National Library of Energy BETA

Sample records for reference ip number

  1. Detailed Chemical Kinetic Reaction Mechanisms for Primary Reference Fuels for Diesel Cetane Number and Spark-Ignition Octane Number

    SciTech Connect (OSTI)

    Westbrook, C K; Pitz, W J; Mehl, M; Curran, H J

    2010-03-03

    For the first time, a detailed chemical kinetic reaction mechanism is developed for primary reference fuel mixtures of n-hexadecane and 2,2,4,4,6,8,8-heptamethyl nonane for diesel cetane ratings. The mechanisms are constructed using existing rules for reaction pathways and rate expressions developed previously for the primary reference fuels for gasoline octane ratings, n-heptane and iso-octane. These reaction mechanisms are validated by comparisons between computed and experimental results for shock tube ignition and for oxidation under jet-stirred reactor conditions. The combined kinetic reaction mechanism contains the submechanisms for the primary reference fuels for diesel cetane ratings and submechanisms for the primary reference fuels for gasoline octane ratings, all in one integrated large kinetic reaction mechanism. Representative applications of this mechanism to two test problems are presented, one describing fuel/air autoignition variations with changes in fuel cetane numbers, and the other describing fuel combustion in a jet-stirred reactor environment with the fuel varying from pure 2,2,4,4,6,8,8-heptamethyl nonane (Cetane number of 15) to pure n-hexadecane (Cetane number of 100). The final reaction mechanism for the primary reference fuels for diesel fuel and gasoline is available on the web.

  2. References R-3 Note: In this report we refer to a number of documents (e.g., plans, reports) that are intended for internal

    E-Print Network [OSTI]

    Pennycook, Steve

    References #12;#12;References R-3 References Note: In this report we refer to a number of documents function as a means of communication between governmental agencies and the tenant companies on the Oak, Appendix B: WAG 1 Groundwater, Surface Water, and Sediment. DOE/OR-1043/V4&D1. U.S. Department of Energy

  3. Practical and fast quantum random number generation based on photon arrival time relative to external reference

    SciTech Connect (OSTI)

    Nie, You-Qi; Zhang, Jun Pan, Jian-Wei; Zhang, Hong-Fei; Wang, Jian; Zhang, Zhen; Ma, Xiongfeng

    2014-02-03

    We present a practical high-speed quantum random number generator, where the timing of single-photon detection relative to an external time reference is measured as the raw data. The bias of the raw data can be substantially reduced compared with the previous realizations. The raw random bit rate of our generator can reach 109 Mbps. We develop a model for the generator and evaluate the min-entropy of the raw data. Toeplitz matrix hashing is applied for randomness extraction, after which the final random bits are able to pass the standard randomness tests.

  4. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  5. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  6. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  7. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  8. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  9. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  10. Application Form Reference Number

    E-Print Network [OSTI]

    Po, Lai-Man

    /yyyy) (/) Title and Description of License/ Certificate/Activity // Date of Award (mm/yyyy) (/) Name Degree/Level Achieved Major Full-time or Part-time Date of Award (mm/yyyy) (/) Period From (mm-time Date of Award (mm/yyyy) (/) Period From (mm/yyyy) (/) To (mm/yyyy) (/) School

  11. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  12. References: AddisonWesley,

    E-Print Network [OSTI]

    Brass, Stefan

    and Crossroads of Internet History . http://www.internetvalley.com/intval1.html . Robert H'obbes' Zakon: Hobbes' Internet Timeline v5.1 http://info.isoc.org/guest/zakon/Internet/History/HIT.html . Tim Berners about the history of the internet. . explain numeric IP addresses and port numbers. . explain the notion

  13. References: AddisonWesley,

    E-Print Network [OSTI]

    Brass, Stefan

    and Crossroads of Internet History. http://www.internetvalley.com/intval1.html . Robert H'obbes' Zakon: Hobbes' Internet Timeline v5.1 http://info.isoc.org/guest/zakon/Internet/History/HIT.html . Tim Berners about the history of the internet. . explain numeric IP addresses and port numbers. . explain the notion

  14. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  15. Document Number Q0029500 References

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the t-) S/,,5 'a C O M P R E H E N S I VReferences 7.0

  16. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  17. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  18. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  19. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  20. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  1. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  2. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  3. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  4. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  5. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  6. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  7. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  8. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  9. Emergency Preparedness Desk Reference Manual

    E-Print Network [OSTI]

    Patzek, Tadeusz W.

    Emergency Preparedness Desk Reference Manual Important Phone Numbers Medical Emergencies / Hazardous Material Fire Emergencies Vehicle Accidents Evacuation Weather Emergencies Building/System Problem or Failure Threat of Violence Terrorism Interpersonal Emergencies Next Page >>> #12;Important Phone Numbers

  10. Reference Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProtonAbout Us HanfordReference Materials Reference

  11. Reference Shelf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProtonAbout Us HanfordReference MaterialsReference Shelf

  12. Poroelastic references

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Christina Morency

    2014-12-12

    This file contains a list of relevant references on the Biot theory (forward and inverse approaches), the double-porosity and dual-permeability theory, and seismic wave propagation in fracture porous media, in RIS format, to approach seismic monitoring in a complex fractured porous medium such as Brady?s Geothermal Field.

  13. Poroelastic references

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Christina Morency

    This file contains a list of relevant references on the Biot theory (forward and inverse approaches), the double-porosity and dual-permeability theory, and seismic wave propagation in fracture porous media, in RIS format, to approach seismic monitoring in a complex fractured porous medium such as Brady?s Geothermal Field.

  14. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  15. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  16. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  17. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  18. Reference Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProtonAbout Us Hanford SiteRecoveryWatertheReference

  19. Reference Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProtonAbout Us HanfordReference Materials

  20. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  1. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  2. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  3. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  4. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  5. Intel C++ Compiler User and Reference Guides

    E-Print Network [OSTI]

    Nikolic, Branislav K.

    Intel® C++ Compiler User and Reference Guides Document number: 304968-022US #12;Disclaimer) 2001, Hewlett-Packard Development Company, L.P. #12;#12;v Table of Contents Intel(R) C++ Compiler User and Reference Guides..............................................1 Intel® C++ Compiler User and Reference

  6. Letters and numbers within parentheses identify refer-ence codes. Numbers in italics refer to the Species/

    E-Print Network [OSTI]

    (A023) 16, 41 Frog, Mountain Yellow-legged (A025) 16, 43 Frog, Red-legged (A021) 16, 39 Frog, Tailed (R013) 17, 57 Snake, Sharp-tailed (R014) 17, 58 Snake, Western Aquatic Garter (R024) 18, 68 Snake, Western Black-headed (R025) 18, 69 Snake, Western Terrestrial Garter (R023) 18, 67 Turtle, Western Pond (R

  7. Professional References Ready Reference E-11

    E-Print Network [OSTI]

    Professional References Ready Reference E-11 College of Engineering, Architecture & Technology College of Engineering, Architecture & Technology Career Services Office ATRC 109E Stillwater, OK 74078 requested to do so. Create a separate sheet entitled "References." Print it on the same high quality papers

  8. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  9. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  10. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  11. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  12. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  13. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  14. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  15. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  16. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  17. Reference: A shorter version of this article appeared as Onsrud, Harlan J., Implementing Geographic Information Technologies Ethically, ArcNews, Fall 2008, Vol 30 Number 3, pp. 1-8.

    E-Print Network [OSTI]

    Wright, Dawn Jeannine

    Geographic Information Technologies Ethically, ArcNews, Fall 2008, Vol 30 Number 3, pp. 1-8. Implementing Geographic Information Technologies Ethically Harlan J. Onsrud, Professor Department of Spatial Information control mechanisms, I argue that morally defensible geospatial technology designs and information system

  18. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  19. Intel Fortran Compiler User and Reference Guides

    E-Print Network [OSTI]

    Nikolic, Branislav K.

    Intel® Fortran Compiler User and Reference Guides Document number: 304970-005US #12;Disclaimer) 2001, Hewlett-Packard Development Company, L.P. #12;#12;v Table of Contents Intel(R) Fortran Compiler User and Reference Guides.........................................1 Intel® Fortran Compiler User

  20. Semantic Features for Classifying Referring Search Terms

    SciTech Connect (OSTI)

    May, Chandler J.; Henry, Michael J.; McGrath, Liam R.; Bell, Eric B.; Marshall, Eric J.; Gregory, Michelle L.

    2012-05-11

    When an internet user clicks on a result in a search engine, a request is submitted to the destination web server that includes a referrer field containing the search terms given by the user. Using this information, website owners can analyze the search terms leading to their websites to better understand their visitors needs. This work explores some of the features that can be used for classification-based analysis of such referring search terms. We present initial results for the example task of classifying HTTP requests countries of origin. A system that can accurately predict the country of origin from query text may be a valuable complement to IP lookup methods which are susceptible to the obfuscation of dereferrers or proxies. We suggest that the addition of semantic features improves classifier performance in this example application. We begin by looking at related work and presenting our approach. After describing initial experiments and results, we discuss paths forward for this work.

  1. Emergency Information Desk Reference

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    Emergency Information Desk Reference ECU Police Department ECU Environmental Health & Safety Revised Feb 2012 #12;Emergency Information Desk Reference 2 INTRODUCTION Emergencies, accidents, and injuries can occur at any time and without warning. ECU has designed this emergency information desk

  2. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  3. High frequency reference electrode

    DOE Patents [OSTI]

    Kronberg, J.W.

    1994-05-31

    A high frequency reference electrode for electrochemical experiments comprises a mercury-calomel or silver-silver chloride reference electrode with a layer of platinum around it and a layer of a chemically and electrically resistant material such as TEFLON around the platinum covering all but a small ring or halo' at the tip of the reference electrode, adjacent to the active portion of the reference electrode. The voltage output of the platinum layer, which serves as a redox electrode, and that of the reference electrode are coupled by a capacitor or a set of capacitors and the coupled output transmitted to a standard laboratory potentiostat. The platinum may be applied by thermal decomposition to the surface of the reference electrode. The electrode provides superior high-frequency response over conventional electrodes. 4 figs.

  4. High frequency reference electrode

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1994-01-01

    A high frequency reference electrode for electrochemical experiments comprises a mercury-calomel or silver-silver chloride reference electrode with a layer of platinum around it and a layer of a chemically and electrically resistant material such as TEFLON around the platinum covering all but a small ring or "halo" at the tip of the reference electrode, adjacent to the active portion of the reference electrode. The voltage output of the platinum layer, which serves as a redox electrode, and that of the reference electrode are coupled by a capacitor or a set of capacitors and the coupled output transmitted to a standard laboratory potentiostat. The platinum may be applied by thermal decomposition to the surface of the reference electrode. The electrode provides superior high-frequency response over conventional electrodes.

  5. Optical voltage reference

    DOE Patents [OSTI]

    Rankin, R.; Kotter, D.

    1994-04-26

    An optical voltage reference for providing an alternative to a battery source is described. The optical reference apparatus provides a temperature stable, high precision, isolated voltage reference through the use of optical isolation techniques to eliminate current and impedance coupling errors. Pulse rate frequency modulation is employed to eliminate errors in the optical transmission link while phase-lock feedback is employed to stabilize the frequency to voltage transfer function. 2 figures.

  6. Optical voltage reference

    DOE Patents [OSTI]

    Rankin, Richard (Ammon, ID); Kotter, Dale (Bingham County, ID)

    1994-01-01

    An optical voltage reference for providing an alternative to a battery source. The optical reference apparatus provides a temperature stable, high precision, isolated voltage reference through the use of optical isolation techniques to eliminate current and impedance coupling errors. Pulse rate frequency modulation is employed to eliminate errors in the optical transmission link while phase-lock feedback is employed to stabilize the frequency to voltage transfer function.

  7. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  8. Sandia Energy - Reference Model Documents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Documents Home Stationary Power Energy Conversion Efficiency Water Power Reference Model Project (RMP) Reference Model Documents Reference Model DocumentsTara Camacho-Lopez2015-05-...

  9. Application Protocol Reference Architecture Application Protocol Reference Architecture

    E-Print Network [OSTI]

    van Sinderen, Marten

    Application Protocol Reference Architecture 165 Chapter 7 Application Protocol Reference Architecture This chapter proposes an alternative reference architecture for application protocols. The proposed reference architecture consists of the set of possible architectures for application protocols

  10. HAZARDOUS WASTE MANAGEMENT REFERENCE

    E-Print Network [OSTI]

    Winfree, Erik

    HAZARDOUS WASTE MANAGEMENT REFERENCE GUIDE Prepared by Environment, Health and Safety Office@caltech.edu http://safety.caltech.edu #12;Hazardous Waste Management Reference Guide Page 2 of 36 TABLE OF CONTENTS Satellite Accumulation Area 9 Waste Accumulation Facility 10 HAZARDOUS WASTE CONTAINER MANAGEMENT Labeling

  11. Reference Hashed Frank Schilder

    E-Print Network [OSTI]

    provides the reader with an introduction to hashing lists and how they can be used for linguistic dam data structure for the representation of discourse referents. A so-called hashing list is employed instead a novel data structure for the representation of discourse referents. A/rushing list t

  12. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  13. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  14. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  15. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  16. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  17. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  18. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  19. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  20. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  1. PVWatts Version 1 Technical Reference

    SciTech Connect (OSTI)

    Dobos, A. P.

    2013-10-01

    The NREL PVWatts(TM) calculator is a web application developed by the National Renewable Energy Laboratory (NREL) that estimates the electricity production of a grid-connected photovoltaic system based on a few simple inputs. PVWatts combines a number of sub-models to predict overall system performance, and makes several hidden assumptions about performance parameters. This technical reference details the individual sub-models, documents assumptions and hidden parameters, and explains the sequence of calculations that yield the final system performance estimation.

  2. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  3. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  4. Volume 43, Number 2, April 2002 F 313 References Cited

    E-Print Network [OSTI]

    with discussions of race and culture. Franz Boas countered racism in the early 1900s by demonstrating that "races textbooks (Boas 1938, Kroeber 1923), and combating racism and ethnocentrism continues to be important

  5. BC Reference number ISO/IEC 14882:1998(E)

    E-Print Network [OSTI]

    Graham, Nick

    by ANSI as an American National Standard. Date of ANSI Approval: 7/27/98 Published by American National National Standards Institute (ANSI), and Information Technology Industry Council (ITI). Not for resale

  6. Value of Information References

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Morency, Christina

    2014-12-12

    This file contains a list of relevant references on value of information (VOI) in RIS format. VOI provides a quantitative analysis to evaluate the outcome of the combined technologies (seismology, hydrology, geodesy) used to monitor Brady's Geothermal Field.

  7. Value of Information References

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Morency, Christina

    This file contains a list of relevant references on value of information (VOI) in RIS format. VOI provides a quantitative analysis to evaluate the outcome of the combined technologies (seismology, hydrology, geodesy) used to monitor Brady's Geothermal Field.

  8. Precision displacement reference system

    DOE Patents [OSTI]

    Bieg, Lothar F. (Albuquerque, NM); Dubois, Robert R. (Albuquerque, NM); Strother, Jerry D. (Edgewood, NM)

    2000-02-22

    A precision displacement reference system is described, which enables real time accountability over the applied displacement feedback system to precision machine tools, positioning mechanisms, motion devices, and related operations. As independent measurements of tool location is taken by a displacement feedback system, a rotating reference disk compares feedback counts with performed motion. These measurements are compared to characterize and analyze real time mechanical and control performance during operation.

  9. Aluminum reference electrode

    DOE Patents [OSTI]

    Sadoway, Donald R. (Belmont, MA)

    1988-01-01

    A stable reference electrode for use in monitoring and controlling the process of electrolytic reduction of a metal. In the case of Hall cell reduction of aluminum, the reference electrode comprises a pool of molten aluminum and a solution of molten cryolite, Na.sub.3 AlF.sub.6, wherein the electrical connection to the molten aluminum does not contact the highly corrosive molten salt solution. This is accomplished by altering the density of either the aluminum (decreasing the density) or the electrolyte (increasing the density) so that the aluminum floats on top of the molten salt solution.

  10. Aluminum reference electrode

    DOE Patents [OSTI]

    Sadoway, D.R.

    1988-08-16

    A stable reference electrode is described for use in monitoring and controlling the process of electrolytic reduction of a metal. In the case of Hall cell reduction of aluminum, the reference electrode comprises a pool of molten aluminum and a solution of molten cryolite, Na[sub 3]AlF[sub 6], wherein the electrical connection to the molten aluminum does not contact the highly corrosive molten salt solution. This is accomplished by altering the density of either the aluminum (decreasing the density) or the electrolyte (increasing the density) so that the aluminum floats on top of the molten salt solution. 1 fig.

  11. Multifunctional reference electrode

    DOE Patents [OSTI]

    Redey, L.; Vissers, D.R.

    1981-12-30

    A multifunctional, low mass reference electrode of a nickel tube, thermocouple means inside the nickel tube electrically insulated therefrom for measuring the temperature thereof, a housing surrounding the nickel tube, an electrolyte having a fixed sulfide ion activity between the housing and the outer surface of the nickel tube forming the nickel/nickel sulfide/sulfide half-cell are described. An ion diffusion barrier is associated with the housing in contact with the electrolyte. Also disclosed is a cell using the reference electrode to measure characteristics of a working electrode.

  12. Grant Reference Lead / Sole

    E-Print Network [OSTI]

    Rank Overall Score Grant Reference Lead / Sole Grant Grant Holder Research Organisation Project of Birmingham Controls on Soil Carbon Export revealed by Novel Tracers on multiple timescales (SCENT) Standard Grant DEC12 8 8 NE/K011871/1 N Melanie Leng NERC British Geological Survey A 500,000-year environmental

  13. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  14. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  15. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  16. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  17. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  18. IP Concatenation: The Method for Enhancement of IPsec Performance

    E-Print Network [OSTI]

    Yeom, Heon Young

    of the public telecommunication infrastructure, maintaining privacy through the use of tunneling protocols of hosts, between a pair of IPsec gateways, or between a IPsec gateway and a host (IPsec gateway is the term to refer to a gateway that implements IPsec protocols). IPsec has some advantages

  19. OSH technical reference manual

    SciTech Connect (OSTI)

    Not Available

    1993-11-01

    In an evaluation of the Department of Energy (DOE) Occupational Safety and Health programs for government-owned contractor-operated (GOCO) activities, the Department of Labor`s Occupational Safety and Health Administration (OSHA) recommended a technical information exchange program. The intent was to share written safety and health programs, plans, training manuals, and materials within the entire DOE community. The OSH Technical Reference (OTR) helps support the secretary`s response to the OSHA finding by providing a one-stop resource and referral for technical information that relates to safe operations and practice. It also serves as a technical information exchange tool to reference DOE-wide materials pertinent to specific safety topics and, with some modification, as a training aid. The OTR bridges the gap between general safety documents and very specific requirements documents. It is tailored to the DOE community and incorporates DOE field experience.

  20. For IPS Office Use Only A / R: Eng Prof

    E-Print Network [OSTI]

    supporting documents have been received (for instance, transcripts and official test scores) 2. You have / Country: ______________________________ Postal Code: ____________________________________ Postal Code country code and city code in telephone) Fax number if dialed from the US

  1. Appendix A: Reference case

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724 2,570Month PreviousDry4,645 8244 Reference

  2. Appendix A: Reference case

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724 2,570Month PreviousDry4,645 8244 Reference6

  3. Appendix A: Reference case

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724 2,570Month PreviousDry4,645 8244 Reference64

  4. Appendix A: Reference case

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724 2,570Month PreviousDry4,645 82444 Reference

  5. Appendix A: Reference case

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0ProvedDecade2,948 2,724 2,570Month PreviousDry4,645 82444 Reference6

  6. Manufacturing Energy and Carbon Footprint References | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    References Manufacturing Energy and Carbon Footprint References footprintreferences.pdf More Documents & Publications 2010 Manufacturing Energy and Carbon Footprints: References...

  7. Change Number

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D BGene Network ShapingDate: M-16-04-04 Federal FacilityChange Number

  8. Coal data: A reference

    SciTech Connect (OSTI)

    Not Available

    1995-02-01

    This report, Coal Data: A Reference, summarizes basic information on the mining and use of coal, an important source of energy in the US. This report is written for a general audience. The goal is to cover basic material and strike a reasonable compromise between overly generalized statements and detailed analyses. The section ``Supplemental Figures and Tables`` contains statistics, graphs, maps, and other illustrations that show trends, patterns, geographic locations, and similar coal-related information. The section ``Coal Terminology and Related Information`` provides additional information about terms mentioned in the text and introduces some new terms. The last edition of Coal Data: A Reference was published in 1991. The present edition contains updated data as well as expanded reviews and additional information. Added to the text are discussions of coal quality, coal prices, unions, and strikes. The appendix has been expanded to provide statistics on a variety of additional topics, such as: trends in coal production and royalties from Federal and Indian coal leases, hours worked and earnings for coal mine employment, railroad coal shipments and revenues, waterborne coal traffic, coal export loading terminals, utility coal combustion byproducts, and trace elements in coal. The information in this report has been gleaned mainly from the sources in the bibliography. The reader interested in going beyond the scope of this report should consult these sources. The statistics are largely from reports published by the Energy Information Administration.

  9. Key Reference Agilent Technologies

    E-Print Network [OSTI]

    Anlage, Steven

    is provided "as is", and is subject to being changed, without notice, in future editions. Further with the User and should any of the contract terms conflict with these terms, the contract terms shall control enables you to define the number of points in a step sweep. When you press this key, the current value

  10. Tank characterization reference guide

    SciTech Connect (OSTI)

    De Lorenzo, D.S.; DiCenso, A.T.; Hiller, D.B.; Johnson, K.W.; Rutherford, J.H.; Smith, D.J. [Los Alamos Technical Associates, Kennewick, WA (United States); Simpson, B.C. [Westinghouse Hanford Co., Richland, WA (United States)

    1994-09-01

    Characterization of the Hanford Site high-level waste storage tanks supports safety issue resolution; operations and maintenance requirements; and retrieval, pretreatment, vitrification, and disposal technology development. Technical, historical, and programmatic information about the waste tanks is often scattered among many sources, if it is documented at all. This Tank Characterization Reference Guide, therefore, serves as a common location for much of the generic tank information that is otherwise contained in many documents. The report is intended to be an introduction to the issues and history surrounding the generation, storage, and management of the liquid process wastes, and a presentation of the sampling, analysis, and modeling activities that support the current waste characterization. This report should provide a basis upon which those unfamiliar with the Hanford Site tank farms can start their research.

  11. Nuclear Science References Database

    E-Print Network [OSTI]

    B. Pritychenko; E. B?ták; B. Singh; J. Totans

    2014-07-08

    The Nuclear Science References (NSR) database together with its associated Web interface, is the world's only comprehensive source of easily accessible low- and intermediate-energy nuclear physics bibliographic information for more than 210,000 articles since the beginning of nuclear science. The weekly-updated NSR database provides essential support for nuclear data evaluation, compilation and research activities. The principles of the database and Web application development and maintenance are described. Examples of nuclear structure, reaction and decay applications are specifically included. The complete NSR database is freely available at the websites of the National Nuclear Data Center http://www.nndc.bnl.gov/nsr and the International Atomic Energy Agency http://www-nds.iaea.org/nsr.

  12. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  13. Sensor Characteristics Reference Guide

    SciTech Connect (OSTI)

    Cree, Johnathan V.; Dansu, A.; Fuhr, P.; Lanzisera, Steven M.; McIntyre, T.; Muehleisen, Ralph T.; Starke, M.; Banerjee, Pranab; Kuruganti, T.; Castello, C.

    2013-04-01

    The Buildings Technologies Office (BTO), within the U.S. Department of Energy (DOE), Office of Energy Efficiency and Renewable Energy (EERE), is initiating a new program in Sensor and Controls. The vision of this program is: • Buildings operating automatically and continuously at peak energy efficiency over their lifetimes and interoperating effectively with the electric power grid. • Buildings that are self-configuring, self-commissioning, self-learning, self-diagnosing, self-healing, and self-transacting to enable continuous peak performance. • Lower overall building operating costs and higher asset valuation. The overarching goal is to capture 30% energy savings by enhanced management of energy consuming assets and systems through development of cost-effective sensors and controls. One step in achieving this vision is the publication of this Sensor Characteristics Reference Guide. The purpose of the guide is to inform building owners and operators of the current status, capabilities, and limitations of sensor technologies. It is hoped that this guide will aid in the design and procurement process and result in successful implementation of building sensor and control systems. DOE will also use this guide to identify research priorities, develop future specifications for potential market adoption, and provide market clarity through unbiased information

  14. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  15. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  16. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  17. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  18. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  19. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  20. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  1. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  2. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  3. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  4. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  5. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  6. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  7. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  8. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  9. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  10. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  11. Optical probe with reference fiber

    DOE Patents [OSTI]

    Da Silva, Luiz B. (Danville, CA); Chase, Charles L. (Dublin, CA)

    2006-03-14

    A system for characterizing tissue includes the steps of generating an emission signal, generating a reference signal, directing the emission signal to and from the tissue, directing the reference signal in a predetermined manner relative to the emission signal, and using the reference signal to compensate the emission signal. In one embodiment compensation is provided for fluctuations in light delivery to the tip of the probe due to cable motion.

  12. Xyce parallel electronic simulator : reference guide.

    SciTech Connect (OSTI)

    Mei, Ting; Rankin, Eric Lamont; Thornquist, Heidi K.; Santarelli, Keith R.; Fixel, Deborah A.; Coffey, Todd Stirling; Russo, Thomas V.; Schiek, Richard Louis; Warrender, Christina E.; Keiter, Eric Richard; Pawlowski, Roger Patrick

    2011-05-01

    This document is a reference guide to the Xyce Parallel Electronic Simulator, and is a companion document to the Xyce Users Guide. The focus of this document is (to the extent possible) exhaustively list device parameters, solver options, parser options, and other usage details of Xyce. This document is not intended to be a tutorial. Users who are new to circuit simulation are better served by the Xyce Users Guide. The Xyce Parallel Electronic Simulator has been written to support, in a rigorous manner, the simulation needs of the Sandia National Laboratories electrical designers. It is targeted specifically to run on large-scale parallel computing platforms but also runs well on a variety of architectures including single processor workstations. It also aims to support a variety of devices and models specific to Sandia needs. This document is intended to complement the Xyce Users Guide. It contains comprehensive, detailed information about a number of topics pertinent to the usage of Xyce. Included in this document is a netlist reference for the input-file commands and elements supported within Xyce; a command line reference, which describes the available command line arguments for Xyce; and quick-references for users of other circuit codes, such as Orcad's PSpice and Sandia's ChileSPICE.

  13. FAQS Reference Guide – Construction Management

    Broader source: Energy.gov [DOE]

    This reference guide addresses the competency statements in the March 2004 edition of DOE-STD-1180-2004, Construction Management Functional Area Qualification Standard.

  14. FAQS Reference Guide – Industrial Hygiene

    Broader source: Energy.gov [DOE]

    This reference guide addresses the competency statements in the November 2007 edition of DOE-STD-1138-2007, Industrial Hygiene Functional Area Qualification Standard.

  15. FAQS Reference Guide – Emergency Management

    Office of Energy Efficiency and Renewable Energy (EERE)

    This reference guide addresses the competency statements in the January 2004 edition of DOE-STD-1177-2004, Emergency Management Functional Area Qualification Standard.

  16. FAQS Reference Guide- Chemical Processing

    Office of Energy Efficiency and Renewable Energy (EERE)

    This reference guide addresses the competency statements in the February 2010 edition of DOE-STD-1176-2010, Chemical Processing Functional Area Qualification Standard.

  17. FAQS Reference Guide – Environmental Compliance

    Office of Energy Efficiency and Renewable Energy (EERE)

    This reference guide addresses the competency statements in the June 2011 edition of DOE-STD-1156-2011, Environmental Compliance Functional Area Qualification Standard.

  18. Ris Energy Report 5 References References for Chapter 3

    E-Print Network [OSTI]

    Risø Energy Report 5 References References for Chapter 3 1. UNEP. (2006). Background paper for the ministerial-level consultations on energy and environment for development. Ninth special session energy outlook 2005. Paris: IEA. 3. IEA. (2003). World energy investment outlook. Paris: IEA. 4. World

  19. Ris Energy Report 6 References Reference list for Chapter 3

    E-Print Network [OSTI]

    Risø Energy Report 6 References Reference list for Chapter 3 1. European Commission. (2007). Communication from the Commis- sion to the European Council and the European Parliament ­ An energy policy of the Brussels European Council 8/9 March 2007. Brussels. (7224/1/07 Rev. 1). 3. Danish Energy authority. (2007

  20. Archived Reference Building Type: Warehouse

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  1. Archived Reference Building Type: Warehouse

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  2. Sandia Energy - Technical Reference for Hydrogen Compatibility...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technical Reference for Hydrogen Compatibility of Materials Home Transportation Energy Hydrogen Materials & Components Compatibility Technical Reference for Hydrogen Compatibility...

  3. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  4. SAM Photovoltaic Model Technical Reference

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SAM Photovoltaic Model Technical Reference P. Gilman National Renewable Energy Laboratory Technical Report NRELTP-6A20-64102 May 2015 NREL is a national laboratory of the U.S....

  5. FAQS Reference Guide – Occupational Safety

    Broader source: Energy.gov [DOE]

    This reference guide has been developed to address the competency statements in the July 2011 version of DOE-STD-1160-2011, Occupational Safety Functional Area Qualification Standard.

  6. Safeguards and Security Program References

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-08-26

    The manual establishes definitions for terms related to the Department of Energy Safeguards and Security (S&S) Program and includes lists of references and acronyms/abbreviations applicable to S&S Program directives. Cancels the Safeguards and Security Glossary of Terms, dated 12-18-95. Current Safeguards and Security Program References can also be found at Safeguards and Security Policy Information Resource (http://pir.pnl.gov/)

  7. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  8. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  9. REFERENCES

    E-Print Network [OSTI]

    2008-08-23

    Mechanism of Fluid Displacement in Sands. Trans. Am. Inst. Min. Metall. Eng.,. 146: 107-116. Chaudhari, N.M., 1971. An Improved Numerical Technique for ...

  10. REFERENCES

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5 United States Code (U.S.C.) Section 552a. . b. P.L. 104-106, Division E, Clinger Cohen Act (CCA) (formerly Information Technology Management Reform Act of 1996. c. P.L....

  11. Fast Reference-Based MRI

    E-Print Network [OSTI]

    Weizman, Lior; Ben-Basaht, Dafna

    2015-01-01

    In many clinical MRI scenarios, existing imaging information can be used to significantly shorten acquisition time or to improve Signal to Noise Ratio (SNR). In some cases, a previously acquired image can serve as a reference image, that may exhibit similarity to the image being acquired. Examples include similarity between adjacent slices in high resolution MRI, similarity between various contrasts in the same scan and similarity between different scans of the same patient. In this paper we present a general framework for utilizing reference images for fast MRI. We take into account that the reference image may exhibit low similarity with the acquired image and develop an iterative weighted approach for reconstruction, which tunes the weights according to the degree of similarity. Experiments demonstrate the performance of the method in three different clinical MRI scenarios: SNR improvement in high resolution brain MRI, utilizing similarity between T2-weighted and fluid-attenuated inversion recovery (FLAIR)...

  12. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  13. sheet is a su se refer to t

    E-Print Network [OSTI]

    Refer to your Search the on number for e f your course select will aut Make sure yo Build your tim at http://w in, build you departmenta nline course t ach course e includes a la tomatically sc ou pick nrolling stration and E website for in exchange a co ow the instruc explanation p button different lab

  14. Title: Information theory Reference: 13791

    E-Print Network [OSTI]

    Overill, Richard E.

    environment or communicates with others. One of the fundamental tenets of information theory a spate of publications appeared applying information theory to many aspects of music analysisTitle: Information theory Reference: 13791 Sort key: informationtheory Version: 3.0 Revision

  15. / R Reference May 25, 2010

    E-Print Network [OSTI]

    Loon, E. Emiel van

    of time searching for a simple way to do what I wanted, but at the end of the semester, I was pleasantly that the entire resulting derived work is distributed under the terms of a permission notice identical to this one, Matlab / R Reference 2 Contents 1 Help 3 2 Entering/building/indexing matrices 3 2.1 Cell arrays

  16. Reference Workbook: Pollution Prevention Plans

    E-Print Network [OSTI]

    #12;Reference Workbook: Pollution Prevention Plans DOE FRAP 1994-35 Prepared for: I Environment Canada Environmental Protection Fraser Pollution Abatement Office 224 West Esplanade North Vancouver, B Pollution Abatement Office. Environment Canada is not responsible for the content of this report but has

  17. References: Elmasri/Navathe:Fundamentals

    E-Print Network [OSTI]

    Brass, Stefan

    7. SQL I 7­1 Part 7: SQL I References: . Elmasri/Navathe:Fundamentals of Database Systems, 3rd Edition, 1999. Chap. 8, ``SQL --- The Relational Database Standard'' (Sect. 8.2, 8.3.3, part of 8. . Date/Darwen: A Guide to the SQL Standard, Fourth Edition, Addison­Wesley , 1997. . Date: A Guide

  18. EMERGENCY PROCEDURES QUICK REFERENCE GUIDE

    E-Print Network [OSTI]

    Frantz, Kyle J.

    1 EMERGENCY PROCEDURES QUICK REFERENCE GUIDE GSU EMERGENCY MANAGEMENT 404-413-0783 GSU POLICE: 404-413-3333 ATLANTA FIRE RESUCE: 911 #12;2 Emergency Response - Order of Priority In any emergency situation, Georgia infrastructure and facilities 3. Resume our research and educational programs Emergency Action Levels: A. Level 1

  19. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  20. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  1. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  2. Reference to Situation Content in Uyghur Auxiliary bolmaq

    E-Print Network [OSTI]

    McKenzie, Andrew; Eziz, Gülnar; Major, Travis

    2015-01-01

    we’ve seen so far. Cough as part of medical checkup (ex. (the physical c. bolP = ?s. cough(I)(s) & SAC(s l )(s) Leg-y¨otel-ip bol-du-m cough- IP bol-past-1s ‘I coughed’ # put-

  3. On Ramsey Numbers

    E-Print Network [OSTI]

    Dhananjay P. Mehendale

    2006-05-24

    In this paper we define new numbers called the Neo-Ramsay numbers. We show that these numbers are in fact equal to the Ramsay numbers. Neo-Ramsey numbers are easy to compute and for finding them it is not necessary to check all possible graphs but enough to check only special kind of graphs having a well-defined adjacency pattern.

  4. Microgrid cyber security reference architecture.

    SciTech Connect (OSTI)

    Veitch, Cynthia K.; Henry, Jordan M.; Richardson, Bryan T.; Hart, Derek H.

    2013-07-01

    This document describes a microgrid cyber security reference architecture. First, we present a high-level concept of operations for a microgrid, including operational modes, necessary power actors, and the communication protocols typically employed. We then describe our motivation for designing a secure microgrid; in particular, we provide general network and industrial control system (ICS)-speci c vulnerabilities, a threat model, information assurance compliance concerns, and design criteria for a microgrid control system network. Our design approach addresses these concerns by segmenting the microgrid control system network into enclaves, grouping enclaves into functional domains, and describing actor communication using data exchange attributes. We describe cyber actors that can help mitigate potential vulnerabilities, in addition to performance bene ts and vulnerability mitigation that may be realized using this reference architecture. To illustrate our design approach, we present a notional a microgrid control system network implementation, including types of communica- tion occurring on that network, example data exchange attributes for actors in the network, an example of how the network can be segmented to create enclaves and functional domains, and how cyber actors can be used to enforce network segmentation and provide the neces- sary level of security. Finally, we describe areas of focus for the further development of the reference architecture.

  5. 1 -Routing Number 2 -Account Number

    E-Print Network [OSTI]

    Chen, Yiling

    you will need: · Your Harvard University Id Number (HUID) · Your HUID pin number · Your Checking/Savings on the right side of the screen under Payroll and Compensation. #12;*Please, in an effort to save paper and if you do not wish to receive a paper copy of the check. Click the small box above the SAVE button. CLICK

  6. Emergency Responder Radioactive Material Quick Reference Sheet

    Broader source: Energy.gov [DOE]

    Transportation Emergency Preparedness Program (TEPP) Emergency Responder Radioactive Material Quick Reference Sheet

  7. Generic Argillite/Shale Disposal Reference Case

    E-Print Network [OSTI]

    Zheng, Liange

    2014-01-01

    Shale Disposal Reference Case August 2014 Borehole activity: Oil and gas drilling targets for hydrocarbon resource

  8. Reference Inflow Characterization for River Resource Reference Model (RM2)

    SciTech Connect (OSTI)

    Neary, Vincent S [ORNL

    2011-12-01

    Sandia National Laboratory (SNL) is leading an effort to develop reference models for marine and hydrokinetic technologies and wave and current energy resources. This effort will allow the refinement of technology design tools, accurate estimates of a baseline levelized cost of energy (LCoE), and the identification of the main cost drivers that need to be addressed to achieve a competitive LCoE. As part of this effort, Oak Ridge National Laboratory was charged with examining and reporting reference river inflow characteristics for reference model 2 (RM2). Published turbulent flow data from large rivers, a water supply canal and laboratory flumes, are reviewed to determine the range of velocities, turbulence intensities and turbulent stresses acting on hydrokinetic technologies, and also to evaluate the validity of classical models that describe the depth variation of the time-mean velocity and turbulent normal Reynolds stresses. The classical models are found to generally perform well in describing river inflow characteristics. A potential challenge in river inflow characterization, however, is the high variability of depth and flow over the design life of a hydrokinetic device. This variation can have significant effects on the inflow mean velocity and turbulence intensity experienced by stationary and bottom mounted hydrokinetic energy conversion devices, which requires further investigation, but are expected to have minimal effects on surface mounted devices like the vertical axis turbine device designed for RM2. A simple methodology for obtaining an approximate inflow characterization for surface deployed devices is developed using the relation umax=(7/6)V where V is the bulk velocity and umax is assumed to be the near-surface velocity. The application of this expression is recommended for deriving the local inflow velocity acting on the energy extraction planes of the RM2 vertical axis rotors, where V=Q/A can be calculated given a USGS gage flow time-series and stage vs. cross-section area rating relationship.

  9. Page numbers in bold refer to definitions of terms and algorithms; page numbers in italics refer to items in the bibliography.

    E-Print Network [OSTI]

    Russell, Stuart

    active sensing, 928 active vision, 1025 actor, 426 actuator, 34, 41 hydraulic, 977 pneumatic, 977 AD, 1025 software agent, 41 taxi-driving, 56, 1047 utility-based, 53­54, 59, 664 vacuum, 37, 62­63 wumpus

  10. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  11. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  12. Reference electrode for electrolytic cell

    DOE Patents [OSTI]

    Kessie, R.W.

    1988-07-28

    A reference electrode device is provided for a high temperature electrolytic cell used to electrolytically recover uranium from spent reactor fuel dissolved in an anode pool, the device having a glass tube to enclose the electrode and electrolyte and serve as a conductive membrane with the cell electrolyte, and an outer metal tube about the glass tube to serve as a shield and basket for any glass sections broken by handling of the tube to prevent their contact with the anode pool, the metal tube having perforations to provide access between the bulk of the cell electrolyte and glass membrane. 4 figs.

  13. Electrolytic cell with reference electrode

    DOE Patents [OSTI]

    Kessie, Robert W. (Naperville, IL)

    1989-01-01

    A reference electrode device is provided for a high temperature electrolytic cell used to electrolytically recover uranium from spent reactor fuel dissolved in an anode pool, the device having a glass tube to enclose the electrode and electrolyte and serve as a conductive membrane with the cell electrolyte, and an outer metal tube about the glass tube to serve as a shield and basket for any glass sections broken by handling of the tube to prevent their contact with the anode pool, the metal tube having perforations to provide access between the bulk of the cell electrolyte and glass membrane.

  14. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  15. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  16. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  17. Agilent 4396B Network/Spectrum/Impedance Analyzer GPIB Command Reference

    E-Print Network [OSTI]

    Anlage, Steven

    Agilent 4396B Network/Spectrum/Impedance Analyzer GPIB Command Reference SERIAL NUMBERS This manual in NNNNN . iv #12;Documentation Map The following manuals are available for the analyzer. User's Guide measurement examples. After you receive your analyzer, begin with this manual. Task Reference (Agilent Part

  18. PhD Awards for Improvement Science The Health Foundation has funded a number of PhD studentships through the PhD

    E-Print Network [OSTI]

    Haase, Markus

    1/1 PhD Awards for Improvement Science IPS 2013 The Health Foundation has funded a number of PhD studentships through the PhD Awards for Improvement Science. We will appoint two PhD students to undertake to building a scientific evidence base to facilitate improvements across healthcare. The PhD Awards

  19. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  20. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  1. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  2. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  3. SNAP operating system reference manual

    SciTech Connect (OSTI)

    Sabuda, J.D.; Polito, J.; Walker, J.L.; Grant, F.H. III

    1982-03-01

    The SNAP Operating System (SOS) is a FORTRAN 77 program which provides assistance to the safeguards analyst who uses the Safeguards Automated Facility Evaluation (SAFE) and the Safeguards Network Analysis Procedure (SNAP) techniques. Features offered by SOS are a data base system for storing a library of SNAP applications, computer graphics representation of SNAP models, a computer graphics editor to develop and modify SNAP models, a SAFE-to-SNAP interface, automatic generation of SNAP input data, and a computer graphic post-processor for SNAP. The SOS Reference Manual provides detailed application information concerning SOS as well as a detailed discussion of all SOS components and their associated command input formats. SOS was developed for the US Nuclear Regulatory Commission's Office of Nuclear Regulatory Research and the US Naval Surface Weapons Center by Pritsker and Associates, Inc., under contract to Sandia National Laboratories.

  4. Investigating packaging effects on bandgap references

    E-Print Network [OSTI]

    Palakodety, Ravi (Ravi Kiran)

    2007-01-01

    This thesis investigates packaging effects on precision bandgap voltage references used in LTC switching regulators. Packaging stress causes a mean offset and room temperature distribution widening of the bandgap reference ...

  5. National Environmental Information Infrastructure Reference Architecture

    E-Print Network [OSTI]

    Greenslade, Diana

    National Environmental Information Infrastructure Reference Architecture Consultation Draft Contributing to the Australian Government National Plan for Environmental Information initiative #12;National Environmental Information Infrastructure Reference Architecture: Consultation Draft Environmental Information

  6. Sandia Energy - Reference Model Project (RMP)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Project (RMP) Home Stationary Power Energy Conversion Efficiency Water Power Reference Model Project (RMP) Reference Model Project (RMP)Tara Camacho-Lopez2015-05-11T21:01:36+00:00...

  7. Charting Future Directions for Reference Service

    E-Print Network [OSTI]

    Stratton, John M.; Devlin, Frances A.

    2011-10-18

    reference desks. Reference questions were coded using a taxonomy based on subject headings used to organize databases into broad categories, in addition to corresponding to professional schools within the University. Using our earlier study as a point...

  8. Shannon Capacity Ramsey Numbers

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Shannon Capacity Ramsey Numbers Old links between Shannon and Ramsey New links between Shannon and Ramsey Bounds on Shannon Capacity and Ramsey Numbers from Product of Graphs Xiaodong Xu1 Stanislaw Institute of Technology, NY, USA March 2014 1/24 #12;Shannon Capacity Ramsey Numbers Old links between

  9. Reference Phase of Fresnel Zone Plates

    E-Print Network [OSTI]

    G. W. Webb

    2003-02-28

    The standard zone plate assumes that the shortest ray connecting a radiation source and a detection point has a phase of 0 deg thereby defining a reference phase. Here we examine the experimental consequences of varying this reference phase from 0 deg to 360 deg. It is concluded that reference phase is an intrinsic and useful property of zone plates.

  10. Bibliography of the Scripps Institution of Oceanography Reference Series 2001

    E-Print Network [OSTI]

    Criqui, Nan P.; Kuhns, Kittie K.

    2002-01-01

    Scripps Institution of Oceanography Reference Series 2001.SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIES 01-01

  11. Heating Season Has Ended An Update On The Numbers

    E-Print Network [OSTI]

    . An Update On The Numbers The attached graphics illustrate electricity consumption over a number of years. As a reference point, electricity comprises 2/3rds of our total fuel costs. Consumption will vary from year)/May and September/October time-frames represent seasonal transition and an opportunity to save on fuel consumption

  12. THEORETICAL CRYPTANALYSIS OF THE KLIMOVSHAMIR NUMBER GENERATOR TF1

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    THEORETICAL CRYPTANALYSIS OF THE KLIMOV­SHAMIR NUMBER GENERATOR TF­1 BOAZ TSABAN Abstract generator TF­1 was introduced in [2] and is based on the methods developed in [1] and references therein. This is an iterative pseudorandom number generator. Its internal state consists of 4 words a, b, c, d, of size w bits

  13. Indoor air quality: Selected references

    SciTech Connect (OSTI)

    Not Available

    1989-05-01

    This document was compiled in response to an increasing number of requests for information about indoor air quality, including sick-building syndrome. Included in the publication are the NIOSH Congressional testimony presented before the Subcommittee on Energy Development and Applications; two articles describing the results of NIOSH research and findings on indoor air-quality problems; NIOSH guidance on conducting indoor-air-quality investigations; and a description of the NIOSH health-hazard evaluation program, which can provide NIOSH assistance in evaluating indoor-air-quality problems.

  14. Number Theory Seminar

    E-Print Network [OSTI]

    $author.value

    2014-12-03

    Dec 3, 2014 ... TBA, Rachel Davis ... September 26, Rachel Davis .... Dessins d'Enfants · Indiana Pi Bill · Notes and Publications · Number Theory Seminar ...

  15. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  16. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  17. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  18. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  19. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  20. Internship Checklist Ready Reference C-3

    E-Print Network [OSTI]

    Internship Checklist Ready Reference C-3 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  1. Cover Letter Formula Ready Reference F-3

    E-Print Network [OSTI]

    Cover Letter Formula Ready Reference F-3 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  2. Letter of Refusal Ready Reference F-8

    E-Print Network [OSTI]

    Letter of Refusal Ready Reference F-8 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology Career

  3. Sample Withdrawal Letter Ready Reference F-11

    E-Print Network [OSTI]

    Sample Withdrawal Letter Ready Reference F-11 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  4. Sample Application Letter Ready Reference F-5

    E-Print Network [OSTI]

    Sample Application Letter Ready Reference F-5 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  5. Sample Networking Letter Ready Reference F-6

    E-Print Network [OSTI]

    Sample Networking Letter Ready Reference F-6 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  6. Sample Acceptance Letter Ready Reference F-10

    E-Print Network [OSTI]

    Sample Acceptance Letter Ready Reference F-10 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  7. Job Search Steps Ready Reference D-1

    E-Print Network [OSTI]

    Job Search Steps Ready Reference D-1 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  8. Preparing A Vita Ready Reference E-13

    E-Print Network [OSTI]

    Preparing A Vita Ready Reference E-13 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  9. FAQS Reference Guide – Facility Maintenance Management

    Office of Energy Efficiency and Renewable Energy (EERE)

    This reference guide addresses the competency statements in the April 2014 edition of DOE Standard DOE-STD-1181-2014, Facility Maintenance Management Functional Area Qualification Standard.

  10. FAQS Reference Guide – NNSA Package Certification Engineer

    Broader source: Energy.gov [DOE]

    This reference guide addresses the competency statements in the February 2009 edition of DOE-STD-1026-2009, NNSA Package Certification Engineer Functional Area Qualification Standard.

  11. FAQS Reference Guide – General Technical Base

    Broader source: Energy.gov [DOE]

    This reference guide addresses the competency statements in the December 2007 edition of DOE-STD-1146-2007, General Technical Base Functional Area Qualification Standard.

  12. EERE Program Management Quick Reference Guide

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Energy Efficiency and Renewable Energy (EERE) Program Management Reference Guide. It provides an overall description of the EERE program management structure, defines...

  13. Reference Designs for Hydrogen Fueling Stations Webinar

    Broader source: Energy.gov [DOE]

    Access the recording and download the presentation slides from the Fuel Cell Technologies Office webinar "Reference Designs for Hydrogen Fueling Stations" held on October 13, 2015.

  14. Reference Number Non-invasive magnetic stimulation is an emerging technology to stimulate

    E-Print Network [OSTI]

    -wave pulse forms. The whole circuitry can be produced at much lower costs compared to existing technologies Stimulation System we manage innovations #12;stimulation occurs more specifically while other neuronal cells 5480177-99 kontakt@baypat.de we manage innovations #12;

  15. Development of Reference Models and Design Tools (LCOE Models...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Development of Reference Models and Design Tools (LCOE Models) Development of Reference Models and Design Tools (LCOE Models) Development of Reference Models and Design Tools (LCOE...

  16. Federal Employee Training Desk Reference | Department of Energy

    Energy Savers [EERE]

    College of Learning and Workforce Development Federal Employee Training Desk Reference Federal Employee Training Desk Reference The DOE Federal Employee Training Desk Reference...

  17. Big Numbers | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    with a length of 35 cm, which certainly helps . With Avogadro's number and the density of liquid hydrogen, we have about 1024 protons per cm2. We then take the beam of 160...

  18. KPA Activity Number

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    September 2002 Page 1 KPA Activity Number KPA Activity SEM Section SME Work Product SQSE Web Site http:cio.doe.govsqse REQUIREMENTS MANAGEMENT RM-1 The software engineering...

  19. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  20. Archived Reference Building Type: Primary school

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  1. Archived Reference Building Type: Primary school

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  2. OUTLOOK -MOBILE DEVICE ACCESS QUICK REFERENCE GUIDE

    E-Print Network [OSTI]

    Liley, David

    th OUTLOOK - MOBILE DEVICE ACCESS QUICK REFERENCE GUIDE Quick Reference Guide is designed to step you through the initial set up of your Outlook email account on your Mac. Note: If you're opening Microsoft Outlook 2011 for the first time, you will see the Welcome to Microsoft Outlook for Mac window

  3. OUTLOOK -MOBILE DEVICE ACCESS QUICK REFERENCE GUIDE

    E-Print Network [OSTI]

    Liley, David

    th OUTLOOK - MOBILE DEVICE ACCESS QUICK REFERENCE GUIDE This Quick Reference Guide is designed to step you through the setup of your Outlook email account on your mobile device. When to use this Guide is Outlook. NOTE: After you have set up your account you must remove your old GWSync account ITS

  4. Archived Reference Building Type: Secondary school

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  5. Archived Reference Building Type: Secondary school

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  6. Archived Reference Building Type: Medium office

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  7. Archived Reference Building Type: Medium office

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  8. Archived Reference Building Type: Outpatient health care

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  9. Archived Reference Building Type: Outpatient health care

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  10. Report number codes

    SciTech Connect (OSTI)

    Nelson, R.N.

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name.

  11. UCGE Reports Number 20284

    E-Print Network [OSTI]

    Calgary, University of

    ABSTRACT Oil and gas are global fuels obtained primarily from drilling wells in underground terrestrial reservoirs. Vertical drilling is preferred because of its simplicity and therefore low cost, but subsurfaceUCGE Reports Number 20284 Department of Geomatics Engineering Continuous Measurement-While-Drilling

  12. Student Code Number: Thermodynamics

    E-Print Network [OSTI]

    Feeny, Brian

    Student Code Number: Thermodynamics Ph.D. Qualifying Exam Department of Mechanical Engineering;Thermodynamics Qualifier January 2013 Problem 1 Air is compressed in an axial-flow compressor operating at steady of exergy destruction within the compressor, in kJ per kg of air flowing. #12;Thermodynamics Qualifier

  13. UCGE Reports Number 20146

    E-Print Network [OSTI]

    Calgary, University of

    in considerable operational cost savings for many exploration and open-pit mining companies in the energy sectorUCGE Reports Number 20146 Department of Geomatics Engineering Development of a Mobile Equipment Equipment Management System solution. In the open-pit mining industries there is a need for these companies

  14. Australia NO REGISTRATION NUMBER

    E-Print Network [OSTI]

    Portugal Romania Slovenia Spain Turkey UK USA Australia Austria Belgium Cyprus France Germany Greece#12;#12;Australia Austria Belgium Cyprus France Germany Greece Ireland Italy Japan Macedonia Ireland Italy Japan Macedonia Portugal Romania Slovenia Spain Turkey UK USA #12;NO REGISTRATION NUMBER 1

  15. LIBRARY AND INFORMATION SERVICES DIVISION Current References

    E-Print Network [OSTI]

    LIBRARY AND INFORMATION SERVICES DIVISION Current References (92 -1) ,..... .. , ... ........,., ECOSYSTEMS OF THE FLORIDA KEYS · A Bibliography U. S. DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration National Environmental Satellite, Data, and Information Service National Oceanographic Data Center

  16. Salary Negotiation Ready ReferenceH-3

    E-Print Network [OSTI]

    Salary Negotiation Ready ReferenceH-3 College of Engineering, Architecture & Technology Career" salary on the top end of your range. Although this range may appear high because it is created from

  17. Writing Career Objectives Ready Reference E-5

    E-Print Network [OSTI]

    Writing Career Objectives Ready Reference E-5 College of Engineering, Architecture & Technology in pharmaceutical research" #12;Oklahoma State University College of Engineering, Architecture & Technology Career your practical skills. Examples: -"A position in a large, high tech organization requiring network

  18. Generic Argillite/Shale Disposal Reference Case

    E-Print Network [OSTI]

    Zheng, Liange

    2014-01-01

    S. and K.S. Johnson, (1984). Shale and other argillaceousand R. T. Cygan, (2010). Shale Disposal of U.S. High-LevelDC. Generic Argillite/Shale Disposal Reference Case August

  19. Archive Reference Buildings by Building Type: Warehouse

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  20. New Construction Commercial Reference Buildings — Archive

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  1. Emergency Responder Radioactive Material Quick Reference Sheet

    Broader source: Energy.gov [DOE]

    This job aid is a quick reference to assist emergency responders in identifying preliminary safety precautions that should be taken during the initial response phase after arrival at the scene of...

  2. FAQS Reference Guide – Civil/ Structural Engineering

    Broader source: Energy.gov [DOE]

    This reference guide has been developed to address the competency statements in the March 2004 edition of DOE-STD-1182-2004, Civil/Structural Engineering Functional Area Qualification Standard.

  3. FAQS Reference Guide – Safety Software Quality Assurance

    Broader source: Energy.gov [DOE]

    This reference guide has been developed to address the competency statements in the (March 2011) edition of DOE-STD-1172-2011, Safety Software Quality Assurance Functional Area Qualification Standard.

  4. Pronominal System and Reference in Pulaar

    E-Print Network [OSTI]

    Ba, Ibrahima

    2015-12-20

    This paper examines pronominal reference and the long-distance anaphor in Pulaar, a West African language spoken from Senegal to Niger and Cameroon. I am focusing on Toore, a dialect of Pulaar spoken in southern Senegal. ...

  5. Clause chaining, switch reference and coordination

    E-Print Network [OSTI]

    Nonato, Rafael

    2014-01-01

    In this thesis I ponder over a constellation of phenomena that revolve around switch reference and coordination, drawing mainly on their instantiation in Kisedje (Je, Brazil). I start by investigating Klsedje's case system. ...

  6. Precision Micropower, Low Dropout Voltage References

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    series references are specified over the extended industrial temperature range (-40°C to +85°C) with typical performance specifications over -40°C to +125°C for applications, such as automotive. All

  7. Archive Reference Buildings by Building Type: Supermarket

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  8. Javarifier : inference of reference immutability in Java

    E-Print Network [OSTI]

    Quinonez, Jamie

    2008-01-01

    Javari is an extension of Java that supports reference immutability constraints. Programmers write Javari type qualifiers, such as the readonly type qualifier, in their programs, and the Javari typechecker detects mutation ...

  9. Generating and interpreting referring expressions in context

    E-Print Network [OSTI]

    Smith, Dustin Arthur

    2013-01-01

    Referring expressions with vague and ambiguous modifiers, such as "a quick visit" and "the big meeting," are difficult for computers to interpret because their meanings are defined in part by context. For the hearer to ...

  10. Integrating Referring and Informing in NP Planning 

    E-Print Network [OSTI]

    O'Donnell, Michael; Knott, Alistair; Hitzeman, Janet; Cheng, Hua

    Two of the functions of an NP are to refer (identify a particular entity) and to inform (provide new information about an entity). While many NPs may serve only one of these functions, some NPs conflate the functions, ...

  11. Population Reference Bureau Kenneth W. Wachter

    E-Print Network [OSTI]

    Wachter, Kenneth W.

    -Recapture Estimates 2. Logistic Regression for Stratum Rates 3. Synthetic Estimation for Small Areas KWW ­ p. 14/2 #12,000 households · American Community Survey: Reverse Record Check KWW ­ p. 20/2 #12;References Bell, Robert and M

  12. An expectation model of referring expressions

    E-Print Network [OSTI]

    Kræmer, John, Ph. D. Massachusetts Institute of Technology

    2010-01-01

    This thesis introduces EMRE, an expectation-based model of referring expressions. EMRE is proposed as a model of non-syntactic dependencies - in particular, discourse-level semantic dependencies that bridge sentence gaps. ...

  13. Optical reference geometry of the Kerr-Newman spacetimes

    E-Print Network [OSTI]

    Zden?k Stuchlík; Stanislav Hledík; Josef Jurá?

    2008-03-17

    Properties of the optical reference geometry related to Kerr-Newman black-hole and naked-singularity spacetimes are illustrated using embedding diagrams of their equatorial plane. Among all inertial forces defined in the framework of the optical geometry, just the centrifugal force plays a fundamental role in connection to the embedding diagrams because it changes sign at the turning points of the diagrams. The limits of embeddability are given, and it is established which of the photon circular orbits hosted the by Kerr-Newman spacetimes appear in the embeddable regions. Some typical embedding diagrams are constructed, and the Kerr-Newman backgrounds are classified according to the number of embeddable regions of the optical geometry as well as the number of their turning points. Embedding diagrams are closely related to the notion of the radius of gyration which is useful for analyzing fluid rotating in strong gravitational fields.

  14. Quantum communication, reference frames and gauge theory

    E-Print Network [OSTI]

    S. J. van Enk

    2006-04-26

    We consider quantum communication in the case that the communicating parties not only do not share a reference frame but use imperfect quantum communication channels, in that each channel applies some fixed but unknown unitary rotation to each qubit. We discuss similarities and differences between reference frames within that quantum communication model and gauge fields in gauge theory. We generalize the concept of refbits and analyze various quantum communication protocols within the communication model.

  15. "Analysis of SOFCs using reference electrodes?

    SciTech Connect (OSTI)

    Finklea, Harry; Chen,Xiaoke; Gerdes,Kirk; Pakalapati, Suryanarayana; Celik, Ismail

    2013-07-01

    Reference electrodes are frequently applied to isolate the performance of one electrode in a solid oxide fuel cell. However, reference electrode simulations raise doubt to veracity of data collected using reference electrodes. The simulations predict that the reported performance for the one electrode will frequently contain performance of both electrodes. Nonetheless, recent reports persistently treat data so collected as ideally isolated. This work confirms the predictions of the reference electrode simulations on two SOFC designs, and to provides a method of validating the data measured in the 3-electrode configuration. Validation is based on the assumption that a change in gas composition to one electrode does not affect the impedance of the other electrode at open circuit voltage. This assumption is supported by a full physics simulation of the SOFC. Three configurations of reference electrode and cell design are experimentally examined using various gas flows and two temperatures. Impedance data are subjected to deconvolution analysis and equivalent circuit fitting and approximate polarization resistances of the cathode and anode are determined. The results demonstrate that the utility of reference electrodes is limited and often wholly inappropriate. Reported impedances and single electrode polarization values must be scrutinized on this basis.

  16. Unpredictability and the transmission of numbers

    E-Print Network [OSTI]

    John M. Myers; F. Hadi Madjid

    2015-08-05

    Curiously overlooked in physics is its dependence on the transmission of numbers. For example the transmission of numerical clock readings is implicit in the concept of a coordinate system. The transmission of numbers and other logical distinctions is often achieved over a computer-mediated communications network in the face of an unpredictable environment. By unpredictable we mean something stronger than the spread of probabilities over given possible outcomes, namely an opening to unforeseeable possibilities. Unpredictability, until now overlooked in theoretical physics, makes the transmission of numbers interesting. Based on recent proofs within quantum theory that provide a theoretical foundation to unpredictability, here we show how regularities in physics rest on a background of channels over which numbers are transmitted. As is known to engineers of digital communications, numerical transmissions depend on coordination reminiscent of the cycle of throwing and catching by players tossing a ball back and forth. In digital communications, the players are computers, and the required coordination involves unpredictably adjusting "live clocks" that step these computers through phases of a cycle. We show how this phasing, which we call `logical synchronization,' constrains number-carrying networks, and, if a spacetime manifold in invoked, put "stripes" on spacetime. Via its logically synchronized channels, a network of live clocks serves as a reference against which to locate events. Such a network in any case underpins a coordinate frame, and in some cases the direct use of a network can be tailored to investigate an unpredictable environment. Examples include explorations of gravitational variations near Earth.

  17. On Measurements, Numbers and p-Adic Mathematical Physics

    E-Print Network [OSTI]

    Branko Dragovich

    2012-05-23

    In this short paper I consider relation between measurements, numbers and p-adic mathematical physics. p-Adic numbers are not result of measurements, but nevertheless they play significant role in description of some systems and phenomena. We illustrate their ability for applications referring to some sectors of p-adic mathematical physics and related topics, in particular, to string theory and the genetic code.

  18. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  19. Quantum random number generator

    E-Print Network [OSTI]

    M. Stipcevic; B. Medved Rogina

    2007-01-01

    We report upon a novel principle for realization of a fast nondeterministic random number generator whose randomness relies on intrinsic randomness of the quantum physical processes of photonic emission in semiconductors and subsequent detection by the photoelectric effect. Timing information of detected photons is used to generate binary random digits-bits. The bit extraction method based on restartable clock theoretically eliminates both bias and autocorrelation while reaching efficiency of almost 0.5 bits per random event. A prototype has been built and statistically tested.

  20. Neither Name, Nor Number

    E-Print Network [OSTI]

    Federico Holik

    2011-12-20

    Since its origins, Quantum mechanics has presented problems with the concept of individuality. It is argued that quantum particles do not have individuality, and so, one can speak about "entities without identity". On the contrary, we claim that the problem of quantum non individuality goes deeper, and that one of its most important features is the fact that there are quantum systems for which particle number is not well defined. In this work, we continue this discussion in relation to the problem about the one and the many.

  1. POLICY NUMBER 2014-04 February 17, 2015

    E-Print Network [OSTI]

    Kim, Duck O.

    POLICY NUMBER 2014-04 February 17, 2015 POLICY: SANCTIONS POLICY FOR PRIVACY AND SECURITY resulting in sanctions against UConn Health by a governmental or regulatory body. Examples of such data may-federal sponsors. The data above is hereafter referred to as "Confidential Data" in this policy. #12;Sanctions

  2. References - DOE Directives, Delegations, and Requirements

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProtonAbout Us HanfordReference MaterialsReference Shelf

  3. On Some Zarankiewicz Numbers and Bipartite Ramsey Numbers for

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    On Some Zarankiewicz Numbers and Bipartite Ramsey Numbers for Quadrilateral Janusz Dybizba Ramsey number b(n1, · · · , nk) is the least positive integer b such that any coloring of the edges of Kb Ramsey numbers avoiding quadrilateral. In particular, we prove that b4(2) = 19, and establish new general

  4. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  5. NIST Standard Reference Database 23 NIST Reference Fluid Thermodynamic and Transport Properties--

    E-Print Network [OSTI]

    measurements and models we have taken from the literature, and without which this database would be much#12;NIST Standard Reference Database 23 NIST Reference Fluid Thermodynamic and Transport Properties (NIST) uses its best efforts to deliver a high quality copy of the Database and to verify that the data

  6. Square Kilometer Array Telescope - Precision Reference Frequency Synchronisation via 1f-2f Dissemination

    E-Print Network [OSTI]

    Wang, B; Gao, C; Bai, Y; Dong, J W; Wang, L J

    2015-01-01

    The Square Kilometer Array (SKA) is an international effort to build the world's largest radio telescope, with one square kilometer collecting area. Besides its ambitious scientific objectives, such as probing the cosmic dawn and cradle of life, SKA also demands several revolutionary technological breakthroughs, with ultra-high precision synchronisation of the frequency references for thousands of antennas being one of them. In this report, aimed at applications to SKA, we demonstrate a frequency reference synchronization and dissemination scheme with the phase noise compensation function placed at the client site. Hence, one central hub can be linked to a large number of client sites, forming a star-shaped topology. As a performance test, the 100 MHz reference signal from a Hydrogen maser clock is disseminated and recovered at two remote sites. Phase noise characteristics of the recovered reference frequency signal coincides with that of the hydrogen-maser source and satisfies SKA requirement.

  7. EMERGENCY PREPAREDNESS This desktop reference was prepared as a crime prevention tool

    E-Print Network [OSTI]

    Nicholson, Bruce J.

    EMERGENCY PREPAREDNESS #12;This desktop reference was prepared as a crime prevention tool Chief of Police 210-567-2791 bratten@uthscsa.edu #12;IMPORTANT PHONE NUMBERS FOR ALL EMERGENCIES cell phone for emergencies.) University Of Texas HSCSA Police Department

  8. Communicating and Learning in Engineering Online Resources 1 Using References in Your Assignments

    E-Print Network [OSTI]

    Sekercioglu, Y. Ahmet

    Communicating and Learning in Engineering Online Resources 1 Using References in Your Assignments: Example 1 The textbook is The Geography of Australia by L. O'Connor published by Penguin in Melbourne number: 808.0666R587W Communicating and Learning in Engineering Online Resources 2 #12;3. Devising a List

  9. Terms of Reference Information Security Group

    E-Print Network [OSTI]

    Haase, Markus

    Terms of Reference Information Security Group Version 3.1 8 March 2011 © University of Leeds 2011 Security Group Information Security Management 3.1 (8/3/11) Page 2 of 4 Document Control Owner: Kevin Darley, IT Security Co-ordinator, Information Systems Services, University of Leeds Source Location: V

  10. Risk Management Steering Committee Terms of Reference

    E-Print Network [OSTI]

    Victoria, University of

    Risk Management Steering Committee Terms of Reference October 2009 1.0 Purpose The purposes Facilities Management Risk and Insurance Analyst Associate Vice-President Human Resources Administrative of the Steering Committee are: a) to follow a continuous process to understand and communicate risk from

  11. The Behavioral Interview Ready Reference G-7

    E-Print Network [OSTI]

    The Behavioral Interview Ready Reference G-7 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology in technical and high tech industries within the last 10 years. Behavioral interviews are designed to focus

  12. Questioning Yourself Ready Reference B-2

    E-Print Network [OSTI]

    Questioning Yourself Ready Reference B-2 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office set my own hours? Do I thrive in a high-stress atmosphere, or would I prefer something a bit more

  13. INVESTIGATION Construction of Reference Chromosome-Scale

    E-Print Network [OSTI]

    Douches, David S.

    INVESTIGATION Construction of Reference Chromosome-Scale Pseudomolecules for Potato: Integrating was genotyped with several types of molecular genetic markers to construct a new ~936 cM linkage map comprising and orientation within the pseudo- molecules are closely collinear with independently constructed high density

  14. Quick-Reference Guide to Optimization with

    E-Print Network [OSTI]

    Nikolic, Branislav K.

    Quick-Reference Guide to Optimization with Intel® Compilers version 11 For IA-32 processors, Intel, you may want to check correctness of your application by building it without optimization using /Od (-O0). In this compiler version, all optimization levels assume support for the SSE2 instruction set

  15. Previous Up Next Article From References: 0

    E-Print Network [OSTI]

    Ottino, Julio M.

    (e.g. laminar) fluid flow. Two decades of interdisciplinary studies in this line of investigationPrevious Up Next Article Citations From References: 0 From Reviews: 0 MR2265644 (Review) 37N10 (37D in applications: micro to macro, fluids to solids. Cambridge Monographs on Applied and Computational Mathematics

  16. Hazard Communication Program 1.0 REFERENCE

    E-Print Network [OSTI]

    de Lijser, Peter

    Hazard Communication Program 1.0 REFERENCE California Code of Regulations, Title 8, Sections 337 the properties and potential safety and health hazards of the materials which they use or to which they are exposed. Employees who use or may be exposed to potentially hazardous substances or harmful physical

  17. Positional reference system for ultraprecision machining

    DOE Patents [OSTI]

    Arnold, J.B.; Burleson, R.R.; Pardue, R.M.

    1980-09-12

    A stable positional reference system for use in improving the cutting tool-to-part contour position in numerical controlled-multiaxis metal turning machines is provided. The reference system employs a plurality of interferometers referenced to orthogonally disposed metering bars which are substantially isolated from machine strain induced position errors for monitoring the part and tool positions relative to the metering bars. A microprocessor-based control system is employed in conjunction with the plurality of positions interferometers and part contour description data input to calculate error components for each axis of movement and output them to corresponding axis driven with appropriate scaling and error compensation. Real-time position control, operating in combination with the reference system, makes possible the positioning of the cutting points of a tool along a part locus with a substantially greater degree of accuracy than has been attained previously in the art by referencing and then monitoring only the tool motion relative to a reference position located on the machine base.

  18. UNIVERSITY PLANNING (SCUP) Terms of Reference

    E-Print Network [OSTI]

    Lennard, William N.

    UNIVERSITY PLANNING (SCUP) Terms of Reference: The Committee is the chief forum within Senate for critical appraisal and coordination of long-term strategic, capital and budget plans for the University planning context, it has specific responsibilities as follows: Long-Range Planning To review and recommend

  19. Campus Planning Committee Terms of Reference

    E-Print Network [OSTI]

    Victoria, University of

    1 Campus Planning Committee Terms of Reference Type: Advisory to President Charge: 1. Recognizing the academic priorities of the institution, the Committee shall advise the President on: a) the long-range plan for the physical development of the Campus; b) amendments to the approved campus plan; c) the University's proposed

  20. Fluid Neutral Momentum Transport Reference Problem

    E-Print Network [OSTI]

    Budny, Robert

    Fluid Neutral Momentum Transport Reference Problem D. P. Stotler, PPPL S. I. Krasheninnikov, UCSD 1 Summary Type of problem: kinetic or fluid neutral transport Physics or algorithm stressed: thermal force term (spatial resolution) in momentum transport equation and treatment of collisions (charge ex- change

  1. Shape Recipes: Scene Representations that Refer

    E-Print Network [OSTI]

    Freeman, William T.

    Shape Recipes: Scene Representations that Refer to the Image William T. Freeman and Antonio to estimate and store. We propose a low-dimensional rep- resentation, called a scene recipe, that relies on the image itself to de- scribe the complex scene configurations. Shape recipes are an example

  2. Office of Classroom Management A quick reference

    E-Print Network [OSTI]

    Thomas, David D.

    Office of Classroom Management A quick reference for how to navigate your classroom's technology of the camera. #12;Office of Classroom Management 1. Press any button other than the "system off" button 2. When and resources www.classroom.umn.edu Classroom Support Hotline: 612-625-1086 ·Controlsforthe

  3. Macrosegregation Macrosegregation refers to variations in composition

    E-Print Network [OSTI]

    Beckermann, Christoph

    in casting processes: (i) Flow that feeds the solidification shrinkage and the contractions of the liquidMacrosegregation Macrosegregation refers to variations in composition that occur in alloy castings variations have a detrimental impact on the subsequent processing behavior and properties of cast materials

  4. LIBRARY AND INFORMATION SERVICES DIVISION Current References

    E-Print Network [OSTI]

    . Satellne. Data. and InformationService National Oceanographic Data Center #12;· GLOBAL CLIMATE CHANGELIBRARY AND INFORMATION SERVICES DIVISION Current References (90 -1) Global Climate Change FEBRUARY of data centers on which an information system must be built. This bibliography offers a selection

  5. R Reference Manual: A gentle overview

    E-Print Network [OSTI]

    Priestley, Jennifer Lewis

    , yet similar to SAS, R is a commands-driven programming environment to execute statistical analysisR Reference Manual: A gentle overview #12;2 Developed and maintained by the Center for Statistics statistical computing packages ­ Excel, SPSS, Minitab, R and SAS. 1 Readers of this manual are assumed to have

  6. Bibliography of the Scripps Institution of Oceanography Reference Series 1994

    E-Print Network [OSTI]

    Criqui, Nan P.

    1995-01-01

    OF THE SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIESScripps Institution of Oceanography. July 1994. 179p. 94-17Scripps Institution of Oceanography Reference Series 1994.

  7. Bibliography of the Scripps Institution of Oceanography Reference Series 1997

    E-Print Network [OSTI]

    Jennings, Paige A.

    1998-01-01

    SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIES 97-01Scripps Institution of Oceanography Reference Series 1997.held at Scripps Institution of Oceanography 19 August 1997.

  8. Biomass Scenario Model Documentation: Data and References Lin...

    Office of Scientific and Technical Information (OSTI)

    Documentation: Data and References Lin, Y.; Newes, E.; Bush, B.; Peterson, S.; Stright, D. 09 BIOMASS FUELS BIOMASS SCENARIO MODEL; BSM; BIOMASS; BIOFUEL; MODEL; DATA; REFERENCES;...

  9. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reference Buildings by Climate Zone and Representative City: 4B Albuquerque, New Mexico Reference Buildings by Climate Zone and Representative City: 4B Albuquerque, New...

  10. Surface Temperature Humidity Reference System Handbook - November 2005

    SciTech Connect (OSTI)

    MT Ritsche

    2005-11-30

    The Surface Temperature and Humidity Reference (SURTHREF) system is intended to provide accurate reference values of ambient temperature and relative humidity for comparison with radiosonde prelaunch values.

  11. A Method for Calculating Reference Evapotranspiration on Daily Time Scales

    E-Print Network [OSTI]

    Farmer, William

    Measures of reference evapotranspiration are essential for applications of agricultural management and water resources engineering. Using numerous esoteric variables, one can calculate daily reference evapotranspiration ...

  12. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    akfairbanksnew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 8 Fairbanks, Alaska Reference Buildings by Climate Zone...

  13. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    atxhoustonnew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 2A Houston, Texas Reference Buildings by Climate Zone...

  14. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    mdbaltimorenew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland Reference Buildings by Climate...

  15. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    agaatlantanew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia Reference Buildings by Climate Zone...

  16. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    usaflmiaminew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida Reference Buildings by Climate Zone...

  17. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    samthelenanew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 6B Helena, Montana Reference Buildings by Climate Zone...

  18. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    acobouldernew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 5B Boulder, Colorado Reference Buildings by Climate...

  19. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    awaseattlenew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 4C Seattle, Washington Reference Buildings by Climate...

  20. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    nvlasvegasnew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 3B Las Vegas, Nevada Reference Buildings by Climate...

  1. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  2. Post-Newtonian reference-ellipsoid for relativistic geodesy

    E-Print Network [OSTI]

    Sergei Kopeikin; Wenbiao Han; Elena Mazurova

    2015-10-12

    We apply general relativity to construct the post-Newtonian background manifold that serves as a reference level surface in relativistic geodesy for conducting calculation of geoid's undulation. We chose the perfect homogeneous fluid uniformly rotating around a fixed axis as a source of the background manifold. We, then, reformulate and extend rotating-fluid calculations done by a number of previous researchers for astrophysical applications to the realm of relativistic geodesy to find out the algebraic equation of the post-Newtonian reference-ellipsoid. We explicitly perform all integrals characterizing gravitational potentials inside the fluid body and represent them in terms of elementary functions depending on the body's eccentricity. We fully explore the coordinate freedom of the equations describing the post-Newtonian ellipsoid and demonstrate that the fractional deviation of the post-Newtonian level surface from the Maclaurin ellipsoid can be made much smaller than the previously anticipated estimate advocated by Bardeen and Chandrasekhar. We also derive the relations of the post-Newtonian mass and angular velocity of the rotating fluid to the parameters of the post-Newtonian ellipsoid. We find out the gauge-invariant expressions for the post-Newtonian mass and angular momentum of the rotating fluid body as well as the gauge-invariant post-Newtonian formulations of the canonical Pizzetti and Clairaut theorems that are used in geodesy to connect the parameters of the reference ellipsoid to the force of gravity at its pole and on equator. Finally, we expand the post-Newtonian geodetic equations characterizing the post-Newtonian ellipsoid into the Taylor series with respect to the eccentricity of the ellipsoid and discuss them with regard to future practical applications by the International Earth Rotation Service (IERS) and the International Union of Geodesy and Geophysics (IUGG).

  3. High Flux Isotope Reactor cold neutron source reference design concept

    SciTech Connect (OSTI)

    Selby, D.L.; Lucas, A.T.; Hyman, C.R.

    1998-05-01

    In February 1995, Oak Ridge National Laboratory`s (ORNL`s) deputy director formed a group to examine the need for upgrades to the High Flux Isotope Reactor (HFIR) system in light of the cancellation of the Advanced neutron Source Project. One of the major findings of this study was that there was an immediate need for the installation of a cold neutron source facility in the HFIR complex. In May 1995, a team was formed to examine the feasibility of retrofitting a liquid hydrogen (LH{sub 2}) cold source facility into an existing HFIR beam tube. The results of this feasibility study indicated that the most practical location for such a cold source was the HB-4 beam tube. This location provides a potential flux environment higher than the Institut Laue-Langevin (ILL) vertical cold source and maximizes the space available for a future cold neutron guide hall expansion. It was determined that this cold neutron beam would be comparable, in cold neutron brightness, to the best facilities in the world, and a decision was made to complete a preconceptual design study with the intention of proceeding with an activity to install a working LH{sub 2} cold source in the HFIR HB-4 beam tube. During the development of the reference design the liquid hydrogen concept was changed to a supercritical hydrogen system for a number of reasons. This report documents the reference supercritical hydrogen design and its performance. The cold source project has been divided into four phases: (1) preconceptual, (2) conceptual design and testing, (3) detailed design and procurement, and (4) installation and operation. This report marks the conclusion of the conceptual design phase and establishes the baseline reference concept.

  4. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  5. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  6. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  7. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  8. Reference Design? | OpenEI Community

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/WaterEnergyRedfield CampusReedsville,Reference Design? Home

  9. The Distribution of Ramsey Numbers

    E-Print Network [OSTI]

    Lane Clark; Frank Gaitan

    2014-11-10

    We prove that the number of integers in the interval [0,x] that are non-trivial Ramsey numbers r(k,n) (3 <= k <= n) has order of magnitude (x ln x)**(1/2).

  10. Ordered Ramsey numbers David Conlon

    E-Print Network [OSTI]

    Fox, Jacob

    Ordered Ramsey numbers David Conlon Jacob Fox Choongbum Lee Benny Sudakov§ Abstract Given a labeled graph H with vertex set {1, 2, . . . , n}, the ordered Ramsey number r with vertices appearing in the same order as in H. The ordered Ramsey number of a labeled graph H is at least

  11. Hypergraph Ramsey numbers David Conlon

    E-Print Network [OSTI]

    Fox, Jacob

    Hypergraph Ramsey numbers David Conlon Jacob Fox Benny Sudakov Abstract The Ramsey number rk(s, n). In this paper we obtain new estimates for several basic hypergraph Ramsey problems. We give a new upper bound-color Ramsey number r3(n, n, n), which is the minimum N such that every 3-coloring of the triples

  12. Data Compression with Prime Numbers

    E-Print Network [OSTI]

    Gordon Chalmers

    2005-11-16

    A compression algorithm is presented that uses the set of prime numbers. Sequences of numbers are correlated with the prime numbers, and labeled with the integers. The algorithm can be iterated on data sets, generating factors of doubles on the compression.

  13. References R-3 Note: In this report we refer to a number of documents (e.g., plans, reports) that are intended for

    E-Print Network [OSTI]

    Pennycook, Steve

    . Operational Monitoring Plan for the High Flux Isotope Reactor Site: Final Design. Oak Ridge National-012529/1. BWXT Y-12, LLC, Oak Ridge, Tennessee. Chan, P. K., G. P. O'Hara, and A. W. Hayes. 1982. "Principles and Methods for Acute and Subchronic Toxicity." Principles and Methods of Toxicology. Raven Press, New York

  14. References R-3 Note: In this report we refer to a number of documents (e.g., plans, reports) that are intended for internal

    E-Print Network [OSTI]

    Pennycook, Steve

    Control Report for the Y-12 National Security Complex, Oak Ridge, Tennessee. Y/TS-1466/R2. B&W Technical Security Complex, Oak Ridge, Tennessee. Y/TS-2035, Y-12 National Security Complex, Oak Ridge, Tennessee. B National Security Complex, Oak Ridge, Tennessee. Y/SUB/08-063119/1. Y-12 National Security Complex, Oak

  15. Department of Energy Construction Safety Reference Guide

    SciTech Connect (OSTI)

    Not Available

    1993-09-01

    DOE has adopted the Occupational Safety and Health Administration (OSHA) regulations Title 29 Code of Federal Regulations (CFR) 1926 ``Safety and Health Regulations for Construction,`` and related parts of 29 CFR 1910, ``Occupational Safety and Health Standards.`` This nonmandatory reference guide is based on these OSHA regulations and, where appropriate, incorporates additional standards, codes, directives, and work practices that are recognized and accepted by DOE and the construction industry. It covers excavation, scaffolding, electricity, fire, signs/barricades, cranes/hoists/conveyors, hand and power tools, concrete/masonry, stairways/ladders, welding/cutting, motor vehicles/mechanical equipment, demolition, materials, blasting, steel erection, etc.

  16. 1993 Solid Waste Reference Forecast Summary

    SciTech Connect (OSTI)

    Valero, O.J.; Blackburn, C.L. [Westinghouse Hanford Co., Richland, WA (United States); Kaae, P.S.; Armacost, L.L.; Garrett, S.M.K. [Pacific Northwest Lab., Richland, WA (United States)

    1993-08-01

    This report, which updates WHC-EP-0567, 1992 Solid Waste Reference Forecast Summary, (WHC 1992) forecasts the volumes of solid wastes to be generated or received at the US Department of Energy Hanford Site during the 30-year period from FY 1993 through FY 2022. The data used in this document were collected from Westinghouse Hanford Company forecasts as well as from surveys of waste generators at other US Department of Energy sites who are now shipping or plan to ship solid wastes to the Hanford Site for disposal. These wastes include low-level and low-level mixed waste, transuranic and transuranic mixed waste, and nonradioactive hazardous waste.

  17. A New Solar Irradiance Reference Spectrum

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach HomeA Better Anode Design to Improve Lithium-Ion Batteries PrintA New Solar Irradiance Reference Spectrum

  18. Technical Reference for Hydrogen Compatibility of Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar Fuel ProductionRecoverable15/2008 Technical Reference on

  19. Technical Reference on Hydrogen Compatibility of Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar Fuel ProductionRecoverable15/2008 Technical Reference onType

  20. Technical Reference on Hydrogen Compatibility of Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired Solar Fuel ProductionRecoverable15/2008 Technical Reference onType1

  1. Administrator References and Logins | Advanced Photon Source

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News Publications Traditional Knowledge KiosksAboutHelp & Reference Users Home Contacts

  2. Property:Reference material | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report Url Jump to:Programmable WavemakingPurchasersReference

  3. Commercial Reference Buildings | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open EnergyColoradoBiomass EnergyCity,Commercial Reference

  4. Reference worldwide model for antineutrinos from reactors

    E-Print Network [OSTI]

    Marica Baldoncini; Ivan Callegari; Giovanni Fiorentini; Fabio Mantovani; Barbara Ricci; Virginia Strati; Gerti Xhixha

    2015-02-16

    Antineutrinos produced at nuclear reactors constitute a severe source of background for the detection of geoneutrinos, which bring to the Earth's surface information about natural radioactivity in the whole planet. In this framework we provide a reference worldwide model for antineutrinos from reactors, in view of reactors operational records yearly published by the International Atomic Energy Agency (IAEA). We evaluate the expected signal from commercial reactors for ongoing (KamLAND and Borexino), planned (SNO+) and proposed (Juno, RENO-50, LENA and Hanohano) experimental sites. Uncertainties related to reactor antineutrino production, propagation and detection processes are estimated using a Monte Carlo based approach, which provides an overall site dependent uncertainty on the signal in the geoneutrino energy window on the order of 3%. We also implement the off-equilibrium correction to the reference reactor spectra associated with the long-lived isotopes and we estimate a 2.4% increase of the unoscillated event rate in the geoneutrino energy window due to the storage of spent nuclear fuels in the cooling pools. We predict that the research reactors contribute to less than 0.2% to the commercial reactor signal in the investigated 14 sites. We perform a multitemporal analysis of the expected reactor signal over a time lapse of 10 years using reactor operational records collected in a comprehensive database published at www.fe.infn.it/antineutrino.

  5. Generic Argillite/Shale Disposal Reference Case

    SciTech Connect (OSTI)

    Zheng, Liange; Colon, Carlos Jové; Bianchi, Marco; Birkholzer, Jens

    2014-08-08

    Radioactive waste disposal in a deep subsurface repository hosted in clay/shale/argillite is a subject of widespread interest given the desirable isolation properties, geochemically reduced conditions, and widespread geologic occurrence of this rock type (Hansen 2010; Bianchi et al. 2013). Bianchi et al. (2013) provides a description of diffusion in a clay-hosted repository based on single-phase flow and full saturation using parametric data from documented studies in Europe (e.g., ANDRA 2005). The predominance of diffusive transport and sorption phenomena in this clay media are key attributes to impede radionuclide mobility making clay rock formations target sites for disposal of high-level radioactive waste. The reports by Hansen et al. (2010) and those from numerous studies in clay-hosted underground research laboratories (URLs) in Belgium, France and Switzerland outline the extensive scientific knowledge obtained to assess long-term clay/shale/argillite repository isolation performance of nuclear waste. In the past several years under the UFDC, various kinds of models have been developed for argillite repository to demonstrate the model capability, understand the spatial and temporal alteration of the repository, and evaluate different scenarios. These models include the coupled Thermal-Hydrological-Mechanical (THM) and Thermal-Hydrological-Mechanical-Chemical (THMC) models (e.g. Liu et al. 2013; Rutqvist et al. 2014a, Zheng et al. 2014a) that focus on THMC processes in the Engineered Barrier System (EBS) bentonite and argillite host hock, the large scale hydrogeologic model (Bianchi et al. 2014) that investigates the hydraulic connection between an emplacement drift and surrounding hydrogeological units, and Disposal Systems Evaluation Framework (DSEF) models (Greenberg et al. 2013) that evaluate thermal evolution in the host rock approximated as a thermal conduction process to facilitate the analysis of design options. However, the assumptions and the properties (parameters) used in these models are different, which not only make inter-model comparisons difficult, but also compromise the applicability of the lessons learned from one model to another model. The establishment of a reference case would therefore be helpful to set up a baseline for model development. A generic salt repository reference case was developed in Freeze et al. (2013) and the generic argillite repository reference case is presented in this report. The definition of a reference case requires the characterization of the waste inventory, waste form, waste package, repository layout, EBS backfill, host rock, and biosphere. This report mainly documents the processes in EBS bentonite and host rock that are potentially important for performance assessment and properties that are needed to describe these processes, with brief description other components such as waste inventory, waste form, waste package, repository layout, aquifer, and biosphere. A thorough description of the generic argillite repository reference case will be given in Jové Colon et al. (2014).

  6. The New Element Californium (Atomic Number 98)

    DOE R&D Accomplishments [OSTI]

    Seaborg, G. T.; Thompson, S. G.; Street, K. Jr.; Ghiroso, A.

    1950-06-19

    Definite identification has been made of an isotope of the element with atomic number 98 through the irradiation of Cm{sup 242} with about 35-Mev helium ions in the Berkeley Crocker Laboratory 60-inch cyclotron. The isotope which has been identified has an observed half-life of about 45 minutes and is thought to have the mass number 244. The observed mode of decay of 98{sup 244} is through the emission of alpha-particles, with energy of about 7.1 Mev, which agrees with predictions. Other considerations involving the systematics of radioactivity in this region indicate that it should also be unstable toward decay by electron capture. The chemical separation and identification of the new element was accomplished through the use of ion exchange adsorption methods employing the resin Dowex-50. The element 98 isotope appears in the eka-dysprosium position on elution curves containing berkelium and curium as reference points--that is, it precedes berkelium and curium off the column in like manner that dysprosium precedes terbium and gadolinium. The experiments so far have revealed only the tripositive oxidation state of eka-dysprosium character and suggest either that higher oxidation states are not stable in aqueous solutions or that the rates of oxidation are slow. The successful identification of so small an amount of an isotope of element 98 was possible only through having made accurate predictions of the chemical and radioactive properties.

  7. Compendium of Experimental Cetane Numbers

    SciTech Connect (OSTI)

    Yanowitz, J.; Ratcliff, M. A.; McCormick, R. L.; Taylor, J. D.; Murphy, M. J.

    2014-08-01

    This report is an updated version of the 2004 Compendium of Experimental Cetane Number Data and presents a compilation of measured cetane numbers for pure chemical compounds. It includes all available single compound cetane number data found in the scientific literature up until March 2014 as well as a number of unpublished values, most measured over the past decade at the National Renewable Energy Laboratory. This Compendium contains cetane values for 389 pure compounds, including 189 hydrocarbons and 201 oxygenates. More than 250 individual measurements are new to this version of the Compendium. For many compounds, numerous measurements are included, often collected by different researchers using different methods. Cetane number is a relative ranking of a fuel's autoignition characteristics for use in compression ignition engines; it is based on the amount of time between fuel injection and ignition, also known as ignition delay. The cetane number is typically measured either in a single-cylinder engine or a constant volume combustion chamber. Values in the previous Compendium derived from octane numbers have been removed, and replaced with a brief analysis of the correlation between cetane numbers and octane numbers. The discussion on the accuracy and precision of the most commonly used methods for measuring cetane has been expanded and the data has been annotated extensively to provide additional information that will help the reader judge the relative reliability of individual results.

  8. The Second Interview Ready Reference G-11

    E-Print Network [OSTI]

    . Use this information to your advantage during the second interview. · Be prepared to discuss salary. Research the average salary for someone with your education and qualifications. Give a salary range (i.e. $60,000 to $65,000) instead of an exact number (i.e. $65,000). Resources such as www.salary.com, www

  9. Number

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the Weldon Spring,7=cr5rnP 7694 i+lJNew York,' , /v-i 2

  10. WECC Variable Generation Planning Reference Book

    SciTech Connect (OSTI)

    Makarov, Yuri V.; Du, Pengwei; Etingov, Pavel V.; Ma, Jian; Vyakaranam, Bharat

    2013-05-14

    This planning reference book is a document reflecting a Western Electricity Coordination Council (WECC) effort to put together multiple sources of information and provide a clear, systemic, comprehensive outline of the problems, both existing and anticipated; their impacts on the system; currently used and proposed solutions by the industry and research community; planning practices; new technologies, equipment, and standards; and expected future trends. This living (periodically updated) document could help WECC and other practicing engineers, especially the younger generation of engineers joining the workforce, to get familiar with a large variety of information related to the integration of variable resources into the WECC system, bypassing in part the need for time-consuming information gathering and learning processes from more experienced engineers or from the literature.

  11. ACAA fly ash basics: quick reference card

    SciTech Connect (OSTI)

    2006-07-01

    Fly ash is a fine powdery material created when coal is burned to generate electricity. Before escaping into the environment via the utility stacks, the ash is collected and may be stored for beneficial uses or disposed of, if necessary. The use of fly ash provides environmental benefits, such as the conservation of natural resources, the reduction of greenhouse gas emissions and eliminating the needed for ash disposal in landfills. It is also a valuable mineral resource that is used in construction and manufacturing. Fly ash is used in the production of Portland cement, concrete, mortars and stuccos, manufactured aggregates along with various agricultural applications. As mineral filler, fly ash can be used for paints, shingles, carpet backing, plastics, metal castings and other purposes. This quick reference card is intended to provide the reader basic source, identification and composition, information specifically related to fly ash.

  12. Webinar October 13: Reference Designs for Hydrogen Fueling Stations...

    Broader source: Energy.gov (indexed) [DOE]

    titled "Reference Designs for Hydrogen Fueling Stations" on Tuesday, October 13, from 12 to 1 p.m. Eastern Daylight Time (EDT). The goal of the H2FIRST Reference Station Design...

  13. United States Department of the Interior - RM-53 - Reference...

    Open Energy Info (EERE)

    search OpenEI Reference LibraryAdd to library PermittingRegulatory Guidance - GuideHandbook: United States Department of the Interior - RM-53 - Reference Manual - Special Park...

  14. ORNL/TM-2012/501 Small Hydropower Cost Reference

    E-Print Network [OSTI]

    Post, Wilfred M.

    ORNL/TM-2012/501 Small Hydropower Cost Reference Model October 2012 Prepared by Qin Fen (Katherine Government or any agency thereof. #12;ORNL/TM-2012/501 Small Hydropower Cost Reference Model Final Project

  15. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    hicago-oharenew2004v1-47-2.zip More Documents & Publications Reference Buildings by Climate Zone and Representative City: 5A Chicago, Illinois Reference Buildings by Climate...

  16. H2FIRST Reference Station Design Task: Project Deliverable 2...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reference Station Design Task: Project Deliverable 2-2 H2FIRST Reference Station Design Task: Project Deliverable 2-2 This H2FIRST project report, published in April 2015, presents...

  17. Air Quality: Air Pollutants, SLAC Emissions Sources, and Regulatory Reference

    E-Print Network [OSTI]

    Wechsler, Risa H.

    Air Quality: Air Pollutants, SLAC Emissions Sources, and Regulatory Reference Department: Chemical permit regulations are designed to track, record, and control air pollutants belonging to several on chemical classifications. This reference outlines major categories of air pollutants found at SLAC

  18. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  19. RECENT REFERENCES: JULY 1, 2006 TO SEPTEMBER 30, 2006

    SciTech Connect (OSTI)

    WINCHELL, D.F.

    2006-09-30

    This document lists experimental references added to Nuclear Science References (NSR) during the period July 1, 2006 to September 30, 2006. The first section lists keynumbers and keywords sorted by mass and nuclide. The second section lists all references, ordered by keynumber.

  20. RECENT REFERENCES: JANUARY 1, 2005 TO DECEMBER 31, 2005

    SciTech Connect (OSTI)

    WINCHELL, D.F.

    2005-12-31

    This document lists experimental references added to Nuclear Science References (NSR) during the period January 1, 2005 to December 31, 2005. The first section lists keynumbers and keywords sorted by mass and nuclide. The second section lists all references, ordered by keynumber.

  1. RECENT REFERENCES: APRIL 1, 2006 TO JUNE 30, 2006

    SciTech Connect (OSTI)

    WINCHELL, D.F.

    2006-06-30

    This document lists experimental references added to Nuclear Science References (NSR) during the period April 1, 2006 to June 30, 2006. The first section lists keynumbers and keywords sorted by mass and nuclide. The second section lists all references, ordered by keynumber.

  2. RECENT REFERENCES: OCTOBER 1, 2005 TO DECEMBER 31, 2005

    SciTech Connect (OSTI)

    WINCHELL, D.F.

    2005-12-31

    This document lists experimental references added to Nuclear Science References (NSR) during the period October 1, 2005 to December 31, 2005. The first section lists keynumbers and keywords sorted by mass and nuclide. The second section lists all references, ordered by keynumber.

  3. On the Intrinsic Locality Properties of Web Reference Streams

    E-Print Network [OSTI]

    Keinan, Alon

    On the Intrinsic Locality Properties of Web Reference Streams Rodrigo Fonseca Virg´ilio Almeida in the study of Web reference streams: sequences of requests for Web objects. In particular, many studies have into the nature of reference stream transformations in the Web. I. INTRODUCTION Considerable effort has gone

  4. Types of random numbers and Monte Carlo Methods Pseudorandom number generation

    E-Print Network [OSTI]

    Mascagni, Michael

    Types of random numbers and Monte Carlo Methods Pseudorandom number generation Quasirandom number generation Conclusions WE246: Random Number Generation A Practitioner's Overview Prof. Michael Mascagni #12;Types of random numbers and Monte Carlo Methods Pseudorandom number generation Quasirandom number

  5. A Reference Grammar of Oklahoma Cherokee

    E-Print Network [OSTI]

    Montgomery-Anderson, Brad

    2008-08-15

    of jurisdiction and membership and, for a Native American tribe, has a large number of speakers of its heritage language. It has been suggested that the Cherokee syllabary has played a role in the maintenance of the language. Richard Allen states that, ?It.... There is a growing body of literature on the recent efforts towards language maintenance. Studies of the immersion experience are in Peter (2003), Peter (2007), Oosahwee (2008), and Peter et. al. (2008). Hirata-Edds et al. (2003) discusses training...

  6. Low-Resolution STELab IPS 3D Reconstructions of the Whole Heliosphere Interval and Comparison with in-Ecliptic Solar Wind Measurements from STEREO and Wind Instrumentation

    E-Print Network [OSTI]

    Bisi, M. M.; Jackson, B. V.; Buffington, A.; Clover, J. M.; Hick, P. P.; Tokumaru, M.

    2009-01-01

    structure of the fast solar wind. J. Geophys. Res. 112,observations of the solar wind. Proc. SPIE 6689, 668911-1.W.A. , Maagoe, S. : 1972, Solar wind velocity from ips

  7. Reprogramming peripheral blood mononuclear cells using an efficient feeder-free, non-integration method to generate iPS cells and the effect of immunophenotype and epigenetic state on HSPC fate 

    E-Print Network [OSTI]

    Liu, Jing

    2014-11-28

    Background and objectives In 2006 Shinya Yamanaka successfully reprogrammed mouse fibroblasts back to an embryonic stem cell-like state (called induced pluripotent cells, iPS cells) using retrovirus to introduce four ...

  8. CRYSTALLINE CERAMIC WASTE FORMS: REFERENCE FORMULATION REPORT

    SciTech Connect (OSTI)

    Brinkman, K.; Fox, K.; Marra, J.

    2012-05-15

    The research conducted in this work package is aimed at taking advantage of the long term thermodynamic stability of crystalline ceramics to create more durable waste forms (as compared to high level waste glass) in order to reduce the reliance on engineered and natural barrier systems. Durable ceramic waste forms that incorporate a wide range of radionuclides have the potential to broaden the available disposal options and to lower the storage and disposal costs associated with advanced fuel cycles. Assemblages of several titanate phases have been successfully demonstrated to incorporate radioactive waste elements, and the multiphase nature of these materials allows them to accommodate variation in the waste composition. Recent work has shown that they can be successfully produced from a melting and crystallization process. The objective of this report is to explain the design of ceramic host systems culminating in a reference ceramic formulation for use in subsequent studies on process optimization and melt property data assessment in support of FY13 melter demonstration testing. The waste stream used as the basis for the development and testing is a combination of the projected Cs/Sr separated stream, the Trivalent Actinide - Lanthanide Separation by Phosphorous reagent Extraction from Aqueous Komplexes (TALSPEAK) waste stream consisting of lanthanide fission products, the transition metal fission product waste stream resulting from the transuranic extraction (TRUEX) process, and a high molybdenum concentration with relatively low noble metal concentrations. In addition to the combined CS/LN/TM High Mo waste stream, variants without Mo and without Mo and Zr were also evaluated. Based on the results of fabricating and characterizing several simulated ceramic waste forms, two reference ceramic waste form compositions are recommended in this report. The first composition targets the CS/LN/TM combined waste stream with and without Mo. The second composition targets with CS/LN/TM combined waste stream with Mo and Zr removed. Waste streams that contain Mo must be produced in reducing environments to avoid Cs-Mo oxide phase formation. Waste streams without Mo have the ability to be melt processed in air. A path forward for further optimizing the processing steps needed to form the targeted phase assemblages is outlined in this report. Processing modifications including melting in a reducing atmosphere, and controlled heat treatment schedules are anticipated to improve the targeted elemental partitioning.

  9. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  10. Motion at low Reynolds number

    E-Print Network [OSTI]

    Tam, Daniel See Wai, 1980-

    2008-01-01

    The work described in this thesis centers on inertialess motion at low Reynolds numbers at the crossroad between biofluids and microfluids. Here we address questions regarding locomotion of micro-swimmers, transport of ...

  11. Departmental Business Instrument Numbering System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-01-27

    The Order prescribes the procedures for assigning identifying numbers to all Department of Energy (DOE) and National Nuclear Security Administration (NNSA) business instruments. Cancels DOE O 540.1. Canceled by DOE O 540.1B.

  12. Departmental Business Instrument Numbering System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-12-05

    To prescribe procedures for assigning identifying numbers to all Department of Energy (DOE), including the National Nuclear Security Administration, business instruments. Cancels DOE 1331.2B. Canceled by DOE O 540.1A.

  13. MOTOR POOL RESERVATIONS Reservation Number:_______________

    E-Print Network [OSTI]

    Ottino, Julio M.

    of Department Chair or Organization Advisor: ________________________________________ Chart String Number: Fund: ______________________________________________________________________ Name of Department or Organization: _____________________________________________________ Name reservations require the "Organization Authorization for University Vehicles" form to be faxed to Motor Pool

  14. Reference material manufacture and certification for the AVNG

    SciTech Connect (OSTI)

    Hauck, Danielle K; Mac Arthur, Duncan; Thron, Jonathan L; Livke, Alexander; Kondratov, Sergey; Razinkov, Sergey

    2010-01-01

    Testing and demonstration of any radiation measurement system requires the use of appropriate radioactive sources. The AVNG implementation that we describe is an attribute measurement system built by RFNC - VNIIEF in Sarov, Russia. The AVNG detects neutron and gamma radiation signatures and displays the three unclassified attributes of 'plutonium presence,' 'plutonium mass > 2 kg,' and 'plutonium isotopic ratio ({sup 240}Pu to {sup 239}Pu) < 0.1.' The AVNG was tested using a number of reference material (RM) sources with masses and isotopic ratios above and below these thresholds. The AVNG was demonstrated in June 2009 using several of these sources in addition to detector calibration sources. Since the AVNG was designed to measure multi-kg plutonium sources, the RM was manufactured specifically for use with this system. In addition, the RM was used to test the thresholds in the AVNG, so the size and composition of each RM was certified prior to use. In this presentation, we will describe the various steps in the manufacture and certification of these RM sources.

  15. WECC Variable Generation Planning Reference Book: Appendices

    SciTech Connect (OSTI)

    Makarov, Yuri V.; Du, Pengwei; Etingov, Pavel V.; Ma, Jian; Vyakaranam, Bharat

    2013-05-13

    The document titled “WECC Variable Generation Planning Reference Book”. This book is divided into two volumes; one is the main document (volume 1)and the other is appendices (volume 2). The main document is a collection of the best practices and the information regarding the application and impact of variables generation on power system planning. This volume (appendices) has additional information on the following topics: Probabilistic load flow problems. 2. Additional useful indices. 3. high-impact low-frequency (HILF) events. 4. Examples of wide-area nomograms. 5. Transmission line ratings, types of dynamic rating methods. 6. Relative costs per MW-km of different electric power transmission technologies. 7. Ultra-high voltage (UHV) transmission. 8.High voltage direct current (VSC-HVDC). 9. HVDC. 10. Rewiring of existing transmission lines. 11. High-temperature low sag (HTLS) conductors. 12. The direct method and energy functions for transient stability analysis in power systems. 13.Blackouts caused by voltage instability. 14. Algorithm for parameter continuation predictor-corrector methods. 15. Approximation techniques available for security regions. 16. Impacts of wind power on power system small signals stability. 17. FIDVR. 18. FACTS. 19. European planning standard and practices. 20. International experience in wind and solar energy sources. 21. Western Renewable Energy Zones (WREZ). 22. various energy storage technologies. 23. demand response. 24. BA consolidation and cooperation options. 25. generator power management requirements and 26. European planning guidelines.

  16. SAPHIRE 8 Volume 2 - Technical Reference

    SciTech Connect (OSTI)

    C. L. Smith; S. T. Wood; W. J. Galyean; J. A. Schroeder; M. B. Sattison

    2011-03-01

    The Systems Analysis Programs for Hands-on Integrated Reliability Evaluations (SAPHIRE) refers to a set of computer programs that were developed to create and analyze probabilistic risk assessment (PRAs). Herein information is provided on the principles used in the construction and operation of Version 8.0 of the SAPHIRE system. This report summarizes the fundamental mathematical concepts of sets and logic, fault trees, and probability. This volume then describes the algorithms used to construct a fault tree and to obtain the minimal cut sets. It gives the formulas used to obtain the probability of the top event from the minimal cut sets, and the formulas for probabilities that apply for various assumptions concerning reparability and mission time. It defines the measures of basic event importance that SAPHIRE can calculate. This volume gives an overview of uncertainty analysis using simple Monte Carlo sampling or Latin Hypercube sampling, and states the algorithms used by this program to generate random basic event probabilities from various distributions. Also covered are enhance capabilities such as seismic analysis, Workspace algorithms, cut set "recovery," end state manipulation, and use of "compound events."

  17. 7. Flows in a rotating reference frame 7.1. Rotating reference frames

    E-Print Network [OSTI]

    Read, Peter L.

    in a rotating reference frame. We use rotating axes, fixed w.r.t. the rotating system but note that time-derivatives of vectors must be modified: 1 #12;Suppose frame R rotates at constant angular velocity = (0, 0, ) w.r.t. an inertial frame I. Consider vector A(t) ­ suppose for simplicity that it lies in the xy-plane of R and I

  18. Kentucky Natural Gas Number of Residential Consumers (Number of Elements)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of Elements) Kentucky Natural Gas Number

  19. TRANSPORT NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION

    E-Print Network [OSTI]

    De Jonghe, Lutgard C.

    2014-01-01

    NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION Lutgard

  20. TRANSPORT NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION

    E-Print Network [OSTI]

    De Jonghe, Lutgard C.

    2012-01-01

    NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION Lutgard

  1. International linear collider reference design report

    SciTech Connect (OSTI)

    Aarons, G.

    2007-06-22

    The International Linear Collider will give physicists a new cosmic doorway to explore energy regimes beyond the reach of today's accelerators. A proposed electron-positron collider, the ILC will complement the Large Hadron Collider, a proton-proton collider at the European Center for Nuclear Research (CERN) in Geneva, Switzerland, together unlocking some of the deepest mysteries in the universe. With LHC discoveries pointing the way, the ILC -- a true precision machine -- will provide the missing pieces of the puzzle. Consisting of two linear accelerators that face each other, the ILC will hurl some 10 billion electrons and their anti-particles, positrons, toward each other at nearly the speed of light. Superconducting accelerator cavities operating at temperatures near absolute zero give the particles more and more energy until they smash in a blazing crossfire at the centre of the machine. Stretching approximately 35 kilometres in length, the beams collide 14,000 times every second at extremely high energies -- 500 billion-electron-volts (GeV). Each spectacular collision creates an array of new particles that could answer some of the most fundamental questions of all time. The current baseline design allows for an upgrade to a 50-kilometre, 1 trillion-electron-volt (TeV) machine during the second stage of the project. This reference design provides the first detailed technical snapshot of the proposed future electron-positron collider, defining in detail the technical parameters and components that make up each section of the 31-kilometer long accelerator. The report will guide the development of the worldwide R&D program, motivate international industrial studies and serve as the basis for the final engineering design needed to make an official project proposal later this decade.

  2. Abstract--A digital ecosystem usually refers to a collection of small and medium enterprise businesses that interacts

    E-Print Network [OSTI]

    Loke, Seng W. - Loke, Seng W.

    ecosystem is the human user of these appliances. The whole interactions of the information appliances, humanAbstract--A digital ecosystem usually refers to a collection of small and medium enterprise ecosystems. We introduce the idea of creating an eco- system from a number of smart devices. This ecosystem

  3. William A. Stein References Cited (858) 220-6876 wstein@math.washington.edu http://sage.math.washington.edu

    E-Print Network [OSTI]

    Stein, William

    William A. Stein References Cited (858) 220-6876 wstein@math.washington.edu http://sage.math.washington and Number Theory, http://modular.math.washington.edu/msri07/. [BMSW06] B. Bektemirov, B. Mazur, W. Stein), http://sage.math.washington.edu/papers/bmsw-rank/. [CDR+07] J. Cremona, H. Darmon, K. Ribet, R. Sharifi

  4. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  5. Reference number of working document: ISO/IEC JTC1/SC22/WG20 N??? Date: 1999-06-11

    E-Print Network [OSTI]

    Kuhn, Markus

    that are members of ISO or IEC participate in the development of33 International Standards through technical 1.39 40 The main task of a technical committee is to prepare International Standards but in41 International Standard, despite repeated efforts;46 47 - type 2, when the subject is still under technical

  6. Reference Number Infrared cameras are e.g. used as night vision devices for cars or in the field of

    E-Print Network [OSTI]

    , Low cost, thermal imaging Patent Situation DE, US, China Offer Cooperation, License, Option, Purchase or military applica- tions, to determine energy flows (e.g. for the mandatory energy pass), or for fire

  7. Experimental determination of Ramsey numbers

    E-Print Network [OSTI]

    Zhengbing Bian; Fabian Chudak; William G. Macready; Lane Clark; Frank Gaitan

    2013-08-14

    Ramsey theory is a highly active research area in mathematics that studies the emergence of order in large disordered structures. Ramsey numbers mark the threshold at which order first appears and are extremely difficult to calculate due to their explosive rate of growth. Recently, an algorithm that can be implemented using adiabatic quantum evolution has been proposed that calculates the two-color Ramsey numbers $R(m,n)$. Here we present results of an experimental implementation of this algorithm and show that it correctly determines the Ramsey numbers R(3,3) and $R(m,2)$ for $4\\leq m\\leq 8$. The R(8,2) computation used 84 qubits of which 28 were computational qubits. This computation is the largest experimental implementation of a scientifically meaningful adiabatic evolution algorithm that has been done to date.

  8. Coupled fluid transport processes and numerical examples The expression "coupled fluid processes" refers to the central role of groundwater in transferring

    E-Print Network [OSTI]

    Kornhuber, Ralf

    Coupled fluid transport processes and numerical examples The expression "coupled fluid processes" refers to the central role of groundwater in transferring energy (i.e. heat) mass (i.e. solutes) over #12;Stability criteria TdK RaT Solutal Rayleigh number Thermal Rayleigh number d sat s D CdK CC Ra

  9. Ten Steps for Career Success Ready Reference A-4

    E-Print Network [OSTI]

    Ten Steps for Career Success Ready Reference A-4 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career

  10. Sample Letter of Inquiry Ready Reference F-4

    E-Print Network [OSTI]

    Sample Letter of Inquiry Ready Reference F-4 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career

  11. First Impressions on Job Interviews Ready Reference G-2

    E-Print Network [OSTI]

    & Technology Career Services Oklahoma State University College of Engineering, Architecture & TechnologyFirst Impressions on Job Interviews Ready Reference G-2 College of Engineering, Architecture

  12. Sample Status Inquiry Letter Ready Reference F-9

    E-Print Network [OSTI]

    Sample Status Inquiry Letter Ready Reference F-9 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  13. Bibliography of the Scripps Institution of Oceanography Reference Series 2000

    E-Print Network [OSTI]

    Criqui, Nan P.

    2001-01-01

    SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIES 00-1.Emeritus professor of oceanography, SIO, UCSD. ( OralScripps Institution of Oceanography. March 2000. 80p. 00-5.

  14. Bibliography of the Scripps Institution of Oceanography Reference Series 1999

    E-Print Network [OSTI]

    Jennings, Paige A.

    2000-01-01

    SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIES 99-1Scripps Institution of Oceanography. April 1999. 55p. 99-11the Scripps Institution of Oceanography. Originally printed

  15. Bibliography of the Scripps Institution of Oceanography Reference Series 2002

    E-Print Network [OSTI]

    Lett, Phyllis C.

    2003-01-01

    Scripps Institution of Oceanography Reference Series. MarchSCRIPPS INSTITUTION OF OCEANOGRAPHY LA JOLL~ CALIFORNIAOF THE SCRIPPS INSTITUTION OF OCEANOGRAPHY REF ERENCE SERIES

  16. Bibliography of the Scripps Institution of Oceanography Reference Series 1995

    E-Print Network [OSTI]

    Criqui, Nan P.

    1995-01-01

    Scripps Institution of Oceanography. August 1995. 353p. 95-OF THE SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIESScripps Institution of Oceanography. January 1995. 10p. Day,

  17. Existing Commercial Reference Buildings Constructed In or After 1980 — Archive

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location.

  18. MPI: The Complete Reference Scientific and Engineering Computation

    E-Print Network [OSTI]

    Lu, Paul

    MPI: The Complete Reference #12; Scientific and Engineering Computation Janusz Kowalik, Editor Data Manchek, and Vaidy Sunderam, 1994 Enabling Technologies for Petaflops Computing by Thomas Sterling, Paul

  19. Reference Model for Control and Automation Systems in Electrical...

    Office of Environmental Management (EM)

    Reference Model for Control and Automation Systems in Electrical Power Version 1.2 October 12, 2005 Prepared by: Sandia National Laboratories' Center for SCADA Security Jason...

  20. Reference Model for Control and Automation Systems in Electrical...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Model for Control and Automation Systems in Electrical Power (October 2005) Reference Model for Control and Automation Systems in Electrical Power (October 2005) Modern...

  1. H2FIRST Reference Station Design Task: Project Deliverable 2...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    98 List of Tables Table ES-1. Station Types Selected for Detailed Reference Design Development ... v Table 1. Changed Input Parameters...

  2. Plutonium Certified Reference Materials Price List | U.S. DOE...

    Office of Science (SC) Website

    Laboratory (NBL) NBL Home About Programs Certified Reference Materials (CRMs) Prices and Certificates Ordering Information Training NEPA Documents News Safety Data Sheets...

  3. NERSC/DOE FES Requirements Workshop Reference Materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Materials Reference Materials Large Scale Computing and Storage Requirements for Fusion Energy Sciences August 3-4, 2010 Official DOE Invitation Workshop Invitation Letter from...

  4. FAQS Reference Guide – Safeguards and Security General Technical Base

    Office of Energy Efficiency and Renewable Energy (EERE)

    This reference guide addresses the competency statements in the July 2009 edition of DOE-STD-1123-2009, Safeguards and Security General Technical Base Qualification Standard.

  5. Sandia Energy - Floating Oscillating Water Column Reference Model...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to provide publicly available technical and economic benchmarks for a variety of marine energy converters. The final reference model, an oscillating water column (OWC)...

  6. Constrained Ramsey Numbers of Graphs

    E-Print Network [OSTI]

    Jiang, Tao

    Constrained Ramsey Numbers of Graphs Robert E. Jamison,1 Tao Jiang,2* and Alan C. H. Ling3 1-like trees. � 2002 Wiley Periodicals, Inc. J Graph Theory 42: 1­16, 2003 Keywords: Ramsey; monochromatic edges have the same color and rainbow iff all of its edges have different colors. In classical Ramsey

  7. Swimming by numbers QUANTUM CONTROL

    E-Print Network [OSTI]

    Mahadevan, L.

    flow, providing key qualitative insight in fluid mechanics. For example, the so-called Reynolds number be described by a universal mechanical principle seems optimistic -- if not entirely unrealistic. Now, however and pressure forces relevant for net propulsion. A measure of the thrust force is given by the mass

  8. Empowering the Frontline: A Dynamic Online Reference Manual and Training Session for Student Library Employee Reference Skills

    E-Print Network [OSTI]

    Loo, Jeffery L; Quigley, Brian D; Ngo, Lisa T; Powell, Susan; Teplitzky, Samantha

    2015-01-01

    training across our libraries’ service points. To developSession for Student Library Employee Reference SkillsTraining Design 5 libraries Engineering & Physical Sciences

  9. Archived Reference Building Type: Stand-alone retail

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  10. Archived Reference Building Type: Stand-alone retail

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  11. Archived Reference Climate Zone: 3C San Francisco, California

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  12. Archived Reference Climate Zone: 3C San Francisco, California

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  13. Archived Reference Climate Zone: 4A Baltimore, Maryland

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  14. Archived Reference Climate Zone: 4A Baltimore, Maryland

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  15. SQL Reference Learning Gupta SQLBase Structured Query Language

    E-Print Network [OSTI]

    SQL Reference Learning Gupta SQLBase Structured Query Language (SQL) By William Sprouse CENTER, CO 80523 Spring 1996 #12;SQL Reference Learning Gupta SQLBase Structured Query Language (SQL.1.2.4 The Clipboard 5 2.2 GETTING STARTED 5 2.2.1 STARTING QUEST 5 2.2.2 GETTING HELP 6 3. SQL BASICS 6 3

  16. DEGAS 2 Verification Test with Fluid Neutral Momentum Transport Reference

    E-Print Network [OSTI]

    Budny, Robert

    DEGAS 2 Verification Test with Fluid Neutral Momentum Transport Reference Problem D. P. Stotler, PPPL 1 Background The "Fluid Neutral Momentum Transport Reference Problem" [1] was used to verify the original DEGAS [2] Monte Carlo neutral transport code. The resulting benchmark was subsequently employed

  17. Archived Reference Climate Zone: 6A Minneapolis, Minnesota

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  18. Archived Reference Climate Zone: 6A Minneapolis, Minnesota

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  19. NIST STANDARD REFERENCE DATA (SRD) INTERNET SERVICE SUBSCRIPTION LICENSE

    E-Print Network [OSTI]

    NIST STANDARD REFERENCE DATA (SRD) INTERNET SERVICE SUBSCRIPTION LICENSE This document is a non-exclusive, non-transferrable, non-assignable and limited License Agreement (AGREEMENT) between the National ­ a person designated in the License to use the Internet Edition of a NIST Standard Reference Database under

  20. Dynamic Stochastic Inventory Management with Reference Price Effects

    E-Print Network [OSTI]

    Chen, Xin

    Dynamic Stochastic Inventory Management with Reference Price Effects Xin Chen Department in which demand depends on not only the current selling price but also a memory-based reference price. Pricing and inventory decisions are made simultane- ously at the beginning of each period. Assuming all

  1. Archived Reference Climate Zone: 2B Phoenix, Arizona

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary ofbuilding types and climate zones is available for reference. Current versions are also available.

  2. Archived Reference Climate Zone: 2B Phoenix, Arizona

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available.

  3. Communication between inertial observers with partially correlated reference frames

    E-Print Network [OSTI]

    Mehdi Ahmadi; Alexander R. H. Smith; Andrzej Dragan

    2015-08-13

    In quantum communication protocols the existence of a shared reference frame between two spatially separated parties is normally presumed. However, in many practical situations we are faced with the problem of misaligned reference frames. In this paper, we study communication between two inertial observers who have partial knowledge about the Lorentz transformation that relates their frames of reference. Since every Lorentz transformation can be decomposed into a pure boost followed by a rotation, we begin by analysing the effects on communication when the parties have partial knowledge about the transformation relating their frames, when the transformation is either a rotation or pure boost. This then enables us to investigate how the efficiency of communication is affected due to partially correlated inertial reference frames related by an arbitrary Lorentz transformation. Furthermore, we show how the results of previous studies where reference frames are completely uncorrelated are recovered from our results in appropriate limits.

  4. Louisiana Natural Gas Number of Residential Consumers (Number of Elements)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of33Cubic Foot)Year Jan

  5. California Natural Gas Number of Residential Consumers (Number of Elements)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 ArizonaResidential Consumers (Number of Elements)

  6. Nebraska Natural Gas Number of Industrial Consumers (Number of Elements)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,Decade Year-03.823,172 3,009165,360Industrial Consumers (Number of

  7. Nebraska Natural Gas Number of Residential Consumers (Number of Elements)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,Decade Year-03.823,172 3,009165,360Industrial Consumers (Number

  8. North Dakota Natural Gas Number of Industrial Consumers (Number of

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements) Industrial Consumers (Number of

  9. North Dakota Natural Gas Number of Residential Consumers (Number of

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements) Industrial Consumers (Number

  10. MAC -OUTLOOK QUICK TIP REFERENCE GUIDE 1 Quick Tip Reference Guide | Swinburne University of Technology Version 1.0

    E-Print Network [OSTI]

    Liley, David

    MAC - OUTLOOK QUICK TIP REFERENCE GUIDE 1 Quick Tip Reference Guide | Swinburne University of Technology Version 1.0 Managing Your Emails Conversation View in Outlook 2011 1. Click Organize tab 2. Click. On the Outlook menu, click Preferences. 2. Under E-mail, click Signatures . 3. Click Default Signatures. 4. Under

  11. Blue carbon storage potential of marine carbonate deposits Project reference IAP/13/50. Please quote this reference when applying.

    E-Print Network [OSTI]

    Guo, Zaoyang

    IAPETUS Blue carbon storage potential of marine carbonate deposits Project reference IAP/13 Henrik Stahl, Scottish Association for Marine Science Key Words 1. Blue carbon 2. Carbonate 3. Coralline is referred to as `blue carbon' to differentiate it from terrestrial carbon stores. Known blue carbon sinks

  12. The Fermat and Mersenne Numbers 

    E-Print Network [OSTI]

    Nowlin, W. D.

    1960-01-01

    . (Throughout this thesis, F will always denote a Feraat nmaber and M a Mersenne nuuber. ) The problea of deternining p which of the Fernat and Mersenne nmabers are prius has concerned uany matheuaticians during the last two centuries. This research has... or a Fermat, number. Next? Froth~a theorem, of which Pepin's test is a special case, is stated and proved. In the last section the theory of recurring series is used to establish primality tests of the Lucas type for both the Fermat and Mersenne...

  13. Atomic and Molecular Quantum Theory Course Number: C561 26 Group Theory Basics

    E-Print Network [OSTI]

    Iyengar, Srinivasan S.

    Atomic and Molecular Quantum Theory Course Number: C561 26 Group Theory Basics 1. Reference: "Group Theory and Quantum Mechanics" by Michael Tinkham. 2. We said earlier that we will go looking for the set, Indiana University 266 c 2003, Srinivasan S. Iyengar (instructor) #12;Atomic and Molecular Quantum Theory

  14. Solidi cation of a high-Reynolds-number ow in laser percussion drilling

    E-Print Network [OSTI]

    Eindhoven, Technische Universiteit

    Solidi#12;cation of a high-Reynolds-number ow in laser percussion drilling W. R. Smith y and R. M laser percussion drilling. 1 Introduction Laser percussion drilling is used to machine gas turbine with conventional mechanical drills. The term percussion refers to the repeated operation of the laser in short

  15. 1. Department, Course Number, Title ORE 664, Nearshore Processes and Sediment Transport

    E-Print Network [OSTI]

    1. Department, Course Number, Title ORE 664, Nearshore Processes and Sediment Transport 2 Sediment transport by waves and currents in coastal areas and its effect on morphological processes. Effect Reference books: 1. Beach Processes and Sedimentation, P.D. Komar, 2nd Edition, Prentice-Hall, Inc., 1998 2

  16. NEW COURSE NUMBER: ENG ME 579 Extra information on MN/SC579: Microelectronic Device Manufacturing

    E-Print Network [OSTI]

    Lin, Xi

    NEW COURSE NUMBER: ENG ME 579 Extra information on MN/SC579: Microelectronic Device Manufacturing for manufacturing engineering students to take for the following reason. Your future careers in manufacturing are undoubtedly most promising for the manufacturing of what is often referred to as "high technology" areas

  17. Good random number generators are (not so) easy to find P. Hellekalek*

    E-Print Network [OSTI]

    Palmeri, Thomas

    criteria for good random number generators: theoretical support, empirical evidence and practical aspects refer to Section 4 and Section 5. In this paper, safety-measures against such unpleasant surprises #12;A good generator is not so easy to find if one sets out to design it by oneself, without

  18. DRAFT CRUISE REPORT Cruise Number: DY0807

    E-Print Network [OSTI]

    Neuston (Neu) 68 Deployment of satellite buoy (SatBuoy) 3 Samples Collected Tows Number Number of larvae of buoy or mooring (Deploy) 3 3 Stimulated fluorescence collected during CTD casts (Fluor) 18 Number

  19. The proper characteristics of frame reference as a 4-invariants

    E-Print Network [OSTI]

    V. V. Voytik

    2015-06-02

    The paper derived 4-dimensional equation for the proper characteristics of the rigid frame of reference. From these conditions it follows the laws of motion of its proper tetrad and inverse kinematics equation, i. e., differential equations, which solves the problem of recovering the parameters of the motion of rigid frame of reference for their proper acceleration and angular velocity. In particular it is shown that the commission boost the moving frame of reference having Thomas precession for a new laboratory system will have a combination of two rotations: a new self-Thomas precession and rotation Wigner, which combine to give an initial frequency of the Thomas precession.

  20. NBS SPEC. PUBL. 260 -16 Standard Reference Materials

    E-Print Network [OSTI]

    NBS SPEC. PUBL. 260 - 16 Standard Reference Materials: HOMOGENEITY CHARACTERIZATION OF NBS Materials: Homogeneity Characterization of NBS Spectrometric Standards IV: Preparation and Microprobe. L. Vieth Institute for Materials Research National Bureau of Standards Washington, D.C. 20234

  1. Library and Information Services Division Current References 2001-1

    E-Print Network [OSTI]

    1 Library and Information Services Division Current References 2001-1 Publications by National Library U. S. Department of Commerce National Oceanic and Atmospheric Administration National Environmental Satellite, Data, and Information Service National Oceanographic Data Center NOAA Central Library

  2. Motivation for the Transaction-Based Reference Platform

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Motivation for the Transaction-Based Reference Platform Or How I learned to Stop Worrying and Love Transactions George Hernandez Pacific Northwest National Lab July 23-24, 2015...

  3. Quantum geometrodynamical description of the Universe in different reference frames

    E-Print Network [OSTI]

    T. P. Shestakova

    2002-05-16

    Several years ago the so-called quantum geometrodynamics in extended phase space was proposed. The main role in this version of quantum geometrodynamics is given to a wave function that carries information about geometry of the Universe as well as about a reference frame in which this geometry is studied. We consider the evolution of a physical object (the Universe) in ``physical'' subspace of extended configurational space, the latter including gauge and ghost degrees of freedom. A measure of the ``physical'' subspace depends on a chosen reference frame, in particular, a small variation of a gauge-fixing function results in changing the measure. Thus, a transition to another gauge condition (another reference frame) leads to non-unitary transformation of a physical part of the wave function. From the viewpoint of the evolution of the Universe in the ``physical'' subspace a transition to another reference frame is an irreversible process that may be important when spacetime manifold has a nontrivial topology.

  4. Archive Reference Buildings by Building Type: Primary school

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  5. Archive Reference Buildings by Building Type: Secondary school

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  6. Bibliography of the Scripps Institution of Oceanography Reference Series 1996

    E-Print Network [OSTI]

    Jennings, Paige A.

    1997-01-01

    SCRIPPS INSTITUTION OF OCEANOGRAPHY REFERENCE SERIES Dufour,the Scripps Institution of Oceanography. January 1996. 42p.Scripps Institution of Oceanography. July 1996. 53p. 96-17

  7. Archive Reference Buildings by Building Type: Stand-alone retail

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  8. Existing Commercial Reference Buildings Constructed Before 1980 — Archive

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and...

  9. X-ray Moiré deflectometry using synthetic reference images

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Stutman, Dan; Valdivia, Maria Pia; Finkenthal, Michael

    2015-06-25

    Moiré fringe deflectometry with grating interferometers is a technique that enables refraction-based x-ray imaging using a single exposure of an object. To obtain the refraction image, the method requires a reference fringe pattern (without the object). Our study shows that, in order to avoid artifacts, the reference pattern must be exactly matched in phase with the object fringe pattern. In experiments, however, it is difficult to produce a perfectly matched reference pattern due to unavoidable interferometer drifts. We present a simple method to obtain matched reference patterns using a phase-scan procedure to generate synthetic Moiré images. As a result, themore »method will enable deflectometric diagnostics of transient phenomena such as laser-produced plasmas and could improve the sensitivity and accuracy of medical phase-contrast imaging.« less

  10. Nuclear Science References Coding Manual D.F. Winchell

    E-Print Network [OSTI]

    Ohta, Shigemi

    Nuclear Science References Coding Manual D.F. Winchell National Nuclear Data Center Brookhaven and coding procedures for specific topics . . 18 3.2.1 NUCLEAR REACTIONS . . . . . . . . . . . . . . . . 19 3.2.2 RADIOACTIVITY . . . . . . . . . . . . . . . . . . . . 20 3.2.3 NUCLEAR STRUCTURE

  11. Archive Reference Buildings by Building Type: Fast food

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  12. Archive Reference Buildings by Building Type: Small office

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  13. Archive Reference Buildings by Building Type: Strip mall

    Broader source: Energy.gov [DOE]

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  14. Archive Reference Buildings by Building Type: Large office

    Office of Energy Efficiency and Renewable Energy (EERE)

    Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is...

  15. Reference Buildings by Climate Zone and Representative City:...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Climate Zone and Representative City: 2B Phoenix, Arizona Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona In addition to the ZIP file for each...

  16. Library and Information Services Division Current References 2009-1

    E-Print Network [OSTI]

    Library and Information Services Division Current References 2009-1 The Year of Darwin 2009 Discovering Darwin at NOAA Central Library: Resources on Charles Darwin, Evolution, and the Galapagos Islands National Oceanographic Data Center NOAA Central Library October 2009 http

  17. Sage Quick Reference: Linear Algebra Robert A. Beezer

    E-Print Network [OSTI]

    Ehler, Martin

    Sage Quick Reference: Linear Algebra Robert A. Beezer Sage Version 4.8 http Combining Matrices A.augment(B) A in first columns, matrix B to the right A.stack(B) A in top rows, B below

  18. Optical reference geometry and inertial forces in Kerr-de Sitter spacetimes

    E-Print Network [OSTI]

    Jiri Kovar; Zdenek Stuchlik

    2007-01-03

    Optical reference geometry and related concept of inertial forces are investigated in Kerr-de Sitter spacetimes. Properties of the inertial forces are summarized and their typical behaviour is illustrated. The intuitive 'Newtonian' application of the forces in the relativistic dynamics is demonstrated in the case of the test particle circular motion, static equilibrium positions and perfect fluid toroidal configurations. Features of the optical geometry are illustrated by the embedding diagrams of its equatorial plane. The embedding diagrams do not cover whole the stationary regions of the spacetimes, therefore the limits of embeddability are established. A shape of the embedding diagrams is related to the behaviour of the centrifugal force and it is characterized by the number of turning points of the diagrams. Discussion of the number of embeddable photon circular orbits is also included and the typical embedding diagrams are constructed. The Kerr-de Sitter spacetimes are classified according to the properties of the inertial forces and embedding diagrams.

  19. Practical Calculation of Molecular Acidity with the Aid of a Reference Molecule

    SciTech Connect (OSTI)

    Burger, Steven K; Liu, Shubin; Ayers, Paul W

    2011-02-24

    A set of linear free energy models are presented for determining the pK{sub a} values of amines, alcohols, and carboxylic acids. Models are determined from a series of pK{sub a} predictors, taken both from traditional natural atomic orbital analysis (NAO) and from a novel approach introduced here of using a reference molecule: an ammonium ion for amines and a hydrogen sulfide molecule for alcohols and carboxylic acids. Using these reference molecules, we calculate the barrier to proton transfer and show that a number of properties associated with the transition state are correlated with the pK{sub a}. By considering 38 predictors, we obtain a four-variable model for amines and a three-variable model for oxygen-containing compounds. The model for amines is based on 145 compounds and has a root mean squared error (RMSE) of 0.45 and R{sup 2} = 0.98. The oxygen set has 48 molecules: RMSE = 0.26, and R{sup 2} = 0.993. Similar, linear, and multilinear models are constructed after separating the sets into chemically similar categories: alcohols, carboxylic acids, and primary, secondary, tertiary, and aromatic amines. This separation gives simpler models with relatively low RMSE values, where the most important predictor of the pK{sub a} is the difference in energy between transferring the proton from the reference molecular base to the conjugate acid from the data set.

  20. Newton-Cartan Gravity in Noninertial Reference Frames

    E-Print Network [OSTI]

    Leo Rodriguez; James St. Germaine-Fuller; Sujeev Wickramasekara

    2014-12-26

    We study properties of Newton-Cartan gravity under transformations into all noninertial, nonrelativistic reference frames. The set of these transformations has the structure of an infinite dimensional Lie group, called the Galilean line group, which contains as a subgroup the Galilei group. We show that the fictitious forces of noninertial reference frames are naturally encoded in the Cartan connection transformed under the Galilean line group. These noninertial forces, which are coordinate effects, do not contribute to the Ricci tensor which describes the curvature of Newtonian spacetime. We show that only the $00$-component of the Ricci tensor is non-zero and equal to ($4\\pi$ times) the matter density in any inertial or noninetial reference frame and that it leads to what may be called Newtonian ADM mass. While the Ricci field equation and Gauss law are both fulfilled by the same physical matter density in inertial and linearly accelerating reference frames, there appears a discrepancy between the two in rotating reference frames in that Gauss law holds for an effective mass density that differs from the physical matter density. This effective density has its origin in the simulated magnetic field that appears in rotating frames, highlighting a rather striking difference between linearly and rotationally accelerating reference frames. We further show that the dynamical equations that govern the simulated gravitational and magnetic fields have the same form as Maxwell's equations, a surprising conclusion given that these equations are well-known to obey special relativity (and $U(1)$-gauge symmetry), rather than Galilean symmetry.

  1. Ramsey numbers of sparse hypergraphs David Conlon

    E-Print Network [OSTI]

    Fox, Jacob

    Ramsey numbers of sparse hypergraphs David Conlon Jacob Fox Benny Sudakov Abstract We give a short proof that any k-uniform hypergraph H on n vertices with bounded degree has Ramsey number at most c(, k on the Ramsey number of hypergraphs with at most m edges. 1 Introduction For a graph H, the Ramsey number r

  2. The Long and Winding Road to Building an Electronic Reference Collection

    E-Print Network [OSTI]

    Morris, Sara E.; Devlin, Frances A.

    2011-10-18

    The Starting Line • Subscriptions to aggregated reference collections – Examples: CREDO Reference, Oxford Reference Online, Gale Virtual Reference Library The Starting Line • Subscription reference titles, not sold as books – Chicago Manual of Style... – Reference E-Books • No usage! • Staff didn’t remember Record with 655 added LibGuide Proceed with Caution… • Solution – Catalog tab • “Electronic Reference Works” – Focusing on four publishers • Credo, Oxford, Sage, Gale – Getting titles...

  3. Analysis of Improved Reference Design for a Nuclear-Driven High Temperature Electrolysis Hydrogen Production Plant

    SciTech Connect (OSTI)

    Edwin A. Harvego; James E. O'Brien; Michael G. McKellar

    2010-06-01

    The use of High Temperature Electrolysis (HTE) for the efficient production of hydrogen without the greenhouse gas emissions associated with conventional fossil-fuel hydrogen production techniques has been under investigation at the Idaho National Engineering Laboratory (INL) for the last several years. The activities at the INL have included the development, testing and analysis of large numbers of solid oxide electrolysis cells, and the analyses of potential plant designs for large scale production of hydrogen using an advanced Very-High Temperature Reactor (VHTR) to provide the process heat and electricity to drive the electrolysis process. The results of these system analyses, using the UniSim process analysis software, have shown that the HTE process, when coupled to a VHTR capable of operating at reactor outlet temperatures of 800 °C to 950 °C, has the potential to produce the large quantities of hydrogen needed to meet future energy and transportation needs with hydrogen production efficiencies in excess of 50%. In addition, economic analyses performed on the INL reference plant design, optimized to maximize the hydrogen production rate for a 600 MWt VHTR, have shown that a large nuclear-driven HTE hydrogen production plant can to be economically competitive with conventional hydrogen production processes, particularly when the penalties associated with greenhouse gas emissions are considered. The results of this research led to the selection in 2009 of HTE as the preferred concept in the U.S. Department of Energy (DOE) hydrogen technology down-selection process. However, the down-selection process, along with continued technical assessments at the INL, has resulted in a number of proposed modifications and refinements to improve the original INL reference HTE design. These modifications include changes in plant configuration, operating conditions and individual component designs. This paper describes the resulting new INL reference design and presents results of system analyses performed to optimize the design and to determine required plant performance and operating conditions.

  4. Department for Analysis and Computational Number Theory Additive functions and number systems

    E-Print Network [OSTI]

    Department for Analysis and Computational Number Theory Additive functions and number systems systems April 7, 2010 1 / 35 #12;Department for Analysis and Computational Number Theory Outline Number and Computational Number Theory Number systems Let R be an integral domain, b R, and N = {n1, . . . , nm} R

  5. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  6. Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too: Understanding action representation in left aIPS. Neuropsychologia (2010), doi:10.1016/j.neuropsychologia.2010.04.028

    E-Print Network [OSTI]

    Hamilton, Antonia

    2010-01-01

    Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too communication Triangles have goals too: Understanding action representation in left aIPS Richard Ramsey of animacy Corresponding author. E-mail address: richard.ramsey@nottingham.ac.uk (R. Ramsey). and brain

  7. Title list of documents made publicly available: May 1--31, 1997. Volume 19, Number 5

    SciTech Connect (OSTI)

    1997-07-01

    The Title List of Documents Made Publicly Available is a monthly publication. It describes the information received and published by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) non-docketed material received and published by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  8. Title list of documents made publicly available. Volume 16, Number 5

    SciTech Connect (OSTI)

    Not Available

    1994-07-01

    The Title List of Documents Made Publicly Available contains descriptions of the information received and generated by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) nondocketed material received and generated by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  9. Title list of documents made publicly available, March 1--31, 1998. Volume 20, Number 3

    SciTech Connect (OSTI)

    1998-05-01

    The Title List of Documents Made Publicly Available is a monthly publication. It describes the information received and published by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) nondocketed material received and published by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a personal author index, a corporate source index, and a report number index.

  10. Title list of documents made publicly available: April 1--30, 1996. Volume 18, Number 4

    SciTech Connect (OSTI)

    1996-06-01

    This publication describes the information received and published by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) non-docketed material received and published by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  11. Title list of documents made publicly available: February 1--29, 1996. Volume 18, Number 2

    SciTech Connect (OSTI)

    1996-04-01

    The Title List of Documents Made Publicly Available is a monthly publication. It contains descriptions of the information received and generated by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) nondocketed material received and generated by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  12. Title list of documents made publicly available: September 1--30, 1996. Volume 18, Number 9

    SciTech Connect (OSTI)

    1996-11-01

    The report describes the information received and published by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) non-docketed material received and published by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  13. Title list of documents made publicly available: June 1--30, 1995. Volume 17, Number 6

    SciTech Connect (OSTI)

    1995-08-01

    This monthly publication contains descriptions of the information received and generated by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) nondocketed material received and generated by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  14. Title list of documents made publicly available: October 1--31, 1994. Volume 16, Number 10

    SciTech Connect (OSTI)

    Not Available

    1994-12-01

    The Title List of Documents Made Publicly Available is a monthly publication. It contains descriptions of the information received and generated by the US Nuclear Regulatory Commission (NRC). This information includes (1) docketed material associated with civilian nuclear power plants and other uses of radioactive materials and (2) nondocketed material received and generated by NRC pertinent to its role as a regulatory agency. As used here, docketed does not refer to Court dockets; it refers to the system by which NRC maintains its regulatory records. This series of documents is indexed by a Personal Author Index, a Corporate Source Index, and a Report Number Index.

  15. REFERENCE CASES FOR USE IN THE CEMENTITOUS PARTNERSHIP PROJECT

    SciTech Connect (OSTI)

    Langton, C.; Kosson, D.; Garrabrants, A.

    2010-08-31

    The Cementitious Barriers Partnership Project (CBP) is a multi-disciplinary, multi-institution cross cutting collaborative effort supported by the US Department of Energy (DOE) to develop a reasonable and credible set of tools to improve understanding and prediction of the structural, hydraulic and chemical performance of cementitious barriers used in nuclear applications. The period of performance is >100 years for operating facilities and > 1000 years for waste management. The CBP has defined a set of reference cases to provide the following functions: (i) a common set of system configurations to illustrate the methods and tools developed by the CBP, (ii) a common basis for evaluating methodology for uncertainty characterization, (iii) a common set of cases to develop a complete set of parameter and changes in parameters as a function of time and changing conditions, (iv) a basis for experiments and model validation, and (v) a basis for improving conceptual models and reducing model uncertainties. These reference cases include the following two reference disposal units and a reference storage unit: (i) a cementitious low activity waste form in a reinforced concrete disposal vault, (ii) a concrete vault containing a steel high-level waste tank filled with grout (closed high-level waste tank), and (iii) a spent nuclear fuel basin during operation. Each case provides a different set of desired performance characteristics and interfaces between materials and with the environment. Examples of concretes, grout fills and a cementitious waste form are identified for the relevant reference case configurations.

  16. Prime number generation and factor elimination

    E-Print Network [OSTI]

    Vineet Kumar

    2014-10-06

    We have presented a multivariate polynomial function termed as factor elimination function,by which, we can generate prime numbers. This function's mapping behavior can explain the irregularities in the occurrence of prime numbers on the number line. Generally the different categories of prime numbers found till date, satisfy the form of this function. We present some absolute and probabilistic conditions for the primality of the number generated by this method. This function is capable of leading to highly efficient algorithms for generating prime numbers.

  17. Using Pin as a Memory Reference Generator for Multiprocessor Simulation

    SciTech Connect (OSTI)

    McCurdy, C

    2005-10-22

    In this paper we describe how we have used Pin to generate a multithreaded reference stream for simulation of a multiprocessor on a uniprocessor. We have taken special care to model as accurately as possible the effects of cache coherence protocol state, and lock and barrier synchronization on the performance of multithreaded applications running on multiprocessor hardware. We first describe a simplified version of the algorithm, which uses semaphores to synchronize instrumented application threads and the simulator on every memory reference. We then describe modifications to that algorithm to model the microarchitectural features of the Itanium2 that affect the timing of memory reference issue. An experimental evaluation determines that while cycle-accurate multithreaded simulation is possible using our approach, the use of semaphores has a negative impact on the performance of the simulator.

  18. The Reference Design for the ILC, Costs, and What's Next

    SciTech Connect (OSTI)

    Barish, Barry

    2007-03-26

    A Reference Design for the International Linear Collider was recently released. The scale of the ILC is such that it must be built by an international collaboration and the design is the culmination of a unique global effort. Through ICFA, a decision was made to base the design on superconducting RF technology and then the Global Design Effort (GDE) was created to coordinate the actual accelerator design toward a construction proposal. The reference design establishes all the features of the machine, and defines both the R&D program and engineering design that will now follow over the next few years.

  19. Turing's normal numbers: towards randomness Veronica Becher

    E-Print Network [OSTI]

    presumably in 1938 Alan Turing gave an algorithm that produces real numbers normal to every integer base- putable normal numbers, and this result should be attributed to Alan Turing. His manuscript entitled "A

  20. Small Ramsey Numbers Stanislaw P. Radziszowski

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Small Ramsey Numbers Stanislaw P. Radziszowski Department of Computer Science Rochester Institute Ramsey numbers, where the avoided graphs are complete or complete without one edge. Many results per behavior of Ramsey numbers, but rather we concentrate on their specific values. Mathematical Reviews

  1. Ramsey Numbers Involving Cycles Stanislaw P. Radziszowski

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Ramsey Numbers Involving Cycles Stanislaw P. Radziszowski Department of Computer Science Rochester and data on Ramsey numbers involving cycles. This survey is based on the author's 2009 revi- sion #12 of the Dynamic Survey DS1, "Small Ramsey Numbers", at the Electronic Journal of Combinatorics. Table of Contents

  2. SHARP THRESHOLDS FOR HYPERGRAPH REGRESSIVE RAMSEY NUMBERS

    E-Print Network [OSTI]

    Lee, Gyesik

    SHARP THRESHOLDS FOR HYPERGRAPH REGRESSIVE RAMSEY NUMBERS LORENZO CARLUCCI, GYESIK LEE, AND ANDREAS WEIERMANN Abstract. The f-regressive Ramsey number Rreg f (d, n) is the minimum N such that every colouring regressive Ramsey numbers as defined by Kanamori and McAloon. In this paper we classifiy the growth

  3. Motivation Examples Star Avoiding Ramsey Numbers

    E-Print Network [OSTI]

    Isaak, Garth

    Motivation Examples Star Avoiding Ramsey Numbers Jonelle Hook, Garth Isaak Department and Cryptography Jonelle Hook, Garth Isaak Star Avoiding Ramsey Numbers #12;Motivation Examples Graph Ramsey-coloring of K13 has a red C5 or a blue K4. Jonelle Hook, Garth Isaak Star Avoiding Ramsey Numbers #12

  4. Diagonal Ramsey Numbers in Multipartite Graphs

    E-Print Network [OSTI]

    van Vuuren, Jan H.

    Diagonal Ramsey Numbers in Multipartite Graphs AP Burger , PJP Grobler , EH Stipp & JH van Vuuren September 17, 2003 Abstract The notion of a graph theoretic Ramsey number is generalised by assuming definition. Some small multipartite Ramsey numbers are found, while upper and lower bounds are established

  5. Diagonal Ramsey Numbers in Multipartite Graphs

    E-Print Network [OSTI]

    van Vuuren, Jan H.

    Diagonal Ramsey Numbers in Multipartite Graphs AP Burger + , PJP Grobler # , EH Stipp # & JH van Vuuren # September 17, 2003 Abstract The notion of a graph theoretic Ramsey number is generalised as in the classical definition. Some small multipartite Ramsey numbers are found, while upper and lower bounds

  6. Number of peer-reviewed publications

    E-Print Network [OSTI]

    ·Number of peer- reviewed publications produced per year ·Data accurate as of 02 April 2012 · Number of publications produced per institution (top 10) ·Collaborations counted multiple times · Non-cumulative number of citations received by OER publications per year ·Data accurate as of 02 April 2012 · The work

  7. Company number 5857955 Wellcome Trust Finance plc

    E-Print Network [OSTI]

    Rambaut, Andrew

    Company number 5857955 Wellcome Trust Finance plc Annual Report and Financial Statements Year ended 30 September 2014 #12;Company number 5857955 Wellcome Trust Finance plc Contents Page Strategic number 58579551 Wellcome Trust Finance plc Strategic Report For the year ended 30 September 2014

  8. KIAS SEOUL, February 2004 Transcendental Number Theory

    E-Print Network [OSTI]

    Waldschmidt, Michel

    ) ­ Introductio in Analysin Infinitorum. Suggests the transcendence of log 1/ log 2 when this number is irrational in Analysin Infinitorum. Suggests the transcendence of log 1/ log 2 when this number is irrational (for this number is irrational (for algebraic 1 and 2). http://www.math.jussieu.fr/miw/ 14 #12;Euler (1748

  9. Number Theory I: Tools and Diophantine Equations

    E-Print Network [OSTI]

    Cohen, Henri

    covered by two other books of the author [Coh0] and [Coh1]. The central (although not unique) theme in integers, rational numbers, or more generally in algebraic numbers. This theme is in particular the central of the reader that he or she is familiar with the standard basic theory of number fields, up to and including

  10. Clar number of catacondensed benzenoid hydrocarbons

    E-Print Network [OSTI]

    Klavzar, Sandi

    Clar number of catacondensed benzenoid hydrocarbons Sandi KlavŸzar a,# , Petra Ÿ Zigert a , Ivan hydrocarbon: CL is equal to the minimum number of straight lines required to intersect all hexagons theory; Clar formula; Clar number; Resonance graph; Benzenoid hydrocarbons 1. Introduction Within

  11. Outline History Basic Theory Research Future Accelerators References Brief Overview of Wakefield

    E-Print Network [OSTI]

    Budker, Dmitry

    Outline History Basic Theory Research Future Accelerators References Brief Overview of Wakefield Overview of Wakefield Acceleration #12;Outline History Basic Theory Research Future Accelerators References of Wakefield Acceleration #12;Outline History Basic Theory Research Future Accelerators References Wakefield

  12. Introduction Luminance and Chrominance High Frequency Content References Smoke Detection in Stationary Video Using

    E-Print Network [OSTI]

    Knaust, Helmut

    Introduction Luminance and Chrominance High Frequency Content References Smoke Detection and Chrominance High Frequency Content References The Problem The Problem: VIDEO: #12;Introduction Luminance and Chrominance High Frequency Content References Fire/Smoke Detection Techniques Standard techniques for fire

  13. Learning user modelling strategies for adaptive referring expression generation in spoken dialogue systems 

    E-Print Network [OSTI]

    Janarthanam, Srinivasan Chandrasekaran

    2011-06-30

    We address the problem of dynamic user modelling for referring expression generation in spoken dialogue systems, i.e how a spoken dialogue system should choose referring expressions to refer to domain entities to users ...

  14. Library and Information Services Division Current References 2008-2

    E-Print Network [OSTI]

    Library and Information Services Division Current References 2008-2 (Rev. August 2012) National Oceanographic Data Center Publications and Products in the NOAA Central Library Network, 1961-2012 A Bibliography Prepared by Anna Fiolek with contribution from Chris Belter NOAA Central Library 1315 East

  15. Library and Information Services Division Current References 2008-2

    E-Print Network [OSTI]

    Library and Information Services Division Current References 2008-2 National Oceanographic Data, and Information Service National Oceanographic Data Center NOAA Central Library November 2008, Rev. September 2009 Center Publications and Products in the NOAA Central Library Network, 1961-Present A Bibliography

  16. Library and Information Services Division Current References 2008-2

    E-Print Network [OSTI]

    Library and Information Services Division Current References 2008-2 (Revised, May 2015) National Oceanographic Data Center Publications and Products in the NOAA Central Library Network, 1961-2015 A Bibliography Prepared by Anna Fiolek and Chris Belter NOAA Central Library 1315 East-West Highway, Silver

  17. A Reference Architecture for Mobile Code Offload in Hostile Environments

    E-Print Network [OSTI]

    Satyanarayanan, Mahadev "Satya"

    , glewis, ejm}@sei.cmu.edu {krha, satya}@cs.cmu.edu Abstract. Handheld mobile technology is reaching firstA Reference Architecture for Mobile Code Offload in Hostile Environments Soumya Simanta,1 Kiryonh language processing, decision making, and mission planning. However, these applications are computation

  18. Environmental Guidance Program Reference Book: American Indian Religious Freedom Act

    SciTech Connect (OSTI)

    Not Available

    1987-11-01

    This Reference Book contains a copy of the American Indian Religious Freedom Act and guidance for DOE compliance with the statute. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Updates that include important new requirements will be provided periodically.

  19. Creating a Professional Portfolio Ready ReferenceE-12

    E-Print Network [OSTI]

    Creating a Professional Portfolio Ready ReferenceE-12 College of Engineering, Architecture & Technology Career Services Portfolios aren't just for artists anymore. Long regarded as an essential job effort and time. The Low and High Tech Alternatives You may design a high tech or low tech portfolio

  20. Researching a Company Online Ready Reference D-13

    E-Print Network [OSTI]

    Researching a Company Online Ready Reference D-13 College of Engineering, Architecture & Technology information on over 50,000 public and private companies (www.hoovers.com). · CorpTech Database of High and private high-tech organizations (www.corptech.com). · Companies Online from Dun & Bradstreet and Lycos

  1. Reference Radiation for Cosmic Rays in RBE Research 

    E-Print Network [OSTI]

    Feng, Shaoyong

    2011-10-21

    effectiveness relative to a specific radiation is usually used. For low energy heavy ions and neutrons 250 keV photons are usually used for the reference radiation but their depth dose distribution is very different from that for cosmic rays. In this research...

  2. Technical Reference on Hydrogen Compatibility of Materials Austenitic Stainless Steels

    E-Print Network [OSTI]

    Siefert, Chris

    and corrosion resistance. Type 304 stainless steel is, however, susceptible to strain- induced martensitic in austenitic stainless steels, a' martensite, is associated with lower resistance to hydrogen embrittlementTechnical Reference on Hydrogen Compatibility of Materials Austenitic Stainless Steels: Type 304

  3. Reference wind farm selection for regional wind power prediction models

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Reference wind farm selection for regional wind power prediction models Nils Siebert George.siebert@ensmp.fr, georges.kariniotakis@ensmp.fr Abstract Short-term wind power forecasting is recognized today as a major requirement for a secure and economic integration of wind generation in power systems. This paper deals

  4. Wind Energy Learning Curves for Reference in Expert Elicitations

    E-Print Network [OSTI]

    Mountziaris, T. J.

    Wind Energy Learning Curves for Reference in Expert Elicitations Sarah Mangels, Erin Baker. Abstract: This study presents future projections of wind energy capacity and cost based on historical data. The study will be used during wind- energy expert elicitations (formal interviews aimed to quantify

  5. Reference: RGL 84-07 Subject: MAPPING PIPELINES

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Reference: RGL 84-07 Subject: MAPPING PIPELINES Title: CHARTING OF PIPELINES AND CABLES Issued: 05/01/84 Expires: 12/31/86 Originator: DAEN-CWO-N Description: REQUIRES MAPPING OF PIPELINE CROSSINGS ON NAUTICAL and pipeline crossings on nautical charts published by the Government. This policy is contained in 33 CFR 209

  6. Technical Reference Compilation and Review of Data Standards

    E-Print Network [OSTI]

    Technical Reference Compilation and Review of Data Standards and Application to the Genomes to Life for the Genomes to Life Program Document 2: Compilation of Data Standards for Proteomic and Transcriptomic Experimental Data Document 3: Compilation of Data Formats and XMLs Applicable to Scientific and Analytical Data

  7. User's and Programmer's Reference One-Button Power Measurements

    E-Print Network [OSTI]

    Anlage, Steven

    Spectrum Analyzers Refer to Volume 1 for core spectrum analyzer information. This manual provides Updates: http://www.agilent.com/find/emailupdates · Information on preventing spectrum analyzer damage can Documentation is updated periodically. · For the latest information about Agilent Technologies PSA Spectrum

  8. User's/Programmer's Reference Core Spectrum Analyzer Functions

    E-Print Network [OSTI]

    Anlage, Steven

    User's/Programmer's Reference Volume 1 Core Spectrum Analyzer Functions ESA Series Spectrum. For the latest information about Agilent Technologies ESA Spectrum Analyzers, including firmware upgrades and used under license. NOTE If the ESA Spectrum Analyzer experiences a rapid "power down / power up

  9. Reference-Free Comparative Genomics of 174 Chloroplasts

    E-Print Network [OSTI]

    Reference-Free Comparative Genomics of 174 Chloroplasts Chai-Shian Kua1,2 , Jue Ruan3 , John's Republic of China, 3 The CAS Key Laboratory of Genome Science and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, People's Republic of China, 4 Department of Biological

  10. Finance Committee Terms of Reference, Membership and Operating Procedures

    E-Print Network [OSTI]

    Botea, Adi

    95/2012 Finance Committee ­ Terms of Reference, Membership and Operating Procedures Principles 1 on, or pose any reasonable risk to, the University's finances and operations" section 18(4)(d). 3. Council has established a Finance Committee as a committee of Council. 4. The broad purpose of the Finance

  11. Request for Reference Department of Chemistry and Biochemistry

    E-Print Network [OSTI]

    de Lijser, Peter

    Request for Reference Department of Chemistry and Biochemistry Phone: (657) 278-3621 / Fax: (657 of Interest: Analytical Inorganic Organic Physical Biochemistry OPTIONAL: I hereby waive my right with your letter to: Graduate Program Adviser, Department of Chemistry & Biochemistry, California State

  12. Shape Recipes: Scene Representations that Refer to the Image

    E-Print Network [OSTI]

    Torralba, Antonio

    Shape Recipes: Scene Representations that Refer to the Image William T. Freeman and Antonio- resentation, called a scene recipe, that relies on the image itself to de- scribe the complex scene configurations. Shape recipes are an example: these are the regression coefficients that predict the bandpassed

  13. A Configurable Reference Modelling Language1 M. Rosemanna

    E-Print Network [OSTI]

    van der Aalst, Wil

    , Configuration, Event-driven Process Chains 1 This research project is financially supported by SAP Corporate reference models "just" depict the possible system capabilities and cannot sufficiently guide the project, Eindhoven, The Netherlands, w.m.p.v.d.aalst@tm.tue.nl Abstract Enterprise Systems (ES) are comprehensive off

  14. Constraint Management in Fuel Cells: A Fast Reference Governor Approach

    E-Print Network [OSTI]

    Stefanopoulou, Anna

    admissible current demand to the fuel cell based on on-line optimization of a scalar parameter and onConstraint Management in Fuel Cells: A Fast Reference Governor Approach Ardalan Vahidi Ilya Kolmanovsky Anna Stefanopoulou Abstract-- The air supply system in a fuel cell may be susceptible

  15. EGS Abstract for MEAN RADIUS, MASS AND INERTIA FOR REFERENCE

    E-Print Network [OSTI]

    EGS Abstract for Nice, 2000 MEAN RADIUS, MASS AND INERTIA FOR REFERENCE EARTH'S MODELS. F. CHAMBAT between real and mean Earth. Abstracts to be submitted on or before December 15, 1999 to EGS OÆce Max-Planck-Str. 13 37191 Katlenburg-Lindau Germany Tel.: [+49] 5556-1440 Fax.: [+49] 5556-4709 Email: EGS

  16. QUICK REFERENCE: Nexis service 5.1 July 2006

    E-Print Network [OSTI]

    off as many as you need. 4. Enter a search term. 5. Click on red search button. Quick ReferenceIndexing TechnologyTM in your search. 3. Search using "Terms and Connectors" or "Natural Language." Choose your preference at the top of the form. 4. Enter your keywords or phrases. 5. To refine search, click on Add

  17. Component-Level Demonstration of a Microfabricated Atomic Frequency Reference

    E-Print Network [OSTI]

    Popovic, Zoya

    size and lower power dissipation. In particular, atomic clocks based on coherent population trappingComponent-Level Demonstration of a Microfabricated Atomic Frequency Reference V. Gerginov, S component-level functionality of the three critical subsystems for a miniature atomic clock based

  18. Unit References Module 1: The Science of Climate Change

    E-Print Network [OSTI]

    Smith, Kate

    164 Unit References Module 1: The Science of Climate Change 1. Intergovernmental Panel on Climate Change. (2007). Climate change 2007: synthesis report. IPCC Plenary XXVII (Valencia, Spain, 12-17 November 2007). 2. America's Climate Choices: Panel on Advancing the Science of Climate Change, National

  19. Technical Reference on Hydrogen Compatibility of Materials Polymers (code 8100)

    E-Print Network [OSTI]

    Siefert, Chris

    Technical Reference on Hydrogen Compatibility of Materials Nonmetals: Polymers (code 8100) Prepared of Materials Nonmetals: Polymers (code 8100) 1. General Polymers are a diverse category of materials be processed in numerous ways with almost infinite variation. The properties of polymers are determined

  20. Thermal Evolution Models for the Valles Caldera with Reference...

    Open Energy Info (EERE)

    by commercial interests seeking hydrothermal resources. In addition, a number of test wells have been drilled just outside the calderas west margin by the Los Alamos...