Powered by Deep Web Technologies
Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

APART  

Energy Science and Technology Software Center (OSTI)

002662MLTPL00 Automated Pre-processing for NMR Assignments with Reduced Tedium http://sir.lanl.gov/APART.htm

2

Multifamily Apartment Rebate Program  

Broader source: Energy.gov [DOE]

Efficiency Vermont offers rebates for the installation of energy efficient equipment in existing multifamily apartments in Vermont for rental property owners. Managers of multifamily apartments may...

3

Earth-sheltered apartments  

SciTech Connect (OSTI)

Earth-sheltered apartments for students at St. Johns University, Collegeville, MN are described. The intent was to provide energy-efficient, low maintenance housing in a neighborhood environment for the students. Students would learn about energy-conscious architecture from living in the buildings. The buildings have had few problems, but energy performance has not been up to expectations. The consumption of electricity exceeded predictions by 49%. The most likely answer to the problem is deviation from design. Several items of energy-efficient design were specified but deleted in order to cut costs.

Germer, J.

1984-12-01T23:59:59.000Z

4

Welcome toWelcome toWelcome toWelcome to Student ApartmentsStudent ApartmentsStudent ApartmentsStudent Apartments  

E-Print Network [OSTI]

residence fire hazard plug in air fresheners residence fire hazard electrical cooking items: rice cookers

Glasgow, University of

5

Contract Periods for 2012-2013 Residence Halls  

E-Print Network [OSTI]

Contract Periods for 2012-2013 Residence Halls All of the residence halls are on Fall/Spring Contracts. THERE IS NO FALL ONLY CONTRACT. · The residence halls open for the fall semester on September 1 rate for the number of days they stay. Apartments Your contract entitles you to an apartment space

Minnesota, University of

6

THE DEVELOPMENT OF MICROSTRUCTURE IN DUPLEX STAINLESS STEEL WELDS  

E-Print Network [OSTI]

THE DEVELOPMENT OF MICROSTRUCTURE IN DUPLEX STAINLESS STEEL WELDS by Naseem Issa Abdallah Haddad;The Development of Microstructure in Duplex Stainless Steel Welds Abstract Duplex stainless steels

Cambridge, University of

7

Welcome toWelcome toWelcome toWelcome to Student ApartmentsStudent ApartmentsStudent ApartmentsStudent Apartments  

E-Print Network [OSTI]

plug in air fresheners residence fire hazard electrical cooking items: rice cookers, kettles, toasters

Glasgow, University of

8

Welcome toWelcome toWelcome toWelcome to Student ApartmentsStudent ApartmentsStudent ApartmentsStudent Apartments  

E-Print Network [OSTI]

residence fire hazard electrical cooking items: rice cookers, kettles, toasters room fire hazard #12

Glasgow, University of

9

Switch to duplex stainless steels  

SciTech Connect (OSTI)

Duplex stainless steels contain approximately equal proportions of ferrite and austenite. These stainless steels have become an established material of construction in the chemical process industries (CPI). Duplexes offer benefits over austenitic stainless steels and carbon steels because of their higher strength, and good toughness and ductility, in combination with equivalent resistance to general corrosion, as well as better resistance to localized corrosion and stress corrosion cracking. Additionally, duplex materials have thermal-conductivity and thermal-expansion coefficients similar to those of ferritic materials, are tough at low (sub-zero) temperatures, and have a high resistance to erosion and abrasion. In some of the highly corrosive environments encountered in the CPI, the super duplex stainless steels offer cost-effective options not possible with the standard austenitic stainless steels. The initial applications were almost exclusively as heat exchanger tubing in water-cooled service. In recent times, duplex stainless steels have been used in the oil, gas, and chemical industries. Examples include service in sweet and mildly sour corrosive environments, on offshore platforms where weight savings can be realized, and as a replacement for standard austenitic stainless steel in chemical-processing plants.

Quik, J.M.A.; Geudeke, M.

1994-11-01T23:59:59.000Z

10

Apartment Touring ChecklistApartment Touring ChecklistApartment Touring ChecklistApartment Touring Checklist Here are some things to keep in mind when looking at apartments to prevent potential issues.  

E-Print Network [OSTI]

Checklist Here are some things to keep in mind when looking at apartments to prevent potential issues. Where

Wisconsin at Madison, University of

11

ECOVILLAGE FACTS The complex includes 50 apartments (18 original and 32 new)  

E-Print Network [OSTI]

radiant floor heating o Structurally insulated panels (SIPs) · In additional to individual garden plots of the Ecovillage apartments include: o solar tubes and compact fluorescent lighting o low-flow toilets, community gatherings o Kitchen o Playroom o Dryers for Ecovillage residents o Solar water heater o Solar

Baltisberger, Jay H.

12

60 Years of duplex stainless steel applications  

SciTech Connect (OSTI)

In this paper the history of wrought duplex stainless steel development and applications is described. Ferritic-austenitic stainless steels were introduced only a few decades after stainless steels were developed. The paper gives details from the first duplex stainless steels in the 1930`s to the super duplex stainless steel development during the 1980`s. During the years much effort has been devoted to production and welding metallurgy as well as corrosion research of the duplex stainless steels. Therefore, duplex stainless steels are to-day established in a wide product range. Numerous important applications are exemplified. In most cases the selection of a duplex steel has been a result of the combination high strength excellent corrosion resistance. In the pulp and paper industry the most interesting use is as vessel material in digesters. For chemical process industry, the duplex steels are currently used in heat exchangers. The largest application of duplex steels exists in the oil and gas/offshore industry. Hundreds of kms of pipelines are installed and are still being installed. An increased use of duplex steels is foreseen in areas where the strength is of prime importance.

Olsson, J.; Liljas, M. [Avesta Sheffield AB, Avesta (Sweden)

1994-12-31T23:59:59.000Z

13

Klamath Apartment Buildings (13) Space Heating Low Temperature...  

Open Energy Info (EERE)

Apartment Buildings (13) Space Heating Low Temperature Geothermal Facility Jump to: navigation, search Name Klamath Apartment Buildings (13) Space Heating Low Temperature...

14

Duplex stainless steel: From specialty to commodity  

SciTech Connect (OSTI)

Important applications of duplex stainless steel in the oil and chemical industry date from the seventies. Duplex stainless steel is attractive because it combines high mechanical strength, about the same as for carbon steel, and good corrosion resistance particularly against chloride stress corrosion cracking up to about 100 C. This paper highlights a number of examples that are typical for the potential as well as the problems associated with this type of material.

Quick, J.M.A.; Geudeke, M. [Shell Internationale Petroleum Mij. B.V., The Hague (Netherlands)

1994-12-31T23:59:59.000Z

15

Analyzing Ventilation Effects of Different Apartment Styles by CFD  

E-Print Network [OSTI]

) study of flows in different apartments in Guangzhou City. The outdoor temperature is 27? and outdoor wind velocity is 1.8m/s, which comes from a southeast direction. Although all the apartments have the same inner layouts, results show apartments located...

Li, X.; Wang, L.; Ye, Z.

2006-01-01T23:59:59.000Z

16

University Apartments Resident Handbook Search the contents of this handbook three ways  

E-Print Network [OSTI]

......................................8 Telephone Services....................................... 9 Electric Service Services and Health Education ............................23 Campus Resources ....................................... 57 Temperature Control...................................58 Electricity

Sheridan, Jennifer

17

CANADIAN METALLURGICAL QUARTERLY HOT WORKABILITY OF 2304 AND 2205 DUPLEX  

E-Print Network [OSTI]

339 CANADIAN METALLURGICAL QUARTERLY HOT WORKABILITY OF 2304 AND 2205 DUPLEX STAINLESS STEELS E, 2002; in revised form December, 2003) Abstract -- The duplex stainless steels 2304 and 2205 were that the hot workability of 2304 and 2205 duplex stainless steels can be improved modestly by multistage

Niewczas, Marek

18

Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

E-Print Network [OSTI]

Measured Airflows in a Multifamily Building," AirflowPerformance of Building Envelopes, Components, and Systems,APARTMENTS AND COMMERCIAL BUILDINGS Price, P.N. ; Shehabi,

Price, P.N.

2011-01-01T23:59:59.000Z

19

Apartment Hunting - Part II - Keeping those Energy Bills Down...  

Broader source: Energy.gov (indexed) [DOE]

apartment hunting, I discuss things to look for that might help keep your energy bills low. When you think about it, energy bills can, in effect, increase your rent each month....

20

Dislocation substructure in fatigued duplex stainless steel  

SciTech Connect (OSTI)

Cyclic plastic straining of crystalline materials results in the formation of specific dislocation structures. Considerable progress in mapping and understanding internal dislocation structures has been achieved by studying single crystal behavior: however, most structural materials have a polycrystalline structure and investigations of polycrystals in comparison to single crystal behavior of simple metals prove to be very useful in understanding more complex materials. There are some classes of materials, however, with complicated structure which do not have a direct equivalent in single crystalline form. Moreover, the specific dimensions and shapes of individual crystallites play an important role both in the cyclic stress-strain response of these materials and in the formation of their interior structure in cyclic straining. Austenitic-ferritic duplex stainless steel, which is a kind of a natural composite, is a material of this type. The widespread interest in the application of duplex steels is caused by approximately doubled mechanical properties and equal corrosion properties, when compared with classical austenitic stainless steels. Fatigue resistance of these steels as well as the surface damage evolution in cyclic straining have been studied; however, much less is known about the internal substructure development in cyclic straining. In this study the dislocation arrangement in ferritic and austenitic grains of the austenitic-ferritic duplex steel alloyed with nitrogen and cyclically strained with two strain amplitudes, is reported and compared to the dislocation arrangement found in single and polycrystals of austenitic and ferritic materials of a similar composition and with the surface relief produced in cyclic plastic straining.

Polak, J. (Ecole Centrale de Lille, Villeneuve d'Ascq (France). Lab. de Mecanique de Lille Inst. of Physical Metallurgy, Brno (Czechoslovakia). Academy of Sciences); Degallaix, S. (Ecole Centrale de Lille, Villeneuve d'Ascq (France). Lab. de Mecanique de Lille); Kruml, T. (Inst. of Physical Metallurgy, Brno (Czechoslovakia). Academy of Sciences)

1993-12-15T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Characterization of thermal aging of duplex stainless steel by SQUID  

SciTech Connect (OSTI)

Thermal aging is a growing concern for long-term-aged duplex stainless steel piping in nuclear power plants. Superconducting QUantum Interference Device (SQUID) was used for the detection of thermal aging of SUS329 rolled duplex stainless steel and SCS16 cast duplex stainless steel. It was found that the SQUID output signal pattern in the presence of AC magnetic field applied to the specimen was sensitive to the changes in electromagnetic properties due to thermal aging.

Isobe, Y.; Kamimura, A.; Aoki, K.; Nakayasu, F. [Nuclear Fuel Industries, Ltd., Osaka (Japan)

1995-08-01T23:59:59.000Z

22

Sigmatization of duplex forgings: A case history  

SciTech Connect (OSTI)

An S31803 (22-05 alloy) duplex stainless steel flow-cross in service fin the H{sub 2}S-containing Saint-Faust gas field near Lacq was almost broken in two by a corrosion crack resulting from improper heat treatment. Sensitization had occurred much more rapidly than expected from the kinetics of sigma phase formation generally considered in the literature. None of the inspection techniques routinely employed in the oil and gas industry would have been capable of detecting this manufacturing defect. More stringent quality acceptance criteria are therefore necessary.

Crolet, J.L. [Elf Aquitaine Production, Pau (France); Corbineau, S. [Elf Aquitaine Production, Lacq (France); Perrollet, C.P. [Elf Enterprise Caledonia, Aberdeen (United Kingdom)

1997-08-01T23:59:59.000Z

23

Microstructure of Super-duplex Stainless Steels  

E-Print Network [OSTI]

.1 Introduction 24 3.2 The Fe-Cr-Ni System . . . . . . . . . . . . 25 3.3 The Alloying Elements in Duplex Stainless Steels 33 3.4 Chromium and Nickel Equivalents . . . . . . . 42 3.5 The Effect of Creq/Nieq Ratio on Equilibrium Volume Fraction of Austenite 43 3... / Austenite Balance 6.1 Introduction . 6.2 Thermodynamic Calculations . . . . . 6.3 Equilibrium Isothermal Heat Treatments 6.4 Effect of Ferrite/ Austenite Balance on Hardness 6.5 Equilibrium Partitioning of Alloying Elements 6.6 Precipitation of Cr2N 6...

Sharafi, Shahriar

1993-12-07T23:59:59.000Z

24

Nickel-free duplex stainless steels  

SciTech Connect (OSTI)

It is well known that nitrogen-alloying in steel produces a variety of exceptional properties such as high strength, high ductility and, eventually, resistance to stress corrosion cracking. High-nitrogen steels (HNS), therefore, have recently been developed to enhance the strength and corrosion resistance of stainless steels. However, due to a low solubility of nitrogen in a liquid steel under atmospheric pressure, the production of such high-nitrogen alloys needs high-pressure facilities that cause an extra cost. A possible route of developing high-nitrogen alloys under atmospheric pressure is to choose a duplex microstructure, where the amount of austenite and ferrite phase is nearly equal. A much lower nitrogen content is needed to maintain a 50% austenite phase compared with the necessary addition of nitrogen to reach a 100% austenitic microstructure. In addition, duplex stainless steels (DSS) with 40--60% ferrite can significantly improve the SCC-resistance. The objective of this work was to develop a new group of nickel-free, high strength and corrosion resistant DSS. Nickel was completely replaced by nitrogen in order to enhance SCC resistance and reduce the alloying element cost. The microstructure, mechanical properties, corrosion resistance and cost analysis of new alloys are investigated in comparison with some commercial stainless steels.

Wang, J.; Uggowitzer, P.J.; Magdowski, R.; Speidel, M.O. [ETH-Zentrum, Zurich (Switzerland). Inst. of Metallurgy] [ETH-Zentrum, Zurich (Switzerland). Inst. of Metallurgy

1998-12-04T23:59:59.000Z

25

Laminar inclusions of duplex stainless steels  

SciTech Connect (OSTI)

Duplex Stainless Steel have been utilized in the offshore petrochemical industries for over twenty years. The steels are normally manufactured to produce a 50:50 duplex austenitic and ferritic microstructure. The microstructure yields the benefits of high strength, corrosion resistance and low thermal expansion. While constructing a high pressure header box for an air cooled heat exchanger, linear indications were observed along the weld preparation faces. These laminations were parallel to the plate surfaces, reminiscent to oxide inclusions found in carbon steel plates manufactured 20 years ago. Concern over premature failure at the highly stressed corner joints resulted in the rejection of the plates. A metallurgical investigation followed. From scanning electron microscopy and energy dispersive x-ray, the indications were shown to be rich in Cr, Mn and Si. The inclusions occurred during steel manufacturing and were most likely due to incorrect removal of oxides at the top of the ingot and/or the exclusion of a secondary remelting process. New plates were ordered with tighter production controls on steel processing. The plates were ultrasonically inspected prior to fabrication and no further problems were discovered.

Hudson, M.E. [Fluor Daniel Canada Inc., Calgary, Alberta (Canada)

1993-12-31T23:59:59.000Z

26

E-Print Network 3.0 - apartment buildings Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

buildings Page: << < 1 2 3 4 5 > >> 1 Thank you for your interest in University Student Apartments. The information below, and in the University Student Apartments Web...

27

SUBAWARD, SUBCONTRACT, CONSULTANT, VENDOR HOW TO TELL THEM APART  

E-Print Network [OSTI]

SUBAWARD, SUBCONTRACT, CONSULTANT, VENDOR HOW TO TELL THEM APART SUBAWARD: The agreement the prime award is a contract. VENDOR: · Indicative characteristics o Provides the goods or services within: Categorized as a vendor-type relationship. An individual or company retained to provide professional advice

Kroll, Kristen L.

28

EIS-0050-S: Commercial and Apartment Conservation Service Program, Supplemental  

Broader source: Energy.gov [DOE]

The Office of Buildings Energy Research and Development prepared this SEIS to analyze the potential environmental impacts resulting from national implementation of the Commercial and Apartment Conservation Service Program. This SEIS is a supplement to DOE/EIS-0050, Residential Conservation Service Program.

29

Nitrogen containing shielding gases for GTAW duplex stainless steels  

SciTech Connect (OSTI)

The duplex stainless steel are alloys characterized as consisting of two phases; austenite and ferrite. As such, they combine the benefits of both phases i.e. good ductility and general corrosion resistance of austenite, but with improved stress corrosion cracking resistance and strength associate with ferrite. Carefully controlled manufacturing techniques are employed to produce this combination in roughly equal proportions to ensure optimum properties. The range of duplex alloys studied in this work covered both the standard grade (2205) and the latest generation of super duplex (2507) alloys; typical compositions are shown in Table 1. Although the standard duplex is the most commonly available and widely used, super duplexes, which are characterized by higher chromium, nickel, molybdenum and nitrogen contents, have even better corrosion properties and are finding increasing applications in the offshore industry. To benefit from the superior properties of duplex, it is vital that these alloys can be welded effectively and that the properties of the welded joint match those of the parent weld. The objective of the current investigation was to study the effect of nitrogen, in both the shielding and purge gas, on the weld metal nitrogen content, microstructure and corrosion resistance, with the eventual aim of recommending an effective shielding gas mixture for duplex stainless steels.

Creffield, G.K.; Cole, M.H.; Paciej, R.; Huang, W.; Urmston, S. [BOC Ltd., London (United Kingdom)

1993-12-31T23:59:59.000Z

30

Lubrication for high load duplex bearings  

SciTech Connect (OSTI)

Three ES and H-compatible lubricants (Environment, Safety and Health) for high load duplex bearing applications were evaluated and compared against trichlorotrifluoroethane (Freon) deposition of low molecular weight polytetrafluoroethylene (PTFE) bearing lubricant extracted from Vydax{trademark}. Vydax is a product manufactured by DuPont consisting of various molecular weights of PTFE suspended in trichlorotrifluoroethane (Freon) which is an ozone-depleting solvent. Bearings with Supercritical CO{sub 2} deposition of PTFE extracted from Vydax AR/IPA, bearings with titanium carbide coated balls, and bearings with diamond-like carbon races and retainers were evaluated. Bearings with Supercritical CO{sub 2} deposition of PTFE from Vydax AR/IPA performed as well as bearings with Freon deposition of PTFE from Freon-based Vydax.

Steinhoff, R.G.

1997-08-01T23:59:59.000Z

31

ITP Industrial Distributed Energy: Boa Vista Apartments: New Bedford Housing Authority/ New Bedford, MA  

Broader source: Energy.gov [DOE]

Overview of Boa Vista Apartments housing development, with CHP system to provide electricity and hot water.

32

Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

SciTech Connect (OSTI)

We compiled and analyzed available data concerning indoor-outdoor air leakage rates and building leakiness parameters for commercial buildings and apartments. We analyzed the data, and reviewed the related literature, to determine the current state of knowledge of the statistical distribution of air exchange rates and related parameters for California buildings, and to identify significant gaps in the current knowledge and data. Very few data were found from California buildings, so we compiled data from other states and some other countries. Even when data from other developed countries were included, data were sparse and few conclusive statements were possible. Little systematic variation in building leakage with construction type, building activity type, height, size, or location within the u.s. was observed. Commercial buildings and apartments seem to be about twice as leaky as single-family houses, per unit of building envelope area. Although further work collecting and analyzing leakage data might be useful, we suggest that a more important issue may be the transport of pollutants between units in apartments and mixed-use buildings, an under-studied phenomenon that may expose occupants to high levels of pollutants such as tobacco smoke or dry cleaning fumes.

Price, P.N.; Shehabi, A.; Chan, R.W.; Gadgil, A.J.

2006-06-01T23:59:59.000Z

33

The performance of duplex stainless steels in chemical environments  

SciTech Connect (OSTI)

The process industries have used 300 series stainless steels for many years where the corrosion resistance of carbon steel is inadequate. Where stainless steels have proved inadequate there has been a tendency to utilize high nickel alloys, with a greatly increased cost. The present paper reviews the different grades of duplex stainless steel and shows how their superior corrosion and stress corrosion cracking resistance, plus their high strength, can be utilized to provide cost effective alternatives to the high nickel alloys. The use of alternative design codes to take advantages of the properties of duplex alloys is discussed. Data is presented to show the resistance of duplex stainless steels to a variety of chemical environments. The use of duplex stainless steels and the reason for their selection in a number of applications is reviewed.

Francis, R. [Weir Materials Ltd., Manchester (United Kingdom). Park Works

1994-12-31T23:59:59.000Z

34

Analysis of Energy Consumption of Duplex Residences in College Station, Texas  

E-Print Network [OSTI]

heating base ioad base load cooling heating days temperature kwh kwh kwh % month month January 31 48.5 0 705 836 54 0 1 February 28.25 52.4 0 507 762 60 0 1 March 31 60.3 0 255 836 77 0 1 April 30 68.2 0 0 809 100 0 0 May 31 74.6 175 0 836 83 1 0...

Kim, S. B.; Woods, P. K.

1998-01-01T23:59:59.000Z

35

Phase Transformations in Cast Duplex Stainless Steels  

SciTech Connect (OSTI)

Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as {sigma} and {chi} can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling-transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe-22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase ({sigma} + {chi}) formation were analyzed using the Johnson-Mehl-Avrami (MA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations. The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities; a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, {sigma} was stabilized with increasing Cr addition and {chi} by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in DSS can be affected by local composition fluctuations in the cast alloy. This may cause discrepancy between thermodynamic prediction and experimental observation.

Yoon-Jun Kim

2004-12-19T23:59:59.000Z

36

Newporter Apartments: Deep Energy Retrofit Short-Term Results  

SciTech Connect (OSTI)

This project demonstrates a path to meet the goal of the Building America program to reduce home energy use by 30% in multi-family buildings. The project demonstrates cost effective energy savings targets as well as improved comfort and indoor environmental quality (IEQ) associated with deep energy retrofits by a large public housing authority as part of a larger rehabilitation effort. The project focuses on a typical 1960's vintage low-rise multi-family apartment community (120 units in three buildings).

Gordon, A.; Howard, L.; Kunkle, R.; Lubliner, M.; Auer, D.; Clegg, Z.

2012-12-01T23:59:59.000Z

37

West Village Student Housing Phase I: Apartment Monitoring and Evaluation  

SciTech Connect (OSTI)

Building America team Alliance for Residential Building Innovation (ARBI) worked with the University of California, Davis (UC Davis) and the developer partner West Village Community Partnership (WVCP) to evaluate performance on 192 student apartments completed in September, 2011 as part of Phase I of the multi-purpose West Village project. West Village, the largest planned zero net energy community in the United States. The campus neighborhood is designed to enable faculty, staff and students to affordably live near campus, take advantage of environmentally friendly transportation options, and participate fully in campus life. The aggressive energy efficiency measures that are incorporated in the design contribute to source energy reductions of 37% over the B10 Benchmark. The energy efficiency measures that are incorporated into these apartments include increased wall & attic insulation, high performance windows, high efficiency heat pumps for heating and cooling, central heat pump water heaters (HPWHs), 100% high efficacy lighting, and ENERGY STAR major appliances. Results discuss how measured energy use compares to modeling estimates over a 10 month monitoring period and includes a cost effective evaluation.

German, A.; Bell, C.; Dakin, B.; Hoeschele, M.

2014-06-01T23:59:59.000Z

38

Our Corporate Residents...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the quality and variety of the Corporate Residents who call ETTP home. From young start-ups to Fortune 500 corporations, Heritage Center's resources and assets are being fully...

39

www.uwindsor.ca/residence Residence Student Handbook Table of Contents  

E-Print Network [OSTI]

www.uwindsor.ca/residence Residence Student Handbook 1 Table of Contents #12;www.uwindsor.ca/residence Residence Student Handbook 2 Welcome Home to Residence ! #12;www.uwindsor.ca/residence Residence Student Handbook 3 Residence Services #12;www.uwindsor.ca/residence Residence Student Handbook 4 Residence Life

40

Green Student Residence Award Make your residence more sustainable  

E-Print Network [OSTI]

Green Student Residence Award Make your residence more sustainable OIKOS Luxembourg in collaboration with the Cell for Sustainable Development and SEVE Logement invites all students living in University-residences to participate in the Green Student Residence Award. How to participate? Build a Team

van der Torre, Leon

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

ENERGY IMPACTS OF ENERGY AND INDOOR ENVIRONMENTAL QUALITY RETROFITS OF APARTMENTS IN CALIFORNIA  

E-Print Network [OSTI]

with simultaneous energy savings and indoor environmental quality (IEQ) improvements as the goal. The control apartments to energy use changes of control apartments, total measured savings of gas energy plus site1 ENERGY IMPACTS OF ENERGY AND INDOOR ENVIRONMENTAL QUALITY RETROFITS OF APARTMENTS IN CALIFORNIA

42

Energy Impacts of Energy and Indoor Environmental Quality Retrofits of Apartments in California  

SciTech Connect (OSTI)

Monthly gas and electricity use data from a set of 13 study apartments and 20 control apartments from three apartment buildings (B1 B3) in California were analyzed. The study apartments were retrofit with simultaneous energy savings and indoor environmental quality (IEQ) improvements as the goal. The control apartments were not retrofit. Pre-retrofit modeling indicated annual energy savings of 21percent, 17percent, and 27percent for the study apartments in B1-B3, respectively. Based on a comparison of changes in energy use of study apartments to energy use changes of control apartments, total measured savings of gas energy plus site electrical energy were 28percent in B1, 5percent in B2, and 3percent in B3. Given the small number of study apartments and the substantial changes in energy use within control apartments, the project yielded no conclusive evidence of energy savings. Apartment energy use increased with number of occupants and with floor area; however, the association with occupancy was most evident. Climate differences did not appear to be the major driver for the variability in energy use among apartments. Changes in occupant behaviors affecting energy use may have overwhelmed and obscured the energy savings in this small number of buildings. Much larger prior studies employing similar retrofits indicate that the retrofits usually do save energy.

Fisk, William J.; Norris, Federico; Singer, Brett C.

2013-11-01T23:59:59.000Z

43

Elemental mapping of spinodal decomposition in duplex stainless , J M Titchmarsh2  

E-Print Network [OSTI]

Elemental mapping of spinodal decomposition in duplex stainless steels T Yamada1 , J M Titchmarsh2 300o C, regions of delta ferrite in duplex stainless steels are susceptible to SD (Cottrell, 1995 steel that has been aged at two temperatures for various times. 2. EXPERIMENTAL DETAILS Duplex stainless

Dunin-Borkowski, Rafal E.

44

Concordia Residence Life GREY NUN'S  

E-Print Network [OSTI]

with picnic tables and pond. #12;#12;· Residence Staff on site · Security cameras · Secure access 13' / 130sf / 12sm #12;Other amenities at Hingston Hall (HB) · Residence Staff on site · Security;#12;Other amenities at the Jesuit Residence · Residence Staff on site · Security camera · Secure access

Doedel, Eusebius

45

Residential Services Headlease residents  

E-Print Network [OSTI]

Residential Services Headlease residents handbook 2013-2014 #12;Map of Brighton inside front cover packs Rent 5 Residential Advisor (RA) network 6 Senior residential advisors Residential Student Support Contents Contents Brighton 1 #12;Welcome Congratulations on securing your place at Sussex. Residential

Sussex, University of

46

Laser Safety Method For Duplex Open Loop Parallel Optical Link  

DOE Patents [OSTI]

A method and apparatus are provided to ensure that laser optical power does not exceed a "safe" level in an open loop parallel optical link in the event that a fiber optic ribbon cable is broken or otherwise severed. A duplex parallel optical link includes a transmitter and receiver pair and a fiber optic ribbon that includes a designated number of channels that cannot be split. The duplex transceiver includes a corresponding transmitter and receiver that are physically attached to each other and cannot be detached therefrom, so as to ensure safe, laser optical power in the event that the fiber optic ribbon cable is broken or severed. Safe optical power is ensured by redundant current and voltage safety checks.

Baumgartner, Steven John (Zumbro Falls, MN); Hedin, Daniel Scott (Rochester, MN); Paschal, Matthew James (Rochester, MN)

2003-12-02T23:59:59.000Z

47

Duplex stainless steels for the pulp and paper industry  

SciTech Connect (OSTI)

The metallurgy and corrosion resistance of duplex stainless steel, particularly with regards to applications in the pulp and paper industry, are described. Practical experiences from pressure vessel installations in cooking plants and bleach plants as well as from non-pressurized items in different parts along the fiber line, are given. The paper also reviews corrosion test results presented previously and compares these with recent test data and the practical experiences. Though most of the installations have been successful, some cases of corrosion attacks on duplex stainless steel have been reported, although these are very limited in number: one digester, one calorifier, two pulp storage towers, and two bleach plant filter washers, of a total of more than 700 identified installations.

Alfonsson, E.; Olsson, J.

1999-07-01T23:59:59.000Z

48

The effect of cathodic protection on duplex stainless steels in sea water  

SciTech Connect (OSTI)

The report reviews the available data on the embrittlement of duplex stainless steels under cathodic protection in sea water. Much of this data has previously been unpublished. The results show that while hydrogen enters duplex alloys at typical protection potentials ({minus}1V SCE) the risk of failure is very low. The austenite phase tends to block cracks in the ferrite, and very high stresses are needed to produce fracture of the austenite or austenite-ferrite phase boundaries to enable crack propagation to occur. The smaller the grain size the more resistant duplex stainless steel is to embrittlement. The report also shows that currently used design stresses for duplex alloys are well below the stresses needed to produce failure. The service experiences with cathodically protected duplex are reviewed and the few failures explained. The report concludes that at normal protection potentials the risk of failure of duplex stainless steel due to hydrogen embrittlement is extremely low.

Francis, R.; Byrne, G.; Warburton, G.R. [Weir Materials Ltd., Manchester (United Kingdom)

1995-11-01T23:59:59.000Z

49

Cleavage-like fracture of austenite in duplex stainless steel  

SciTech Connect (OSTI)

Nitrogen alloying of stainless steel has proved to be extremely successful for mechanical and corrosion properties. For duplex stainless steel, which appears to be very promising for industrial application, the beneficial influence of nitrogen has also been established for contents of about 0.2 wt-%. Duplex structures are found in many alloys and systems as, for instance, in Cu- and Ti-alloys and in stainless steel. They all are characterized by a mixture of similar amounts of two phases whose plastic behaviors are different from one another. In the case of duplex stainless steel the matrix phase is usually ferrite. However, by increasing the nitrogen content and therefore the stability of austenite, it is shown in the present work that austenite can also become the matrix. Because the partition coefficient of nitrogen between [alpha] and [gamma] is large, it is also possible to harden the [gamma] phase more than [alpha]. The question this paper attempts to answer is whether or not nitrogen alloying can exchange the roles of the [alpha] and the [gamma] phases with respect to mechanical properties.

Foct, J. (Univ. de Lille (France)); Akdut, N. (Inst. fuer Metallkunde und Metallphysik, Aachen (Germany))

1993-07-15T23:59:59.000Z

50

Performance history over 10 years of super duplex stainless steel in flue gas desulfurization  

SciTech Connect (OSTI)

25 Cr duplex (austenitic/ferritic) stainless steel containing copper and nitrogen offers a cost effective solution to material selection for pollution control equipment. The properties of duplex stainless steel which make it suitable for this type of application are discussed and long term performance histories presented. It is concluded that high alloy duplex steel has an important role to play in the production of low maintenance reliable equipment for FGD and other pollution control systems.

Bendall, K.C. [Langley Alloys Ltd., Maidenhead (United Kingdom)

1996-08-01T23:59:59.000Z

51

E-Print Network 3.0 - aged lean duplex Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and thermochronologic ages from rocks in the Main Central thrust zone in central Nepal. At its current exposure level... duplex. Se- quential emplacement of the Main Central...

52

Green Student Residence Award Make your residence more sustainable  

E-Print Network [OSTI]

Green Student Residence Award The Guide Make your residence more sustainable This award's student group for sustainability OIKOS, in collaboration with the Cell for Sustainable Development and SEVE Logement invites all students living in student accommodation to participate in the Green Student

van der Torre, Leon

53

Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

SciTech Connect (OSTI)

The current focus on building energy retrofit provides an opportunity to simultaneously improve indoor environmental quality (IEQ). Toward this end, we developed a protocol for selecting packages of retrofits that both save energy and improve IEQ in apartments. The protocol specifies the methodology for selecting retrofits from a candidate list while addressing expected energy savings, IEQ impacts, and costs in an integrated manner. Interviews, inspections and measurements are specified to collect the needed input information. The protocol was applied to 17 apartments in three buildings in two different climates within California. Diagnostic measurements and surveys conducted before and after retrofit implementation indicate enhanced apartment performance.

Noris, Federico; Delp, William W.; Vermeer, Kimberly; Adamkiewicz, Gary; Singer, Brett C.; Fisk, William J.

2012-06-18T23:59:59.000Z

54

Long term experiences of the use of duplex stainless steel to combat corrosion in the pulp and paper industry  

SciTech Connect (OSTI)

Duplex (austenitic/ferritic) stainless steels offer properties of interest and a cost effective material selection solution for plant and equipment in the pulp and paper industry. The characteristics of duplex steels leading to successful long term applications of 22 Cr duplex and a copper containing 25 Cr super duplex stainless steel are reviewed. It is concluded that, applied correctly, two-phase stainless steels can provide long term reliable maintenance-free service in many pulp and paper plant environments.

Bendall, K.C. [Langley Alloys Ltd., Maidenhead (United Kingdom)

1996-08-01T23:59:59.000Z

55

A Study of Austenite Precipitate Growth in Duplex Stainless Steel A Research Performance Evaluation  

E-Print Network [OSTI]

A Study of Austenite Precipitate Growth in Duplex Stainless Steel A Research Performance Evaluation-based metals handbooks. Due the multi-component nature of the duplex stainless steels which are the basis stainless steel. Current State of Knowledge The velocity of an interface during a phase transformation can

McGaughey, Alan

56

Use of duplex stainless steel castings in control valves  

SciTech Connect (OSTI)

Duplex stainless steels have enjoyed rapidly increasing popularity in recent years. For numerous reasons the availability of these alloys in the cast form has lagged behind the availability of the wrought form. Commercial demand for control valves in these alloys has driven development of needed information to move into production. A systematic approach was used to develop specifications, suppliers and weld procedures. Corrosion, stress corrosion cracking (SCC), sulfide stress cracking (SSC) and hardness results are also presented for several alloys including; CD3MN (UNS J92205), CD4MCu (UNS J93370) and CD7MCuN (cast UNS S32550).

Gossett, J.L. [Fisher Controls International, Inc., Marshalltown, IA (United States)

1996-07-01T23:59:59.000Z

57

Observation of duplex DNA-drug noncovalent complexes by electrospray ionization mass spectrometry  

SciTech Connect (OSTI)

We have observed by ESI-MS the noncovalent complex formed between a minor groove binding molecule and a 12 base pair self-complementary oligonucleotide. When the ratio of Distamycin Dm to oligonucleotide was varied, oligonucleotide duplex, 1:1 Dm/oligonucleotide duplex, and 2:1 Dm/oligonucleotide duplex noncovalent complexes were observed, consistent with NMR results for the same sequence and Dm to oligonucleotide duplex concentration ratios. These results indicate that ESI-MS is an effective analytical technique for the detection of specific drug-oligonucleotide duplex noncovalent complexes and that specific noncovalent complexes can be observed reflecting stoichiometry in solution. Additional experiments to determine if ESI-MS can provide information on the specificity and selectivity of additional minor groove binding and intercalating molecules are in progress. 19 refs., 1 fig.

Gale, D.C.; Goodlett, D.R.; Light-Wahl, K.J.; Smith, R.D. (Pacific Northwest Lab., Richland, WA (United States))

1994-06-29T23:59:59.000Z

58

Sustainable water supply: rainwater harvesting for multistoried residential apartments in dhaka, bangladesh  

E-Print Network [OSTI]

. Based on these guidelines, a mathematical model has been developed to figure out cistern sizes for collection of rainwater. The solution is applied to a typical plan of an apartment house in Dhaka (multistoried) using programming and visualization so...

Sultana, Farzana

2009-05-15T23:59:59.000Z

59

"Shelter within my reach" : medium rise apartment housing for the middle income group in Karachi, Pakistan  

E-Print Network [OSTI]

This thesis identifies the project development processes of medium rise (five storied or less) apartment housing built by the private formal sector, catering to the middle income groups in Karachi, Pakistan. Middle income ...

Mahmood, Saman, 1972-

1999-01-01T23:59:59.000Z

60

The case for micro-apartment housing in growing urban centers  

E-Print Network [OSTI]

Taking an analytical approach, this thesis will address how the unmet housing need of urban single-person households can be rectified by the introduction of micro-apartments. The existing housing stock has been built largely ...

Shore, Zachary, S.M. Massachusetts Institute of Technology

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Corrosion resistance evaluation of 22Cr duplex stainless steel weldments  

SciTech Connect (OSTI)

Among the alternatives for the materials to be used for the construction of two flowlines 22Cr duplex stainless steel was taken into consideration. Corrosion resistance of the welds when exposed to the produced sour fluids was considered as the most critical point, so a program of corrosion testing on the 22Cr duplex stainless steel welds was developed. Three different welding procedures were used and tested in two different laboratories; specimens belonging to one of the welding procedures were also tested after a pre-strain to assess the effect of the deformation induced in the pipe by the wrapping in a reel. Tests were performed in an environment simulating the expected flowlines internal service conditions. Several testing procedures were used. Pitting test according to ASTM G48 Standard were carried out in order to rank welds and exposure tests in simulated field conditions were performed to assess stress corrosion and localized corrosion resistance. Test results showed that all the welds passed the tests and were applicable as corrosion resistant in the service environment. A ranking of the weld procedure based on their corrosion resistance has been determined.

Kopliku, A. [AGIP S.p.A., Milan (Italy); Bell, D. [AGIP UK, London (United Kingdom); Barteri, M. [C.S.M., Rome (Italy); Fowler, C. [CAPCIS, Manchester (United Kingdom)

1996-12-01T23:59:59.000Z

62

Moessbauer measurements of microstructural change in aged duplex stainless steel  

SciTech Connect (OSTI)

A duplex stainless steel (ASME SA351 CF8M) has usually been manufactured by a continuous casting technique. It consists of a paramagnetic austenite phase and a ferromagnetic ferrite phase. It has been known that the ferrite phase decomposition occurs in this steel after aging between 300 and 450 C. As a result of phase decomposition, a Fe-rich phase and a Cr-rich phase are produced in the ferrite phase. It is difficult to detect the phase decomposition even by not only optical microscopy but also transmission electron microscopy, since the decomposed structure is very fine. However, Moessbauer measurements that can detect the magnetic hyperfine field of magnetic substance may detect the microstructural change. An averaged magnetic hyperfine field increases in the ferrite phase, due to the production of the Fe-rich phase which has high magnetic hyperfine field. Therefore, the authors investigated the phase decomposition of the duplex stainless steel caused by aging, utilization Moessbauer spectroscopy which has capability of detecting this structural change in the atomic level quantitatively. The authors also investigated the potential of backscattering Moessbauer method for NDE technique.

Kirihigashi, A.; Sakamoto, N.; Yamaoka, T. [Mitsubishi Heavy Industries, Ltd., Hyogo (Japan); Nasu, S. [Osaka Univ. (Japan)

1995-08-01T23:59:59.000Z

63

Resident Advisor Position Description Occupational Summary  

E-Print Network [OSTI]

Resident Advisor Position Description Occupational Summary The Resident Advisor (RA) is assigned and Residence Hall policies. The Resident Advisor provides programming based on an assessment of the community and individual needs. The responsibilities of the Resident Advisor position are implemented under the supervision

Bogaerts, Steven

64

Washington Residents, Agencies, NGOs Specialists  

E-Print Network [OSTI]

Washington Residents, Agencies, NGOs Specialists County Directors, County Faculty, Staff, and Volunteers Department Chairs District Directors County Government Issue Teams Research and Extension Centers WASHINGTON STATE UNIVERSITY CAMPUSES Pullman Spokane Tri-Cities Vancouver Agriculture Program Director R

Collins, Gary S.

65

Project Management Plan Resident Management System (RMS)  

E-Print Network [OSTI]

1 Project Management Plan Resident Management System (RMS) And Quality Control System (QCS Resident Management System.........................................................................................................3 Project Management Plan - Purpose

US Army Corps of Engineers

66

Damage and rupture mechanisms in an austenoferritic duplex steel  

SciTech Connect (OSTI)

The influence of ageing on damage and rupture mechanisms in an austenoferritic duplex stainless steel is studied using conventional straining and impact toughness testing at 20 C and 320 C, and in situ SEM straining at 20 C. While the as-received alloy fails in a ductile mode, damage in the aged material starts with cleavage nucleation in ferrite. The authors show that, owing to the bipercolated topology of the alloy, these cleavage cracks can propagate while passing round austenite ligaments whose plastic stretching controls the crack extension. The variations with strain of both the crack size and the average crack separation are computed analytically and their comparison gives a good prediction of ductility.

Verhaeghe, B.; Louchet, F.; Brechet, Y. [LTPCM-CNRS, St. Martin d`Heres (France). Groupe Physique du Metal] [LTPCM-CNRS, St. Martin d`Heres (France). Groupe Physique du Metal; Massoud, J.P. [EDF, Moret sur Loing (France)] [EDF, Moret sur Loing (France)

1997-05-01T23:59:59.000Z

67

Plastic anisotropy in a superplastic duplex stainless steel  

SciTech Connect (OSTI)

Measurements of the plastic anisotropy in uniaxial tension of the duplex stainless steel, SAF2304, have been made at room temperature and under conditions where the material was superplastic. There was significant plastic anisotropy in both types of deformation and there were some similarities between the low and high temperature variations with tensile axis orientation. Although it was possible to model the high temperature anisotropy using a grain boundary sliding model, the assumed distribution of sliding boundaries was considered to be unrealistic. This, together with aspects of microstructural and textural development, indicated that deformation was principally occurring by intragranular slip with a significant contribution caused by mechanical inhomogeneity in the two-phase material.

Song, J.L.; Bate, P.S. [Univ. of Birmingham (United Kingdom)] [Univ. of Birmingham (United Kingdom)

1997-07-01T23:59:59.000Z

68

LOUISIANA RESIDENCE REGULATIONS A resident student for tuition purposes is defined as one who has abandoned all prior domiciles  

E-Print Network [OSTI]

. ALIEN RESIDENT Alien Resident applicants must provide a Xerox copy of both sides of their alien resident

69

Rapid method to detect duplex formation in sequencing by hybridization methods  

DOE Patents [OSTI]

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19T23:59:59.000Z

70

Applications and experiences with super duplex stainless steel in wet FGD scrubber systems  

SciTech Connect (OSTI)

The paper presents the properties of the author`s company`s proprietary super duplex stainless steel. Work is presented showing the development of a more realistic laboratory solution representing typical limestone slurries found in real flue gas desulfurization (FGD) systems. The importance of additions of metal ions such as Fe{sup 3+} and Mn{sup 2+} as well as partially oxidized sulfur species is demonstrated. Results are presented comparing the crevice corrosion resistance of super duplex stainless steel in these slurries with other commonly used wrought and cast stainless steels, for both simulated anthracite and lignite type slurries. Data from loop tests on the erosion resistance of a range of alloys in simulated FGD slurries is presented. The results clearly show the superior resistance of super duplex stainless steel to both crevice corrosion and erosion in FGD slurries. Finally the experiences in UK FGD systems with both cast and wrought super duplex stainless steel are presented.

Francis, R.; Byrne, G.; Warburton, G.; Hebdon, S. [Weir Materials Ltd., Manchester (United Kingdom)

1998-12-31T23:59:59.000Z

71

E-Print Network 3.0 - aged duplex stainless Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 Figure 5.19. Light micrographs showing the microstructure of duplex rolled metal IC381 solution treated at 1300 C for 26 hours and then quenched into Summary: for...

72

Recognition of Duplex RNA by Helix-Threading Peptides Barry D. Gooch and Peter A. Beal*  

E-Print Network [OSTI]

Recognition of Duplex RNA by Helix-Threading Peptides Barry D. Gooch and Peter A. Beal 84112-0850 Received April 15, 2004; E-mail: beal@chem.utah.edu Abstract: Many important biological

Beal, Peter A.

73

X-mas trees: A new application for duplex stainless steels  

SciTech Connect (OSTI)

The development of fields in severe areas (subsea installations, deserts) necessitates the use of materials which can operate maintenance free in these conditions. Depending on production route and aggressivity of relevant media, the materials used until now, such as AISI 4130, are being superseded by higher alloyed materials such as F6NM, Duplex and Super Duplex Steels. Extensive investigation of metallurgical, mechanical, technological and stress aspects as well as research into the influence of melting, forging and heat treatment processes on high alloyed materials enables ``High Tech`` forgings to be manufactured. Based on investigations and experience gained by previously produced forgings (WYE-piece, Gate Valve components, Swivel forgings, line pipes made of Super Duplex Stainless Steels and Duplex Stainless Steels), the first X-mas trees made of solid Duplex Stainless Steel has been produced. Due to the excellent mechanical and corrosion properties of Duplex Stainless Steel, the expensive and time consuming cladding can be eliminated for most environments, which results in good economy and significantly reduced production time. To obtain information about the quality of such a large forging, samples were taken from one of these X-mas trees and the mechanical and corrosion properties were investigated.

Hochoertler, G.; Zeiler, G.; Haberfellner, K.

1995-12-31T23:59:59.000Z

74

Characterizing the bending and flexibility induced by bulges in DNA duplexes  

E-Print Network [OSTI]

Advances in DNA nanotechnology have stimulated the search for simple motifs that can be used to control the properties of DNA nanostructures. One such motif, which has been used extensively in structures such as polyhedral cages, two-dimensional arrays, and ribbons, is a bulged duplex, that is two helical segments that connect at a bulge loop. We use a coarse-grained model of DNA to characterize such bulged duplexes. We find that this motif can adopt structures belonging to two main classes: one where the stacking of the helices at the center of the system is preserved, the geometry is roughly straight and the bulge is on one side of the duplex, and the other where the stacking at the center is broken, thus allowing this junction to act as a hinge and increasing flexibility. Small loops favor states where stacking at the center of the duplex is preserved, with loop bases either flipped out or incorporated into the duplex. Duplexes with longer loops show more of a tendency to unstack at the bulge and adopt an open structure. The unstacking probability, however, is highest for loops of intermediate lengths, when the rigidity of single-stranded DNA is significant and the loop resists compression. The properties of this basic structural motif clearly correlate with the structural behavior of certain nano-scale objects, where the enhanced flexibility associated with larger bulges has been used to tune the self-assembly product as well as the detailed geometry of the resulting nanostructures.

John S. Schreck; Thomas E. Ouldridge; Flavio Romano; Ard A. Louis; Jonathan P. K. Doye

2014-12-19T23:59:59.000Z

75

Pull-apart emplacement of the Margeride granitic complex (French Massif Central). Implications for the late  

E-Print Network [OSTI]

Pull-apart emplacement of the Margeride granitic complex (French Massif Central). Implications Margeride granitic complex that crops out in the central part of the Variscan French Massif Central. This complex consists of three facies, namely, a main porphyritic monzogranite, a two-mica granite, and late

Paris-Sud XI, Université de

76

Energy Policy 32 (2004) 10451052 California's electricity crisis: a market apart?  

E-Print Network [OSTI]

Energy Policy 32 (2004) 1045­1052 Viewpoint California's electricity crisis: a market apart? James Bushnell* University of California Energy Institute, 2547 Channing Way, Berkeley, CA 94720-5180, USA capacity, a flawed market design, and the venality of electricity producers. However, many

Kammen, Daniel M.

77

JAEA Fatigue Analysis of EBR-II Duplex Tubing  

SciTech Connect (OSTI)

This work addresses questions brought up concerning the mechanisms associated with fatigue crack growth retardation and/or arrest within the nickel bond layer in duplex 2 Cr-1Mo steel superheater tubes. Previous work performed at the Idaho National Laboratory (INL) indicated that the nickel bond layer did not function as a crack arrestor during fatigue crack propagation with the exception of one, isolated case involving an exceptionally low fatigue load and a high temperature (400 0C) environment. Since it is atypical for a fatigue crack to propagate from a relatively soft material (the nickel bond layer) to a harder material (the 2 Cr-1Mo steel) there has been speculation that the nickel bond layer was hardened in service. Additionally, there are questions surrounding the nature of the fatigue crack propagation within the nickel bond layer; specifically with regard to the presence of voids seen on micrographs of the bond layer and oxidation within the steel along the edge of the nickel bond layer. There is uncertainty as to the effect of these voids and/or oxide barriers with respect to potential fatigue crack arrest.

J. H. Jackson; D. L. Porter; W. R. Lloyd

2009-07-01T23:59:59.000Z

78

Superplastic Forming of Duplex Stainless Steel for Aerospace Part  

SciTech Connect (OSTI)

In this study, the high temperature forming behavior of duplex stainless steel has been characterized and the outer shell of a combustion chamber was fabricated with pressure difference of hot gas. It consists of two parts which are the outer skin made of stainless steel to sustain the internal pressure and the inner shell made of copper alloy for regenerative cooling channels. Two outer skins partitioned to half with respect to the symmetric axis was prepared by hot gas forming process with a maximum pressure of 7 MPa following to FEM analysis. For inner layer, copper alloy was machined for cooling channels and then placed in the gas pressure welding fixture. It is shown that the optimum condition of gas pressure welding is 7 MPa at 890 deg. C, for one hour. EDX analysis and scanning electron microscope micrograph confirm the atomic diffusion process is observed at the interface and copper atoms diffuse into steel, while iron and chrome atoms diffuse into copper. The result shows that the manufacturing method with superplastic forming and gas pressure welding of steel and copper alloy has been successful for near net shape manufacturing of scaled combustion chamber of launch vehicle.

Lee, Ho-Sung; Yoon, Jong-Hoon; Yoo, Joon-Tae; Yi, Young-Moo [Korea Aerospace Research Institute, 45 Eoeun-dong Yuseong, Daejeon 305-333 (Korea, Republic of)

2011-08-22T23:59:59.000Z

79

Hydrogen embrittlement of duplex stainless steels -- Simulating service experience  

SciTech Connect (OSTI)

The challenges in characterizing susceptibility of corrosion resistant alloys (CRAS) to hydrogen embrittlement in service are highlighted using experimental data for duplex stainless steels (DSSS) in two major industrial applications: in oil production environments downhole, where galvanic coupling to carbon steel can cause hydrogen uptake, and in subsea pipelines where cathodic protection provides the source of hydrogen atoms. The influence of environment composition, charging current, pre-exposure, time, temperature, temperature excursions, and mechanical test method is examined. For constant temperature conditions, pre-exposure may have no major impact on embrittlement of DSSS because hydrogen ingress via regions of mechanically ruptured oxide film is dominant, unless there are internal microstructural regions or defects of high susceptibility. Pre-exposure maybe more significant when excursions from high to low temperature occur. The application of interrupted slow strain rate testing to determination of the threshold strain to cracking of a DSS indicates a need for testing at very low strain rates. The time-consuming nature of this testing may inhibit its extended utilization but without such data there is a measure of uncertainty in materials selection with respect to the degree of risk and the tolerance to service excursions.

Turnbull, A.; Griffiths, A.; Reid, T. [National Physical Lab., Teddington (United Kingdom)

1999-11-01T23:59:59.000Z

80

Survey on Cooling Costs and Related Factors for Apartments in an Urban Area of Osaka  

E-Print Network [OSTI]

. (1978), Hong (1993), Sawachi et al. (1994), and Suzuki et al. (1995). Ojima et al. surveyed the actual situations of energy use for electricity, gas, and kerosene in nine cities for both detached houses and apartments and for both rented and owned... members, the income, and the cooling and heating systems affected the energy use. Enai et al. presented a method to estimate kerosene consumption according to the degree-days. Sawachi et al. introduced estimation formulae of energy use based...

Umemiya, N.; Lin, X.; Inoue, G.

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Kelly House Apartment Community (236 Students, Co-ed by Apt. / Tier 3 Single or Double Occupancy Fee)  

E-Print Network [OSTI]

Kelly House Apartment Community (236 Students, Co-ed by Apt. / Tier 3 Single or Double Occupancy Fee) Kelly House is a four story an apartment complex for upperclassmen at the corner of St. Philip and Vanderhorst Streets. Constructed in 1995, Kelly house features a central courtyard and central laundry room

Kunkle, Tom

82

Ventilation and Infiltration in High-Rise Apartment Buildings Richard C. Diamond, Helmut E. Feustel and Darryl J. Dickerhoff  

E-Print Network [OSTI]

-rise apartment buildings. 1.0. Introduction & Literature Review Quantifying the impact of infiltration on energy annual energy consumption per floor in a 12-story apartment building in Pittsburgh, Pennsylvania, these findings have more general implications for energy retrofits and health and comfort of occupants in high

Diamond, Richard

83

Heat treatment temperature influence on ASTM A890 GR 6A super duplex stainless steel microstructure  

SciTech Connect (OSTI)

Duplex and super duplex stainless steels are ferrous alloys with up to 26% chromium, 8% nickel, 5% molybdenum and 0.3% nitrogen, which are largely used in applications in media containing ions from the halogen family, mainly the chloride ion (Cl{sup -}). The emergence of this material aimed at substituting Copper-Nickel alloys (Cupro-Nickel) that despite presenting good corrosion resistance, has mechanical properties quite inferior to steel properties. The metallurgy of duplex and super duplex stainless steel is complex due to high sensitiveness to sigma phase precipitation that becomes apparent, due to the temperatures they are exposed on cooling from solidification as well as from heat treatment processes. The objective of this study was to verify the influence of heat treating temperatures on the microstructure and hardness of ASTM A890/A890M Gr 6A super duplex stainless steel type. Microstructure control is of extreme importance for castings, as the chemical composition and cooling during solidification inevitably provide conditions for precipitation of sigma phase. Higher hardness in these materials is directly associated to high sigma phase concentration in the microstructure, precipitated in the ferrite/austenite interface. While heat treatment temperature during solution treatment increases, the sigma phase content in the microstructure decreases and consequently, the material hardness diminishes. When the sigma phase was completely dissolved by the heat treatment, the material hardness was influenced only due to ferrite and austenite contents in the microstructure.

Martins, Marcelo [SULZER BRASIL S/A - FUNDINOX DIVISION (Brazil); Centro Universitario Salesiano de Sao Paulo (Brazil); E-mail: marcelo.martins@sulzer.com; Casteletti, Luiz Carlos [Materials, Aeronautics and Automobiles Engineering Department at the Sao Carlos Engineering School of the Sao Paulo University (USP) (Brazil)

2005-09-15T23:59:59.000Z

84

Housing & Conference Services Residence Life Office  

E-Print Network [OSTI]

/IRC in the assigned residence(s). Residence Orientation Advisors assist peers in making a successful transition are trained in event management, diversity, risk management, teambuilding, leadership, supervision environment. (i.e. camp, high school position, university position, ect.) · Demonstrated project management

Thompson, Michael

85

WARREN RESIDENTIAL LIFE RESIDENT ASSISTANT POSITION DESCRIPTION  

E-Print Network [OSTI]

WARREN RESIDENTIAL LIFE RESIDENT ASSISTANT POSITION DESCRIPTION The position of Resident Assistant for students living within the Warren College residential community. Resident Assistant's (RA's) are principle members of the Warren Residential Life staff. In accordance with the University of California's Personnel

Russell, Lynn

86

Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through a theoretical link  

E-Print Network [OSTI]

Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through comprising 6 to 20 base pairs self-assemble into polydisperse semi- flexible chains due to hydrophobic on temperature and duplex length, such chains order into liquid crystal phases. Here, we investigate the self-assembly

Sciortino, Francesco

87

Final Report, Volume 3, Guidance Document for the Evaluation of Cast Super Duplex Stainless Steel  

SciTech Connect (OSTI)

Volume 3 comprises of the Development of Qualification Standards for Cast Super Duplex Stainless Steel (A890-5A) which is equivalent to wrought 2507. The objective of this work was to determine the suitability of ASTM A923 Standard Test methods for Detecting Detrimental Intermetallic Phase in Duplex Austenitic-Ferritic Stainless Steels for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). The various tests which were carried out were ASTM A923 Test Method A, B and C (Sodium Hydroxide Etch Test, Charpy Impact Test and Ferric Chloride Corrosion Test), ferrite measurement using Feritscope{reg_sign}, ASTM E562 Manual Point Count Method and X-Ray Diffraction, hardness measurement using Rockwell B and C and microstructural analysis using SEM and EDS.

Hariharan, Vasudevan; Lundin, Carl, D.

2005-09-30T23:59:59.000Z

88

Rapid method to detect duplex formation in sequencing by hybridization methods  

DOE Patents [OSTI]

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Mirzabekov, Andrei Darievich (Moscow, RU); Timofeev, Edward Nikolaevich (Moscow, RU); Florentiev, Vladimer Leonidovich (Moscow, RU); Kirillov, Eugene Vladislavovich (Moscow, RU)

1999-01-01T23:59:59.000Z

89

Phase boundaries and deformation in high nitrogen duplex stainless steels; 1: Rolling texture development  

SciTech Connect (OSTI)

The texture development during cold rolling of two nitrogen alloyed duplex stainless steels with different nitrogen contents and different microstructures were investigated. The fcc phases of both duplex steels show an almost identical texture development in contrast to the ferritic phases. In single phase ferritic steels a typical fiber type texture develops to slip on [110], [112] and [123] planes. In contrast to this, the ferritic phase of duplex steel D1 deforms mainly by slip on [110] planes so that no typical fiber type texture can be observed. The texture development of the cast specimen D2 is characterized by its random character in the ferritic phase. This proves that besides the microstructure, nitrogen strongly influences the deformation mechanisms. Furthermore, it appears that for both phases the intensities of the cold rolling textures decrease. Induced by the phase boundaries, strong shear components appear as well as the activation of additional slip systems and the refinement of the microstructure.

Akdut, N. (Inst. fuer Metallkunde und Metallphysik, Aachen (Germany). RWTH Aachen); Foct, J. (Univ. de Lille, Villeneuve d'Ascq (France). Lab. de Metallurgie Physique)

1995-01-01T23:59:59.000Z

90

Localized hydrogen cracking in the austenitic phase of a duplex stainless steel  

SciTech Connect (OSTI)

The aim of this study is to investigate the role of hydrogen on the mechanical behavior of an austenitic phase, in the particular situation of duplex stainless steels. In these duplex alloys, in presence of hydrogen, the ferritic phase is embrittled by hydrogen and the resistance to cracking is mainly related to the behavior of the austenitic phase. Thus, a discussion of the role of hydrogen at the crack tip of a duplex alloy (as function of the microstructure) has been proposed by T. Perng and C.J. Altester after experiments conducted in gaseous environment. A similar experimental approach has been followed in this study; slow strain rate tests (SSRT) have been performed on duplex stainless steels in gaseous environments for low hydrogen charging conditions. The main question is then related to the conditions for hydrogen entry and embrittlement of the austenitic phase ({gamma}). Because hydrogen is spread everywhere in the ferritic matrix ({alpha}), it was asked if the behavior of the austenitic phase of the duplex was comparable to that of a purely austenitic sample during hydrogen charging. Critical experiments have been conducted to answer this question. SSRT (strain rate = 10{sup {minus}6}s{sup {minus}1}) were performed on duplex stainless steels in a pressure vessel under 30 bar of hydrogen or deuterium at room temperature. Complementary chemical analysis by Secondary Ionic Mass Spectroscopy (SIMS) allowed to image the spatial distribution of deuterium as function of the microstructure. The role of hydrogen will be then mainly illustrated on the basis of microscopic examinations of the crack path transition from the ferritic to the austenitic grains, and discussed through the corrosion enhanced plasticity model proposed by T. Magnin for SCC in ductile materials.

Oltra, R.; Bouillot, C. [Univ. de Bourgogne, Dijon (France). Lab. de Recherches sur la Reactivite des Solides] [Univ. de Bourgogne, Dijon (France). Lab. de Recherches sur la Reactivite des Solides; Magnin, T. [Ecole des Mines, Saint-Etienne (France)] [Ecole des Mines, Saint-Etienne (France)

1996-11-01T23:59:59.000Z

91

Energy efficient residence: research results  

SciTech Connect (OSTI)

This report on the design, construction, and monitoring of an energy efficient residence and a conventional comparison home by the National Association of Home Builders Research Foundation, Inc. The report describes the two homes in considerable detail, summarizes the results of the energy and other measurements, and evaluates many of the energy conservation techniques used. Finally, these results are synthesized with the foundation's other energy conservation experience into two lists of energy saving design tips for homes in both colder and warmer climates. Most of the design tips are accompanied by brief comments intended to aid in their interpretation and use.

Johnson, R.J.

1980-12-01T23:59:59.000Z

92

CO{sub 2} laser welding of duplex and super-duplex stainless steels (the effect of argon-nitrogen assist-gas mixtures)  

SciTech Connect (OSTI)

Continuous wave CO{sub 2} laser welds have been fabricated on duplex and super duplex stainless steel substrates at a power of 3.5 kW. The work has examined the influence of Ar-N{sub 2} assist-gas mixtures on weld metal composition and microstructure. Welding in pure argon leads to reduction in the Cr, Ni, Mo and N content of the weld metal and a significant decrease in austenite volume fraction relative to the baseplate. Relative to welding in Ar, the use of a N{sub 2} bearing assist-gas restores the Cr, Ni and Mo levels to those found in the baseplate at the welding speeds employed. Moreover, the N{sub 2} bearing assist-gases result in an increase in the weld metal N content and austenite volume fraction relative to welding in pure Ar.

Robinson, J.M.; Reed, R.C. [Univ. of Cambridge (United Kingdom); Camyab, A. [Imperial Coll. of Science, Technology and Medicine, London (United Kingdom)

1996-12-31T23:59:59.000Z

93

A Study on Zoning Regulations' Impact on Thermal Comfort Conditions in Non-conditioned Apartment Buildings in Dhaka City  

E-Print Network [OSTI]

zoning schemes seemed essential for this study. To analyze the four zoning regulation schemes' impact on thermal comfort in apartment buildings, four sets of built environment were created in EnergyPlus (Energy Simulation software) as well as in Fluent...

Islam, Saiful

2012-02-14T23:59:59.000Z

94

Preferential precipitation site of sigma phase in duplex stainless steel weld metal  

SciTech Connect (OSTI)

Duplex stainless steels are characterized by favorable combination of mechanical and corrosion properties, consisting roughly of equal parts of austenite ({gamma}) and ferrite ({alpha}). But exposure to elevated temperatures brings partial decomposition of ferrite to austenite and sigma phase, which deteriorates their properties. Sigma phase forms often at ferrite/austenite ({alpha}/{gamma}) interfaces through nucleation process. The heterogeneous nucleation of sigma phase at an {alpha}/{gamma} interface depends on the chemical driving force and the interfacial energy. Many studies have examined the effect of chemical driving force on sigma phase formation in duplex and austenitic stainless steel weld metals with different chemical compositions, but no detailed report has described the influence of {alpha}/{gamma} interfacial energy on sigma phase nucleation. The Kurdjumov-Sachs (K-S) orientation relationship is accepted to bring a coherent and low energy {alpha}/{gamma} interface in duplex stainless steels. The coherency of {alpha}/{gamma} interface can affect the sigma phase formation. The present study has examined the effect of crystallographic orientation relationship at {alpha}/{gamma} interface on sigma phase formation in a duplex stainless steel weld metal where the chemical element distribution is relatively uniform because of rapid cooling during weld thermal cycle.

Sato, Y.S.; Kokawa, Hiroyuki [Tohoku Univ., Sendai (Japan). Dept. of Materials Processing] [Tohoku Univ., Sendai (Japan). Dept. of Materials Processing

1999-02-19T23:59:59.000Z

95

Effect of interfacial oxidation occurring during the duplex process combining surface nanocrystallisation and co-rolling  

E-Print Network [OSTI]

, nanocristallised 316L stainless steel multilayer structures were produced by the duplex process as described in [5 presents an investigation of the interface quality of nanocristallised 316L stainless steel multilayer, copper or stainless steel [1-4]. Unfortunately the affected depth remains limited ( 250 µm for 316L

Paris-Sud XI, Université de

96

Sigma phase morphologies in cast and aged super duplex stainless steel  

SciTech Connect (OSTI)

Solution annealed and water quenched duplex and super duplex stainless steels are thermodynamically metastable systems at room temperature. These systems do not migrate spontaneously to a thermodynamically stable condition because an energy barrier separates the metastable and stable states. However, any heat input they receive, for example through isothermal treatment or through prolonged exposure to a voltaic arc in the welding process, cause them to reach a condition of stable equilibrium which, for super duplex stainless steels, means precipitation of intermetallic and carbide phases. These phases include the sigma phase, which is easily identified from its morphology, and its influence on the material's impact strength. The purpose of this work was to ascertain how 2-hour isothermal heat treatments at 920 deg. C and 980 deg. C affect the microstructure of ASTM A890/A890M GR 6A super duplex stainless steel. The sigma phase morphologies were found to be influenced by these two aging temperatures, with the material showing a predominantly lacy microstructure when heat treated at 920 deg. C and block-shaped when heat treated at 980 deg. C.

Martins, Marcelo, E-mail: marcelo.martins@sulzer.com [SULZER BRASIL S/A (Brazil); Sao Paulo Salesian University Center (UNISAL), Americana Division, Av. Eng. Joao Fernandes G. Molina, 905 - Distrito Industrial - 13.213-080 Jundiai-SP (Brazil); Casteletti, Luiz Carlos, E-mail: castelet@sc.usp.br [Department of Materials, Aeronautical and Automotive Engineering, Sao Carlos School of Engineering, University of Sao Paulo (USP), Av. Trabalhador Sao Carlense, 400 - 13.566-590 Sao Carlos - SP (Brazil)

2009-08-15T23:59:59.000Z

97

The {sigma} phase formation in annealed UNS S31803 duplex stainless steel: Texture aspects  

SciTech Connect (OSTI)

The influence of sigma phase precipitation on the texture of austenite in a duplex stainless steel UNS S31803 was investigated. Sigma phase quantification was precisely performed by electron backscattered scanning diffraction (EBSD) for some conditions. It was found that the increase of the sigma phase precipitation enhances the amount of Brass texture in the austenite phase.

Souza, C.M. [Universidade Federal do Rio de Janeiro, Departamento de Engenharia Metalurgica e de Materiais (Brazil)], E-mail: eng_marley@yahoo.com.br; Abreu, H.F.G. [Universidade Federal do Ceara, Departamento de Engenharia Metalurgica e de Materiais, Campus do Pici Bl. 702, Fortaleza, CE, CEP 60.455-760 (Brazil); Tavares, S.S.M. [Universidade Federal Fluminense, Departamento de Engenharia Mecanica (Brazil); Rebello, J.M.A. [Universidade Federal do Rio de Janeiro, Departamento de Engenharia Metalurgica e de Materiais (Brazil)

2008-09-15T23:59:59.000Z

98

Phase transformations in ferrite phase of a duplex stainless steel aged at 500[degree]C  

SciTech Connect (OSTI)

Due to their high strength, high corrosion resistance, and good properties of castings, duplex stainless steels are widely used in the recirculation system of nuclear power plants. Although the presence of ferrite phase increases the strength and the resistance to SCC, the ferrite phase also brings about thermal aging embrittlement known as 475 C embrittlement''. The room temperature impact strength can decrease by 80% after aging for 8 years at a temperature as low as 300 C. Much research has been performed on the low temperature embrittlement of duplex stainless steels. It is generally acknowledged that the spinodal decomposition in ferrite phase and precipitation of some other carbides or nickel silicide are responsible for the degradation in mechanical properties of duplex stainless steels at low temperatures. The extent of the degradation was found to be strongly dependent on the composition in ferrite, which is closely related to the change of microstructure. Thus, the exact evolution of phase transformation in ferrite has also drawn a large audience. In this study, using electron microscopy, the authors investigated the phase evolution of ferrite phase in duplex stainless steel, aged at 500 C. up to 10,000 hours.

Shiao, J.J.; Tsai, C.H.; Huang, J.H.; Kai, J.J. (National Tsing Hua Univ., Hsinchu (Taiwan, Province of China). Dept. of Nuclear Engineering)

1993-12-01T23:59:59.000Z

99

Estimated size and performance of a natural gas fired duplex Stirling for domestic refrigeration applications  

SciTech Connect (OSTI)

Calibrated calculations are used to size an integrated Stirling cooler and engine (Duplex configuration). Fuel for the engine is natural gas and the working fluid is helium. The potential exists for long life and low noise. Performance is shown to be very competitive when compared to standard vapor compression systems. 10 refs., 8 figs., 1 tab.

Berchowitz, D.M. (Sunpower, Inc., Athens, OH (United States)); Shonder, J. (Oak Ridge National Lab., TN (United States))

1991-01-01T23:59:59.000Z

100

Computational mapping reveals dramatic effect of Hoogsteen breathing on duplex DNA reactivity  

E-Print Network [OSTI]

Computational mapping reveals dramatic effect of Hoogsteen breathing on duplex DNA reactivity Formaldehyde has long been recognized as a haz- ardous environmental agent highly reactive with DNA. Recently-ray and nuclear magnetic resonance techniques for observing weakly specific interactions of small organic

Vajda, Sandor

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

X-Ray Conformational Study of the DNA Duplex in Solution  

E-Print Network [OSTI]

X-Ray Conformational Study of the DNA Duplex in Solution V. GRASSIAN* and G. W. BRADY,f Rensselaer Earlier x-ray studies on dissolved linear DNA molecules were interpreted on the assumption engaged in x-ray diffraction studies of circular su- perhelical DNA. Some of our preliminary results have

Benham, Craig J.

102

Effect of Mo substitution by W on impact property of heat affected zone in duplex stainless steels  

SciTech Connect (OSTI)

The duplex stainless steels are characterized by two phase structures composed of a mixture of austenite and ferrite phases. They offer high toughness, good weldability, satisfactory corrosion protection, excellent stress corrosion cracking resistance and high strength. Because of these characteristics, these steels have been widely used in various applications such as oil, gas, and chemical industries. Duplex stainless steels generally have suffered embrittlement when exposed at elevated temperature, i.e. above 300 C. To avoid this embrittlement, conventional duplex stainless steels are subject to solution treatment followed by water quenching in the final stage of production or fabrication, which limits the size of products. Kim et al. have recently reported that embrittlement can be greatly reduced by the partial or full replacement of Mo by W in 22Cr-base duplex stainless steels. For the processing of duplex stainless steel, fusion welding is a major fabrication method for corrosion resistant applications. Therefore the welding behavior of these materials has to be fully defined. The purpose of this study is to investigate the effect of Mo substitution by W on the impact property of simulated heat affected zones in 22Cr duplex stainless steels. Structural transformation associated with Mo substitution by W in HAZ has been also investigated on W-containing alloys and conventional 3% Mo duplex stainless steel.

Huh, M.J.; Kim, S.B.; Paik, K.W.; Kim, Y.G. [Korea Advanced Inst. of Science and Technology, Taejon (Korea, Republic of). Dept. of Materials Science and Engineering] [Korea Advanced Inst. of Science and Technology, Taejon (Korea, Republic of). Dept. of Materials Science and Engineering

1997-04-01T23:59:59.000Z

103

Final Report, Volume 1, Metallurgical Evaluation of Cast Duplex Stainless Steels and their Weldments  

SciTech Connect (OSTI)

Duplex stainless steels (DSS) are being specified for chloride containing environments due to their enhanced pitting and stress corrosion cracking resistance. They exhibit improved corrosion performance over the austenitic stainless steels. Duplex stainless steels also offer improved strength properties and are available in various wrought and cast forms. Selected grades of duplex stainless steel castings and their welds, in comparison with their wrought counterparts, were evaluated, regarding corrosion performance and mechanical properties and weldability. Multiple heats of cast duplex stainless steel were evaluated in the as-cast, solution annealed (SA) static cast and SA centrifugal cast conditions, while their wrought counterparts were characterized in the SA condition and in the form of as-rolled plate. Welding, including extensive assessment of autogenous welds and a preliminary study of composite welds (shielded metal arc weld (SMAW)), was performed. The evaluations included critical pitting temperature (CPT) testing, intergranular corrosion (IGC) testing, ASTM A923 (Methods A, B and C), Charpy impact testing, weldability testing (ASTM A494), ferrite measurement and microstructural evaluations. In the study, the corrosion performances of DSS castings were characterized and assessed, including the wrought counterparts for comparison. The evaluation filled the pore of lack of data for cast duplex stainless steels compared to wrought materials. A database of the pitting corrosion and IGC behavior of cast and wrought materials was generated for a greater depth of understanding for the behavior of cast duplex stainless steel. In addition, improved evaluation methods for DSS castings were developed according to ASTM A923, A262, G48 and A494. The study revealed that when properly heat treated according to the specification, (1) DSS castings have equal or better pitting and intergranular corrosion resistance than their wrought counterparts; (2) Welding reduces the pitting and intergranular corrosion resistance for both the wrought and cast duplex alloys; (3) Castings generally have better toughness than their wrought counterparts in the temperature range of ???????¢????????????????80???????????????°C to +20???????????????°C; (4) All shield metal arc (SMA) test welds in DSS castings, with recommended or over matching filler metal, indicate that welding is not a significant factor when considering DSS applications.

Wen, Songqing; Lundin, Carl, W.; Batten, Greg, W.

2005-09-30T23:59:59.000Z

104

Final Report, Volume 1, Metallurgical Evaluation of Cast Duplex Stainless Steels and their Weldments  

SciTech Connect (OSTI)

Duplex stainless steels (DSS) are being specified for chloride containing environments due to their enhanced pitting and stress corrosion cracking resistance. They exhibit improved corrosion performance over the austenitic stainless steels. Duplex stainless steels also offer improved strength properties and are available in various wrought and cast forms. Selected grades of duplex stainless steel castings and their welds, in comparison with their wrought counterparts, were evaluated, regarding corrosion performance and mechanical properties and weldability. Multiple heats of cast duplex stainless steel were evaluated in the as-cast, solution annealed (SA) static cast and SA centrifugal cast conditions, while their wrought counterparts were characterized in the SA condition and in the form of as-rolled plate. Welding, including extensive assessment of autogenous welds and a preliminary study of composite welds (shielded metal arc weld (SMAW)), was performed. The evaluations included critical pitting temperature (CPT) testing, intergranular corrosion (IGC) testing, ASTM A923 (Methods A, B and C), Charpy impact testing, weldability testing (ASTM A494), ferrite measurement and microstructural evaluations. In the study, the corrosion performances of DSS castings were characterized and assessed, including the wrought counterparts for comparison. The evaluation filled the pore of lack of data for cast duplex stainless steels compared to wrought materials. A database of the pitting corrosion and IGC behavior of cast and wrought materials was generated for a greater depth of understanding for the behavior of cast duplex stainless steel. In addition, improved evaluation methods for DSS castings were developed according to ASTM A923, A262, G48 and A494. The study revealed that when properly heat treated according to the specification, (1) DSS castings have equal or better pitting and intergranular corrosion resistance than their wrought counterparts; (2) Welding reduces the pitting and intergranular corrosion resistance for both the wrought and cast duplex alloys; (3) Castings generally have better toughness than their wrought counterparts in the temperature range of -80 C to +20 C; (4) All shield metal arc (SMA) test welds in DSS castings, with recommended or over matching filler metal, indicate that welding is not a significant factor when considering DSS applications.

Wen, Songqing; Lundin, Carl, W.; Batten, Greg, W.

2005-09-30T23:59:59.000Z

105

Variable residence time vortex combustor  

DOE Patents [OSTI]

A variable residence time vortex combustor including a primary combustion chamber for containing a combustion vortex, and a plurality of louvres peripherally disposed about the primary combustion chamber and longitudinally distributed along its primary axis. The louvres are inclined to impel air about the primary combustion chamber to cool its interior surfaces and to impel air inwardly to assist in driving the combustion vortex in a first rotational direction and to feed combustion in the primary combustion chamber. The vortex combustor also includes a second combustion chamber having a secondary zone and a narrowed waist region in the primary combustion chamber interconnecting the output of the primary combustion chamber with the secondary zone for passing only lower density particles and trapping higher density particles in the combustion vortex in the primary combustion chamber for substantial combustion.

Melconian, Jerry O. (76 Beaver Rd., Reading, MA 01867)

1987-01-01T23:59:59.000Z

106

Resident Professionalism in the Emergency Department  

E-Print Network [OSTI]

Residencies and the Pharmaceutical Industry. Acad Emerg MedPrograms and the Pharmaceutical Industry. Acad Emerg MedPhysicians and the pharmaceutical industry: Is a gift ever

Tokhi, Rizwan; Garmel, Gus M

2006-01-01T23:59:59.000Z

107

Corrosion behavior of a high-chromium duplex stainless steel with minor additions of ruthenium in sulfuric acid  

SciTech Connect (OSTI)

The influence of small ruthenium additions on the corrosion behavior of high-chromium duplex stainless steels (DSS) was studied. Ruthenium additions ({le} 0.28%) increased the corrosion resistance of the base alloy by simultaneously improving hydrogen evolution efficiency and inhibiting anodic dissolution. The corrosion behavior of the high-chromium DSS with small ruthenium additions differed somewhat from behavior of similar duplex alloys of the 22%-Cr type. The lowering of hydrogen overpotential, which promotes an elevated corrosion potential leading to passivity, was much more significant in the 29%-Cr duplex alloys than in the 22%-Cr types.

Potgieter, J.H. [Pretoria Portland Cement, Johannesburg (South Africa). Technical Services Dept.; Brookes, H.C. [Univ. of Natal, Durban (South Africa). Dept. of Chemistry

1995-04-01T23:59:59.000Z

108

Airflow Characteristics of Direct-Type Kitchen Hood Systems in High-Rise Apartment Buildings  

E-Print Network [OSTI]

, Samsung C&T, South Korea 2 Introduction ? Today?s high-rise apartment buildings exhibit high degree of air-tightness. ? They are also subjected to stack effect and seasonal, unpredictable, wind pressure variations. ? Therefore, it is questionable... characteristics for alt0 16 32CMH 0Pa 42CMH 0Pa 74CMH 16Pa 477CMH 984CMH 355CMH 815CMH 173CMH 26Pa 0CMH 0CMH 0CMH 54CMH 0Pa 158CMH 1Pa 35CMH 0Pa 74CMH 18Pa (a)?On?3rd?floor?at?12:00,?Jan?1st 1.5m/s North 50CMH 1Pa 23CMH 0Pa 75CMH 18Pa...

Park, M.

2011-01-01T23:59:59.000Z

109

HollyMcLellan,ColvilleConfederatedTribes Resident Fish Division Native resident fish persisted after  

E-Print Network [OSTI]

HollyMcLellan,ColvilleConfederatedTribes Resident Fish Division Native resident fish persistedMcLellan,ColvilleConfederatedTribes Resident Fish Division Surveys document increase in walleye and decrease in native fish abundance Native fish populations affected Sanpoil: wildkokanee and redband trout populations depressed Columbia

110

Residency Manual Department of Obstetrics and Gynecology  

E-Print Network [OSTI]

Residency Manual Department of Obstetrics and Gynecology American University of Beirut Medical experience and the opportunity to make some lifelong friends. From you, we expect your best efforts and your hardest work. By the end of your residency: You will have begun to understand what it means to practice

Shihadeh, Alan

111

Staff summary of Issues & Recommendations Resident Fish  

E-Print Network [OSTI]

1 Staff summary of Issues & Recommendations Resident Fish *preliminary draft, please refer to full recommendations for complete review 10/29/2013 10:07 AM 2009 Fish and Wildlife Program Section Section D. 7 Title: Resident Fish Mitigation (pg 22-23) Overview Generally, entities recommend that the existing language

112

Duplex stainless steel corrosion behavior during acidification: Laboratory versus field test results  

SciTech Connect (OSTI)

Laboratory tests and field acidizing operations have been conducted on a 25% Cr-140 ksi duplex stainless steel utilizing a 90% HCl 15% + 10% CHs{sub 3}COOH acid mixture inhibited with a commercial package. Laboratory tests proved that the duplex stainless steel can be effectively protected in the adopted experimental conditions at 150 C. Examination of parts of tubings extracted from a real completion showed appreciable corrosion attack only in the sections of the string placed at higher depth (operating temperatures {approximately}130 C): in these cases the estimated rates of corrosion attack can be about one order of magnitude higher than that foreseeable on the basis of laboratory tests. However even in these cases the severity of attack is maintained within acceptable limits.

Cheldi, T.; Obracaj, I. [AGIP S.p.A. CORM, San Donato Milanese (Italy). Corrosion and Materials Technologies Dept.; Cigada, A.; Cabrini, M. [Politecnico di Milano (Italy). Dipt. di Chimica Fisica Applicata; Vicentini, B.; Rondelli, G. [C.N.R.-I.T.M., Milano (Italy)

1995-10-01T23:59:59.000Z

113

Internal friction study of decomposition kinetics of SAF 2507 type duplex stainless steel  

SciTech Connect (OSTI)

During the last decade, super duplex stainless steels (DSSs) with increased nitrogen content have been an object of intensive studies. Present work is devoted to the study of the peculiarities of {delta}-ferrite decomposition in SAF 2507 type duplex steel, and redistribution of nitrogen between ferrite and austenite phases in a wide temperature range by means of internal fraction (IF). Unlike local methods of electron microscopy or engineering methods of hardness or impact toughness testing, which give basically information on the formation of brittle intermetallic phases, the internal friction technique allows to study the state of solid solution and kinetics of changes in the relative amounts of ferrite and austenite phases during thermal treatment.

Smuk, O.; Smuk, S.; Hanninen, H. [Helsinki Univ. of Technology (Finland). Lab. of Engineering Materials] [Helsinki Univ. of Technology (Finland). Lab. of Engineering Materials; Jagodzinski, Yu.; Tarasenko, O. [National Academy of Sciences, Kiev (Ukraine). Inst. for Metal Physics] [National Academy of Sciences, Kiev (Ukraine). Inst. for Metal Physics

1999-01-08T23:59:59.000Z

114

Simulation of the precipitation of sigma phase in duplex stainless steels  

SciTech Connect (OSTI)

The precipitation of sigma phase within the ferrite component of a duplex stainless steel has been simulated using a two-dimensional computer model which takes into account the partitioning of alloy elements between ferrite and austenite. The model is based on a cellular automation and, despite having a rather simple set of transition rules, is able to simulate changes in the volume fractions of the austenite, ferrite, and sigma phases. The microstructures produced are similar in appearance to those in the real system. Comparison of the model and the real system may assist in the assessment of the various phenomena occurring. Use is made of the model to examine many of the factors that might conceivably be harnessed to retard precipitation of the sigma phase in duplex stainless steels.

Cortie, M.B.; Jackson, E.M.L.E.M. [Mintek, Randburg (South Africa). Physical Metallurgy Div.

1997-12-01T23:59:59.000Z

115

Influence of aging on intergranular corrosion of a 25% chromium-5% nickel duplex stainless steel  

SciTech Connect (OSTI)

Although duplex stainless steels (SS) exhibit good performance in many severe corrosive environments, their corrosion resistance can be hampered by precipitation of chromium (Cr)- and molybdenum (Mo)-rich phases during heat treatments. The influence of aging treatments on intergranular corrosion (IGC) of a commercial 25% Cr-5% nickel (Ni) duplex SS (UNS S32550) was studied. The SS was given aging treatments in the range 773 K to 1,173 K for durations from 6 min to 100 h. Microstructure study of the aged samples indicated the presence of various phases, among them [sigma], Cr-rich carbide, secondary austenite, [alpha][prime], and copper (Cu)-rich precipitate. The influence of these precipitated phases on IGC susceptibility of the SS was evaluated by the ferric sulfate (Fe[SO[sub 4

Ravindranath, K.; Malhotra, S.N. (Indian Inst. of Tech., Bombay (India). Dept. of Metallurgical Engineering)

1994-04-01T23:59:59.000Z

116

Corrosion failure of duplex stainless steel equipment in a PVC plant  

SciTech Connect (OSTI)

After <9 months of operation in a polyvinyl chloride (PVC) manufacturing plant, alloy 2205 duplex stainless steel (UNS 31803) columns and spiral heat exchangers (HXs) were corroding and cracking. The columns were repaired and remained in service but the HXs needed to be replaced. Candidate materials for the HXs were assessed, and it was found that the super-austenitic alloys containing 6% molybdenum would be more appropriate for this application.

Davies, M.; Potgieter, G.

2000-05-01T23:59:59.000Z

117

Final Report, Volume 3, Guidance Document for the Evaluation of Cast Super Duplex Stainless Steel  

SciTech Connect (OSTI)

Volume 3 is comprised of the Development of Qualification Standards for Cast Super Duplex Stainless Steel (A890-5A) which is equivalent to wrought 2507. The objective of this work was to determine the suitability of ASTM A923 ???¢????????Standard Test methods for Detecting Detrimental Intermetallic Phase in Duplex Austenitic-Ferritic Stainless Steels???¢??????? for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). The various tests which were carried out were ASTM A923 Test Method A, B and C (Sodium Hydroxide Etch Test, Charpy Impact Test and Ferric Chloride Corrosion Test), ferrite measurement using Feritscope???????®, ASTM E562 Manual Point Count Method and X-Ray Diffraction, hardness measurement using Rockwell B and C and microstructural analysis using SEM and EDS.

Hariharan, Vasudevan; Lundin, Carl, W.

2005-09-30T23:59:59.000Z

118

Duplex-like structures in submarine fan channels, Ouachita Mountains, Arkansas  

SciTech Connect (OSTI)

Submarine fan channel sequences of the Jackfork Formation (Lower Pennsylvanian) at DeGray Dam section in the Ouachita Mountains, Arkansas, contain discrete units (10-75 cm thick) with moderately dipping (25/sup 0/-40/sup 0/), sigmoidal imbricate slices. Adjacent units with opposing imbricate slices are common. The sigmoidal structures are similar in geometry to a tectonic feature known as a duplex. A tectonic origin of sigmoidal structures, however, seems unlikely because opposing directions of imbrication in adjacent units would require an unrealistic tectonic movement history for the area. The authors propose that the Jackfork sigmoidal structures were formed by a process kinematically similar to that responsible for generating duplex structures. Unlike tectonic duplexes, however, the sigmoidal structures were formed by soft-sediment deformation of sand and mud layers as high-energy sediment gravity flows glided over these layers. Sediment gravity flows, responsible for forming the sigmoidal deformation, were probably generated by slumping of adjacent channel walls. Dip direction of sigmoidal slices is perpendicular to channel axes. Thus, recognition of sigmoidal deformation structures may be useful in inferring the trend of channels in ancient submarine fan complexes.

Shanmugam, G.; Moiola, R.J.; Sales, J.K.

1988-03-01T23:59:59.000Z

119

Investigation of the passivity, hydrogen embrittlement and threshold stress of duplex stainless steel  

SciTech Connect (OSTI)

The electrochemical behavior of duplex stainless steel has been studied in various environments. Its passivity state was investigated in borate-buffer using cyclic voltammetry and impedance spectroscopy techniques. The susceptibility towards sulfide stress cracking and hydrogen embrittlement were tested at a constant load under cathodic polarization in the NACE solution saturated with H{sub 2}S and 0.5 M sulfuric acid solution containing As{sub 2}O{sub 3} as a promoter. SEM analysis accompanied these investigations. It is proposed that the highly protective quality of the passive film formed on the investigated duplex stainless steel may be associated with the presence of multiple oxidation rates (Cr{sup 3+} and Cr{sup 6+}) formed in the solid state along with (CrO{sub 4}{sup 2{minus}} and MoO{sub 4}{sup 2{minus}}) anions and the great variety of possible bridging ligand states (OH{sup {minus}}, H{sub 2}O, O{sup 2{minus}}). This leads to a significant degree of bonding flexibility and supports amorphous, i.e., glassy structure of the passive film. Therefore, the stresses that would be associated with epitaxy, are easily alleviated without the creation of long-range defect structures. The investigated duplex stainless steel shows high resistance to hydrogen embrittlement and sulfide stress cracking. The embrittlement index was determined to be 26%, while the threshold stress amounts to 84% of the yield strength.

Gojic, M.; Metikos-Hukovic, M.; Babic, R. [Univ. of Zagreb (Croatia)

1996-12-31T23:59:59.000Z

120

Prevention of crevice corrosion in duplex SS flanges using carbon steel bolts with cathodic protection  

SciTech Connect (OSTI)

Achieving reliable long-term performance of high strength bolts for flange connections in subsea service is a critical issue for the offshore industry. Viable bolting materials with high strength that are not susceptible to embrittlement or galvanic corrosion when the flanges are made of stainless steels are limited. A laboratory study was performed to determine the viability of using B7 carbon steel stud bolts and 316 stainless steel (SS) seal rings in a Duplex SS flange for subsea service The laboratory test system used full size commercial flanges, bolts and seal rings to simulate electrochemical conditions that will occur in crevices associated with carbon steel bolts in a Duplex SS flange and with the use of a 316 stainless steel seal ring in a Duplex SS flange. The flange systems were instrumented to enable monitoring of current densities and potentials at precise locations within the crevices throughout the tests as test parameters were changed. Test parameters included cathodic protection level, temperature, and sealing the outer flange gap. Cathodic protection was provided by remote aluminum sacrificial anodes to achieve potentials typical for a sub sea manifold. Both electrochemical data and examination of the components at the end of the 164 day exposure indicated that sufficient cathodic protection occurred in the crevices to provide long term corrosion control to all of the components involved. The capability to use B7 bolts rather than high alloy bolts enables a significant project savings.

Thomason, W.H.; Ivie, R.G.; Marlow, J.A.

1999-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Development of the use, and approval testing of duplex stainless steel in the chemical industry  

SciTech Connect (OSTI)

The application of duplex stainless steels within ICI began in the early 1970`s. At that time Langley 40V the precursor of Ferralium was being introduced into phosphoric acid production as a pump material, which gave a superior corrosion/erosion resistance compared to 316L in such hostile environments. At the same time the UNS S31500 duplex alloy was being introduced as a tube material not so much for its corrosion resistance, but to give enhanced performance over carbon steel with better resistance to chloride SCC compared with austenitic 300 series type stainless steels. Since then duplex alloys have gained increasing use as the product forms have increased and the alloys have developed. In addition to their resistance to chlorides their good corrosion resistance in difficult chemical environments has been exploited. This has necessitated ensuring that welded structures have a corrosion resistance matching the parent plate. This paper gives examples of some of the applications and the development of a test procedure based on ASTM G-48 to approve the integrity of the welds in a corrosive environment.

Smith, R.F. [ICI, Cleveland (United Kingdom); Pennington, A. [ICI Teesside Operations, Cleveland (United Kingdom)

1994-12-31T23:59:59.000Z

122

STUDY OF AGING EFFECTS IN 2205 DUPLEX STAINLESS STEEL USING THERMOELECTRIC POWER MEASUREMENT  

SciTech Connect (OSTI)

Thermoelectric power (TEP) measurements have been used as an effective method for evaluating the metallurgical state of various alloys. In the steel industry, some fabrication processes promote phase transformation and second phase precipitations which affect the material properties. Assessment of mechanical properties is critical in order to ensure quality of components. This work was conducted in order to evaluate the influence of the aging state of 2205 duplex stainless steel on TEP values. Commercial 2205 duplex steel was isothermally aged at 650 deg. C 700 deg. C and 900 deg. C at different aging times. TEP measurement technique was applied as a non destructive assessment technique to characterize the aging kinetics of the aged 2205 duplex stainless steel, hardness Rockwell (RC) and Charpy impact test were preformed to observe the effect of aging time on the specimens. Metallographic analysis was used to monitor phase transformation and sigma phase precipitation caused by the spinodal decomposition process of ferrite into secondary austenite and sigma phase. Results indicate that that the TEP is sensitive to gradual microstructural changes produced by the aging treatments.

Lara, N.; Ruiz, A.; Carreon, H.; Medina, A. [NDE Group, Instituto de Investigaciones Metalurgicas, UMSNH (Mexico); Sanchez, A. [Department of Mechanical Engineering, UMSNH (Mexico)

2010-02-22T23:59:59.000Z

123

Qualification of large diameter duplex stainless steel girth welds intended for low temperature service  

SciTech Connect (OSTI)

British Gas recently had a requirement to fabricate some UNS31803 duplex stainless steel pipework for an offshore topsides process plant. The pipework had a maximum diameter of 600mm, with a corresponding wall thickness of 18mm, and it was designed to operate at a minimum temperature of {minus}40 C. There is a lack of published toughness data for girth welds in duplex stainless steel at this thickness and minimum design temperature. Additionally, toughness requirements for girth welds in current pipework and pressure vessel codes are based on experience with carbon steels. As a result, a program of work has been carried out to study the Charpy, CTOD and wide plate toughness of girth welds in 22%Cr duplex stainless steel pipework. The welds were produced using a typical gas tungsten arc/gas metal arc pipework fabrication procedure. In addition, non-destructive evaluation trials have been carried out on a deliberately defective weld using radiography and ultrasonics. It was demonstrated that double wall single image {gamma}-radiography, single wall single image and panoramic X-radiography, and conventional shear wave ultrasonics were all able to detect planar root defects varying from 3 to 7mm in depth. There was good agreement between the sizes recorded by ultrasonics and those measured from macrosections. Small scale mechanical tests demonstrated that welds with overmatching tensile properties, and low temperature toughness properties which were acceptable to specification, could be produced. Wide plate tests demonstrated that defect size calculations from BS PD7493 were conservative.

Prosser, K.; Robinson, A.G.; Rogers, P.F.

1996-12-31T23:59:59.000Z

124

Application of electron backscattered diffraction to cleavage fracture in duplex stainless steel  

SciTech Connect (OSTI)

The mechanical properties and corrosion resistance of duplex stainless steel (DSS) are generally superior to conventional austenite or ferrite grades. DSSs can have yield strengths twice the austenite grades, while retaining good ductility and toughness properties. Commercial wrought duplex stainless steels, either plates or rod, are processed by hot rolling followed by a solution annealing treatment to optimize the austenite-ferrite ratio and dissolve any pre-existing secondary phases. Processing may lead to a significant anisotropy in mechanical properties. For example, the tensile properties in cold-rolled sheet of duplex stainless steel (22Cr5Ni) reveals anisotropy of strength, i.e., the transverse direction tensile strength is 7.3% higher than tensile strength in the rolling direction (RD). It was also shown in a study of the effect of crack orientation on the impact properties of the same steel, that when the crack was oriented parallel to the direction of elongation of the austenite phase, the crack could grow along the more brittle ferrite phase for a longer distance before encountering the more ductile austenite. This decreased impact toughness. These are examples of microstructure texture. Crystallographic texture may also have an effect on properties that are related to specific crystallographic planes; such as brittle cleavage and stress corrosion cracking. This paper describes the application of electron backscattered diffraction (EBSD) to study cleavage fracture and crystal texture in age-hardened DSS.

Kim, S.; Marrow, T.J.

1999-05-21T23:59:59.000Z

125

Spatial fractal characteristic of spinodal decomposition in Fe-Cr-Ni duplex stainless steel  

SciTech Connect (OSTI)

Owing to the extensive use of duplex stainless steels in areas like chemical and petrochemical industries, considerable interest has arisen concerning the thermal degradation of these materials during service, and the consequent changes on the mechanical properties. The embrittlement of these steels is basically due to the decomposition of the ferrite phase at elevated temperatures, and duplex steels are seldom used at temperatures above 300 C. Although the microstructure of spinodal decomposition has been studied extensively using atom probe, it is interesting to investigate the development of fractal characteristics in the microstructure during spinodal decomposition. In this paper the authors present part of their recent results in this aspect on a duplex stainless steel. The {alpha} and {alpha}{prime} domains evolved from the primary ferrite phase during spinodal decomposition have different morphologies. The {alpha} (Fe-rich) forms the matrix while the {alpha}{prime} (Cr-rich) domains are developed in the form of discrete regions embedded within the {alpha} matrix. The distribution of these domains follows the fractal-growth characteristics with fractal dimensions ranging from 0.1 to 0.2. In addition, there exists a lower critical dimension beyond which the self-similarity of the domains breaks down.

Shek, C.H.; Wong, K.W.; Lai, J.K.L. [City Univ. of Hong Kong (Hong Kong). Dept. of Physics and Materials Science] [City Univ. of Hong Kong (Hong Kong). Dept. of Physics and Materials Science; Shao, Y.Z. [Zhongshan Univ., Guangzhou (China). Dept. of Physics] [Zhongshan Univ., Guangzhou (China). Dept. of Physics

1997-08-15T23:59:59.000Z

126

Stress corrosion cracking of duplex stainless steel weldments in sour conditions  

SciTech Connect (OSTI)

Duplex stainless steels are widely used in the oil and gas production industry for a variety of applications. The stress corrosion cracking (SCC) behavior of wrought material is reasonably well understood, and usage limitations are placed upon these alloys in NACE MR0175 for sour service. However, the SCC behavior of weldments is not as well understood, limiting use of welded material in H{sub 2}S-containing environments. The SCC resistance of duplex stainless steels is influenced by their microstructure and chemical composition. An investigation of the SCC behavior of welded 22% Cr and 25% Cr alloys in a simulated oilfield environment has been conducted. Mechanized orbital TIG was used to butt weld 168 mm OD tubes. The shielding gas contained nitrogen additions of up to 7% (UNS S32760) and 10% (UNS S31803). Slow strain rate testing (SSRT) was conducted on cross-weld specimens in sodium chloride solutions overpressured with varying partial pressures of H{sub 2}S and CO{sub 2}. Nitrogen uptake from the shielding gas has a detrimental effect on SCC resistance of duplex stainless steel weldments. While this effect is only modest, it is in direct contrast to the beneficial effect it has on pitting corrosion resistance.

Schofield, M.J. [Cortest Labs. Ltd., Sheffield (United Kingdom); Bradshaw, R.; Cottis, R.A. [UMIST, Manchester (United Kingdom). Corrosion and Protection Centre

1996-04-01T23:59:59.000Z

127

Microstructure/property relationships in dissimilar welds between duplex stainless steels and carbon steels  

SciTech Connect (OSTI)

The metallurgical characteristics, toughness and corrosion resistance of dissimilar welds between duplex stainless steel Alloy 2205 and carbon steel A36 have been evaluated. Both duplex stainless steel ER2209 and Ni-based Alloy 625 filler metals were used to join this combination using a multipass, gas tungsten arc welding (GTAW) process. Defect-free welds were made with each filler metal. The toughness of both the 625 and 2209 deposits were acceptable, regardless of heat input. A narrow martensitic region with high hardness was observed along the A36/2209 fusion boundary. A similar region was not observed in welds made with the 625 filler metal. The corrosion resistance of the welds made with 2209 filler metal improved with increasing heat input, probably due to higher levels of austenite and reduced chromium nitride precipitation. Welds made with 625 exhibited severe attack in the root pass, while the bulk of the weld was resistant. This investigation has shown that both filler metals can be used to joint carbon steel to duplex stainless steels, but that special precautions may be necessary in corrosive environments.

Barnhouse, E.J. [Weirton Steel Corp., WV (United States); Lippold, J.C. [Ohio State Univ., Columbus, OH (United States)

1998-12-01T23:59:59.000Z

128

Laboratory testing on welded duplex stainless steel line pipe internal corrosion resistance  

SciTech Connect (OSTI)

Duplex 22% Cr stainless steel (ss) was recommended, at the basic design stage, as the most cost-performing material for intrafield flowlines conveying multiphase sour production from subsea well-heads to production platform. Due to aggressiveness of the production environment [H{sub 2}S partial pressure (pH{sub 2}S) = 14 mbar, CO{sub 2} partial pressure (pCO{sub 2}) = 40 bar, NaCl = 100 g/l, T = 135 C], and partially to the lack of definitive information on the corrosion resistance of welded duplex, some laboratory testing was deemed necessary and performed. The paper presents testing results dealing with localized corrosion and sulfide stress cracking (SSC) resistance of base material and girth-welded seamless tubes 22% Cr duplex, both wrought and centrifugally cast. The last one was considered because of possible procurement difficulties of the first one when required in small quantities and large diameters as in the case of production manifolds. It is concluded that the material can be used in the test environment as girth weld line pipe provided suitable welding technique is adopted.

Condanni, D. [AGIP SpA, Milan (Italy); Barteri, M. [C.S.M., Rome (Italy)

1996-12-01T23:59:59.000Z

129

Application of martensitic, modified martensitic and duplex stainless steel bar stock for completion equipment  

SciTech Connect (OSTI)

Martensitic and duplex stainless steel tubing are commonly used for oil and gas applications containing CO{sub 2}. Completion equipment manufacturing requires use of solid round bar or heavy wall hollows. Material properties for this stock are not identical in all cases. Material properties as well as corrosion characteristics are discussed for 13Cr, 13Cr-5Ni-2Mo and 25Cr alloys. Corrosion testing of modified or Enhanced 13Cr solid bar stock, UNS S41425 and other compositions in H{sub 2}S-Cl{sup {minus}} and pH is reported in coupled and uncoupled condition. Corrosion testing of various super duplex bar stock at various H{sub 2}S-chlorides and temperature in CO{sub 2} environment is reported. Impact value requirements, welding issues and special consideration required for these alloys for completion equipment is discussed. Modified 13Cr and Super Duplex Oil Country Tubular Goods (OCTG) are readily available, however, availability of completion equipment raw material compatible with these OCTG is limited.

Bhavsar, R.B. [CAMCO Products and Services, Houston, TX (United States); Montani, R. [Foroni, S.p.A., Colombo (Italy)

1998-12-31T23:59:59.000Z

130

Influence of sigma-phase formation on the localized corrosion behavior of a duplex stainless steel  

SciTech Connect (OSTI)

Because of their austenitic-ferritic microstructures, duplex stainless steels offer a good combination of mechanical and corrosion resistance properties. However, heat treatments can lower the mechanical strength of these stainless steels as well as render them susceptible to intergranular corrosion (IGC) and pitting corrosion. In this study, a low-carbon (0.02%) duplex stainless steel is subjected to various heat treatments at 450 to 950 C for 30 min to 10 h. The heat-treated samples than undergo ASTM IGC and pitting corrosion tests, and the results are correlated with the microstructures obtained after each heat treatment. In the absence of Cr{sub 23}C{sub 6} precipitation, {sigma}-phase precipitates render this duplex stainless steel susceptible to IGC and pitting corrosion. Even submicroscopic {sigma}-phase precipitates are deleterious for IGC resistance. Longer-duration heat treatments (at 750 to 850 C) induce chromium diffusion to replenish the chromium-depleted regions around the {sigma}-phase precipitates and improve IGC resistance; pitting resistance, however, is not fully restored. Various mechanisms of {sigma}-phase formation are discussed to show that regions adjacent to {sigma}-phase are depleted of chromium and molybdenum. The effect of chemical composition (pitting resistance equivalent) on the pitting resistance of various stainless steels is also noted.

Adhe, K.N.; Kain, V.; Madangopal, K.; Gadiyar, H.S. [Bhabha Atomic Research Centre, Bombay (India). Metallurgy Div.

1996-08-01T23:59:59.000Z

131

Parking & Transportation Department RESIDENT -PERSONAL INFORMATION  

E-Print Network [OSTI]

Parking & Transportation Department RESIDENT - PERSONAL INFORMATION Date know if you are interested in: Public Transportation Car Pool Van Pool _____________________________________________________________________________________ Please be sure to contact the Parking & Transportation Department with any changes to your information, i

Oliver, Douglas L.

132

vol. 176, no. 1 the american naturalist july 2010 Teasing Apart the Many Effects of Lighting Environment  

E-Print Network [OSTI]

vol. 176, no. 1 the american naturalist july 2010 Teasing Apart the Many Effects of Lighting covary with lighting in many taxa. Determining the mechanisms underlying these patterns is dif- ficult because lighting environments can have multiple effects on signaling that occur at multiple timescales

Fuller, Rebecca

133

Better Buildings Program San Jose - Serving Moderate Income Residents...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Program San Jose - Serving Moderate Income Residents Better Buildings Program San Jose - Serving Moderate Income Residents Provides an overview of the program components and goals,...

134

The role of environmental and metallurgical variables on the resistance of duplex stainless steels to sulphide SCC  

SciTech Connect (OSTI)

Duplex and super duplex stainless steels are widely used by the Oil and Gas industry for handling slightly sour process fluids. These alloys have limits, beyond which sulfide stress corrosion cracking (SSCC) is likely. In NACE MR0175 the operating limits of alloys are usually defined by a maximum hardness and an H{sub 2}S limit. For one or two alloys another parameter may also be specified. The present paper has collected together a body of evidence, some of it previously unpublished, to show that the susceptibility to SSCC depends on a number of environmental variables, i.e. temperature, chloride, pH and H{sub 2}S, as well as several metallurgical variables e.g. microstructure and degree of cold work. The data for one alloy, a proprietary super duplex stainless steel, is used to show how these variables inter-relate, and where the alloy may be safely used. The results clearly show that NACE MR0175 is inadequate for specifying the limits of use of a duplex or super duplex stainless steel. The authors suggest that where an alloy is though likely to be useful and the conditions are outside the scope of MR0175, testing as specified in the European Federation of Corrosion document on CRA`s (Publication No. 17), should be carried out.

Francis, R.; Byrne, G.; Warburton, G. [Weir Materials Ltd., Manchester (United Kingdom)

1997-08-01T23:59:59.000Z

135

Roadmap to Residency: From Application to the Match and Beyond  

E-Print Network [OSTI]

Roadmap to Residency: From Application to the Match and Beyond Association of American Medical Colleges Learn Serve Lead #12;Roadmap to Residency: From Application to the Match and Beyond #12;© 2006 with application to U.S. residency programs. iii Roadmap to Residency: From Application to the Match and Beyond

Sherman, S. Murray

136

Roadmap to Residency: From Application to the Match and Beyond  

E-Print Network [OSTI]

Roadmap to Residency: From Application to the Match and Beyond Association of American Medical Colleges Learn Serve Lead Second Edition #12;Roadmap to Residency: From Application to the Match and Beyond in the processes associated with application to U.S. residency programs. iii Roadmap to Residency: From Application

Weber, David J.

137

106 IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 53, NO. 1, JANUARY 2005 Adaptive Duplexer Implemented Using Single-Path  

E-Print Network [OSTI]

of a surface acoustic wave duplexer is introduced, which reduces the noise levels in the receive band have com- bined to result in more pollution of the receive band spectrum with spurious noise signals the performance of the surface acoustic wave (SAW) duplexer over the bandwidth of single receiver channel

York, Robert A.

138

Figure 5.19. Light micrographs showing the microstructure of duplex rolled metal IC381 solution treated at 1300 C for 26 hours and then quenched into  

E-Print Network [OSTI]

of duplex rolled metal IC381 solution treated at 1300 °C for 26 hours and then quenched into water the microstructure of duplex rolled metal IC373 solution treated at 1300 QC for 26 hours amI then quenched into water solution treated at 1300 QC for 26 hours and then quenched into water. The llleasured volullle fraction

Cambridge, University of

139

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction  

DOE Patents [OSTI]

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Mirzabekov, Andrei Darievich (Moscow, RU); Yershov, Gennadiy Moiseyevich (Zelenograd, RU); Guschin, Dmitry Yuryevich (Hinsale, IL); Gemmell, Margaret Anne (Western Springs, IL); Shick, Valentine V. (Moscow, RU); Proudnikov, Dmitri Y. (Samara, RU); Timofeev, Edward N. (Moscow, RU)

2002-01-01T23:59:59.000Z

140

Process for stabilizing dimensions of duplex stainless steels for service at elevated temperatures  

SciTech Connect (OSTI)

Duplex stainless steel materials containing austenite plus delta ferrite, are dimensionally stabilized by heating the material to a reaction temperature between about 1050.degree.-1450.degree. F. (566.degree.-788.degree. C.), holding it at this temperature during transformation of delta ferrite to austenite plus sigma phase, and subsequently heating to a reversion temperature between about 1625.degree.-1750.degree. F. (885.degree.-954.degree. C.), whereby the sigma phase transforms back to ferrite, but the austenite remains dispersed in the ferrite phase. Final controlled cooling permits transformation of ferrite to austenite plus sigma and, later, precipitation of carbides.

Hull, Frederick C. (Pittsburgh, PA); Tobin, John C. (Richland, WA)

1981-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Application of the hydrogen microprint and the microautoradiography techniques to a duplex stainless steel  

SciTech Connect (OSTI)

Hydrogen microprint (HMT) and microautoradiography (HMAT) techniques have been used to study the hydrogen distribution in the microstructure of a duplex stainless steel having a 50/50 austenite/ferrite phase ratio. Both techniques indicated that the austenite/ferrite interphase boundaries and the austenite phase could act as effective hydrogen traps in steel microstructure. The HMT and HMAT results confirm the ideas that the grain boundary diffusivity of hydrogen is concentration-dependent and that the grain boundaries are not high-diffusivity paths for hydrogen.

Yalci, H.K.; Edmonds, D.V. [Univ. of Oxford (United Kingdom). Dept. of Materials] [Univ. of Oxford (United Kingdom). Dept. of Materials

1995-03-01T23:59:59.000Z

142

Effect of 475 C embrittlement on fractal behavior and tensile properties of a duplex stainless steel  

SciTech Connect (OSTI)

The fractal dimension variations of several tension surfaces of a duplex stainless steel broken at room temperature has been studied after several aging treatments performed at 475 C for 1, 2, 6.5, 12, 24, 40, and 120 h. A dimple type of fracture mode was observed for small aging times and transgranular as well as dimple rupture for 24, 40, and 120 h of aging. The higher the time of aging is, the smaller the fractal dimension and the true fracture strain. An expected reduction of the strength with the time of aging was observed.

Hilders, O.A.; Ramos, M.; Pena, N.D. [Central Univ. of Venezuela, Caracas (Venezuela). School of Metallurgical Engineering and Materials Science] [Central Univ. of Venezuela, Caracas (Venezuela). School of Metallurgical Engineering and Materials Science; Saenz, L. [Univ. of Carabobo, Valencia (Venezuela). Dept. of Materials and Fabrication Processes] [Univ. of Carabobo, Valencia (Venezuela). Dept. of Materials and Fabrication Processes

1999-02-01T23:59:59.000Z

143

Gas metal arc welding of duplex stainless steel using flux cored wire  

SciTech Connect (OSTI)

The effect of chemical compositions and welding parameters on pitting corrosion resistance and notch toughness of duplex stainless steel weld metals by FCAW was investigated. And the effect of welding parameters on hot cracking susceptibility of the FCAW weld metals was also studied. Pitting corrosion resistance was improved with the increase of Cr, Mo and N content in the weld metal, and it was also proved that the corrosion resistance was greatly affected by welding heat input. Hot cracking susceptibility of the weld metal was increased with the increase of welding current and welding speed.

Maruyama, T.; Ogawa, T.; Nishiyama, S.; Ushijima, A.; Yamashita, K. [Kobe Steel, Ltd., Fujisawa (Japan)

1994-12-31T23:59:59.000Z

144

DUPLEX: A molecular mechanics program in torsion angle space for computing structures of DNA and RNA  

SciTech Connect (OSTI)

DUPLEX produces energy minimized structures of DNA and RNA of any base sequence for single and double strands. The smallest subunits are deoxydinucleoside monophosphates, and up to 12 residues, single or double stranded can be treated. In addition, it can incorporate NMR derived interproton distances an constraints in the minimizations. Both upper and lower bounds for these distances can be specified. The program has been designed to run on a UNICOS Cray supercomputer, but should run, albeit slowly, on a laboratory computer such as a VAX or a workstation.

Hingerty, B.E.

1992-07-01T23:59:59.000Z

145

FALL 2012, WINTER 2013 UNFURNISHED APARTMENT LICENSE AGREEMENT HOUSING DATES OF OCCUPANCY: You will receive written communication from the Office of Housing  

E-Print Network [OSTI]

Apartments. I acknowledge that I have reviewed the pamphlet entitled "Protect Your Family from Lead in Your will receive written communication from the Office of Housing and Residential Life regarding your approved dates of occupancy based on your requested dates. This Unfurnished Apartment Housing License Agreement

Finley Jr., Russell L.

146

West Virginia University 1 Tuition, Fees & Residency  

E-Print Network [OSTI]

Year's Work The WVU Financial Aid Office provides an estimate of the total cost of attendance for an academic year at financialaid.wvu.edu/tuition-cost-information/ cost-of-attendance. This estimate includesWest Virginia University 1 Tuition, Fees & Residency In this section: Cost: Cost of an Academic

Mohaghegh, Shahab

147

North Carolina State Residence Classification Manual  

E-Print Network [OSTI]

North Carolina State Residence Classification Manual A Manual to Assist the Public Higher Education Employees and Their Families 20 10. The Academic Common Market Program 20 11. Tuition Classification Governing Classification Determinations 12 A. Fundamental Principles of the Law of Domicile 12 1

Thaxton, Christopher S.

148

Observation of a small oligonucleotide duplex by electrospray ionization mass spectrometry  

SciTech Connect (OSTI)

Electrospray ionization (ESI) has been demonstrated to be a soft ionization technique, allowing accurate molecular weight determination for biopolymers due to gas-phase multiple charging. Recent results have demonstrated that noncovalent associations can be preserved upon transfer into the gas phase with ESI, providing a new approach to the determination of both structurally-specific and nonspecific noncovalent associations in solution. The mass spectrometric experimental conditions necessary to preserve such noncovalent associations, and the physical constraints upon such, have yet to be elucidated, although it is clear that gentle interface conditions minimizing internal excitation of noncovalent complexes are helpful. Base-paired oligonucleotide hybridization constitutes one of the most important and thoroughly studied noncovalent associations of biopolymers. Initial attempts to observe duplex oligonucleotides resulted in detection of only the monomeric constituents. Since then, the authors have developed interface conditions that are more gentle and yet still provide sufficient molecular ion desolvation to preserve such associations using new instrumentation with a greatly extended m/z range. In this communication, the authors report the successful ionization of duplex oligonucleotides and the conditions necessary for detection by negative ion ESI-MS. 6 refs., 1 fig.

Light-Wahl, K.J.; Springer, D.L.; Winger, B.E.; Edmonds, C.G.; Thrall, B.D.; Smith, R.D. (Pacific Northwest Lab., Richland, WA (United States)); Camp, D.G. II (Eastern Oregon State College, La Grande (United States))

1993-01-27T23:59:59.000Z

149

Influence of microstructure on the flow behavior of duplex stainless steels at high temperatures  

SciTech Connect (OSTI)

Three kinds of duplex stainless steel, with different ferrite-to-austenite ratios, were deformed in torsion over the temperature range 900 C to 1,200 C; the corresponding microstructural evolution was observed and correlated with the deformation conditions. The shapes of the high-temperature flow curves depend strongly on the volume fractions of the phases, the characteristics of the ferrite-austenite interface, and the active softening mechanism. At low volume fractions of austenite, the mechanical behavior is determined by the ferrite matrix and the flow curves are typical of materials that soften by continuous dynamic recrystallization. When the volume fraction of austenite is increased, coherent {gamma} particles distributed within the grains and at the grain boundaries hinder the deformation of the softer {alpha} matrix, increasing both the yield and the peak stress. These peaked flow curves are characterized by rapid work hardening followed by extensive flow softening; under these conditions, the hard austenite particles become aligned with the deformation direction after large strains. AT high volume fractions of austenite ({approximately}50%), the material tends to form a duplex structure, with the flow curves displaying extended work-hardening and work-softening regions; however, a drastic decrease is observed in ductility because of the dissimilar plastic behaviors of the two phases.

Balancin, O.; Hoffmann, W.A.M.; Jonas, J.J.

2000-05-01T23:59:59.000Z

150

In-Situ Observations of Phase Transformations in the HAZ of 2205 Duplex Stainless Steel Weldments  

SciTech Connect (OSTI)

Ferrite ({delta})/austenite ({gamma}) transformations in the heat affected zone (HAZ) of a gas tungsten arc (GTA) weld in 2205 duplex stainless steel are observed in real-time using spatially resolved X-ray diffraction (SRXRD) with high intensity synchrotron radiation. A map showing the locations of the {delta} and {gamma} phases with respect to the calculated weld pool dimensions has been constructed from a series of SRXRD scans. Regions of liquid, completely transformed {gamma}, a combination of partially transformed {gamma} with untransformed {delta}, and untransformed {delta}+{gamma} are identified. Analysis of each SRXRD pattern provides a semi-quantitative definition of both the {delta}/{gamma} phase balance and the extent of annealing which are mapped for the first time with respect to the calculated weld pool size and shape. A combination of these analyses provides a unique real-time description of the progression of phase transformations in the HAZ. Using these real-time observations, important kinetic information about the transformations occurring in duplex stainless steels during heating and cooling cycles typical of welding can be determined.

Palmer, T A; Elmer, J W; Wong, J

2001-08-15T23:59:59.000Z

151

Effect of ageing on precipitation and impact energy of 2101 economical duplex stainless steel  

SciTech Connect (OSTI)

The impact energy and microstructure of a thermally aged 2101 duplex stainless steel with composition of Fe-21.4Cr-1.2Ni-5.7Mn-0.23 N-0.31Mo were studied. The results showed that the room temperature impact energy of specimens decreased gradually with ageing temperature up to 700 deg. C and then increased with aging over 700 deg. C. The minimum value of impact energy was 37 J after 700 deg. C aging, which was only 34% of that for as-annealed specimens. For specimens aged at 700 deg. C, the room temperature impact energy decreased significantly after 3 min and was halved after 10 min. Fractographs showed that, with increasing aging time, the fracture morphology changed from fibrous fracture to transgranular and intragranular fracture. Scanning electron micrographs revealed that many precipitates were distributed along {alpha}/{gamma} and {alpha}/{alpha} interfaces. The precipitates were extracted and confirmed by X-ray diffraction to be Cr{sub 2}N. Therefore, it can be concluded that precipitation of Cr{sub 2}N is the main reason for the decrease of impact energy in aged 2101 duplex stainless steel.

Zhang Wei [Shanghai Baosteel Technology Center, Baosteel Co., LTD. Shanghai 200431 (China); College of Materials Science and Engineering, Shanghai Jiaotong University, Shanghai 200240 (China); Jiang Laizhu [Shanghai Baosteel Technology Center, Baosteel Co., LTD. Shanghai 200431 (China)], E-mail: zwatt@163.com; Hu Jincheng; Song Hongmei [Shanghai Baosteel Technology Center, Baosteel Co., LTD. Shanghai 200431 (China)

2009-01-15T23:59:59.000Z

152

Fracture mechanics analysis of cast duplex stainless steel elbows containing a surface crack  

SciTech Connect (OSTI)

Some components of the primary loop of a PWR are made of cast duplex stainless steel. This kind of steel may age even at relatively low temperatures, (below 400 C, which is within the temperature range of PWR service conditions), leading to a significant decrease of its toughness. This is why a large research program was initiated on the fracture behavior of aged duplex stainless steel elbows in France. The main task of this program was to test three 2/3-scale models of aged PWR primary loop elbows. The first two tests (called SEM1 and SEM2) were conducted under in-plane closure bending at 320 C; the third (called SEM3) was conducted under constant internal pressure and in-plane closure bending at 60 C. The first two elbows contained a semi-elliptical notch machined into the outer surface of one flank, oriented either longitudinally (SEM1 test) or circumferentially (SEM2 test); the third elbow contained both notches described above, one on each flank. This paper presents the results of the experiments, the finite element calculations and the ductile fracture mechanics analyses that were performed.

Delliou, P.A. le; Semete, P. [Electricite de France, Moret Sur Loing (France). Direction des Etudes et Recherches; Ignaccolo, S. [Electricite de France, Villeurbanne (France). Direction de l`Equipement

1998-12-31T23:59:59.000Z

153

Microstructural and mechanical behavior of a duplex stainless steel under hot working conditions  

SciTech Connect (OSTI)

In the hot deformation of the duplex stainless steels, the complexity of the microstructure evolution and mechanical response is increased as compared with those of single-phase ferritic or austenitic stainless steels. In the present work, plane strain compression and torsion deformation modes have been used to analyze the microstructural evolution and the mechanical behavior of a duplex stainless steel in as-cast and wrought conditions, as a function of spatial phase distribution, the nature of interface, and the relative mechanical properties of both phases. The law of mixtures has been used to explain the different flow curves obtained when changing the phase distribution and/or the deformation mode. On deforming as-cast microstructures, the deformation partitions vary heterogeneously between both phases and some austenite areas act as hard nondeforming particles. Cracks have been observed to occur at the interface of such regions, from relatively low strains, for which the initial Kurdjumov-Sachs orientation relationship between ferrite and austenite is still present.

Iza-Mendia, A. [Centro de Estudios e Investigaciones Tecnicas de Gipuzkoa, San Sebastian (Spain). Dept. of Materials]|[Univ. of Navarra, San Sebastian (Spain); Pinol-Juez, A. [Centro de Estudios e Investigaciones Tecnicas de Gipuzkoa, San Sebastian (Spain). Dept. of Materials; Urcola, J.J.; Gutierrez, I. [Univ. of Navarra, San Sebastian (Spain)

1998-12-01T23:59:59.000Z

154

Microstructural characteristics and corrosion behavior of a super duplex stainless steel casting  

SciTech Connect (OSTI)

The machining of super duplex stainless steel castings is usually complicated by the difficulty involved in maintaining the dimensional tolerances required for given applications. Internal stresses originating from the solidification process and from subsequent heat treatments reach levels that exceed the material's yield strength, promoting plastic strain. Stress relief heat treatments at 520 deg. C for 2 h are an interesting option to solve this problem, but because these materials present a thermodynamically metastable condition, a few precautions should be taken. The main objective of this work was to demonstrate that, after solution annealing at 1130 deg. C and water quenching, stress relief at 520 deg. C for 2 h did not alter the duplex microstructure or impair the pitting corrosion resistance of ASTM A890/A890M Grade 6A steel. This finding was confirmed by microstructural characterization techniques, including light optical and scanning electron microscopy, and X-ray diffraction. Corrosion potential measurements in synthetic sea water containing 20,000 ppm of chloride ions were also conducted at three temperatures: 5 deg. C, 25 deg. C and 60 deg. C.

Martins, Marcelo [Industrial Manager of SULZER BRASIL S/A and Professor of the Sao Paulo Salesian University Center (UNISAL), Americana Division, SP (Brazil)], E-mail: marcelo.martins@sulzer.com; Casteletti, Luiz Carlos [Department of Materials, Aeronautical and Automotive Engineering, Sao Carlos School of Engineering, University of Sao Paulo (USP), Sao Carlos, SP Brazil (Brazil)

2009-02-15T23:59:59.000Z

155

The design, development and performance of a Duplex Stirling natural gas liquefier  

SciTech Connect (OSTI)

The idea of using a Duplex Stirling System for natural gas liquefaction has long been considered by Sunpower as an attractive application for Stirling engines. A few years ago an internally funded project was embarked upon to build a small demonstration Duplex Stirling unit. This machine was designed around the Model M-100 engine which was then being produced commercially. The demonstrator machine first ran in 1979 and soon proved to be a stable and reliable performer. A series of three further machines incorporating various improvements and modifications followed at which point it was confidently felt that the design of a large machine of more realistic capacity could be attempted. Work was started in August 1981 on the design and development of a preproduction natural gas liquefier with a capacity of at least 4 1/hr. The design of the larger machine borrows extensively from the experience gained from the small prototype machines. Scaling, computer simulation and optimization are used to refine the design. Presented here is a summary of the design and development of the preproduction machine.

Berchowitz, D.M.

1982-09-01T23:59:59.000Z

156

On the Impacts and Benefits of Implementing Full-Duplex Communications Links in an Underwater Acoustic Network  

E-Print Network [OSTI]

. These networks may provide command and control for autonomous underwater vehicles, forward reporting by arraysOn the Impacts and Benefits of Implementing Full-Duplex Communications Links in an Underwater of sensor grids, ad hoc communications links to covert forces, or positive control of unmanned, forward

Xie, Geoffrey

157

SH & RL Handyperson advert September 2014 RESIDENCE HANDYPERSON (2 POSTS)  

E-Print Network [OSTI]

with maintenance standard operating procedures Reporting and recording of residence maintenance issues maintenance within the building. Requirements include: Grade 10/relevant equivalent qualification and planned maintenance at residence level Accountability for handling and securing tools in compliance

Jarrett, Thomas H.

158

CAL STATE UNIVERSITY, FULLERTON NON-RESIDENT ALIEN PAYMENT CHECKLIST  

E-Print Network [OSTI]

CAL STATE UNIVERSITY, FULLERTON NON-RESIDENT ALIEN PAYMENT CHECKLIST To be used when making", the individual is not considered a non-resident alien for tax purposes. Process the payment request through receipts* Additional Non-Resident Alien supporting documents needed: Foreign National Information Form

de Lijser, Peter

159

RESIDENT ADVISOR JOB CONTRACT 2013-2014 OFFICE COPY  

E-Print Network [OSTI]

RESIDENT ADVISOR JOB CONTRACT 2013-2014 OFFICE COPY This contract provides information supplemental to that found in the Resident Advisor Job Description. After having reviewed the job description the position of Resident Advisor for the 2013-2014 academic year. In accepting this position I agree to all

Devoto, Stephen H.

160

West Virginia University 1 Tuition, Fees and Residency  

E-Print Network [OSTI]

West Virginia University 1 Tuition, Fees and Residency Page Contents: · Academic Common Market Academic Common Market West Virginia provides its residents the opportunity, through the Academic Common. The programs are restricted to West Virginia residents who have been accepted for admission to one

Mohaghegh, Shahab

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

West Virginia University 1 Tuition, Fees and Residency  

E-Print Network [OSTI]

West Virginia University 1 Tuition, Fees and Residency Page Contents: · Residency Policy · Fee of adoption. Section 2: Classification for Admission and Fee Purposes 1. Students enrolling in a West Virginia status to another public institution in West Virginia. Section 3: Residence Determined by Domicile 1

Mohaghegh, Shahab

162

Long-range, full-duplex, modulated-reflector cell phone for voice/data transmission  

DOE Patents [OSTI]

A long-range communications apparatus utilizing modulated-reflector technology is described. The apparatus includes an energy-transmitting base station and remote units that do not emit radiation in order to communicate with the base station since modulated-reflector technology is used whereby information is attached to an RF carrier wave originating from the base station which is reflected by the remote unit back to the base station. Since the remote unit does not emit radiation, only a low-power power source is required for its operation. Information from the base station is transmitted to the remote unit using a transmitter and receiver, respectively. The range of such a communications system is determined by the properties of a modulated-reflector half-duplex link.

Neagley, Daniel L. (Albuquerque, NM); Briles, Scott D. (Los Alamos, NM); Coates, Don M. (Santa Fe, NM); Freund, Samuel M. (Los Alamos, NM)

2002-01-01T23:59:59.000Z

163

Role of surface finishing on pitting corrosion of a duplex stainless steel in seawater  

SciTech Connect (OSTI)

Localized corrosion of duplex UNS S32550 stainless steel in seawater was investigated in the laboratory and in field trials for several surface finish conditions: polished, ground, and sandblasted. Electrochemical data obtained by polarization curves showed that the smoother, polished surface had better characteristics (higher pitting and protection potentials) than the ground or sandblasted surfaces. However, despite its high degree of roughness, the sandblasted surface was the most resistant in field conditions, exhibiting the lowest number of sites attacked. Internal compressive stresses created by sandblasting seem also to have an unsensitizing effect on sensitized zones that exist in cast steel (due to repairs of mold defects), reducing its susceptibility to microbiologically influenced corrosion (MIC). Such stresses are not generated in polished or ground surfaces, and localized MIC attack can occur.

Salah-Rousset, N.B.; Chaouachi, M.A. [ENIT, Tunis (Tunisia). Lab. of Metallurgy and Materials; Chellouf, A. [STEG, Tunis (Tunisia)

1996-04-01T23:59:59.000Z

164

Direct Observations of Sigma Phase Growth and Dissolution in 2205 Duplex Stainless Steel  

SciTech Connect (OSTI)

The formation and growth of sigma ({sigma}) phase in a 2205 duplex stainless steel is monitored during an 850 C isothermal heat treatment using an in situ synchrotron x-ray diffraction technique. At this temperature, {sigma} phase is first observed within approximately 40 seconds of the start of the isothermal heat treatment and grows rapidly over the course of the 3600 second heat treatment to a volume fraction of approximately 13%. A simultaneous increase in the austenite ({gamma}) volume fraction and a decrease in the ferrite ({delta}) volume fraction are observed. The {sigma} phase formed at this temperature is rapidly dissolved within approximately 200 seconds when the temperature is increased to 1000 C. Accompanying this rapid dissolution of the {sigma} phase, the {delta} and {gamma} volume fractions both approach the balanced (50/50) level observed in the as-received material.

Palmer, T; Elmer, J; Babu, S; Specht, E

2005-06-14T23:59:59.000Z

165

Application of Taguchi method in Nd-YAG laser welding of super duplex stainless steel  

SciTech Connect (OSTI)

This investigation is aimed at achieving a near 50-50 % ferrite-austenite ratio of laser welded super duplex stainless steel, UNS S 32760 (Zeron 100). Bead-on-plate welding has been carried out using a 2 kW Nd-YAG laser with 3 different kinds of wave form, Continuous, Sine and Square wave. The weld metals were examined with respect to the phase volume contents by X-ray diffraction. Laser welding involved a large number of variables, interaction and levels of variables. Taguchi Method was selected and used to reduce the number of experimental conditions and to identify the dominant factors. The optimum combinations of controllable factors were found from each set of wave form. The optimum 40-60% ferrite-austenite ratio were realized on some of the combination parameter groups after using the Parameter Design method.

Yip, W.M.; Man, H.C.; Ip, W.H. [Hong Kong Polytechnic Univ., Kowloon (Hong Kong)

1996-12-31T23:59:59.000Z

166

Influence of thermal cycling on the microstructure of a ferritic-austenitic duplex stainless steel  

SciTech Connect (OSTI)

The influence of thermal cycling without any applied load on the microstructural features of a forged stainless ferritic-austenitic duplex steel was investigated by transmission electron microscopy. The steel was examined in uncycled and cycled conditions. Thermal cycling between 20 C and 900 C did not alter the volume fractions and the anisotropic grain structure of ferrite and austenite. On the other hand, thermal cycling has a strong influence on the dislocation arrangement in both phases. Three different types of precipitate were identified in the uncycled material. The amount of these particles was increased by thermal cycling. There was a strong evidence for the precipitation of {alpha}{prime} particles in the cycled material.

Horvath, W.; Prantl, W.; Werner, E.; Stuewe, H.P. [Montanuniversitat Leoben (Austria). Inst. of Metal Physics] [Montanuniversitat Leoben (Austria). Inst. of Metal Physics

1995-06-01T23:59:59.000Z

167

Effect of temperature and strain rate on cavitation in a superplastic duplex stainless steel  

SciTech Connect (OSTI)

The effect of temperature and strain rate on cavitation during superplastic deformation of a duplex stainless steel has been studied at 1,223 K and 1,253 K for initial strain rates ranging from 2 {times} 10{sup {minus}4} s{sup {minus}1} to 2 {times} 10{sup {minus}3} s{sup {minus}1}. The cavitation was analyzed quantitatively for a specifically developed image processing technique that allows an accurate determination of the volume fraction and size distribution of the voids. The results show that increasing temperature and/or decreasing strain rate cause a more homogeneous deformation of the specimen characterized by a uniform size and distribution of the cavities. The increase of the strain rate results in an increase in cavity volume fraction related to more cavity nucleation and interlinkage. This reflects the lack of accommodation process during the mechanism of grain boundary sliding.

Pulino-Sagradi, D.; Nazar, A.M.M.; Ammann, J.J.; Medrano, R.E. [State Univ. of Campinas, Sao Paulo (Brazil). Dept. of Materials Engineering] [State Univ. of Campinas, Sao Paulo (Brazil). Dept. of Materials Engineering

1997-11-01T23:59:59.000Z

168

Effect of {gamma} phase on corrosive wear of duplex stainless steel in sulfuric acid solution  

SciTech Connect (OSTI)

A modified pin-on-ring device was used to study corrosive wear of a duplex stainless steel (DSS) containing ferrite ({alpha}) and austenite ({gamma}) phases in 1 mol/L sulfuric acid (H{sub 2}SO{sub 4}) at room temperature. Different percentages of {gamma} phase in the matrix ({gamma}{sub p}) were obtained by annealing at different solution temperatures. The corrosive wear resistance of the DSS containing small amounts of {gamma} phase was shown to be greater than that of DSS containing large amounts of {gamma} phase under low loads (< 22 N), but the opposite was true under high loads (> 22 N). The same relationships between corrosive wear rate and load were found under cathodic protection at {minus}600 mV{sub SCE}. The morphologies of wear tracks and debris were observed by scanning electron microscopy (SEM). The influence of the amount of {gamma} phase in the matrix on hardness, corrosion, and corrosive wear resistance was evaluated.

Lu, X.C. [Tsinghua Univ., Beijing (China). National Tribology Lab.; Li, S.Z.; Jiang, X.X.; Zhang, T.C. [Academia Sinica, Shenyang (China). Inst. of Metal Research

1995-06-01T23:59:59.000Z

169

Critical stress for stress corrosion cracking of duplex stainless steel in sour environments  

SciTech Connect (OSTI)

The critical stress for initiation of stress corrosion cracking (SCC) of a duplex stainless steel (DSS) in a sour environment was investigated using three stress application techniques: constant-strain, constant-load, and slow strain rate testing (SSRT). The critical stresses for SCC initiation as determined by detailed observation of the alloy surface after the three tests were in good agreement when a newly proposed index was adopted to express the SSRT results combined with crack observations for each test. The effect of cold work (CW) on SCC and pitting resistance of the DSS also was studied. CW did not accelerate SCC when initiation was controlled by pitting. The critical stress for SCC initiation increased with increasing CW and the resultant increase in yield stress.

Miyasaka, A.; Kanamaru, T. [Nippon Steel Corp., Tokai, Aichi (Japan). Nagoya Research and Development Labs.; Ogawa, H. [Nippon Steel Corp., Futtsu, Chiba (Japan). Steel Research Labs.

1996-08-01T23:59:59.000Z

170

Direct observations of sigma phase growth and dissolution in 2205 duplex stainless steel  

SciTech Connect (OSTI)

The formation and growth of sigma ({sigma}) phase in a 2205 duplex stainless steel is monitored during an 850 C isothermal heat treatment using an in situ synchrotron x-ray diffraction technique. At this temperature, {sigma} phase is first observed within approximately 40 seconds of the start of the isothermal heat treatment and grows rapidly over the course of the 3600 second heat treatment to a volume fraction of approximately 13%. A simultaneous increase in the austenite ({gamma}) volume fraction and a decrease in the ferrite ({delta}) volume fraction are observed. The {sigma} phase formed at this temperature is rapidly dissolved within approximately 200 seconds when the temperature is increased to 1000 C. Accompanying this rapid dissolution of the {sigma} phase, the {delta} and {gamma} volume fractions both approach the balanced (50/50) level observed in the as-received material.

Palmer, T.A.; Elmer, J.W.; Babu, S.S.; Specht, E.D. (LLNL); (ORNL)

2007-10-10T23:59:59.000Z

171

NON RESIDENT ALIEN REQUIRED DOCUMENTS CLASSIFICATION REQUIRED ATTACHEMENTS MUST BE SUBMITTED WITH THE  

E-Print Network [OSTI]

NON RESIDENT ALIEN REQUIRED DOCUMENTS CLASSIFICATION REQUIRED ATTACHEMENTS MUST BE SUBMITTED WITH THE PAYROLL DOCUMENTS AND CITIZENSHIP STATUS FORM Permanent Resident Resident Alien Card, or I-551 Stamped

Adali, Tulay

172

Controlled short residence time coal liquefaction process  

DOE Patents [OSTI]

Normally solid dissolved coal product and a distillate liquid product are produced by continuously passing a feed slurry comprising raw feed coal and a recycle solvent oil and/or slurry together with hydrogen to a preheating-reaction zone (26, alone, or 26 together with 42), the hydrogen pressure in the preheating-reaction zone being at least 1500 psig (105 kg/cm.sup.2), reacting the slurry in the preheating-reaction zone (26, or 26 with 42) at a temperature in the range of between about 455.degree. and about 500.degree. C. to dissolve the coal to form normally liquid coal and normally solid dissolved coal. A total slurry residence time is maintained in the reaction zone ranging from a finite value from about 0 to about 0.2 hour, and reaction effluent is continuously and directly contacted with a quenching fluid (40, 68) to substantially immediately reduce the temperature of the reaction effluent to below 425.degree. C. to substantially inhibit polymerization so that the yield of insoluble organic matter comprises less than 9 weight percent of said feed coal on a moisture-free basis. The reaction is performed under conditions of temperature, hydrogen pressure and residence time such that the quantity of distillate liquid boiling within the range C.sub.5 -455.degree. C. is an amount at least equal to that obtainable by performing the process under the same conditions except for a longer total slurry residence time, e.g., 0.3 hour. Solvent boiling range liquid is separated from the reaction effluent and recycled as process solvent.

Anderson, Raymond P. (Overland Park, KS); Schmalzer, David K. (Englewood, CO); Wright, Charles H. (Overland Park, KS)

1982-05-04T23:59:59.000Z

173

Technologist in Residence Pilot | Department of Energy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security AdministrationcontrollerNanocrystallineForeign ObjectOUR8,MaterialsTechnologist in Residence Pilot

174

TEM microscopical examination of the magnetic domain boundaries in a super duplex austenitic-ferritic stainless steel  

SciTech Connect (OSTI)

It has been demonstrated in an earlier publication that significant improvements in the coercivity, maximum induction and remanence values can be achieved, by using a 2205 type Duplex austenitic-ferritic stainless steel (DSS) instead of the low alloy medium carbon steels currently being used. These improvements are achieved in the as received 2205 material, and after small amounts of cold rolling have been applied, to increase the strength. In addition, the modification of the duplex austenitic-ferritic microstructure, via a heat treatment route, results in a finer austenite `island` dispersion in a ferritic matrix and provides an attractive option for further modification of the magnetic characteristics of the material. However, the 2205 type DSS exhibits {open_quotes}marginal{close_quotes} corrosion protection in a marine environment, so that a study has been undertaken to examine whether the beneficial effects exhibited by the 2205 DSS, are also present in a 2507 type super-DSS.

Fourlaris, G.; Gladman, T. [Univ. of Leeds (United Kingdom); Maylin, M. [Holton Heath, Dorset (United Kingdom)] [and others

1996-12-31T23:59:59.000Z

175

Department of Residence Services 2013 SUMMER RESIDENCE HALL CONTRACT FOR ROOM  

E-Print Network [OSTI]

the age of eighteen (18). A. OFFER Kent State University offers to furnish space, in consideration(s) marked on the application portion of this document. This contract is for space in the residence halls. This contract is issued for the 2013 summer session(s) marked on the application portion, or balance thereof

Khan, Javed I.

176

Department of Residence Services 2011 SUMMER RESIDENCE HALL CONTRACT FOR ROOM  

E-Print Network [OSTI]

the age of eighteen (18). A. OFFER Kent State University offers to furnish space, in consideration(s) marked on the application portion of this document. This contract is for space in the residence halls. This contract is issued for the 2011 summer session(s) marked on the application portion, or balance thereof

Khan, Javed I.

177

A process model for the heat-affected zone microstructure evolution in duplex stainless steel weldments: Part I. The model  

SciTech Connect (OSTI)

The present investigation is concerned with modeling of the microstructure evolution in duplex stainless steels under thermal conditions applicable to welding. The important reactions that have been modeled are the dissolution of austenite during heating, subsequent grain growth in the delta ferrite regime, and finally, the decomposition of the delta ferrite to austenite during cooling. As a starting point, a differential formulation of the underlying diffusion problem is presented, based on the internal-state variable approach. These solutions are later manipulated and expressed in terms of the Scheil integral in the cases where the evolution equation is separable or can be made separable by a simple change of variables. The models have then been applied to describe the heat-affected zone microstructure evolution during both thick-plate and thin-plate welding of three commercial duplex stainless steel grades: 2205, 2304, and 2507. The results may conveniently be presented in the form of novel process diagrams, which display contours of constant delta ferrite grain size along with information about dissolution and reprecipitation of austenite for different combinations of weld input energy and peak temperature. These diagrams are well suited for quantitative readings and illustrate, in a condensed manner, the competition between the different variables that lead to structural changes during welding of duplex stainless steels.

Hemmer, H.; Grong, O.

1999-11-01T23:59:59.000Z

178

Impact of graphite gasket/duplex stainless steel couples on crevice chemistry and likelihood of crevice attack in seawater  

SciTech Connect (OSTI)

Electrochemical polarization measurements have been made on a graphite laminate gasket and a super-duplex stainless steel (DSS) in deaerated IM NaCl solution over a range of pH. The open circuit potential of the graphite is significantly more noble than that of the duplex stainless steel and the kinetics of the hydrogen ion reduction are greater at potentials more positive than about 0.0 V SCE. The data were used as input to a model of crevice chemistry and predictions made for potentials up to +0.4 V SCE. For crevices of parallel plates of DSS-DSS and DSS-Plastic, the usual acidic conditions were predicted but for a DSS-Graphite combination the pH was predicted to be alkaline. The latter is a consequence of the enhanced kinetics for cathodic reduction of hydrogen ions and water on the graphite which, when contained within the crevice, act to elevate the pH. The predictions suggest that coupling to graphite, contained within the crevice, may act to prevent crevice corrosion initiation in contrast to the usual perception of behavior when coupling to more noble materials. In practice, there have been significant crevice corrosion failures of a super-duplex stainless steel associated with graphite gaskets. However, in all cases, the failures were in chlorinated systems for which the corrosion potentials are particularly high and beyond the range for which a benefit from graphite could be anticipated.

Turnbull, A. [National Physical Lab., Teddington (United Kingdom). Centre for Materials Measurement and Technology

1998-12-31T23:59:59.000Z

179

Effect of solution annealing temperature on precipitation in 2205 duplex stainless steel  

SciTech Connect (OSTI)

In the present study, effect of solution annealing temperature (1050 Degree-Sign C and 1100 Degree-Sign C) and isothermal ageing (700 Degree-Sign C: 15 min to 6 h) on the microstructural changes in 2205 duplex stainless steel has been investigated systematically. Scanning electron microscopy and X-ray diffraction were adopted to follow the microstructural evolution, while an energy dispersive spectrometer attached to scanning electron microscope was used to obtain localised chemical information of various phases. The ferritic matrix of the two phase 2205 duplex stainless steel ({approx} 45% ferrite and {approx} 55% austenite) undergoes a series of metallurgical transformations during ageing-formation of secondary austenite ({gamma}{sub 2}) and precipitation of Cr and Mo rich intermetallic (chi-{chi} and sigma-{sigma}) phases. For solution annealing at 1050 Degree-Sign C, significant amount of carbides were observed in the ferrite grains after 1 h of ageing at 700 Degree-Sign C. {chi} Phase precipitated after the precipitation of carbides-preferentially at the ferrite-ferrite and also at the ferrite-austenite boundaries. {sigma} Phase was not observed in significant quantity even after 6 h of ageing. The sequence of precipitation in samples solution annealed at 1050 Degree-Sign C was found to be carbides {yields} {chi} {yields} {sigma}. On the contrary, for samples solution annealed at 1100 Degree-Sign C, the precipitation of {chi} phase was negligible. {chi} Phase precipitated before {sigma} phase, preferentially along the ferrite-ferrite grain boundaries and was later consumed in the {sigma} phase precipitation. The {sigma} phase precipitated via the eutectoid transformation of ferrite to yield secondary austenite {gamma}{sub 2} and {sigma} phase in the ferrite and along the ferrite-austenite grain boundaries. An increase in the volume fraction of {gamma}{sub 2} and {sigma} phase with simultaneous decrease in the ferrite was evidenced with ageing. - Highlights: Black-Right-Pointing-Pointer Effect of solution annealing temperature on microstructural evolution is studied. Black-Right-Pointing-Pointer {chi} Phase precipitated preferentially in the samples solution annealed at 1050 Degree-Sign C. Black-Right-Pointing-Pointer {sigma} Phase precipitated preferentially in the samples solution annealed at 1100 Degree-Sign C. Black-Right-Pointing-Pointer For SA at 1050 Degree-Sign C, the sequence of precipitation was carbides {yields} {chi} phase {yields} {sigma} phase. Black-Right-Pointing-Pointer For SA at 1100 Degree-Sign C, {sigma} phase precipitated via the eutectoid reaction: ferrite (F) {yields} {sigma} + {gamma}{sub 2}.

Kashiwar, A., E-mail: akashiwar@gmail.com [Department of Metallurgical and Materials Engineering, Visvesvaraya National Institute of Technology (VNIT), South Ambazari Road, Nagpur-440010, Maharashtra (India); Vennela, N. Phani, E-mail: phanivennela@gmail.com [Department of Metallurgical and Materials Engineering, Visvesvaraya National Institute of Technology (VNIT), South Ambazari Road, Nagpur-440010, Maharashtra (India); Kamath, S.L., E-mail: kamath@iitb.ac.in [Department of Metallurgical Engineering and Materials Science, Indian Institute of Technology Bombay (IITB), Powai, Mumbai-400076, Maharashtra (India); Khatirkar, R.K., E-mail: rajesh.khatirkar@gmail.com [Department of Metallurgical and Materials Engineering, Visvesvaraya National Institute of Technology (VNIT), South Ambazari Road, Nagpur-440010, Maharashtra (India)

2012-12-15T23:59:59.000Z

180

Pulling Apart Molecular Magnetism  

E-Print Network [OSTI]

A single molecule constitutes the ultimate nanometer-scale object through which electronic transport can take place. Being so small, molecules share many characteristics with atoms, such as discrete quantized energy spectra ...

Jarillo-Herrero, Pablo

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Private Water Well Education for Adult Residents of Oklahoma.  

E-Print Network [OSTI]

??The scope of this study involved an investigation into the education of the adult residents of Oklahoma regarding private water wells. The groundwater supply for (more)

Robbins, Sharon Marie

2012-01-01T23:59:59.000Z

182

The Denver Energy Challenge- Serving Moderate Income Residents  

Broader source: Energy.gov [DOE]

Provides an overview of the Denver Energy Challenge and how services were expanded to moderate income residents including challenges and next steps.

183

Value of Duplex Ultrasound Assistance for Thromboaspiration and Dilation of Thrombosed Native Arterio-Venous Fistulae  

SciTech Connect (OSTI)

Purpose: To evaluate the value of duplex ultrasound assistance during thromboaspiration of thrombosed arteriovenous fistulae for haemodialysis. Materials and Methods: We prospectively studied 54 thrombosed native fistulae (23 with total thrombosis and 31 with partial thrombosis), in which we performed manual thromboaspiration guided by ultrasonography associated with fluoroscopy. Results: The fistulae were located in the forearm (n = 39) or in the upper arm (n = 15) of 46 patients. Mean patient age was 65 years, and hypertension was the most common risk factor (74 %). Mean access age was 928 days (range 69-2,290), and most fistulae were on the left side (41 cases, 75.92 %). The success rate was 83 % in the total thrombosis group and 100 % in the partial thrombosis group. Including initial failures, the respective primary patency rates in the total thrombosis group and the partial thrombosis group were, respectively, 83 {+-} 8 % (n = 20) and 87 {+-} 6 % (n = 28) at 1 month, 39 {+-} 10 % (n = 10) and 61 {+-} 8 % (n = 20) at 6 months, and 17 {+-} 8 % (n = 5) and 26 {+-} 8 % (n = 9) at 1 year. The mean decrease of fluoroscopy time with ultrasound was 3 min (range 1-5). The mean decrease of radiation dose was 2.6 Gy cm Superscript-Two (range 0.9-4.3]. Conclusion: Ultrasound is a feasible and useful tool in the management of thrombosed native fistulae, thus decreasing radiation exposure, and has no detrimental effect on success rates.

Garcia-Medina, J., E-mail: josegmedina57@gmail.com [Reina Sophia University Hospital, Vascular and Interventional Radiology Unit, Department of Radiology (Spain)

2013-12-15T23:59:59.000Z

184

Influence of nitrogen in the shielding gas on corrosion resistance of duplex stainless steel welds  

SciTech Connect (OSTI)

The influence of nitrogen in shielding gas on the corrosion resistance of welds of a duplex stainless steel (grade U-50), obtained by gas tungsten arc (GTA) with filler wire, autogenous GTA (bead-on-plate), electron beam welding (EBW), and microplasma techniques, has been evaluated in chloride solutions at 30 C. Pitting attack has been observed in GTA, electron beam welding, and microplasma welds when welding has been carried out using pure argon as the shielding gas. Gas tungsten arc welding with 5 to 10% nitrogen and 90 to 95% argon, as the shielding gas, has been found to result in an improved pitting corrosion resistance of the weldments of this steel. However, the resistance of pitting of autogenous welds (bead-on-plate) obtained in pure argon as the shielding gas has been observed to remain unaffected. Microscopic examination, electron probe microanalysis (EPMA), and x-ray diffraction studies have revealed that the presence of nitrogen in the shielding gas in the GTA welds not only modifies the microstructure and the austenite to ferrite ratio but also results in a nearly uniform distribution of the various alloying elements, for example, chromium, nickel, and molybdenum among the constituent phases, which are responsible for improved resistance to pitting corrosion.

Bhatt, R.B.; Kamat, H.S.; Ghosal, S.K.; De, P.K.

1999-10-01T23:59:59.000Z

185

Ferrite Measurement in Austenitic and Duplex Stainless Steel Castings - Final Report  

SciTech Connect (OSTI)

The ability to determine ferrite rapidly, accurately and directly on a finished casting, in the solution annealed condition, can enhance the acceptance, save on manufacturing costs and ultimately improve service performance of duplex stainless steel cast products. If the suitability of a non-destructive ferrite determination methodology can be demonstrated for standard industrial measurement instruments, the production of cast secondary standards for calibration of these instruments is a necessity. With these concepts in mind, a series of experiments were carried out to demonstrate, in a non-destructive manner, the proper methodology for determining ferrite content. The literature was reviewed, with regard to measurement techniques and vagaries, an industrial ferrite measurement round-robin was conducted, the effects of casting surface finish, preparation of the casting surface for accurate measurement and the evaluation of suitable means for the production of cast secondary standards for calibration were systematically investigated. The data obtained from this research program provide recommendations to ensure accurate, repeatable, and reproducible ferrite measurement and qualifies the Feritscope for field use on production castings.

Lundin, C.D.; Zhou, G.; Ruprecht, W.

1999-08-01T23:59:59.000Z

186

Passivation and anodic oxidation of duplex TiN coating on stainless steel  

SciTech Connect (OSTI)

The passivation and anodic oxidation of duplex TiN coatings deposited by arc ion plating onto prenitrided AISI 304 stainless steel have been studied by potentiodynamic polarization, electrochemical impedance spectroscopy, and Mott-Schottky measurements in 0.1 M H{sub 2}SO{sub 4} + 0.05 M HCl. The chemical composition of the oxidized surface film atop TiN was analyzed by X-ray photoelectron spectroscopy. Up to 1.2 V/SHE the TiN coating exhibits passive behavior, which is attributed to the formation of a TiO{sub 2}-like film of nanometer thickness which grows linearly with anodic potential at a rate of 2.4 nm/V. Above 1.2 V/SHE enhanced anodic oxidation of TiN is observed at a rate of 17.7 nm/V, and the overall corrosion performance is governed both by the oxidized TiN coating and by a metallic Ti interlayer atop the nitrided stainless steel substrate. At all potentials the TiO{sub 2} film is characterized by relatively high donor densities and is, furthermore, terminated by a hydroxylated surface.

Rudenja, S.; Pan, J.; Wallinder, I.O.; Leygraf, C.; Kulu, P.

1999-11-01T23:59:59.000Z

187

Effect of temperature and pH on cavitation erosion of super duplex stainless steel  

SciTech Connect (OSTI)

Cavitation erosion characteristics of super duplex stainless steel (S32760) and austenitic stainless steel (S30400) in 3.5% NaCl solution with controlled temperature and pH value in the range of 10 to 70 C and pH 3 to 11 have been studied by means of a 20kHz ultrasonic vibrator at a peak to peak amplitude of 50 {micro}m. The erosion resistance of other stainless steels including S31803 and S31603 was also investigated for comparison purpose. Plots of cumulative erosion mass loss per unit area versus temperature for S32760 and S30400 indicate that the degree of erosion initially increases as the temperature increases from 10 C to 50 C and passes through a maximum at about 50 C and then decreases with further increase in temperature to 70 C. Results of cumulative erosion versus pH indicate that the degree of erosion of S32760 is more sensitive to pH value than that of S30400 at 23 C.

Kwok, C.T.; Man, H.C.; Leung, L.K. [Hong Kong Polytechnic Univ., Kowloon (Hong Kong)

1996-10-01T23:59:59.000Z

188

Synchrotron Based Observations of Sigma Phase Formation and Dissolution in Duplex Stainless Steel  

SciTech Connect (OSTI)

The formation and growth of sigma ({sigma}) phase in 2205 duplex stainless steel was observed and measured in real time using synchrotron radiation during isothermal heat treating at temperatures between 700 C and 850 C. Synchrotron experiments were performed on this material at the Advanced Photon Source (APS) while isothermally holding the samples for times of up to 10 hr. During the isothermal hold, sigma formed in quantities up to 22% as the ferrite transformed to a mixture of sigma and austenite phases. In addition, sigma formed at 850 C was heated to 1000 C to observe its dissolution. The amounts of sigma that formed, and the dissolution temperature of sigma were compared to the results predicted by Thermocalc, showing differences between the calculated and measured values. The synchrotron data was further modeled using a modified Johnson-Mehl-Avrami analysis to determine kinetic parameters for sigma formation. The initial JMA exponent, n, at low fractions of sigma was found to be approximately 7.0, however, towards the end of the transformation, n decreased to values of approximately 0.75. Because of the variable value of n, it was not possible to determine reliable values for the activation energy and pre-exponential terms for the JMA equation. During cooling to room temperature, the high temperature austenite partially transformed to ferrite, substantially increasing the ferrite content while the sigma phase kept its high temperature value.

Elmer, J; Palmer, T; Specht, E

2006-08-22T23:59:59.000Z

189

Duplex stainless steel fracture surface analysis using X-ray fractography  

SciTech Connect (OSTI)

The fatigue fracture surface of a duplex stainless steel was analyzed using x-ray fractography. A lower than average austenite content was observed at the fracture surface due to the transformation of austenite into deformation-induced martensite. The influence of fatigue cycling on the transformation was confined to a depth of about 30 {micro}m below the fracture surface. X-ray analyses of both the ferrite-martensite and the austenite phases indicated residual stresses ({sigma}{sub r}) increasing with depth from the fracture surface and reaching a maximum some tens of microns below the fracture surface. The lower {sigma}{sub r} observed at the fracture surface has been attributed to the stress relaxation effects caused by the new fracture surfaces created in the crack growth process. The observed decrease in full width at half maximum (FWHM) in the ferrite-martensite phase was presumed to be due to the dynamic recovery effect that was likely to occur within the material close to the crack tip as a consequence of fatigue cycling.

Rajanna, K.; Pathiraj, B.; Kolster, B.H. [Foundation for Advanced Metals Science, Hengelo (Netherlands)

1997-02-01T23:59:59.000Z

190

SnO2:F Coated Duplex Stainless Steel for PEM Fuel Cell Bipolar Plates  

SciTech Connect (OSTI)

Duplex 2205 stainless steel was deposited with 0.6 {micro}m thick SnO2:F coating; coated steel was characterized for PEMFC bipolar plate application. Compared with bare alloy, interfacial contact resistance (ICR) values of the coated 2205 steel are higher. SnO2:F coating adds its own resistance to the air-formed film on the steel. In a PEMFC anode environment, a current peak of ca. 25 {micro}A/cm2 registered at ca. 30 min for coated 2205 steel. It stabilized at ca. 2.0 {approx} -1.0 {micro}A/cm2. This peak is related to the complicated process of coating dissolution and oxide-layer formation. Anodic-cathodic current transfer occurred at ca. 200 min polarization. In a PEMFC cathode environment, current was stable immediately after polarization. The stable current was ca. 0.5 {approx} 2.0 {micro}A/cm2 during the entire polarization period. AES depth profiles with tested samples and ICP analysis with the tested solutions confirmed the excellent corrosion resistance of the SnO2:F coated 2205 alloy in simulated PEMFC environments.

Wang, H.; Turner, J. A.

2008-01-01T23:59:59.000Z

191

Evolution of the residual stress state in a duplex stainless steel during loading  

SciTech Connect (OSTI)

The evolution of micro- and macrostresses in a duplex stainless steel during loading has been investigated in situ by X-ray diffraction. A 1.5 mm cold-rolled sheet of alloy SAF 2304 solution treated at 1,050 C was studied. Owing to differences in the coefficient of thermal expansion between the two phases, compressive residual microstresses were found in the ferritic phase and balancing tensile microstresses in the austenitic phase. The initial microstresses were almost two times higher in the transverse direction compared to the rolling direction. During loading the microstresses increase in the macroscopic elastic regime but start to decrease slightly with increasing load in the macroscopic plastic regime. For instance, the microstresses along the rolling direction in the austenite increase from 60 MPa, at zero applied load, to 110 MPa, at an applied load of 530 MPa. At the applied load of 620 MPa a decrease of the microstress to 90 MPa was observed. During unloading from the plastic regime the microstresses increase by approximately 35 MPa in the direction of applied load but remain constant in the other directions. The initial stress state influences the stress evolution and even after 2.5% plastic strain the main contribution to the microstresses originates from the initial thermal stresses. Finite element simulations show stress variations within one phase and a strong influence of both the elastic and plastic anisotropy of the individual phases on the simulated stress state.

Johansson, J.; Oden, M.; Zheng, X.H. (Linkoeping Univ. (Sweden). Div. of Engineering Materials)

1999-07-09T23:59:59.000Z

192

The effect of the microstructure on the superplasticity of a duplex stainless steel  

SciTech Connect (OSTI)

The aim of this work is to study the effect of the microstructure on the superplasticity of 22% Cr-5% Ni-3% Mo-0.18% N ferrite ({alpha})-austenite ({gamma}) duplex stainless steel. To obtain different microstructures several thermo-mechanical treatments were employed. Superplasticity was evaluated at 1,253 K by m-value measurements, elongation to failure, deformation homogeneity, and changes in microstructure after tensile tests. A maximum elongation of 1510% was reached with an initial strain rate of 3 {times} 10{sup {minus}4}/s. For this condition, the m-value attained 0.64 and necking was not verified. Higher degrees of superplasticity are obtained when the initial microstructure of the material is fine and homogeneous. Such microstructure can be obtained by a solution treatment in the {alpha}-single phase field, followed by a heavy cold rolling operation and a new solution treatment in the {alpha}/{gamma} dual phase field. The precipitation of {sigma}-phase during superplastic deformation promotes cavitation and decreases the deformation homogeneity and the elongation to failure.

Sagradi, M.; Pulino-Sagradi, D.; Medrano, R.E. [Univ. Estadual de Campinas, Sao Paulo (Brazil)] [Univ. Estadual de Campinas, Sao Paulo (Brazil)

1998-07-01T23:59:59.000Z

193

Synchrotron Based Observations of Sigma Phase Formation and Dissolution in Duplex Stainless Steel  

SciTech Connect (OSTI)

The formation and growth of sigma ({sigma}) phase in 2205 duplex stainless steel was observed and measured in real time using synchrotron radiation during isothermal heat treating at temperatures between 700 C and 850 C. Synchrotron experiments were performed on this material at the Advanced Photon Source (APS) while isothermally holding the samples for times of up to 10 hr. During the isothermal hold, sigma formed in quantities up to 22% as the ferrite transformed to a mixture of sigma and austenite phases. In addition, sigma formed at 850 C was heated to 1000 C to observe its dissolution. The amounts of sigma that formed, and the dissolution temperature of sigma were compared to the results predicted by Thermocalc, showing differences between the calculated and measured values. The synchrotron data was further modeled using a modified Johnson-Mehl-Avrami analysis to determine kinetic parameters for sigma formation. The initial JMA exponent, n, at low fractions of sigma was found to be approximately 7.0, however, towards the end of the transformation, n decreased to values of approximately 0.75. Because of the variable value of n, it was not possible to determine reliable values for the activation energy and pre-exponential terms for the JMA equation. During cooling to room temperature, the high temperature austenite partially transformed to ferrite, substantially increasing the ferrite content while the sigma phase kept its high temperature value.

Elmer, J. W. [Lawrence Livermore National Laboratory (LLNL); Palmer, T. A. [Lawrence Livermore National Laboratory (LLNL); Specht, Eliot D [ORNL

2007-01-01T23:59:59.000Z

194

Phase transformation and mechanical behavior in annealed 2205 duplex stainless steel welds  

SciTech Connect (OSTI)

The phase transformations and mechanical behaviour during welding and subsequent annealing treatment of 2205 duplex stainless steel have been investigated. Detailed microstructural examination showed the presence of higher ferrite amounts in the heat affected zone (HAZ), while higher amounts of austenite were recorded in the centre region of the weld metal. Annealing treatments in the temperature range of 800-1000 deg. C resulted in a precipitation of {sigma} phase and M{sub 23}C{sub 6} chromium carbides at the {gamma}/{delta} interfaces that were found to be preferential precipitation sites. Above 1050 deg. C, the volume fraction of {delta} ferrite increases with annealing temperature. The increase of {delta} ferrite occurs at a faster rate in the HAZ than in the base metal and fusion zone. Optimal mechanical properties and an acceptable ferrite/austenite ratio throughout the weld regions corresponds to annealing at 1050 deg. C. Fractographic examinations showed that the mode of failure changed from quasi-cleavage fracture to dimple rupture with an increase in the annealing temperature from 850 to 1050 deg. C.

Badji, Riad [LPMTM-CNRS- Universite Paris 13, 99, av. J.B. Clement, 93430 Villetaneuse (France)], E-mail: riadbadji1@yahoo.fr; Bouabdallah, Mabrouk [Ecole Nationale Polytechnique, 10, Avenue Hassan Badi, BP 182, El Harrach (Algeria); Bacroix, Brigitte; Kahloun, Charlie [LPMTM-CNRS- Universite Paris 13, 99, av. J.B. Clement, 93430 Villetaneuse (France); Belkessa, Brahim; Maza, Halim [Welding and NDT research Centre, B.P 64, Cheraga (Algeria)

2008-04-15T23:59:59.000Z

195

University of Michigan Medical School 2010 Residency Match Results  

E-Print Network [OSTI]

University of Michigan Medical School 2010 Residency Match Results Name Institution SpecialtyGaw/NMH/VA-IL Surgery-Preliminary Northwestern University Feinberg School Urological Surgery Michyla Bowerson Michigan-VT Pediatrics #12;University of Michigan Medical School 2010 Residency Match Results Name Institution Specialty

Shyy, Wei

196

First-year Residency Responsible Administrative Unit: Requirement Policy  

E-Print Network [OSTI]

positively influences students' overall educational experiences, and supports their total success and growth shall supersede the conditions of an existing fully executed residence hall contract, including all conditions for terminating the contract. Page 1 of 2 #12;First-year Residency Responsible Administrative Unit

197

CLEAN CAST STEEL TECHNOLOGY: DETERMINATION OF TRANSFORMATION DIAGRAMS FOR DUPLEX STAINLESS STEEL.  

SciTech Connect (OSTI)

Duplex stainless steels (DSS) constitute both ferrite and austenite as a matrix. Such a microstructure confers a high corrosion resistance with favorable mechanical properties. However, intermetallic phases such as sigma (???????????????¯??????????????????????????????³) and chi (???????????????¯??????????????????????????????£) can also form during casting or high-temperature processing and can degrade the properties of the DSS. This research was initiated to develop time-temperature-transformation (TTT) and continuous-cooling- transformation (CCT) diagrams of two types of cast duplex stainless steels, CD3MN (Fe 22Cr-5Ni-Mo-N) and CD3MWCuN (Fe-25Cr-7Ni-Mo-W-Cu-N), in order to understand the time and temperature ranges for intermetallic phase formation. The alloys were heat treated isothermally or under controlled cooling conditions and then characterized using conventional metallographic methods that included tint etching, and also using electron microscopy (SEM, TEM) and wavelength dispersive spectroscopy (WDS). The kinetics of intermetallic-phase (???????????????¯??????????????????????????????³ + ???????????????¯??????????????????????????????£) formation were analyzed using the Johnson-Mehl-Avrami (JMA) equation in the case of isothermal transformations and a modified form of this equation in the case of continuous cooling transformations, The rate of intermetallic-phase formation was found to be much faster in CD3MWCuN than CD3MN due mainly to differences in the major alloying contents such as Cr, Ni and Mo. To examine in more detail the effects of these elements of the phase stabilities, a series of eight steel castings was designed with the Cr, Ni and Mo contents systematically varied with respect to the nominal composition of CD3MN. The effects of varying the contents of alloying additions on the formation of intermetallic phases were also studied computationally using the commercial thermodynamic software package, Thermo-Calc. In general, ???????????????¯??????????????????????????????³ was stabilized with increasing Cr addition and by increasing Mo addition. However, a delicate balance among Ni and other minor elements such as N and Si also exists. Phase equilibria in DSS can be affected by local composition fluctuations in the cast alloy. This may cause discrepancy between thermodynamic prediction and experimental observation.

Chumbley. L., S.

2005-09-18T23:59:59.000Z

198

Evaluation of Oxidation and Hydrogen Permeation of Al Containing Duplex Stainless Steels  

SciTech Connect (OSTI)

As the National Hydrogen Economy continues to develop and evolve the need for structural materials that can resist hydrogen assisted degradation will become critical. To date austenitic stainless steel materials have been shown to be mildly susceptible to hydrogen attack which results in lower mechanical and fracture strengths. As a result, hydrogen permeation barrier coatings are typically applied to these steel to retard hydrogen ingress. The focal point of the reported work was to evaluate the potential for intentional alloying of commercial 300-series stainless steels to promote hydrogen permeation resistant oxide scales. Previous research on the Cr- and Fe-oxide scales inherent to 300-series stainless steels has proven to be inconsistent in effecting permeation resistance. The approach undertaken in this research was to add aluminum to the 300-series stainless steels in an attempt to promote a pure Al-oxide or and Al-rich oxide scale. Aloxide had been previously demonstrated to be an effective hydrogen permeation barrier. Results for 304L and 347H alloys doped with Al in concentration from 0.5-3.0 wt% with respect to oxidation kinetic studies, cyclic oxidation and characterization of the oxide scale chemistry are reported herein. Gaseous hydrogen permeation testing of the Al-doped alloys in both the unoxidized and oxidized (600 C, 30 mins) conditions are reported. A critical finding from this work is that at concentration as low as 0.5 wt% Al, the Al stabilizes the ferrite phase in these steels thus producing duplex austenitic-ferritic microstructures. As the Al-content increases the amount of measured ferrite increases thus resulting in hydrogen permeabilities more closely resembling ferritic steels.

Adams, Thad M.; Korinko, Paul; Duncan, Andrew

2005-06-17T23:59:59.000Z

199

In-Situ Observations of Sigma Phase Dissolution in 2205 Duplex Stainless Steel using Synchrotron X-Ray Diffraction  

SciTech Connect (OSTI)

Synchrotron radiation was used to directly observe the transformation of ferrite, austenite and sigma phases during heating and cooling of 2205 duplex stainless steel. Sigma formed during the initial stages of heating, dissolved as the temperature was increased, and reformed on cooling. The dissolution temperature of sigma was measured to be 985 C {+-} 2.8 C at a heating rate of 0.25 C/s, and the kinetics of sigma formation at 850 C was determined to be slower after dissolving at 1000 C than before.

Elmer, J; Palmer, T; Specht, E

2006-08-08T23:59:59.000Z

200

In-Situ Observations of Sigma Phase Dissolution in 2205 Duplex Stainless Steel Using Synchrotron X-Ray Diffraction  

SciTech Connect (OSTI)

Synchrotron radiation was used to directly observe the transformation of ferrite, austenite and sigma phases during heating and cooling of 2205 duplex stainless steel. Sigma formed during the initial stages of heating, dissolved as the temperature was increased, and reformed on cooling. The dissolution temperature of sigma was measured to be 985 2.8 C at a heating rate of 0.25 C/s, and the kinetics of sigma formation at 850 Cwas determined to be slower after dissolving at 1000 C than before.

Elmer, J. W. [Lawrence Livermore National Laboratory (LLNL); Palmer, T. A. [Lawrence Livermore National Laboratory (LLNL); Specht, Eliot D [ORNL

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Duplex Stirling gas-fired heat pump. Phase 2. Breadboard demonstration. Final report, May 1981-November 1982  

SciTech Connect (OSTI)

This program represents the first attempt to design, fabricate, and test a breadboard gas-fired duplex Stirling heat pump in a heating only mode. The system was designed to obtain a COP of 1.5 at an ambient temperature of 17F and have an output sufficient for an average residential home. The design methodology, detailed system description and test results for sub components and the entire system are discussed. Technical problems encountered in the program, and recommendations for further efforts are detailed.

Gedeon, D.; Penswick, B.; Beale, W.

1982-11-01T23:59:59.000Z

202

Effect of aging on impact properties of ASTM A890 Grade 1C super duplex stainless steel  

SciTech Connect (OSTI)

Super duplex stainless steels in the solution annealed condition are thermodynamically metastable systems which, when exposed to heat, present a strong tendency to 'seek' the most favorable thermodynamic condition. The main purpose of this study was to characterize the microstructure of a super duplex stainless steel in the as cast and solution annealed conditions, and to determine the influence of aging heat treatments on its impact strength, based on Charpy impact tests applied to V-notched test specimens. The sigma phase was found to begin precipitating at heat treatment temperatures above 760 deg. C and to dissolve completely only above 1040 deg. C, with the highest peak concentration of this phase appearing at close to 850 deg. C. Heat treatments conducted at temperatures of 580 deg. C to 740 deg. C led to a reduction of the energy absorbed in the Charpy impact test in response to the precipitation of a particulate phase with particle sizes ranging from 0.5 {mu}m to 1.0 {mu}m, with a chromium and iron-rich chemical composition.

Martins, Marcelo [Industrial Manager of SULZER BRASIL S/A and Professor of the Centro Universitario Salesiano de Sao Paulo (UNISAL) at Americana, SP (Brazil)], E-mail: marcelo.martins@sulzer.com; Forti, Leonardo Rodrigues Nogueira [Materials Engineer at UFSCar, Federal University of Sao Carlos (Brazil)], E-mail: leornf@yahoo.com.br

2008-02-15T23:59:59.000Z

203

Detection of secondary phases in duplex stainless steel by magnetic force microscopy and scanning Kelvin probe force microscopy  

SciTech Connect (OSTI)

The secondary phase transformations in a commercial super duplex stainless steel were investigated by micro-chemical analyses and high resolution scanning probe microscopy. Energy dispersive X-ray and electron probe detected ferrite and austenite as well as secondary phases in unetched aged duplex stainless steel type 25Cr-7Ni-3Mo. Volta potential indicated that nitride and sigma appeared more active than ferrite, while secondary austenite and austenite presented a nobler potential. Reversal order in nobility is thought to be attributable to the potential ranking provided by oxide nature diversity as a result of secondary phase surface compositions on steel. After eutectoid transformation, secondary austenite was detected by electron probe microanalysis, whereas atomic force microscopy distinguished this phase from former austenite by image contrast. Magnetic force microscopy revealed a ghosted effect on the latter microstructure probably derived from metal memory reminiscence of mechanical polishing at passivity and long range magnetic forces of ferrite phase. - Highlights: Nobility detection of secondary phases by SKPFM in DSS particles is not a straightforward procedure. As Volta potential and contrast are not always consistent SKPFM surface oxides is thought played an important role in detection. AFM distinguished secondary austenite from former austenite by image contrast though SEM required EPMA.

Ramrez-Salgado, J. [Instituto Mexicano del Petrleo, Direccin de Investigacin y Posgrado, Eje Central Norte Lzaro Crdenas, No. 152, 07730 D.F., Mxico (Mexico); Domnguez-Aguilar, M.A., E-mail: madoming@imp.mx [Instituto Mexicano del Petrleo, Direccin de Investigacin y Posgrado, Eje Central Norte Lzaro Crdenas, No. 152, 07730 D.F., Mxico (Mexico); Castro-Domnguez, B. [University of Tokyo, Department of Chemical System Engineering, Faculty of Engineering Bldg. 5, 7F 722, 7-3-1 Hongo, Bunkyo-ku, Tokyo 1138656 (Japan); Hernndez-Hernndez, P. [Instituto Mexicano del Petrleo, Direccin de Investigacin y Posgrado, Eje Central Norte Lzaro Crdenas, No. 152, 07730 D.F., Mxico (Mexico); Newman, R.C. [University of Toronto, Department of Chemical Engineering and Applied Chemistry, 200 College Street, Toronto M5S 3E5 (Canada)

2013-12-15T23:59:59.000Z

204

Effects of loading mode on the critical cracking potential of duplex ([alpha] + [gamma]) stainless steel in a hot chloride solution  

SciTech Connect (OSTI)

One of the common characteristics in stress corrosion cracking (SCC) between austenitic and ferritic stainless steels in chloride environments is that cracking occurs at potentials noble to a critical value which has been designated as the critical cracking potential, E[sub cc]. For austenitic stainless steels, E[sub cc] is insensitive to prior cold work with or without the generation of martensite and has been interpreted as the minimum potential for crack propagation. On the other hand, for low interstitial ferritic stainless steels., E[sub cc] is extremely sensitive to microstructural variations induced by small amounts of cold work or grain coarsening. It has been demonstrated that E[sub cc] for the low interstitial ferritic stainless steels, when it is measured at constant load, is that for crack initiation and is determined by the competing rates of generation of a new surface by slip induced film breakdown and repassivation. However, the physical and/or electrochemical meaning for E[sub cc] of duplex stainless steels has not yet been studied. It is the purpose of this work to determine if E[sub cc] for duplex stainless is a potential for crack initiation or one for crack propagation in a hot chloride environment and to examine the effects of loading modes on the E[sub cc] of these alloys.

Kwon, Hyuk Sang (Korea Advanced Inst. of Science and Tech., Taejon (Korea, Republic of))

1993-08-01T23:59:59.000Z

205

Kentucky Residents Cash in on Rebate Program | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Program Kentucky Residents Cash in on Rebate Program September 9, 2010 - 6:30pm Addthis Air-conditioning units are just one of 16 appliances that the Kentucky Appliance Rebate...

206

West Nile virus transmission in resident birds, Dominican Republic  

E-Print Network [OSTI]

We report West Nile virus (WNV) activity in the Dominican Republic for the first time. Specific anti-WNV antibodies were detected in 5 (15%) of 33 resident birds sampled at one location in November 2002. One seropositive bird ...

Komar, Oliver; Robbins, Mark B.; Klenk, Kaci; Blitvich, Bradley J.; Marlenee, Nicole L.; Burkhalter, Kristen L.; Gubler, Duane J.; Gonzá lvez, Guillermo; Peñ a, Carlos J.; Peterson, A. Townsend; Komar, Nicholas

2003-10-01T23:59:59.000Z

207

Growing Up in Scotland: Year 3 - Non-resident Parents  

E-Print Network [OSTI]

This report uses data from the Growing Up in Scotland study (GUS) to explore the prevalence of, and many issues related to, non-resident parenthood in Scotland specifically in relation to young and very young children. ...

Marryat, Louise; Reid, Susan; Wasoff, Fran

2009-01-21T23:59:59.000Z

208

In-Training Practice Patterns of Combined Emergency Medicine/Internal Medicine Residents, 2003-2007  

E-Print Network [OSTI]

medicine residents during training. Ann Int Med. 2006;145:et al Table 3. Perceived training deficits of current (2008)specialty elective training during residency Administrative

Kessler, Chad S; Gonzalez, Andrew A; Stallings, Leonard A; Templeman, Todd A

2011-01-01T23:59:59.000Z

209

E-Print Network 3.0 - address residence address Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 FORM 1: Application for an Appeal of Eviction Decision by University of Saskatchewan Residences Summary: : Room and Hall in Residence: University of Saskatchewan e-mail...

210

Final Report, Volume 2, The Development of Qualification Standards for Cast Duplex Stainless Steel  

SciTech Connect (OSTI)

The scope of testing cast Duplex Stainless Steel (DSS) required testing to several ASTM specifications, while formulating and conducting industry round robin tests to verify and study the reproducibility of the results. ASTM E562 (Standard Test Method for Determining Volume Fraction by Systematic manual Point Count) and ASTM A923 (Standard Test Methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic/Ferritic Stainless Steels) were the specifications utilized in conducting this work. An ASTM E562 industry round robin, ASTM A923 applicability study, ASTM A923 industry round robin, and an ASTM A923 study of the effectiveness of existing foundry solution annealing procedures for producing cast DSS without intermetallic phases were implemented. In the ASTM E562 study, 5 samples were extracted from various cast austenitic and DSS in order to have varying amounts of ferrite. Each sample was metallographically prepared by UT and sent to each of 8 participants for volume fraction of ferrite measurements. Volume fraction of ferrite was measured using manual point count per ASTM E562. FN was measured from the Feritescope{reg_sign} and converted to volume fraction of ferrite. Results indicate that ASTM E562 is applicable to DSS and the results have excellent lab-to-lab reproducibility. Also, volume fraction of ferrite conversions from the FN measured by the Feritescope{reg_sign} were similar to volume fraction of ferrite measured per ASTM E562. In the ASTM A923 applicability to cast DSS study, 8 different heat treatments were performed on 3 lots of ASTM A890-4A (CD3MN) castings and 1 lot of 2205 wrought DSS. The heat treatments were selected to produce a wide range of cooling rates and hold times in order to study the suitability of ASTM A923 to the response of varying amounts on intermetallic phases [117]. The test parameters were identical to those used to develop ASTM A923 for wrought DSS. Charpy V-notch impact samples were extracted from the castings and wrought DSS and tested per ASTM A923 method B (Charpy impact test). Method A (sodium hydroxide etch test) was performed on one half of a fractured Charpy V-notch impact sample and Method C (ferric chloride corrosion weight loss test) was performed on another half. Test results for the three cast lots and one wrought lot indicate that ASTM A923 is relevant for detecting intermetallic phases in cast DSS. In the ASTM A923 round robin study, five laboratories conducted ASTM A923 Methods A & C on cast DSS material and the lab-to-lab reproducibility of the data was determined. Two groups of samples were sent to the participants. Group 1 samples were tested per ASTM A923 Method A, group 2 samples were tested by ASTM A923 Method C. Testing procedures for this round robin study were identical to those used in the ASTM A923 applicability study. Results from this round robin indicate that there is excellent lab-to-lab reproducibility of ASTM A923 with respect to cast DSS and that ASTM A923 could be expanded to cover both wrought and cast DSS. In the ASTM A923 study of the effectiveness of existing foundry solution annealing procedures for producing cast DSS without intermetallic phases, Ten heats of ASTM A890-4A (CD3MN) in the foundry solution annealed condition were tested per ASTM A923 Methods A, B, & C. Testing of these materials per ASTM A923 was used to determine if the foundry solution anneal procedures were adequate to completely eliminate any intermetallic phases, which may have precipitated during the casting and subsequent heat treatment processes. All heats showed no sign of intermetallic phase per Method A, passed minimum Charpy impact energy requirements per Method B (> 40 ft-lbs {at} -40 C (-40 F)), and showed negligible weight loss per Method C (< 10 mdd). These results indicate that the solution annealing procedure used by foundries is adequate to produce a product free from intermetallic phases.

Russell, Steven, W.; Lundin, Carl, D.

2005-09-30T23:59:59.000Z

211

Final Report, Volume 2, The Development of Qualification Standards for Cast Duplex Stainless Steel  

SciTech Connect (OSTI)

The scope of testing cast Duplex Stainless Steel (DSS) required testing to several ASTM specifications, while formulating and conducting industry round robin tests to verify and study the reproducibility of the results. ASTM E562 (Standard Test Method for Determining Volume Fraction by Systematic manual Point Count) and ASTM A923 (Standard Test Methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic/Ferritic Stainless Steels) were the specifications utilized in conducting this work. An ASTM E562 industry round robin, ASTM A923 applicability study, ASTM A923 industry round robin, and an ASTM A923 study of the effectiveness of existing foundry solution annealing procedures for producing cast DSS without intermetallic phases were implemented. In the ASTM E562 study, 5 samples were extracted from various cast austenitic and DSS in order to have varying amounts of ferrite. Each sample was metallographically prepared by UT and sent to each of 8 participants for volume fraction of ferrite measurements. Volume fraction of ferrite was measured using manual point count per ASTM E562. FN was measured from the Feritescope???????® and converted to volume fraction of ferrite. Results indicate that ASTM E562 is applicable to DSS and the results have excellent lab-to-lab reproducibility. Also, volume fraction of ferrite conversions from the FN measured by the Feritescope???????® were similar to volume fraction of ferrite measured per ASTM E562. In the ASTM A923 applicability to cast DSS study, 8 different heat treatments were performed on 3 lots of ASTM A890-4A (CD3MN) castings and 1 lot of 2205 wrought DSS. The heat treatments were selected to produce a wide range of cooling rates and hold times in order to study the suitability of ASTM A923 to the response of varying amounts on intermetallic phases [117]. The test parameters were identical to those used to develop ASTM A923 for wrought DSS. Charpy V-notch impact samples were extracted from the castings and wrought DSS and tested per ASTM A923 method B (Charpy impact test). Method A (sodium hydroxide etch test) was performed on one half of a fractured Charpy V-notch impact sample and Method C (ferric chloride corrosion weight loss test) was performed on another half. Test results for the three cast lots and one wrought lot indicate that ASTM A923 is relevant for detecting intermetallic phases in cast DSS. In the ASTM A923 round robin study, five laboratories conducted ASTM A923 Methods A & C on cast DSS material and the lab-to-lab reproducibility of the data was determined. Two groups of samples were sent to the participants. Group 1 samples were tested per ASTM A923 Method A, group 2 samples were tested by ASTM A923 Method C. Testing procedures for this round robin study were identical to those used in the ASTM A923 applicability study. Results from this round robin indicate that there is excellent lab-to-lab reproducibility of ASTM A923 with respect to cast DSS and that ASTM A923 could be expanded to cover both wrought and cast DSS. In the ASTM A923 study of the effectiveness of existing foundry solution annealing procedures for producing cast DSS without intermetallic phases, Ten heats of ASTM A890-4A (CD3MN) in the foundry solution annealed condition were tested per ASTM A923 Methods A, B, & C. Testing of these materials per ASTM A923 was used to determine if the foundry solution anneal procedures were adequate to completely eliminate any intermetallic phases, which may have precipitated during the casting and subsequent heat treatment processes. All heats showed no sign of intermetallic phase per Method A, passed minimum Charpy impact energy requirements per Method B (> 40 ft-lbs @ -40???????°C (-40???????°F)), and showed negligible weight loss per Method C (< 10 mdd). These results indicate that the solution annealing procedure used by foundri

Russell, Steven, W.; Lundin, Carl, W.

2005-09-30T23:59:59.000Z

212

SECTION 6-RESIDENCE HALL SAFETY Safety for residents, staff, and visitors to the residence halls is the responsibility of the Residential Life  

E-Print Network [OSTI]

halls is the responsibility of the Residential Life Department. The department reports unsafe hazards for the purpose of insuring a safe residential environment administered by Residential Life shall be as follows: SAFETY INSPECTIONS OF RESIDENT HALLS Residential Hall rooms shall be inspected monthly for fire safety

Selmic, Sandra

213

Biomarker monitoring of a population residing near uranium mining activities  

SciTech Connect (OSTI)

We investigated whether residents residing near uranium mining operations (target population), who are potentially exposed to toxicants from mining waste, have increased genotoxic effects compared with people residing elsewhere (reference population). Population surveys were conducted, and 24 target and 24 reference residents were selected. The selected subjects and controls were matched on age and gender and they were nonsmokers. Blood samples were collected for laboratory studies. The standard cytogenetic assay was used to determine chromosome aberration frequencies, and the challenge assay was used to investigate DNA repair responses. We found that individuals who resided near uranium mining operations had a higher mean frequency of cells with chromosome aberrations and higher deletion frequency but lower dicentric frequency than the reference group, although the difference was not statistically significant. After cells were challenged by exposure to {gamma}-rays, the target population had a significantly higher frequency of cells with chromosome aberrations and deletion frequency than the reference group. The latter observation is indicative of abnormal DNA repair response in the target population. 22 refs., 3 tabs.

Au, W.W.; Legator, M.S.; Whorton, E.B.; Wilkinson, G.S.; Gabehart, G.J.; Lane, R.G. [Univ. of Texas Medical Branch, Galveston, TX (United States)

1995-05-01T23:59:59.000Z

214

Hydrogenation of individual components isolated from Athabasca bitumen vacuum resid  

SciTech Connect (OSTI)

The ability to produce synthetic fuels from heavy oils and vacuum resids depends on a number of factors, among them being geological origin, thermal history and type of upgrading process. In general, the properties of resids are sufficiently different that for each a unique set of processing conditions can be found to optimize its conversion to distillate. Ideally, one would like to predict a resid's upgradability and the optimum processing conditions from a few simple analytical lab tests. Unfortunately, properties of vacuum resids determined by conventional analytical methods correlate only loosely with upgradability. The pitch conversion and distillate yield most commonly used to monitor processes provide little insight into the upgrading chemistry. The same can be said for global parameters such as sulfur and nitrogen conversions. At present there is no recourse but to process each feedstock on a suitable large scale. This is expensive and time consuming. The objective of the present study is to establish a good model of upgrading chemistry that explains which components in a feedstock cause problems, which are most reactive, which interact with catalysts, and which convert to distillate or residue. Such knowledge should lead to analytical methods sensitive to the chemical changes occurring during upgrading. This paper reports the modified chromatographic separation procedures and some initial results for the hydroprocessing of Athabasca bitumen vacuum resid (ABVB) and its maltene and asphaltene components using a newly designed bubbling microautoclave.

Dawson, W.H. (CANMET, Ottawa, Ontario (Canada)); Chornet, E.; Tiwari, P.; Heitz, M. (Sherbrooke Univ., Quebec (Canada))

1989-04-01T23:59:59.000Z

215

The effects of insulation defects on the corrosion of sub-sea super duplex stainless steel process pipes  

SciTech Connect (OSTI)

There is an increasing use of CRAs (corrosion resistant alloys) for subsea flowlines. These pipes carry corrosive fluids at high temperatures and pressures, and insulation is usually, applied to prevent excessive cooling of the process fluids. The present tests were undertaken to investigate the effect of insulation defects on the susceptibility to localized corrosion of a super duplex stainless steel at different internal temperatures. Four different commercial coating systems were tested, Neoprene, EPDM, Polyurethane and Polyurethane foam. The results show that pitting occurred at an average temperature of 55 C for neoprene and EPDM, and at lower temperatures for the other two coatings. The reasons for this are discussed, and the implications for service applications.

Francis, R.; Irwin, J.; Byrne, G.; Warburton, G. [Weir Materials Ltd., Manchester (United Kingdom)

1995-10-01T23:59:59.000Z

216

Effect of annealing temperature on the pitting corrosion resistance of super duplex stainless steel UNS S32750  

SciTech Connect (OSTI)

The pitting corrosion resistance of commercial super duplex stainless steels SAF2507 (UNS S32750) annealed at seven different temperatures ranging from 1030 deg. C to 1200 deg. C for 2 h has been investigated by means of potentiostatic critical pitting temperature. The microstructural evolution and pit morphologies of the specimens were studied through optical/scanning electron microscope. Increasing annealing temperature from 1030 deg. C to 1080 deg. C elevates the critical pitting temperature, whereas continuing to increase the annealing temperature to 1200 deg. C decreases the critical pitting temperature. The specimens annealed at 1080 deg. C for 2 h exhibit the best pitting corrosion resistance with the highest critical pitting temperature. The pit morphologies show that the pit initiation sites transfer from austenite phase to ferrite phase as the annealing temperature increases. The aforementioned results can be explained by the variation of pitting resistance equivalent number of ferrite and austenite phase as the annealing temperature changes.

Tan Hua; Jiang Yiming; Deng Bo; Sun Tao; Xu Juliang [Department of Material Science, Fudan University, Shanghai 200433 (China); Li Jin, E-mail: jinli@fudan.edu.cn [Department of Material Science, Fudan University, Shanghai 200433 (China)

2009-09-15T23:59:59.000Z

217

Microstructure and XRD analysis of brazing joint for duplex stainless steel using a Ni-Si-B filler metal  

SciTech Connect (OSTI)

Brazing of a nitrogen-containing duplex stainless steel was preformed using a nickel-based filler metal (Ni-4.5wt.%, Si-3.2wt.%, B). The microstructure of the brazed joint was investigated using scanning electron microscopy, energy dispersive spectrometry, electron probe microanalyzer, and layer-by-layer X-ray diffraction analysis. The results indicated that before completion of isothermal solidification, BN, Ni{sub 3}B and Ni{sub 3}Si precipitates formed at the interface, in the athermally solidified zone and isothermally solidified zone, respectively. After isothermal solidification, only {gamma}-Ni phase appeared in the brazed interlayer. The appearance of hardness peak values in the athermally solidified zone and the interface most probably corresponded to the formation of Ni{sub 3}B and BN, respectively.

Yuan Xinjian [Department of Materials Science and Engineering, Pusan National University, Busan, 609-735 (Korea, Republic of); Yun Kang, Chung, E-mail: Kangcy@pusan.ac.kr [Department of Materials Science and Engineering, Pusan National University, Busan, 609-735 (Korea, Republic of); Kim, Myung Bok [Department of Materials Science and Engineering, Pusan National University, Busan, 609-735 (Korea, Republic of)

2009-09-15T23:59:59.000Z

218

The effect of tungsten and molybdenum additions on the cavitation corrosion behavior of duplex stainless steel (DSS) in seawater  

SciTech Connect (OSTI)

Cavitation corrosion studies were conducted on two duplex stainless steel (DSS) specimens of which one was containing tungsten and more molybdenum than the other. Experiments were conducted in seawater using an ultrasonically-induced cavitation facilities. The rate of mass-loss, free corrosion potential, and microscopic examinations were compared for the two alloys in the presence and absence of cavitation. There was negligible mass loss for the two alloys under stagnant conditions. However, some differences were observed between the two alloys with respect to mass-loss, corrosion potential and morphology of attacked areas. The alloy containing tungsten and mover molybdenum experienced more loss in weight regardless of their more noble corrosion potential during cavitation. This difference in behavior was explained in terms of the effect of the alloying elements on the microstructure of the alloys and their susceptibility to absorb the impact energy of cavitation.

Al-Hashem, A.; Abdullah, A.; Shalaby, H.M. [Kuwait Inst. for Scientific Research, Safat (Kuwait). Materials Application Dept.

1998-12-31T23:59:59.000Z

219

Office of Payroll Processing Requirements Business and Finance Non-Resident Alien  

E-Print Network [OSTI]

Office of Payroll Processing Requirements Business and Finance Non-Resident Alien The Ohio State University | Office of the Controller Page 1 of 2 Payroll Processing Guidelines ­ Non-Resident Alien Revised May 2010 What should I know about payroll processing for a non-resident alien? · A Non-Resident Alien

220

RESIDENT FISH SECTION 10 FISH AND WILDLIFE PROGRAM 10-1 September 13, 1995  

E-Print Network [OSTI]

RESIDENT FISH SECTION 10 FISH AND WILDLIFE PROGRAM 10-1 September 13, 1995 Section 10 RESIDENT FISH Resident fish are freshwater fish that live and migrate within the rivers, streams and lakes of the Columbia River Basin, but do not travel to the ocean. Resident fish exist throughout the basin

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

West Virginia University 1 Tuition, Fees and Residency  

E-Print Network [OSTI]

Year's Work The WVU Financial Aid Office provides an estimate of the total cost of attendance for an academic year at financialaid.wvu.edu/tuition-cost-information/ cost-of-attendance. This estimate includesWest Virginia University 1 Tuition, Fees and Residency In this section: Cost: Cost of an Academic

Mohaghegh, Shahab

222

West Virginia University 1 Tuition, Fees, and Residency  

E-Print Network [OSTI]

Financial Aid Office provides an estimate of the total cost of attendance for an academic year at financialaid.wvu.edu/tuition-cost-information/ cost-of-attendance . This estimate includes tuition and feesWest Virginia University 1 Tuition, Fees, and Residency Cost of an Academic Year's Work The WVU

Mohaghegh, Shahab

223

West Virginia University 1 Tuition, Fees and Residency  

E-Print Network [OSTI]

of an Academic Year's Work The WVU Financial Aid Office provides an estimate of the total cost of attendance for an academic year at financialaid.wvu.edu/tuition-cost-information/ cost-of-attendance. This estimate includesWest Virginia University 1 Tuition, Fees and Residency In this section: COST: Cost of an Academic

Mohaghegh, Shahab

224

Division of Human Resources Pay to Non Resident Aliens  

E-Print Network [OSTI]

Division of Human Resources Pay to Non Resident Aliens Questions (813) 974-7955 Payroll a payment is made to a nonresident alien (NRA) or to a third party on their behalf. The following is a list is not comprehensive; therefore, prior to processing any type payment for a nonresident alien it is imperative that you

Meyers, Steven D.

225

Monitoring and control systems to mitigate energy use in residences  

E-Print Network [OSTI]

;FULTON s c h o o l o f e n g i n e e r i n g Residential Energy Use in U.S. 21% of total US energy energy (or water) only when and where needed Provide feedback to inform efficiency decisions Widely, remote meter reading for utilities Information system to provide feedback to residents on home energy use

Keller, Arturo A.

226

2011-2012 Urology Residency Policy Manual Table of Contents  

E-Print Network [OSTI]

& Alcohol Abuse Policy 23 Substance abuse assistance resources at UCHC 23 Duty Hours 24 Supervision 25 #12 goals and objectives: 1) Patient Care ­ Residents are expected to develop the ability to deliver care and execute patient care plans appropriate for their level of training and develop manual surgical skills

Kim, Duck O.

227

Influence of Polymer Viscoelasticity on the Residence Distributions of Extruders  

E-Print Network [OSTI]

Keywords: twin-screw extruder, residence distributions, rheology, elasticity, polypro- pylene, polyethylene. An extruder is composed of a barrel that houses screws or shafts that convey and mix material over the length of the machine. An intermeshing, corotating twin-screw extruder (CoTSE) has two screws composed of different

Raghavan, Srinivasa

228

Residence Hall Housing Office 1900 Perdido St. Room 210  

E-Print Network [OSTI]

are shared with a suitemate. All dorm suites have network connectivity and basic cable television. Common, labs, library, and cafeteria. A modern, state of the art Wellness Center, which includes weight lifting television service. The laundry and lobby areas are always available for the convenience of the Residence

229

Using a Hidden Markov Model for Resident Identification  

E-Print Network [OSTI]

. The result is a passive, low profile means to attribute individual events to unique residents. For this work environment using only passive sensors. Our first step is to design an algorithm that maps sensor events to know who is performing what actions. This knowledge allows the system to accurately build individuals

Cook, Diane J.

230

THURGOOD MARSHALL COLLEGE Returning 2012-2013 Resident Advisor Application  

E-Print Network [OSTI]

THURGOOD MARSHALL COLLEGE Returning 2012-2013 Resident Advisor Application The Thurgood Marshall/philosophy? How do you incorporate it into your day to day work as an RA at Marshall College? 6. Other than process and return it to the Thurgood Marshall College Office of Residential Life, in person, by 4:00 p

Russell, Lynn

231

Stable, Ultra-Low Residence Time Partial Oxidation  

DOE Patents [OSTI]

A process for the catalytic partial oxidation of methane in gas phase at very short residence time (800,000 to 12,000,000 hr.sup.-1) by contacting a gas stream containing methane and oxygen with a metal supported catalyst, such as platinum deposited on a ceramic monolith.

Schmidt, Lanny D. (Minneapolis, MN); Hickman, Daniel A. (Midland, MI)

1997-07-15T23:59:59.000Z

232

Application of fluorescence microscopy to coal-derived resid characterization  

SciTech Connect (OSTI)

This study evaluates the usefulness of a fluorescence microscopy methodology to analyze coal-derived resids and interpret the data in the light of liquefaction processing conditions, process response, the inferred resid reactivity, and in relation to results of other analytical data. The fluorescence technique utilized has been widely applied to coal and kerogen characterization, albeit with some modifications, but is novel in its application to the characterization of coal liquids. Fluorescence is the emission of light energy which occurs when electrons, having been excited to a higher energy orbital, return to their lower energy ground state. The majority of organic molecules that fluoresce are those with conjugated double bonds (chromophores), such as aromatics, characterized by pi-electrons less strongly bound within the molecule than sigma electrons, that can be excited to anti-bonding pi-orbitals. Increasing the extent of pi-bond conjugation (i.e. larger molecular size) generally imparts a shift in absorption and emission spectra to longer wavelengths. Resid fluorescence largely depends on the concentration and degree of conjugation of aromatic chromophores in the high molecular weight liquids, possibly with ancillary effects from oxygen functionalities. In this context, fluorescence analysis of liquefaction resids can potentially evaluate process performance, since direct liquefaction processes endeavor to break down the macromolecular structure of coal, and reduce the molecular weight of polycondensed aromatics through hydrogenation, the opening of ring structures, and heteroatom removal.

Rathbone, R.F.; Hower, J.C.; Derbyshire, F.J.

1991-01-01T23:59:59.000Z

233

Application of fluorescence microscopy to coal-derived resid characterization  

SciTech Connect (OSTI)

This study evaluates the usefulness of a fluorescence microscopy methodology to analyze coal-derived resids and interpret the data in the light of liquefaction processing conditions, process response, the inferred resid reactivity, and in relation to results of other analytical data. The fluorescence technique utilized has been widely applied to coal and kerogen characterization, albeit with some modifications, but is novel in its application to the characterization of coal liquids. Fluorescence is the emission of light energy which occurs when electrons, having been excited to a higher energy orbital, return to their lower energy ground state. The majority of organic molecules that fluoresce are those with conjugated double bonds (chromophores), such as aromatics, characterized by pi-electrons less strongly bound within the molecule than sigma electrons, that can be excited to anti-bonding pi-orbitals. Increasing the extent of pi-bond conjugation (i.e. larger molecular size) generally imparts a shift in absorption and emission spectra to longer wavelengths. Resid fluorescence largely depends on the concentration and degree of conjugation of aromatic chromophores in the high molecular weight liquids, possibly with ancillary effects from oxygen functionalities. In this context, fluorescence analysis of liquefaction resids can potentially evaluate process performance, since direct liquefaction processes endeavor to break down the macromolecular structure of coal, and reduce the molecular weight of polycondensed aromatics through hydrogenation, the opening of ring structures, and heteroatom removal.

Rathbone, R.F.; Hower, J.C.; Derbyshire, F.J.

1991-12-31T23:59:59.000Z

234

Internship Opportunities Akamai Internship Program for Hawaii Residents  

E-Print Network [OSTI]

Internship Opportunities Akamai Internship Program for Hawaii Residents http://cfao.ucolick.org/EO/internshipsnew/akamai/index.php American Meteorological Society http://www.ametsoc.org/amsstudentinfo/internships.html Explorations information, visit: Geotimes Summer Internship http://www.geotimes.org/internship.html Joint

235

Why Become a Master By encouraging Connecticut residents to recycle  

E-Print Network [OSTI]

Why Become a Master Composter? By encouraging Connecticut residents to recycle organic waste % of a typical household's waste can be recycled right in our own backyards. This significantly reduces Service Matt Freund, Freund's Farm Bob Jacquier, Laurelbrook Farm Connecticut Recycling Coalition

Holsinger, Kent

236

Why Become a Master By encouraging Connecticut residents to recycle  

E-Print Network [OSTI]

Why Become a Master Composter? By encouraging Connecticut residents to recycle organic waste % of a typical household's waste can be recycled right in our own backyards. This significantly reduces Service Ken Longo, Manchester Recycling Center Matt Freund, Freund's Farm Bob Jacquier, Laurelbrook Farm

Alpay, S. Pamir

237

RESIDENCE ALCOHOL POLICY Residence students are expected to use alcohol responsibly and to follow the University Alcohol  

E-Print Network [OSTI]

of a student's room must be in personalized plastic containers or cans. Students who wish to transport open alcohol within the residence may do so only in a covered personalized plastic container. Cases of beer are not considered personalized containers and therefore are not permitted for consumption in common areas. Unopened

238

Cancer mortality and residence near petrochemical industries in Taiwan  

SciTech Connect (OSTI)

An ecologic study design was used to investigate the relationship between cancer risks and residence in communities adjacent to petrochemical industrial counties (PICs). Directly age-adjusted mortality rates for cancer during 1982-1991 among 16 counties characterized by a heavy concentration of petrochemical industries were compared to rates among 16 matched counties with similar concentration of nonpetrochemical manufacturing industries, urbanization level, and demographic characteristics. An excess rate for liver cancer among males was found in the so-called PICs. The correlation could not be explained by confounding variables such as urbanization, socioeconomic class, or employment in nonpetrochemical industries. No other increased cancer risks were found to be associated with residence near petrochemical industries. 30 refs., 3 tabs.

Yang, Chun-Yuh; Chiu, Hui-Fen; Chiu, Jeng-Fen [Kaohsiung Medical College (Taiwan, Province of China)] [and others

1997-02-21T23:59:59.000Z

239

GCHP Results in Net-Zero Energy Residence in Japan  

E-Print Network [OSTI]

· Advanced Ambient Light Sensor Control · Lithium Battery Storage System · Solar Thermal Heat Collector: 4m2 chip panel t=15 First Floor Radiant Floor Heating #12;Rubber chip panel t=15 Second Floor Radiant Floor Residence, Nerima-ku, Tokyo ·The Project ·Data Presentation 1 #12;· Insulation heat loss factor: 1.84W/m2K

240

Optimization of Occupancy Based Demand Controlled Ventilation in Residences  

SciTech Connect (OSTI)

Although it has been used for many years in commercial buildings, the application of demand controlled ventilation in residences is limited. In this study we used occupant exposure to pollutants integrated over time (referred to as 'dose') as the metric to evaluate the effectiveness and air quality implications of demand controlled ventilation in residences. We looked at air quality for two situations. The first is that typically used in ventilation standards: the exposure over a long term. The second is to look at peak exposures that are associated with time variations in ventilation rates and pollutant generation. The pollutant generation had two components: a background rate associated with the building materials and furnishings and a second component related to occupants. The demand controlled ventilation system operated at a low airflow rate when the residence was unoccupied and at a high airflow rate when occupied. We used analytical solutions to the continuity equation to determine the ventilation effectiveness and the long-term chronic dose and peak acute exposure for a representative range of occupancy periods, pollutant generation rates and airflow rates. The results of the study showed that we can optimize the demand controlled airflow rates to reduce the quantity of air used for ventilation without introducing problematic acute conditions.

Mortensen, Dorthe K.; Walker, Iain S.; Sherman, Max H.

2011-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

"Living for the City:" : the political meaning of public housing residents' extraordinary struggle  

E-Print Network [OSTI]

While the particularities of public housing residents' hardships often capture the attention of the national media, less recognized and understood is how public housing residents work to address the instabilities they ...

Green, La Tonya M. (La Tonya Mellissa), 1975-

2012-01-01T23:59:59.000Z

242

The Enzyme-mimic Activity of Ferric Nano-Core Residing in Ferritin...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Enzyme-mimic Activity of Ferric Nano-Core Residing in Ferritin and Its Biosensing Applications. The Enzyme-mimic Activity of Ferric Nano-Core Residing in Ferritin and Its...

243

Effects of environmental agents on social behavior of geriatric residents in an institution dining room  

E-Print Network [OSTI]

it for appropriateness for a geriatric population. Behavior of geriatric residents in a retirement community is assessed in accordance with minor changes made in their dining room environment. Observed behavior included the amount of time residents spent in the dining...

Davies, Kimberly D

1996-01-01T23:59:59.000Z

244

Direct Observations of Sigma Phase Formation in Duplex Stainless Steels using In Situ Synchrotron X-Ray Diffraction  

SciTech Connect (OSTI)

The formation and growth of sigma phase in 2205 duplex stainless steel was observed and measured in real time using synchrotron radiation during 10 hr isothermal heat treatments at temperatures between 700 C and 850 C. Sigma formed in near-equilibrium quantities during the isothermal holds, starting from a microstructure which contained a balanced mixture of metastable ferrite and austenite. In situ synchrotron diffraction continuously monitored the transformation, and these results were compared to those predicted by thermodynamic calculations. Differences between the calculated and measured amounts of sigma, ferrite and austenite suggest that the thermodynamic calculations underpredict the sigma dissolution temperature by approximately 50 C. The data were further analyzed using a modified Johnson-Mehl-Avrami (JMA) approach to determine kinetic parameters for sigma formation over this temperature range. The initial JMA exponent, n, at low fractions of sigma was found to be approximately 7.0, however, towards the end of the transformation, n decreased to values of approximately 0.75. The change in the JMA exponent was attributed to a change in the transformation mechanism from discontinuous precipitation with increasing nucleation rate, to growth of the existing sigma phase after nucleation site saturation occurred. Because of this change in mechanism, it was not possible to determine reliable values for the activation energy and pre-exponential terms for the JMA equation. While cooling back to room temperature, the partial transformation of austenite resulted in a substantial increase in the ferrite content, but sigma retained its high temperature value to room temperature.

Elmer, J W; Palmer, T A; Specht, E D

2006-07-03T23:59:59.000Z

245

Characterization of Low Temperature Ferrite/Austenite Transformations in the Heat Affected Zone of 2205 Duplex Stainless Steel Arc Welds  

SciTech Connect (OSTI)

Spatially Resolved X-Ray Diffraction (SRXRD) has been used to identify a previously unobserved low temperature ferrite ({delta})/austenite({gamma}) phase transformation in the heat affected zone (HAZ) of 2205 Duplex Stainless Steel (DSS) welds. In this ''ferrite dip'' transformation, the ferrite transforms to austenite during heating to peak temperatures on the order of 750 C, and re-transforms to ferrite during cooling, resulting in a ferrite volume fraction equivalent to that in the base metal. Time Resolved X-Ray Diffraction (TRXRD) and laser dilatometry measurements during Gleeble{reg_sign} thermal simulations are performed in order to verify the existence of this low temperature phase transformation. Thermodynamic and kinetic models for phase transformations, including both local-equilibrium and para-equilibrium diffusion controlled growth, show that diffusion of substitutional alloying elements does not provide a reasonable explanation for the experimental observations. On the other hand, the diffusion of interstitial alloying elements may be rapid enough to explain this behavior. Based on both the experimental and modeling results, two mechanisms for the ''ferrite dip'' transformation, including the formation and decomposition of secondary austenite and an athermal martensitic-type transformation of ferrite to austenite, are considered.

Palmer, T A; Elmer, J W; Babu, S S; Vitek, J M

2003-08-20T23:59:59.000Z

246

How to control hydrogen level in (super) duplex stainless steel weldments using the GTAW or GMAW process  

SciTech Connect (OSTI)

In this investigation, an attempt is made to further the understanding of factors influencing the hydrogen content in duplex stainless steel gas tungsten arc (GTA) and gas metal arc (GMA) welds as well as to what extent it affects hydrogen-induced cracking susceptibility. The results indicated that susceptibility to hydrogen cracking using the GTA or GMA process appears to be limited. In practice, maintaining a moisture level below 10 ppm in the shielding gas is of less importance than the choice of welding parameters. Even a moisture level of 1000 ppm in the shielding gas, in combination with the correct welding parameters, will result in a sufficient low hydrogen content in the weld. Similarly, a moisture level in the shielding gas below 10 ppm does not necessarily result in low hydrogen content in the weld metal. Although very high ferrite levels were combined with high restrain and high hydrogen content, none of the GMA and GTA welds cracked. Susceptibility to hydrogen cracking is concluded to be limited.

Mee, V.V.D. [Lincoln Electric Co., Cleveland, OH (United States); Meelker, H. [Lincoln Smitweld bv (Netherlands); Schelde, R.V.D. [AGA Gas bv (Netherlands)

1999-01-01T23:59:59.000Z

247

Direct Observations of Sigma Phase Formation in Duplex Stainless Steels Using In Situ Synchrotron X-Ray Diffraction  

SciTech Connect (OSTI)

The formation and growth of sigma ( ) phase in 2205 duplex stainless steel (DSS) was observed and measured in real time using synchrotron radiation during 10 hour isothermal heat treatments at temperatures between 700 C and 850 C. Sigma formed in near-equilibrium quantities during the isothermal holds, starting from a microstructure which contained a balanced mixture of metastable ferrite and austenite. In-situ synchrotron diffraction continuously monitored the transformation, and these results were compared to those predicted by thermodynamic calculations. The data were further analyzed using a modified Johnson-Mehl-Avrami-Kolmogrov (JMAK) approach to determine kinetic parameters for sigma formation over this temperature range. The initial JMAK exponent, n, at low fractions of sigma was found to be approximately 7.0; however, toward the end of the transformation, n decreased to values of approximately 0.75. The change in the JMAK exponent was attributed to a change in the transformation mechanism from discontinuous precipitation with increasing nucleation rate, to growth of the existing sigma phase after nucleation site saturation occurred. Because of this change in mechanism, it was not possible to determine reliable values for the activation energy and pre-exponential terms for the JMAK equation. While cooling back to room temperature, the partial transformation of austenite resulted in a substantial increase in the ferrite content, but sigma retained its high-temperature value to room temperature.

Elmer, J. W. [Lawrence Livermore National Laboratory (LLNL); Palmer, T. A. [Lawrence Livermore National Laboratory (LLNL); Specht, Eliot D [ORNL

2007-01-01T23:59:59.000Z

248

The use of X-ray diffraction, microscopy, and magnetic measurements for analysing microstructural features of a duplex stainless steel  

SciTech Connect (OSTI)

X-ray diffraction, light optical microscopy, and magnetization saturation measurements were employed to analyse the microstructural features of a UNS S31803 duplex stainless steel modified by high-temperature treatments. The samples were heated to 1300 deg. C and cooled by different ways to produce five different microstructures. Solution treatments at 1000 deg. C were also employed to produce another five conditions. Three methods were employed to determine the austenite/ferrite proportions. X-ray diffraction gave higher austenite values than the other methods, due to the influence of texture, but can be successfully used to determine the microstrain level in each phase. Magnetic saturation measurement is a very simple and precise method for quantification of austenite and ferrite volume fractions in samples that were fast-cooled and slow-cooled. Light microscopy can give a fast and precise measurement of the phase proportions and reveals important features related to the morphology of the phases, but in the samples where the austenite content is low, quantification becomes difficult and imprecise.

Ribeiro Miranda, M.A. [Instituto de Fisica, Universidade Federal do Ceara, Campus do Pici, Caixa Postal 6030, CEP 60455-760 Fortaleza/CE (Brazil)]. E-mail: marcus@fisica.ufc.br; Sasaki, J.M. [Instituto de Fisica, Universidade Federal do Ceara, Campus do Pici, Caixa Postal 6030, CEP 60455-760 Fortaleza/CE (Brazil); Tavares, S.S.M. [PGMEC/TEM, Universidade Federal Fluminense, Rua Passo da Patria, 156, CEP 24210-240, Niteroi/RJ (Brazil); de Abreu, H.F.G. [Depto. Engenharia Meca-hat nica, Universidade Federal do Ceara (Brazil); Neto, J.M. [Instituto de Fisica, Universidade Federal do Rio de Janeiro (Brazil)

2005-05-15T23:59:59.000Z

249

PURDUE UNIVERSITY RESIDENCES NEWSLETTER FOR FAMILIES AND FRIENDS In thIs Issue  

E-Print Network [OSTI]

at the Tapawingo park ice skating rink earlier this semester. Life as a Resident Assistant Student leaders reap

Fernández-Juricic, Esteban

250

RESIDENT ALIEN VS NONRESIDENT ALIEN STATUS Immigration And Tax Law Definitions  

E-Print Network [OSTI]

RESIDENT ALIEN VS NONRESIDENT ALIEN STATUS Immigration And Tax Law Definitions This handout. IMMIGRATION LAW: A nonresident alien is a person who is not a citizen or permanent resident of the U.S. who. A resident alien, for IMMIGRATION purposes, is the same as an immigrant, or a "greed card" holder--a non

Kasman, Alex

251

Office of Residential Life PreCollege Summer Resident Advisor Contract 2014  

E-Print Network [OSTI]

Office of Residential Life PreCollege Summer Resident Advisor Contract ­ 2014 This contract provides information supplemental to that found in the PreCollege Summer Program Resident Advisor Job the position of Resident Advisor for the summer of 2014. (print name) In accepting this position, I agree

Royer, Dana

252

Resident Elective Syllabus 2014-2015; Page 1 Department of Medicine  

E-Print Network [OSTI]

Resident Elective Syllabus 2014-2015; Page 1 Department of Medicine Internal Medicine Residency, and Organizational Change Syllabus and Reader 2014-2015 Lisa Shieh, MD, PhD, FHM Clinical Associate Professor and Organizational Improvement Specialist, Education and Evaluation #12;Resident Elective Syllabus 2014-2015; Page 2

Quake, Stephen R.

253

Resident Elective Syllabus 2013-2014; Page 1 Department of Medicine  

E-Print Network [OSTI]

Resident Elective Syllabus 2013-2014; Page 1 Department of Medicine Internal Medicine Residency, and Organizational Change Syllabus and Reader 2013-2014 Lisa Shieh, MD, PhD, FHM Clinical Associate Professor Professor of Medicine #12;Resident Elective Syllabus 2013-2014; Page 2 TABLE OF CONTENTS Part I: Guidelines

Quake, Stephen R.

254

UNIVERSITY OF TORONTO SCARBOROUGH RESIDENCE HANDBOOK 2012-2013 Welcome Home 3  

E-Print Network [OSTI]

Facilities 24 Garbage, Composting & Recycling 26 Cleaning & Maintenance 28 Residence Admissions 30 Parking 31 Policy Pet Policy Roller Blades & Skateboards Screens #12;UNIVERSITY OF TORONTO SCARBOROUGH RESIDENCE OF TORONTO SCARBOROUGH RESIDENCE HANDBOOK 2012-2013 #12;Recycling Recycling Tips #12;UNIVERSITY OF TORONTO

Boonstra, Rudy

255

Life Cycle Assessment of Vanier Residence in University of British Columbia  

E-Print Network [OSTI]

cycle assessment (LCA) was conducted on the Vanier Residence. The LCA conducted looks into the lifeLife Cycle Assessment of Vanier Residence in University of British Columbia Building PerformanceOff were used to create an LC model of the Vanier Residence. For this case study, a cradle-to-gate life

256

Enrichment Mini-Course (EMC) in Residence Sunday, May 5 to Friday, May 10, 2013  

E-Print Network [OSTI]

- 1 - Enrichment Mini-Course (EMC) in Residence Sunday, May 5 to Friday, May 10, 2013 Thank you for your interest in attending the Enrichment Mini-Course (EMC) program for a fun and challenging the EMC in Residence program, students will be assigned rooms in the Victoria Hall residence building

Ellis, Randy

257

Eden Apartments East Village Center  

E-Print Network [OSTI]

median income · Rain Garden and Green Roof Su stainable Multi-Family L iving Location: Rosemount, MN UMore Park Sustainable Aspects · Rain Garden · Green Roof · Walkable Streets · Multi-Use Zoning · Minimal Impervious Surface · Energy Star Appliances · Low VOC Materials · Electricity from Eco

Netoff, Theoden

258

Charter Oak Apartments East Campus  

E-Print Network [OSTI]

43 44 46 47 48 49 50 51 52 53 54 55 56 57 Hillside Road Hunting Lodge Road Separatist Road 61 62 63, I, L, W, X, Y Visitor Parking: Metered / Parking Garage Employee Parking: Area 1 Area 2 Area 3 Horsebarn Hill Area Inset #12;

Holsinger, Kent

259

Short residence time coal liquefaction process including catalytic hydrogenation  

DOE Patents [OSTI]

Normally solid dissolved coal product and a distillate liquid product are produced by continuously passing a feed slurry comprising raw feed coal and a recycle solvent oil and/or slurry together with hydrogen to a preheating-reaction zone, the hydrogen pressure in the preheating-reaction zone being at least 1,500 psig (105 kg/cm[sup 2]), reacting the slurry in the preheating-reaction zone at a temperature in the range of between about 455 and about 500 C to dissolve the coal to form normally liquid coal and normally solid dissolved coal. A total slurry residence time is maintained in the reaction zone ranging from a finite value from about 0 to about 0.2 hour, and reaction effluent is continuously and directly contacted with a quenching fluid to substantially immediately reduce the temperature of the reaction effluent to below 425 C to substantially inhibit polymerization so that the yield of insoluble organic matter comprises less than 9 weight percent of said feed coal on a moisture-free basis. The reaction is performed under conditions of temperature, hydrogen pressure and residence time such that the quantity of distillate liquid boiling within the range C[sub 5]-454 C is an amount at least equal to that obtainable by performing the process under the same condition except for a longer total slurry residence time, e.g., 0.3 hour. Solvent boiling range liquid is separated from the reaction effluent and recycled as process solvent. The amount of solvent boiling range liquid is sufficient to provide at least 80 weight percent of that required to maintain the process in overall solvent balance. 6 figs.

Anderson, R.P.; Schmalzer, D.K.; Wright, C.H.

1982-05-18T23:59:59.000Z

260

Short residence time coal liquefaction process including catalytic hydrogenation  

DOE Patents [OSTI]

Normally solid dissolved coal product and a distillate liquid product are produced by continuously passing a feed slurry comprising raw feed coal and a recycle solvent oil and/or slurry together with hydrogen to a preheating-reaction zone (26, alone, or 26 together with 42), the hydrogen pressure in the preheating-reaction zone being at least 1500 psig (105 kg/cm.sup.2), reacting the slurry in the preheating-reaction zone (26, or 26 with 42) at a temperature in the range of between about 455.degree. and about 500.degree. C. to dissolve the coal to form normally liquid coal and normally solid dissolved coal. A total slurry residence time is maintained in the reaction zone ranging from a finite value from about 0 to about 0.2 hour, and reaction effluent is continuously and directly contacted with a quenching fluid (40, 68) to substantially immediately reduce the temperature of the reaction effluent to below 425.degree. C. to substantially inhibit polymerization so that the yield of insoluble organic matter comprises less than 9 weight percent of said feed coal on a moisture-free basis. The reaction is performed under conditions of temperature, hydrogen pressure and residence time such that the quantity of distillate liquid boiling within the range C.sub.5 -454.degree. C. is an amount at least equal to that obtainable by performing the process under the same condition except for a longer total slurry residence time, e.g., 0.3 hour. Solvent boiling range liquid is separated from the reaction effluent (83) and recycled as process solvent (16). The amount of solvent boiling range liquid is sufficient to provide at least 80 weight percent of that required to maintain the process in overall solvent balance.

Anderson, Raymond P. (Overland Park, KS); Schmalzer, David K. (Englewood, CO); Wright, Charles H. (Overland Park, KS)

1982-05-18T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

ASTRO's 2007 Core Physics Curriculum for Radiation Oncology Residents  

SciTech Connect (OSTI)

In 2004, American Society for Therapeutic Radiology and Oncology (ASTRO) published a curriculum for physics education. The document described a 54-hour course. In 2006, the committee reconvened to update the curriculum. The committee is composed of physicists and physicians from various residency program teaching institutions. Simultaneously, members have associations with American Association of Physicists in Medicine, ASTRO, Association of Residents in Radiation Oncology, American Board of Radiology, and American College of Radiology. Representatives from the latter two organizations are key to provide feedback between the examining organizations and ASTRO. Subjects are based on Accreditation Council for Graduate Medical Education requirements (particles and hyperthermia), whereas the majority of subjects and appropriated hours/subject were developed by consensus. The new curriculum is 55 hours, containing new subjects, redistribution of subjects with updates, and reorganization of core topics. For each subject, learning objectives are provided, and for each lecture hour, a detailed outline of material to be covered is provided. Some changes include a decrease in basic radiologic physics, addition of informatics as a subject, increase in intensity-modulated radiotherapy, and migration of some brachytherapy hours to radiopharmaceuticals. The new curriculum was approved by the ASTRO board in late 2006. It is hoped that physicists will adopt the curriculum for structuring their didactic teaching program, and simultaneously, American Board of Radiology, for its written examination. American College of Radiology uses the ASTRO curriculum for their training examination topics. In addition to the curriculum, the committee added suggested references, a glossary, and a condensed version of lectures for a Postgraduate Year 2 resident physics orientation. To ensure continued commitment to a current and relevant curriculum, subject matter will be updated again in 2 years.

Klein, Eric E. [Washington University, St. Louis, MO (United States)]. E-mail: eklein@radonc.wustl.edu; Gerbi, Bruce J. [University of Minnesota, Minneapolis, MN (United States); Price, Robert A. [Fox Chase Cancer Center, Philadelphia, PA (United States); Balter, James M. [University of Michigan, Ann Arbor, MI (United States); Paliwal, Bhudatt [University of Wisconsin, Madison, WI (United States); Hughes, Lesley [Saint Joseph Medical Center, Reading, PA (United States); Huang, Eugene [MD Anderson Cancer Center, Houston, TX (United States)

2007-08-01T23:59:59.000Z

262

Technologist-in-Residence Documents | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned Small BusinessEMPLOYMENT VERIFICATION1Technologist-in-Residence Documents

263

Long-term performance of the Hunn passive solar residence  

SciTech Connect (OSTI)

Detailed performance and annual energy consumption data are reported, as well as occupant observations and conclusions, for three heating seasons in the Hunn hybrid passive/active solar residence located in Los Alamos, New Mexico. The performance data were gathered by the Los Alamos National Laboratory and include hourly storage wall and interior temperature data for a midwinter period, an interior air-temperature histogram, and measured auxiliary energy consumption and solar heating fraction for each heating season. Also, energy and cost savings over the three-year period are estimated.

Hunn, B.D.

1981-01-01T23:59:59.000Z

264

Impact of graphite gasket/duplex stainless steel couples on crevice chemistry and the likelihood of crevice attack in seawater  

SciTech Connect (OSTI)

Crevice corrosion in seawater usually is assumed to be induced by attainment of a critical solution chemistry. Electrochemical polarization measurements were made on a graphite laminate gasket and a super-duplex stainless steel (DSS) in deaerated 1M sodium chloride (NaCl) solution over a range of pH. The open-circuit potential of the graphite was significantly more noble than that of the DSS, and the kinetics of the hydrogen ion reduction were greater at potentials more positive than {approximately} 0.0 V{sub SCE}. Data were used as input to a model of crevice chemistry, and predictions were made for potentials up to 0.4 V{sub SCE}. For crevices of parallel plates of DSS-DSS and DSS-plastic, the usual acidic conditions were predicted. However, for a DSS-graphite combination, there was no significant decrease in pH. The latter was a consequence of the enhanced kinetics for cathodic reduction of hydrogen ions and water on the graphite which, when confined within the crevice, opposed the fall in pH associated with the metal-ion hydrolysis process. The predictions suggested that coupling to graphite, contained within the crevice, may act to prevent crevice corrosion initiation in contrast to the usual perception of behavior when coupling to more noble materials. In practice, there have been significant crevice corrosion failures of DSS associated with graphite gaskets. However, in all cases, the failures were in chlorinated systems for which corrosion potentials are particularly high and beyond the range for which a benefit from graphite could be anticipated.

Turnbull, A. [National Physical Lab., Middlesex (United Kingdom). Centre for Materials Measurement and Technology

1999-02-01T23:59:59.000Z

265

Final Report, Volume 4, The Development of Qualification Standards for Cast Super Duplex Stainless Steel (2507 Wrought Equivalent)  

SciTech Connect (OSTI)

The objective of the program is to determine the suitability of ASTM A923 ???¢????????Standard Test methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic-Ferritic Stainless Steels???¢??????? for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). Different tests were carried out on the materials procured from various steel foundries as stated in the ASTM A923. The foundries were designated as Foundry A, B, C and D. All the materials were foundry solution annealed. Materials from Foundry D were solution heat treated at The University of Tennessee also and then they were subjected to heat treatment schedule which was derived from the testing of wrought DSS to establish the A923 specification. This was possible because the material from the same heat was sufficient for conducting the full scope of heat treatment. This was done prior to carrying out various other tests. Charpy samples were machined. The Ferrite content was measured in all the Charpy samples using Feritscope???????® and ASTM E562 Manual Point Count Method. After the ferrite content was measured the samples were sent to AMC-Vulcan, Inc. in Alabama to conduct the Charpy impact test based on ASTM A923 Test Method B. This was followed by etch testing and corrosion analysis based on ASTM A923 Test Methods A and C respectively at University of Tennessee. Hardness testing using Rockwell B and C was also carried out on these samples. A correlation was derived between all the three test methods and the best method for evaluating the presence of intermetallic in the material was determined. The ferrite content was correlated with the toughness values. Microstructural analysis was carried out on the etch test samples using Scanning Electron Microscopy in order to determine if intermetallic phases were present. The fracture surfaces from Charpy test specimens were also observed under SEM in order to determine the presence of any cracks and whether it was a brittle or a ductile fracture. A correlation was carried out between the ferrite content, hardness values and the type of fracture. SEM was also carried out on the corrosion samples in order to see the difference on the surface after corrosion analysis has been carried out. Energy Dispersive Spectroscopy was carried out on the material acquired from Foundry D in order to determine the variation in the amount of the chemical composition of various elements when the material is subjected to different heat treatment schedules. X-Ray analysis was also carried out in order to verify whether it is possible to identify the different phases present in the material. Volume percentage of ferrite was also calculated from X-Ray diffraction and compared with the Feritscope???????® and ASTM E562 Manual Point Count data in order to determine whether X-Ray Diffraction is a suitable method for carrying out qualitative analysis of different phases present. From the various tests that were conducted, it was concluded that since ASTM A923 Methods adequately identifies the presence of intermetallic phases in A890 ???¢???????? 5A grade Cast Super Duplex Stainless Steel A890 ???¢???????? 5A can be directly included in ASTM A923. Correlation was determined between all the ASTM A923 Test Methods A, B and C and Test Method B were identified as the best method for detecting the presence of detrimental intermetallic phases. The micrographs from the A890-4A grade (now in ASTM A923) were identified as applicable for the A890-5A grade to compare and detect the presence of intermetallic phases. Using these micrographs one can verify whether an A890-5A sample has an unaffected, affected or a possibly

Hariharan, Vasudevan; Lundin, Carl, W.

2005-09-30T23:59:59.000Z

266

Final Report, Volume 4, The Develpoment of Qualification Standards forCast Super Duplex Stainless Steel (2507 Wrought Equivalent)  

SciTech Connect (OSTI)

The objective of the program is to determine the suitability of ASTM A923 Standard Test methods for Detecting Detrimental Intermetallic Phase in Wrought Duplex Austenitic-Ferritic Stainless Steels for 25 Cr Cast Super Duplex Stainless Steels (ASTM A890-5A). Different tests were carried out on the materials procured from various steel foundries as stated in the ASTM A923. The foundries were designated as Foundry A, B, C and D. All the materials were foundry solution annealed. Materials from Foundry D were solution heat treated at The University of Tennessee also and then they were subjected to heat treatment schedule which was derived from the testing of wrought DSS to establish the A923 specification. This was possible because the material from the same heat was sufficient for conducting the full scope of heat treatment. This was done prior to carrying out various other tests. Charpy samples were machined. The Ferrite content was measured in all the Charpy samples using Feritscope{reg_sign} and ASTM E562 Manual Point Count Method. After the ferrite content was measured the samples were sent to AMC-Vulcan, Inc. in Alabama to conduct the Charpy impact test based on ASTM A923 Test Method B. This was followed by etch testing and corrosion analysis based on ASTM A923 Test Methods A and C respectively at University of Tennessee. Hardness testing using Rockwell B and C was also carried out on these samples. A correlation was derived between all the three test methods and the best method for evaluating the presence of intermetallic in the material was determined. The ferrite content was correlated with the toughness values. Microstructural analysis was carried out on the etch test samples using Scanning Electron Microscopy in order to determine if intermetallic phases were present. The fracture surfaces from Charpy test specimens were also observed under SEM in order to determine the presence of any cracks and whether it was a brittle or a ductile fracture. A correlation was carried out between the ferrite content, hardness values and the type of fracture. SEM was also carried out on the corrosion samples in order to see the difference on the surface after corrosion analysis has been carried out. Energy Dispersive Spectroscopy was carried out on the material acquired from Foundry D in order to determine the variation in the amount of the chemical composition of various elements when the material is subjected to different heat treatment schedules. X-Ray analysis was also carried out in order to verify whether it is possible to identify the different phases present in the material. Volume percentage of ferrite was also calculated from X-Ray diffraction and compared with the Feritscope{reg_sign} and ASTM E562 Manual Point Count data in order to determine whether X-Ray Diffraction is a suitable method for carrying out qualitative analysis of different phases present. From the various tests that were conducted, it was concluded that since ASTM A923 Methods adequately identifies the presence of intermetallic phases in A890-5A grade Cast Super Duplex Stainless Steel A890-5A can be directly included in ASTM A923. Correlation was determined between all the ASTM A923 Test Methods A, B and C and Test Method B were identified as the best method for detecting the presence of detrimental intermetallic phases. The micrographs from the A890-4A grade (now in ASTM A923) were identified as applicable for the A890-5A grade to compare and detect the presence of intermetallic phases. Using these micrographs one can verify whether an A890-5A sample has an unaffected, affected or a possibly affected structure. It was also observed that when compared to the A890-4A grade A890-5A grade is more sensitive to heat treatment. From the ferrite and hardness measurement a correlation was developed between toughness, volume percentage ferrite and hardness of the material. From SEM and EDS the type of intermetallic phase present and its chemical composition was determined. The best method for calculating volume percentage ferrite was determined between the Ferits

Hariharan, Vasudevan; Lundin, Carl, D.

2005-09-30T23:59:59.000Z

267

Final Report, Volume 5, Data Package for ASTM A923 Supporting Inclusion of A890-5 Super Duplex Stainless Steel (Cast Equivalent of 2507)  

SciTech Connect (OSTI)

Volume 5 is the Data Package for the evaluation of Super Duplex Stainless Steel Castings prepared at the end of work comprised in volumes 3 and 4. The document deals with the various evaluation methods used in the work documented in volume 3 and 4. This document covers materials regarding evaluation of the A890-5A material in terms of inclusion in ASTM A923. The various tests which were conducted on the A890-5A material are included in this document.

Hariharan, Vasudevan; Lundin, Carl, W.

2005-09-30T23:59:59.000Z

268

Final Report, Volume 5, Data Package for ASTM A923 Supporting Inclusion of A890-5A Super Duplex Stainless Steel ( Cast Equivalent of 2507)  

SciTech Connect (OSTI)

Volume 5 is the Data Package for the evaluation of Super Duplex Stainless Steel Castings prepared at the end of work comprised in volumes 3 and 4. The document deals with the various evaluation methods used in the work documented in volume 3 and 4. This document covers materials regarding evaluation of the A890-5A material in terms of inclusion in ASTM A923. The various tests which were conducted on the A890-5A material are included in this document.

Hariharan, Vasudevan; Lundin, Carl, D.

2005-09-30T23:59:59.000Z

269

The effects of thermo-mechanical treatments on superplasticity of Fe-24Cr-7Ni-3Mo-0.14N duplex stainless steel  

SciTech Connect (OSTI)

In this study, the effect of thermo-mechanical treatment on superplasticity of 24Cr-7Ni-3Mo-0.14N alloy was investigated at 850 C in three phase regime consisting of {alpha}, {gamma} and {sigma} phases. In order to examine the effect of thermo-mechanical treatment conditions on superplasticity, the solution treatment temperature and cold reduction ratio were varied. The effects of thermo-mechanical treatment conditions on the microstructural factors of constituent phases were analyzed. The relationships between the microstructural factors and superplasticity in Fe-24Cr-7Ni-3Mo-0.14N duplex stainless steel were discussed.

Han, Y.S.; Hong, S.H. [Korea Advanced Inst. of Science and Technology, Taejon (Korea, Republic of). Dept. of Materials Science and Engineering] [Korea Advanced Inst. of Science and Technology, Taejon (Korea, Republic of). Dept. of Materials Science and Engineering; [Center for Advanced Aerospace Materials, Pohang (Korea, Republic of)

1997-03-01T23:59:59.000Z

270

Hazard Assessment of Chemical Air Contaminants Measured in Residences  

SciTech Connect (OSTI)

Identifying air pollutants that pose a potential hazard indoors can facilitate exposure mitigation. In this study, we compiled summary results from 77 published studies reporting measurements of chemical pollutants in residences in the United States and in countries with similar lifestyles. These data were used to calculate representative mid-range and upper bound concentrations relevant to chronic exposures for 267 pollutants and representative peak concentrations relevant to acute exposures for 5 activity-associated pollutants. Representative concentrations are compared to available chronic and acute health standards for 97 pollutants. Fifteen pollutants appear to exceed chronic health standards in a large fraction of homes. Nine other pollutants are identified as potential chronic health hazards in a substantial minority of homes and an additional nine are identified as potential hazards in a very small percentage of homes. Nine pollutants are identified as priority hazards based on the robustness of measured concentration data and the fraction of residences that appear to be impacted: acetaldehyde; acrolein; benzene; 1,3-butadiene; 1,4-dichlorobenzene; formaldehyde; naphthalene; nitrogen dioxide; and PM{sub 2.5}. Activity-based emissions are shown to pose potential acute health hazards for PM{sub 2.5}, formaldehyde, CO, chloroform, and NO{sub 2}.

Logue, J.M.; McKone, T.E.; Sherman, M. H.; Singer, B.C.

2010-05-10T23:59:59.000Z

271

Cathodic hydrogen embrittlement of a 22% chromium 5% nickel duplex stainless steel in sulfide containing 3.5 wt% NaCl solution  

SciTech Connect (OSTI)

Hydrogen embrittlement (HE) of a 2,205 duplex stainless steel has been studied by slow straining of tensile specimens in sulfide containing 3.5 wt% NaCl solution. A more complex sulfide-concentration-dependent loss in ductility was discovered at controlled potentials in {minus}1,100 mV (SCE). It is believed that HE was controlled by the critical concentration of S as a promoter at lower sulfide levels and recovery of ductility at higher sulfide concentrations was attributed to the role of the sulfide as a cathodic inhibitor. No stress corrosion cracking (SCC) was observed at anodic polarization in this system. The electrochemical results indicate that the corrosion potentials of 2,205 duplex stainless steel in 3.5 wt% NaCl solution move to the less noble direction with increasing the sulfide concentration or with decreasing the solution acidity. This trend was not influenced by the presence of dissolved oxygen. Under severe HE environments transgranular cleavage is the favored path for cracking.

Tsai, S.Y. [Industrial Technology Research Inst., Hsinchu (Taiwan, Province of China). Materials Research Labs.; Shih, H.C. [National Tsing Hua Univ., Hsinchu (Taiwan, Province of China). Dept. of Materials Science and Engineering; Yen, K.P. [National Chung Hsing Univ., Taichung (Taiwan, Province of China). Inst. of Materials Engineering

1996-08-01T23:59:59.000Z

272

Investigation of hydrogen induced cracking in 2205 duplex stainless steel in wet H{sub 2}S environments after isothermal treatment at 675, 750 and 900 deg. C  

SciTech Connect (OSTI)

The effect of isothermal treatment (at 675, 750 and 900 deg. C) on HIC (hydrogen induced cracking) in sour environments containing hydrogen sulphide of a 2205 duplex stainless steel has been investigated. The performance and microstructure of failed material were characterized by optical microscopy, scanning electron microscopy and also X-ray diffraction. Two kinds of Cr-, Mo-enriched intermetallic phases, {sigma} and {chi}, were found to precipitate preferentially at {alpha}/{gamma} interfaces and within {alpha} grains after different times of aging in the temperature range of 650-900 deg. C. After performing tests according to the NACE Standard TM 0284 (1987) the specimens were investigated by using quantitative metallography methods. The volume fraction of {sigma} phase was changed with the time of aging and {sigma} phase developed into coarse particles due to the high diffusibility of solute atoms at high temperatures. The variation of size and shape of {sigma} phase particles was obtained by applying different heat treatment conditions to 2205 steel specimens. The results showed that 2205 duplex stainless steel containing nearly 12 vol.% of {sigma} phase in dispersed conditions was resistant to step cracking in wet environments containing hydrogen sulphide. It was highly possible that a crack would propagate faster along the embrittled {sigma} phase. However, very small cracks were found at austenite-ferrite boundaries where o phase particles were also present.

Sozanska, Maria [Department of Materials Science, Silesian University of Technology, Krasinskiego 8, 40-019 Katowice (Poland)]. E-mail: maria.sozanska@polsl.pl; Klyk-Spyra, Katarzyna [Department of Materials Science, Silesian University of Technology, Krasinskiego 8, 40-019 Katowice (Poland)

2006-06-15T23:59:59.000Z

273

Conformation and dynamics of nucleotides in bulges and symmetric internal loops in duplex DNA studied by EPR and fluorescence spectroscopies  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer Bulges and loops were studied by both EPR and fluorescence spectroscopies using the probe C/C{sup f}. Black-Right-Pointing-Pointer One-base bulge was in a temperature-dependent equilibrium between looped-out and stacked states. Black-Right-Pointing-Pointer Bases in two- and three-base bulges were stacked at all temperatures, resulting in DNA bending. Black-Right-Pointing-Pointer Bases were stacked in symmetrical two- to five-base internal loops, according to EPR data. Black-Right-Pointing-Pointer Unexpectedly high fluorescence for the smaller loops indicated local structural perturbations. -- Abstract: The dynamics and conformation of base bulges and internal loops in duplex DNA were studied using the bifunctional spectroscopic probe C, which becomes fluorescent (C{sup f}) upon reduction of the nitroxide functional group, along with EPR and fluorescence spectroscopies. A one-base bulge was in a conformational equilibrium between looped-out and stacked states, the former favored at higher temperature and the latter at lower temperature. Stacking of bulge bases was favored in two- and three-base bulges, independent of temperature, resulting in DNA bending as evidenced by increased fluorescence of C{sup f}. EPR spectra of C-labeled three-, four- and five-base symmetrical interior DNA bulges at 20 Degree-Sign C showed low mobility, indicating that the spin-label was stacked within the loop. The spin-label mobility at 37 Degree-Sign C increased as the loops became larger. A considerable variation in fluorescence between different loops was observed, as well as a temperature-dependence within constructs. Fluorescence unexpectedly increased as the size of the loop decreased at 2 Degree-Sign C. Fluorescence of the smallest loops, where a single T{center_dot}T mismatch was located between the stem region and the probe, was even larger than for the single strand, indicating a considerable local structural deformation of these loops from regular B-DNA. These results show the value of combining EPR and fluorescence spectroscopy to study non-helical regions of nucleic acids.

Cekan, Pavol [University of Iceland, Science Institute, Dunhaga 3, 107 Reykjavik (Iceland)] [University of Iceland, Science Institute, Dunhaga 3, 107 Reykjavik (Iceland); Sigurdsson, Snorri Th., E-mail: snorrisi@hi.is [University of Iceland, Science Institute, Dunhaga 3, 107 Reykjavik (Iceland)

2012-04-13T23:59:59.000Z

274

Stabilizing contributions of sulfur-modified nucleotides: crystal structure of a DNA duplex with 2'-O-[2-(methoxy)ethyl]-2-thiothymidines  

SciTech Connect (OSTI)

Substitution of oxygen atoms by sulfur at various locations in the nucleic acid framework has led to analogs such as the DNA phosphorothioates and 4'-thio RNA. The phosphorothioates are excellent mimics of DNA, exhibit increased resistance to nuclease degradation compared with the natural counterpart, and have been widely used as first-generation antisense nucleic acid analogs for applications in vitro and in vivo. The 4'-thio RNA analog exhibits significantly enhanced RNA affinity compared with RNA, and shows potential for incorporation into siRNAs. 2-Thiouridine (s{sup 2}U) and 5-methyl-2-thiouridine (m{sup 5}s{sup 2}U) are natural nucleotide analogs. s{sup 2}U in tRNA confers greater specificity of codon-anticodon interactions by discriminating more strongly between A and G compared with U. 2-Thio modification preorganizes the ribose and 2'-deoxyribose sugars for a C3'-endo conformation, and stabilizes heteroduplexes composed of modified DNA and complementary RNA. Combination of the 2-thio and sugar 2'-O-modifications has been demonstrated to boost both thermodynamic stability and nuclease resistance. Using the 2'-O-[2-(methoxy)ethyl]-2-thiothymidine (m{sup 5}s{sup 2}Umoe) analog, we have investigated the consequences of the replacement of the 2-oxygen by sulfur for base-pair geometry and duplex conformation. The crystal structure of the A-form DNA duplex with sequence GCGTAT*ACGC (T* = m{sup 5}s{sup 2}Umoe) was determined at high resolution and compared with the structure of the corresponding duplex with T* = m{sup 5}Umoe. Notable changes as a result of the incorporation of sulfur concern the base-pair parameter 'opening', an improvement of stacking in the vicinity of modified nucleotides as measured by base overlap, and a van der Waals interaction between sulfur atoms from adjacent m{sup 5}s{sup 2}Umoe residues in the minor groove. The structural data indicate only minor adjustments in the water structure as a result of the presence of sulfur. The observed small structural perturbations combined with the favorable consequences for pairing stability and nuclease resistance (when combined with 2'-O-modification) render 2-thiouracil-modified RNA a promising candidate for applications in RNAi.

Diop-Frimpong, Benjamin; Prakash, Thazha P.; Rajeev, Kallanthottathil G.; Manoharan, Muthiah; Egli, Martin (Isis Pharm.); (Alnylam Pharm.); (Vanderbilt)

2010-03-05T23:59:59.000Z

275

welcome to university residences Boiler Gold Rush Check-In...........................Saturday, August 13 and  

E-Print Network [OSTI]

welcome to university residences #12;Boiler Gold Rush Check-In...........................Saturday, August 13 and Sunday, August 14, 2011 Boiler Gold Rush residence hall systems in the United States. weLcomE! 1 #12;Boiler GoLD Rush ParticiPants Your regular

Fernández-Juricic, Esteban

276

Bielefelder Poet in Residence ist eine Veranstaltung des Fachs Germanistik der Fakultt fr Linguistik und Literatur-  

E-Print Network [OSTI]

Bielefelder Poet in Residence ist eine Veranstaltung des Fachs Germanistik der Fakultät für Studierenden die Werke des Poet, sie erfahren etwas vom ihrem/ seinem Schreiballtag ­ von Inspirationen öffentliche Lesungen. Den Auftakt der Reihe Bielefelder Poet in Residence macht 2012 Zoran Drvenkar. Er wurde

Moeller, Ralf

277

Organochlorine Pollutants and Stable Isotopes in Resident and Migrant Passerine Birds from Northwest Michoacan, Mexico  

E-Print Network [OSTI]

Organochlorine Pollutants and Stable Isotopes in Resident and Migrant Passerine Birds from Northwest Michoaca´n, Mexico Miguel A. Mora Received: 22 October 2007 / Accepted: 20 December 2007 to assess if resident and migrant birds wintering in western Michoaca´n, Mexico accumulated elevated

Mora, Miguel A.

278

Copy 1 Purchasing Copy 2 Residence Hall Director Request for Reimbursement  

E-Print Network [OSTI]

copy to the Purchasing Office. 3. The Purchasing Director will review the "Request for RequestCopy 1 ­ Purchasing Copy 2 ­ Residence Hall Director MU 6/94 Request for Reimbursement For Damages: _________________________________________________________________________________________ _________________________________________________________________________________________ _________________________________________________________________________________________ #12;Copy 1 ­ Purchasing Copy 2 ­ Residence Hall Director PROCEDURES FOR REQUESTING REIMBURSEMENT

Hardy, Christopher R.

279

Antalya Residents Attitudes Regarding the Impacts of All-Inclusive Resorts in the Turkish Coastal Destination  

E-Print Network [OSTI]

to such leakage. In an effort to better understand AIR, the purpose of this study was to examine how residents perceive the impacts of AIR in Antalya, Turkey. In so doing, a further focus of the work was looking at the interrelationships between residents...

Erul, Emrullah

2014-07-11T23:59:59.000Z

280

Autonomous Crack Displacement Monitoring of a Residence Near a Quarry David E. Kosnik, Northwestern University  

E-Print Network [OSTI]

Autonomous Crack Displacement Monitoring of a Residence Near a Quarry David E. Kosnik, Northwestern remote mon- itoring of cracks in interior and exterior walls of a residence near a limestone quarry for construction and raw materials. For instance, neighbors of road aggregate quarries often perceive

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

University of Kentucky 2013-2014 Undergraduate Bulletin 323 PolicyonResidency  

E-Print Network [OSTI]

University of Kentucky 2013-2014 Undergraduate Bulletin 323 PolicyonResidency 13 KAR 2 in the classification of a person as a Kentucky resident or as a nonresident for admission and tuition assessment 164.001(12) if the type of institution is not expressly stated and includes the Kentucky Virtual

MacAdam, Keith

282

Commuting behavior of western U.S. residents  

SciTech Connect (OSTI)

Estimation and interpretation of commutes to work has been studied extensively with respect to gender, race, and income. While the literature is extensive in these areas, there has been little research on regional differences between US states and territories. Since data which reports the commute to work is in average minutes, the distance traveled is estimated using estimates of the distance between home and work county centroids. The models differ in estimation of in-county commutes. The first assumes that the commute is equal to the radius of the county and the second estimates the commute as a weighted distance based on place location. Two data sets are compared, US National Guard data and US census data. Goal of this paper is to make conclusions about the commuting behavior of western residents through the use of these estimates, and therefore to provide a estimation method for distance commutes which can be used in further research. It is concluded that the radius method of estimation may be an over estimation, in particular in the western states. Since the non-western states are generally more homogeneously populated, this overestimation is not observed. It is recommended that the place location method be used for similar research, in particular studies dealing with western states. Suggestions are made for further research and recommendations are made for the US Army National Guard in regards to recruiting.

Caviglia, J. [Tennessee Univ., Knoxville, TN (United States)]|[Oak Ridge National Lab., TN (United States)

1996-06-01T23:59:59.000Z

283

Results of the 2012-2013 Association of Residents in Radiation Oncology (ARRO) Job Search and Career Planning Survey of Graduating Residents in the United States  

SciTech Connect (OSTI)

Purpose/Objective(s): To determine the timeline used by postgraduate year (PGY)-5 radiation oncology residents during the job application process and the factors most important to them when deciding on a first job. Methods and Materials: In 2012 and 2013, the Association of Residents in Radiation Oncology conducted a nationwide electronic survey of PGY-5 radiation oncology residents in the United States during the final 2 months of their training. Descriptive statistics are reported. In addition, subgroup analysis was performed. Results: Surveys were completed by 180 of 314 residents contacted. The median time to start networking for the purpose of employment was January PGY-4; to start contacting practices, complete and upload a curriculum vitae to a job search website, and use the American Society of Radiation Oncology Career Center was June PGY-4; to obtain letters of recommendation was July PGY-5; to start interviewing was August PGY-5; to finish interviewing was December PGY-5; and to accept a contract was January PGY-5. Those applying for a community position began interviewing at an earlier average time than did those applying for an academic position (P=.04). The most important factors to residents when they evaluated job offers included (in order from most to least important) a collegial environment, geographic location, emphasis on best patient care, quality of support staff and facility, and multidisciplinary approach to patient care. Factors that were rated significantly different between subgroups based on the type of position applied for included adequate mentoring, dedicated research time, access to clinical trials, amount of time it takes to become a partner, geographic location, size of group, starting salary, and amount of vacation and days off. Conclusions: The residents' perspective on the job application process over 2 years is documented to provide a resource for current and future residents and employers to use.

Mattes, Malcolm D., E-mail: mdm9007@nyp.org [Department of Radiation Oncology, New York Methodist Hospital, Brooklyn, New York (United States); Kharofa, Jordan [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Zeidan, Youssef H. [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Tung, Kaity [Department of Radiation Oncology, New York Methodist Hospital, Brooklyn, New York (United States); Gondi, Vinai [Department of Radiation Oncology, University of Wisconsin Comprehensive Cancer Center, Madison, Wisconsin (United States); Department of Radiation Oncology, Central Dupage Hospital Cancer Center, Warrenville, Illinois (United States); Golden, Daniel W. [Department of Radiation Oncology, Pritzker School of Medicine, University of Chicago, Chicago, Illinois (United States)

2014-01-01T23:59:59.000Z

284

Dislocation structures in the bands of localized cyclic plastic strain in austenitic 316L and austenitic-ferritic duplex stainless steels  

SciTech Connect (OSTI)

Dislocation structures in bands corresponding to cyclic strain localization have been studied in two types of stainless steels, single phase austenitic 316L steel and two-phase austenitic-ferritic duplex steel. Dislocation structures are documented in thin foils oriented approximately perpendicular to the active slip plane of individual grains and parallel to the primary Burgers vector. Persistent slip bands, with the structure more or less reminiscent of the well-known ladder structure, were found in austenitic grains of both steels. These bands can be correlated with the distinct surface relief consisting of extrusions, intrusions and shallow surface cracks in austenitic grains were found. The distribution of the wall and labyrinth structure embedded in the matrix structure in ferritic grains, which was proposed to be responsible for the localization of the cyclic strain, however, does not correspond to the distribution of the distinct surface slip lines on the surface.

Kruml, T.; Polak, J.; Obrtlik, K. [Academy of Sciences of the Czech Republic, Brno (Czech Republic). Inst. of Physics of Materials] [Academy of Sciences of the Czech Republic, Brno (Czech Republic). Inst. of Physics of Materials; Degallaix, S. [Ecole Centrale de Lille, Villeneuve d`Ascq (France). Lab. de Mecanique de Lille] [Ecole Centrale de Lille, Villeneuve d`Ascq (France). Lab. de Mecanique de Lille

1997-12-01T23:59:59.000Z

285

Improving Domotic Services Combining a Dialog System and a Resident Tracking System  

E-Print Network [OSTI]

equip a house nowadays include: alarm systems, HVAC systems (Heating, Ventilation, and Air Conditioning, consider a lights remote control: if the resident has a wireless remote control with which he can control

Instituto de Sistemas e Robotica

286

Investigation of colonias residents' potential for self-help housing construction  

E-Print Network [OSTI]

recommendations for methods of providing assistance. Because the findings showed that colonias residents could not be grouped according to employment, that the original hypothesis needed revision. It was found that no abilities were requisite to self...

Roach, Katherine Anne

1993-01-01T23:59:59.000Z

287

The effects of 24 hour reality orientation nursing staff training on two groups of elderly residents  

E-Print Network [OSTI]

APPENDIX E: Four Scales Used for the Neasures of Resident Orientation, Staf f Attitudes toward the Elderly, a Staff Job Satis- faction and Nursing Staff Instruction and Code Porno . . . . . . . . . . . . 85 APPENDIX F: The Observer Rating Form 96...

Cardiff, Donna Kaye

1980-01-01T23:59:59.000Z

288

Utility of the CORD ECG Database in Evaluating ECG Interpretation by Emergency Medicine Residents  

E-Print Network [OSTI]

the assessment and teaching of ECG skills. It allowed morefor incorporation into an ECG curriculum in EM residencyRESEARCH Utility of the CORD ECG Database in Evaluating ECG

Wong, Hubert E; Kazzi, A Antoine; Langdorf, Mark I

2002-01-01T23:59:59.000Z

289

Going Green? Urban vs. Rural Residency and Pro-Environmental Attitudes in China  

E-Print Network [OSTI]

GOING GREEN? URBAN VS. RURAL RESIDENCY AND PRO-ENVIRONMENTAL ATTITUDES IN CHINA Major: Political Science April 2009 Submitted to the Office of Undergraduate Research Texas A&M University in partial fulfillment... of the requirements for the designation as UNDERGRADUATE RESEARCH SCHOLAR A Senior Scholars Thesis by SAMANTHA LEE-MING CHIU GOING GREEN? URBAN VS. RURAL RESIDENCY AND PRO-ENVIRONMENTAL ATTITUDES IN CHINA Approved by: Research Advisor: Robert...

Chiu, Samantha

290

An exploration of sequence specific DNA-duplex/pyrene interactions for intercalated and surface-associated pyrene species. Final report, May 1, 1993--December 31, 1996  

SciTech Connect (OSTI)

The broad objective of this DOE sponsored work on photoinduced electron transfer (ET) within covalently modified DNA was to learn about the rates of Et among various DNA bases and commonly used organic electron donor (D) and acceptor (A) molecules. This hypothesis driven, multidisciplinary project combined skills in modified nucleic acid synthesis and in continuous and time-resolved optical spectroscopies. Covalently modified DNA chemistry as investigated in this program had two specific long term goals. The first was to use experimental and theoretical insights into the mechanisms of electron transfer (ET) reactions to design supramolecular assemblies of redox-active chromophores that function as efficient vectorial ET engines. The second was to construct oligonucleotide probes for real-time monitoring of intracellular processes involving DNA and RNA such as m-RNA expression and translocation. This research project laid the groundwork for studying ET reactions within DNA duplexes by examining the photophysics of uridine nucleosides which are covalently labeled at the 5-position with 1-pyrenyl chromophores.

Netzel, T.L.

1997-03-01T23:59:59.000Z

291

Investigation of the Kinetics of the Ferrite/Austenite Phase Transformation in the HAZ of a 2205 Duplex Stainless Steel Weldment  

SciTech Connect (OSTI)

A semi-quantitative map based on a series of spatially resolved X-ray diffraction (SRXRD) scans shows the progression of the ferrite ({delta})/austenite ({gamma}) phase balance throughout the HAZ during GTA welding of a 2205 duplex stainless steel (DSS). This map shows an unexpected decrease in the ferrite fraction on heating, followed by a recovery to the original ferrite fraction on cooling at locations within the HAZ. Even though such behavior is supported by thermodynamic calculations, it has not been confirmed by either experimental methods or have the kinetics been evaluated. Both Gleeble thermal simulations and time resolved x-ray diffraction measurements on spot welds in the 2205 DSS provide further evidence for this rather low-temperature transformation. On the other hand, calculations of the diffusion of alloying elements across the 6/y interface under a variety of conditions shed no further light on the driving force for this transformation. Further work on the mechanisms and driving forces for this transformation is on-going.

Palmer, T A; Elmer, J W; Wong, J; Babu, S S; Vitek, J M

2002-03-14T23:59:59.000Z

292

Long-term embrittlement of cast duplex stainless steels in LWR systems. Semiannual report, April--September 1992: Volume 7, No. 2  

SciTech Connect (OSTI)

This progress report summarizes work performed by Argonne National Laboratory on longterm thermal embrittlement of cast duplex stainless steels in LWR systems during the six months from April--September 1992. A procedure and correlations are presented for predicting Charpy-impact energy, tensile flow stress, fracture toughness J-R curve, tearing modulus, and J{sub IC} of aged cast stainless steels from known material information. The ``saturation`` impact strength and fracture toughness of a specific cast stainless steel, i.e., the minimum value that would be achieved for the material after long-term service, is estimated from the chemical composition of the steel. Mechanical properties as a function of time and temperature of reactor service are estimated from impact energy and flow stress of the unaged material and the kinetics of embrittlement, which are also determined from chemical composition. The J{sub IC} values are determined from the estimated J-R curve and flow stress. Examples of estimating mechanical properties of cast stainless steel components during reactor service are presented. A common ``lower-bound`` J-R curve for cast stainless steels of unknown chemical composition is also defined for a given grade of steel, ferrite content, and temperature.

Chopra, O.K. [Argonne National Lab., IL (United States)

1993-07-01T23:59:59.000Z

293

Representation of the molecular structure of petroleum resid through characterization and Monte Carlo modeling  

SciTech Connect (OSTI)

Increased refining of heavy petroleum feedstocks has led to greater interest in the chemical and physical properties of resid. Although resid has been implicated in many processing difficulties, very little detailed structural information is available in the literature. This is mainly due to the molecular complexity and high initial boiling point of the material, which makes traditional analytical methods difficult or impossible to use. To cope with these problems a stochastic molecular level construction model coupled to a global optimization program has been developed. Structural attributes were defined in terms of aromatic and naphthenic rings and alkyl sidechains. The attributes were quantified using probability density functions (pdfs). By stochastically sampling the attributes many times a large number of molecules representative of a resid were constructed. Using initial starting points estimated from the literature, optimal structural attributes were found in an iterative manner by comparing the predicted resid properties with actual experimental measurements. The program yields detailed structural information in the form of probability density functions for the initial resid.

Trauth, D.M.; Stark, S.M.; Petti, T.F.; Neurock, M.; Yasar, M.; Klein, M.T.

1993-12-31T23:59:59.000Z

294

Risk communication with Fukushima residents affected by the Fukushima Daiichi accident at whole-body counting  

SciTech Connect (OSTI)

After the Tokyo Electric Power Company (TEPCO) Fukushima Daiichi nuclear power plant accident, the Tokai Research and Development Center of the Japan Atomic Energy Agency (JAEA) have had direct dialogue as risk communication with Fukushima residents who underwent whole-body counting examination (WBC). The purpose of the risk communication was to exchange information and opinions about radiation in order to mitigate Fukushima residents' anxiety and stress. Two kinds of opinion surveys were performed: one survey evaluated residents' views of the nuclear accident itself and the second survey evaluated the management of WBC examination as well as the quality of JAEA's communication skills on risks. It appears that most Fukushima residents seem to have reduced their anxiety level after the direct dialogue. The results of the surveys show that Fukushima residents have the deepest anxiety and concern about their long-term health issues and that they harbor anger toward the government and TEPCO. On the other hand, many WBC patients and patients' relatives have expressed gratitude for help in reducing their feelings of anxiety.

Gunji, I.; Furuno, A.; Yonezawa, R.; Sugiyama, K. [Risk Communication Study Office, Japan Atomic Energy Agency 4-33 Muramatsu, Tokai-mura, Ibaraki, 319-1194 (Japan)

2013-07-01T23:59:59.000Z

295

Lung cancer among women residing close to an arsenic emitting copper smelter  

SciTech Connect (OSTI)

Lung cancer deaths occurring between 1935 and 1969 among women residing near an arsenic emitting smelter were examined. For three geographically defined exposure groups, the observed and expected number of lung cancer deaths were compared. In none of the exposure groups did the observed number of deaths exceed the expected. However, an index of exposure based on distance of residence from the smelter and duration of residence in the area was 27% higher for cases than for age-matched controls (p = .10). Adjusting for a latency of 20 yr, case exposures were 23% higher than for controls (p = .07). Dividing individuals into quintiles of exposure yielded odds ratios ranging from 1 to 1.6 (test of trend, p = .07).

Frost, F.; Harter, L.; Milham, S.; Royce, R.; Smith, A.H.; Hartley, J.; Enterline, P.

1987-05-01T23:59:59.000Z

296

The effect of mean cell residence time on the adsorbability of dissolved organic compounds found in petrochemical wastewaters  

E-Print Network [OSTI]

, each with a different mean cell residence time, biologically treated the waste- water. Follow1ng biolog1cal treatment, the wastewater was subjected to activated carbon adsorption treatment. The Freundlich isotherm, non-adsorbable organic compound... residence time on adsorbability is the same for petrochemical wastewater as it is for municipal wastewater. The purpose of this thesis is to determine if the mean cell residence time in a biological treatment process can af'feet the ad- sorbability...

Johnson, Timothy Loring

1979-01-01T23:59:59.000Z

297

A survey of education and confidence level among graduating anesthesia residents with regard to selected peripheral nerve blocks  

E-Print Network [OSTI]

Proficiency in interscalene anesthesia-how many blocks areJE: A survey of exposure to regional anesthesia techniquesin American anesthesia residency training programs. Reg

Moon, Tiffany; Lim, Eunjung; Kinjo, Sakura

2013-01-01T23:59:59.000Z

298

Rolling-circle replication of UV-irradiated duplex DNA in the phi X174 replicative-form----single-strand replication system in vitro  

SciTech Connect (OSTI)

Cloning of the phi X174 viral origin of replication into phage M13mp8 produced an M13-phi X174 chimera, the DNA of which directed efficient replicative-form----single-strand rolling-circle replication in vitro. This replication assay was performed with purified phi X174-encoded gene A protein, Escherichia coli rep helicase, single-stranded DNA-binding protein, and DNA polymerase III holoenzyme. The nicking of replicative-form I (RFI) DNA by gene A protein was essentially unaffected by the presence of UV lesions in the DNA. However, unwinding of UV-irradiated DNA by the rep helicase was inhibited twofold as compared with unwinding of the unirradiated substrate. UV irradiation of the substrate DNA caused a strong inhibition in its ability to direct DNA synthesis. However, even DNA preparations that contained as many as 10 photodimers per molecule still supported the synthesis of progeny full-length single-stranded DNA. The appearance of full-length radiolabeled products implied at least two full rounds of replication, since the first round released the unlabeled plus viral strand of the duplex DNA. Pretreatment of the UV-irradiated DNA substrate with purified pyrimidine dimer endonuclease from Micrococcus luteus, which converted photodimer-containing supercoiled RFI DNA into relaxed, nicked RFII DNA and thus prevented its replication, reduced DNA synthesis by 70%. Analysis of radiolabeled replication products by agarose gel electrophoresis followed by autoradiography revealed that this decrease was due to a reduction in the synthesis of progeny full-length single-stranded DNA. This implies that 70 to 80% of the full-length DNA products produced in this system were synthesized on molecules that carried photodimers.

Shavitt, O.; Livneh, Z.

1989-06-01T23:59:59.000Z

299

Observations of Ferrite/Austenite Transformations in the Heat Affected Zone of 2205 Duplex Stainless Steel Spot Welds Using Time Resolved X-Ray Diffraction  

SciTech Connect (OSTI)

Time Resolved X-Ray Diffraction (TRXRD) measurements are made in the Heat Affected Zone (HAZ) of 2205 Duplex Stainless Steel (DSS) spot welds. Both the {gamma} {yields} {delta} and {delta} {yields} {gamma} transformations are monitored as a function of time during the rapid spot weld heating and cooling cycles. These observations are then correlated with calculated thermal cycles. Where the peak temperatures are highest ({approx}1342 C), the {gamma} {yields} {delta} transformation proceeds to completion, leaving a ferritic microstructure at the end of heating. With lower peak temperatures, the {gamma} {yields} {delta} transformation proceeds to only partial completion, resulting in a microstructure containing both transformed and untransformed austenite. Further analyses of the individual diffraction patterns show shifts in the peak positions and peak widths as a function of both time and temperature. In addition, these changes in the peak characteristics are correlated with measured changes in the ferrite volume fraction. Such changes in the peak positions and widths during the {gamma} {yields} {delta} transformation provide an indication of changes occurring in each phase. These changes in peak properties can be correlated with the diffusion of nitrogen and other substitutional alloying elements, which are recognized as the primary mechanisms for this transformation. Upon cooling, the {delta} {yields} {gamma} transformation is observed to proceed from both the completely and partially transformed microstructural regions in the TRXRD data. An examination of the resulting microstructures confirms the TRXRD observation as the evidence shows that austenite both nucleates and grows from the ferritic microstructure at locations closest to the fusion zone boundary and grows from untransformed austenite grains at locations further from this boundary.

Palmer, T; Elmer, J; Babu, S

2003-10-29T23:59:59.000Z

300

Short-Term Monitoring to Diagnose Comfort Problems in a Residence in Central Texas  

E-Print Network [OSTI]

on the house (i.e., cleaning the cooling coils, enlarging the compressor and relining of the return duct). Measurements were then repeated to determine that the problem had been f ~ e d . This paper describes the case study residence, the measurements used...

Kootin-Sanwu, V.; Sresthaputra, A.; Haberl, J. S.

2000-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

NON-RESIDENT ALIEN DATA COLLECTION FORM Last or Family Name ___________________________________ First Name _____________________________  

E-Print Network [OSTI]

NON-RESIDENT ALIEN DATA COLLECTION FORM Last or Family Name for Nonresident Aliens. A nonresident alien subject to wage withholding must give the employer a completed Form W, nonresident aliens should use the following instructions: 1) Check only "Single" marital status on line 3

Yates, Andrew

302

Effect of matrix acidity on resid cracking activity of FCC catalysts  

SciTech Connect (OSTI)

The importance of matrix acid sites on the cracking of large resid molecules in heavy crude fractions is discussed. The challenge of measuring fresh matrix acidity was overcome by first destroying the zeolite by treating the catalyst with concentrated acid and then titrating the acid sites by thermogravimetry of pyridine. Due to differences in hydrothermal stability, the acidity of matrix in its fresh form did not correlate with the commercial resid cracking activity on an equilibrated catalyst. To overcome this drawback, the zeolite was destroyed by steaming at 870{degrees}C. Such severe treatment created a matrix that closely resembled that of the commercially equilibrated catalyst. Changes in the nature of acid sites were investigated by performing diffuse reflectance infrared spectroscopy (DRIFTS) measurements on fresh and steamed matrices. While Lewis acid sites were predominant on most fresh matrices, the population of Bronsted acid sites increased as a result of hydrothermal deactivation. The correlations between each type of acidity and commercial resid cracking are discussed. The incorporation of acid density, type, and stability into a comprehensive model is shown to be an important prerequisite for designing robust resid cracking catalysts.

Alerasool, S.; Doolin, P.K.; Hoffman, J.F. [Ashland Petroleum Company, Ashland, KY (United States)

1996-10-01T23:59:59.000Z

303

Utah Department of Health Bureau of Health Facility Licensing, Certification and Resident Assessment  

E-Print Network [OSTI]

Utah Department of Health Bureau of Health Facility Licensing, Certification and Resident of Utah Rule R432-31 (http://health.utah.gov/hflcra/forms.php) This is a physician order sheet based be effectively managed at current setting. ___ Limited additional interventions: Includes care above. May also

Tipple, Brett

304

OPTIMISATION OF EXTRUDED POLYMER FOAM BY THE RESIDENT TIME DISTRIBUTION APPROACH  

E-Print Network [OSTI]

to simulate the twin-screw extruder[1] to [11] . In this paper, we have studied the processing of polystyrene foam by extrusion in a single screw extruder coupled with a gear pump. The basic principle of foamingOPTIMISATION OF EXTRUDED POLYMER FOAM BY THE RESIDENT TIME DISTRIBUTION APPROACH Frédéric Leonardi

Paris-Sud XI, Université de

305

In Brief . ... resident scholar in the Center for Energy and Mineral Resources, will  

E-Print Network [OSTI]

In Brief . ... resident scholar in the Center for Energy and Mineral Resources, will administer production of hatchery seed and the culture of marketable oysters. They also hope to increase productivity director of Texas A&M Univer- sity's Center for Marine Resources, the University reports. Hann, who

306

USING RESIDENT SMALL MAMMALS TO ASSESS THE HABITAT POTENTIAL OF EXPERIMENTAL BIOFUELS FEEDSTOCKS  

E-Print Network [OSTI]

USING RESIDENT SMALL MAMMALS TO ASSESS THE HABITAT POTENTIAL OF EXPERIMENTAL BIOFUELS FEEDSTOCKS ...................................................................................................................35 CHAPTER 2: Comparing survival of deer mice across experimental biofuels plots in Eastern South ...................................................................................................................65 CHAPTER 3: Small mammal diversity across 4 experimental biofuels plots in Eastern South Dakota

307

Keeping the Intelligent Environment Resident in the Loop Parisa Rashidi and Diane J. Cook*  

E-Print Network [OSTI]

Keeping the Intelligent Environment Resident in the Loop Parisa Rashidi and Diane J. Cook* *School will become part of our everyday environments. However, many of these technologies are brittle and do and requests. 1 Introduction Recently there has been extensive research to develop smart environments

Cook, Diane J.

308

Staff summary of Issues & Recommendations Resident Fish Substitution/Blocked Area Mitigation  

E-Print Network [OSTI]

1 Staff summary of Issues & Recommendations Resident Fish Substitution/Blocked Area Mitigation *Preliminary draft, please refer to full recommendations for complete review 10/29/2013 10:08:05 AM 2009 Fish and Wildlife Program Section Section II.C. 1. Substitution for Anadromous Fish Losses Section II. D. 8

309

Energy-Performance Trade-offs for Spatial Access Methods on Memory-Resident Data  

E-Print Network [OSTI]

Energy-Performance Trade-offs for Spatial Access Methods on Memory-Resident Data Ning An Sudhanva-force approach that does not use an index. The results show that there are both performance and energy trade also play an important role in determining the energy-performance trade-offs. Further, technological

Gurumurthi, Sudhanva

310

Public Park Ecology and Neighborhood Crime: Assessing Resident Perceptions of Crime and Park Quality  

E-Print Network [OSTI]

Public Park Ecology and Neighborhood Crime: Assessing Resident Perceptions of Crime and Park's perceptions of danger [2]. · The Ecology of fear hypothesis suggests that the types and maintenance of park vegetation and landscaping affect both the incidence of crime and public perceptions of it [2]. Analyses

Hall, Sharon J.

311

The Effects of Residency and Body Size on Contest Initiation and Outcome in the Territorial Dragon,  

E-Print Network [OSTI]

, Ctenophorus decresii Kate D. L. Umbers, Louise Osborne, J. Scott Keogh* Research School of Biology, Australian, Osborne L, Keogh JS (2012) The Effects of Residency and Body Size on Contest Initiation and Outcome in many species [5­ 7]. In sand gobies for example, males fight over nest sites and winners are on average

Keogh, Scott

312

Resident Microbiota of the Gypsy Moth Midgut Harbors Antibiotic Resistance Determinants  

E-Print Network [OSTI]

for them. Significantly, antibiotic-resistant human pathogens are carried by flies and cockroachesResident Microbiota of the Gypsy Moth Midgut Harbors Antibiotic Resistance Determinants Heather K the significance of insects as environmental reservoirs of antibiotic-resistant bacteria. We characterized

Handelsman, Jo

313

Genomic and physiological footprint of the Deepwater Horizon oil spill on resident marsh fishes  

E-Print Network [OSTI]

expression in gill tissues of larval and adult fish. These data suggest that heavily weathered crude oil from-seq | toxicogenomics Following the Deepwater Horizon (DWH) drilling disaster on April 20, 2011, in the Gulf of Mexico study monitoring the biological effects of oil exposure on fish resident in Gulf of Mexico coastal marsh

Whitehead, Andrew

314

Phase II Water Rental Pilot Project: Snake River Resident Fish and Wildlife Resources and Management Recommendations.  

SciTech Connect (OSTI)

The Idaho Water Rental Pilot Project was implemented in 1991 as part of the Non-Treaty Storage Fish and Wildlife Agreement between Bonneville Power Administration and the Columbia Basin Fish and Wildlife Authority. The goal of the project is to quantify resident fish and wildlife impacts resulting from salmon flow augmentation releases made from the upper Snake River Basin. Phase I summarized existing resource information and provided management recommendations to protect and enhance resident fish and wildlife habitat resulting from storage releases for the I improvement of an adromous fish migration. Phase II includes the following: (1) a summary of recent biological, legal, and political developments within the basin as they relate to water management issues, (2) a biological appraisal of the Snake River between American Falls Reservoir and the city of Blackfoot to examine the effects of flow fluctuation on fish and wildlife habitat, and (3) a preliminary accounting of 1993--1994 flow augmentation releases out of the upper Snake, Boise, and Payette river systems. Phase III will include the development of a model in which annual flow requests and resident fish and wildlife suitability information are interfaced with habitat time series analysis to provide an estimate of resident fish and wildlife resources.

Stovall, Stacey H.

1994-08-01T23:59:59.000Z

315

Autonomous Remote Crack Displacement Monitoring of a Residence Near a Limestone  

E-Print Network [OSTI]

Autonomous Remote Crack Displacement Monitoring of a Residence Near a Limestone Quarry, Naples a limestone quarry. The object is to quantitatively compare crack re- sponse to blast-induced ground motion for construction and raw materials. For instance, neighbors of road aggregate quarries often perceive

316

Safety Culture in Surgical Residency Programs across Virginia A Thesis Presented to  

E-Print Network [OSTI]

Safety Culture in Surgical Residency Programs across Virginia A Thesis Presented to the faculty One way to measure the safety of complex organizations is through safety culture surveys given. The results showed that one's role in an organization affects one's perception of safety, and that the culture

Virginia, University of

317

Welcome new and returning residents! Help us make USC greener by recycling! Your Room Recycling Bin  

E-Print Network [OSTI]

Welcome new and returning residents! Help us make USC greener by recycling! Your Room Recycling Bin Every room is provided with a recycling bin to make it easy for you to recycle while living in University Housing. Use this bin to collect mixed recyclables in your room and take them to your nearest

Almor, Amit

318

Social Behavior and Ecology of "Southern Resident" Killer Whales (Orcinus orca) Jennifer Anne Marsh  

E-Print Network [OSTI]

an extremely cohesive social structure (Bigg, Olesiuki, Ellis, Ford, & Balcomb, 1990), fluctuations in social state, which also include "transient" and "offshore" forms (Ford, Ellis & Balcomb, 2000). There are two matrilineal lines (Bigg, Olesiuki, Ellis, Ford, & Balcomb, 1990). "Northern resident" killer whales utilize

319

Second Place -Resident Basic Science Award 1995 Mitochondrial role in hair cell survival after injury  

E-Print Network [OSTI]

Second Place - Resident Basic Science Award 1995 Mitochondrial role in hair cell survival after biogenesis in hair cell survival after injury was evaluated by inhibiting mitochondrial protein synthesiswith chloramphenicol and then studying the effects on hair cell survival after exposure to two different types

Rubel, Edwin

320

This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax purposes can complete their Federal tax filing requirements. (Normally, individuals who have resided in the U.S. for less than 5  

E-Print Network [OSTI]

This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax are considered Non-Resident Aliens for tax purposes. Please consult I.R.S. Publication 519: U.S. Tax Guide for Aliens.) START HERE! Did you receive U.S.-source Did you receive a Form W-2 NOTE: If you earned U

Snider, Barry B.

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax purposes can complete their Federal tax filing requirements. (Normally, individuals who have resided in the U.S. for less than 5  

E-Print Network [OSTI]

This flowchart is meant to provide a suggested general overview of how Non-Resident Alien for tax are considered Non-Resident Aliens for tax purposes. Please consult I.R.S. Publication 519: U.S. Tax Guide for Aliens.) Did you claim a tax treaty for 2013? AND/OR Did you receive other taxable income or scholarship

Fraden, Seth

322

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)

2012-04-18T23:59:59.000Z

323

From the 2006 Conference Proceedings of the Association for Science Teacher Education OUR PHYSTEC PROJECT: COLLABORATING WITH A RESIDENT  

E-Print Network [OSTI]

PROJECT: COLLABORATING WITH A RESIDENT TEACHER TO IMPROVE AN ELEMENTARY SCIENCE FIELD EXPERIENCE Cody interns' science lessons. The project team, including a full-time teacher-in-residence, engaged to learning science. At Towson, the PhysTEC project team consists of Dr. Cody Sandifer and Dr. Laura Lising

Sandifer, Cody

324

COMMUNITY SPACE MONITOR (CSM) APPLICATION Thank you for applying for the Community Space Monitor position with the Residence Life department.  

E-Print Network [OSTI]

COMMUNITY SPACE MONITOR (CSM) APPLICATION Thank you for applying for the Community Space Monitor, .docx) and PDF (.pdf) format only. #12;Residence Life Updated August 2014 -1 of 3- Community Space Monitor: Job Description IDENTIFICATION Position Title: Community Space Monitor Department: Residence Life

325

open callEMPAC curtis r. priem experimental media and performing arts center ARTIST-IN-RESIDENCE PROGRAM  

E-Print Network [OSTI]

of a longer-term development process. A residency may be used to develop a part of a project, to explore, and overall resources. The review process will be led by our curatorial and production teams. Each project development of the financial plan for a residency is part of the review process. Research, Production

Linhardt, Robert J.

326

The role of the resid solvent in coprocessing with finely divided catalysts. Quarterly report, July--September 1993  

SciTech Connect (OSTI)

The research performed this quarter involved evaluating the resid as the solvent in coprocessing. Since the objective of this research contract is to determine if the naphthenic portion of resids is able to transfer hydrogen to coal, the resid was fractionated in order to obtain different compositional fractions for liquefaction reactions. In order to evaluate different fractions of resids, the fractions must first be separated by liquid chromatography. The literature was surveyed as described below to determine the most feasible of effecting the separation. Methods used to analyze the fractions were also examined. On the basis of the information obtained, an experimental procedure was developed for separating the resid into fractions and then analyzing the fractions by Fourier transform infrared spectroscopy (FTIR) and by {sup 13}C nuclear magnetic resonance.

Curtis, C.W.

1993-12-31T23:59:59.000Z

327

Heating Energy Meter Validation for Apartments  

E-Print Network [OSTI]

Household heat metering is the core of heating system reform. Because of many subjective and objective factors, household heat metering has not been put into practice to a large extent in China. In this article, the research subjects are second...

Cai, B.; Li, D.; Hao, B.

2006-01-01T23:59:59.000Z

328

Cascade Apartments: Deep Energy Multifamily Retrofit  

SciTech Connect (OSTI)

In December of 2009-10, King County Housing Authority (KCHA) implemented energy retrofit improvements in the Cascade multifamily community, located in Kent, Washington (marine climate.)This research effort involved significant coordination from stakeholders KCHA, WA State Department of Commerce, utility Puget Sound Energy, and Cascade tenants. This report focuses on the following three primary BA research questions : 1. What are the modeled energy savings using DOE low income weatherization approved TREAT software? 2. How did the modeled energy savings compare with measured energy savings from aggregate utility billing analysis? 3. What is the Savings to Investment Ratio (SIR) of the retrofit package after considering utility window incentives and KCHA capitol improvement funding.

Gordon, A.; Mattheis, L.; Kunkle, R.; Howard, L.; Lubliner, M.

2014-02-01T23:59:59.000Z

329

Identifying apartment buildings with potential heating issues.  

E-Print Network [OSTI]

??The residential sector in Sweden uses a large amount of energy for heating and hot water. Sweden as well as all other European countries need (more)

Rooij, Joris van

2011-01-01T23:59:59.000Z

330

Apartment Hunting Checklist FURNITURE AND APPLIANCES  

E-Print Network [OSTI]

), close and lock? Hallway & outdoor lighting sufficient? STATE OF REPAIR Doors & windows fit securely light fixture covers broken or missing? Covers on light switches & electrical outlets? Electrical to be replaced? Cleaned? Enough light in each room? Need lamps? DON'T FORGET TO CHECK Enough electrical outlets

Kravets, Robin

331

Un aparte con Roberto Ramos-Perea  

E-Print Network [OSTI]

y sacarla. El proceso creativo es complejsimo, pero siempre he encontrado que el teatro es el medio ms concreto, ms directo, ms responsable de comunicar una idea. Cuntas obras has escrito? El otro da hice un censo y son cuarenta y dos. De... perodo de preparacin ? Es todo un proceso. Por ejemplo, para la obra que tengo en mente en estos momentos llevo preparndome tres aos y todava no he escrito una sola letra. Porque la cantidad de lectura que hay que hacer, los simulacros de vivencia...

Montañ ez, Carmen L.

1996-10-01T23:59:59.000Z

332

Supra-Canonical 26Al/27Al and the Residence Time of CAIs in the  

E-Print Network [OSTI]

Supra-Canonical 26Al/27Al and the Residence Time of CAIs in the Solar Protoplanetary Disk Edward D initial 26Al/27Al ratio of 4.5 ? 10­5 has been a fiducial marker for the beginning of the solar system that some CAIs had initial 26Al/27Al values at least 25% greater than canonical and that the canonical

Harrison, Mark

333

Reconstruction of Long-Lived Radionuclide Intakes for Techa Riverside Residents: Cesium-137  

SciTech Connect (OSTI)

Radioactive contamination of the Techa River (Southern Urals, Russia) occurred from 19491956 due to routine and accidental releases of liquid radioactive wastes from the Mayak Production Association. The long-lived radionuclides in the releases were 90Sr and 137Cs. Contamination of the components of the Techa River system resulted in chronic external and internal exposure of about 30,000 residents of riverside villages. Data on radionuclide intake with diet are used to estimate internal dose in the Techa River Dosimetry System (TRDS), which was elaborated for the assessment of radiogenic risk for Techa Riverside residents. The 90Sri ntake function was recently improved taking into account the recently available archival data on radionuclide releases and in-depth analysis of the extensive data on 90Sr measurements in Techa Riverside residents. The main purpose of this paper is to evaluate the dietary intake of 137Cs by Techa Riverside residents. The 137Cs intake with river water used for drinking was reconstructed on the basis of the 90Sr intake-function and the concentration ratio 137Cs/90Sr in river water. Intake via 137Cs transfer from floodplain soil to grass and cows milk was evaluated for the first time. As a result, the maximal 137Cs intake level was indicated near the site of releases in upper-Techa River settlements (8,0009,000 kBq). For villages located on the lower Techa River the 137Cs intake was significantly less (down to 300 kBq). Cows milk was the main source of 137Cs in diet in the upper-Techa.

Tolstykh, E. I.; Degteva, M. O.; Peremyslova, L. M.; Shagina, N. B.; Vorobiova, M. I.; Anspaugh, L. R.; Napier, Bruce A.

2013-05-01T23:59:59.000Z

334

The American Society for Radiation Oncology's 2010 Core Physics Curriculum for Radiation Oncology Residents  

SciTech Connect (OSTI)

Purpose: In 2004, the American Society for Radiation Oncology (ASTRO) published its first physics education curriculum for residents, which was updated in 2007. A committee composed of physicists and physicians from various residency program teaching institutions was reconvened again to update the curriculum in 2009. Methods and Materials: Members of this committee have associations with ASTRO, the American Association of Physicists in Medicine, the Association of Residents in Radiation Oncology, the American Board of Radiology (ABR), and the American College of Radiology. Members reviewed and updated assigned subjects from the last curriculum. The updated curriculum was carefully reviewed by a representative from the ABR and other physics and clinical experts. Results: The new curriculum resulted in a recommended 56-h course, excluding initial orientation. Learning objectives are provided for each subject area, and a detailed outline of material to be covered is given for each lecture hour. Some recent changes in the curriculum include the addition of Radiation Incidents and Bioterrorism Response Training as a subject and updates that reflect new treatment techniques and modalities in a number of core subjects. The new curriculum was approved by the ASTRO board in April 2010. We anticipate that physicists will use this curriculum for structuring their teaching programs, and subsequently the ABR will adopt this educational program for its written examination. Currently, the American College of Radiology uses the ASTRO curriculum for their training examination topics. In addition to the curriculum, the committee updated suggested references and the glossary. Conclusions: The ASTRO physics education curriculum for radiation oncology residents has been updated. To ensure continued commitment to a current and relevant curriculum, the subject matter will be updated again in 2 years.

Xiao Ying, E-mail: ying.xiao@jefferson.edu [Thomas Jefferson University Hospital, Philadelphia, PA (United States); De Amorim Bernstein, Karen [Montefiore Medical Center, Bronx, NY (United States); Chetty, Indrin J. [Henry Ford Health System, Detroit, MI (United States); Eifel, Patricia [M. D. Anderson Cancer Center, Houston, TX (United States); Hughes, Lesley [Cooper University Hospital, Camden, NJ (United States); Klein, Eric E. [Washington University, Saint Louis, MO (United States); McDermott, Patrick [William Beaumont Hospital, Royal Oak, MI (United States); Prisciandaro, Joann [University of Michigan, Ann Arbor, MI (United States); Paliwal, Bhudatt [University of Wisconsin, Madison, WI (United States); Price, Robert A. [Fox Chase Cancer Center, Philadelphia, PA (United States); Werner-Wasik, Maria [Thomas Jefferson University Hospital, Philadelphia, PA (United States); Palta, Jatinder R. [University of Florida, Gainesville, FL (United States)

2011-11-15T23:59:59.000Z

335

Factors that Determine Academic Versus Private Practice Career Interest in Radiation Oncology Residents in the United States: Results of a Nationwide Survey  

SciTech Connect (OSTI)

Purpose: To determine what factors US radiation oncology residents consider when choosing academic or nonacademic careers. Methods and Materials: A 20-question online survey was developed and sent to all US radiation oncology residents to assess factors that influence their career interest. Residents were asked to rate their interest in academics (A) versus private practice (PP) on a 0 (strong interest in A) to 100 (strong interest in PP) scale. Responses were classified as A (0-30), undecided (40-60), and PP (70-100). Residents were also asked to rank 10 factors that most strongly influenced their career interest. Results: Three hundred thirty-one responses were collected, of which 264 were complete and form the basis for this analysis. Factors that correlated with interest in A included having a PhD (P=.018), postgraduate year level (P=.0006), research elective time (P=.0003), obtaining grant funding during residency (P=.012), and number of publications before residency (P=.0001), but not number of abstracts accepted in the past year (P=.65) or publications during residency (P=.67). The 3 most influential factors for residents interested in A were: (1) baseline interest before residency; (2) academic role models; and (3) research opportunities during residency. The 3 most influential factors for residents interested in PP were: (1) baseline interest before residency; (2) academic role models; and (3) academic pressure and obligations. Conclusions: Interest in A correlated with postgraduate year level, degree, and research time during residency. Publications before but not during residency correlated with academic interest, and baseline interest was the most influential factor. These data can be used by residency program directors to better understand what influences residents' career interest.

Chang, Daniel T., E-mail: dtchang@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Shaffer, Jenny L. [Department of Radiation Oncology, Stanford University, Stanford, California (United States); Haffty, Bruce G. [Department of Radiation Oncology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, New Brunswick, New Jersey (United States); Wilson, Lynn D. [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut (United States)

2013-11-01T23:59:59.000Z

336

Design for the Frail Old: Environmental and Perceptual Influences on Corridor Walking Behaviors of Assisted Living Residents  

E-Print Network [OSTI]

living among these residents and yet, there is little research that has been done in this regard. The researcher conducted two studies in Central Texas to explore how corridor design features influenced indoor walking behaviors among assisted living...

Lu, Zhipeng

2010-10-12T23:59:59.000Z

337

Statewide Electricity and Demand Capacity Savings from the Implementation of IECC Code in Texas: Analysis for Single-Family Residences  

E-Print Network [OSTI]

This paper presents estimates of the statewide electricity and electric demand savings achieved from the adoption of the International Energy Conservation Code (IECC) for single-family residences in Texas and includes the corresponding increase...

Kim, H.; Baltazar, J.C.; Haberl, J.

2011-01-01T23:59:59.000Z

338

Idaho Water Rental Pilot Project Probability/Coordination Study Resident Fish and Wildlife Impacts Phase III, 1997 Annual Report.  

SciTech Connect (OSTI)

Phase III began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River Basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water.

Leitzinger, Eric J. (Idaho Department of Fish and Game, Boise, ID)

1998-10-01T23:59:59.000Z

339

A characterization and evaluation of coal liquefaction process streams. The kinetics of coal liquefaction distillation resid conversion  

SciTech Connect (OSTI)

Under subcontract from CONSOL Inc., the University of Delaware studied the mechanism and kinetics of coal liquefaction resid conversion. The program at Delaware was conducted between August 15, 1994, and April 30, 1997. It consisted of two primary tasks. The first task was to develop an empirical test to measure the reactivity toward hydrocracking of coal-derived distillation resids. The second task was to formulate a computer model to represent the structure of the resids and a kinetic and mechanistic model of resid reactivity based on the structural representations. An introduction and Summary of the project authored by CONSOL and a report of the program findings authored by the University of Delaware researchers are presented here.

Klein, M.T.; Calkins, W.H.; Huang, H.; Wang, S.; Campbell, D.

1998-03-01T23:59:59.000Z

340

The gated community: residents' crime experience and perception of safety behind gates and fences in the urban area  

E-Print Network [OSTI]

The primary purpose of the study is to explore the connections between residents' perception of safety and their crime experience, and the existence of gates and fences in multi-family housing communities in urban areas. For cultivating discussions...

Kim, Suk Kyung

2006-10-30T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Duplex Stainless Steels Margaret Gorog  

E-Print Network [OSTI]

, substituted for 6% mo SS in bleach plant Hyper DSS, Offshore oil applications Super, Hyper ­ Corrosion

Das, Suman

342

An occupational therapy intervention for residents with stroke related disabilities in UK care homes (OTCH): cluster randomised controlled trial  

E-Print Network [OSTI]

or drug addiction. Care home man- agers were offered a full explanation of the study. No care homes were actively delivering occupational ther- apy as a component of standard care. Once the managers had given informed consent, care home staff searched... to the treatment allo- cation of care homes. intervention and control Residents in the control arm received usual care. This did not involve an occupational therapy component. The occupational therapy intervention at the level of the care home resident followed...

Sackley, Catherine M.; Walker, Marion F.; Burton, Chris R.; Watkins, Caroline L.; Mant, Jonathan; Roalfe, Andrea K; Wheatley, Keith; Sheehan, Bart; Sharp, Leslie; Stant, Katie E; Fletcher-Smith, Joanna; Steel, Kerry; Wilde, Kate; Irvine, Lisa; Peryer, Guy

2015-02-05T23:59:59.000Z

343

Options, knowledge, and satisfaction of Texas residents affected by Edwards Aquifer issues: implications for education and government  

E-Print Network [OSTI]

OPINIONS, KNOWLEDGE, AND SATISFACTION OF TEXAS RESIDENTS AFFECTED BY EDWARDS AQUIFER ISSUES: IMPLICATIONS FOR EDUCATION AND GOVERNMENT A Thesis by AMY SUZETTE KINNEY Submitted to Texas A&M University in partial fulfillment of the requirements... Education ABSTRACT Opinions, Knowledge, and Satisfaction of Texas Residents Affected by Edwards Aquifer Issues: Implications for Education and Government. (December 1994) Amy Suzette Kinney, B. S. , Tarleton State University Chair of Advisory Committee...

Kinney, Amy Suzette

1994-01-01T23:59:59.000Z

344

The role of the resid solvent in co-processing with finely divided catalysts. Quarterly report April--June 1993  

SciTech Connect (OSTI)

The primary purpose of the work performed this quarter was to establish under thermal and catalytic reaction conditions whether hydrogen transfer occurred between cycloalkane type structures that are present in resids and heteroatomic species that are present in coal and liquefied coal. The research this quarter focused upon evaluating benzophenone (BENZ) as a model acceptor for hydrogen that might be transferred from a cycloalkane, perhydropyrene (PHP), under coprocessing conditions. Hence, a number of reactions was performed in which BENZ was reacted alone in hydrogen and nitrogen atmospheres in the presence and absence of a catalytic agent, molybdenum naphthenate. Reactions were also performed using a combination of PHP and BENZ at a 1 to 1 weight ratio. Also performing this quarter were initial separations with petroleum resids. Two different resids were used, Maya and LHC-362. The literature was also surveyed to determine important characteristics that should be evaluated for selecting resids. The resids that are desired for this project are resids with high-, medium-, and low-naphthenic content. Different levels of asphaltenes are also desirable. Resids with these characteristics are currently being sought. The model compound PHP that had been commercially available as naphthene representative of resids is now no longer available. Hence, several scoping experiments were performed in order to determine conditions for synthesizing PHP. The synthesis procedure reported in US Patent 3,303,227 was used as a basis for this work. Although more than 85% PHP was synthesized, partially hydrogenated pyrenes were also produced which will require separation in order to obtain pure PHP.

Curtis, C.W.

1993-11-01T23:59:59.000Z

345

Simulation of Off-Grid, Off-Pipe, Single-Family Detached Residences in US Climates  

E-Print Network [OSTI]

system type (wind, PV or hybrid), the capacity of electricity generating and storage systems were determined to meet/exceed the electricity use for days with inadequate solar radiation and wind. For locations with the potential of solar power...SimBuild 2008 Third National Conference of IBPSA-USA Berkeley, California July 30 ? August 1, 2008 116 SIMULATION OF OFF-GRID, OFF-PIPE, SINGLE-FAMILY DETACHED RESIDENCES IN U.S. CLIMATES Mini Malhotra1, Jeff Haberl2 1Research Assistant...

Malhotra, M.; Haberl, J.

346

Microcarbon residue yield and heteroatom partitioning between volatiles and solids for whole vacuum resids and their liquid chromatographic fractions  

SciTech Connect (OSTI)

Five petroleum >1000{degrees}F resids were separated into compound type fractions using liquid chromatography. The coking tendency of each compound type was assessed using the microcarbon residue (MCR) test (ASTM D 4530). Heteroatom (N, S, Ni, V) partitioning between MCR solids versus volatiles was determined through analysis of the starting fractions and the corresponding MCR solids. The weighted sum of MCR solid yields over all compound types in a given resid was typically in good agreement with the MCR yield of the whole resid. This finding agrees with prior studies indicating coke yield to be an additive property. Sulfur partitioning was also an additive property, was predictable from MCR yield, and was nearly independent of the initial form (sulfide, thiophenic, sulfoxide) present. Nitrogen and nickel partitioning were nonadditive and therefore composition dependent. Partitioning of vanadium into solids was essentially quantitative for all resids and their fractions. MCR solid yield was generally dependent only on H/C ratio. However, there is some evidence indicating secondary dependence on hydrocarbon structure; i.e., that naphthenic rings reduce MCR in proportion to H/C by virtue of their effective hydrogen transfer properties. Deposition of N and Ni into MCR solids over the fractions was often appreciably less than that of the whole resids, thereby indicating that interaction among various compound types was required for maximum incorporation of those elements into coke.

Green, J.B.; Shay, J.Y.; Reynolds, J.W.; Green, J.A.; Young, L.L.; White, M.E.

1993-10-01T23:59:59.000Z

347

Slow urban living apartments : transformation of five story walk-up apartments in Seoul  

E-Print Network [OSTI]

Experiential living is the new trend for future living. Whether it is through living in micro spaces, flexible units, mixed-use developments, practicing urban farming, or sharing lifestyles, these different trends of living ...

Lim, Yihyun

2014-01-01T23:59:59.000Z

348

Home > Visit apartments online > Vacation Rental > Bailleul I own an Apartment  

E-Print Network [OSTI]

with baker, wine shop, pharmacy and small bars and bistrots with a FRANPRIX supermarket nearby and security description: - 1890 Building, 4 floor, with lift, entry code security system, with interphone, 2 Bedrooms Apt clean. - Dishwasher, Refrigerator, Freezer, Cooking rings, Oven, Microwave, Dinnerware and serving

Gray, Robert M.

349

Home > Visit apartments online > Vacation Rental > Bailleul I own an Apartment  

E-Print Network [OSTI]

Paris ambience with baker, wine shop, pharmacy and small bars and bistrots with a FRANPRIX supermarket floor, entry code security system, with interphone, 2 Bedrooms Apt, furnished, 66m / 660 sqft, high. - Dishwasher, Refrigerator, Freezer, Cooking rings, Oven, Microwave, Dinnerware and serving pieces, Toaster

Gray, Robert M.

350

Hodges residence: performance of a direct gain passive solar home in Iowa  

SciTech Connect (OSTI)

Results are presented for the performance of the Hodges Residence, a 2200-square-foot earth-sheltered direct gain passive solar home in Ames, Iowa, during the 1979-80 heating season, its first occupied season. No night insulation was used on its 500 square feet of double-pane glass. Total auxiliary heat required was 43 GJ (41 MBTU) gross and 26 GJ (25 MBTU) net, amounting, respectively, to 60 and 36 kJ/C/sup 0/-day-m/sup 2/ (2.9 and 1.8 BTU/F/sup 0/-day-ft/sup 2/). The heating season was unusually cloudy and included the cloudiest January in the 21 years of Ames insolation measurements. Results are also presented for the performance of the hollow-core floor which serves as the main storage mass and for the comfort range in the house.

Hodges, L.

1980-01-01T23:59:59.000Z

351

Optimal beam pattern to maximize inclusion residence time in an electron beam melting hearth  

SciTech Connect (OSTI)

Approximate probabilities of inclusion survival through an electron beam melting hearth are computed from nitride dissolution rates, flotation velocities, and residence times. Dissolution rates were determined by measuring shrinkage rates of pure TiN and nitrided sponge in small pools of molten titanium in an electron beam melting hearth. Flotation velocities were calculated using correlations for fluid flow around spheres, and show that particles sink or float unless their densities are extremely close to that of molten titanium. Flow field characteristics which lead to effective inclusion removal are discussed in terms of heat flux pattern required to produce them, based on the electron beam`s unique ability to impart a nearly arbitrary heat flux pattern to the melt surface.

Powell, A.; Pal, U. [Massachusetts Inst. of Tech., Cambridge, MA (United States); Avyle, J. van den [Sandia National Labs., Albuquerque, NM (United States)

1997-02-01T23:59:59.000Z

352

Role of the resid solvent in catalytic coprocessing. Quarterly report, October 1994--December 1994  

SciTech Connect (OSTI)

This quarterly report summarizes the authors` work in characterizing resid solvents in the coal liquefaction process. The research performed this quarter involved a literature review in which the literature involving naphthenic structures was reviewed to ascertain if any new literature was available that could provide insights into this work. The literature review is given in part one of this report. The second aspect of the work was the performance of additional model compound studies to complete the work that has been previously performed. The third part of this report was the work performed in preparation for the Department of Energy review to be held on January 24, 1995, in Pittsburgh, PA. The written documentation was due to the Department of Energy in December and is attached as Part 3 of this report.

Curtis, C.W.

1995-04-01T23:59:59.000Z

353

Annual Report on Resident Fish Activities, 1986 Fiscal Year, Columbia River Basin Fish and Wildlife Program, Action Item 41.8.  

SciTech Connect (OSTI)

This report addresses the status of resident fish projects currently funded by the Bonneville Power Administration (BPA) under the Columbia River Basin Fish and Wildlife Program (Program) established pursuant to the Northwest Power Act (P.L. 96-501). The report provides a brief synopsis, review and discussion of 13 resident fish projects funded during September 1985 to May 1986. The resident fish section of the Program addresses measures which are intended to protect resident fish, mitigate fishery losses caused by hydroelectric projects, and compensate for past losses through enhancement measures. These measures include, but are not limited to: flow requirements, drawdown requirements, temperature control, and streambed protection.

United States. Bonneville Power Administration.

1986-05-01T23:59:59.000Z

354

H1N1 Influenza: What You Need to Know if You Live in Residence Welcome to residence at the University of Toronto. We're delighted that you'll be living  

E-Print Network [OSTI]

flu have been similar to the symptoms of seasonal flu: a temperature of more than 38°C, cough, sore your hands often. · Cough or sneeze into your sleeve or a tissue. · Stay at home or in your residence-the-counter medication to reduce aches and fever (e.g., acetaminophen or ibuprofen) · Cough medicine and throat lozenges

Boonstra, Rudy

355

Abstract--Challenges in e-Commerce negotiation reside in two issues such as, automation and knowledge incorporation. In this  

E-Print Network [OSTI]

Abstract--Challenges in e-Commerce negotiation reside in two issues such as, automation and knowledge incorporation. In this paper, we describe how knowledge plays a role in automated negotiation of automated negotiation systems is specified. KB helps in giving a unified approach for representing the data

Fong, Chi Chiu "Simon"

356

WORK ENVIRONMENT The University of Connecticut School of Medicine will provide each resident/fellow with a work  

E-Print Network [OSTI]

the goals for their educational program. The environment will comply with all the ACGME Institutional of training will be defined using the classification provided in the common program requirements. The basis requirements and Common Program Requirements, as well as the program requirements of the Residency Review

Oliver, Douglas L.

357

W:\\Clinical Affairs\\Marshall\\HOTLINES\\HOTLINES-Revised-1-31-2013.doc Internal Medicine Residency Hotlines!  

E-Print Network [OSTI]

W:\\Clinical Affairs\\Marshall\\HOTLINES\\HOTLINES-Revised-1-31-2013.doc Internal Medicine Residency after hours and leave Ron a voice mail message. 2. To talk personally to William Marshall, Chair. To talk personally to Debbie McCall, Executive Assistant Dean for Administration about pay, benefits

Gilbert, Matthew

358

Columbia University, Department of Pathology & Cell Biology Recent Graduates of the Residency Program -Fellowships and Faculty positions  

E-Print Network [OSTI]

Columbia University, Department of Pathology & Cell Biology Recent Graduates of the Residency Molecular Genetic Pathology, Columbia Assistant Attending Pathologist, NewYork-Presbyterian Hospital John Crary, PhD AP/NP 2010 NP, Columbia Assistant Professor, Columbia Kalpana Devaraj AP/CP 2010 GI

Lazar, Aurel A.

359

YOLO COUNTY SERVICES GUIDE The Yolo County Services Guide is a new resource to help residents access various  

E-Print Network [OSTI]

YOLO COUNTY SERVICES GUIDE The Yolo County Services Guide is a new resource to help residents by the Yolo County Health Department and the Yolo Family Resource Center, a nonprofit organization again anywhere in the document. #12;SERVICES / RESOURCES PROVIDED BY YOLO COUNTY & OTHER AGENCIES

Nguyen, Danh

360

Phase I Water Rental Pilot Project : Snake River Resident Fish and Wildlife Resources and Management Recommendations.  

SciTech Connect (OSTI)

The Idaho Water Rental Pilot Project was implemented as a part of the Non-Treaty Storage Fish and Wildlife Agreement (NTSA) between Bonneville Power Administration and the Columbia Basin Fish and Wildlife Authority. The goal of the project is to improve juvenile and adult salmon and steelhead passage in the lower Snake River with the use of rented water for flow augmentation. The primary purpose of this project is to summarize existing resource information and provide recommendations to protect or enhance resident fish and wildlife resources in Idaho with actions achieving flow augmentation for anadromous fish. Potential impacts of an annual flow augmentation program on Idaho reservoirs and streams are modeled. Potential sources of water for flow augmentation and operational or institutional constraints to the use of that water are identified. This report does not advocate flow augmentation as the preferred long-term recovery action for salmon. The state of Idaho strongly believes that annual drawdown of the four lower Snake reservoirs is critical to the long-term enhancement and recovery of salmon (Andrus 1990). Existing water level management includes balancing the needs of hydropower production, irrigated agriculture, municipalities and industries with fish, wildlife and recreation. Reservoir minimum pool maintenance, water quality and instream flows are issues of public concern that will be directly affected by the timing and quantity of water rental releases for salmon flow augmentation, The potential of renting water from Idaho rental pools for salmon flow augmentation is complicated by institutional impediments, competition from other water users, and dry year shortages. Water rental will contribute to a reduction in carryover storage in a series of dry years when salmon flow augmentation is most critical. Such a reduction in carryover can have negative impacts on reservoir fisheries by eliminating shoreline spawning beds, reducing available fish habitat, and exacerbating adverse water quality conditions. A reduction in carry over can lead to seasonal reductions in instream flows, which may also negatively affect fish, wildlife, and recreation in Idaho. The Idaho Water Rental Pilot Project does provide opportunities to protect and enhance resident fish and wildlife habitat by improving water quality and instream flows. Control of point sources, such as sewage and industrial discharges, alone will not achieve water quality goals in Idaho reservoirs and streams. Slow, continuous releases of rented water can increase and stabilize instream flows, increase available fish and wildlife habitat, decrease fish displacement, and improve water quality. Island integrity, requisite for waterfowl protection from mainland predators, can be maintained with improved timing of water releases. Rebuilding Snake River salmon and steelhead runs requires a cooperative commitment and increased flexibility in system operations to increase flow velocities for fish passage and migration. Idaho's resident fish and wildlife resources require judicious management and a willingness by all parties to liberate water supplies equitably.

Riggin, Stacey H.; Hansen, H. Jerome

1992-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Efficiency Maine Multifamily Efficiency Program  

Broader source: Energy.gov [DOE]

Efficiency Maine's Multifamily Efficiency Program offers incentives to multifamily residency building owners for improving energy efficiency. Residencies must have 5 to 20 apartment units to...

362

Estimates of achievable potential for electricity efficiency improvements in U.S. residences  

SciTech Connect (OSTI)

This paper investigates the potential for public policies to achieve electricity efficiency improvements in US residences. This estimate of achievable potential builds upon a database of energy-efficient technologies developed for a previous study estimating the technical potential for electricity savings. The savings potential and cost for each efficiency measure in the database is modified to reflect the expected results of policies implemented between 1990 and 2010. Factors included in these modifications are: the market penetration of efficiency measures, the costs of administering policies, and adjustments to the technical potential measures to reflect the actual energy savings and cost experienced in the past. When all adjustment factors are considered, this study estimates that policies can achieve approximately 45% of the technical potential savings during the period from 1990 to 2010. Thus, policies can potentially avoid 18% of the annual frozen-efficiency baseline electricity consumption forecast for the year 2010. This study also investigates the uncertainty in best estimate of achievable potential by estimating two alternative scenarios -- a

Brown, Richard

1993-05-01T23:59:59.000Z

363

Subunit Stabilization and Polyethylene Glycolation of Cocaine Esterase Improves In Vivo Residence Time  

SciTech Connect (OSTI)

No small-molecule therapeutic is available to treat cocaine addiction, but enzyme-based therapy to accelerate cocaine hydrolysis in serum has gained momentum. Bacterial cocaine esterase (CocE) is the fastest known native enzyme that hydrolyzes cocaine. However, its lability at 37 C has limited its therapeutic potential. Cross-linking subunits through disulfide bridging is commonly used to stabilize multimeric enzymes. Herein we use structural methods to guide the introduction of two cysteine residues within dimer interface of CocE to facilitate intermolecular disulfide bond formation. The disulfide-crosslinked enzyme displays improved thermostability, particularly when combined with previously described mutations that enhance stability (T172R-G173Q). The newly modified enzyme yielded an extremely stable form of CocE (CCRQ-CocE) that retained greater than 90% of its activity after 41 days at 37 C, representing an improvement of more than 4700-fold over the wild-type enzyme. CCRQ-CocE could also be modified by polyethylene glycol (PEG) polymers, which improved its in vivo residence time from 24 to 72 h, as measured by a cocaine lethality assay, by self-administration in rodents, and by measurement of inhibition of cocaine-induced cardiovascular effects in rhesus monkeys. PEG-CCRQ elicited negligible immune response in rodents. Subunit stabilization and PEGylation has thus produced a potential protein therapeutic with markedly higher stability both in vitro and in vivo.

Narasimhan, Diwahar; Collins, Gregory T.; Nance, Mark R.; Nichols, Joseph; Edwald, Elin; Chan, Jimmy; Ko, Mei-Chuan; Woods, James H.; Tesmer, John J.G.; Sunahara, Roger K. (Michigan)

2012-03-15T23:59:59.000Z

364

American Society for Radiation Oncology (ASTRO) 2012 Workforce Study: The Radiation Oncologists' and Residents' Perspectives  

SciTech Connect (OSTI)

Purpose: The American Society for Radiation Oncology (ASTRO) conducted the 2012 Radiation Oncology Workforce Survey to obtain an up-to-date picture of the workforce, assess its needs and concerns, and identify quality and safety improvement opportunities. The results pertaining to radiation oncologists (ROs) and residents (RORs) are presented here. Methods: The ASTRO Workforce Subcommittee, in collaboration with allied radiation oncology professional societies, conducted a survey study in early 2012. An online survey questionnaire was sent to all segments of the radiation oncology workforce. Respondents who were actively working were included in the analysis. This manuscript describes the data for ROs and RORs. Results: A total of 3618 ROs and 568 RORs were surveyed. The response rate for both groups was 29%, with 1047 RO and 165 ROR responses. Among ROs, the 2 most common racial groups were white (80%) and Asian (15%), and the male-to-female ratio was 2.85 (74% male). The median age of ROs was 51. ROs averaged 253.4 new patient consults in a year and 22.9 on-treatment patients. More than 86% of ROs reported being satisfied or very satisfied overall with their career. Close to half of ROs reported having burnout feelings. There was a trend toward more frequent burnout feelings with increasing numbers of new patient consults. ROs' top concerns were related to documentation, reimbursement, and patients' health insurance coverage. Ninety-five percent of ROs felt confident when implementing new technology. Fifty-one percent of ROs thought that the supply of ROs was balanced with demand, and 33% perceived an oversupply. Conclusions: This study provides a current snapshot of the 2012 radiation oncology physician workforce. There was a predominance of whites and men. Job satisfaction level was high. However a substantial fraction of ROs reported burnout feelings. Perceptions about supply and demand balance were mixed. ROs top concerns reflect areas of attention for the healthcare sector as a whole.

Pohar, Surjeet, E-mail: spohar@iuhealth.org [Indiana University Health East, Indianapolis, Indiana (United States); Fung, Claire Y. [Commonwealth Newburyport Cancer Center, Newburyport, Massachusetts (United States); Hopkins, Shane [William R. Bliss Cancer Center, Ames, Iowa (United States); Miller, Robert [Mayo Clinic, Rochester, Minnesota (United States); Azawi, Samar [VA Veteran Hospital/University of California Irvine, Newport Beach, California (United States); Arnone, Anna; Patton, Caroline [ASTRO, Fairfax, Virginia (United States); Olsen, Christine [Massachusetts General Hospital, Boston, Massachusetts (United States)

2013-12-01T23:59:59.000Z

365

Statewide Electricity and Demand Capacity Savings from the Implementation of IECC Code in Texas: Analysis for Single-Family Residences  

E-Print Network [OSTI]

STATEWIDE ELECTRICITY AND DEMAND CAPACITY SAVINGS FROM THE IMPLEMENTATION OF IECC CODE IN TEXAS: ANALYSIS FOR SINGLE?FAMILY RESIDENCES 11th International Conference for Enhanced Building Operations New York City, October 18 ? 20, 2011 Hyojin...&M University System Statewide Electricity and Demand Savings from the IECC Code in TX 11th ICEBO Conference Oct. 18 ? 20, 2011 2 Outline Introduction Methodology Base?Case Building Results Summary Statewide Electricity and Demand Savings from the IECC...

Kim, H.; Baltazar, J.C.; Haberl, J.; Lewis, C.; Yazdani, B.

2011-01-01T23:59:59.000Z

366

A quasi-steady state model to predict attic heat transfer and energy savings in residences using radiant barriers  

E-Print Network [OSTI]

[10-14] for Oak Ridge National Laboratories (ORNL) has focused on comparing energy reduction on three experimental houses operated by ORNL. Their research has consisted of both summer and winter tests of radiant barriers. Radiant Barrier...A QUASI-STEADY STATE MODEL TO PREDICT ATTIC HEAT TRANSFER AND ENERGY SAVINGS IN RESIDENCES USING RADIANT BARRIERS A Thesis by DAVID WALTER WINIARSKI Submitted to the Office of Graduate Studies of Texas ARM University in partial fulfillment...

Winiarski, David Walter

2012-06-07T23:59:59.000Z

367

Admissions Checklist for Degree Seeking U.S. Resident Aliens You can save a filled copy of this form on your computer by clicking on the icon on your browser.  

E-Print Network [OSTI]

Admissions Checklist for Degree Seeking U.S. Resident Aliens You can save a filled copy as quickly as possible to ensure timely processing. 5. [ ] Documentation verifying U.S. Resident Alien

Texas at Arlington, University of

369

Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2000 Annual Report.  

SciTech Connect (OSTI)

The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, commonly known as the Joint Stock Assessment Project (JSAP) is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (blocked area). The three-phase approach of this project will enhance the fisheries resources of the blocked area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information housed in a central location will allow managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP (NWPPC program measure 10.8B.26) is designed and guided jointly by fisheries managers in the blocked area and the Columbia Basin blocked area management plan (1998). The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of blocked area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the blocked area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. The use of common collection and analytical tools is essential to the process of streamlining joint management decisions. In 1999 and 2000 the project began to address some of the identified data gaps, throughout the blocked area, with a variety of newly developed sampling projects, as well as, continuing with ongoing data collection of established projects.

Crossley, Brian (Spokane Tribe of Indians, Department of Natural Resources, Wellpinit, WA); Lockwood, Jr., Neil W. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA)

2001-01-01T23:59:59.000Z

370

Detailed Analysis of the Thermal Mass Credits in a Code-Traceable DOE-2 Simulation of the 2001 IECC for a Single-Family Residence in Texas  

E-Print Network [OSTI]

This paper presents the results of a study that investigates the thermal mass credits in the 2001 International Energy Conservation Code (IECC) (ICC 1999, 2001) for a single-family residence in Texas using the DOE-2 building energy simulation...

Kim, S.; Haberl, J.

371

Statewide Electricity and Demand Capacity Savings from the International Energy Conservation Code (IECC) Adoption for Single-Family Residences in Texas (2002-2011)  

E-Print Network [OSTI]

This report is the continuation of the previous 2011 Statewide Electricity Savings report from code-compliant, single-family residences built between 2002 and 2009. Statewide electricity and electric demand savings achieved from the adoption...

Kim, H.; Baltazar, J. C.; Haberl, J. S.; Yazdani, B.

2013-01-01T23:59:59.000Z

372

ADJUSTMENT OF STATUS TO PERMANENT RESIDENT Adjustment of Status, filed on form I-485, is your personal application to the U.S. government  

E-Print Network [OSTI]

months in most countries, but can vary must apply in country of birth or legal permanent residence exam and interview overseas must obtain police certificates from every country where applicant

Scharer, John E.

373

Resident Fish Stock above Chief Joseph and Grand Coulee Dams; 2002 Annual Report.  

SciTech Connect (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. In 1999, 2000, and 2001 the project began addressing some of the identified data gaps throughout the Blocked Area. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Department of Natural Resources, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA); Butler, Chris (Spokane Tribe of Indians, Department of Natural Resources, Wellpinit, WA)

2003-09-01T23:59:59.000Z

374

Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2002-2003 Annual Report.  

SciTech Connect (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial and native fish assemblages in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. The project began addressing identified data gaps throughout the Blocked Area in 1999. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, Spokane River below Spokane Falls, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002 and 2003. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife); Butler, Chris (Spokane Tribe of Indians, Wellpinit, WA)

2006-02-01T23:59:59.000Z

375

Resident Fish Stock above Chief Joseph and Grand Coulee Dams; 2003-2004 Annual Report.  

SciTech Connect (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power and Conservation Council (NPCC), formerly the Northwest Power Planning Council. The NPCC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPCC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial and native fish assemblages in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area. The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. The project began addressing identified data gaps throughout the Blocked Area in 1999. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of streams and lakes on the Spokane Indian Reservation were completed by 2001. Assessments of the Little Spokane River and its tributaries, Spokane River below Spokane Falls, tributaries to the Pend Oreille River, small lakes in Pend Oreille County, WA, and water bodies within and near the Spokane Indian Reservation were conducted in 2002 and 2003. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispel Tribe of Indians, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Olympia, WA); Butler, Chris (Spokane Tribe of Indians, Wellpinit, WA)

2005-11-01T23:59:59.000Z

376

Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams; 2001 Annual Report.  

SciTech Connect (OSTI)

In 1980, the United States Congress enacted the Northwest Power Planning and Conservation Act (PL 96-501, 1980), which established the Northwest Power Planning Council (NPPC). The NPPC was directed by Congress to develop a regional Power Plan and also the Columbia River Basin Fish and Wildlife Program (FWP) to restore or replace losses of fish caused by construction and operation of hydroelectric dams in the Columbia River Basin. In developing the FWP, Congress specifically directed NPPC to solicit recommendations for measures to be included in the Program from the region's fish and wildlife agencies and Indian tribes. All measures adopted by the Council were also required to be consistent with the management objectives of the agencies and tribes [Section 4.(h)(6)(A)], the legal rights of Indian tribes in the region [Section 4.(h)(6)(D)] and be based upon and supported by the best available scientific knowledge [Section 4.(h)(6)(B)]. The Resident Fish Stock Status above Chief Joseph and Grand Coulee Dams Project, also known as the Joint Stock Assessment Project (JSAP) specifically addresses NPPC Council measure 10.8B.26 of the 1994 program. The Joint Stock Assessment Project is a management tool using ecosystem principles to manage artificial fish assemblages and native fish in altered environments existing in the Columbia River System above Chief Joseph and Grand Coulee Dams (Blocked Area). A three-phase approach of this project will enhance the fisheries resources of the Blocked Area by identifying data gaps, filling data gaps with research, and implementing management recommendations based on research results. The Blocked Area fisheries information is housed in a central location, allowing managers to view the entire system while making decisions, rather than basing management decisions on isolated portions of the system. The JSAP is designed and guided jointly by fisheries managers in the Blocked Area and the Columbia Basin Blocked Area Management Plan (1998). The initial year of the project (1997) identified the need for a central data storage and analysis facility, coordination with the StreamNet project, compilation of Blocked Area fisheries information, and a report on the ecological condition of the Spokane River System. These needs were addressed in 1998 by acquiring a central location with a data storage and analysis system, coordinating a pilot project with StreamNet, compiling fisheries distribution data throughout the Blocked Area, identifying data gaps based on compiled information, and researching the ecological condition of the Spokane River. In order to ensure that any additional information collected throughout the life of this project will be easily stored and manipulated by the central storage facility, it was necessary to develop standardized methodologies between the JSAP fisheries managers. Common collection and analytical methodologies were developed in 1999. In 1999, 2000, and 2001 the project began addressing some of the identified data gaps throughout the Blocked Area. Data collection of established projects and a variety of newly developed sampling projects are ongoing. Projects developed and undertaken by JSAP fisheries managers include investigations of the Pend Orielle River and its tributaries, the Little Spokane River and its tributaries, and water bodies within and near the Spokane Indian Reservation. Migration patterns of adfluvial and reservoir fish in Box Canyon Reservoir and its tributaries, a baseline assessment of Boundary Reservoir and its tributaries, ecological assessment of mountain lakes in Pend Oreille County, and assessments of seven streams and four lakes on the Spokane Indian Reservation were completed by 2000. Assessments of the Little Spokane River and its tributaries, tributaries to the Pend Oreille River, small lakes in southern Pend Oreille County, and water bodies within and near the Spokane Indian Reservation were conducted in 2001. This work was done in accordance with the scope of work approved by Bonneville Power Administration (BPA).

Connor, Jason M. (Kalispell Department of Natural Resources, Usk, WA); McLellan, Jason G. (Washington Department of Fish and Wildlife, Spokane, WA); O'Connor, Dick (Washington Department of Fish and Wildlife, Olympia, WA)

2003-01-01T23:59:59.000Z

377

Idaho Water Rental Pilot Project Probability/Coordination Study Resident Fish and Wildlife Impacts Phase III, 1996 Annual Report.  

SciTech Connect (OSTI)

Phase 3 began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River Basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water. Existing data, in the form of weighted usable area versus flow relationships, were used to estimate habitat changes for white sturgeon (Acipenser transinontanus) and rainbow trout (Oncorhynchus mykiss) in the Snake River between C.J. Strike Dam and Brownlee pool. The increased flows resulted in increased habitat for adult and juvenile white sturgeon and adult rainbow trout. But, the flows have failed to meet mean monthly flow recommendations for the past three years despite the addition of the flow augmentation releases. It is unlikely that the flow augmentation releases have had any significant long-term benefit for sturgeon and rainbow trout in the Snake River. Flow augmentation releases from the Boise and Payette rivers have in some years helped to meet or exceed minimum flow recommendations in these tributaries. The minimum flows would not have been reached without the flow augmentation releases. But, in some instances, the timing of the releases need to be adjusted in order to maximize benefits to resident fishes in the Boise and Payette rivers.

Leitzinger, Eric J. [Idaho Dept. of Fish and Game, Boise, ID (United States)

1997-12-01T23:59:59.000Z

378

Idaho Water Rental Pilot Project probability/coordination study resident fish and wildlife impacts, Phase III. Annual report  

SciTech Connect (OSTI)

Phase III began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water. Existing data, in the form of weighted usable area versus flow relationships, were used to estimate habitat changes for white sturgeon (Acipenser transmontanus) and rainbow trout (Oncorhynchus mykiss)in the Snake River between C.J. Strike Dam and Brownlee pool. The increased flows resulted in increased white sturgeon habitat for most life stages. Rainbow trout adult and spawning habitat increased while juvenile and fry habitat generally decreased. Whether or not these short term increases in habitat result in long term benefits to the fish populations has yet to be determined.

Leitzinger, E.

1996-09-01T23:59:59.000Z

379

Idaho Water Rental Pilot Project Probability/Coordination Study Resident Fish and Wildlife Impact Phase III, 1995 Annual Report.  

SciTech Connect (OSTI)

Phase III began in 1995 with the overall goal of quantifying changes in resident fish habitat in the Snake River basin upstream of Brownlee Reservoir resulting from the release of salmon flow augmentation water. Existing data, in the form of weighted usable area versus flow relationships, were used to estimate habitat changes for white sturgeon (Acipenser transmontanus) and rainbow trout (Oncorhynchus mykiss) in the Snake River between C.J. Strike Dam and Brownlee pool. The increased flows resulted in increased white sturgeon habitat for most life stages. Rainbow trout adult and spawning habitat increased while juvenile and fry habitat generally decreased. Whether or not these short term increases in habitat result in long term benefits to the fish populations has yet to be determined.

Leitzinger, Eric J. (Idaho Department of Fish and Game, Boise, ID)

1996-09-01T23:59:59.000Z

380

MICROSTRUCTURE OF SUPER-DUPLEX STAINLESS STEELS  

E-Print Network [OSTI]

of Materials Science and Metallurgy Pelnbroke Street Calnbridge CB23QZ A dissertation submitted for the degree the supervision of Dr. H.K.D.H. Bhadeshia in the Department of Materials Science and Metallurgy, Cambridge of laboratory facilities in the Department of Materials Science and Metallurgy at the University of Cambridge. I

Cambridge, University of

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

E-Print Network [OSTI]

Building Environment and Thermal Envelope Council (BETEC)of Thermal Performance of the Exterior Envelopes ofof the Thermal Performance of the Exterior Envelopes of

Price, P.N.

2011-01-01T23:59:59.000Z

382

Cascade Apartments - Deep Energy Multifamily Retrofit , Kent, Washington (Fact Sheet)  

SciTech Connect (OSTI)

In December of 2009-10, King County Housing Authority (KCHA) implemented energy retrofit improvements in the Cascade multifamily community, located in Kent, Washington (marine climate.)This research effort involved significant coordination from stakeholders KCHA, WA State Department of Commerce, utility Puget Sound Energy, and Cascade tenants. This report focuses on the following three primary BA research questions : 1. What are the modeled energy savings using DOE low income weatherization approved TREAT software? 2. How did the modeled energy savings compare with measured energy savings from aggregate utility billing analysis? 3. What is the Savings to Investment Ratio (SIR) of the retrofit package after considering utility window incentives and KCHA capitol improvement funding.

Not Available

2014-02-01T23:59:59.000Z

383

Indoor-Outdoor Air Leakage of Apartments and Commercial Buildings  

E-Print Network [OSTI]

D. A. , AK Persily, and SJ Emmerich, "Energy Impacts of Airfuture work. Steve Emmerich from NISI provided unpublishedAndrew Persily and Steven Emmerich of the National Institute

Price, P.N.

2011-01-01T23:59:59.000Z

384

SciTech Connect: Conway Street Apartments: A Multifamily Deep...  

Office of Scientific and Technical Information (OSTI)

ASSOCIATES; CONSORTIUM FOR ADVANCED RESIDENTIAL BUILDINGS; MULTIFAMILY; RETROFIT; ZERO ENERGY; SOLAR THERMAL; DRAIN WATER RECOVERY SYSTEM; DEMAND-CONTROLLED RECIRCULATION...

385

Conway Street Apartments: A Multifamily Deep Energy Retrofit  

SciTech Connect (OSTI)

While single-family, detached homes account for 63% of households (EIA 2009); multi-family homes account for a very large portion of that remaining housing stock, and this fraction is growing. Through recent research efforts, CARB has been evaluating strategies and technologies that can make dramatic improvements in energy performance in multi-family buildings.

Aldrich, R.; Williamson, J.

2014-11-01T23:59:59.000Z

386

Integrating Energy and Indoor Environmental Quality Retrofits in Apartments  

E-Print Network [OSTI]

some natural-draft water heaters posed risks of combustion-with pilot lights, and water heaters; and installation ofappliance (furnace, water heater) with potential back

Fisk, William J.

2014-01-01T23:59:59.000Z

387

Klamath Apartment Buildings (13) Space Heating Low Temperature Geothermal  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6Kentwood,George CountyMexicoFacility | Open Energy

388

Integrating Energy and Indoor Environmental Quality Retrofits in Apartments  

E-Print Network [OSTI]

of the National Weatherization Assistance Program, Oak RidgeNational Weatherization Assistance Program, which targetsthe National Weatherization Assistance Program indicates a

Fisk, William J.

2014-01-01T23:59:59.000Z

389

Stay Warm in Your Apartment | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned Small Business Webinar JuneFOADepartment ofCool for Less Money with aUpStay

390

Reference Buildings by Building Type: Midrise Apartment | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L dDepartmentnews-flashes Office ofofDepartment ofofofMedium

391

Title: Ames Blue Alert- Wood Cabinet Falls Apart  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched Ferromagnetism in Layered NbS2 andThe1A:decisional. 1 B O NAmes Blue Alert- Wood

392

VERIFICATION OF EMPLOYMENT According to the rules and regulations set forth by the State of New Mexico for establishing residency for tuition  

E-Print Network [OSTI]

/13/95), spouses and dependents of persons who have moved to or who now live in New Mexico and who provideVERIFICATION OF EMPLOYMENT According to the rules and regulations set forth by the State of New Mexico for establishing residency for tuition purposes (Commission on Higher Education rule 910, 10

New Mexico, University of

393

Purpose of the Form All non-US Citizens are required to complete the Form UPP-192, Alien Determination of Residency. The UPP-  

E-Print Network [OSTI]

Purpose of the Form All non-US Citizens are required to complete the Form UPP-192, Alien Alien Status Indicate your current alien status. If you are currently working/receiving payment from UPP-192 ­ ALIEN DETERMINATION OF RESIDENCY INSTRUCTIONS #12;Section III ­ Immigration Information Days

He, Chuan

394

PUBLIC SAFETY -We all share responsibility for safety in the residences and on campus. Rutgers University Public Safety works very closely with University Housing to insure that  

E-Print Network [OSTI]

PUBLIC SAFETY - We all share responsibility for safety in the residences and on campus. Rutgers University Public Safety works very closely with University Housing to insure that students feel safe SAFETY ­ The Rutgers University Police Department, RUPD, has a visible presence on campus. In addition

395

PROGRAMMING AND TRAINING ASSISTANT APPLICATION Thank you for applying for the Programming and Training Assistant position with the Residence Life department.  

E-Print Network [OSTI]

PROGRAMMING AND TRAINING ASSISTANT APPLICATION Thank you for applying for the Programming and Training Assistant position with the Residence Life department. We wish you every success in your, .docx) and PDF (.pdf) format only. #12;-1 of 2- PROGRAMMING AND TRAINING ASSISTANT JOB DESCRIPTION

396

Life Cycle Analysis for the Walter H. Gage Residence The life cycle analysis (LCA) being carried out for this project is one of thirteen  

E-Print Network [OSTI]

The life cycle analysis (LCA) being carried out for this project is one of thirteen others that are being1 Life Cycle Analysis for the Walter H. Gage Residence Civl 498c Jack Liu #12;Liu 2 Abstract by the UBC Records Department to perform takeoffs for the EIE inputs. The EIE presented the impact assessment

397

AGREEMENT & AUTHORIZATION FOR TELECOMMUTING The Employee named below is hereby authorized to perform work for Fermilab at the residence or off-site office located at  

E-Print Network [OSTI]

FERMILAB AGREEMENT & AUTHORIZATION FOR TELECOMMUTING The Employee named below is hereby authorized to perform work for Fermilab at the residence or off-site office located at understands and agrees that authorization to perform Fermilab job duties away from the Fermilab premises

Quigg, Chris

398

Infrastructure Required for Tag/Mark Application, Detection, and Recovery Tag/Mark & release Juvenile fish migration Adult fish migration Mortality*Ocean residency  

E-Print Network [OSTI]

Juvenile fish migration Adult fish migration Mortality*Ocean residency Adipose fin clip Marking trailers N processing Otolith Insulated box, thermal chilling system, lab processing, smolt traps N/A Fish traps, fish *Fish mortality data may be collected at any stage of the fish life cycle from harvest, recovered

399

Estimated effective dose rates from radon exposure in workplaces and residences within Los Alamos county in New Mexico  

SciTech Connect (OSTI)

Many millions of office workers are exposed to radon while at work and at home. Though there has been a multitude of studies reporting the measurements of radon concentrations and potential lung and effective doses associated with radon and progeny exposure in homes, similar studies on the concentrations and subsequent effective dose rates in the workplace are lacking. The purposes of this study were to measure radon concentrations in office and residential spaces in the same county and explore the radiation dose implications. Sixty-five track-etch detectors were deployed in office spaces and 47 were deployed in residences, all within Los Alamos County, New Mexico, USA. The sampling periods for these measurements were generally about three months. The measured concentrations were then used to calculate and compare effective dose rates resulting from exposure while at work and at home. Results showed that full-time office workers receive on average about nine times greater exposure at home than while in the office (691 mrem yr{sup -1} versus 78 mrem yr{sup -1}). The estimated effective dose rate for a more homebound person was 896 mrem yr{sup -1}. These effective dose rates are contrasted against the 100 mrem yr{sup -1} threshold for regulation of a 'radiological worker' defined in the Department of Energy regulations occupational exposure and the 10 mrem yr{sup -1} air pathway effective public dose limit regulated by the Environmental Protection Agency.

Whicker, Jeffrey J [Los Alamos National Laboratory; Mcnaughton, Michael [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

400

Greater Cincinnati Energy Alliance- Residential Loan Program (Ohio)  

Broader source: Energy.gov [DOE]

The Greater Cincinnati Energy Alliance provides loans for single family residencies and owner occupied duplexes in Hamilton county in Ohio and Boone, Kenton, and Campbell counties in Kentucky. To...

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Greater Cincinnati Energy Alliance- Residential Loan Program (Kentucky)  

Broader source: Energy.gov [DOE]

The Greater Cincinnati Energy Alliance provides loans for single family residencies and owner occupied duplexes in Hamilton county in Ohio and Boone, Kenton, and Campbell counties in Kentucky. To...

402

Humidity Control in Residences  

E-Print Network [OSTI]

. By introducing a separate vapor compression unit to pre-condition outside air, indoor relative humidity can be controlled. This new air conditioning system combines a ventilation unit with a conventional recirculation air conditioning unit. Although successful...

Trowbridge, J.; Peterson, J.

1994-01-01T23:59:59.000Z

403

West Residences Family Sports  

E-Print Network [OSTI]

ESCONDIDO RD MAYFIELD BOW DOIN ALMA ST QUARRYRD Lagunita UNIVERSITY AVE PALO RD OLM STED ROTH WY PANAMAST

404

Urology Residency Program 2014  

E-Print Network [OSTI]

weeks Adult Urology 12 weeks General Surgery 4 weeks Pediatric Urology 4 weeks Nephrology 4 weeks Emergency Medicine 8 weeks Selective (choose 2 Radiology, CCU, Internal Medicine) 4 weeks Vacation PGY2 for each specific discipline. It will consist of: 20 weeks Adult Urology 8 weeks Pediatric Urology 12

MacMillan, Andrew

405

Residence Hall & Furnished  

E-Print Network [OSTI]

Air Conditioner Units . . . . . . . . . . . . . . . . . 7 Bunking/Lofting Beds & Air Conditioning . . . . . . . . . . . . 9 Mailing Address

Polly, David

406

Building America Case Study: Ground Source Heat Pump Research, TaC Studios Residence, Atlanta, Georigia (Fact Sheet)  

SciTech Connect (OSTI)

As part of the NAHB Research Center Industry Partnership, Southface partnered with TaC Studios, an Atlanta based architecture firm specializing in residential and light commercial design, on the construction of a new test home in Atlanta, GA in the mixed-humid climate. This home serves as a residence and home office for the firm's owners, as well as a demonstration of their design approach to potential and current clients. Southface believes the home demonstrates current best practices for the mixed-humid climate, including a building envelope featuring advanced air sealing details and low density spray foam insulation, glazing that exceeds ENERGY STAR requirements, and a high performance heating and cooling system. Construction quality and execution was a high priority for TaC Studios and was ensured by a third party review process. Post construction testing showed that the project met stated goals for envelope performance, an air infiltration rate of 2.15 ACH50. The homeowner's wished to further validate whole house energy savings through the project's involvement with Building America and this long-term monitoring effort. As a Building America test home, this home was evaluated to detail whole house energy use, end use loads, and the efficiency and operation of the ground source heat pump and associated systems. Given that the home includes many non-typical end use loads including a home office, pool, landscape water feature, and other luxury features not accounted for in Building America modeling tools, these end uses were separately monitored to determine their impact on overall energy consumption.

Not Available

2014-09-01T23:59:59.000Z

407

Genetic and Phenotypic Catalog of Native Resident Trout of the interior Columbia River Basin : FY-2001 Report : Populations in the Wenatchee, Entiat, Lake Chelan and Methow River Drainages.  

SciTech Connect (OSTI)

The 1994 Fish and Wildlife Program of the Northwest Power Planning Council specifies the recovery and preservation of population health of native resident fishes of the Columbia River Basin. Among the native resident species of concern are interior rainbow trout of the Columbia River redband subspecies Oncorhynchus mykiss gairdneri 1 and westslope cutthroat trout O. clarki lewisi. The westslope cutthroat trout has been petitioned for listing under the U. S. Endangered Species Act (American Wildlands et al. 1997). Before at-risk populations can be protected, their presence and status must be established. Where introgression from introduced species is a concern, as in the case of both westslope cutthroat trout and redband rainbow trout, genetic issues must be addressed as well. As is true with native trout elsewhere in the western United States (Behnke 1992), most of the remaining pure populations of these species in the Columbia River Basin are in relatively remote headwater reaches. The objective of this project was to photo-document upper Columbia Basin native resident trout populations in Washington, and to ascertain their species or subspecies identity and relative genetic purity using a nonlethal DNA technique. FY-2001 was year three (and final year) of a project in which we conducted field visits to remote locations to seek out and catalog these populations. In FY-2001 we worked in collaboration with the Wenatchee National Forest to catalog populations in the Wenatchee, Entiat, Lake Chelan, and Methow River drainages of Washington State.

Trotter, Patrick C.

2001-10-01T23:59:59.000Z

408

{sup 226}Ra and {sup 231}Pa systematics of axial MORB, crustal residence ages, and magma chamber characteristics at 9--10{degree}N East Pacific Rise  

SciTech Connect (OSTI)

Mass spectrometric measurements of {sup 30}Th-22{sup 226}Ra and {sup 235}-U{sup 231}Pa disequilibria for axial basalts are used to determine crustal residence ages for MORB magma and investigate the temporal and spatial characteristics of axial magma chambers (AMC) at 9--10{degrees}N East Pacific Rise (EPR). Relative crustal residence ages can be calculated from variations in {sup 226}Ra/{sup 230}Th and {sup 231}Pa/{sup 235}U activity ratios for axial lavas, if (1) mantle sources and melting are uniform, and mantle transfer times are constant or rapid for axial N-MORB, and (2) {sup 231}Pa/{sup 235}U and {sup 226}Ra/{sup 230}Th in the melt are unaffected by shallow level fractional crystallization. Uniform Th, Sr, and Nd isotopic systematics and incompatible element ratios for N-MORB along the 9--10{degrees}N segment indicate that mantle sources and transfer times are similar. In addition, estimated bulk solid/melt partition coefficients for U, Th, and Pa are small, hence effects of fractional crystallization on {sup 231}Pa/{sup 235}U ratios for the melt are expected to be negligible. However, fractional crystallization of plagioclase in the AMC would lower {sup 226}Ra/{sup 230}Th ratios in the melt and produce a positive bias in {sup 226}Ra crustal residence ages for fractionated lavas.

Goldstein, S.J.; Murrell, M.T. [Los Alamos National Lab., NM (United States); Perfit, M.R. [Univ., of Florida, Gainesville, FL (United States). Dept. of Geology; Batiza, R. [Univ., of Hawaii, Honolulu, HI (United States); Fornari, D.J. [Woods Hole Oceanographic Institution, MA (United States). Dept. of Geology and Geophysics

1994-06-01T23:59:59.000Z

409

Foreign Student & Scholar Services, Student Services Building, 30 Lovett Avenue, Newark, DE 19716, Tel: (302)831-2115,Fax:(302)831-2123, E-mail: foreignservices@udel.edu Honorarium payments may be made only to a non-resident alien who is in an immigration  

E-Print Network [OSTI]

-resident alien who is in an immigration status that legally allows such payments. The visa types B-1, B-2, W/B, W/T and UD J-1 are eligible. The following regulations relate to non-resident alien honorarium payments to visitors at the University of Delaware: 1) A non-resident alien can receive an honorarium without a SSN

Firestone, Jeremy

410

Study on effects of resident-perceived neighborhood boundaries on public services accessibility & its relation to utilization: using Geographic Information System, focusing on the case of public parks in Austin, Texas  

E-Print Network [OSTI]

parks based on equity consideration and its relationship to park utilization. The study also addressed whether the neighborhood boundaries perceived by the actual residents may exhibit more actual neighborhood construct than Census-based Neighborhood...

Cho, Chun Man

2004-09-30T23:59:59.000Z

411

Statewide Electrical Energy Cost Savings and Peak Demand Reduction from the IECC Code-Compliant, Single-Family Residences in Texas (2002-2009)  

E-Print Network [OSTI]

constructed in Texas was determined using the annual surveys, National Association of Home Builders (NAHB) (NAHB 2001?2005 and 2009-2010)4. Figure 6 shows the ratio of the single family residences in Texas by type of heating system for Climate Zone 2 (CZ 2... for New Homes (Paquette et al. 2010), the American Council for an Energy-Efficient Economy (ACEEE) Consumer Guide to Home Energy Savings (Amann et al. 2007), and the similar incremental cost analysis studies in Texas (Malhotra et al. 2008; Kim et al...

Kim, H; Baltazar, J.C.; Haberl, J.

412

Looking past the first year: Do the savings last?. A study of the persistence of energy savings in low-income Wisconsin residences, final report  

SciTech Connect (OSTI)

Wisconsin Energy Conservation Corporation (WECC) conducted a Study of the Persistence of Energy Savings in Low-Income Wisconsin Residences for the Department of Energy`s (DOE) Existing Buildings Efficiency Program. The study assessed the persistence of energy savings resulting from participation in the Wisconsin Utility Weatherization Assistance Program (UWAP). The study assessed the impact of weatherization and heating system measures up to eight years after the installation of energy conservation measures (ECMS) in low-income, gas-heated residences, the majority of which are 1- and 2-unit buildings. Primary data for the study came from two utilities, Wisconsin Gas Company and Madison Gas & Electric Company. Both utilities provided WECC with their weatherization program databases, which contained participant information back to 1982. WECC also obtained fuel consumption information for the program participants from each utility. The consumption histories spanned a 6-year period from March 1985 through May 1991 for Wisconsin Gas Company participants, and a 5-year period from October 1986 through August 1991 for Madison Gas & Electric Company participants. After attrition, the study included 5,129 customers from the Wisconsin Gas Company program and 1,553 customers from the Madison Gas & Electric Company program.

Narum, D.; Pigg, S.; Schlegel, J.

1992-09-01T23:59:59.000Z

413

Results of in vivo measurements of strontium-90 body-burden in Urals residents: analyses of data obtained 2006-2012  

SciTech Connect (OSTI)

A part of the Urals territory was contaminated with 90Sr and 137Cs in the 1950s as a result of accidents at the "Mayak" Production Association. The paper describes the analysis of in vivo 90Sr measurements in Urals residents. The measurements were performed with the use of whole-body-counter SICH-9.1M in 2006-2012. Totally 5840 measurements for 4876 persons were performed from 2006 to 2012; maximal measured value was 24 kBq. Earlier, similar measurements were performed with SICH-9.1 (1974-1997). Comparison of the results obtained with SICH-9.1 and SICH-9.1M has shown a good agreement of the two data sets.

Tolstykh, E. I.; Bougrov, N. G.; Krivoshchapov, Victor A.; Shishkina, Elena A.; Shagina, N. B.; Degteva, M. O.; Anspaugh, L. R.; Napier, Bruce A.

2012-06-01T23:59:59.000Z

414

360 De Neve Drive Los Angeles, CA 90095-1495  

E-Print Network [OSTI]

Rental Listing ($25 for 30 day listing) LISTER INFORMATION: Name circle one): Apartment Condo Duplex Guest House House Studio Townhouse Listing Category (please circle On street Off street Gated Carport Utilities Included (circle all that apply): None Gas Cable TV Electric

Grether, Gregory

415

Tuesday, May 29, 2012 page of 15 Disclaimer: NJIT, Residence Life is not responsible for arrangements made between readers of this list and landlords. We cannot guarantee the availability  

E-Print Network [OSTI]

-Campus Housing Listing as of 5-29-2012 Residence Life Office, Cypress Hall Office Phone: (973) 596-3039 Email community and 24 Hour Security Patrol. Tennis Court and Swimming Pool . No pets, No partying, No smoking in townhouse shared with male students, with 24/7 security patrols and access to tennis courts, swimming pool

Bieber, Michael

416

Linking Household Food Inventories with Dietary Recalls to Examine the Association between Nutrient Availability and Dietary Intake among Mexican-origin Children who Reside in Texas Border Region Colonias  

E-Print Network [OSTI]

The purpose of this study was to determine the relationship between household food inventories (HFI) and dietary recalls among Mexican-origin children (ages 6-11 years old) who reside in Texas border region colonias. Household food availability is a...

Hutchinson, Jennifer Becker

2012-10-19T23:59:59.000Z

417

THINGS TO CONSIDER WHEN APARTMENT HUNTING IN BOSTON We strongly recommended that you come to Boston to search for an apartment in-person. It is not a  

E-Print Network [OSTI]

­ The Massachusetts Bay Transportation Authority (MBTA), better known as "the T," operates the public transportation are available at the Bursar's Office. For more T info, check their website at http://www.mbta.com. · Bus routes arrive at various subway stations within the city. Check the MBTA website for more information. Program

Dennett, Daniel

418

THINGS TO CONSIDER WHEN APARTMENT HUNTING IN BOSTON We strongly recommended that you come to Boston to search for an apartment in-person. It is not a  

E-Print Network [OSTI]

Transportation ­ The Massachusetts Bay Transportation Authority (MBTA), better known as "the T," operates monthly T passes are available at the Bursar's Office. For more T info, check their website at http://www.mbta schedules arrive at various subway stations within the city. Check the MBTA website for more information

Dennett, Daniel

419

THINGS TO CONSIDER WHEN APARTMENT HUNTING IN BOSTON We strongly recommended that you come to Boston to search for an apartment in-person. It is not a  

E-Print Network [OSTI]

(MBTA), better known as "the T," operates the public transportation system in Boston and the surrounding T info, check their website at http://www.mbta.com. · Bus routes 9, 11, 43, and the Silver Line all stop the city. Check the MBTA website for more information. Please note, while many of our students live

Dennett, Daniel

420

William A. Sax Title: Executive-in-Residence Residence  

E-Print Network [OSTI]

courses dealing with management, leadership, negotiations, world energy and international issues · Started offshore Netherlands, U.K. and Norway. 1955 - 1968: Geophysicist: in all capacities including Chief Geophysicist of Unocal. 1950 - 1955: Geophysicist: Chevron Oil Corporation and Forest Oil Corporation

Ferrari, Silvia

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

PERMANENT RESIDENCE EMPLOYMENT-BASED  

E-Print Network [OSTI]

national is the principal investigator. · Evidence showing membership in associations in the academic field publications written by others about the foreign national's work in the academic field. This can include copies of book reviews, or articles highlighting the faculty member's work. The faculty member's work should

422

TOMASSPIKE(I) RESIDENCE HALLS  

E-Print Network [OSTI]

directions from Centre Street. public transportation: The Boston College branch of the MBTA's "Green Line" (B

Huang, Jianyu

423

Conditional Residency Application REGISTRAR'S OFFICE  

E-Print Network [OSTI]

that he or she is "[a] person who is living and is gainfully employed on a full-time or part-time and self-sustaining

Franco, John

424

Immediate Residency Application REGISTRAR'S OFFICE  

E-Print Network [OSTI]

, as of the first day of a term of enrollment, has accepted full-time, self-sustaining employment and established

Franco, John

425

Neurology Residency Department of Neurology &  

E-Print Network [OSTI]

-patient service Montreal Neurological Hospital Pediatric neurology in-patient clinical teaching unit;2 SMBD-Jewish General Hospital Elective rotations Neuro-radiology Montreal Neurological Hospital

Shoubridge, Eric

426

University Residence Halls Summer Residential  

E-Print Network [OSTI]

-style fish boil served on the sho and organic offerings and home baked desserts bring raves from our guests

Scharer, John E.

427

ALS Doctoral Fellowship in Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies |November 2011Astudies smart sensorsCollaborativeALSALS Doctoral

428

ALS Doctoral Fellowship in Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies |November 2011Astudies smart sensorsCollaborativeALSALS

429

ALS Doctoral Fellowship in Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered‰PNGExperience4AJ01) (See95TI07)Operations During theALSSafetyCommunications

430

ALS Doctoral Fellowship in Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered‰PNGExperience4AJ01) (See95TI07)Operations During theALSSafetyCommunicationsDoctoral

431

ALS Doctoral Fellowship in Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered‰PNGExperience4AJ01) (See95TI07)Operations During

432

ALS Doctoral Fellowship in Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsrucLasDelivered‰PNGExperience4AJ01) (See95TI07)Operations DuringALS Doctoral Fellowship in

433

UT Arlington Residence Hall Handbook  

E-Print Network [OSTI]

............................................................17 FACILITIES MANAGEMENT .......................... 17 ROOM AND BUILDING MAINTENANCE.........................................................................21 ABANDONED PROPERTY .............................................21 UT ARLINGTON POLICE "OPERATION

Huang, Haiying

434

FERRITE STRUCTURE AND MECHANICAL PROPERTIES OF LOW ALLOY DUPLEX STEELS  

E-Print Network [OSTI]

nucleated precipitates in the ferrite phase of the base + Nbto Scripta Metal1urgica FERRITE STRUCTURE AND MECHANICALUniversity of Califomia. Ferrite Structure and Mechanical

Hoel, R.H.

2013-01-01T23:59:59.000Z

435

Integrated Tunable Duplexer in CMOS Technology for Multiband Cellular Transceivers  

E-Print Network [OSTI]

2 deals with the high power loss in the hybrid transformerof that topology is the power loss in the balance resistor.2 ) represents the power loss due to impedance mismatch, L M

Abdelhalem, Sherif H.

436

Integrated Tunable Duplexer in CMOS Technology for Multiband Cellular Transceivers  

E-Print Network [OSTI]

Design . . . . . . 4.2.2 Direct-Conversion Receiver Design .high per- formance 2-GHz direct-conversion front-end with aand optimization of direct-conversion receivers with 25%

Abdelhalem, Sherif H.

437

acier inoxydable duplex: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 Prvision de l'paisseur du film passif d'un acier inoxydable 316L soumis au fretting corrosion grce au Point Defect Model, PDM. Physics Websites Summary: Prvision de...

438

aged cast duplex: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

being mounted at CERN. It will make use of a decommissioned LHC test magnet to look for solar axions through its conversion into photons inside the magnetic field. The magnet has...

439

METALLURGICAL EVALUATION OF CAST DUPLEX STAINLESS STEELS AND THEIR WELDMENTS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces and InterfacesAdministration -Lowell L. Wood,3,March 26,MEMSMESAREPORT

440

FERRITE STRUCTURE AND MECHANICAL PROPERTIES OF LOW ALLOY DUPLEX STEELS  

E-Print Network [OSTI]

and Properties of Dual-Phase Steels, R. A. Kot and J. W.Formable HSLA and Dual Phase Steels, A. T. Davenport, ed. ,Formable HSLA and Dual Phase Steels, A. T. Davenport, ed. ,

Hoel, R.H.

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Increased Levels of Harvest and Habitat Law Enforcement and Public Awareness for Anadromous Salmonids and Resident Fish in the Columbia River Basin -- Demonstration Period, 1992--1994, Final Report.  

SciTech Connect (OSTI)

This report was funded by the Bonneville Power Administration (BPA), US Department of Energy, as part of BPA`s program to protect, mitigate, and enhance fish and wildlife affected by the development and operation of hydroelectric facilities on the Columbia River and its tributaries. Illegal harvest and violation of habitat protection regulations are factors affecting the survival of many native species of anadromous and resident fish in the Columbia Basin.

NeSmith, Frank (Idaho Department of Fish and Game, Boise, ID); Long, Mack (Montana Department of Fish, Wildlife and Paks, Kalispell, MT); Matthews, Dayne (Washington Department of Fish and Wildlife, Olympia, WA)

1995-06-01T23:59:59.000Z

442

Work to save dose: contrasting effective dose rates from radon exposure in workplaces and residences against the backdrop of public and occupational limits  

SciTech Connect (OSTI)

Office workers are exposed to radon while at work and at home. Though there has been a multitude of studies reporting the measurements of radon concentrations and potential lung and effective doses associated with radon and progeny exposure in homes, similar studies on the concentrations and subsequent effective dose rates in the non-mine workplaces are lacking. Additionally, there are few, if any, comparative analyses of radon exposures at more 'typical' workplace with residential exposures within the same county. The purposes of this study were to measure radon concentrations in office and residential spaces in the same county and explore the radiation dose implications. Sixty-five track-etch detectors were deployed in office spaces and 47 were deployed in residences, all within Los Alamos County, New Mexico, USA. The sampling periods for these measurements were generally about three months. The measured concentrations were used to calculate and compare effective dose rates resulting from exposure while at work and at home. Results showed that full-time office workers receive on average about 8 times greater exposure at home than while in the office (2.3 mSv yr-! versus 0.3 mSv yr-!). The estimated effective dose rate for a more homebound person was about 3 mSv yr-!. Estimating effective doses from background radon exposure in the same county as Los Alamos National Laboratory, with thousands of'radiological workers,' highlights interesting contrasts in radiation protection standards that span public and occupational settings. For example, the effective dose rate from background radon exposure in unregulated office spaces ranged up to 1.1 mSv yr-!, which is similar to the 1 mSv yr-! threshold for regulation ofa 'radiological worker,' as defined in the Department of Energy regulations for occupational exposure. Additionally, the estimated average effective dose total of> 3 mSv yf! from radon background exposure in homes stands in contrast to the 0.1 mSv yr-! air pathway effective public dose limit regulated by the Environmental Protection Agency for radioactive air emissions.

Whicker, Jeffrey J [Los Alamos National Laboratory; Mcnaughton, Michael W [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

443

A Multiple Watershed Approach to Assessing the Effects of Habitat Restoration Actions on Anadromous and Resident Fish Populations, Technical Report 2003-2004.  

SciTech Connect (OSTI)

Habitat protection and restoration is a cornerstone of current strategies to restore ecosystems, recover endangered fish species, and rebuild fish stocks within the Columbia River Basin. Strategies featuring habitat restoration include the 2000 Biological Opinion on operation of the Federal Columbia River Power System (FCRPS BiOp) developed by the National Marine Fisheries Service (NMFS), the 2000 Biological Opinion on Bull Trout developed by the US Fish and Wildlife Service (USFWS), and Sub-Basin Plans developed under the Fish and Wildlife Program of the Northwest Power and Conservation Council (NWPCC). There is however little quantitative information about the effectiveness of different habitat restoration techniques. Such information is crucial for helping scientists and program managers allocate limited funds towards the greatest benefits for fish populations. Therefore, it is critical to systematically test the hypotheses underlying habitat restoration actions for both anadromous and resident fish populations. This pilot project was developed through a proposal to the Innovative Projects fund of the NWPCC (ESSA 2002). It was funded by the Bonneville Power Administration (BPA) following reviews by the Independent Scientific Review Panel (ISRP 2002), the Columbia Basin Fish and Wildlife Authority (CBFWA 2002), the NWPCC and BPA. The study was designed to respond directly to the above described needs for information on the effectiveness of habitat restoration actions, including legal measures specified in the 2000 FCRPS BiOp (RPA 183, pg. 9-133, NMFS 2000). Due to the urgency of addressing these measures, the timeline of the project was accelerated from a duration of 18 months to 14 months. The purpose of this pilot project was to explore methods for evaluating past habitat restoration actions and their effects on fish populations. By doing so, the project will provide a foundation of retrospective analyses, on which to build prospective, multi-watershed designs for future habitat restoration actions. Such designs are being developed concurrently with this project by several other groups in the Columbia Basin (RME Workgroup 2003, NMFS 2003, Hillman and Paulsen 2002, Hillman 2003). By addressing questions about habitat restoration and monitoring (in coordination with other related efforts), we hope that this project will catalyze a shift in the Basin's paradigm of habitat restoration, moving from implementation of individual watershed projects towards rigorously designed and monitored, multiwatershed, adaptive management experiments. The project involved three phases of work, which were closely integrated with various related and ongoing efforts in the region: (1) Scoping - We met with a Core Group of habitat experts and managers to scope out a set of testable habitat restoration hypotheses, identify candidate watersheds and recommend participants for a data evaluation workshop. (2) Data Assembly - We contacted over 80 scientists and managers to help evaluate the suitability of each candidate watershed's historical data for assessing the effectiveness of past restoration actions. We eventually settled on the Yakima, Wenatchee, Clearwater, and Salmon subbasins, and began gathering relevant data for these watersheds at a workshop with habitat experts and managers. Data assembly continued for several months after the workshop. (3) Data Analysis and Synthesis - We explored statistical approaches towards retrospectively analyzing the effects of restoration 'treatments' at nested spatial scales across multiple watersheds (Chapters 2-5 of this report). These analyses provided a foundation for identifying existing constraints to testing restoration hypotheses, and opportunities to overcome these constraints through improved experimental designs, monitoring protocols and project selection strategies (Chapters 6 and 7 of this report). Finally, we developed a set of recommendations to improve the design, implementation, and monitoring of prospective habitat restoration programs in the Columbia River Basin (Chapter 8).

Marmorek, David

2004-03-01T23:59:59.000Z

444

Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network [OSTI]

RESNETnationalstandardforhomeenergyaudits. standards/National_Energy_Audit_Standard.pdf,in,

Noris, Federico

2014-01-01T23:59:59.000Z

445

Assessment of children's exposure to arsenic from CCA-wood staircases at apartment complexes in Florida  

E-Print Network [OSTI]

in Florida Julia Ky Gress a , Jason T. Lessl a,b , Xiaoling Dong a , Lena Q. Ma a,b, a Soil Water Science Department, University of Florida, Gainesville, FL 32611, United States b State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Jiangsu 201146, China H I G H L

Ma, Lena

446

Apartment Hunting with an Eye to Energy Savings: Part I | Department...  

Broader source: Energy.gov (indexed) [DOE]

consumers. | Photo courtesy of Andrew Hudgins, NREL 17078. Comparing Hybrid and Plug-in Electric Vehicles Leilani Mnter adopts an acre of rainforest for every race she drives...

447

E-Print Network 3.0 - apartment level accusations Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences and Ecology 49 Morphosyntactic Mismatches revisited: the case of Romanian Supine* Elena Soare Summary: of projection is characterized by internal properties...

448

Building America Case Study: Conway Street Apartments, Greenfield, Massachusetts (Fact Sheet)  

SciTech Connect (OSTI)

While single-family, detached homes account for 63% of households (EIA 2009); multi-family homes account for a very large portion of that remaining housing stock, and this fraction is growing. Through recent research efforts, CARB has been evaluating strategies and technologies that can make dramatic improvements in energy performance in multi-family buildings

Not Available

2014-12-01T23:59:59.000Z

449

ALDEA SAN MIGUEL JUNIor 1-BEDrooM ApArtMENtS  

E-Print Network [OSTI]

________________________________________________________________ 6 Care_of_Furnishings_________________________________________________________ 7 Keys_and_Lockout

Yamamoto, Keith

450

Prying Apart Ruddlesden-Popper Phases: Exfoliation into Sheets and Nanotubes for Assembly of Perovskite  

E-Print Network [OSTI]

.; Salvador, P. A.; Mason, T. O.; Zhang, H.; Marks, L. D. J. Am. Chem. Soc. 1996, 118, 8951. (b) Salvador, P

451

Web-based feedback system: the life cycle management as continuous maintenance of apartment facility information  

E-Print Network [OSTI]

to make it efficient. A database requires a database management system (DBMS), a set of computer programs for organizing the information in a database, to manage its structure and control access to the data stored in the database [9]. A DBMS supports... the structuring of the database in a standard format and provides tools for data input, verification, storage, retrieval, query, and manipulation. According to Ramakishman [26], DBMS is software, designed to assist in maintaining and utilizing large collection...

Jeong, Jin Su

2006-10-30T23:59:59.000Z

452

Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network [OSTI]

bulbswithcompactfluorescentbulbs. Inaddition,thea?lightbulbswith fluorescentlightbulbsthatuselesslight bulbs with compact fluorescentlights Replace

Noris, Federico

2014-01-01T23:59:59.000Z

453

Vale: Dr Keith ROBY (1941-1981) In 1974, apart from the foundation professors,  

E-Print Network [OSTI]

such as Graham Chandler at the University of Western Australia and Professor David Craig at the Australian was one of the most talented and productive theoretical chemists in Australia - this from colleagues of public life - of energy, technology, the environment, the third world, and of setting up courses to teach

454

Panr Cunsn ApaRTMENTS GHP Retrofit ProvidesEnergyEfficiencyfor HUD  

E-Print Network [OSTI]

-to-air heatpump, anda water-to-waterheatpump. Each was installed at the complex and monitored for a six

455

Specializing in Apartment & Residential Leasing, Sales, Home Purchase and Nationwide Corporate Housing  

E-Print Network [OSTI]

. And here's more good news: the Houston area is now home to more Fortune 500 companies than any other city Corporate Housing Houston: Unequaled Housing Value Houston is a city of contrasts and surprises, of sky, of energy giants and world-class educational complexes, of Grand Opera and great expanses of year

Bittner, Eric R.

456

Deported for Life: For Helping a Friend to Get an Apartment and a Car  

E-Print Network [OSTI]

Just sit down and wait. The FBI is coming to ask you a fewhave I got to do with the FBI? He felt helpless and wantedobserver reported him to the FBI, but the Figure 1. Ansar

Shiekh, Irum

2007-01-01T23:59:59.000Z

457

Apart from outcomes of direct rele-vance to the Tajik Pamirs, what are the  

E-Print Network [OSTI]

, strategic goals, and elements for sustainable development? A strategy for sustainable mountain development According to OECD-DAC guidelines, a strategy for sustainable development should comprise: A coordinated set of par- ticipatory and continuously improving processes of analysis, debate, capacity- strengthening

Richner, Heinz

458

Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network [OSTI]

fromfurnacesandwaterheaters. Someprotocolscautionwithpilotlights, andwaterheaters;andinstallationofnaturaldraftgaswaterheatersinaninternalcloseton

Noris, Federico

2014-01-01T23:59:59.000Z

459

How Do You Save Energy in Your Apartment or Rental? | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana.ProgramJulietip sheetK-4In 2013Department of Energy Truck 51No doubtOn

460

residential environment. Electrical connections that are easily pulled apart and single, exposed conductors that are readily  

E-Print Network [OSTI]

of Energy, which sponsored code-writing activities, believed that rooftop, building-integrated, utility that additions to the code specifically addressed this technology. Making Solar Electricity Safer In the mid-1970 connections. In those early years, although the majority of PV installations were off grid, the early PV code

Johnson, Eric E.

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

The web-based graphic service request system for facility management of apartments  

E-Print Network [OSTI]

This research investigates the feasibility of web technology as a means of handling service requests for delivering high quality service in building operation and maintenance. This research proposes a web-based graphic service request (WGSR) system...

Lee, Kwang Jun

2006-10-30T23:59:59.000Z

462

Protocol for Maximizing Energy Savings and Indoor Environmental Quality Improvements when Retrofitting Apartments  

E-Print Network [OSTI]

practicesforweatherizationassistanceprogram,in,EnergyWeatherizationprogramtargetinglow?incomepopulationsthatreceivepublicassistance

Noris, Federico

2014-01-01T23:59:59.000Z

463

Easy Energy Tips for Apartments or Rental Homes | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana.Program - LibbyofThisStatement Tuesday, Septemberof

464

Table HC1.1.4 Housing Unit Characteristics by Average Floorspace--Apartments, 2  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ <Information Administration (EIA) 10 MECS Survey Data9c : U.S.WelcomeDomesticb.Major5a.4 Housing Unit

465

Table HC1.2.4 Living Space Characteristics by Average Floorspace--Apartments, 2  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ <Information Administration (EIA) 10 MECS Survey Data9c : U.S.WelcomeDomesticb.Major5a.4 Housing22.4

466

Pull-Apart in Strike-Slip Fault Zone | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: EnergyPotentialUrbanUtilityScalePVCapacityPulaski County, Kentucky: Energy Resources Jump to:

467

01-02-2008 - Wood Cabinet Falls Apart | The Ames Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation Desert SouthwestTechnologies | BlandinePrinceton Plasmareactions. |8 - Wood Cabinet Falls

468

Non-Residential Solar Water Heating Site Assessment at Milwaukee Apartment  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F S iPartnership ProgramDepartment of EnergyBuildings |

469

Simulation of wind driven ventilative cooling systems for an apartment building in Beijing and Shanghai  

E-Print Network [OSTI]

produce energy for buildings and industry. In order to reduce pollution and greenhouse gas emissions ventilation, CFD, Energy analysis 1. Introduction Throughout the entire world, buildings are major consumers of energy and major sources of greenhouse gas emissions. In China, buildings consume 17% of the total energy

Chen, Qingyan "Yan"

470

Air Conditioner User Behavior in a Master-Metered Apartment Building  

E-Print Network [OSTI]

Air conditioner operation was studied in order to understand how energy consumption and peak power are determined by user behavior, equipment operation and building characteristics. In a multi-family building, thirteen room air conditioners were...

Kempton, W.; Feuermann, D.; McGarity, A. E.

1987-01-01T23:59:59.000Z

471

UCSB Owned Apartments & Residential Housing TV Starter & TV Essential are provided through UCSB Communication Services.  

E-Print Network [OSTI]

Govt.Accesss 21 CityofCarpinteria Govt.Accesss 22 CNN 41 Lifetime 42 MSNBC 43 UniMás 44 AztecaAmerica 45 Spike

California at Santa Barbara, University of

472

UT, Knoxville Building Representatives (Updated November 13, 2013)  

E-Print Network [OSTI]

. Jeff Maples 974-3061 jeff-maples@utk.edu 50122500 **Apartment Residence Hall 2117 Andy Holt Ave Ms@utk.edu depratt@utk.edu cjogle@utk.edu 50136500 Auxiliary Services 2021 Stephenson Drive Mr. Jack Williams 974

Grissino-Mayer, Henri D.

473

Estimation the Performance of Solar Fiber Optic Lighting System after Repairing the Glass Fiber Cables in a South Korean Residential Building  

E-Print Network [OSTI]

The solar fiber optic lighting system consists of the solar ray concentrating apparatus, the tracking control, lighting transmission and emission parts. This system was installed on a 20-storey apartment building in South Korea. Many residents had...

Cha, K. S.; Kim, T. K.; Park, M. S.

474

PETER ANGELIS Assistant Vice Chancellor  

E-Print Network [OSTI]

· OCH Maintenance · Off-Campus University Apartments · On-Campus Residence Halls & Dining Services Center · Design, Project Management & Operations - Energy Services - Landscaping - Recycling - Utilities & Consolidation · Internal Audit Oversight · Organizational Effectiveness & Development · Strategic Planning

Grether, Gregory

475

354 STUDENT SERVICES AND PROGRAMS Student Services  

E-Print Network [OSTI]

, a vending area, a lounge, and a laundry room. A meal service contract is required in the high-rise residence the suite communities also require a meal service contract, except Squires Hall. On-campus apartments offer

Xie,Jiang (Linda)

476

Detailed Analysis of Thermal Mass Effects in a Code-Traceable DOE-2 Simulation of the 2000 IECC for a Single-Family Residence in Texas: A Project for Texas' Senate Bill 5 Legislation for Reducing Pollution in Nonattainment and Affected Areas  

E-Print Network [OSTI]

This study examines the thermal mass effects in a code-traceable DOE-2 simulation of the 2000 IECC (International Energy Conservation Code) for a single-family residence in Texas. This report is composed of two major simulations: 1) the simulation...

Kim, S.; Haberl, J. S.

2008-07-18T23:59:59.000Z

477

TRANSFERGUIDE FOUNDED IN 1829, Rochester Institute of  

E-Print Network [OSTI]

in RIT residence halls, apartments, or townhouses on campus. On-campus fraterni- ties, sororities social events and activities are sponsored by the College Activities Board, Residence Halls Association's Teams--baseball, basketball, crew, cross country, ice hockey (Division I), lacrosse, soc- cer, swimming

Zanibbi, Richard

478

Design and Analysis of Salmonid Tagging Studies in the Columbia Basin : Evaluating Wetland Restoration Projects in the Columbia River Estuary using Hydroacoustic Telemetry Arrays to Estimate Movement, Survival, and Residence Times of Juvenile Salmonids, Volume XXII (22).  

SciTech Connect (OSTI)

Wetlands in the Columbia River estuary are actively being restored by reconnecting these habitats to the estuary, making more wetland habitats available to rearing and migrating juvenile salmon. Concurrently, thousands of acoustically tagged juvenile salmonids are released into the Columbia River to estimate their survival as they migrate through the estuary. Here, we develop a release-recapture model that makes use of these tagged fish to measure the success of wetland restoration projects in terms of their contribution to populations of juvenile salmon. Specifically, our model estimates the fraction of the population that enter the wetland, survival within the wetland, and the mean residence time of fish within the wetland. Furthermore, survival in mainstem Columbia River downstream of the wetland can be compared between fish that remained the mainstem and entered the wetland. These conditional survival estimates provide a means of testing whether the wetland improves the subsequent survival of juvenile salmon by fostering growth or improving their condition. Implementing such a study requires little additional cost because it takes advantage of fish already released to estimate survival through the estuary. Thus, such a study extracts the maximum information at minimum cost from research projects that typically cost millions of dollars annually.

Perry, Russell W.; Skalski, John R.

2008-08-01T23:59:59.000Z

479

Using 3D Acoustic Telemetry to Assess the Response of Resident Salmonids to Strobe Lights in Lake Roosevelt, Washington; Chief Joseph Kokanee Enhancement Feasibility Study, Annual Report 2001-2002.  

SciTech Connect (OSTI)

In 1995, the Chief Joseph Kokanee Enhancement Project was established to mitigate the loss of anadromous fish due to the construction of Chief Joseph and Grand Coulee dams. The objectives of the Chief Joseph Enhancement Project are to determine the status of resident kokanee (Oncorhynchus nerka) populations above Chief Joseph and Grand Coulee dams and to enhance kokanee and rainbow trout (Oncorhynchus mykiss) populations. Studies conducted at Grand Coulee Dam documented substantial entrainment of kokanee through turbines at the third powerhouse. In response to finding high entrainment at Grand Coulee Dam, the Independent Scientific Review Panel (ISRP) recommended investigating the use of strobe lights to repel fish from the forebay of the third powerhouse. Therefore, our study focused on the third powerhouse and how strobe lights affected fish behavior in this area. The primary objective of our study was to assess the behavioral response of kokanee and rainbow trout to strobe lights using 3D acoustic telemetry, which yields explicit spatial locations of fish in three dimensions. Our secondary objectives were to (1) use a 3D acoustic system to mobile track tagged fish in the forebay and upriver of Grand Coulee Dam and (2) determine the feasibility of detecting fish using a hydrophone mounted in the tailrace of the third powerhouse. Within the fixed hydrophone array located in the third powerhouse cul-de-sac, we detected 50 kokanee and 30 rainbow trout, accounting for 47% and 45% respectively, of the fish released. Kokanee had a median residence time of 0.20 h and rainbow trout had a median residence time of 1.07 h. We detected more kokanee in the array at night compared to the day, and we detected more rainbow trout during the day compared to the night. In general, kokanee and rainbow trout approached along the eastern shore and the relative frequency of kokanee and rainbow trout detections was highest along the eastern shoreline of the 3D array. However, because we released fish near the eastern shore, this approach pattern may have resulted from our release location. A high percentage of rainbow trout (60%) approached within 35 m of the eastern shore, while fewer kokanee (40%) approached within 35 m of the eastern shore and were more evenly distributed across the entrance to the third powerhouse cul-de-sac area. During each of the strobe light treatments there were very few fish detected within 25 m of the strobe lights. The spatial distribution of fish detections showed relatively few tagged fish swam through the center of the array where the strobe lights were located. We detected 11 kokanee and 12 rainbow trout within 25 m of the strobe lights, accounting for 10% and 18% respectively, of the fish released. Both species exhibited very short residence times within 25 m of the strobe lights No attraction or repulsion behavior was observed within 25 m of the strobe lights. Directional vectors of both kokanee and rainbow trout indicate that both species passed the strobe lights by moving in a downstream direction and slightly towards the third powerhouse. We statistically analyzed fish behavior during treatments using a randomization to compare the mean distance fish were detected from the strobe lights. We compared treatments separately for day and night and with the data constrained to three distances from the strobe light (< 85m, < 50 m, and < 25 m). For kokanee, the only significant randomization test (of 10 tests) occurred with kokanee during the day for the 3-On treatment constrained to within 85 m of the strobe lights, where kokanee were significantly further away from the strobe lights than during the Off treatment (randomization test, P < 0.004, Table 1.5). However, one other test had a low P-value (P = 0.064) where kokanee were closer to the lights during the 3-On treatment at night within 85 m of the strobe lights compared to the Off treatment. For rainbow trout, none of the 11 tests were significant, but one test had a low P-value (P = 0.04), and fish were further away from the strobe lights during

Perry, Russlee; Farley, M.; Hansen, Gabriel

2003-01-01T23:59:59.000Z

480

Methodology and assumptions for evaluating heating and cooling energy requirements in new single-family residential buildings: Technical support document for the PEAR (Program for Energy Analysis of Residences) microcomputer program  

SciTech Connect (OSTI)

This report provides technical documentation for a software package called PEAR (Program for Energy Analysis of Residences) developed by LBL. PEAR offers an easy-to-use and accurate method of estimating the energy savings associated with various energy conservation measures used in site-built, single-family homes. This program was designed for use by non-technical groups such as home builders, home buyers or others in the buildings industry, and developed as an integral part of a set of voluntary guidelines entitled Affordable Housing Through Energy Conservation: A Guide to Designing and Constructing Energy Efficient Homes. These guidelines provide a method for selecting and evaluating cost-effective energy conservation measures based on the energy savings estimated by PEAR. This work is part of a Department of Energy program aimed at conducting research that will improve the energy efficiency of the nation's stock of conventionally-built and manufactured homes, and presenting the results to the public in a simplified format.

Huang, Y.J.; Ritschard, R.; Bull, J.; Byrne, S.; Turiel, I.; Wilson, D.; Hsui, C.; Foley, D.

1987-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "residences apartments duplex" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Mississippi Residents Save Through Appliance Rebate Program ...  

Broader source: Energy.gov (indexed) [DOE]

retailer see 90% increase in washing machine sales. April 22 was more than just Earth Day for Cowboy Maloney's Electric City. The Jackson store-one of 12 Cowboy Maloney's...

482

Kalispel Resident Fish Project : Annual Report, 2002.  

SciTech Connect (OSTI)

In 2002 the Kalispel Natural Resource Department (KNRD) continued monitoring enhancement projects (implemented from 1996 to 1998) for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Additional baseline fish population and habitat assessments were conducted, in 2002, in tributaries to the Pend Oreille River. Further habitat and fish population enhancement projects were also implemented in 2002.

Andersen, Todd; Olson, Jason

2003-03-01T23:59:59.000Z

483

Kalispel Resident Fish Project Annual Report, 2003.  

SciTech Connect (OSTI)

In 2003 the Kalispel Natural Resource Department (KNRD) continued monitoring enhancement projects (implemented from 1996 to 1998) for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Additional baseline fish population and habitat assessments were conducted, in 2003, in tributaries to the Pend Oreille River. Further habitat and fish population enhancement projects were also implemented.

Olson, Jason; Andersen, Todd

2004-04-01T23:59:59.000Z

484

DATE: December 9, 2011 TO: Bailey Residents  

E-Print Network [OSTI]

Joseph, Facilities Operations Supervisor, Walt Herrle, Food Service Director, and Greg Perrizo, Business Operations Supervisor RE: Bailey Hall Winter Break Information Please take a few minutes to read of the Bailey Staff will enter all rooms to conduct a safety and maintenance inspection. If University property

Janssen, Michel

485

Bike/ped bridge West Residences  

E-Print Network [OSTI]

UNIVERSITY AVE JUNIPERO SERRA BLVD PALO RD OLM STED PANAMAST PASTEUR DR OAK RD BIRCH ASH YALE OBERLIN

486

Undergraduate Residents' Guidelines for Living On Campus  

E-Print Network [OSTI]

Driver for Disabled Students 732-932-7817 Emergency Services (Inspections) 732-932-4800 Cable TV Telephones 7 Convenience Telephones 7 Emergency Telephones 7 Cable TV/Internet Access 7 Policy and Weight lifting 12 Bicycles 12 Drug Policy 12 Noise Policy 12 Disruptive Behavior Policy 13 Weapons 13

487

Kalispel Resident Fish Project : Annual Report, 1995.  

SciTech Connect (OSTI)

In 1995 the Kalispel Natural Resource Department (KNRD) in conjunction with the Washington Department of Fish and Wildlife (WDFW) initiated the implementation of a habitat and population enhancement project for bull trout (Salvelinus confluentus), westslope cutthroat trout (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Habitat and population assessments were conducted in seven tributaries of the Box Canyon reach of the Pend Oreille River. Assessments were used to determine the types and quality of habitat that were limiting to native bull trout and cutthroat trout populations. Assessments were also used to determine the effects of interspecific competition within these streams. A bull trout and brook trout (Salvelinus fontinalis) hybridization assessment was conducted to determine the degree of hybridization between these two species. Analysis of the habitat data indicated high rates of sediment and lack of wintering habitat. The factors that contribute to these conditions have the greatest impact on habitat quality for the tributaries of concern. Population data suggested that brook trout have less stringent habitat requirements; therefore, they have the potential to outcompete the native salmonids in areas of lower quality habitat. No hybrids were found among the samples, which is most likely attributable to the limited number of bull trout. Data collected from these assessments were compiled to develop recommendations for enhancement measures. Recommendations for restoration include riparian planting and fencing, instream structures, as well as, removal of non-native brook trout to reduce interspecific competition with native salmonids in an isolated reach of Cee Cee Ah Creek.

Maroney, Joseph; Donley, Christopher; Scott, Jason; Lockwood, Jr., Neil

1997-06-01T23:59:59.000Z

488

Educating Glendale, Arizona Residents About Energy Savings |...  

Broader source: Energy.gov (indexed) [DOE]

a problem. Citizens were constantly asking them for information on how to reduce home energy consumption, but they did not have a staff member to answer the questions. That...

489

General Residence Hall Information General Information  

E-Print Network [OSTI]

/dining facilities. Air Conditioning All rooms in Susan Davis Hall are equipped with window air conditioning units

Sheridan, Jennifer

490

Kalispel Resident Fish Project : Annual Report, 2008.  

SciTech Connect (OSTI)

In 2008, the Kalispel Natural Resource Department (KNRD) continued to implement its habitat enhancement projects for bull trout (Salvelinus confluentus) and westslope cutthroat trout (Oncorhynchus clarki lewisi). Baseline fish population and habitat assessments were conducted in Upper West Branch Priest River. Additional fish and habitat data were collected for the Granite Creek Watershed Assessment, a cooperative project between KNRD and the U.S. Forest Service Panhandle National Forest (FS) . The watershed assessment, funded primarily by the Salmon Recovery Funding Board of the State of Washington, will be completed in 2009.

Andersen, Todd [Kalispel Natural Resource Department

2009-07-08T23:59:59.000Z

491

Solar photovoltaic residence in Carlisle, Massachusetts  

SciTech Connect (OSTI)

The first solar photovoltaic house designed and constructed under the US Department of Energy's Solar Photovoltaic Residential Project has been completed. The house, which is powered by a 7-kWp PV system, will be used to assess the occupants' acceptance of and reactions to residential photovoltaic systems and to familiarize utilities, builders, developers, town building officials and others with issues concerning photovoltaic installations. The house is located on a two-acre lot in Carlisle, approximately twenty miles northwest of Boston. Built by a local architect/developer team, the house includes energy conservation and passive solar features. It utilizes a roof-mounted, flat-plate PV array which operates in a two-way energy exchange mode with the electric utility. The energy conservation and passive solar features of this house are described and a detailed description of the utility-interactive photovoltaic system is presented, along with initial performance data.

Strong, S. J.; Nichols, B. E.

1981-01-01T23:59:59.000Z

492

Kalispel Resident Fish Project : Annual Report, 1997.  

SciTech Connect (OSTI)

In 1997 the Kalispel Natural Resource Department (KNRD) in conjunction with the Washington Department of Fish and Wildlife (WDFW) continued the implementation of a habitat and population enhancement project for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Habitat enhancement measures, as outlined in the recommendations from the 1996 annual report, were conducted during field season 1997. Fencing and planting of riparian areas and instream structures were implemented. As a precursor to these enhancement efforts, pre-assessments were conducted to determine the affects of the enhancement. Habitat quality, stream morphology and fish populations were pre-assessed. This season also began the first year of post-assessment monitoring and evaluation of measures implemented during 1996. The largemouth bass hatchery construction was completed in October and the first bass were introduced to the facility that same month. The first round of production is scheduled for 1998.

Donley, Christopher; Lockwoood, Jr., Neil

1997-01-01T23:59:59.000Z

493

Kalispel Resident Fish Project : Annual Report, 2001.  

SciTech Connect (OSTI)

In 2001 the Kalispel Natural Resource Department (KNRD) continued assessing habitat and population enhancement projects for bull trout (Salvelinus confluentus), westslope cutthroat (Oncorhynchus clarki lewisi) and largemouth bass (Micropterus salmoides). Habitat enhancement measures, as outlined in recommendations from the 1996, 1997, and 1998 annual reports, were monitored during field season 1999, 2000, and 2001. Post assessments were used to evaluate habitat quality, stream morphology and fish populations where enhancement projects were implemented.

Andersen, Todd

2002-01-01T23:59:59.000Z

494

MORNINGSIDE An informational newsletter for residents  

E-Print Network [OSTI]

; and existing oil tanks will be emptied and cleaned. Some buildings will receive new gas regulators and on some footprint, both through the change in fuel type and the elimination of oil delivery trucks. In addition, gas residential buildings on the Morningside campus to using natural gas as the primary fuel source for heat

Qian, Ning

495

University Residence Hall Move-Out Begins  

E-Print Network [OSTI]

services and the University Center compost all food-prep waste and recycle their used cooking oil the daylight hours. Dining services continues to increase organic and local farms in food supply contracts. Currently, 10% of the produce served is certified organic or local/sustainable, and the seafood served

California at Santa Barbara, University of

496

Employee Headcount by County of Residence  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series toESnet4: Networking for37 East and West OtherEmployee Headcount by County

497

www.residences.qmul.ac.uk ACCOMMODATION  

E-Print Network [OSTI]

/freezers, cookers, microwave ovens, toasters, washing up facilities, storage cupboards, food preparation surfaces

Chittka, Lars

498

Impact evaluation of the energy retrofits installed in the Margolis high-rise apartment building, Chelsea housing authority  

SciTech Connect (OSTI)

As part of a joint demonstration effort involving HUD, DOE, a local public housing authority and Boston Edison, an evaluation of energy and demand saving retrofits was conducted for a tall, residential, low-income building located in Boston. The thirteen story building underwent window, lighting, and heating system control renovations in December, 1992. The success of these retrofits was determined using monthly and hourly whole-building consumption data along with a calibrated DOE-2.1D energy simulation model. According to the model developed, post-retrofit conditions showed reductions in annual energy consumption of 325 MWh and in peak demand of 100 kW. These savings resulted in an annual energy cost savings of $28,000. Over 90% of energy and cost savings were attributed to the window retrofit. Interaction of the reduction in lighting capacity with the building`s electric resistance heating system reduced the potential for energy and demand savings associated with the lighting retrofit. Results from the hourly simulation model also indicate that night setbacks controlled by the energy management system were not implemented. An additional 32 MWh in energy savings could be obtained by bringing this system on-line, however peak demand would be increased by 40 kW as the morning demand for space heat is increased, with a net loss in cost savings of $2,500.

Abraham, M.M.; McLain, H.A.; MacDonald, J.M.

1995-03-01T23:59:59.000Z

499

Why don't things fall apart? : a study of the survival of the Solomon Islands state  

E-Print Network [OSTI]

leased to foreign companies by local landowners for timbertropical timber boom of the 1980s, logging companies, mainlycompany called Somma Ltd (Aqorau 2008; K