reaction zone being at least 1500 psig (105 kg/cm.sup.2), reacting the slurry in the preheating-reaction zone (26, or 26 with 42) at a temperature in the range of between about 455.degree. and about 500.degree. C. to dissolve the coal to form normally liquid coal and normally solid dissolved coal. A total slurry residence time is maintained in the reaction zone ranging from a finite value from about 0 to about 0.2 hour, and reaction effluent is continuously and directly contacted with a quenching fluid (40, 68) to substantially immediately reduce the temperature of the reaction effluent to below 425.degree. C. to substantially inhibit polymerization so that the yield of insoluble organic matter comprises less than 9 weight percent of said feed coal on a moisture-free basis. The reaction is performed under conditions of temperature, hydrogen pressure and residence time such that the quantity of distillate liquid boiling within the range C.sub.5 -454.degree. C. is an amount at least equal to that obtainable by performing the process under the same condition except for a longer total slurry residence time, e.g., 0.3 hour. Solvent boiling range liquid is separated from the reaction effluent (83) and recycled as process solvent (16). The amount of solvent boiling range liquid is sufficient to provide at least 80 weight percent of that required to maintain the process in overall solvent balance.

Anderson, Raymond P. (Overland Park, KS); Schmalzer, David K. (Englewood, CO); Wright, Charles H. (Overland Park, KS)


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Short residence time coal liquefaction process including catalytic hydrogenation  

DOE Patents (OSTI)

Normally solid dissolved coal product and a distillate liquid product are produced by continuously passing a feed slurry comprising raw feed coal and a recycle solvent oil and/or slurry together with hydrogen to a preheating-reaction zone, the hydrogen pressure in the preheating-reaction zone being at least 1,500 psig (105 kg/cm[sup 2]), reacting the slurry in the preheating-reaction zone at a temperature in the range of between about 455 and about 500 C to dissolve the coal to form normally liquid coal and normally solid dissolved coal. A total slurry residence time is maintained in the reaction zone ranging from a finite value from about 0 to about 0.2 hour, and reaction effluent is continuously and directly contacted with a quenching fluid to substantially immediately reduce the temperature of the reaction effluent to below 425 C to substantially inhibit polymerization so that the yield of insoluble organic matter comprises less than 9 weight percent of said feed coal on a moisture-free basis. The reaction is performed under conditions of temperature, hydrogen pressure and residence time such that the quantity of distillate liquid boiling within the range C[sub 5]-454 C is an amount at least equal to that obtainable by performing the process under the same condition except for a longer total slurry residence time, e.g., 0.3 hour. Solvent boiling range liquid is separated from the reaction effluent and recycled as process solvent. The amount of solvent boiling range liquid is sufficient to provide at least 80 weight percent of that required to maintain the process in overall solvent balance. 6 figs.

Anderson, R.P.; Schmalzer, D.K.; Wright, C.H.



Hazard Assessment of Chemical Air Contaminants Measured in Residences  

SciTech Connect

Identifying air pollutants that pose a potential hazard indoors can facilitate exposure mitigation. In this study, we compiled summary results from 77 published studies reporting measurements of chemical pollutants in residences in the United States and in countries with similar lifestyles. These data were used to calculate representative mid-range and upper bound concentrations relevant to chronic exposures for 267 pollutants and representative peak concentrations relevant to acute exposures for 5 activity-associated pollutants. Representative concentrations are compared to available chronic and acute health standards for 97 pollutants. Fifteen pollutants appear to exceed chronic health standards in a large fraction of homes. Nine other pollutants are identified as potential chronic health hazards in a substantial minority of homes and an additional nine are identified as potential hazards in a very small percentage of homes. Nine pollutants are identified as priority hazards based on the robustness of measured concentration data and the fraction of residences that appear to be impacted: acetaldehyde; acrolein; benzene; 1,3-butadiene; 1,4-dichlorobenzene; formaldehyde; naphthalene; nitrogen dioxide; and PM{sub 2.5}. Activity-based emissions are shown to pose potential acute health hazards for PM{sub 2.5}, formaldehyde, CO, chloroform, and NO{sub 2}.

Logue, J.M.; McKone, T.E.; Sherman, M. H.; Singer, B.C.



Free Energy Profiles of Base Flipping in Intercalative Polycyclic Aromatic Hydrocarbon-Damaged DNA Duplexes: Energetic and Structural Relationships to Nucleotide Excision Repair Susceptibility  

Science Journals Connector (OSTI)

Free Energy Profiles of Base Flipping in Intercalative Polycyclic Aromatic Hydrocarbon-Damaged DNA Duplexes: Energetic and Structural Relationships to Nucleotide Excision Repair Susceptibility ... These structural differences produce different computed van der Waals stacking interaction energies between the flipping partner base with the lesion aromatic ring system and adjacent bases; we find that the better the stacking, the higher the relative flipping free energy barrier and hence lower flipping probability. ... We emphasize, however, that the brief MD only served the purpose of equilibrating the model but is far too short for analyses of the constellation of protein朌NA interactions that stabilize the structure. ...

Yuqin Cai; Han Zheng; Shuang Ding; Konstantin Kropachev; Adam G. Schwaid; Yijin Tang; Hong Mu; Shenglong Wang; Nicholas E. Geacintov; Yingkai Zhang; Suse Broyde



Charter Oak Apartments East Campus  

E-Print Network (OSTI)

43 44 46 47 48 49 50 51 52 53 54 55 56 57 Hillside Road Hunting Lodge Road Separatist Road 61 62 63, I, L, W, X, Y Visitor Parking: Metered / Parking Garage Employee Parking: Area 1 Area 2 Area 3 Horsebarn Hill Area Inset #12;

Holsinger, Kent


First Author Research Productivity of United States Radiation Oncology Residents: 2002-2007  

SciTech Connect

Purpose: Participation in investigative research is a required element of radiation oncology residency in the United States. Our purpose was to quantify the first author research productivity of recent U.S. radiation oncology residents during their residency training. Methods and Materials: We performed a computer-based search of PubMed and a manual review of the proceedings of the annual meetings of the American Society for Therapeutic Radiology and Oncology to identify all publications and presented abstracts with a radiation oncology resident as the first author between 2002 and 2007. Results: Of 1,098 residents trained at 81 programs, 50% published {>=}1 article (range, 0-9), and 53% presented {>=}1 abstract (range, 0-3) at an American Society for Therapeutic Radiology and Oncology annual meeting. The national average was 1.01 articles published and 1.09 abstracts presented per resident during 4 years of training. Of 678 articles published, 82% represented original research and 18% were review articles. Residents contributed 15% of all abstracts at American Society for Therapeutic Radiology and Oncology annual meetings, and the resident contribution to orally presented abstracts increased from 12% to 21% during the study period. Individuals training at programs with >6 residents produced roughly twice as many articles and abstracts. Holman Research Pathway residents produced double the national average of articles and abstracts. Conclusion: Although variability exists among individuals and among training programs, U.S. radiation oncology residents routinely participate in investigative research suitable for publication or presentation at a scientific meeting. These data provide national research benchmarks that can assist current and future radiation oncology residents and training programs in their self-assessment and research planning.

Morgan, Peter B. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)], E-mail: peter.morgan@fccc.edu; Sopka, Dennis M. [Drexel University College of Medicine, Philadelphia, PA (United States); Kathpal, Madeera [Division of Neurosurgery, Philadelphia College of Osteopathic Medicine, Philadelphia, PA (United States); Haynes, Jeffrey C. [Department of Radiation Oncology, Hospital of University of Pennsylvania, Philadelphia, PA (United States); Lally, Brian E.; Li, Linna [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)



Role of the resid solvent in catalytic coprocessing with finely divided catalysts. Final report  

SciTech Connect

The role of the resid in coprocessing coal with petroleum resid has been investigated using model systems. The primary question being investigated is whether resid is participating in reactions with coal or if the resid is acting simply as a diluent. Since hydrogen transfer is an important mechanism by which solvent interacts with coal, hydrogen transfer between naphthenes, saturated alicyclic molecules, that represent resid and aromatic molecules that represent coal were examined in reactions with a high pressure H{sub 2} atmosphere that is typical of actual coprocessing. The model naphthene, perhydropyrene, was chosen as the donor species and the models, anthracene, phenanthrene, and benzophenone, were chosen as the acceptor species. Coprocessing reactions of coal with petroleum resid were performed to evaluate the effect of the chemistry of both constituents on coal conversion and the upgrading of the heavy resid. Three heavy resids, Maya, FHC-623 and Manji were used as the whole resid and as fractions that has been separates into hexane solubles and saturate fractions.

Curtis, C.W.



The Influence of Residence Time and Organic Acids on the Desorption of Goethite.  

E-Print Network (OSTI)

??The Influence of Residence Time and Organic Acids on the Desorption of Trace Metals from Goethite Leslie James Glover II Committee Chair: M.J. Eick Crop (more)

Glover II, Leslie James



Energy retrofitting of a typical old Danish multi-family building to a 搉early-zero energy building based on experiences from a test apartment  

Science Journals Connector (OSTI)

The purpose of the research described in this paper was to demonstrate that an old Danish multi-family building built in 1896 could be retrofitted to a 搉early-zero energy building. Three types of retrofit measures were implemented in a 搕est apartment to obtain practical experiences. The first measure was the installation of two different types of interior insulation, specifically, an insulation component consisting of an aerogel杝tone wool mixture or vacuum insulation panels. The second measure related to the retrofit of windows in which five measures were completed that consisted of applying a secondary frame, a sash mounted on the frame or to coupled frames. The third measure consisted of installing a decentralised mechanical ventilation system with heat recovery. The results showed that following the retrofit the building's theoretical energy use diminished from 162.5爇Wh/(m2爕ear) to 51.5爇Wh/(m2爕ear), corresponding to a reduction in energy use of 68%. The theoretical energy use after retrofitting fulfilled the requirements for new buildings in Denmark. The practical experiences that were retained following the retrofit were that the ventilation system ought to be installed with low noise components, insulation materials must be sized and cut to fit on site, and that new windows were selected.

Martin Morelli; Leif R鴑by; Svend Erik Mikkelsen; Maja G. Minzari; Troels Kildemoes; Henrik M. Tommerup



welcome to university residences Boiler Gold Rush Check-In...........................Saturday, August 13 and  

E-Print Network (OSTI)

welcome to university residences #12;Boiler Gold Rush Check-In...........................Saturday, August 13 and Sunday, August 14, 2011 Boiler Gold Rush residence hall systems in the United States. weLcomE! 1 #12;Boiler GoLD Rush ParticiPants Your regular

Fern谩ndez-Juricic, Esteban


90Sr Internal Irradiation of Population Residing in North-East Region of Ukraine  

Science Journals Connector (OSTI)

......Internal Irradiation of Population Residing in North-East Region of Ukraine L. Kalmykov G. Paschenko E. Gur The 90Sr content was investigated for residents of north-east Ukraine (Kharkov region) before (in 1963-1973) and after (in 1992-1993......

L. Kalmykov; G. Paschenko; E. Gur



Using Height Sensors for Biometric Identification in Multi-resident Homes  

E-Print Network (OSTI)

Using Height Sensors for Biometric Identification in Multi-resident Homes Vijay Srinivasan, John the doorways in a home. Height sensors are cheap, are convenient for the residents, are simple to install in an existing home, and are perceived to be less invasive than cameras or microphones. Height is typically only

Stankovic, John A.


Copy 1 Purchasing Copy 2 Residence Hall Director Request for Reimbursement  

E-Print Network (OSTI)

copy to the Purchasing Office. 3. The Purchasing Director will review the "Request for RequestCopy 1 颅 Purchasing Copy 2 颅 Residence Hall Director MU 6/94 Request for Reimbursement For Damages: _________________________________________________________________________________________ _________________________________________________________________________________________ _________________________________________________________________________________________ #12;Copy 1 颅 Purchasing Copy 2 颅 Residence Hall Director PROCEDURES FOR REQUESTING REIMBURSEMENT

Hardy, Christopher R.


Antalya Residents Attitudes Regarding the Impacts of All-Inclusive Resorts in the Turkish Coastal Destination  

E-Print Network (OSTI)

to such leakage. In an effort to better understand AIR, the purpose of this study was to examine how residents perceive the impacts of AIR in Antalya, Turkey. In so doing, a further focus of the work was looking at the interrelationships between residents...

Erul, Emrullah



Autonomous Crack Displacement Monitoring of a Residence Near a Quarry David E. Kosnik, Northwestern University  

E-Print Network (OSTI)

Autonomous Crack Displacement Monitoring of a Residence Near a Quarry David E. Kosnik, Northwestern remote mon- itoring of cracks in interior and exterior walls of a residence near a limestone quarry for construction and raw materials. For instance, neighbors of road aggregate quarries often perceive


Commuting behavior of western U.S. residents  

SciTech Connect

Estimation and interpretation of commutes to work has been studied extensively with respect to gender, race, and income. While the literature is extensive in these areas, there has been little research on regional differences between US states and territories. Since data which reports the commute to work is in average minutes, the distance traveled is estimated using estimates of the distance between home and work county centroids. The models differ in estimation of in-county commutes. The first assumes that the commute is equal to the radius of the county and the second estimates the commute as a weighted distance based on place location. Two data sets are compared, US National Guard data and US census data. Goal of this paper is to make conclusions about the commuting behavior of western residents through the use of these estimates, and therefore to provide a estimation method for distance commutes which can be used in further research. It is concluded that the radius method of estimation may be an over estimation, in particular in the western states. Since the non-western states are generally more homogeneously populated, this overestimation is not observed. It is recommended that the place location method be used for similar research, in particular studies dealing with western states. Suggestions are made for further research and recommendations are made for the US Army National Guard in regards to recruiting.

Caviglia, J. [Tennessee Univ., Knoxville, TN (United States)]|[Oak Ridge National Lab., TN (United States)



How the Recovery Act and Community Organizing Are Saving the Residents of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

How the Recovery Act and Community Organizing Are Saving the How the Recovery Act and Community Organizing Are Saving the Residents of San Mateo County Major Cash How the Recovery Act and Community Organizing Are Saving the Residents of San Mateo County Major Cash May 25, 2011 - 9:44am Addthis Steve, a resident of Hillsborough, learned about his home's energy use by receiving a comprehensive home energy assessment. Johanna Sevier Project Officer, Golden Field Office What does this project do? San Mateo County residents can get up to $4,000 per household County expects to upgrade 750 homes and reduce home energy use by an estimated 35 billion BTU's Home energy upgrade efforts expected to create 150 new jobs Obtaining a home energy upgrade is increasingly affordable in California, thanks to an array of financial incentives and rebates. In fact, residents


Results of the 2012-2013 Association of Residents in Radiation Oncology (ARRO) Job Search and Career Planning Survey of Graduating Residents in the United States  

SciTech Connect

Purpose/Objective(s): To determine the timeline used by postgraduate year (PGY)-5 radiation oncology residents during the job application process and the factors most important to them when deciding on a first job. Methods and Materials: In 2012 and 2013, the Association of Residents in Radiation Oncology conducted a nationwide electronic survey of PGY-5 radiation oncology residents in the United States during the final 2 months of their training. Descriptive statistics are reported. In addition, subgroup analysis was performed. Results: Surveys were completed by 180 of 314 residents contacted. The median time to start networking for the purpose of employment was January PGY-4; to start contacting practices, complete and upload a curriculum vitae to a job search website, and use the American Society of Radiation Oncology Career Center was June PGY-4; to obtain letters of recommendation was July PGY-5; to start interviewing was August PGY-5; to finish interviewing was December PGY-5; and to accept a contract was January PGY-5. Those applying for a community position began interviewing at an earlier average time than did those applying for an academic position (P=.04). The most important factors to residents when they evaluated job offers included (in order from most to least important) a collegial environment, geographic location, emphasis on best patient care, quality of support staff and facility, and multidisciplinary approach to patient care. Factors that were rated significantly different between subgroups based on the type of position applied for included adequate mentoring, dedicated research time, access to clinical trials, amount of time it takes to become a partner, geographic location, size of group, starting salary, and amount of vacation and days off. Conclusions: The residents' perspective on the job application process over 2 years is documented to provide a resource for current and future residents and employers to use.

Mattes, Malcolm D., E-mail: mdm9007@nyp.org [Department of Radiation Oncology, New York Methodist Hospital, Brooklyn, New York (United States); Kharofa, Jordan [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Zeidan, Youssef H. [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Tung, Kaity [Department of Radiation Oncology, New York Methodist Hospital, Brooklyn, New York (United States); Gondi, Vinai [Department of Radiation Oncology, University of Wisconsin Comprehensive Cancer Center, Madison, Wisconsin (United States); Department of Radiation Oncology, Central Dupage Hospital Cancer Center, Warrenville, Illinois (United States); Golden, Daniel W. [Department of Radiation Oncology, Pritzker School of Medicine, University of Chicago, Chicago, Illinois (United States)



Cost Implications of Reduced Work Hours and Workloads for Resident Physicians  

Science Journals Connector (OSTI)

...substantial costs were not included. Shifting residents' work to substitute providers or an expanded population of residents would generate the labor costs. Secondary objectives included estimating potential net costs to major teaching hospitals and cost-effectiveness to society specifically, costs per averted... The Institute of Medicine recently made new recommendations to reduce the work hours and workload of residents. This economic analysis suggests that implementation of these recommendations would be costly (annual labor costs, $1.6 billion), but if they are highly effective in reducing patient harm, they may be cost-effective.

Nuckols T.K.Bhattacharya J.Wolman D.M.Ulmer C.Escarce J.J.



Glenn McConnell Residence Hall (240 Students, Co-ed by Floor / Tier 2 Single or Double Occupancy Fee)  

E-Print Network (OSTI)

modular components to allow the resident to customize as desired. The first section has a retractable, a sink, a microwave, a full-size refrigerator, and a pantry to be shared by all residents in the suite. The pantry has individual cabinets for each resident. Extra microwaves and/or mini-refrigerators brought

Kunkle, Tom


GRADUATION/SEPARATION REQUIREMENTS In order to graduate from a residency/fellowship program at the University of Connecticut School of  

E-Print Network (OSTI)

at the University of Connecticut School of Medicine, a resident/fellow must: have passed USMLE Step 3, COMLEX Step at the University of Connecticut School of Medicine. If a resident/fellow leaves a residency/fellowship prior

Oliver, Douglas L.

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Frank Nixon Residence Pool & Spa Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Frank Nixon Residence Pool & Spa Low Temperature Geothermal Facility Frank Nixon Residence Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Frank Nixon Residence Pool & Spa Low Temperature Geothermal Facility Facility Frank Nixon Residence Sector Geothermal energy Type Pool and Spa Location Saratoga, Wyoming Coordinates 41.4549621掳, -106.8064263掳 Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Cha-Ching! How One Missouri Town is Helping Residents Save Money and Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cha-Ching! How One Missouri Town is Helping Residents Save Money Cha-Ching! How One Missouri Town is Helping Residents Save Money and Energy Cha-Ching! How One Missouri Town is Helping Residents Save Money and Energy April 20, 2011 - 9:52am Addthis Workers demonstrate the nitrogen tank used to inflate tires in St. Peters, MO. | Courtesy of the City of St. Peters Workers demonstrate the nitrogen tank used to inflate tires in St. Peters, MO. | Courtesy of the City of St. Peters April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Residents of St. Peters, Missouri are seeing several improvements in their community thanks to a $512,800 Energy Efficiency and Conservation Block Grant (EECBG). The grant, which is funded by the Recovery Act, has allowed the town to implement three energy efficiency programs that will save


Bystander suppression of allergic airway inflammation by lung resident memory CD8+ T cells  

Science Journals Connector (OSTI)

...resident memory CD8+ T cells 10.1073/pnas.0401582101 Benjamin J. Marsland Nicola L. Harris Mali Camberis Manfred Kopf Sarah...146 , 374 -377. 1362635 17 Azzawi, M., Bradley, B., Jeffery, P., Frew, A., Assoufi, B., Collins, J., Durham...

Benjamin J. Marsland; Nicola L. Harris; Mali Camberis; Manfred Kopf; Sarah M. Hook; Graham Le Gros



Identification of hearing loss among residents with dementia: Perceptions of health care aides  

Science Journals Connector (OSTI)

Abstract Effective communication can be difficult when working with individuals with dementia and hearing loss. Given the high prevalence of both dementia and hearing loss among individuals in long term care, direct care providers in this setting, will almost certainly confront frequent communication challenges. To understand health care aide perspectives of caring for residents with dementia and hearing loss, 12 health care aides from five nursing homes participated in audio-recorded, semi-structured interviews. Transcripts were coded and themes were identified. Health care aides reported the difficulties in distinguishing the relative contributions of hearing loss and dementia to communication breakdowns. They reported that familiarity with residents helped them differentiate between sensory versus cognitive impairments in conversations with residents. Although able to identify strategies to support communication, communication difficulty complicated both their provision of care and support of quality of life for residents with dementia and hearing loss. Suggestions for practice and education are provided.

Susan E. Slaughter; Tammy Hopper; Carla Ickert; Daniel F. Erin



Evaluation of Risk to a Groundskeeper, Student, and Resident on the Colorado School of Mines  

E-Print Network (OSTI)

Evaluation of Risk to a Groundskeeper, Student, and Resident on the Colorado School of Mines Site, Golden, Colorado Prepared by The S.M. Stoller Corporation 105 Technology Drive, Suite 190 Broomfield, Colorado 80021 December 11, 2009 #12


Utility of the CORD ECG Database in Evaluating ECG Interpretation by Emergency Medicine Residents  

E-Print Network (OSTI)

the assessment and teaching of ECG skills. It allowed morefor incorporation into an ECG curriculum in EM residencyRESEARCH Utility of the CORD ECG Database in Evaluating ECG

Wong, Hubert E; Kazzi, A Antoine; Langdorf, Mark I



The gated community: residents' crime experience and perception of safety behind gates and fences in the urban area  

E-Print Network (OSTI)

regarding the connections between gated community territory, safety, and crime experience, this study classifies apartment communities according to the conditions of their gating and fencing: gated communities, perceived gated communities, and non...

Kim, Suk Kyung



Representation of the molecular structure of petroleum resid through characterization and Monte Carlo modeling  

SciTech Connect

Increased refining of heavy petroleum feedstocks has led to greater interest in the chemical and physical properties of resid. Although resid has been implicated in many processing difficulties, very little detailed structural information is available in the literature. This is mainly due to the molecular complexity and high initial boiling point of the material, which makes traditional analytical methods difficult or impossible to use. To cope with these problems a stochastic molecular level construction model coupled to a global optimization program has been developed. Structural attributes were defined in terms of aromatic and naphthenic rings and alkyl sidechains. The attributes were quantified using probability density functions (pdfs). By stochastically sampling the attributes many times a large number of molecules representative of a resid were constructed. Using initial starting points estimated from the literature, optimal structural attributes were found in an iterative manner by comparing the predicted resid properties with actual experimental measurements. The program yields detailed structural information in the form of probability density functions for the initial resid.

Trauth, D.M.; Stark, S.M.; Petti, T.F.; Neurock, M.; Yasar, M.; Klein, M.T.



An exploration of sequence specific DNA-duplex/pyrene interactions for intercalated and surface-associated pyrene species. Final report, May 1, 1993--December 31, 1996  

SciTech Connect

The broad objective of this DOE sponsored work on photoinduced electron transfer (ET) within covalently modified DNA was to learn about the rates of Et among various DNA bases and commonly used organic electron donor (D) and acceptor (A) molecules. This hypothesis driven, multidisciplinary project combined skills in modified nucleic acid synthesis and in continuous and time-resolved optical spectroscopies. Covalently modified DNA chemistry as investigated in this program had two specific long term goals. The first was to use experimental and theoretical insights into the mechanisms of electron transfer (ET) reactions to design supramolecular assemblies of redox-active chromophores that function as efficient vectorial ET engines. The second was to construct oligonucleotide probes for real-time monitoring of intracellular processes involving DNA and RNA such as m-RNA expression and translocation. This research project laid the groundwork for studying ET reactions within DNA duplexes by examining the photophysics of uridine nucleosides which are covalently labeled at the 5-position with 1-pyrenyl chromophores.

Netzel, T.L.



Community-Minded Interns at Savannah River Site Help Area Residents in Need  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Community-Minded Interns at Savannah River Site Help Area Residents Community-Minded Interns at Savannah River Site Help Area Residents in Need with Home Repairs Community-Minded Interns at Savannah River Site Help Area Residents in Need with Home Repairs August 1, 2012 - 12:00pm Addthis James Cunningham, right, nails a board to the framework for a deck project in Jackson. Ashley Flowers, Savannah River Remediation project controls intern, assists by holding the board in place. James Cunningham, right, nails a board to the framework for a deck project in Jackson. Ashley Flowers, Savannah River Remediation project controls intern, assists by holding the board in place. AIKEN, S.C. - More than two dozen college interns who worked at the Savannah River Site (SRS) this summer joined other volunteers and headed into area neighborhoods to help people in need with home repairs.


Colville Resident Trout Hatchery Project Supplement Analysis (DOE/EA-0307-SA-01)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2, 2003 2, 2003 REPLY TO ATTN OF: KEC-4 SUBJECT: Colville Resident Trout Hatchery Project Supplement Analysis (DOE/EA-0307-SA-01) TO: Greg Baesler Project Manager - KEWU-4 Proposed Action: Colville Resident Trout Hatchery Project-Modifications to original proposal Project No.: 1985-038-00 Location: Colville Indian Reservation, Okanogan County, Washington Proposed by: Bonneville Power Administration (BPA) Introduction: The Bonneville Power Administration prepared an Environmental Assessment (DOE/EA-0307) for the Colville Resident Hatchery Project (Project) and published a Finding of No Significant Impact (FONSI) in the Federal Register on September 8, 1986 (Vol. 51, No.173). The Project involved the design, site selection, construction, operation and maintenance of a


Turbines Off NYC East River Will Provide Power to 9,500 Residents |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Turbines Off NYC East River Will Provide Power to 9,500 Residents Turbines Off NYC East River Will Provide Power to 9,500 Residents Turbines Off NYC East River Will Provide Power to 9,500 Residents February 6, 2012 - 3:16pm Addthis Free Flow System turbine being installed in East River, New York, NY (Dec 2006). | Image Credit: Kris Unger/Verdant Power, Inc. Free Flow System turbine being installed in East River, New York, NY (Dec 2006). | Image Credit: Kris Unger/Verdant Power, Inc. Hoyt Battey Water Power Market Acceleration and Deployment Team Lead, Wind and Water Power Program What does this project do? The 30 turbines will generate 1,050 kilowatts of electricity -- this power will be delivered to 9,500 New York homes. As part of the Roosevelt Island Tidal Energy project, 30 turbines are being installed along the strait that connects the Long Island Sound with the


Community-Minded Interns at Savannah River Site Help Area Residents in Need  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Community-Minded Interns at Savannah River Site Help Area Residents Community-Minded Interns at Savannah River Site Help Area Residents in Need with Home Repairs Community-Minded Interns at Savannah River Site Help Area Residents in Need with Home Repairs August 1, 2012 - 12:00pm Addthis James Cunningham, right, nails a board to the framework for a deck project in Jackson. Ashley Flowers, Savannah River Remediation project controls intern, assists by holding the board in place. James Cunningham, right, nails a board to the framework for a deck project in Jackson. Ashley Flowers, Savannah River Remediation project controls intern, assists by holding the board in place. AIKEN, S.C. - More than two dozen college interns who worked at the Savannah River Site (SRS) this summer joined other volunteers and headed into area neighborhoods to help people in need with home repairs.


The effects of 24 hour reality orientation nursing staff training on two groups of elderly residents  

E-Print Network (OSTI)

THE ~i OF 24 HCUR BEi"-KATY ORIENTATION NURSING STAFF ~G ON %%K) GRCUPS OF ELDERLY RESIDENTS A Thesis Donna Kaye Cardiff Suhnitted to the Graduate College of ~ A&M University in partial fulfillment of the requirement for the degree of August... 1980 Major Subject: Psychology 'BK ~ OF 24 HCXR REALITY ORIENZKTION NURSING STAFF TRAINING ON 'IN3 GROUPS OF ELZEZKY RESIDENTS A Thesis Donna Kaye Cardiff Approved as to style and content by: Cha of Ccnmittee) (Merrbez) 1 (~) (Head of B...

Cardiff, Donna Kaye



EECBG Success Story: Cha-Ching! How One Missouri Town is Helping Residents Save Money and Energy  

Energy.gov (U.S. Department of Energy (DOE))

Residents of St. Peters, Missouri are seeing several improvements in their community thanks to a $512,800 Energy Efficiency and Conservation Block Grant (EECBG). Learn more.


Safety Culture in Surgical Residency Programs across Virginia A Thesis Presented to  

E-Print Network (OSTI)

Safety Culture in Surgical Residency Programs across Virginia A Thesis Presented to the faculty One way to measure the safety of complex organizations is through safety culture surveys given. The results showed that one's role in an organization affects one's perception of safety, and that the culture

Virginia, University of


Indoor air quality implications of using ion generators in residences Michael S. Waring*  

E-Print Network (OSTI)

Indoor air quality implications of using ion generators in residences Michael S. Waring characterizes the indoor air quality implications of an ion generator in a 27 m3 residential room, with a matrix exposure and health professionals to make justified recommendations about the use of these ozone

Siegel, Jeffrey


Energy-Performance Trade-offs for Spatial Access Methods on Memory-Resident Data  

E-Print Network (OSTI)

Energy-Performance Trade-offs for Spatial Access Methods on Memory-Resident Data Ning An Sudhanva-force approach that does not use an index. The results show that there are both performance and energy trade also play an important role in determining the energy-performance trade-offs. Further, technological

Gurumurthi, Sudhanva


UBC Social, Ecological Economic Development Studies (SEEDS) Student Report LCA Totem Park Residence  

E-Print Network (OSTI)

UBC Social, Ecological Economic Development Studies (SEEDS) Student Report LCA 颅 Totem Park of a project/report." #12;March 18, 2009 LCA 颅 TOTEM PARK RESIDENCES Abstract This study looks at the total an idea of what the total embodied impact of the building complex is. The goal and scope of an LCA must


Utah Department of Health Bureau of Health Facility Licensing, Certification and Resident Assessment  

E-Print Network (OSTI)

Utah Department of Health Bureau of Health Facility Licensing, Certification and Resident of Utah Rule R432-31 (http://health.utah.gov/hflcra/forms.php) This is a physician order sheet based be effectively managed at current setting. ___ Limited additional interventions: Includes care above. May also

Tipple, Brett

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Costs for Academic Year 2013-2014 Tennessee Resident Tuition & Fees  

E-Print Network (OSTI)

Costs for Academic Year 2013-2014 Tennessee Resident Tuition & Fees New Undergraduate $11 Information Graduates of the BS curricula offered by the college may pursue advanced graduate study or take Industrial Engineering Materials Science & Engineering Mechanical Engineering Nuclear Engineering Master

Wang, Xiaorui "Ray"


NON-RESIDENT ALIEN DATA COLLECTION FORM Last or Family Name ___________________________________ First Name _____________________________  

E-Print Network (OSTI)

NON-RESIDENT ALIEN DATA COLLECTION FORM Last or Family Name for Nonresident Aliens. A nonresident alien subject to wage withholding must give the employer a completed Form W, nonresident aliens should use the following instructions: 1) Check only "Single" marital status on line 3

Yates, Andrew


Pediatric Resident Packet All of the following documents MUST be brought to Baby Gator on or  

E-Print Network (OSTI)

Pediatric Resident Packet All of the following documents MUST be brought to Baby Gator on or before Gator. ___ Background Information ___ Letter from College of Medicine indicating a clear background See Tammy Owens for this letter. ___ Copy of Gator 1 Card or Driver's License ___ Emergency Contact Sheet

Slatton, Clint



E-Print Network (OSTI)

to simulate the twin-screw extruder[1] to [11] . In this paper, we have studied the processing of polystyrene foam by extrusion in a single screw extruder coupled with a gear pump. The basic principle of foamingOPTIMISATION OF EXTRUDED POLYMER FOAM BY THE RESIDENT TIME DISTRIBUTION APPROACH Fr茅d茅ric Leonardi

Paris-Sud XI, Universit茅 de


Welcome new and returning residents! Help us make USC greener by recycling! Your Room Recycling Bin  

E-Print Network (OSTI)

Welcome new and returning residents! Help us make USC greener by recycling! Your Room Recycling Bin Every room is provided with a recycling bin to make it easy for you to recycle while living in University Housing. Use this bin to collect mixed recyclables in your room and take them to your nearest

Almor, Amit


Incident Invasive Breast Cancer, Geographic Location of Residence, and Reported Average Time Spent Outside  

Science Journals Connector (OSTI)

...areas of low versus high solar irradiance measured in...residence and geographic solar irradiance are not consistently...total average sunlight energy striking the ground...foods and supplements (energy adjusted IU/d). Some...low compared with high solar irradiance (comparing...

Amy E. Millen; Mary Pettinger; Jo L. Freudenheim; Robert D. Langer; Carol A. Rosenberg; Yasmin Mossavar-Rahmani; Christine M. Duffy; Dorothy S. Lane; Anne McTiernan; Lewis H. Kuller; Ana Maria Lopez; and Jean Wactawski-Wende



Residence Time Distribution Measurement and Analysis of Pilot-Scale Pretreatment Reactors for Biofuels Production: Preprint  

SciTech Connect

Measurement and analysis of residence time distribution (RTD) data is the focus of this study where data collection methods were developed specifically for the pretreatment reactor environment. Augmented physical sampling and automated online detection methods were developed and applied. Both the measurement techniques themselves and the produced RTD data are presented and discussed.

Sievers, D.; Kuhn, E.; Tucker, M.; Stickel, J.; Wolfrum, E.




E-Print Network (OSTI)

USING RESIDENT SMALL MAMMALS TO ASSESS THE HABITAT POTENTIAL OF EXPERIMENTAL BIOFUELS FEEDSTOCKS ...................................................................................................................35 CHAPTER 2: Comparing survival of deer mice across experimental biofuels plots in Eastern South ...................................................................................................................65 CHAPTER 3: Small mammal diversity across 4 experimental biofuels plots in Eastern South Dakota


Patch Isolation, Corridor Effects, and Colonization by a Resident Sparrow in a Managed Pine Woodland  

E-Print Network (OSTI)

Patch Isolation, Corridor Effects, and Colonization by a Resident Sparrow in a Managed Pine: The isolation of habitat patches is often cited as having a major impact on the dynamics of small populations occupying patches in a complex iandscape Few studie~ howet~, have provided field data demonstrating


Phase II Water Rental Pilot Project: Snake River Resident Fish and Wildlife Resources and Management Recommendations.  

SciTech Connect

The Idaho Water Rental Pilot Project was implemented in 1991 as part of the Non-Treaty Storage Fish and Wildlife Agreement between Bonneville Power Administration and the Columbia Basin Fish and Wildlife Authority. The goal of the project is to quantify resident fish and wildlife impacts resulting from salmon flow augmentation releases made from the upper Snake River Basin. Phase I summarized existing resource information and provided management recommendations to protect and enhance resident fish and wildlife habitat resulting from storage releases for the I improvement of an adromous fish migration. Phase II includes the following: (1) a summary of recent biological, legal, and political developments within the basin as they relate to water management issues, (2) a biological appraisal of the Snake River between American Falls Reservoir and the city of Blackfoot to examine the effects of flow fluctuation on fish and wildlife habitat, and (3) a preliminary accounting of 1993--1994 flow augmentation releases out of the upper Snake, Boise, and Payette river systems. Phase III will include the development of a model in which annual flow requests and resident fish and wildlife suitability information are interfaced with habitat time series analysis to provide an estimate of resident fish and wildlife resources.

Stovall, Stacey H.



Autonomous Remote Crack Displacement Monitoring of a Residence Near a Limestone  

E-Print Network (OSTI)

Autonomous Remote Crack Displacement Monitoring of a Residence Near a Limestone Quarry, Naples a limestone quarry. The object is to quantitatively compare crack re- sponse to blast-induced ground motion for construction and raw materials. For instance, neighbors of road aggregate quarries often perceive


Incident Invasive Breast Cancer, Geographic Location of Residence, and Reported Average Time Spent Outside  

Science Journals Connector (OSTI)

...baseline; and (c) clinic center solar irradiance. Hazard ratios and...life, baseline residence, or solar irradiance measured in Langelys...mortality in the United States and Canada. J Natl Cancer Inst 1997...ecologic study of dietary and solar ultraviolet-B links to breast...

Amy E. Millen; Mary Pettinger; Jo L. Freudenheim; Robert D. Langer; Carol A. Rosenberg; Yasmin Mossavar-Rahmani; Christine M. Duffy; Dorothy S. Lane; Anne McTiernan; Lewis H. Kuller; Ana Maria Lopez; and Jean Wactawski-Wende



Staff summary of Issues & Recommendations Resident Fish Substitution/Blocked Area Mitigation  

E-Print Network (OSTI)

1 Staff summary of Issues & Recommendations Resident Fish Substitution/Blocked Area Mitigation *Preliminary draft, please refer to full recommendations for complete review 10/29/2013 10:08:05 AM 2009 Fish and Wildlife Program Section Section II.C. 1. Substitution for Anadromous Fish Losses Section II. D. 8


A residence-time-based transport approach for the groundwater pathway in performance assessment models  

Science Journals Connector (OSTI)

This paper presents the theoretical development and numerical implementation of a new modeling approach for representing the groundwater pathway in risk assessment or performance assessment model of a contaminant transport system. The model developed ... Keywords: Groundwater pathway, Mixing model, Performance assessment, Residence time distribution

Bruce A. Robinson; Shaoping Chu



This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax purposes can complete their Federal tax filing requirements. (Normally, individuals who have resided in the U.S. for less than 5  

E-Print Network (OSTI)

This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax are considered Non-Resident Aliens for tax purposes. Please consult I.R.S. Publication 519: U.S. Tax Guide for Aliens.) START HERE! Did you receive U.S.-source Did you receive a Form W-2 NOTE: If you earned U

Snider, Barry B.


This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax purposes can complete their Federal tax filing requirements. (Normally, individuals who have resided in the U.S. for less than 5  

E-Print Network (OSTI)

This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax are considered Non-Resident Aliens for tax purposes. Please consult I.R.S. Publication 519: U.S. Tax Guide for Aliens.) Did you claim a tax treaty for 2013? AND/OR Did you receive other taxable income or scholarship

Fraden, Seth


Multi-School Collaboration to Develop and Test Nutrition Computer Modules for Pediatric Residents  

Science Journals Connector (OSTI)

The provision of essential nutrition-related content in US medical education has been deficient, despite efforts of the federal government and multiple professional organizations. Novel and efficient approaches are needed. A multi-department project was developed to create and pilot a computer-based compact disc instructional program covering the nutrition topics of oral rehydration therapy, calcium, and vitamins. Funded by an internal medical school grant, the content of the modules was written by Department of Pediatrics faculty. The modules were built by School of Informatics faculty and students, and were tested on a convenience sampling of 38 pediatric residents in a randomized controlled trial performed by a registered dietitian/School of Health and Rehabilitation Sciences Master抯 degree candidate. The modules were reviewed for content by the pediatric faculty principal investigator and the registered dietitian/School of Health and Rehabilitation Sciences graduate student. Residents completed a pretest of nutrition knowledge and attitude toward nutrition and Web-based instruction. Half the group was given three programs (oral rehydration therapy, calcium, and vitamins) on compact disc for study over 6 weeks. Both study and control groups completed a posttest. Pre- and postintervention objective test results in study vs control groups and attitudinal survey results before and after intervention in the study group were compared. The experimental group demonstrated significantly better posttrial objective test performance compared to the control group (P=0.0005). The study group trended toward improvement, whereas the control group performance declined substantially between pre- and posttests. Study group resident attitudes toward computer-based instruction improved. Use of these computer modules prompted almost half of the residents in the study group to independently pursue relevant nutrition-related information. This inexpensive, collaborative, multi-department effort to design a computer-based nutrition curriculum positively impacted both resident knowledge and attitudes.

Patricia L. Roche; Mary R. Ciccarelli; Sandeep K. Gupta; Barbara M. Hayes; Jean P. Molleston



open callEMPAC curtis r. priem experimental media and performing arts center ARTIST-IN-RESIDENCE PROGRAM  

E-Print Network (OSTI)

of a longer-term development process. A residency may be used to develop a part of a project, to explore, and overall resources. The review process will be led by our curatorial and production teams. Each project development of the financial plan for a residency is part of the review process. Research, Production

Linhardt, Robert J.


Housing & Residence Education Disclosure of Fire Safety Standards and Measures 1 Campus Fire Safety Right-to-Know  

E-Print Network (OSTI)

Housing & Residence Education Disclosure of Fire Safety Standards and Measures 1 Campus Fire Safety and death resulting from each fire. #12;Housing & Residence Education Disclosure of Fire Safety Standards) -- HVAC fan motor burned up -- Alpha Chi Omega -- 3/13/10 $1,500 (Greek) -- Futon mattress caught fire

Fang, Yuguang "Michael"


Housing & Residence Education Disclosure of Fire Safety Standards and Measures 1 Campus Fire Safety Right-to-Know  

E-Print Network (OSTI)

Housing & Residence Education Disclosure of Fire Safety Standards and Measures 1 Campus Fire Safety and death resulting from each fire. #12;Housing & Residence Education Disclosure of Fire Safety Standards) -- Grease Fire -- Beaty Towers -- 9/10/10 $100 (Greek) -- HVAC fan motor burned up -- Alpha Chi Omega -- 3

Slatton, Clint

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The role of the resid solvent in coprocessing with finely divided catalysts. Quarterly report, July--September 1993  

SciTech Connect

The research performed this quarter involved evaluating the resid as the solvent in coprocessing. Since the objective of this research contract is to determine if the naphthenic portion of resids is able to transfer hydrogen to coal, the resid was fractionated in order to obtain different compositional fractions for liquefaction reactions. In order to evaluate different fractions of resids, the fractions must first be separated by liquid chromatography. The literature was surveyed as described below to determine the most feasible of effecting the separation. Methods used to analyze the fractions were also examined. On the basis of the information obtained, an experimental procedure was developed for separating the resid into fractions and then analyzing the fractions by Fourier transform infrared spectroscopy (FTIR) and by {sup 13}C nuclear magnetic resonance.

Curtis, C.W.



Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)



What We Talked About with the White House "Entrepreneur-in-Residence" |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

We Talked About with the White House We Talked About with the White House "Entrepreneur-in-Residence" What We Talked About with the White House "Entrepreneur-in-Residence" April 20, 2012 - 1:42pm Addthis Want more information on Apps for Energy? Signup at http://appsforenergy.challenge.gov. | Image by Hantz Leger. Want more information on Apps for Energy? Signup at http://appsforenergy.challenge.gov. | Image by Hantz Leger. Erin R. Pierce Erin R. Pierce Digital Communications Specialist, Office of Public Affairs What does this project do? Apps for Energy helps spur innovation and out-of-the-box thinking. Green Button's open data standards give developers the opportunity to impact the way millions use their utility data. Insights from developers and the general public play a key role in


Solar project description; for Houston Construction Company, single family residence, Eden Prairie, Minnesota  

SciTech Connect

The Houston Construction Company solar energy system is designed to provide 62 percent of the space heating and domestic hot water energy requirements for a single-family detached residence containing 1796 square feet. The residence is in Eden Prairie, MN. Energy collection is accomplished by 468 square feet of Solaron flat-plate collectors which face south at an angle of 60 degrees from the horizontal. Air is the medium for transfer of solar energy from the collectors to either the conditioned space or storage. Storage is a 314 ft/sup 3/ bin containing approximately 24,000 lbs of crushed rock located in a utility room. When solar energy is inadequate to satisfy the requirements of the space heating subsystem, auxiliary thermal energy is supplied from an 80,000 Btu/hr natural gas furnace. Domestic hot water is provided by a 30,000 Btu/hr natural gas water heater if the solar contribution is insufficient.

Not Available



Reconstruction of Long-Lived Radionuclide Intakes for Techa Riverside Residents: Cesium-137  

SciTech Connect

Radioactive contamination of the Techa River (Southern Urals, Russia) occurred from 19491956 due to routine and accidental releases of liquid radioactive wastes from the Mayak Production Association. The long-lived radionuclides in the releases were 90Sr and 137Cs. Contamination of the components of the Techa River system resulted in chronic external and internal exposure of about 30,000 residents of riverside villages. Data on radionuclide intake with diet are used to estimate internal dose in the Techa River Dosimetry System (TRDS), which was elaborated for the assessment of radiogenic risk for Techa Riverside residents. The 90Sri ntake function was recently improved taking into account the recently available archival data on radionuclide releases and in-depth analysis of the extensive data on 90Sr measurements in Techa Riverside residents. The main purpose of this paper is to evaluate the dietary intake of 137Cs by Techa Riverside residents. The 137Cs intake with river water used for drinking was reconstructed on the basis of the 90Sr intake-function and the concentration ratio 137Cs/90Sr in river water. Intake via 137Cs transfer from floodplain soil to grass and cows milk was evaluated for the first time. As a result, the maximal 137Cs intake level was indicated near the site of releases in upper-Techa River settlements (8,0009,000 kBq). For villages located on the lower Techa River the 137Cs intake was significantly less (down to 300 kBq). Cows milk was the main source of 137Cs in diet in the upper-Techa.

Tolstykh, E. I.; Degteva, M. O.; Peremyslova, L. M.; Shagina, N. B.; Vorobiova, M. I.; Anspaugh, L. R.; Napier, Bruce A.



Supra-Canonical 26Al/27Al and the Residence Time of CAIs in the  

E-Print Network (OSTI)

Supra-Canonical 26Al/27Al and the Residence Time of CAIs in the Solar Protoplanetary Disk Edward D initial 26Al/27Al ratio of 4.5 ? 10颅5 has been a fiducial marker for the beginning of the solar system that some CAIs had initial 26Al/27Al values at least 25% greater than canonical and that the canonical

Harrison, Mark


Application of multiple swirl burners in pilot-scale entrained bed gasifier for short residence time  

Science Journals Connector (OSTI)

Abstract The design concept of an entrained bed gasifier is presented. A 3 t/d-scale gasification system was constructed based on this concept. Syngas residence time in the gasifier was set to 2爏, relatively shorter than that of commercial gasifiers, to verify the possibility of complete gasification reaction within a short residence time. A series of gasification tests were conducted under high pressures and high temperatures. Performance data of the gasification experiment using multiple swirl burners showed that the carbon conversion and cold gas efficiency were higher than 98% and 72%, respectively. This high performance seemed to be attributable to the effects of rigorous mixing of oxygen and pulverized coal by the strong swirl flow and the relatively uniform oxygen concentration by the swirling plug flow. Syngas composition of the experimental result well agreed with that of the equilibrium state. This project demonstrated the feasibility of complete gasification reaction within a short residence time for low-rank coal of high reactivity.

Jin-Wook Lee; Yongseung Yun; Seok-Woo Chung; Suk-Hwan Kang; Jae-Hong Ryu; Gyoo-Tae Kim; Yong-Jeon Kim



CPFD simulation of solids residence time and back-mixing in CFB risers  

Science Journals Connector (OSTI)

Abstract A Computational Particle Fluid Dynamics (CPFD) approach was applied to investigate the solids residence time distribution (RTD) and back-mixing behavior in a circulating fluidized bed (CFB) riser. The comparison between the simulation results and the experimental data indicates that the CPFD method was capable to predict the hydrodynamics and solids mean residence time. It was found that the solids residence time exhibited a non-uniform distribution both in the axial and in the radial directions of the riser. Even in the dilute phase transport (DPT) regime, the predicted solids RTD curves had the feature of an early peak and an extended tail, indicating that the solids flow deviates from plug flow and exhibits back-mixing. The solids back-mixing mainly occurred in the lower part of the riser, which provided significant implications for the industrial applications of the CFB reactors since most of the chemical reactions and heat/mass transport processes occur at the lower part of the riser. It is important to minimize the solids back-mixing at the lower part of the riser for the industrial CFB applications like the FCC.

Xiaogang Shi; Renjin Sun; Xingying Lan; Feng Liu; Yinghui Zhang; Jinsen Gao



Factors that Determine Academic Versus Private Practice Career Interest in Radiation Oncology Residents in the United States: Results of a Nationwide Survey  

SciTech Connect

Purpose: To determine what factors US radiation oncology residents consider when choosing academic or nonacademic careers. Methods and Materials: A 20-question online survey was developed and sent to all US radiation oncology residents to assess factors that influence their career interest. Residents were asked to rate their interest in academics (A) versus private practice (PP) on a 0 (strong interest in A) to 100 (strong interest in PP) scale. Responses were classified as A (0-30), undecided (40-60), and PP (70-100). Residents were also asked to rank 10 factors that most strongly influenced their career interest. Results: Three hundred thirty-one responses were collected, of which 264 were complete and form the basis for this analysis. Factors that correlated with interest in A included having a PhD (P=.018), postgraduate year level (P=.0006), research elective time (P=.0003), obtaining grant funding during residency (P=.012), and number of publications before residency (P=.0001), but not number of abstracts accepted in the past year (P=.65) or publications during residency (P=.67). The 3 most influential factors for residents interested in A were: (1) baseline interest before residency; (2) academic role models; and (3) research opportunities during residency. The 3 most influential factors for residents interested in PP were: (1) baseline interest before residency; (2) academic role models; and (3) academic pressure and obligations. Conclusions: Interest in A correlated with postgraduate year level, degree, and research time during residency. Publications before but not during residency correlated with academic interest, and baseline interest was the most influential factor. These data can be used by residency program directors to better understand what influences residents' career interest.

Chang, Daniel T., E-mail: dtchang@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Shaffer, Jenny L. [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Haffty, Bruce G. [Department of Radiation Oncology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, New Brunswick, New Jersey (United States); Wilson, Lynn D. [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut (United States)



Data:16253744-f4c8-4a5a-8156-b8f4f239e141 | Open Energy Information  

Open Energy Info (EERE)

44-f4c8-4a5a-8156-b8f4f239e141 44-f4c8-4a5a-8156-b8f4f239e141 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Fife - collectively metered apartments Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months):


Data:525ab942-47f8-49c5-a3df-0565b725384b | Open Energy Information  

Open Energy Info (EERE)

42-47f8-49c5-a3df-0565b725384b 42-47f8-49c5-a3df-0565b725384b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - Collectively Metered Apartments Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)


Data:7abb6335-af9f-4c46-b6f4-0d5b1f807dc9 | Open Energy Information  

Open Energy Info (EERE)

abb6335-af9f-4c46-b6f4-0d5b1f807dc9 abb6335-af9f-4c46-b6f4-0d5b1f807dc9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Lakewood - collectively metered apartments Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):


Data:07ebea2b-96a0-4c1d-ba40-44aa6205e84a | Open Energy Information  

Open Energy Info (EERE)

ebea2b-96a0-4c1d-ba40-44aa6205e84a ebea2b-96a0-4c1d-ba40-44aa6205e84a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Fircrest - collectively metered apartments Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):


Reference Buildings by Building Type: Midrise Apartment  

Energy.gov (U.S. Department of Energy (DOE))

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.


Identifying apartment buildings with potential heating issues.  

E-Print Network (OSTI)

??The residential sector in Sweden uses a large amount of energy for heating and hot water. Sweden as well as all other European countries need (more)

Rooij, Joris van



Heating Energy Meter Validation for Apartments  

E-Print Network (OSTI)

Household heat metering is the core of heating system reform. Because of many subjective and objective factors, household heat metering has not been put into practice to a large extent in China. In this article, the research subjects are second...

Cai, B.; Li, D.; Hao, B.



Cascade Apartments: Deep Energy Multifamily Retrofit  

SciTech Connect

In December of 2009-10, King County Housing Authority (KCHA) implemented energy retrofit improvements in the Cascade multifamily community, located in Kent, Washington (marine climate.)This research effort involved significant coordination from stakeholders KCHA, WA State Department of Commerce, utility Puget Sound Energy, and Cascade tenants. This report focuses on the following three primary BA research questions : 1. What are the modeled energy savings using DOE low income weatherization approved TREAT software? 2. How did the modeled energy savings compare with measured energy savings from aggregate utility billing analysis? 3. What is the Savings to Investment Ratio (SIR) of the retrofit package after considering utility window incentives and KCHA capitol improvement funding.

Gordon, A.; Mattheis, L.; Kunkle, R.; Howard, L.; Lubliner, M.



Archived Reference Building Type: Midrise Apartment  

Energy.gov (U.S. Department of Energy (DOE))

Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.


Archived Reference Building Type: Midrise Apartment  

Energy.gov (U.S. Department of Energy (DOE))

Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones爄s available for reference.燙urrent versions燼re also available.


Un aparte con Roberto Ramos-Perea  

E-Print Network (OSTI)

es lo mejor que conozco, mi vida. As puedes entrecruzar la ficci髇 con la realidad... Eso es parte del juego. En el caso de Tuya siempre Julita, no tiene nada que ver conmigo porque la historia no es contempor醤ea. Me met mucho en la vida de... comienzo de Tuya siempre... haces una advertencia que llamas 玌na confesi髇... Es como si no tuvieras nada que ver, como si no quisieras presentarnos a la Julia de Burgos. No, mira, es que hay unas consideraciones de car醕ter humanitarios. Considerando...

Montañ ez, Carmen L.


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A characterization and evaluation of coal liquefaction process streams. The kinetics of coal liquefaction distillation resid conversion  

SciTech Connect

Under subcontract from CONSOL Inc., the University of Delaware studied the mechanism and kinetics of coal liquefaction resid conversion. The program at Delaware was conducted between August 15, 1994, and April 30, 1997. It consisted of two primary tasks. The first task was to develop an empirical test to measure the reactivity toward hydrocracking of coal-derived distillation resids. The second task was to formulate a computer model to represent the structure of the resids and a kinetic and mechanistic model of resid reactivity based on the structural representations. An introduction and Summary of the project authored by CONSOL and a report of the program findings authored by the University of Delaware researchers are presented here.

Klein, M.T.; Calkins, W.H.; Huang, H.; Wang, S.; Campbell, D.



Factors Related to the Residence Time of Fine Particle Concerning the Burnout of Fujian Anthracite During Combustion in CFB Boiler  

Science Journals Connector (OSTI)

Factors related to the residence time of fine Fujian anthracite coke particle during combustion in CFB boiler which would affect its burnout were ... burnout of Fujian anthracite particle during combustion in CFB

Jieqing Zheng; Hongzhou He



A Multi-modal Curriculum for Emergency Medicine Residents to Maximize Value of Attendance at a National Conference  

E-Print Network (OSTI)

optimized attending the conference. Ninety-two percent feltAttendance at a National Conference Blazejewski A, Rosen A,residents to a national conference. We know of no formal

Blazejewski, A; Golden, D; Clark, S



Statewide Electricity and Demand Capacity Savings from the Implementation of IECC Code in Texas: Analysis for Single-Family Residences  

E-Print Network (OSTI)

This paper presents estimates of the statewide electricity and electric demand savings achieved from the adoption of the International Energy Conservation Code (IECC) for single-family residences in Texas and includes the corresponding increase...

Kim, H.; Baltazar, J.C.; Haberl, J.



Simulations of the Energy Performance of a Solar Photovoltaic Residence and Hybrid Electric Automobile in Fresno, California  

Science Journals Connector (OSTI)

JSR Associates has designed an integrated system incorporating a solar photovoltaic residence and hybrid electric auto that (1) collects, converts, stores, and distributes incident solar energy on the residenc...

J. S. Reuyl; R. D. Schutt



Idaho Water Rental Pilot Project Probability/Coordination Study Resident Fish and Wildlife Impacts Phase III, 1997 Annual Report.  

SciTech Connect

Phase III began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River Basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water.

Leitzinger, Eric J. (Idaho Department of Fish and Game, Boise, ID)



The Vulnerability of Mobile Home Residents in Tornado Disasters: The 2008 Super Tuesday Tornado in Macon County, Tennessee  

Science Journals Connector (OSTI)

Mobile home residents are known to be highly vulnerable to tornadoes and account for a considerable portion of tornado-related fatalities. The problem is partially related to the limited protection provided by the structure; however, shortcomings ...

Philip L. Chaney; Greg S. Weaver



The role of the resid solvent in co-processing with finely divided catalysts. Quarterly report April--June 1993  

SciTech Connect

The primary purpose of the work performed this quarter was to establish under thermal and catalytic reaction conditions whether hydrogen transfer occurred between cycloalkane type structures that are present in resids and heteroatomic species that are present in coal and liquefied coal. The research this quarter focused upon evaluating benzophenone (BENZ) as a model acceptor for hydrogen that might be transferred from a cycloalkane, perhydropyrene (PHP), under coprocessing conditions. Hence, a number of reactions was performed in which BENZ was reacted alone in hydrogen and nitrogen atmospheres in the presence and absence of a catalytic agent, molybdenum naphthenate. Reactions were also performed using a combination of PHP and BENZ at a 1 to 1 weight ratio. Also performing this quarter were initial separations with petroleum resids. Two different resids were used, Maya and LHC-362. The literature was also surveyed to determine important characteristics that should be evaluated for selecting resids. The resids that are desired for this project are resids with high-, medium-, and low-naphthenic content. Different levels of asphaltenes are also desirable. Resids with these characteristics are currently being sought. The model compound PHP that had been commercially available as naphthene representative of resids is now no longer available. Hence, several scoping experiments were performed in order to determine conditions for synthesizing PHP. The synthesis procedure reported in US Patent 3,303,227 was used as a basis for this work. Although more than 85% PHP was synthesized, partially hydrogenated pyrenes were also produced which will require separation in order to obtain pure PHP.

Curtis, C.W.



The effect of mean cell residence time on the adsorbability of dissolved organic compounds found in petrochemical wastewaters  

E-Print Network (OSTI)


Johnson, Timothy Loring



Options, knowledge, and satisfaction of Texas residents affected by Edwards Aquifer issues: implications for education and government  

E-Print Network (OSTI)

OPINIONS, KNOWLEDGE, AND SATISFACTION OF TEXAS RESIDENTS AFFECTED BY EDWARDS AQUIFER ISSUES: IMPLICATIONS FOR EDUCATION AND GOVERNMENT A Thesis by AMY SUZETTE KINNEY Submitted to Texas A&M University in partial fulfillment of the requirements... Education ABSTRACT Opinions, Knowledge, and Satisfaction of Texas Residents Affected by Edwards Aquifer Issues: Implications for Education and Government. (December 1994) Amy Suzette Kinney, B. S. , Tarleton State University Chair of Advisory Committee...

Kinney, Amy Suzette



Duplex Stainless Steels Margaret Gorog  

E-Print Network (OSTI)

, substituted for 6% mo SS in bleach plant Hyper DSS, Offshore oil applications Super, Hyper 颅 Corrosion

Das, Suman


Simulation of Off-Grid, Off-Pipe, Single-Family Detached Residences in US Climates  

E-Print Network (OSTI)

system type (wind, PV or hybrid), the capacity of electricity generating and storage systems were determined to meet/exceed the electricity use for days with inadequate solar radiation and wind. For locations with the potential of solar power...SimBuild 2008 Third National Conference of IBPSA-USA Berkeley, California July 30 ? August 1, 2008 116 SIMULATION OF OFF-GRID, OFF-PIPE, SINGLE-FAMILY DETACHED RESIDENCES IN U.S. CLIMATES Mini Malhotra1, Jeff Haberl2 1Research Assistant...

Malhotra, M.; Haberl, J.


A non-discrete method for computation of residence time in fluid mechanics simulations  

Science Journals Connector (OSTI)

Cardiovascular simulations provide a promising means to predict risk of thrombosis in grafts devices and surgical anatomies in adult and pediatric patients. Although the pathways for platelet activation and clot formation are not yet fully understood recent findings suggest that thrombosis risk is increased in regions of flow recirculation and high residence time (RT). Current approaches for calculating RT are typically based on releasing a finite number of Lagrangian particles into the flow field and calculating RT by tracking their positions. However special care must be taken to achieve temporal and spatial convergence often requiring repeated simulations. In this work we introduce a non-discrete method in which RT is calculated in an Eulerian framework using the advection-diffusion equation. We first present the formulation for calculating residence time in a given region of interest using two alternate definitions. The physical significance and sensitivity of the two measures of RT are discussed and their mathematical relation is established. An extension to a point-wise value is also presented. The methods presented here are then applied in a 2D cavity and two representative clinical scenarios involving shunt placement for single ventricle heart defects and Kawasaki disease. In the second case study we explored the relationship between RT and wall shear stress a parameter of particular importance in cardiovascular disease.

Alison L. Marsden



Microcarbon residue yield and heteroatom partitioning between volatiles and solids for whole vacuum resids and their liquid chromatographic fractions  

SciTech Connect

Five petroleum >1000{degrees}F resids were separated into compound type fractions using liquid chromatography. The coking tendency of each compound type was assessed using the microcarbon residue (MCR) test (ASTM D 4530). Heteroatom (N, S, Ni, V) partitioning between MCR solids versus volatiles was determined through analysis of the starting fractions and the corresponding MCR solids. The weighted sum of MCR solid yields over all compound types in a given resid was typically in good agreement with the MCR yield of the whole resid. This finding agrees with prior studies indicating coke yield to be an additive property. Sulfur partitioning was also an additive property, was predictable from MCR yield, and was nearly independent of the initial form (sulfide, thiophenic, sulfoxide) present. Nitrogen and nickel partitioning were nonadditive and therefore composition dependent. Partitioning of vanadium into solids was essentially quantitative for all resids and their fractions. MCR solid yield was generally dependent only on H/C ratio. However, there is some evidence indicating secondary dependence on hydrocarbon structure; i.e., that naphthenic rings reduce MCR in proportion to H/C by virtue of their effective hydrogen transfer properties. Deposition of N and Ni into MCR solids over the fractions was often appreciably less than that of the whole resids, thereby indicating that interaction among various compound types was required for maximum incorporation of those elements into coke.

Green, J.B.; Shay, J.Y.; Reynolds, J.W.; Green, J.A.; Young, L.L.; White, M.E.



Microsoft PowerPoint - SRS Headcount by County of Residence Q4 FY 2013.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

GA County SRNS SRR WSI *Parsons GA County SRNS SRR WSI *Parsons Amer- esco MOX DOE-SR GA County Total Burke 23 15 4 17 0 24 0 83 Columbia 719 258 101 75 6 148 44 1351 Jefferson 2 3 0 1 0 3 0 9 Lincoln 11 1 2 1 0 4 0 19 McDuffie 10 8 0 5 0 13 2 38 Richmond 508 184 110 117 2 215 34 1170 Screven 20 7 1 6 0 4 0 38 Other 24 12 3 91 0 162 0 292 Total 1317 488 221 313 * 8 573 80 3000 SRS Employee Headcount by County of Residence Q4, FY 13


Role of the resid solvent in catalytic coprocessing. Quarterly report, October 1994--December 1994  

SciTech Connect

This quarterly report summarizes the authors` work in characterizing resid solvents in the coal liquefaction process. The research performed this quarter involved a literature review in which the literature involving naphthenic structures was reviewed to ascertain if any new literature was available that could provide insights into this work. The literature review is given in part one of this report. The second aspect of the work was the performance of additional model compound studies to complete the work that has been previously performed. The third part of this report was the work performed in preparation for the Department of Energy review to be held on January 24, 1995, in Pittsburgh, PA. The written documentation was due to the Department of Energy in December and is attached as Part 3 of this report.

Curtis, C.W.



Solar project description for Saddle Hill Trust: Lot 77, single family residence, Medway, Massachusetts  

SciTech Connect

A solar energy system for preheating domestic hot water for a single-family residence in Massachusetts is described. The system consists of four flat plate air-based collectors with a gross area of 77 square feet, an air-to-water heat exchanger, and a 120-gallon preheat tank for storage. Preheated domestic water is supplied from the preheat tank to a cnventional gas-fired 40-gallon domestic hot water tank which supplies the residential hot water demand. The original cost estimate for provisioning and installation of the solar system are given. Four modes of operation are described: collector-to-preheat, preheat-to-domestic hot water, night or cloudy collector condition, and overheat protection. The system performance evaluation instrumentation for the National Solar Data Network is described. (LEW)

Moore, D.



Magnetic field exposure assessment for adult residents of Maine who live near and far away from overhead transmission lines  

SciTech Connect

Sixty-Hz magnetic field exposures were measured for 45 adult residents of Maine. Thirty of the subjects resided near rights-of-way (ROWs) with either 345- and 115-kV transmission lines, or ROWs with only 115-kV transmission lines; fifteen resided far from any transmission lines. Personal exposure data for a single 24-hour period was acquired with the EMDEX. The EMDEX's event-marker button was used to partition exposures into Home and Away components. Also, three area measurements were taken for each subject during the personal exposure measurement period: (1) 24-hr fixed-site bedroom measurement with a second EMDEX; (2) Spot measurements in at least three rooms of every residence; and (3) Spot measurements outside each residence. Residence near transmission lines highly loaded during the measurement period was associated with increased Home and Total exposure relative to a far-away population. Average exposure level while away from home was uniform (at about 2 mG) throughout the study population. On a quantitative level, Home exposure was correlated equivalently with Spot-In (r = .70) and the 24-hr fixed site measurement (r = .68). Correlations of area measurements with Total exposure were weaker because of the dilution effect of Away exposure (r = .64 for Spot-In; r = .61 for 24-h Bedroom). Away and Home exposures were not correlated (r = .14), which reinforced our confidence that the participants used the EMDEX correctly. The data suggest the need for caution before inferences are drawn about total personal exposure from area measurements. The study demonstrates the feasibility of obtaining valid measures of magnetic-field exposure with the personal exposure monitors that have been developed.

Kavet, R.; Silva, J.M.; Thornton, D. (Enertech Consultants, Campbell, CA (United States))



揥e are used to this: a qualitative assessment of the perceptions of and attitudes towards air pollution amongst slum residents in Nairobi  

Science Journals Connector (OSTI)

People抯 perceptions of and attitudes towards pollution are critical for reducing exposure among people ... of residents in two slums in Nairobi regarding air pollution.

Kanyiva Muindi; Thaddaeus Egondi; Elizabeth Kimani-Murage



Annual Report on Resident Fish Activities, 1986 Fiscal Year, Columbia River Basin Fish and Wildlife Program, Action Item 41.8.  

SciTech Connect

This report addresses the status of resident fish projects currently funded by the Bonneville Power Administration (BPA) under the Columbia River Basin Fish and Wildlife Program (Program) established pursuant to the Northwest Power Act (P.L. 96-501). The report provides a brief synopsis, review and discussion of 13 resident fish projects funded during September 1985 to May 1986. The resident fish section of the Program addresses measures which are intended to protect resident fish, mitigate fishery losses caused by hydroelectric projects, and compensate for past losses through enhancement measures. These measures include, but are not limited to: flow requirements, drawdown requirements, temperature control, and streambed protection.

United States. Bonneville Power Administration.


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


H1N1 Influenza: What You Need to Know if You Live in Residence Welcome to residence at the University of Toronto. We're delighted that you'll be living  

E-Print Network (OSTI)

flu have been similar to the symptoms of seasonal flu: a temperature of more than 38掳C, cough, sore your hands often. 路 Cough or sneeze into your sleeve or a tissue. 路 Stay at home or in your residence-the-counter medication to reduce aches and fever (e.g., acetaminophen or ibuprofen) 路 Cough medicine and throat lozenges

Boonstra, Rudy


Home > Visit apartments online > Vacation Rental > Bailleul I own an Apartment  

E-Print Network (OSTI)

with baker, wine shop, pharmacy and small bars and bistrots with a FRANPRIX supermarket nearby and security description: - 1890 Building, 4 floor, with lift, entry code security system, with interphone, 2 Bedrooms Apt clean. - Dishwasher, Refrigerator, Freezer, Cooking rings, Oven, Microwave, Dinnerware and serving

Gray, Robert M.


Home > Visit apartments online > Vacation Rental > Bailleul I own an Apartment  

E-Print Network (OSTI)

Paris ambience with baker, wine shop, pharmacy and small bars and bistrots with a FRANPRIX supermarket floor, entry code security system, with interphone, 2 Bedrooms Apt, furnished, 66m / 660 sqft, high. - Dishwasher, Refrigerator, Freezer, Cooking rings, Oven, Microwave, Dinnerware and serving pieces, Toaster

Gray, Robert M.


CONNECTICUT CONTROLLED SUBSTANCE NUMBER The State Department of Consumer Protection mandates that all residents/fellows (with or  

E-Print Network (OSTI)

Page 54 CONNECTICUT CONTROLLED SUBSTANCE NUMBER The State Department of Consumer Protection of Connecticut must be registered in order to prescribe any controlled substance to any patient. After the initial registration, all residents/fellows will be notified by the State of Connecticut when

Oliver, Douglas L.


Diversity of Methicillin-Resistant Staphylococcus aureus Strains Isolated from Residents of 26 Nursing Homes in Orange County, California  

Science Journals Connector (OSTI)

...Strains Isolated from Residents of 26 Nursing Homes in Orange County, California Lyndsey O...Bath, Bath, United Kingdom. Nursing homes represent a unique and important methicillin-resistant...transported back into these settings from nursing homes. Since MRSA bacteria are prevalent in...

Lyndsey O. Hudson; Courtney Reynolds; Brian G. Spratt; Mark C. Enright; Victor Quan; Diane Kim; Paul Hannah; Lydia Mikhail; Richard Alexander; Douglas F. Moore; Daniel Godoy; Cynthia J. Bishop; Susan S. Huang



People helping turtles, turtles helping people: Understanding resident attitudes towards sea turtle conservation and opportunities for enhanced community  

E-Print Network (OSTI)

People helping turtles, turtles helping people: Understanding resident attitudes towards sea turtle, all five sea turtle species have declined over the past century due to intense over- exploitation heavily impacted areas has been the Baja California peninsula, where sea turtle populations remain

Gerber, Leah R.


Your place or mine? A phylogenetic comparative analysis of marital residence in Indo-European and Austronesian societies  

Science Journals Connector (OSTI)

...languages, and Proto-Indo-European (PIE) for the hypothetical ancestor of IE languages...significant basal node in each family (PIE for IE and Proto-Malayo-Polynesian for...residence, nodes Proto-Indo-Hittite and PIE reconstructed as virilocal with posterior...



YOLO COUNTY SERVICES GUIDE The Yolo County Services Guide is a new resource to help residents access various  

E-Print Network (OSTI)

YOLO COUNTY SERVICES GUIDE The Yolo County Services Guide is a new resource to help residents by the Yolo County Health Department and the Yolo Family Resource Center, a nonprofit organization again anywhere in the document. #12;SERVICES / RESOURCES PROVIDED BY YOLO COUNTY & OTHER AGENCIES

Nguyen, Danh


To enter the Blue Bottle Photo Competition, applicants must follow these rules: 1) There can only be one submission per resident.  

E-Print Network (OSTI)

To enter the Blue Bottle Photo Competition, applicants must follow these rules: 1) There can only be one submission per resident. 2) Only residents may enter this competition. 3) Photos are entered into the competition by posting them on the wall of the Positive Impact Facebook page. 4) Photo posting opens at 12

Ferrara, Katherine W.


Senior Citizen Audit Program At the University of Connecticut, State of Connecticut residents 62 years of age or older may attend  

E-Print Network (OSTI)

Senior Citizen Audit Program At the University of Connecticut, State of Connecticut residents 62 a Connecticut driver's license or other photo ID with proof of age and residency. The fee of $15 is payable when-570-9214 Storrs, CT 06269 203-236-9819 860-486-3331 University of Connecticut Senior Citizen Auditor Registration

Alpay, S. Pamir


Residence time distribution and heat transfer in circular pipe fitted with longitudinal rectangular wings  

Science Journals Connector (OSTI)

Abstract Numerical simulations are used to analyze the heat and mass transfer in a circular pipe fitted with longitudinal rectangular vortex generators for Reynolds number between 7500 and 15,000 based on the pipe diameter. The aim of the present study is to test and quantify the mixing efficiency of a new solution able to avoid the bypass region that exists in the center of the high efficiency vortex static mixer (HEV), and also to enhance the heat transfer without increasing the pressure losses. The rectangular wings used here generate each a streamwise counter-rotating vortex pair sweeping the volume of the mixer and act as internal agitator on the flow. The particle dispersion is investigated by analyzing Poincar sections and by studying the residence time distribution (RTD). The two approaches show much better mass transfer performance and better mixing homogeneity for the new wings arrangement. The heat transfer is also investigated and it is shown that the thermal enhancement factor in the new arrangement is much greater than that of the conventional systems used in the industry. When compared to the HEV heat exchangers it is shown that the thermal enhancement in the present configuration reaches about 40% relative to the classic HEV and 15% relative to the reversed HEV.

Charbel Habchi; Jean-Luc Harion



American Society for Radiation Oncology (ASTRO) 2012 Workforce Study: The Radiation Oncologists' and Residents' Perspectives  

SciTech Connect

Purpose: The American Society for Radiation Oncology (ASTRO) conducted the 2012 Radiation Oncology Workforce Survey to obtain an up-to-date picture of the workforce, assess its needs and concerns, and identify quality and safety improvement opportunities. The results pertaining to radiation oncologists (ROs) and residents (RORs) are presented here. Methods: The ASTRO Workforce Subcommittee, in collaboration with allied radiation oncology professional societies, conducted a survey study in early 2012. An online survey questionnaire was sent to all segments of the radiation oncology workforce. Respondents who were actively working were included in the analysis. This manuscript describes the data for ROs and RORs. Results: A total of 3618 ROs and 568 RORs were surveyed. The response rate for both groups was 29%, with 1047 RO and 165 ROR responses. Among ROs, the 2 most common racial groups were white (80%) and Asian (15%), and the male-to-female ratio was 2.85 (74% male). The median age of ROs was 51. ROs averaged 253.4 new patient consults in a year and 22.9 on-treatment patients. More than 86% of ROs reported being satisfied or very satisfied overall with their career. Close to half of ROs reported having burnout feelings. There was a trend toward more frequent burnout feelings with increasing numbers of new patient consults. ROs' top concerns were related to documentation, reimbursement, and patients' health insurance coverage. Ninety-five percent of ROs felt confident when implementing new technology. Fifty-one percent of ROs thought that the supply of ROs was balanced with demand, and 33% perceived an oversupply. Conclusions: This study provides a current snapshot of the 2012 radiation oncology physician workforce. There was a predominance of whites and men. Job satisfaction level was high. However a substantial fraction of ROs reported burnout feelings. Perceptions about supply and demand balance were mixed. ROs top concerns reflect areas of attention for the healthcare sector as a whole.

Pohar, Surjeet, E-mail: spohar@iuhealth.org [Indiana University Health East, Indianapolis, Indiana (United States); Fung, Claire Y. [Commonwealth Newburyport Cancer Center, Newburyport, Massachusetts (United States); Hopkins, Shane [William R. Bliss Cancer Center, Ames, Iowa (United States); Miller, Robert [Mayo Clinic, Rochester, Minnesota (United States); Azawi, Samar [VA Veteran Hospital/University of California Irvine, Newport Beach, California (United States); Arnone, Anna; Patton, Caroline [ASTRO, Fairfax, Virginia (United States); Olsen, Christine [Massachusetts General Hospital, Boston, Massachusetts (United States)



Exploring spatial variations in the relationships between residents' recreation demand and associated factors: A case study in Texas  

Science Journals Connector (OSTI)

Abstract In the field of outdoor recreation, past research has attempted to identify the relationships between the socioeconomic status of recreation participants and demand. This approach has used global regression models that focus on local or site-level recreation demand prediction. No studies have applied spatial statistical approaches to examine recreation demand at the state or regional level. The objectives of this study are twofold: 1) to identify socio-demographic and economic determinants of the spatial disparities of residents' demand for national park visitation; 2) to demonstrate the spatial variation in the relationship between residents' demand and its associated factors through a local regression modeling technique (GWR). The analysis was conducted at the county level for Texas, using public and private levels of secondary data. A particular version of OLS (ordinary least squares), stepwise regression, was used to select significant explanatory variables for developing the model. Six explanatory variables were selected for the modeling procedure: 1) older adults; 2) family structure (traditional vs. nonfamily structure); 3) recreation-related spending; 4) education, and 5) poverty rate. The study results found that the Moran's I value for national park visitation showed a positive spatial autocorrelation across the state which means that spatial distribution disparities of residents' recreation demand exist in Texas. The variable relationships differed by specific counties and spatially in predicting residents' demand. The GWR model made improvements in model performance over the OLS model. Overall, the strongest positive influence on national park visitation was found for those who spent $250 or more to purchase recreation-related equipment. In conducting future research, the GWR model is a useful statistical technique to examine and compare spatial relationships across regional study areas and can be complementary to global statistical analyses.

Kyung Hee Lee; Michael A. Schuett



A quasi-steady state model to predict attic heat transfer and energy savings in residences using radiant barriers  

E-Print Network (OSTI)

[10-14] for Oak Ridge National Laboratories (ORNL) has focused on comparing energy reduction on three experimental houses operated by ORNL. Their research has consisted of both summer and winter tests of radiant barriers. Radiant Barrier...A QUASI-STEADY STATE MODEL TO PREDICT ATTIC HEAT TRANSFER AND ENERGY SAVINGS IN RESIDENCES USING RADIANT BARRIERS A Thesis by DAVID WALTER WINIARSKI Submitted to the Office of Graduate Studies of Texas ARM University in partial fulfillment...

Winiarski, David Walter



Statewide Electricity and Demand Capacity Savings from the Implementation of IECC Code in Texas: Analysis for Single-Family Residences  

E-Print Network (OSTI)

STATEWIDE ELECTRICITY AND DEMAND CAPACITY SAVINGS FROM THE IMPLEMENTATION OF IECC CODE IN TEXAS: ANALYSIS FOR SINGLE?FAMILY RESIDENCES 11th International Conference for Enhanced Building Operations New York City, October 18 ? 20, 2011 Hyojin...&M University System Statewide Electricity and Demand Savings from the IECC Code in TX 11th ICEBO Conference Oct. 18 ? 20, 2011 2 Outline Introduction Methodology Base?Case Building Results Summary Statewide Electricity and Demand Savings from the IECC...

Kim, H.; Baltazar, J.C.; Haberl, J.; Lewis, C.; Yazdani, B.



Section 6 -Facilities Usage and Maintenance A. Facilities Usage and Maintenance  

E-Print Network (OSTI)

or full- size refrigerators or freezers are not permitted in the residence halls or apartments. 12. All

Pantaleone, Jim


An investigation into the knowledge and attitudes towards radon testing among residents in a high radon area  

Science Journals Connector (OSTI)

The aim of this study was to investigate the knowledge and attitudes of residents in the Castleisland area to radon. Castleisland in Co. Kerry was described as a high radon area following the discovery of a house in the area with radon levels 245 times that of the national reference level. Residents in this area were then asked to measure their homes for radon in the Castleisland radon survey. The uptake of this measurement was 17%. In order to investigate this response rate further, a questionnaire was designed and distributed to residents in the Castleisland area. This questionnaire measured the testing history of the participants, the reasons for testing/not testing, the factors important to them when considering having their home tested, radon knowledge and finally intentions to measure their home for radon. It was found that the main reason people do not test their home for radon is that they believe their home does not have a problem. Optimistic bias was thought to play a role here. The subjective norm component of the theory of planned behaviour was found to have a significant independent contribution in the variation in intentions to measure one's home for radon and this in turn could be targeted to increase uptake of radon measurement in the future.

Susan Clifford; David Hevey; Gerard Menezes



Admissions Checklist for Degree Seeking U.S. Resident Aliens You can save a filled copy of this form on your computer by clicking on the icon on your browser.  

E-Print Network (OSTI)

Admissions Checklist for Degree Seeking U.S. Resident Aliens You can save a filled copy as quickly as possible to ensure timely processing. 5. [ ] Documentation verifying U.S. Resident Alien

Texas at Arlington, University of


A comparative study of single family and multifamily housing recovery following 1992 Hurricane Andrew in Miami-Dade County, Florida  

E-Print Network (OSTI)

examines the recovery of single family, duplex, and apartment complex housing in south Miami-Dade County, Florida, after 1992 Hurricane Andrew to determine if there is indeed a "multifamily home lag." This research also provides a better understanding...

Lu, Jing-Chein


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2000 Annual Report.  

SciTech Connect

The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, commonly known as the Joint Stock Assessment Project (JSAP) is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (blocked area). The three-phase approach of this project will enhance the fisheries resources of the blocked area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information housed in a central location will allow managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP (NWPPC program measure 10.8B.26) is designed and guided jointly by fisheries managers in the blocked area and the Columbia Basin blocked area management plan (1998). The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of blocked area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the blocked area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. The use of common collection and analytical tools is essential to the process of streamlining joint management decisions. In 1999 and 2000 the project began to address some of the identified data gaps, throughout the blocked area, with a variety of newly developed sampling projects, as well as, continuing with ongoing data collection of established projects.

Crossley, Brian (Spokane Tribe of Indians, Department of Natural Resources, Wellpinit, WA); Lockwood, Jr., Neil W. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA)



Suppressors of Cytokine Signaling 1 and 3 Are Upregulated in Brain Resident Cells in Response to Virus-Induced Inflammation of the Central Nervous System via at Least Two Distinctive Pathways  

Science Journals Connector (OSTI)

...Cytokine Signaling 1 and 3 Are Upregulated in Brain Resident Cells in Response to Virus-Induced...LCMV model, SOCS mRNA was expressed in brain resident cells, including astrocytes and...found SOCS expression to be upregulated in brain resident cells with a peak on day 7 p...

Maria Abildgaard Steffensen; Christina Fenger; Jeanette Erbo Christensen; Carina Krogsgaard J鴕gensen; Maria Rosaria Bassi; Jan Pravsgaard Christensen; Bente Finsen; Allan Randrup Thomsen



ADJUSTMENT OF STATUS TO PERMANENT RESIDENT Adjustment of Status, filed on form I-485, is your personal application to the U.S. government  

E-Print Network (OSTI)

months in most countries, but can vary must apply in country of birth or legal permanent residence exam and interview overseas must obtain police certificates from every country where applicant

Scharer, John E.


Genetic and Phenotypic Catalog of Native Resident Trout of the Interior Columbia River Basin; Populations of the Upper Yakima Basin, 1997-1998 Annual Report.  

SciTech Connect

The objective of this project is to photo-document upper Columbia Basin native resident trout populations in Washington, and to ascertain their species or subspecies identity and relative genetic purity using a nonlethal DNA technique.

Trotter, Patrick C. (Fishery Science Consultant, Seattle, WA); McMillan, Bill; Gayeski, Nick (Washington Trout, Duvall, WA)



Detailed Analysis of the Thermal Mass Credits in a Code-Traceable DOE-2 Simulation of the 2001 IECC for a Single-Family Residence in Texas  

E-Print Network (OSTI)

This paper presents the results of a study that investigates the thermal mass credits in the 2001 International Energy Conservation Code (IECC) (ICC 1999, 2001) for a single-family residence in Texas using the DOE-2 building energy simulation...

Kim, S.; Haberl, J.


Influence of mean gas residence time in the bubbling fluidised bed on the performance of a 100-kW dual fluidised bed steam gasifier  

Science Journals Connector (OSTI)

In this study, the influence of mean gas residence time in the bubbling fluidised bed, ? f..., on the performance of a pilot scale 100爇W dual fluidised bed gasifier was experimentally investigate...

W. L. Saw; S. S. Pang



Statewide Electricity and Demand Capacity Savings from the International Energy Conservation Code (IECC) Adoption for Single-Family Residences in Texas (2002-2011)  

E-Print Network (OSTI)

This report is the continuation of the previous 2011 Statewide Electricity Savings report from code-compliant, single-family residences built between 2002 and 2009. Statewide electricity and electric demand savings achieved from the adoption...

Kim, H.; Baltazar, J. C.; Haberl, J. S.; Yazdani, B.



Data:Ad7dc9f5-a5cf-406f-9d41-9b5f7d92f714 | Open Energy Information  

Open Energy Info (EERE)

f5-a5cf-406f-9d41-9b5f7d92f714 f5-a5cf-406f-9d41-9b5f7d92f714 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Lakewood Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh):


Data:Ca9c956f-3cdd-47e7-98f1-40228cb2d165 | Open Energy Information  

Open Energy Info (EERE)

c956f-3cdd-47e7-98f1-40228cb2d165 c956f-3cdd-47e7-98f1-40228cb2d165 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Steilacoom Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh):


Data:552fc369-7cf0-4f9c-b245-9fab3a11edae | Open Energy Information  

Open Energy Info (EERE)

9-7cf0-4f9c-b245-9fab3a11edae 9-7cf0-4f9c-b245-9fab3a11edae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of University Place Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)


Data:08bcd187-c56b-4840-a335-e94c7045cc30 | Open Energy Information  

Open Energy Info (EERE)

8bcd187-c56b-4840-a335-e94c7045cc30 8bcd187-c56b-4840-a335-e94c7045cc30 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Fife Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh):


Resident Fish Stock above Chief Joseph and Grand Coulee Dams; 2002 Annual Report.  

SciTech Connect

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. In 1999, 2000, and 2001 the project began addressing some of the identified data gaps throughout the Blocked Area. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Department of Natural Resources, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA); Butler, Chris (Spokane Tribe of Indians, Department of Natural Resources, Wellpinit, WA)



Resident Fish Stock above Chief Joseph and Grand Coulee Dams; 2003-2004 Annual Report.  

SciTech Connect

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial and native fish assemblages in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. The project began addressing identified data gaps throughout the Blocked Area in 1999. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, Spokane River below Spokane Falls, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002 and 2003. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Olympia, WA); Butler, Chris (Spokane Tribe of Indians, Wellpinit, WA)



Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2001 Annual Report.  

SciTech Connect

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power Planning Council (NPPC). The NPPC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPPC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area and the Columbia Basin Blocked Area Management Plan (1998). The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. In 1999, 2000, and 2001 the project began addressing some of the identified data gaps throughout the Blocked Area. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of seven streams and four lakes on the Spokane Indian Reservation were completed by 2000. Assessments of the Little Spokane River and its tributaries, tributaries to the Pend Oreille River, small lakes in southern Pend Oreille County, and water bodies within and near the Spokane Indian Reservation were conducted in 2001. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispell Department of Natural Resources, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA); O'Connor, Dick (Washington Department of Fish and Wildlife, Olympia, WA)



Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2002-2003 Annual Report.  

SciTech Connect

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial and native fish assemblages in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. The project began addressing identified data gaps throughout the Blocked Area in 1999. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, Spokane River below Spokane Falls, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002 and 2003. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife); Butler, Chris (Spokane Tribe of Indians, Wellpinit, WA)



Residency, site fidelity and habitat use of Atlantic cod (Gadus morhua) at an offshore wind farm using acoustic telemetry  

Science Journals Connector (OSTI)

Abstract Because offshore wind energy development is fast growing in Europe it is important to investigate the changes in the marine environment and how these may influence local biodiversity and ecosystem functioning. One of the species affected by these ecosystem changes is Atlantic cod (Gadus morhua), a heavily exploited, commercially important fish species. In this research we investigated the residency, site fidelity and habitat use of Atlantic cod on a temporal scale at windmill artificial reefs in the Belgian part of the North Sea. Acoustic telemetry was used and the Vemco VR2W position system was deployed to quantify the movement behaviour. In total, 22 Atlantic cod were tagged and monitored for up to one year. Many fish were present near the artificial reefs during summer and autumn, and demonstrated strong residency and high individual detection rates. When present within the study area, Atlantic cod also showed distinct habitat selectivity. We identified aggregation near the artificial hard substrates of the wind turbines. In addition, a clear seasonal pattern in presence was observed. The high number of fish present in summer and autumn alternated with a period of very low densities during the winter period.

Jan T. Reubens; Francesca Pasotti; Steven Degraer; Magda Vincx



Idaho Water Rental Pilot Project Probability/Coordination Study Resident Fish and Wildlife Impacts Phase III, 1996 Annual Report.  

SciTech Connect

Phase 3 began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River Basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water. Existing data, in the form of weighted usable area versus flow relationships, were used to estimate habitat changes for white sturgeon (Acipenser transinontanus) and rainbow trout (Oncorhynchus mykiss) in the Snake River between C.J. Strike Dam and Brownlee pool. The increased flows resulted in increased habitat for adult and juvenile white sturgeon and adult rainbow trout. But, the flows have failed to meet mean monthly flow recommendations for the past three years despite the addition of the flow augmentation releases. It is unlikely that the flow augmentation releases have had any significant long-term benefit for sturgeon and rainbow trout in the Snake River. Flow augmentation releases from the Boise and Payette rivers have in some years helped to meet or exceed minimum flow recommendations in these tributaries. The minimum flows would not have been reached without the flow augmentation releases. But, in some instances, the timing of the releases need to be adjusted in order to maximize benefits to resident fishes in the Boise and Payette rivers.

Leitzinger, Eric J. [Idaho Dept. of Fish and Game, Boise, ID (United States)



Idaho Water Rental Pilot Project probability/coordination study resident fish and wildlife impacts, Phase III. Annual report  

SciTech Connect

Phase III began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water. Existing data, in the form of weighted usable area versus flow relationships, were used to estimate habitat changes for white sturgeon (Acipenser transmontanus) and rainbow trout (Oncorhynchus mykiss)in the Snake River between C.J. Strike Dam and Brownlee pool. The increased flows resulted in increased white sturgeon habitat for most life stages. Rainbow trout adult and spawning habitat increased while juvenile and fry habitat generally decreased. Whether or not these short term increases in habitat result in long term benefits to the fish populations has yet to be determined.

Leitzinger, E.



Idaho Water Rental Pilot Project Probability/Coordination Study Resident Fish and Wildlife Impact Phase III, 1995 Annual Report.  

SciTech Connect

Phase III began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water. Existing data, in the form of weighted usable area versus flow relationships, were used to estimate habitat changes for white sturgeon (Acipenser transmontanus) and rainbow trout (Oncorhynchus mykiss) in the Snake River between C.J. Strike Dam and Brownlee pool. The increased flows resulted in increased white sturgeon habitat for most life stages. Rainbow trout adult and spawning habitat increased while juvenile and fry habitat generally decreased. Whether or not these short term increases in habitat result in long term benefits to the fish populations has yet to be determined.

Leitzinger, Eric J. (Idaho Department of Fish and Game, Boise, ID)



Purpose of the Form All non-US Citizens are required to complete the Form UPP-192, Alien Determination of Residency. The UPP-  

E-Print Network (OSTI)

Purpose of the Form All non-US Citizens are required to complete the Form UPP-192, Alien Alien Status Indicate your current alien status. If you are currently working/receiving payment from UPP-192 颅 ALIEN DETERMINATION OF RESIDENCY INSTRUCTIONS #12;Section III 颅 Immigration Information Days

He, Chuan

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Malignant Neoplasms among Residents of a Blackfoot Disease-endemic Area in Taiwan: High-Arsenic Artesian Well Water and Cancers  

Science Journals Connector (OSTI)

...of this area also has a high salinity. For this reason, some residents...There was a decreasing gradient of BFD prevalence rate following...Ichu following a declining gradient of BFD prevalence rate. The...township. However, the declining gradient of SMRs was not in the order...

Chien-Jen Chen; Ya-Chien Chuang; Tong-Ming Lin; and Hsin-Yin Wu



Infrastructure Required for Tag/Mark Application, Detection, and Recovery Tag/Mark & release Juvenile fish migration Adult fish migration Mortality*Ocean residency  

E-Print Network (OSTI)

Juvenile fish migration Adult fish migration Mortality*Ocean residency Adipose fin clip Marking trailers N processing Otolith Insulated box, thermal chilling system, lab processing, smolt traps N/A Fish traps, fish *Fish mortality data may be collected at any stage of the fish life cycle from harvest, recovered


PUBLIC SAFETY -We all share responsibility for safety in the residences and on campus. Rutgers University Public Safety works very closely with University Housing to insure that  

E-Print Network (OSTI)

PUBLIC SAFETY - We all share responsibility for safety in the residences and on campus. Rutgers University Public Safety works very closely with University Housing to insure that students feel safe SAFETY 颅 The Rutgers University Police Department, RUPD, has a visible presence on campus. In addition


AGREEMENT & AUTHORIZATION FOR TELECOMMUTING The Employee named below is hereby authorized to perform work for Fermilab at the residence or off-site office located at  

E-Print Network (OSTI)

FERMILAB AGREEMENT & AUTHORIZATION FOR TELECOMMUTING The Employee named below is hereby authorized to perform work for Fermilab at the residence or off-site office located at understands and agrees that authorization to perform Fermilab job duties away from the Fermilab premises

Quigg, Chris


Effect of Residence Time on Ni-Sorption Mechanisms on Clay and Oxide Minerals: An X-ray Absorption Fine Structure (XAFS) Study  

E-Print Network (OSTI)

Effect of Residence Time on Ni-Sorption Mechanisms on Clay and Oxide Minerals: An X-ray Absorption Fine Structure (XAFS) Study A. M. Scheidegger and G. M. Lamble Metal sorption on clay and oxide in reaction rate has been attributed to metal sorption onto sites of lower reactivity, diffusion

Sparks, Donald L.


Residence Time Effects on P Sorption/Desorption on Ferrihydrite Understanding mechanisms of P retention/release on soil mineral surfaces is  

E-Print Network (OSTI)

Residence Time Effects on P Sorption/Desorption on Ferrihydrite Y. Arai Understanding mechanisms through macroscopic and microscopic approaches. The effect of ionic strength (0.0, 0.1, 1.0) on P sorption pH, sorption decreased ad I decreased. The effect of pH (4, 7.l5, 9.5) on P sorption kinetics

Sparks, Donald L.


Residence Time Effects on Arsenate Adsorption/Desorption Mechanisms on Goethite S. E. O'Reilly,* D. G. Strawn, and D. L. Sparks  

E-Print Network (OSTI)

Residence Time Effects on Arsenate Adsorption/Desorption Mechanisms on Goethite S. E. O'Reilly,* D and desorption on goethite, and to combine spectro- Xu et al., 1988). For example, arsenate sorption on scopic x and Glaubig, 1988).showed that arsenate sorption on goethite increased with time. Sorp- Goethite ( 颅Fe

Sparks, Donald L.


Integrating Energy and Indoor Environmental Quality Retrofits in Apartments  

E-Print Network (OSTI)

of the National Weatherization Assistance Program, Oak RidgeNational Weatherization Assistance Program, which targetsthe National Weatherization Assistance Program indicates a

Fisk, William J.



Cascade Apartments - Deep Energy Multifamily Retrofit , Kent, Washington (Fact Sheet)  

SciTech Connect

In December of 2009-10, King County Housing Authority (KCHA) implemented energy retrofit improvements in the Cascade multifamily community, located in Kent, Washington (marine climate.)This research effort involved significant coordination from stakeholders KCHA, WA State Department of Commerce, utility Puget Sound Energy, and Cascade tenants. This report focuses on the following three primary BA research questions : 1. What are the modeled energy savings using DOE low income weatherization approved TREAT software? 2. How did the modeled energy savings compare with measured energy savings from aggregate utility billing analysis? 3. What is the Savings to Investment Ratio (SIR) of the retrofit package after considering utility window incentives and KCHA capitol improvement funding.

Not Available



Integrating Energy and Indoor Environmental Quality Retrofits in Apartments  

E-Print Network (OSTI)

Environmental Quality and Energy Education In addition toAPPENDIX A1: Tenant Indoor Environmental Quality and Energyimproving indoor air quality (IAQ), energy efficiency and

Fisk, William J.



Building America Case Study: Conway Street Apartments, Greenfield...  

Energy Savers (EERE)

Learned * Ductless heat pumps allow for much lower first costs than conventional heating and cooling systems. With an efficient envelope, operating costs are also very...


Integrating Energy and Indoor Environmental Quality Retrofits in Apartments  

E-Print Network (OSTI)

e.g. , replacement of HVAC filters, use of kitchen and bathconditioning (HVAC) systems incorporating particle filters,forced-air HVAC systems, the existing particle filters were

Fisk, William J.



Indoor Environmental Quality Benefits of Apartment Energy Retrofits  

E-Print Network (OSTI)

kitchen range hood HVAC system filter upgrade Add waterHVAC ductwork & seal return plenum Install stand-alone wall-mounted HEPA filter

Noris, Federico



Conway Street Apartments: A Multifamily Deep Energy Retrofit  

SciTech Connect

While single-family, detached homes account for 63% of households (EIA 2009); multi-family homes account for a very large portion of that remaining housing stock, and this fraction is growing. Through recent research efforts, CARB has been evaluating strategies and technologies that can make dramatic improvements in energy performance in multi-family buildings.

Aldrich, R.; Williamson, J.



Deterministic hydrodynamics: Taking blood apart John A. Davis*  

E-Print Network (OSTI)

*露 *Princeton Institute for the Science and Technology of Materials, and Departments of Electrical Engineering and 露Physics, Princeton University, Princeton, NJ 08544; and Wadsworth Center, Albany, NY 12201 Contributed of blood plasma with no dilution by using a continuous- flow deterministic array that separates blood


174. THE EFFECTS OF RESIDENCE TIME ON THE RETENTION OF ARSENATE BY GOETHITE. S.E. O'Reilly and D.L. Sparks, Department of Plant and Soil Sciences, University  

E-Print Network (OSTI)

174. THE EFFECTS OF RESIDENCE TIME ON THE RETENTION OF ARSENATE BY GOETHITE. S.E. O'Reilly and D on goethite. Batch sorption and desorption studies were conducted at pH 6 for periods up to 2 months. Arsenate sorption increased slowly with time. As residence time between arsenate and goethite increased

Sparks, Donald L.


Urology Residency Program 2014  

E-Print Network (OSTI)

weeks Adult Urology 12 weeks General Surgery 4 weeks Pediatric Urology 4 weeks Nephrology 4 weeks Emergency Medicine 8 weeks Selective (choose 2 Radiology, CCU, Internal Medicine) 4 weeks Vacation PGY2 for each specific discipline. It will consist of: 20 weeks Adult Urology 8 weeks Pediatric Urology 12

MacMillan, Andrew


Greater Cincinnati Energy Alliance- Residential Loan Program (Kentucky)  

Energy.gov (U.S. Department of Energy (DOE))

The Greater Cincinnati Energy Alliance provides loans for single family residencies and owner occupied duplexes in Hamilton county in Ohio and Boone, Kenton, and Campbell counties in Kentucky. To...


Building America Case Study: Ground Source Heat Pump Research, TaC Studios Residence, Atlanta, Georigia (Fact Sheet)  

SciTech Connect

As part of the NAHB Research Center Industry Partnership, Southface partnered with TaC Studios, an Atlanta based architecture firm specializing in residential and light commercial design, on the construction of a new test home in Atlanta, GA in the mixed-humid climate. This home serves as a residence and home office for the firm's owners, as well as a demonstration of their design approach to potential and current clients. Southface believes the home demonstrates current best practices for the mixed-humid climate, including a building envelope featuring advanced air sealing details and low density spray foam insulation, glazing that exceeds ENERGY STAR requirements, and a high performance heating and cooling system. Construction quality and execution was a high priority for TaC Studios and was ensured by a third party review process. Post construction testing showed that the project met stated goals for envelope performance, an air infiltration rate of 2.15 ACH50. The homeowner's wished to further validate whole house energy savings through the project's involvement with Building America and this long-term monitoring effort. As a Building America test home, this home was evaluated to detail whole house energy use, end use loads, and the efficiency and operation of the ground source heat pump and associated systems. Given that the home includes many non-typical end use loads including a home office, pool, landscape water feature, and other luxury features not accounted for in Building America modeling tools, these end uses were separately monitored to determine their impact on overall energy consumption.

Not Available



Texas A&M AgriLife Extension Service Procedures 24.01.01.X0.10 Fire Safety for StateOwned Residences  

E-Print Network (OSTI)

Protection Association (NFPA) 101庐, Life Safety Code漏 has been adopted by the Texas State Fire MarshalTexas A&M AgriLife Extension Service Procedures 24.01.01.X0.10 Fire Safety for State.01.01.X0.10 Fire Safety for State颅Owned Residences Page 1 of 2 PROCEDURE STATEMENT The National Fire

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


{sup 226}Ra and {sup 231}Pa systematics of axial MORB, crustal residence ages, and magma chamber characteristics at 9--10{degree}N East Pacific Rise  

SciTech Connect

Mass spectrometric measurements of {sup 30}Th-22{sup 226}Ra and {sup 235}-U{sup 231}Pa disequilibria for axial basalts are used to determine crustal residence ages for MORB magma and investigate the temporal and spatial characteristics of axial magma chambers (AMC) at 9--10{degrees}N East Pacific Rise (EPR). Relative crustal residence ages can be calculated from variations in {sup 226}Ra/{sup 230}Th and {sup 231}Pa/{sup 235}U activity ratios for axial lavas, if (1) mantle sources and melting are uniform, and mantle transfer times are constant or rapid for axial N-MORB, and (2) {sup 231}Pa/{sup 235}U and {sup 226}Ra/{sup 230}Th in the melt are unaffected by shallow level fractional crystallization. Uniform Th, Sr, and Nd isotopic systematics and incompatible element ratios for N-MORB along the 9--10{degrees}N segment indicate that mantle sources and transfer times are similar. In addition, estimated bulk solid/melt partition coefficients for U, Th, and Pa are small, hence effects of fractional crystallization on {sup 231}Pa/{sup 235}U ratios for the melt are expected to be negligible. However, fractional crystallization of plagioclase in the AMC would lower {sup 226}Ra/{sup 230}Th ratios in the melt and produce a positive bias in {sup 226}Ra crustal residence ages for fractionated lavas.

Goldstein, S.J.; Murrell, M.T. [Los Alamos National Lab., NM (United States); Perfit, M.R. [Univ., of Florida, Gainesville, FL (United States). Dept. of Geology; Batiza, R. [Univ., of Hawaii, Honolulu, HI (United States); Fornari, D.J. [Woods Hole Oceanographic Institution, MA (United States). Dept. of Geology and Geophysics



Foreign Student & Scholar Services, Student Services Building, 30 Lovett Avenue, Newark, DE 19716, Tel: (302)831-2115,Fax:(302)831-2123, E-mail: foreignservices@udel.edu Honorarium payments may be made only to a non-resident alien who is in an immigration  

E-Print Network (OSTI)

-resident alien who is in an immigration status that legally allows such payments. The visa types B-1, B-2, W/B, W/T and UD J-1 are eligible. The following regulations relate to non-resident alien honorarium payments to visitors at the University of Delaware: 1) A non-resident alien can receive an honorarium without a SSN

Firestone, Jeremy


Study on effects of resident-perceived neighborhood boundaries on public services accessibility & its relation to utilization: using Geographic Information System, focusing on the case of public parks in Austin, Texas  

E-Print Network (OSTI)

parks based on equity consideration and its relationship to park utilization. The study also addressed whether the neighborhood boundaries perceived by the actual residents may exhibit more actual neighborhood construct than Census-based Neighborhood...

Cho, Chun Man



Measurements of daily urinary uranium excretion in German peacekeeping personnel and residents of the Kosovo region to assess potential intakes of depleted uranium (DU)  

Science Journals Connector (OSTI)

Following the end of the Kosovo conflict, in June 1999, a study was instigated to evaluate whether there was a cause for concern of health risk from depleted uranium (DU) to German peacekeeping personnel serving in the Balkans. In addition, the investigations were extended to residents of Kosovo and southern Serbia, who lived in areas where DU ammunitions were deployed. In order to assess a possible DU intake, both the urinary uranium excretion of volunteer residents and water samples were collected and analysed using inductively coupled plasma-mass spectrometry (ICP-MS). More than 1300 urine samples from peacekeeping personnel and unexposed controls of different genders and age were analysed to determine uranium excretion parameters. The urine measurements for 113 unexposed subjects revealed a daily uranium excretion rate with a geometric mean of 13.9爊g/d (geometric standard deviation (GSD)=2.17). The analysis of 1228 urine samples from the peacekeeping personnel resulted in a geometric mean of 12.8 ng/d (GSD=2.60). It follows that both unexposed controls and peacekeeping personnel excreted similar amounts of uranium. Inter-subject variation in uranium excretion was high and no significant age-specific differences were found. The second part of the study monitored 24爃 urine samples provided by selected residents of Kosovo and adjacent regions of Serbia compared to controls from Munich, Germany. Total uranium and isotope ratios were measured in order to determine DU content. 235U/238U ratios were within 睜0.3% of the natural value, and 236U/238U was less than 2犠10?7, indicating no significant DU in any of the urine samples provided, despite total uranium excretion being relatively high in some cases. Measurements of ground and tap water samples from regions where DU munitions were deployed did not show any contamination with DU, except in one sample. It is concluded that both peacekeeping personnel and residents serving or living in the Balkans, respectively, were not exposed to significant amounts of DU.

U. Oeh; N.D. Priest; P. Roth; K.V. Ragnarsdottir; W.B. Li; V. H鰈lriegl; M.F. Thirlwall; B. Michalke; A. Giussani; P. Schramel; H.G. Paretzke



Sold directly to consumers for:  

Gasoline and Diesel Fuel Update (EIA)

Customer Type Residential Residence (Single-Family Dwellings) Motor Home Propane Tanks CommercialInstitutional Airports Apartment BuildingsMulti-Family Dwellings Churches...


Data:06e5a14c-81b6-47c7-a596-28d9f3e16780 | Open Energy Information  

Open Energy Info (EERE)

Sector: Residential Description: Available only to residences, condominiums, Mobile Homes, or individually-metered apartments in which the energy required for all water...


Data:4a4012e1-9dd9-4833-9e0c-57be00f354b7 | Open Energy Information  

Open Energy Info (EERE)

Available only to residential customers in residences, condominiums, Mobile homes, or individually-metered apartments for lighting, cooking, water heating, heating,...


Data:A8a9f920-3074-483c-a5d4-81d7e47a1f7a | Open Energy Information  

Open Energy Info (EERE)

Description: Availability Available for residential electric service through one meter to individual residential customers in an individual residence or apartment and for...


Results of in vivo measurements of strontium-90 body-burden in Urals residents: analyses of data obtained 2006-2012  

SciTech Connect

A part of the Urals territory was contaminated with 90Sr and 137Cs in the 1950s as a result of accidents at the "Mayak" Production Association. The paper describes the analysis of in vivo 90Sr measurements in Urals residents. The measurements were performed with the use of whole-body-counter SICH-9.1M in 2006-2012. Totally 5840 measurements for 4876 persons were performed from 2006 to 2012; maximal measured value was 24 kBq. Earlier, similar measurements were performed with SICH-9.1 (1974-1997). Comparison of the results obtained with SICH-9.1 and SICH-9.1M has shown a good agreement of the two data sets.

Tolstykh, E. I.; Bougrov, N. G.; Krivoshchapov, Victor A.; Shishkina, Elena A.; Shagina, N. B.; Degteva, M. O.; Anspaugh, L. R.; Napier, Bruce A.



Cyber-Security week is coming up during the week of October 13, thru October 17, 2008. This year the Residence Hall Association is sponsoring a poster contest to educate and  

E-Print Network (OSTI)

the Residence Hall Association is sponsoring a poster contest to educate and bring awareness of cyber this is an issue that affects all of us. How do you get involved? Your poster should created electronically the document in a PDF format. What will you be doing? The poster should consist of information about the topic

Ray, David


Tuesday, May 29, 2012 page of 15 Disclaimer: NJIT, Residence Life is not responsible for arrangements made between readers of this list and landlords. We cannot guarantee the availability  

E-Print Network (OSTI)

-Campus Housing Listing as of 5-29-2012 Residence Life Office, Cypress Hall Office Phone: (973) 596-3039 Email community and 24 Hour Security Patrol. Tennis Court and Swimming Pool . No pets, No partying, No smoking in townhouse shared with male students, with 24/7 security patrols and access to tennis courts, swimming pool

Bieber, Michael


09-07-13 07:53More snapping turtles spotted in Ottawa: residents Page 1 sur 5http://www.cbc.ca/canada/ottawa/story/2009/07/10/ottawa-turtle-eggs-rideau.html#socialcomments  

E-Print Network (OSTI)

09-07-13 07:53More snapping turtles spotted in Ottawa: residents Page 1 sur 5http://www.cbc.ca/canada/ottawa/story/2009/07/10/ottawa-turtle-eggs-rideau.html#socialcomments More snapping turtles spotted in Ottawa the Rideau River say they've seen more snapping turtles since construction on the city's sewers began

Blouin-Demers, Gabriel



SciTech Connect

Human teeth have been considered as dosimeters for decades. Methods include the in vivo measurement of 90Sr/90Y in teeth with a tooth-beta counter (TBC), the radiochemical determination of 90Sr in whole teeth, and the measurement of dose in teeth by use of electron paramagnetic resonance (EPR). Presented in this paper are results of 2,514 TBC measurements, 334 radiochemical measurements, and 218 EPR measurements for residents living in settlements along the Techa River. All three kinds of measurements indicate a sharp peak that corresponds to the uptake of 90Sr by tooth tissue. The results can be interpreted in terms of an intake function for 90Sr only if the period of calcification of each individual tooth is considered?such detail on a tooth by tooth basis is presented in this paper. The conclusion is reached that the TBC data are the most reliable in terms of reconstruction of 90Sr intake; this is due in part to the fact that the TBC measures four teeth (all at position 1) with essentially the same time periods of mineralization and because there are a large number of TBC measurements. The main utility of EPR measurements is considered to be the validation of estimates of external dose; but for this purpose teeth with 90Sr taken up into enamel must be avoided.

Tolstykh, E I.; Shishkina, Elena A.; Degteva, M O.; Ivanov, Denis V.; Shved, Valentina A.; Bayankin, Sergey N.; Anspaugh, Lynn R.; Napier, Bruce A.; Wieser, Albrecht; Jacob, Peter




E-Print Network (OSTI)

directions from Centre Street. public transportation: The Boston College branch of the MBTA's "Green Line" (B

Huang, Jianyu


Conditional Residency Application REGISTRAR'S OFFICE  

E-Print Network (OSTI)

that he or she is "[a] person who is living and is gainfully employed on a full-time or part-time and self-sustaining

Franco, John


Immediate Residency Application REGISTRAR'S OFFICE  

E-Print Network (OSTI)

, as of the first day of a term of enrollment, has accepted full-time, self-sustaining employment and established

Franco, John



E-Print Network (OSTI)

protection systems. Documents in the following websites are referenced in the report: 路 www.fau.edu/facilities/EH&S/safety/fire evacuation procedures. 路 Inspecting, testing and maintaining fire protection systems in accordance with National Fire Protection Association (NFPA) standards. 路 Performing plan reviews and code consultation

Fernandez, Eduardo


Neurology Residency Department of Neurology &  

E-Print Network (OSTI)

-patient service Montreal Neurological Hospital Pediatric neurology in-patient clinical teaching unit;2 SMBD-Jewish General Hospital Elective rotations Neuro-radiology Montreal Neurological Hospital

Shoubridge, Eric


Data:588469d3-5d8a-442d-b11c-7dd07a9e8c05 | Open Energy Information  

Open Energy Info (EERE)

d3-5d8a-442d-b11c-7dd07a9e8c05 d3-5d8a-442d-b11c-7dd07a9e8c05 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tacoma, Washington (Utility Company) Effective date: 2013/04/01 End date if known: Rate name: RS - Schedule A-1 - City of Fircrest Sector: Residential Description: Available for domestic purposes in residences, apartments, duplex houses and multiple family dwellings. Source or reference: www.mytpu.org/customer-service/rates/power-rates/power-rates-schedules.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh):


THINGS TO CONSIDER WHEN APARTMENT HUNTING IN BOSTON We strongly recommended that you come to Boston to search for an apartment in-person. It is not a  

E-Print Network (OSTI)

颅 The Massachusetts Bay Transportation Authority (MBTA), better known as "the T," operates the public transportation are available at the Bursar's Office. For more T info, check their website at http://www.mbta.com. 路 Bus routes arrive at various subway stations within the city. Check the MBTA website for more information. Program

Dennett, Daniel

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


THINGS TO CONSIDER WHEN APARTMENT HUNTING IN BOSTON We strongly recommended that you come to Boston to search for an apartment in-person. It is not a  

E-Print Network (OSTI)

Transportation 颅 The Massachusetts Bay Transportation Authority (MBTA), better known as "the T," operates monthly T passes are available at the Bursar's Office. For more T info, check their website at http://www.mbta schedules arrive at various subway stations within the city. Check the MBTA website for more information

Dennett, Daniel


THINGS TO CONSIDER WHEN APARTMENT HUNTING IN BOSTON We strongly recommended that you come to Boston to search for an apartment in-person. It is not a  

E-Print Network (OSTI)

(MBTA), better known as "the T," operates the public transportation system in Boston and the surrounding T info, check their website at http://www.mbta.com. 路 Bus routes 9, 11, 43, and the Silver Line all stop the city. Check the MBTA website for more information. Please note, while many of our students live

Dennett, Daniel


Increased Levels of Harvest and Habitat Law Enforcement and Public Awareness for Anadromous Salmonids and Resident Fish in the Columbia River Basin -- Demonstration Period, 1992--1994, Final Report.  

SciTech Connect

This report was funded by the Bonneville Power Administration (BPA), US Department of Energy, as part of BPA`s program to protect, mitigate, and enhance fish and wildlife affected by the development and operation of hydroelectric facilities on the Columbia River and its tributaries. Illegal harvest and violation of habitat protection regulations are factors affecting the survival of many native species of anadromous and resident fish in the Columbia Basin.

NeSmith, Frank (Idaho Department of Fish and Game, Boise, ID); Long, Mack (Montana Department of Fish, Wildlife and Paks, Kalispell, MT); Matthews, Dayne (Washington Department of Fish and Wildlife, Olympia, WA)



Deformation behavior of duplex zircaloy-4-oxygen alloys  

SciTech Connect

Mechanical properties at thermal equilibrium have been determined. The strengthening behavior for alloys having isolated /alpha/ grains in the softer /beta/ matrix is similar to dispersed particle strengthening. Yield strength obeys the Petch relationship. The strength obeys a modified rule of mixtures. Deformation behavior is interpreted in terms of dislocation slip in the /beta/ matrix and diffusion assisted climb near the interphase boundary. 9 refs.

Tseng, D.; Tangri, K.



Erosion studies on duplex and graded ceramic overlay coatings  

Science Journals Connector (OSTI)

The solid-particle erosion resistance of ceramic thermal barrier coatings (TBCs) is of considerable economic and industrial significance. Of additional significance to the service performance of these coatings...

Saifi Usmani; Sanjay Sampath Ph.D.



Effective phase control of silicon films during high-rate deposition in atmospheric-pressure very high-frequency plasma: Impacts of gas residence time on the performance of bottom-gate thin film transistors  

Science Journals Connector (OSTI)

Abstract Hydrogenated amorphous silicon (a-Si) and microcrystalline silicon (?c-Si) films were grown in atmospheric-pressure (AP) He/H2/SiH4 plasma excited by a 150-MHz very high-frequency (VHF) power at a temperature of 220牥C. The variations in thickness and crystallinity of the deposited Si films along the gas flow direction were studied as functions of gas residence time in the plasma, VHF power density and H2 flow rate. Furthermore, the electrical characteristics of bottom-gate thin film transistors (TFTs) were investigated to evaluate the film quality. The results revealed that the chemical reactions both in gas phase and on the growing film surface were significantly enhanced in AP-VHF plasma, promoting phase transition from amorphous to microcrystalline in a time of the order of 0.1爉s. The performance of the \\{TFTs\\} showed that a-Si layers formed in the upstream portion of the plasma zone had reasonably good electrical property (field-effect mobility of approximately 2燾m2/V爏) despite very high deposition rates around 20爊m/s. While ?c-Si layers deposited in the downstream portion were very defective, which might come from the insufficient passivation of grain boundaries with a-Si tissues due to a too long gas residence time in the plasma. The precise control of gas residence time by adjusting the length of plasma will be effective for the phase control of Si films with desired quality.

H. Kakiuchi; H. Ohmi; T. Yamada; A. Hirano; T. Tsushima; W. Lin; K. Yasutake



Genetic and Phenotype [Phenotypic] Catalog of Native Resident Trout of the interior Columbia River Basin : FY-99 Report : Populations of the Pend Oreille, Kettle, and Sanpoil River Basins of Colville National Forest.  

SciTech Connect

The 1994 Fish and Wildlife Program of the Northwest Power Planning Council specifies the recovery and preservation of population health of native resident fishes of the Columbia River Basin. Among the native resident species of concern are interior rainbow trout of the Columbia River redband subspecies Oncorhynchus mykiss gairdneri 1 and westslope cutthroat trout O. clarki lewisi. The westslope cutthroat trout has been petitioned for listing under the U. S. Endangered Species Act (American Wildlands et al. 1997). Before at-risk populations can be protected, their presence and status must be established. Where introgression from introduced species is a concern, as in the case of both westslope cutthroat trout and redband rainbow trout, genetic issues must be addressed as well. As is true with native trout elsewhere in the western United States (Behnke 1992), most of the remaining pure populations of these species in the Columbia River Basin are in relatively remote headwater reaches. The objective of this project is to photo-document upper Columbia Basin native resident trout populations in Washington, and to ascertain their species or subspecies identity and relative genetic purity using a nonlethal DNA technique. FY-99 was year two of a five-year project in which we conducted field visits to remote locations to seek out and catalog these populations. In FY-99 we worked in collaboration with the Colville National Forest and Kalispel Indian Tribe to catalog populations in the northeastern corner of Washington State.

Trotter, Patrick C.



Technical assistance to the Montana Department of Health and Environmental Sciences. Arsenic and lead exposure study of residents living near the Rocker operable unit of the Silver Bow Creek Superfund site, Rocker, Montana. Final report  

SciTech Connect

The ATSDR and the Montana Department of Health and Environmental Sciences conducted a study to assess arsenic and lead exposure among residents of Rocker, Montana, where arsenic had been detected in soil up to 214,000 ppm. No statistically significant difference was found between Rocker residents and a comparison population with respect to the geometric mean of the urine arsenic levels. When data were combined from both groups, recent seafood ingestion was the variable most strongly associated with detectable urine arsenic levels. Although blood lead levels in the target area differed significantly from those in the comparison, a significant association was not detected between blood lead levels > or = 10 microgram/d1 and area of residence. Lead was detected in the blood of two siblings in the target area at levels of 20.7 and 31.3 microgram/d1. A lead based paint hazard and elevated concentrations of soil lead from the children's play area were detected in the household.

Gaventa, S.; Coull, B.; Gedrose, J.; Jones, P.; Dennehy, D.



A Multiple Watershed Approach to Assessing the Effects of Habitat Restoration Actions on Anadromous and Resident Fish Populations, Technical Report 2003-2004.  

SciTech Connect

Habitat protection and restoration is a cornerstone of current strategies to restore ecosystems, recover endangered fish species, and rebuild fish stocks within the Columbia River Basin. Strategies featuring habitat restoration include the 2000 Biological Opinion on operation of the Federal Columbia River Power System (FCRPS BiOp) developed by the National Marine Fisheries Service (NMFS), the 2000 Biological Opinion on Bull Trout developed by the US Fish and Wildlife Service (USFWS), and Sub-Basin Plans developed under the Fish and Wildlife Program of the Northwest Power and Conservation Council (NWPCC). There is however little quantitative information about the effectiveness of different habitat restoration techniques. Such information is crucial for helping scientists and program managers allocate limited funds towards the greatest benefits for fish populations. Therefore, it is critical to systematically test the hypotheses underlying habitat restoration actions for both anadromous and resident fish populations. This pilot project was developed through a proposal to the Innovative Projects fund of the NWPCC (ESSA 2002). It was funded by the Bonneville Power Administration (BPA) following reviews by the Independent Scientific Review Panel (ISRP 2002), the Columbia Basin Fish and Wildlife Authority (CBFWA 2002), the NWPCC and BPA. The study was designed to respond directly to the above described needs for information on the effectiveness of habitat restoration actions, including legal measures specified in the 2000 FCRPS BiOp (RPA 183, pg. 9-133, NMFS 2000). Due to the urgency of addressing these measures, the timeline of the project was accelerated from a duration of 18 months to 14 months. The purpose of this pilot project was to explore methods for evaluating past habitat restoration actions and their effects on fish populations. By doing so, the project will provide a foundation of retrospective analyses, on which to build prospective, multi-watershed designs for future habitat restoration actions. Such designs are being developed concurrently with this project by several other groups in the Columbia Basin (RME Workgroup 2003, NMFS 2003, Hillman and Paulsen 2002, Hillman 2003). By addressing questions about habitat restoration and monitoring (in coordination with other related efforts), we hope that this project will catalyze a shift in the Basin's paradigm of habitat restoration, moving from implementation of individual watershed projects towards rigorously designed and monitored, multiwatershed, adaptive management experiments. The project involved three phases of work, which were closely integrated with various related and ongoing efforts in the region: (1) Scoping - We met with a Core Group of habitat experts and managers to scope out a set of testable habitat restoration hypotheses, identify candidate watersheds and recommend participants for a data evaluation workshop. (2) Data Assembly - We contacted over 80 scientists and managers to help evaluate the suitability of each candidate watershed's historical data for assessing the effectiveness of past restoration actions. We eventually settled on the Yakima, Wenatchee, Clearwater, and Salmon subbasins, and began gathering relevant data for these watersheds at a workshop with habitat experts and managers. Data assembly continued for several months after the workshop. (3) Data Analysis and Synthesis - We explored statistical approaches towards retrospectively analyzing the effects of restoration 'treatments' at nested spatial scales across multiple watersheds (Chapters 2-5 of this report). These analyses provided a foundation for identifying existing constraints to testing restoration hypotheses, and opportunities to overcome these constraints through improved experimental designs, monitoring protocols and project selection strategies (Chapters 6 and 7 of this report). Finally, we developed a set of recommendations to improve the design, implementation, and monitoring of prospective habitat restoration programs in the Columbia River Basin (Chapter 8).

Marmorek, David



Texas' Senate Bill 5 Legislation for Reducing Pollution in Non-Attainment and Affected Areas: Procedures for Measuring Electricity Savings from the Adoption of the International Energy Conservation Code (IRC/IECC 2001) in New Residences  

E-Print Network (OSTI)

and 4 (i.e., 1,000 to 1,999 HDD65) for the Houston-Galveston-Beaumont-Port Author-Brazoria area. Also shown on Figure 2 are the locations of the various weather data sources, including the seventeen Typical Meteorological Year (TMY2) (NREL 1995... populated counties in the state, and contained 13.9 million residents in 1999, which represents 69.5% of the state?s 20.0 million total population (U.S. Census 1999). As shown in Figure 3, three of these counties (i.e., Harris, Dallas, and Tarrant...

Haberl, J. S.; Culp, C.; Yazdani, B.; Fitzpatrick, T.; Turner, W. D.



Determination of polychlorinated biphenyl levels in the serum of residents and in the homogenates of seafood from the New Bedford, Massachusetts Area: A comparison of exposure sources through pattern recognition techniques  

SciTech Connect

Gas chromatographic patterns of polychlorinated biophenyls (PCBs) found in the serum of New Bedford, MA residents with high serum PCBs were compared to patterns found in lobsters and bluefish taken from local waters, and goats fed selected technical Aroclors (e.g., Aroclors 1016, 1242, 1254, or 1260) using Jaccard measures of similarity and Principal Component Analysis. Pattern in humans were silimar to patterns in lobsters and both were more similar to those in the goat fed Aroclor 1254 as demonstrated by both pattern recognition techniques. However, patterns observed in humans, lobsters and bluefish all exhibited some presence of PCBs more characteristic of Aroclors 1016 and/or 1242 or 1260.

Burse, V.W.; Groce, D.F.; Caudill, S.P.; Korver, M.P.; Phillips, D.L.



Apart from outcomes of direct rele-vance to the Tajik Pamirs, what are the  

E-Print Network (OSTI)

, strategic goals, and elements for sustainable development? A strategy for sustainable mountain development According to OECD-DAC guidelines, a strategy for sustainable development should comprise: A coordinated set of par- ticipatory and continuously improving processes of analysis, debate, capacity- strengthening

Richner, Heinz


Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network (OSTI)


Noris, Federico



Prying Apart Ruddlesden-Popper Phases: Exfoliation into Sheets and Nanotubes for Assembly of Perovskite  

E-Print Network (OSTI)

.; Salvador, P. A.; Mason, T. O.; Zhang, H.; Marks, L. D. J. Am. Chem. Soc. 1996, 118, 8951. (b) Salvador, P


The web-based graphic service request system for facility management of apartments  

E-Print Network (OSTI)

This research investigates the feasibility of web technology as a means of handling service requests for delivering high quality service in building operation and maintenance. This research proposes a web-based graphic service request (WGSR) system...

Lee, Kwang Jun



Web-based feedback system: the life cycle management as continuous maintenance of apartment facility information  

E-Print Network (OSTI)

This research investigates the feasibility of web technology as a means of delivering facility information for better support of facility operations and maintenance. This study proposes a web-based feedback system as a pragmatic solution...

Jeong, Jin Su



Groningen, een stad apart : over het verleden van een eigenzinnige stad (1000-1600).  

E-Print Network (OSTI)

??Groningers hebben een opvallend zelfbewuste houding en een grote behoefte aan onafhankelijkheid. Kenmerken die volgens promovendus Jan van den Broek het gevolg zijn van de (more)

Broek, Jan van den



Wind resistance performance analysis of automated exterior wall painting robot for apartment buildings  

Science Journals Connector (OSTI)

Painters who have to work on the exterior walls of high-rise buildings are constantly exposed to the risk of falling, which can be fatal. Korea and other countries are endeavoring to develop technology that autom...

Ji-Won Cho; Hyun-Seok Yoo; Seung-Ho Choi



Assessment of children's exposure to arsenic from CCA-wood staircases at apartment complexes in Florida  

E-Print Network (OSTI)

in Florida Julia Ky Gress a , Jason T. Lessl a,b , Xiaoling Dong a , Lena Q. Ma a,b, a Soil Water Science Department, University of Florida, Gainesville, FL 32611, United States b State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Jiangsu 201146, China H I G H L

Ma, Lena


Research of Economic Sustainability of Different Energy Refurbishment Strategies for an Apartment Block Building  

Science Journals Connector (OSTI)

Abstract May energy saving derived from the retrofit of a building be able to pay its costs? The paper wants to answer to this simple question, reporting a research started with a simple case study (an Italian social housing quarter, served by a district heating system, which needs as many others in many other countries a reasonable refurbishment). The economic sustainability of different retrofitting strategies has been studied: a method to evaluate the costs of refurbishment interventions has been developed through a detailed design of interventions, identifying construction costs thanks to the contribution of a group of selected contractors which gave us reasonable prices representative of a real services offers and assessing the cost-optimal energy levels leading the building towards the energy labels B and A. Both envelope and systems refurbishment works have been investigated. The adopted method allows to chose among different refurbishment options, evaluating them as elementary cases and whole interventions, considering their efficiency by means of the Cost of Conserved Energy (CCE) method and the pay-back of the investments (ROI) by the cash-flow method, analysing different funding systems and incentives.

Enrico De Angelis; Giorgio Pansa; Ermanno Serra


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

________________________________________________________________ 6 Care_of_Furnishings_________________________________________________________ 7 Keys_and_Lockout

Yamamoto, Keith


Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network (OSTI)

bulbs爓ith燾ompact爁luorescent燽ulbs. 營n燼ddition,爐he燼?light燽ulbs爓ith fluorescent爈ight燽ulbs爐hat爑se爈ess爈ight bulbs with compact fluorescent爈ights牋 Replace

Noris, Federico



Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network (OSTI)

range爃ood Upgrade燞VAC爏ystem爁ilter Add爓ater爃eater爁orced?air燞VAC爏ystems,爐he爀xisting爌article爁ilters爓ere爁ilter爑nits爁or爌articulate爎eduction, enhancement爋f爁iltration爄n燞VAC

Noris, Federico



Americans and Iraq, twelve years apart: Comparing support for the US wars in Iraq  

Science Journals Connector (OSTI)

Abstract Significant differences exist in Americans support for force between the 1991 Persian Gulf War and 2003 Iraq War, even when holding all demographic variables constant. Nearly every group decreased their support from 1991 to 2003, including men and women, Whites and racial minorities, people with high school degrees or higher, nearly all age categories, and Democrat and Independent affiliated individuals. When examining potential causes for decreased support in the 2003 Iraq War, the 搉ature of the conflict presents the strongest argument and evidence. The Persian Gulf War aimed to force the Iraqi army from Kuwait, while the Iraq War was aimed at changing the governmental regime of Iraq. The latter conflict was less socially acceptable than the former to Americans. These differences between the conflicts are the best explanation for the change in support, while other explanations, including the changing composition of the population and a less pro-military populace, are insufficient.

Dana M. Williams; Suzanne R. Slusser



Panr Cunsn ApaRTMENTS GHP Retrofit ProvidesEnergyEfficiencyfor HUD  

E-Print Network (OSTI)

-to-air heatpump, anda water-to-waterheatpump. Each was installed at the complex and monitored for a six


Teasing apart the heterogeneity of autism: Same behavior, different brains in toddlers  

E-Print Network (OSTI)

R. MacFall & Allison K. Ross & James Provenzale & Arianna Martin & Allan L. Reiss & Joseph Piven-009-9009-8 H. C. Hazlett :J. Piven Carolina Institute for Developmental Disabilities, The University of North, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA A. A. Lightbody :A. Martin :A. L. Reiss

Utah, University of


Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network (OSTI)

RESNET爊ational爏tandard爁or爃ome爀nergy燼udits. 爏tandards/National_Energy_Audit_Standard.pdf,爄n,

Noris, Federico



Non-Residential Solar Water Heating Site Assessment at Milwaukee Apartment Buildings  

Energy.gov (U.S. Department of Energy (DOE))

The Midwest Renewable Energy Association's certified site assessors conducted 25 site assessments under a subcontract with NREL in 2009. The attached is one of the SHW assessments.


Impact of passive solar energy utilization on multi-story apartment houses in hot dry climates  

SciTech Connect

Objectives were to study the thermal behavior of a multi-story, prismatic building and to analyze the impact of various building parameters on this behavior. The building used is representative of residential buildings encountered in hot, dry parts of the world and conforms to the design and construction practices that prevail in such areas. A computer simulation model (BLAST) is employed to describe the building's thermal behavior on an hour-by-hour basis. The model is used to assess the impact of various passive building parameters on the temperature of each interior zone. The simulation is divided into three phases. The first entails simulating the housing prototype as it exists. The second is a parametric evaluation of individual building features; it includes studying the contribution of each of the building parameters/strategies under consideration. The third phase of the investigation involves combinations of features instead of individual features for the study of their thermal interaction. Data analysis indicates that natural ventilation and thermal mass are most critical in determining the interior thermal environment of a building in the hot, dry zone. Included in the study is a historical review of passive solar applications in buildings and a thorough discussion of the comfort requirements in hot, dry region. Findings of the study are outlined, and recommendations for future research are presented.

Abdou, O.A.



Building America Case Study: Conway Street Apartments, Greenfield, Massachusetts (Fact Sheet)  

SciTech Connect

While single-family, detached homes account for 63% of households (EIA 2009); multi-family homes account for a very large portion of that remaining housing stock, and this fraction is growing. Through recent research efforts, CARB has been evaluating strategies and technologies that can make dramatic improvements in energy performance in multi-family buildings

Not Available



UT, Knoxville Building Representatives (Updated November 13, 2013)  

E-Print Network (OSTI)

. Jeff Maples 974-3061 jeff-maples@utk.edu 50122500 **Apartment Residence Hall 2117 Andy Holt Ave Ms@utk.edu depratt@utk.edu cjogle@utk.edu 50136500 Auxiliary Services 2021 Stephenson Drive Mr. Jack Williams 974

Grissino-Mayer, Henri D.


Estimation the Performance of Solar Fiber Optic Lighting System after Repairing the Glass Fiber Cables in a South Korean Residential Building  

E-Print Network (OSTI)

The solar fiber optic lighting system consists of the solar ray concentrating apparatus, the tracking control, lighting transmission and emission parts. This system was installed on a 20-storey apartment building in South Korea. Many residents had...

Cha, K. S.; Kim, T. K.; Park, M. S.


Detailed Analysis of Thermal Mass Effects in a Code-Traceable DOE-2 Simulation of the 2000 IECC for a Single-Family Residence in Texas: A Project for Texas' Senate Bill 5 Legislation for Reducing Pollution in Nonattainment and Affected Areas  

E-Print Network (OSTI)

This study examines the thermal mass effects in a code-traceable DOE-2 simulation of the 2000 IECC (International Energy Conservation Code) for a single-family residence in Texas. This report is composed of two major simulations: 1) the simulation...

Kim, S.; Haberl, J. S.



Efficiency Maine Multifamily Efficiency Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Efficiency Maine Multifamily Efficiency Program Efficiency Maine Multifamily Efficiency Program Efficiency Maine Multifamily Efficiency Program < Back Eligibility Multi-Family Residential Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Program Info State Maine Program Type State Rebate Program Rebate Amount Upon approval of Energy Reduction Plan: $100 prescriptive path per apartment unit; $200 modeling path per apartment unit Upon approval of installations: $1400 all paths or 50% of installed cost (whichever is less) Efficiency Maine's Multifamily Efficiency Program offers incentives to multifamily residency building owners for improving energy efficiency. Residencies must have 5 to 20 apartment units to qualify for this rebate.


Solar photovoltaic residence in Carlisle, Massachusetts  

SciTech Connect

The first solar photovoltaic house designed and constructed under the US Department of Energy's Solar Photovoltaic Residential Project has been completed. The house, which is powered by a 7-kWp PV system, will be used to assess the occupants' acceptance of and reactions to residential photovoltaic systems and to familiarize utilities, builders, developers, town building officials and others with issues concerning photovoltaic installations. The house is located on a two-acre lot in Carlisle, approximately twenty miles northwest of Boston. Built by a local architect/developer team, the house includes energy conservation and passive solar features. It utilizes a roof-mounted, flat-plate PV array which operates in a two-way energy exchange mode with the electric utility. The energy conservation and passive solar features of this house are described and a detailed description of the utility-interactive photovoltaic system is presented, along with initial performance data.

Strong, S. J.; Nichols, B. E.



Kalispel Resident Fish Project : Annual Report, 1995.  

SciTech Connect

In 1995 the Kalispel Natural Resource Department (KNRD) in conjunction with the Washington Department of Fish and Wildlife (WDFW) initiated the implementation of a habitat and population enhancement project for bull trout (Salvelinus confluentus), westslope cutthroat trout (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Habitat and population assessments were conducted in seven tributaries of the Box Canyon reach of the Pend Oreille River. Assessments were used to determine the types and quality of habitat that were limiting to native bull trout and cutthroat trout populations. Assessments were also used to determine the effects of interspecific competition within these streams. A bull trout and brook trout (Salvelinus fontinalis) hybridization assessment was conducted to determine the degree of hybridization between these two species. Analysis of the habitat data indicated high rates of sediment and lack of wintering habitat. The factors that contribute to these conditions have the greatest impact on habitat quality for the tributaries of concern. Population data suggested that brook trout have less stringent habitat requirements; therefore, they have the potential to outcompete the native salmonids in areas of lower quality habitat. No hybrids were found among the samples, which is most likely attributable to the limited number of bull trout. Data collected from these assessments were compiled to develop recommendations for enhancement measures. Recommendations for restoration include riparian planting and fencing, instream structures, as well as, removal of non-native brook trout to reduce interspecific competition with native salmonids in an isolated reach of Cee Cee Ah Creek.

Maroney, Joseph; Donley, Christopher; Scott, Jason; Lockwood, Jr., Neil



Oceanic residence times of trace metals  

Science Journals Connector (OSTI)

... Co, Ni, Cu, Zn, Cd) and filtered samples (Fe, Mn) by flameless atomic absorption techniques. The resultant data have been used in a mass and salt ...

J. M. Bewers; P. A. Yeats



College Avenue Campus Frelinghuysen Residence Hall  

E-Print Network (OSTI)

. 路 At the traffic light at the top of the exit ramp, bear left on George Street. 路 Make a right on to Seminary Place for Route 27 and take the exit marked "George Street-Rutgers University" (approximately 2.6 miles from the Turnpike). NOTE: DO NOT take the first George Street exit which is immediately after Paulus Blvd


General Residence Hall Information General Information  

E-Print Network (OSTI)

/dining facilities. Air Conditioning All rooms in Susan Davis Hall are equipped with window air conditioning units

Sheridan, Jennifer


MORNINGSIDE An informational newsletter for residents  

E-Print Network (OSTI)

; and existing oil tanks will be emptied and cleaned. Some buildings will receive new gas regulators and on some footprint, both through the change in fuel type and the elimination of oil delivery trucks. In addition, gas residential buildings on the Morningside campus to using natural gas as the primary fuel source for heat

Qian, Ning

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Kalispel Resident Fish Project : Annual Report, 2002.  

SciTech Connect

In 2002 the Kalispel Natural Resource Department (KNRD) continued monitoring enhancement projects (implemented from 1996 to 1998) for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Additional baseline fish population and habitat assessments were conducted, in 2002, in tributaries to the Pend Oreille River. Further habitat and fish population enhancement projects were also implemented in 2002.

Andersen, Todd; Olson, Jason



Kalispel Resident Fish Project Annual Report, 2003.  

SciTech Connect

In 2003 the Kalispel Natural Resource Department (KNRD) continued monitoring enhancement projects (implemented from 1996 to 1998) for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Additional baseline fish population and habitat assessments were conducted, in 2003, in tributaries to the Pend Oreille River. Further habitat and fish population enhancement projects were also implemented.

Olson, Jason; Andersen, Todd




Energy.gov (U.S. Department of Energy (DOE))

Following significant population growth and economic prosperity in the last decade, Nevada was hit by the economic downturn with some of the highest rates of foreclosure and unemployment in the...


DATE: December 9, 2011 TO: Bailey Residents  

E-Print Network (OSTI)

Joseph, Facilities Operations Supervisor, Walt Herrle, Food Service Director, and Greg Perrizo, Business Operations Supervisor RE: Bailey Hall Winter Break Information Please take a few minutes to read of the Bailey Staff will enter all rooms to conduct a safety and maintenance inspection. If University property

Janssen, Michel


Kalispel Resident Fish Project : Annual Report, 2008.  

SciTech Connect

In 2008, the Kalispel Natural Resource Department (KNRD) continued to implement its habitat enhancement projects for bull trout (Salvelinus confluentus) and westslope cutthroat trout (Oncorhynchus clarki lewisi). Baseline fish population and habitat assessments were conducted in Upper West Branch Priest River. Additional fish and habitat data were collected for the Granite Creek Watershed Assessment, a cooperative project between KNRD and the U.S. Forest Service Panhandle National Forest (FS) . The watershed assessment, funded primarily by the Salmon Recovery Funding Board of the State of Washington, will be completed in 2009.

Andersen, Todd [Kalispel Natural Resource Department



www.residences.qmul.ac.uk ACCOMMODATION  

E-Print Network (OSTI)

/freezers, cookers, microwave ovens, toasters, washing up facilities, storage cupboards, food preparation surfaces

Chittka, Lars


TRANSFERGUIDE FOUNDED IN 1829, Rochester Institute of  

E-Print Network (OSTI)

in RIT residence halls, apartments, or townhouses on campus. On-campus fraterni- ties, sororities social events and activities are sponsored by the College Activities Board, Residence Halls Association's Teams--baseball, basketball, crew, cross country, ice hockey (Division I), lacrosse, soc- cer, swimming

Zanibbi, Richard


Interaction between building design, management, household and individual factors in relation to energy use for space heating in apartment buildings  

Science Journals Connector (OSTI)

Abstract In Stockholm, 472 multi-family buildings with 7554 dwellings has been selected by stratified random sampling. Information about building characteristics and property management was gathered from each property owners. Energy use for space heating was collected from the utility company. Perceived thermal comfort, household and personal factors were assessed by a standardized self-administered questionnaire, answered by one adult person in each dwelling, and a proportion of each factor was calculated for each building. Statistical analysis was performed by multiple linear regression models with control for relevant factors all at the same time in the model. Energy use for heating was significantly related to the building age, type of building and ventilation, length of time since the last heating adjustment, ownership form, proportion of females, and proportion of occupants expressing thermal discomfort. How beneficial energy efficiency measures will be may depend on the relationship between energy use and factors related to the building and the property maintenance together with household and personal factors, as all these factors interact with each other. The results show that greater focus should be on real estate management and maintenance and also a need for research with a gender perspective on energy use for space heating.

Karin Engvall; Erik Lampa; Per Levin; Per Wickman; Egil 謋verholm



Impact evaluation of the energy retrofits installed in the Margolis high-rise apartment building, Chelsea housing authority  

SciTech Connect

As part of a joint demonstration effort involving HUD, DOE, a local public housing authority and Boston Edison, an evaluation of energy and demand saving retrofits was conducted for a tall, residential, low-income building located in Boston. The thirteen story building underwent window, lighting, and heating system control renovations in December, 1992. The success of these retrofits was determined using monthly and hourly whole-building consumption data along with a calibrated DOE-2.1D energy simulation model. According to the model developed, post-retrofit conditions showed reductions in annual energy consumption of 325 MWh and in peak demand of 100 kW. These savings resulted in an annual energy cost savings of $28,000. Over 90% of energy and cost savings were attributed to the window retrofit. Interaction of the reduction in lighting capacity with the building`s electric resistance heating system reduced the potential for energy and demand savings associated with the lighting retrofit. Results from the hourly simulation model also indicate that night setbacks controlled by the energy management system were not implemented. An additional 32 MWh in energy savings could be obtained by bringing this system on-line, however peak demand would be increased by 40 kW as the morning demand for space heat is increased, with a net loss in cost savings of $2,500.

Abraham, M.M.; McLain, H.A.; MacDonald, J.M.



UCSC EMPLOYEE HOUSING APARTMENTS APPLICATION Rental rates include: rent, refuse collection, common area utilities, groundskeeping services, and repairs and  

E-Print Network (OSTI)

area utilities, groundskeeping services, and repairs and maintenance of the Laureate Court complex. Tenants pay for their own utilities (i.e., electricity, gas, water, telephone and cable services). A $750

California at Santa Cruz, University of


Method and apparatus for fabrication of high gradient insulators with parallel surface conductors spaced less than one millimeter apart  

DOE Patents (OSTI)

Optical patterns and lithographic techniques are used as part of a process to embed parallel and evenly spaced conductors in the non-planar surfaces of an insulator to produce high gradient insulators. The approach extends the size that high gradient insulating structures can be fabricated as well as improves the performance of those insulators by reducing the scale of the alternating parallel lines of insulator and conductor along the surface. This fabrication approach also substantially decreases the cost required to produce high gradient insulators.

Sanders, David M. (Livermore, CA); Decker, Derek E. (Livermore, CA)



Examen Begrippen van Kansrekening en Statistiek 2K WE, april 1998 maak iedere opgave op een apart vel papier,  

E-Print Network (OSTI)

kansverdeling? Wat is de verwachtingswaarde en de variantie? 2. Aan een tafel staan vier stoelen. Twee personen gaan op een willekeurig gekozen plaats aan tafel zitten. Wat is de kans dat ze naast elkaar zitten, a. als de tafel rond is, b. als de tafel rechthoekig is en alle stoelen zijn aan een zijde geplaatst. 3

de Groen, Pieter


Residence Codes (Alpha Order) as of 61412 Code Residence Code description  

E-Print Network (OSTI)

011 CORTLAND 2 Active 000 COUNTY UNKNOWN 2 Active 900 COUNTY UNKNOWN 2 Active 012 DELAWARE 2 Active 146 OKLAHOMA 3 Active 041 ONEIDA 2 Active 042 ONONDAGA 2 Active 043 ONTARIO 2 Active 044 ORANGE 2

Qiu, Weigang



E-Print Network (OSTI)

and the student, and/or parent or legal guardian, if the student is under the age of eighteen (18). A. OFFER Kent period marked on the application portion, or balance thereof. Therefore, once the student has agreed

Khan, Javed I.



E-Print Network (OSTI)

and the student, and/or parent or legal guardian, if the student is under the age of eighteen (18). A. OFFER Kent period marked on the application portion, or balance thereof. Therefore, once the student has agreed

Sheridan, Scott


Mating success of resident versus non-resident males in a territorial butterfly  

Science Journals Connector (OSTI)

...short flight and landed on the Christmas tree and mated after a brief...forest landscapes is that the light conditions are more conducive...Johnsen2003Insect communication: polarized light as a butterfly mating signal...territory ownership is that light conditions in a large sunspot...



Faculty and Resident Scholarship 2013-2014 Name of Resident Presentation Name  

E-Print Network (OSTI)

Academy of Physical Medicine and Rehabilitation Annual Assembly and Technical Exhibition in National in National Harbor, Maryland on October 3-6, 2013 Dapul, Geraldine, Adam Pourcho, Parmod Mukhi. "Atypical Questionnaire [VHS-Q], in Traumatic Brain Injury Patients: A Prospective Study Accepted by Institutional Review

Finley Jr., Russell L.


Liquid-crystalline phases formed by DNA duplexes containing pyrophosphate groups  

SciTech Connect

We have studied the interaction between synthetic DNA molecules containing pyrophosphate (PP) groups in various positions, which makes it possible to control the charge distribution along the DNA chain. The PP groups were either symmetrically arranged at the ends or at the center of DNA molecules or uniformly distributed along these molecules. It is shown that, similar to nonmodified DNA, the synthetic PP-modified DNA molecules can form cholesteric liquid crystals. Minima of the pair interaction potential are found, conditions of the symmetry of this potential are formulated, and the dependence of conformation angles on the effective charge is determined. The results of calculations show that the system exhibits polymorphism (i.e., several phases of cholesteric liquid crystals can exist in DNA solutions)

Volkov, Yu. S., E-mail: yu.volkov@gmail.com; Golo, V. L. [Moscow State University (Russian Federation); Kats, E. I. [Russian Academy of Sciences Chernogolovka, Landau Institute for Theoretical Physics (Russian Federation); Kuznetsova, S. A. [Institut Laue-Langevin (France)



Ethidium Intercalation in Synthetic DNA and RNA duplexes. A Fluorescence Study.  

Science Journals Connector (OSTI)

It is a well established fact that different helical conformations of DNA can be stabilized in acqueous solution by added salts or cosolvents, counterion type or temperature variations. In contrast with this m...

C. Cuniberti; M. Alloisio



Role of stress-assisted martensite in the design of strong ultrafine-grained duplex steels  

E-Print Network (OSTI)

stress- assisted process that enhances transformation-induced plasticity in ultrafine-grained austenite. This metallurgical principle was validated experimentally by using a combination of transmission Kikuchi diffraction mapping, transmission electron... intrusion applications or hole-expanded components in the automotive industry [1]. Moreover, some of the medium manganese steels require prolonged heat treatments so as to ensure solute partitioning in order to stabilise the austenite [16, 17], making...

Yen, Hung-Wei; Ooi, Steve Woei; Eizadjou, Mehdi; Breen, Andrew; Huang, Ching-Yuan; Bhadeshia, H. K. D. H.; Ringer, Simon P.


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Design of duplex low-carbon steels with carbide forming elements  

E-Print Network (OSTI)

Molybdenum X3 a strong carbide forming element Mo凜). (in the form of alloy carbides. Molybdenum improves grain1) Niobium is a strong carbide forming element (NbC). The

Costello, Peter K.



Thermal-Hydraulic Analysis of Seed-Blanket Unit Duplex Fuel Assemblies with VIPRE-01  

E-Print Network (OSTI)

nucleate boiling ratio EFIT European Facility for Industrial Transmutation EMT Effective Medium Theory EOL end-of-life EURO-TRANS EUROpean research program for the TRANSmutation of high level nuclear waste in ADS EPRI Electric Power Research... MA minor actinides ME Maxwell-Eucken viii MDNBR minimum departure from nucleate boiling ratio MNFI modified Nuclear Fuels Industries Mo molybdenum MOX mixed-oxide M-R multi-recycling NFI Nuclear Fuels Industries Np neptunium NPP nuclear...

McDermott, Patrick 1987-



Water-evaporation reduction by duplex films: Application to the human tear film  

E-Print Network (OSTI)

secretions: Chemistry, biophysics, and physiological role of Meibomian lipids.lipids with different chemical and physical properties than those in natural secretion.secretion over the cornea and closed the eye. Upon opening the eye, the lipid

Cerretani, Colin F; Ho, Nghia H; Radke, C.J.



Corrosion-assisted cracking of duplex stainless steels in suction roll applications  

SciTech Connect

Corrosion-assisted cracking of suction rolls is a worldwide pulp and paper industry concern despite the great strides in identifying more resistant materials. The authors have examined various tests to assess their use in predicting the susceptibility of suction roll alloys with known service performance. Under conditions of high mean stress and low pH, near-threshold fatigue crack growth testing discriminates among the several materials in approximately the same ranking as their service performance characteristics would have predicted.

Yeske, R.M.; Revall, M.A.; Thompson, C.M. (Inst. of Paper Science and Technology, Atlanta, GA (United States))



E-Print Network 3.0 - alter rna duplex Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

investigated using thermal denaturation (Tm) studies of a 12 base pair RNA ... Source: Beal, Peter A. - Department of Chemistry, University of Utah Collection: Chemistry 14 David...


Gainesville Green | Open Energy Information  

Open Energy Info (EERE)

Gainesville Green Gainesville Green Jump to: navigation, search Gainesville Green, a website created by a collaboration between Acceleration, International Carbon Bank and Exchange, and the University of Florida Program for Resource Efficient Communities, and intended for Gainesville, Florida residents, is driving change in energy use. The website centers on a tool, a map of Gainesville residences, to highlight energy use at individual residences', apartment complexes, and entire subdivisions. Gainesville Green believes that making this information open and transparent will allow residents to make more informed decisions about their energy use, and will go a long way towards reducing energy usage in Gainesville. Gainesville Green users have the ability to compare location and


Mass Spectrometric Study of Genetic and Epigenetic DNA Modifications  

E-Print Network (OSTI)

of cytosine in synthetic duplex DNA. Moreover, the level ofmethylation in synthetic duplex DNA. The underlined 揅攐f cytosine in synthetic duplex DNA. Moreover, the global

Wang, Hongxia



Overheating in Hot Water- and Steam-Heated Multifamily Buildings  

SciTech Connect

Apartment temperature data have been collected from the archives of companies that provide energy management systems (EMS) to multifamily buildings in the Northeast U.S. The data have been analyzed from more than 100 apartments in eighteen buildings where EMS systems were already installed to quantify the degree of overheating. This research attempts to answer the question, 'What is the magnitude of apartment overheating in multifamily buildings with central hot water or steam heat?' This report provides valuable information to researchers, utility program managers and building owners interested in controlling heating energy waste and improving resident comfort. Apartment temperature data were analyzed for deviation from a 70 degrees F desired setpoint and for variation by heating system type, apartment floor level and ambient conditions. The data shows that overheating is significant in these multifamily buildings with both hot water and steam heating systems.

Dentz, J.; Varshney, K.; Henderson, H.



Page 28 Housing Services Sonoma State University 2012-2013 Catalog Zinfandel Hall  

E-Print Network (OSTI)

its own dining hall, swimming pools, study rooms, convenience store, post office, meeting roomsPage 28 Housing Services Sonoma State University 2012-2013 Catalog Zinfandel Hall (707) 664. The Community is a unique mix of nontraditional resident hall suites and campus apartments, all located just

Ravikumar, B.


Page 28 Housing Services Sonoma State University 2011-2012 Catalog Zinfandel Hall  

E-Print Network (OSTI)

its own dining hall, swimming pools, study rooms, convenience store, post office, meeting roomsPage 28 Housing Services Sonoma State University 2011-2012 Catalog Zinfandel Hall (707) 664. The Community is a unique mix of nontraditional resident hall suites and campus apartments, all located just

Ravikumar, B.



E-Print Network (OSTI)

Student Center Russell Complex Christiana Towers Apartments Clayton Hall Conference Center Ray Street-to-Park Garage 6 Laird Campus Resident Gold 7 Conference Center Lot*垄 Red/Gold 8 Christiana Towers (8-W*,8-NE, 8 Avenue垄 Restricted 53 Pearson*垄 Restricted 53C Pearson Gate Gate-Controlled 54 Solar House Gray 55

Firestone, Jeremy


On the Failure of Power System Automatic Generation Control due to Measurement Noise  

E-Print Network (OSTI)

of the Supervisory Control and Data Acquisition (SCADA) system that resides in a centralized location (typically of service attacks, and resort to other malicious actions [2]. Various false data detection techniques based PMU measurements by spoofing the clocks that they use for synchronization [7]. Apart from malicious

Liberzon, Daniel


Hazard Assessment of Chemical Air Contaminants Measured in Residences  

E-Print Network (OSTI)

Collection Methods, Health Effects Institute, Mickely LelandMatter Species, Health Effects Institute:HEI 130 Pt 2

Logue, J.M.



Toxic Contaminants and Their Effects on Resident Fish  

E-Print Network (OSTI)

-estradiol PBDPE4-2 NPEO2 bisphenol A OPEO-2 triclosan NPEO1 tonalide galaxolide para-nonylphenol benzophenone para



Energy.gov (U.S. Department of Energy (DOE))

In the hot Florida climate, poor insulation or inefficient equipment can have a large impact on homeowners energy use. Because the state has some of the highest energy consumption per capita and...


Potential use of managed lanes by Texas residents  

E-Print Network (OSTI)

. ? This research work uses the data collected for the Texas Transportation Institute (TTI) Project entitled ?The Role of Preferential Treatment for Carpools in Managed Lane Facilities.? I would like to thank the TTI research team led by Matt MacGregor from Tx...DOT as Project Director and Ginger Goodin from TTI as Research Supervisor for conducting and funding the survey to collect necessary data and helping with the data analysis. I would especially like to mention Dr. David Ungemah for programming the online survey...

Mahlawat, Maneesh



University of Central Florida Housing and Residence Life  

E-Print Network (OSTI)

:______________________________________________________________ Phone#:________________________ Cell Phone #:_______________________ Fax #:____________________________E#: _______________________Cell Phone #:_____________________ Fax #:______________________E-mail:_____________________ Housing:____ _________________________ Company Intern Coordinator/Sponsor: ______________________________ Office Phone

Kaup, David J.


New Residence Hall Siena College East and West Elevation  

E-Print Network (OSTI)

Dining hall can be divided into thirds with partitions Environmental High efficiency boilers Low flow


Salt marsh tidal exchange increases residence time of silica in ...  

Science Journals Connector (OSTI)

All L&O articles are moved into Open Access after three years. Home | Career | Employment | Education | Meetings | Policy | Publications | Students | Forms |...


Residence Life Collegium Office Woods-Penn 302 ext. 3115  

E-Print Network (OSTI)

Anna Smith, James 3458 Colleen Donathan Kentucky, Talcott 3483 Dara Evans Kettering, Home Management HC Matthew Ondak MON Ismail Murtadha Danforth HC Codie Monhollen MON Seth Hutchins MON Evan James Hannah Worcester MON Megan Holsey Home Management HC Stacey Roberts James HC Jessica Elston MON Brenna

Baltisberger, Jay H.

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


College Avenue Campus Brett and Demarest Residence Halls  

E-Print Network (OSTI)

light at the top of the exit ramp, bear left on George Street for Demarest and Brett. From Garden State is marked "George Street - Rutgers University, New Brunswick, Route 27." 路 At the traffic light at the top and take the exit marked "George Street-Rutgers University" (approximately 2.6 miles from the Turnpike


College Avenue Campus Mettler, Stonier, and Tinsley Residence Halls  

E-Print Network (OSTI)

. 路 At the traffic light at the top of the exit ramp, bear right on George Street. 路 Take the jug handle onto is marked "George Street Rutgers University, New Brunswick, Route 27." 路 At the traffic light at the top and take the exit marked "George Street-Rutgers University" (approximately 2.6 miles from the Turnpike


GCHP Results in Net-Zero Energy Residence in Japan  

E-Print Network (OSTI)

路 Advanced Ambient Light Sensor Control 路 Lithium Battery Storage System 路 Solar Thermal Heat Collector: 4m2 Gas Water Heater 路 Lighting Fixtures: LED 路 Solar Photo-voltaic System: 5.94kW 路 Home Energy HyperLoop Horizontal Slinky Vertical Slinky #12;4 HyperLoop Heat Exchanger Heat pump When cooling, heat


Urban Residents' Perceptions About The City of Austin's Wildlands  

E-Print Network (OSTI)

insects and organic matter (Austin 1995b). INFORMATION CHANNELS AND ENVIRONMENTAL KNOWLEDGE Previous studies suggest that the public tends to more frequently use mass media (newspapers, television) for sources of environmental information (Steel et... al. 1990; Brothers et al. 1991; Jacobson et al. 2001). Newspapers have been found to be a more 27 13 important information source than television or radio (Bailey 1971). Although television has been recorded as the most frequently used...

Martin, Laura Elizabeth



Resident attitudes toward tourism as a form of community development  

E-Print Network (OSTI)

Many view tourism as a tool for community development. However, empirical studies suggest that its growth can bring environmental, sociocultural, and economic changes to the community where it is developed. Thus, it is important that planners look...

Doh, Minsun



The Effect Of Academic 揗isrepresentation on Residency Match Outcomes  

E-Print Network (OSTI)

1):955-958. [ PubMed ] 10. Armstrong A, Dahl C, Haffner W.4 , Nayla Idriss 1 , April W Armstrong 1 Dermatology Online

Maverakis, Emanual; Li, Chin-Shang; Alikhan, Ali; Lin, Tzu-Chun; Idriss, Nayla; Armstrong, April W



Resident Sites Atefeh S. McCampbell, Ph.D.  

E-Print Network (OSTI)

. ARMSTRONG, M.D. Physician RICHARD N. BANEY, M.D. President (Ret.), Health First Physicians Inc. ALBINO P, Krasney and Dettmer PHILLIP W. FARMER Vice Chairman, Florida Institute of Technology Board of Trustees

Wood, Stephen L.


Optimization of Occupancy Based Demand Controlled Ventilation in Residences  

E-Print Network (OSTI)

Efficiency and Renewable Energy, Building TechnologiesEfficiency and Renewable Energy, Building Technologies

Mortensen, Dorthe K.



Benjamin J. Morris Associate Professor U.S. Permanent Resident  

E-Print Network (OSTI)

; University of California, Berkeley Statistics 134. Probability, Spring 2003. Computer Science 172 21, 1973 University of California morris@math.ucdavis.edu Davis, CA 95616 Education Ph.D. Statistics, University of California, Berkeley, July 2000 (advisor: Alistair Sinclair). A.B. Mathematics and Statistics

California at Davis, University of


Hazard Assessment of Chemical Air Contaminants Measured in Residences  

E-Print Network (OSTI)

implications for indoor nitrogen dioxide concentrations."concentrations of indoor nitrogen dioxide in Hamburg (westand concentrations of indoor nitrogen dioxide in Barcelona,

Logue, J.M.



Kalispel Resident Fish Project, 2004-2005 Annual Report.  

SciTech Connect

In 2004 the Kalispel Natural Resource Department (KNRD) implemented a new enhancement monitoring project for bull trout (Salvelinus confluentus) and westslope cutthroat trout (Oncorhynchus clarki lewisi). Largemouth bass (Micropterus salmoides) enhancement projects were also monitored. Additional baseline fish population and habitat assessments were conducted, in tributaries to the Pend Oreille River.

Olson, Jason; Andersen, Todd



POLICY GUIDANCE MEMORANDUM #14 Establishing a Residence for a...  

Energy Savers (EERE)

this issue. DOE guidance is as follows. This guidance will be incorporated in the DOE Handbook on Recruitment and Retention Incentives as an appendix during the next update....


Graduate Medical Education and Residents 1) Business Manager Responsibilities  

E-Print Network (OSTI)

for the dates included in the next payroll, usually the 16th 颅 30th or 31st of the month, before the lockout


DOE Zero Energy Ready Home: Leganza Residence- Greenbank, Washington  

Energy.gov (U.S. Department of Energy (DOE))

This DOE Zero Energy Ready Home features structural insulated panel walls and roof, a 2-ton ground source heat pump, radiant floor heat, 7.1 kWh PV, and triple-pane windows.



Energy Savers (EERE)

and Sparks, Nevada. The program's goals included creating the foundation for a self-sustaining program that would help the state meet its goal to upgrade 5% of all...


Change through tourism: resident perceptions of tourism development  

E-Print Network (OSTI)

place. The conceptual basis of this study is development and change theory and empirical findings of tourism impact research. This study provides information to assist in understanding questions related to the rural communities tourism planning process...

Doh, Minsun



DOE Zero Energy Ready Home: Leganza Residence - Greenbank, Washington...  

Energy Savers (EERE)

panel (SIPs) walls, a 10.25-inch SIPS roof, an R-20 insulated slab, a 2-ton ground source heat pump, radiant floor heat, 7.1 kWh PV, and triple-pane windows. DOE Zero Energy Ready...


www.hfs.washington.edu/UWStreetFood/ & Resident Dining Account  

E-Print Network (OSTI)

....................................... $ 1.75 Shinka Tea Chocolate Pudding ...................... $ 2.50 COLD DRINKS Coke, Diet Coke, Coke Zero, Sprite, ...............$ 1.05 Lemonade, Grape Fanta, Orange Fanta, Water Mexican Coke or Orange

Washington at Seattle, University of



Energy Savers (EERE)

summer heat waves can send Floridians' utility bills soaring. St. Lucie County in the heart of Florida's Treasure Coast committed to helping homeowners reduce their rising...


Commissioning High Performance Residences in Hot, Humid Climates  

E-Print Network (OSTI)

is individually designed, inspected, rated and commissioned for optimum performance. This paper summarizes the experiences to date with two production builders who have cost shared with the Building America program to deliver these outstanding results. Keys...

Fonorow, K.; Chandra, S.; McIlvaine, J.; Colon, C.


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Hazard Assessment of Chemical Air Contaminants Measured in Residences  

E-Print Network (OSTI)

defined a generally acceptable cancer risk level for HAPs.levels based on an acceptable level of risk. Thecalculate acceptable exposure concentration for cancer risk

Logue, J.M.



Replacement Costs and Cleaning & Service Charges for ResidenceHalls  

E-Print Network (OSTI)

Incandescent Light Fixture $130.00 each Incandescent Light Fixture Globe $82.00 each Exit Sign $440.00 each

Shyy, Wei


Hazard Assessment of Chemical Air Contaminants Measured in Residences  

E-Print Network (OSTI)

Conference & Exhibition Healthy Buildings 2009, Syracuse, NYConference & Exhibition Healthy Buildings 2009, Syracuse, NYproceedings from the 2009 Healthy Building Conference held

Logue, J.M.



Better Buildings Program San Jose- Serving Moderate Income Residents  

Energy.gov (U.S. Department of Energy (DOE))

Provides an overview of the program components and goals, including the whole neighborhood approach pilot which aims to streamline participant, contractor, and administration processes for neighborhood retrofitting in order to reduce high transaction costs created by the current one-off delivery model.



Energy Savers (EERE)

energy efficiency sector by partnering with contractors and local nonprofits to train a "green workforce" and increase community energy efficiency awareness. With the success of...


Low-energy Passive Solar Residence in Austin, Texas  

E-Print Network (OSTI)

year long optimum indoor comfort in buildings. This research, through a design exercise, intends to verify whether a naturally ventilated house, in hot humid region of Austin, TX, can enhance its passive cooling potential through double?walled wind...

Sau, Arunabha




E-Print Network (OSTI)

heaters 路 Halogen lamps 路 Sandwich makers/grills, hot plates, rice cookers, crock-pots, waffle makers

Vertes, Akos


Costs for Academic Year 2011-2012 Tennessee Resident  

E-Print Network (OSTI)

Engineering Nuclear Engineering Master of Science: Aerospace Engineering Biomedical Engineering Biosystems & Engineering Mechanical Engineering MS-MBA Program Nuclear Engineering Reliability & Maintainability Industrial Engineering Materials Science & Engineering Mechanical Engineering Nuclear Engineering ACADEMICS

Tennessee, University of


Costs for Academic Year 2010-11 Tennessee Resident  

E-Print Network (OSTI)

Mechanical Engineering Nuclear Engineering Master of Science: Aerospace Engineering Biomedical Nuclear Engineering Polymer Engineering Reliability & Maintainability Engineering Doctor Nuclear Engineering Polymer Engineering ACADEMICS LEADERSHIP Dr. Wayne T. Davis, Dean 124

Tennessee, University of


Northern Virginia Residents Improve Their Homes' Energy With...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Boost The Northern Virginia Home Energy Makeover Contest logo. The Local Energy Alliance Program (LEAP) awarded energy efficiency funding to three households as part of the...


for all Student Housing residents IN A COMMUNITY  

E-Print Network (OSTI)

when you cough or sneeze. Throw the tissue in the trash after you use it. Cough or sneeze into your upper sleeve if a tissue is not available. Clean your hands after coughing or sneezing, either

Hernes, Peter J.


Office of Resident Wellness Postgraduate Medical Education 2013-2014  

E-Print Network (OSTI)

Resources........................................................... 4 路 PerformanceEnhancement&TimeManagement............... 7 3. Mindfulness in Medicine 路 Audio of Dundas Street West. To access the office via subway, exit at St. Patrick station. Contact Information Dr

Sokolowski, Marla


SFU Rental Suites Managed by AWM-Alliance Real Estate Group Ltd. Verdant Rental Housing -state of the art Eco-Designed apartments for rent on campus to  

E-Print Network (OSTI)

3/4/2014 SFU Rental Suites Managed by AWM-Alliance Real Estate Group Ltd. Verdant Rental Housing-Alliance's CONTACT INFORMATION AWM-Alliance Real Estate Group Ltd. #401 颅 958 West 8th Avenue Vancouver, BC V5Z 1E5-time faculty and senior administrative staff. A model of sustainable environmental living with modern


Characterizing Ultrafine Particle Exposures in Two Types of Indoor Environments: San Francisco Bay Area Classrooms and Beijing High-Rise Apartments  

E-Print Network (OSTI)

Particle loading rates for HVAC filters, heat exchanger, andFor these reasons, the HVAC filters in classrooms should bemaintain high-efficiency HVAC filters in each classrooms is

Mullen, Nasim Ayoubzadeh



SFU Rental Suites Managed by AWM-Alliance Real Estate Group Ltd. Verdant Rental Housing -state of the art Eco-Designed apartments for rent on campus to  

E-Print Network (OSTI)

6/7/2010 SFU Rental Suites Managed by AWM-Alliance Real Estate Group Ltd. Verdant Rental Housing are interested in renting a unit at Verdant, please contact: AWM-Alliance's CONTACT INFORMATION AWM-Alliance Real


Definitive Differentiation between Single and Mixed Mycobacterial Infections in Red Deer (Cervus elaphus) by a Combination of Duplex Amplification of p34 and f57 Sequences and Hpy188I Enzymatic Restriction of Duplex Amplicons  

Science Journals Connector (OSTI)

...subspecies isolated from red deer (n 36) a Cervine...Johnes disease in farmed red deer (Cervus elaphus...Mycobacterium bovis in red deer (Cervus elaphus...E. Kucera, N. B. Gates, L. M. Woods, and M. Fallon-McKnight...

Jacques Godfroid; Cathy Delcorps; Leonid M. Irenge; Karl Walravens; Sylvie March; Jean-Luc Gala



Thermodynamics and Enzymatic Polymerization of Artificial Metallo-Nucleic Acids AND Investigation of Duplex Formation between GAN and RNA  

E-Print Network (OSTI)

癈 rt (92%). (c) DMTrCl, pyridine, rt (69%). (d) (iPr) 2 NP(Cl)OEtCN, (iPr) 2 NEt, CH 2 Cl 2 , rt (71%). Scheme 1. 7N,N-diisopropylehylamine ((iPr) 2 NEt) and 2-cyanoehtyl-N,N-

Kim, Eun Kyong



1 Dda Helicase Tightly Couples Translocation on 2 Single-Stranded DNA to Unwinding of Duplex DNA  

E-Print Network (OSTI)

, Slot 516, Little Rock, AR 72205, USA 9 2 Department of Chemistry, Harding University, 915 East Market Avenue, Searcy, AR 72143, USA 10 3 Laboratorie de Physique Statistique, Ecole Normale Superieure, UPMC 25 Helicases utilize the energy of ATP hydrolysis to unwind double- 26 stranded DNA while


Duplex Oxide Formation during Transient Oxidation of Cu-5%Ni(001) Investigated by In situ UHV-TEM and XPS  

SciTech Connect

The transient oxidation stage of a model metal alloy thin film was characterized with in situ ultra-high vacuum (UHV) transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and analytic high-resolution TEM. We observed the formations of nanosized NiO and Cu{sub 2}O islands when Cu-5a5%Ni(100) was exposed to oxygen partial pressure, pO{sub 2} = 1 x 10{sup -4} Torr and various temperatures in situ. At 350 C epitaxial Cu{sub 2}O islands formed initially and then NiO islands appeared on the surface of the Cu{sub 2}O island, whereas at 750 C NiO appeared first. XPS and TEM was used to reveal a sequential formation of NiO and then Cu{sub 2}O islands at 550 C. The temperature-dependant oxide selection may be due to an increase of the diffusivity of Ni in Cu with increasing temperature.

Yang, J.C.; Starr, D.; Kang, Y.; Luo, L.; Tong, X.; Zhou, G.



Greater Cincinnati Energy Alliance - Residential Loan Program (Ohio) |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Greater Cincinnati Energy Alliance - Residential Loan Program Greater Cincinnati Energy Alliance - Residential Loan Program (Ohio) Greater Cincinnati Energy Alliance - Residential Loan Program (Ohio) < Back Savings Category Heating & Cooling Cooling Commercial Heating & Cooling Appliances & Electronics Home Weatherization Commercial Weatherization Sealing Your Home Ventilation Heat Pumps Commercial Lighting Lighting Water Heating Windows, Doors, & Skylights Solar Program Info State Ohio Program Type Local Loan Program The Greater Cincinnati Energy Alliance provides loans for single family residencies and owner occupied duplexes in Hamilton county in Ohio and Boone, Kenton, and Campbell counties in Kentucky. To qualify for loans, homeowners must receive a [http://www.greatercea.org/residential-energy-efficiency Home Performance

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Texas Energy Code Compliance Collaborative  

E-Print Network (OSTI)

Conference, San Antonio, Texas Dec. 16-18 7 Source: ACEEE Building Energy Codes Program 2010 ESL-KT-13-12-29 CATEE 2013: Clean Air Through Energy Efficiency Conference, San Antonio, Texas Dec. 16-18 Residential (Single Family Residences And Duplexes...CATEE 2013 December 18, 2013 ESL-KT-13-12-29 CATEE 2013: Clean Air Through Energy Efficiency Conference, San Antonio, Texas Dec. 16-18 ? Member-based, non-profit organization ? The newest Regional Energy Efficiency Organization (REEO) ? Founded...

Herbert, C.



Data:7a1460d7-e6ae-4638-8c34-cec47f9209cd | Open Energy Information  

Open Energy Info (EERE)

60d7-e6ae-4638-8c34-cec47f9209cd 60d7-e6ae-4638-8c34-cec47f9209cd No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Platte-Clay Electric Coop, Inc Effective date: 2013/01/01 End date if known: Rate name: R - Rural and Residential Service Sector: Residential Description: Applicable to the classifications hereinafter described for services supplied by the Cooperative. 1. Residences: A single family residence dwelling or building. B. General fgarming or agricultural purposes supplied by a single meter. 3. Apartments and Multiple Occupancy Buildings: A separately metered individual flat or apartment unit used as the home, residence, or sleeping place of one or more persons. 4. Residences and Farms: Supplying combination residence and farm use where supplied through a single meter and limited to the use of service within the residence and that required for all general farming and agricultural purposes conducted on the premises served. Where separate meters are required to supply operation incidental thereto but located at such distance that they cannot be connected to the main meter, each meter shall be billed as a separate service. 5. Season or Recreational: Seasonal or recreational facilities where individually metered.


Energy Saving Alignment Strategy: Achieving energy efficiency in urban buildings by matching occupant temperature preferences with a building抯 indoor thermal environment  

Science Journals Connector (OSTI)

Abstract Existing strategies for residential energy savings through physical renovation or motivating occupant energy conservation behavior can be costly and/or have transitory effects. Focusing on multi-family dwellings, an important subset of the urban residential sector, we propose an Energy Saving Alignment Strategy (ESAS) that has advantageous cost-effectiveness and a long-lasting influence. By aligning the distribution of residents thermostat preferences with the indoor temperature, ESAS aims to maximize thermal comfort and, accordingly, energy savings in multi-family buildings where indoor temperatures vary between apartments as a function of apartment orientation and floor level. Using a case study of a 1084-apartment public housing complex in New York, we classify both occupants thermostat preferences and apartments operative temperatures into five groups, and optimize energy efficiency by assigning each group of occupants to the group of apartments that best aligns with their thermostat preference. We test ESAS in eight cities representing all four U.S. census regions and six climate zones. Simulation results reveal 2.142.0% in energy savings compared to random apartment assignments depending on geographic location, with the highest energy reductions occurring in cities with mild climates, where the range of occupant thermostat preferences coincides with the natural indoor temperature range. We conclude by providing suggested guidelines on how ESAS might work in practice, and recommendations for extending ESAS research.

Xiaoqi Xu; Patricia J. Culligan; John E. Taylor



E-Print Network 3.0 - alpha-1 foundation dna Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Medicine ; Materials Science ; Physics 76 Conductivity of a single DNA duplex bridging a carbon nanotube gap Summary: Conductivity of a single DNA duplex bridging a carbon...


Data:4b98bd77-5a51-4ced-8870-b459fa36225d | Open Energy Information  

Open Energy Info (EERE)

bd77-5a51-4ced-8870-b459fa36225d bd77-5a51-4ced-8870-b459fa36225d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Raton Public Service Company Effective date: End date if known: Rate name: Residential- Rural Sector: Residential Description: To all customers within the RPS service area but outside the municipal boundaries of the Cit of Raton, for single-phase electric service used for residential purposes in individual private dwellings, duplexes, or apartments supplied at one point of delivery and measured through one meter. Source or reference: Rates Binder A Source Parent: Comments Applicability


Data:6e2d736a-077e-452b-ab44-a8f19cbc7c3f | Open Energy Information  

Open Energy Info (EERE)

a-077e-452b-ab44-a8f19cbc7c3f a-077e-452b-ab44-a8f19cbc7c3f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Raton Public Service Company Effective date: End date if known: Rate name: Residential- Urban Sector: Residential Description: To all customers within the RPS service area that lie within the municipal boundaries of the City of Raton, for single-phase electric service used for residenital purposes in individual private dwellings, duplexes, or apartments supplied at one point of delivery and measured through one meter. Source or reference: Rates Binder A Source Parent: Comments Applicability


Single-Molecule Detection of Transcription Factor Binding to DNA in Real Time:? Specificity, Equilibrium, and Kinetic Parameters  

Science Journals Connector (OSTI)

Preparation of Synthetic DNA Duplexes. ... DNA targets for the proteins consisted of short synthetic DNA duplexes formed from oligonucleotides purchased from Integrated DNA Technologies. ... Binding of synthetic DNA duplexes was tested by measuring the ability of duplexes labeled with the quencher dabcyl to quench GFP or BFL emission, because the excitation spectrum of dabcyl overlaps with the emission spectrum of these fluorophores. ...

Eric A. Nalefski; Eugene Nebelitsky; Janice A. Lloyd; Steven R. Gullans



Data:F2dfa017-6b45-4c5a-9044-f2f96f12bae3 | Open Energy Information  

Open Energy Info (EERE)

dfa017-6b45-4c5a-9044-f2f96f12bae3 dfa017-6b45-4c5a-9044-f2f96f12bae3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Greenville Utilities Comm Effective date: 2013/04/01 End date if known: Rate name: Residential Sector: Residential Description: This schedule is applicable to separately metered and billed supply of alternating current electricity to any customer for use in and about (a) a single-family residence, flat or apartment, (b) a combination residence and farm, or (c) a private residence used as a boarding and/or rooming house with no more than one cooking installation, nor more than ten bedrooms.


U.S. Residential Miscellaneous Refrigeration Products: Results from Amazon Mechanical Turk Surveys  

E-Print Network (OSTI)

dormitory multi-family apartment building mobile orfamily house multi-family apartment building mobile or

Greenblatt, Jeffery B.



Ber鋕ning av v鋜meenergif鰎luster i flerbostadshus genom analys av den totala fj鋜rv鋜meenergianv鋘dningen; Calculation of the thermal energy losses in apartment buildings through analyze of the total district thermal energy consumption .  

E-Print Network (OSTI)

?? This thesis has been carried out on behalf of IV Produkt AB and intends to set an average ratio of thermal energy losses in (more)

Fredhav, Dennis



Re-examining the health effects of radiation and its protection  

Science Journals Connector (OSTI)

The health effects of radiation from atomic explosions in Japan were completely different from those due to radiation from the Co-60 contaminated apartments in Taiwan. The sudden exposure to acute radiation in extremely high doses killed Japanese people, and harmed the survivors in lower doses as shown by increased cancer mortality, especially the leukemia based on the LNT model. The chronic radiation received by the residents unknowingly in the Co-60 contaminated apartments in Taiwan, even in higher doses, caused no excess cancer deaths; on the contrary their spontaneous cancer deaths were sharply reduced to only about 2.5% of that of the general population, and hereditary defects in their offspring were only 5%??7% of those of the normal population. Therefore, the residents in the Co-60 contamination apartments had coincidently accomplished a human experiment of the health effects to human beings. The chronic radiation received from the Co-60 contaminated houses is quite similar to the radiation exposure to the workers and public in the peaceful use of nuclear energy and medical radiation. Acute radiation from a nuclear accident could harm a limited number of people, but the chronic radiation might benefit people, such as in the case of the Chernobyl accident. People should not be fearful of chronic exposure to low radiation and the traditional radiation protection policy and practices used in past 60 years should be revised based on the health effects observed in Taiwan.

Y.C. Luan; M.C. Shieh; S.T. Chen; H.T. Kung; K.L. Soong; Y.C. Yeh; T.S. Chou; W.C. Fang; S.L. Yao; C.J. Pong; S.H. Mong; J.T. Wu; J.M. Wu; H.J. Jen; W.L. Chen; W.P. Deng; M.F. Wu; M.L. Shen; C.P. Sun



Energy Savings Resulting from Shading Devices on Single-Family Residences in Austin, Texas  

E-Print Network (OSTI)

windows) and exterior (solar screens, awnings, overhangs, and the effects of recessed windows and vegetation) shading devices. The analysis was conducted with the DOE-2 building energy analysis computer program. Nominal baseline cases (single glazing, gas...

Pletzer, R. K.; Jones, J. W.; Hunn, B. D.



China's National Resident Identity Card: Identity and Population Management in Transition  

E-Print Network (OSTI)

application, the baby's birth certificate (or a certificatebaby's birth), and the parents' certificate of permission toThe certificate of permission to give birth, which is issued

Keane, Merril



Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

Council Weatherization Assistance Program World Healthsuch as the Weatherization Assistance Program (WAP) areas has the Weatherization Assistance Program (U.S. DOE,

Less, Brennan



Educational Technology Improves ECG Interpretation of Acute Myocardial Infarction among Medical Students and Emergency Medicine Residents  

E-Print Network (OSTI)

Learning and cognitive styles in web-based learning: theory,AJ, et al. What do we mean by web- March 2007. Available at:E, et al. Evaluation of a web- 12. Subramanian A, Timberlake

Pourmand, Ali; Tanski, Mary; Davis, Steven; Shokoohi, Hamid; Lucas, Raymond; Zaver, Fareen



Educational Technology Improves ECG Interpretation of Acute Myocardial Infarction among Medical Students and Emergency Medicine Residents  

E-Print Network (OSTI)

Use of Educational Technology in Medical Volume XVI, NO .et al. Educational Technology Improves ECG Interpretationthe field of educational爐echnology. Educ Technol. critical

Pourmand, Ali; Tanski, Mary; Davis, Steven; Shokoohi, Hamid; Lucas, Raymond; Zaver, Fareen



Passive-solar-heating project for a single-family residence. Final report  

SciTech Connect

This project was a passive home heating system utilizing solar collectors that are part of the roof structure of a 15' x 30' greenhouse. The design utilized solar air collectors constructed on site that are actually part of the roof of the greenhouse. The flow of air is from the storage to the collectors then back to the storage. The storage bin consists of a 5' x 19' concrete insulated bin built into the floor of the greenhouse. The storage mass was gallon plastic jugs. The plastic jugs did not work properly, so they are being replaced by salt rods. This replacement will be an after the fact project by the owner. The concrete storage bin was insulated with 2'' plastic foam insulation, applied to the 8'' concrete wall. The ducts entering and leaving the storage bin have low voltage (12 volt) electric dampers. A cross flow system was used. The heated air circulates from the collectors to storage via ducts in the walls of the lean-to design. The removal of heat from the storage bin was from end to end via the ducts to the central air system for the house. In addition, the greenhouse is connected to the house with a doorway that can be opened to circulate air into the house, a shuttled exhaust fan 1/3H.P. motor has aided in the circulation of air from the storage bin to the collectors and back.

Starkey, V.J.



A longitudinal evaluation of residents health outcomes in nursing homes and residential care homes in Taiwan  

Science Journals Connector (OSTI)

The role of nursing homes (NHs) and residential care homes (RHs) frequently overlaps in Taiwan, raising...

Li-Fan Liu; Miin-Jye Wen



Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

quality in southeastern U.S. homes. Paper presented at thehighly energy efficient homes桝 review No. NF18. Amersham,of energy-efficiency in homes. Environment International, 8(

Less, Brennan



Impacts of Vessel Noise Perturbations on the Resident Sperm Whale Population in the Gulf of Mexico  

E-Print Network (OSTI)

RESPONSE TO NOISE ........... 92 VII FRAMEWORK FOR THE MANAGEMENT OF MARINE NOISE POLLUTION ....................................................................................... 101 Regional Framework for Noise... Pollution Management ................ 102 Nation-State Provisions .................................................................. 106 International Framework for Noise Pollution Management .......... 112 Proposed Guidelines...

Azzara, Alyson


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

-themes. For instance, the sub-themes for "better vehicles" were: electric car, hybrid cars, non-polluting car

Paris-Sud XI, Universit茅 de


Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

retrofit, net-zero energy, green certified and PassiveRetrofit, Net-Zero Energy, Green Certified and Passiveas part of a green building, Energy Star or Passive House

Less, Brennan



A Simplified Procedure for Sizing Vertical Ground Coupled Heat Pump Heat Exchangers for Residences in Texas  

E-Print Network (OSTI)

A simplified technique for the sizing of vertical U-tube ground coupled heat pump (GCHP) heat exchangers for Texas climates was developed utilizing a transient simulation model of a ground coupled heat pump and weather and soil data for Texas...

O'Neal, D. L.; Gonzalez, J. A.; Aldred, W.



Residence Hall ROI: The Benefits of Energy Modeling for University Dormitories  

E-Print Network (OSTI)

Through Energy Efficiency Conference, San Antonio, Texas Dec. 16-18 Texas State University Stephen F. AustinUniversity of Houston 550,980 sf 10 floors 984 beds 190,830 sf 6 floors 612 beds 126,400 sf 4 floors 400 beds Traditional Metrics ESL-KT-13...-12-20 CATEE 2013: Clean Air Through Energy Efficiency Conference, San Antonio, Texas Dec. 16-18 Stephen F. AustinUniversity of Houston 560 sf floor area / bed 316 sf floor area / per bed 80 sf wall area / bed 45 sf wall area / bed 26 sf wall area / bed Roof...

Hodges, C.; Hernandez, A.



Spatial Mismatch or Automobile Mismatch? An Examination of Race, Residence and Commuting in US Metropolitan Areas  

E-Print Network (OSTI)

1473 Spatial Mismatch or Automobile Mismatch? An Examinationimplicitly acknowledged that automobile access, not commutear- eas. As a rule, automobile commutes are signi?cantly

Taylor, Brian D.; Ong, Paul M.



Why Do Inner City Residents Pay Higher Premiums? The Determinants of Automobile Insurance Premiums  

E-Print Network (OSTI)

The Determinants of Automobile Insurance Premiums Paul M.The Determinants of Automobile Insurance Premiums Abstractplace-based component of automobile insurance premiums. We

Ong, Paul M.; Stoll, Michael A.



Copyright 2005 AAMC. All rights reserved. 1 Residency Program Evaluation Guide  

E-Print Network (OSTI)

Rotations/electives Rounds (educational vs. work) Conferences No. and variety of patients Hospital library-time vs. part-time Research vs. teaching responsibilities Clinical vs. teaching skills Availability

MacMillan, Andrew


List of Resident Sites for UC San Diego Skaggs School of Pharmacy and Pharmaceutical Sciences Students  

E-Print Network (OSTI)

Roche/Rutgers Kaiser Orange County/Irvine Oncology Fellowship - UCSD/Pfizer Pharmaceutical Industry Fellowship - Rutgers/F. Hoffman-LaRoche Pharmaceutical Industry Fellowship - Rutgers/Novartis Pharmaceutical Industry Fellowship - Rutgers/Schering-Plough Corporation Pharmaceutical Industry Fellowship - St. John

Gleeson, Joseph G.


Clinical Poems and Clinical Conversations: Some Thoughts on Working with Family Medicine Residents  

E-Print Network (OSTI)

relation to the patient. "Oklahoma Farmer" Margo Short, M.D.forgetful. This proud Oklahoma farmer who was always strong.grandfather, a northwest Oklahoma wheat farmer. I accepted

Stein, Howard F



E-Print Network 3.0 - arsenic exposed residents Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Department, University of Florida Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies 2 Unsaturated Zone Arsenic Distribution...


Residence times and source ages of deep crustal fluids: interpretation of 129  

E-Print Network (OSTI)

amounts of fluids, but the testing of these fluids was impacted by potential contamination prob- lems associated with the drilling process. A large amount of crustal brine was collected, however, in a later pump

Fehn, Udo


Korean ESL learners' pragmatic competence: motivation, amount of contact, and length of residence  

E-Print Network (OSTI)

in three stages: descriptive statistics, correlation coefficients, and multiple regressions. The findings of the study provided that (a) the levels of motivation examined demonstrated a positive and moderate relationship to the Korean ESL learners L2...

Ahn, Soo Jin



Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

a 3,785 L (1,000 gal) solar storage tank to supply spacestorage tanks serve as solar storage, pre-heat, buffer andthe incorporation of solar energy demands storage MS Thesis,

Less, Brennan



Northern Virginia Residents Improve Their Homes' Energy With A Funding Boost  

Energy.gov (U.S. Department of Energy (DOE))

The Local Energy Alliance Program (LEAP) awarded energy efficiency funding to three households as part of the program's Northern Virginia Home Energy Makeover Contest. The three winners, chosen from 1,600 applications, will use their winnings to help fund energy efficiency upgrades in their homes. Each winner has different needs based on their home type, but all saw the need for energy efficiency improvements. Contest winners Ann and Rich Dorman plan to upgrade their condominium with LED lights and additional insulation. Second place winners, Marti Fucile and Eric Shor will make their townhome, which has high ceilings and tall windows, more efficient with upgrades. "I knew this house was drafty, and that it wasn't as efficient as it could be," Fucile said. "We're definitely anxious to make our footprint smaller and make this place more efficient." Finally, Rich and Lisa Layman will upgrade their 1940s-era home and plan to set aside money saved on energy bills for their children's college funds. LEAP hopes that Home Energy Makeover Contest winners will spread the message of energy efficiency as they experience the benefits firsthand. "Our goal was to find representative homes, where homeowners then can serve as 'energy champions,'" said Cynthia Adams, executive director of LEAP in the Northern Virginia area.


Coping with floods: Preparedness, response and recovery of flood-affected residents in  

E-Print Network (OSTI)

water flow put moveable contents upstairs protect oil tanks install water pump safeguard domestic = very ineffectively performed measure 2002 2005 2006 2010 2011Year: switch off gas/electricity Figure 3

Baer, Christian


September 1, 2011 Review of Resident Fish, Data Management and Program Coordination  

E-Print Network (OSTI)

) and Bonneville Power Administration (Bonneville) will begin the category review of all projects regarding. The scientific and administrative review for the category enables the Council and Bonneville to make long for Fiscal Years 2013-2017 Dear Project Proponents: The Northwest Power and Conservation Council (Council


Analysis of potential impacts to resident fish from Columbia River System Operation alternatives  

Science Journals Connector (OSTI)

The US Army Corps of Engineers, the US Bureau of Reclamation, and the Bonneville Power Administration initiated the Columbia River System Operation Review...

David R. Geist; Lance W. Vail; Daniel J. Epstein


Evaluation of serum dioxin congeners among residents near continuously burning municipal solid waste incinerators in Korea  

Science Journals Connector (OSTI)

The objective of this study was to evaluate the congeners of polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs) in Korean serum samples as biological markers. Serum samples from 1...

Chan-Seok Moon; Yoon-Seok Chang



Analysis of chlorinated polyvinyl chloride pipe burst problems :Vasquez residence system inspection.  

SciTech Connect

This report documents the investigation regarding the failure of CPVC piping that was used to connect a solar hot water system to standard plumbing in a home. Details of the failure are described along with numerous pictures and diagrams. A potential failure mechanism is described and recommendations are outlined to prevent such a failure.

Black, Billy D.; Menicucci, David F.; Harrison, John (Florida Solar Energy Center)



Preparing Residents in Training to Become Health-Care Leaders: A Pilot Project  

Science Journals Connector (OSTI)

The aim of this study is to describe a successful and exportable training module that addresses Next Accreditation System (NAS) behavioral milestones for leadership competencies.

Ronald J. Gurrera; Rodney Dismukes; Matthew Edwards; Usama Feroze


Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Bloom of resident antibiotic-resistant bacteria in soil following manure fertilization  

E-Print Network (OSTI)

conventions, will likely increase in the future. According to the National Organic Program, raw manure may be used up to 90颅 120 d before harvest, depending on the crop, and composted manure may be applied at any

Handelsman, Jo


Department of Industrial Engineering Spring 2012 Improving Resident Therapy Transportation Scheduling for Muncy Valley Hospital  

E-Print Network (OSTI)

Transportation Scheduling for Muncy Valley Hospital Skilled Nursing Units Overview The objective of this project is required to be efficient due to the fact that approximately 40% of the hospital's revenue is derived from. Eliminate communication issues by introducing two way radios to the hospital staff. Approach Gather initial

Demirel, Melik C.


Kalispell (i.e. Kalispel) Resident Fish Project : Annual Report, 1996.  

SciTech Connect

In 1996 the Kalispell Natural Resource Department (KNRD) in conjunction with the Washington Department of Fish and Wildlife (WDFW) continued the implementation of a habitat and population enhancement project for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). A habitat and population assessment was conducted on Browns Creek a tributary of Cee Cee Ah Creek, one of the priority tributaries outlined in the 1995 annual report. The assessment was used to determine the type and quality of habitat that was limiting to native bull trout and cutthroat trout populations. Analysis of the habitat data indicated high amounts of sediment in the stream, low bank cover, and a lack of winter habitat. Data collected from this assessment was used to prescribe habitat enhancement measures for Browns Creek. Habitat enhancement measures, as outlined in the recommendations from the 1995 annual report, were conducted during field season 1996. Fencing and planting of riparian areas and in stream structures were implemented. As a precursor to these enhancement efforts, pre-assessments were conducted to determine the affects of the enhancement. Habitat quality, stream morphology and fish populations were pre-assessed. The construction of the largemouth bass hatchery was started in October of 1995. The KNRD, Contractors Northwest Inc. and associated subcontractors are in the process of constructing the hatchery. The projected date of hatchery completion is summer 1997.

Maroney, Joseph; Donley, Christopher; Lockwood, Jr., Neil



Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

Sustainability Classification .. 62 MS Thesis, Dept. of Architecture,Sustainability Classifications of Project Homes MS Thesis, Dept. of Architecture,Architecture, UC Berkeley 2012 http://escholarship.org/uc/item/25x5j8w6 Figure 24 Formaldehyde Concentrations by Energy/Sustainability

Less, Brennan



Behavioral Ecology Vol. 8 No. 2: 218-225 The resident's dilemma: a female choice  

E-Print Network (OSTI)

; Bradbury, 1981; Lank and Smith, 1987; Westcott, 1994). Finally, other models propose that leks result from


Solar project description for Arno Kahn/Builders and Laborers Commonwealth single family residence Duluth, Minnesota  

SciTech Connect

The Arno Kahn/Builders and Laborers Commonwealth Site is a house in a Minnesota suburb. It combines a modified direct-gain sun space system with a thermal envelope. The living space is separated from the sun space by a three-story mass wall. Sunlight enters the three-story solarium and heats the mass wall which in turn heats the air. The warm air is then distributed through the thermal envelope. Manually operated shades provide night insulation for the south-facing windows, and roof overhangs and a turbine vent in the solarium roof prevent overheating. Domestic hot water is preheated in four tanks located behind the window of the basement sunroom. The concrete floor in the basement provides part of the heat storage. Wood burning stoves and electric baseboard heaters provide auxiliary heating. Five modes of operation are described: collector-to-storage, collector-to-space heating, storage-to-space heating, solarium cooling and domestic hot water preheating. The instrumentation for the National Solar Data Network is described. The solar energy portion of the construction costs is estimated to be $7000. (LEW)

Moore, D



Solar project description for living systems single family residence, Davis, California  

SciTech Connect

Two independent systems are described - a direct gain passive solar space heating system and an active domestic hot water preheating system. Large south-facing windows and a clerestory skylight permit direct winter sun to enter the house. Solar energy thermal storage is provided by both water filled tubes and the concrete slab floor. Movable shutters and insulating curtains provide capability to reduce night heat losses. Summer overheat protection is provided by roof overhangs and by natural ventilation. A natural gas furnace and wood stove provide auxiliary space heat. The domestic hot water system has an array of liquid flat plate collector with a gross area of 53 square feet. Freeze protection is by drain-down. An 82-gallon solar preheat tank supplies water to a conventional 20-gallon domestic hot water tank. The collector, storage, heating load, and auxiliary loads subsystems and modes of operation are described for both systems. The house is instrumented for thermal performance evaluation. Original cost estimates for provisioning and installation of the solar system are given. (LEW)

Not Available



A passive cooling design for multifamily residences [sic] in hot, humid climates  

E-Print Network (OSTI)

People living in hot, humid climates suffer either from extremely uncomfortable weather conditions or from the great cost of air-conditioning systems for maintaining comfort. Most of the available passive cooling techniques ...

Tang, Joseph C



Federal Funding in Response to Hurricane Katrina: Utilization by New Orleans Residents  

E-Print Network (OSTI)

for each individual or household to eliminate the previous ceilings on housing repair and replacement funds, though overall Section 408 caps of $25,000 with cost of living adjustments still remain.31 The Post-Katrina Act also grants FEMA authorization...: The FEMA Teleregistration Line.? 3 September. Federal Emergency Management Agency. 26 Information available in the Parish Quick Facts Report: FEMA 1603 & 1607-DR-LA as of COB 3/27/07. 27 FEMA. 2005. ?Disaster Recovery Centers to Open.? 6 Sept. Federal...

Beauchamp, Krystle; Chavez, Leslie; Dye, Wendy; Lamon, Matt; Mallas, Liz; Stephens, Caroline



Small Residence Multizone Modeling with Partial Conditioning for Energy Effieiency in Hot and Humid Climates  

E-Print Network (OSTI)

Energy Conservation Code 2012 and Building America benchmark definitions. A detailed comparison was made between the commonly used energy modeling tools (DOE-2.1e, EnergyPlus and TRNSYS) and a modeling method was developed for the estimation...

Andolsun, Simge



Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

Energy Group Consol Net Zero Energy Certified The ThousandEnergy Institute, 2012) Net-Zero Energy Certified (Zero Netare: Passive House Net-zero energy home Green certified home

Less, Brennan




E-Print Network (OSTI)

Hall. The Hawkins Hall International Cuisine Cook-Off. Windsor ladies dressed up for a masquerade ball

Fern谩ndez-Juricic, Esteban


Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

CARB. (2011). Nitrogen dioxide - overview. Retrieved 6/8,concentrations of nitrogen dioxide and formaldehyde inair quality standard for nitrogen dioxide (Technical Support

Less, Brennan



Bloom of resident antibiotic-resistant bacteria in soil following manure fertilization  

Science Journals Connector (OSTI)

...331 27 Jacoby GA Munoz-Price LS ( 2005 ) The new beta-lactamases . N Engl J Med 352...thank Ashley Ferguson and Nicole Price for technical assistance...mass no longer decreased on heating. CFU of solid media were determined...in this study from cultured oil bacteria at 52 d after manure...

Nikolina Udikovic-Kolic; Fabienne Wichmann; Nichole A. Broderick; Jo Handelsman



Installation guidelines for Solar Heating System, single-family residence at New Castle, Pennsylvania  

SciTech Connect

The Solar Heating System installer guidelines are provided for each subsystem and includes testing and filling the system. This single-family residential heating system is a solar-assisted, hydronic-to-warm-air system with solar-assisted domestic water heating. It is composed of the following major components: liquid cooled flat plate collectors; water storage tank; passive solar-fired domestic water preheater; electric hot water heater; heat pump with electric backup; solar hot water coil unit; tube-and-shell heat exchanger, three pumps, and associated pipes and valving in an energy transport module; control system; and air-cooled heat purge unit. Information is also provided on the operating procedures, controls, caution requirements, and routine and schedule maintenance. Information consists of written procedures, schematics, detail drawings, pictures and manufacturer's component data.

Not Available



Indoor Air Quality in 24 California Residences Designed as High Performance Green Homes  

E-Print Network (OSTI)

1989). Residential indoor air quality and energy efficiency.book Residential Indoor Air Quality and Energy Efficiency by2009). Indoor air quality in highly energy efficient homes桝

Less, Brennan



Social Media Scavenger Hunt to Bolster Resident Involvement at an Academic Conference  

E-Print Network (OSTI)

adjunct at an ACEP conference, a smartphone scavenger huntInvolvement at an Academic Conference Fix M, Mallin MP,learn more (62.5%) at the conference secondary to the tasks,

Fix, M; Mallin, M P; Stroud, S



Functional Unit, Technological Dynamics, and Scaling Properties for the Life Cycle Energy of Residences  

Science Journals Connector (OSTI)

(1, 2) At the sub-building scale, LCA is used to assess building level technologies such as water heaters(3) and energy systems. ... To control for the effects of climate and technology, we limit the study to the Phoenix metropolitan area and to a standard set of materials and technologies typically used in residential structures within this region, in compliance with local building code and the 2009 International Energy Conservation Code for Arizona抯 climate zone 2. For this analysis we consider houses typical in Phoenix: average construction quality, without basement, built on a cement slab foundation, exterior walls made of stucco on a wood frame, with a cement tiled roof. ...

Stephane Frijia; Subhrajit Guhathakurta; Eric Williams



UNC EM Boot Camp Boosts Confidence Levels of Graduating Medical Students Entering EM Residency Programs  

E-Print Network (OSTI)

favorably viewed their EM Boot Camp experience and felt that57 UNC EM Boot Camp Boosts Confidence Levels of Graduatinghave used some type of Boot Camp, modeled after military

Watson, L F



Wind?energy farm noise impacts on nearby residences梩he citizen's view  

Science Journals Connector (OSTI)

Wind?energy farms with hundreds of wind turbines have proliferated in close proximity to residential properties without any apparent control on the noise impact consequences. Annoying and intrusive wind turbinenoise occurred as soon as the first turbines were installed. The adverse noise impact has continued and intensified as additional WECS (wind energy conversion system) sites were approved and developed with the installation of hundreds of additional turbines. The adverse noiseeffects consist of low?frequency noise that is not fully addressed or controlled by only A?weighted sound level standards pure tones and higher noise levels during higher wind?speed conditions. More stringent noise controls should have been implemented in the beginning. Riverside County has recently adopted a more stringent noise standard that also includes a pure tone restriction that will apply to future sites. However mitigation of the mistakes made at the earlier sites remains to be resolved.

John R. Warner
