National Library of Energy BETA

Sample records for reduced lignin content

  1. Expression of a bacterial 3-dehydroshikimate dehydratase reduces lignin content and improves biomass saccharification efficiency

    SciTech Connect (OSTI)

    Eudes, Aymerick; Sathitsuksanoh, Noppadon; Baidoo, Edward E. K.; George, Anthe; Liang, Yan; Yang, Fan; Singh, Seema; Keasling, Jay D.; Simmons, Blake A.; Loqué, Dominique

    2015-01-13

    Lignin confers recalcitrance to plant biomass used as feedstocks in agro-processing industries or as source of renewable sugars for the production of bioproducts. The metabolic steps for the synthesis of lignin building blocks belong to the shikimate and phenylpropanoid pathways. Genetic engineering efforts to reduce lignin content typically employ gene knockout or gene silencing techniques to constitutively repress one of these metabolic pathways. Recently, new strategies have emerged offering better spatiotemporal control of lignin deposition, including the expression of enzymes that interfere with the normal process for cell wall lignification. In this study, we report that expression of a 3-dehydroshikimate dehydratase (QsuB from Corynebacterium glutamicum) reduces lignin deposition in Arabidopsis cell walls. QsuB was targeted to the plastids to convert 3-dehydroshikimate – an intermediate of the shikimate pathway – into protocatechuate. Compared to wild-type plants, lines expressing QsuB contain higher amounts of protocatechuate, p-coumarate, p-coumaraldehyde and p-coumaryl alcohol, and lower amounts of coniferaldehyde, coniferyl alcohol, sinapaldehyde and sinapyl alcohol. 2D-NMR spectroscopy and pyrolysis-gas chromatography/mass spectrometry (pyro-GC/MS) reveal an increase of p-hydroxyphenyl units and a reduction of guaiacyl units in the lignin of QsuB lines. Size-exclusion chromatography indicates a lower degree of lignin polymerization in the transgenic lines. Therefore, our data show that the expression of QsuB primarily affects the lignin biosynthetic pathway. Finally, biomass from these lines exhibits more than a twofold improvement in saccharification efficiency. We conclude that the expression of QsuB in plants, in combination with specific promoters, is a promising gain-of-function strategy for spatiotemporal reduction of lignin in plant biomass.

  2. Expression of a bacterial 3-dehydroshikimate dehydratase reduces lignin content and improves biomass saccharification efficiency

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Eudes, Aymerick; Sathitsuksanoh, Noppadon; Baidoo, Edward E. K.; George, Anthe; Liang, Yan; Yang, Fan; Singh, Seema; Keasling, Jay D.; Simmons, Blake A.; Loqué, Dominique

    2015-01-13

    Lignin confers recalcitrance to plant biomass used as feedstocks in agro-processing industries or as source of renewable sugars for the production of bioproducts. The metabolic steps for the synthesis of lignin building blocks belong to the shikimate and phenylpropanoid pathways. Genetic engineering efforts to reduce lignin content typically employ gene knockout or gene silencing techniques to constitutively repress one of these metabolic pathways. Recently, new strategies have emerged offering better spatiotemporal control of lignin deposition, including the expression of enzymes that interfere with the normal process for cell wall lignification. In this study, we report that expression of a 3-dehydroshikimatemore » dehydratase (QsuB from Corynebacterium glutamicum) reduces lignin deposition in Arabidopsis cell walls. QsuB was targeted to the plastids to convert 3-dehydroshikimate – an intermediate of the shikimate pathway – into protocatechuate. Compared to wild-type plants, lines expressing QsuB contain higher amounts of protocatechuate, p-coumarate, p-coumaraldehyde and p-coumaryl alcohol, and lower amounts of coniferaldehyde, coniferyl alcohol, sinapaldehyde and sinapyl alcohol. 2D-NMR spectroscopy and pyrolysis-gas chromatography/mass spectrometry (pyro-GC/MS) reveal an increase of p-hydroxyphenyl units and a reduction of guaiacyl units in the lignin of QsuB lines. Size-exclusion chromatography indicates a lower degree of lignin polymerization in the transgenic lines. Therefore, our data show that the expression of QsuB primarily affects the lignin biosynthetic pathway. Finally, biomass from these lines exhibits more than a twofold improvement in saccharification efficiency. We conclude that the expression of QsuB in plants, in combination with specific promoters, is a promising gain-of-function strategy for spatiotemporal reduction of lignin in plant biomass.« less

  3. Modification of lignin content and composition in plants

    DOE Patents [OSTI]

    Ye, Zheng-Hua (Athens, GA)

    2002-01-01

    Plants and methods of preparing plants having reduced lignin content and/or altered lignin composition are provided. The activities of caffeoyl-CoA O-methyltransferase and/or caffeic acid O-methyltransferase enzymes in the modified plants are reduced.

  4. Plants with modified lignin content and methods for production thereof

    SciTech Connect (OSTI)

    Zhao, Qiao; Chen, Fang; Dixon, Richard A.

    2014-08-05

    The invention provides methods for decreasing lignin content and for increasing the level of fermentable carbohydrates in plants by down-regulation of the NST transcription factor. Nucleic acid constructs for down-regulation of NST are described. Transgenic plants are provided that comprise reduced lignin content. Plants described herein may be used, for example, as improved biofuel feedstock and as highly digestible forage crops. Methods for processing plant tissue and for producing ethanol by utilizing such plants are also provided.

  5. Transcription factors for modification of lignin content in plants

    SciTech Connect (OSTI)

    Wang, Huanzhong; Chen, Fang; Dixon, Richard A.

    2015-06-02

    The invention provides methods for modifying lignin, cellulose, xylan, and hemicellulose content in plants, and for achieving ectopic lignification and, for instance, secondary cell wall synthesis in pith cells, by altered regulation of a WRKY transcription factor. Nucleic acid constructs for altered WRKY-TF expression are described. Transgenic plants are provided that comprise modified pith cell walls, and lignin, cellulose, and hemicellulose content. Plants described herein may be used, for example, as improved biofuel feedstock and as highly digestible forage crops.

  6. Modification of Lignin Content of Plant Cell Walls - Energy Innovation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Portal Biomass and Biofuels Biomass and Biofuels Find More Like This Return to Search Modification of Lignin Content of Plant Cell Walls Brookhaven National Laboratory Contact BNL About This Technology Publications: PDF Document Publication Engineering Monolignol 4-O-Methyltransferases to Modulate Lignin Biosynthesis (4,477 KB) Technology Marketing Summary The use of woody biomass for the energy-effective production of biofuels is challenged by the difficulties encountered in breaking down

  7. New Way to Reduce Plant Lignin Could Lead to Cheaper Biofuels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New Way to Reduce Plant Lignin Could Lead to Cheaper Biofuels

  8. Lignin nanoparticle synthesis

    DOE Patents [OSTI]

    Dirk, Shawn M.; Cicotte, Kirsten Nicole; Wheeler, David R.; Benko, David A.

    2015-08-11

    A method including reducing a particle size of lignin particles to an average particle size less than 40 nanometers; after reducing the particle size, combining the lignin particles with a polymeric material; and forming a structure of the combination. A method including exposing lignin to a diazonium precursor including a functional group; modifying the lignin by introducing the functional group to the lignin; and combining the modified lignin with a polymeric material to form a composite. An apparatus including a composite of a polymer and lignin wherein the lignin has an average particle size less than 100 micrometers.

  9. Modulating lignin in plants

    DOE Patents [OSTI]

    Apuya, Nestor; Bobzin, Steven Craig; Okamuro, Jack; Zhang, Ke

    2013-01-29

    Materials and methods for modulating (e.g., increasing or decreasing) lignin content in plants are disclosed. For example, nucleic acids encoding lignin-modulating polypeptides are disclosed as well as methods for using such nucleic acids to generate transgenic plants having a modulated lignin content.

  10. Biologically produced acid precipitable polymeric lignin

    DOE Patents [OSTI]

    Crawford, Don L. (Moscow, ID); Pometto, III, Anthony L. (Moscow, ID)

    1984-01-01

    A water soluble, acid precipitable polymeric degraded lignin (APPL), having a molecular weight of at least 12,000 daltons, and comprising, by percentage of total weight, at least three times the number of phenolic hydroxyl groups and carboxylic acid groups present in native lignin. The APPL may be modified by chemical oxidation and reduction to increase its phenolic hydroxyl content and reduce the number of its antioxidant inhibitory side chains, thereby improving antioxidant properties.

  11. High-throughput prediction of Acacia and eucalypt lignin syringyl/guaiacyl content using FT-Raman spectroscopy and partial least squares modeling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lupoi, Jason S.; Healey, Adam; Singh, Seema; Sykes, Robert; Davis, Mark; Lee, David J.; Shepherd, Merv; Simmons, Blake A.; Henry, Robert J.

    2015-01-16

    High-throughput techniques are necessary to efficiently screen potential lignocellulosic feedstocks for the production of renewable fuels, chemicals, and bio-based materials, thereby reducing experimental time and expense while supplanting tedious, destructive methods. The ratio of lignin syringyl (S) to guaiacyl (G) monomers has been routinely quantified as a way to probe biomass recalcitrance. Mid-infrared and Raman spectroscopy have been demonstrated to produce robust partial least squares models for the prediction of lignin S/G ratios in a diverse group of Acacia and eucalypt trees. The most accurate Raman model has now been used to predict the S/G ratio from 269 unknown Acaciamore » and eucalypt feedstocks. This study demonstrates the application of a partial least squares model composed of Raman spectral data and lignin S/G ratios measured using pyrolysis/molecular beam mass spectrometry (pyMBMS) for the prediction of S/G ratios in an unknown data set. The predicted S/G ratios calculated by the model were averaged according to plant species, and the means were not found to differ from the pyMBMS ratios when evaluating the mean values of each method within the 95 % confidence interval. Pairwise comparisons within each data set were employed to assess statistical differences between each biomass species. While some pairwise appraisals failed to differentiate between species, Acacias, in both data sets, clearly display significant differences in their S/G composition which distinguish them from eucalypts. In conclusion, this research shows the power of using Raman spectroscopy to supplant tedious, destructive methods for the evaluation of the lignin S/G ratio of diverse plant biomass materials.« less

  12. Reducing the moisture content of clean coals

    SciTech Connect (OSTI)

    Kehoe, D. )

    1992-12-01

    Coal moisture content can profoundly effect the cost of burning coal in utility boilers. Because of the large effect of coal moisture, the Empire State Electric Energy Research Corporation (ESEERCO) contracted with the Electric Power Research Institute to investigate advanced coal dewatering methods at its Coal Quality Development Center. This report contains the test result on the high-G solid-bowl centrifuge, the second of four devices to be tested. The high-G solid-bowl centrifuge removes water for coal by spinning the coal/water mixture rapidly in a rotating bowl. This causes the coal to cling to the sides of the bowl where it can be removed, leaving the water behind. Testing was performed at the CQDC to evaluate the effect of four operating variables (G-ratio, feed solids concentration, dry solids feed rate, and differential RPM) on the performance of the high-G solid-bowl centrifuge. Two centrifuges of different bowl diameter were tested to establish the effect of scale-up of centrifuge performance. Testing of the two centrifuges occurred from 1985 through 1987. CQDC engineers performed 32 tests on the smaller of the two centrifuges, and 47 tests on the larger. Equations that predict the performance of the two centrifuges for solids recovery, moisture content of the produced coal, and motor torque were obtained. The equations predict the observed data well. Traditional techniques of establishing the performance of centrifuge of different scale did not work well with the two centrifuges, probably because of the large range of G-ratios used in the testing. Cost of operating a commercial size bank of centrifuges is approximately $1.72 per ton of clean coal. This compares well with thermal drying, which costs $1.82 per ton of clean coal.

  13. Structural Transformation of Isolated Poplar and Switchgrass Lignins from Dilute Acid Pretreatment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sun, Qining; Pu, Yunqiao; Meng, Xianzhi; Wells, Tyrone; Ragauskas, Arthur J.

    2015-08-27

    A key step in conversion of cellulosic biomass into sustainable fuels and chemicals is thermochemical pretreatment to reduce plant cell wall recalcitrance. Obtaining an improved understanding of the fundamental chemistry of lignin, the most recalcitrant component of biomass, during pretreatment is critical to the continued development of renewable biofuel production. To examine the intrinsic chemistry of lignin during dilute acid pretreatment (DAP), lignin was isolated from poplar and switchgrass using a cellulolytic enzyme system and then treated under DAP conditions. These results highlight that lignin is subjected to depolymerization reactions within the first 2 min of dilute acid pretreatment andmore » these changes are accompanied by increased generation of aliphatic and phenolic hydroxyl groups of lignin. This is followed by a competing set of depolymerization and repolymerization reactions that lead to a decrease in the content of guaiacyl lignin units and an increase in condensed lignin units as the reaction residence time is extended beyond 5 min. Finally, we showed that a detailed comparison of changes in functional groups and molecular weights of cellulolytic enzyme lignins with different structural parameters, related to the recalcitrant properties of lignin, could be successfully altered during DAP conditions.« less

  14. Structural Transformation of Isolated Poplar and Switchgrass Lignins from Dilute Acid Pretreatment

    SciTech Connect (OSTI)

    Sun, Qining; Pu, Yunqiao; Meng, Xianzhi; Wells, Tyrone; Ragauskas, Arthur J.

    2015-08-27

    A key step in conversion of cellulosic biomass into sustainable fuels and chemicals is thermochemical pretreatment to reduce plant cell wall recalcitrance. Obtaining an improved understanding of the fundamental chemistry of lignin, the most recalcitrant component of biomass, during pretreatment is critical to the continued development of renewable biofuel production. To examine the intrinsic chemistry of lignin during dilute acid pretreatment (DAP), lignin was isolated from poplar and switchgrass using a cellulolytic enzyme system and then treated under DAP conditions. These results highlight that lignin is subjected to depolymerization reactions within the first 2 min of dilute acid pretreatment and these changes are accompanied by increased generation of aliphatic and phenolic hydroxyl groups of lignin. This is followed by a competing set of depolymerization and repolymerization reactions that lead to a decrease in the content of guaiacyl lignin units and an increase in condensed lignin units as the reaction residence time is extended beyond 5 min. Finally, we showed that a detailed comparison of changes in functional groups and molecular weights of cellulolytic enzyme lignins with different structural parameters, related to the recalcitrant properties of lignin, could be successfully altered during DAP conditions.

  15. Lignin | Open Energy Information

    Open Energy Info (EERE)

    Lignin Jump to: navigation, search Lignin.jpg What is Lignin? Lignin is the fiber in our food, the thing that makes vegetables crunchy and firm. It is a polymer found extensively...

  16. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, Donald L. (Moscow, ID); Ramachandra, Muralidhara (Moscow, ID)

    1993-01-01

    A newly discovered lignin peroxidase enzyme is provided. The enzyme is obtained from a bacterial source and is capable of degrading the lignin portion of lignocellulose in the presence of hydrogen peroxide. The enzyme is extracellular, oxidative, inducible by lignin, larch wood xylan, or related substrates and capable of attacking certain lignin substructure chemical bonds that are not degradable by fungal lignin peroxidases.

  17. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, Donald L. (Moscow, ID); Ramachandra, Muralidhara (Wilmington, DE)

    1993-01-01

    DNA constructs are provided for the production of Streptomyces lignin peroxidase. The enzyme finds use in the degradation of lignin and oxidation of organic substrates.

  18. Bacterial extracellular lignin peroxidase

    DOE Patents [OSTI]

    Crawford, D.L.; Ramachandra, M.

    1993-08-03

    DNA constructs are provided for the production of Streptomyces lignin peroxidase. The enzyme finds use in the degradation of lignin and oxidation of organic substrates.

  19. Process for production of synthesis gas with reduced sulfur content

    DOE Patents [OSTI]

    Najjar, Mitri S. (Hopewell Junction, NY); Corbeels, Roger J. (Wappingers Falls, NY); Kokturk, Uygur (Wappingers Falls, NY)

    1989-01-01

    A process for the partial oxidation of a sulfur- and silicate-containing carbonaceous fuel to produce a synthesis gas with reduced sulfur content which comprises partially oxidizing said fuel at a temperature in the range of 1800.degree.-2200.degree. F. in the presence of a temperature moderator, an oxygen-containing gas and a sulfur capture additive which comprises an iron-containing compound portion and a sodium-containing compound portion to produce a synthesis gas comprising H.sub.2 and CO with a reduced sulfur content and a molten slag which comprises (i) a sulfur-containing sodium-iron silicate phase and (ii) a sodium-iron sulfide phase. The sulfur capture additive may optionally comprise a copper-containing compound portion.

  20. Hydrotreating Pyrolytic Lignin to Produce a Refinery Feedstock (Poster)

    SciTech Connect (OSTI)

    French, R. J.

    2013-09-01

    Fast pyrolysis of biomass followed by water separation to produce pyrolytic lignin and hydrotreating of the lignin could be used to produce a stable volatile low-oxygen intermediate liquid. Such a liquid could be converted into a finished motor-fuel in a refinery, taking advantage of the existing infrastructure and economies of scale of refineries. Hydrotreating just the lignin would consume less hydrogen while preserving about half of the energy of the original oil. The aqueous by-products could be reformed to produce the needed hydrogen and would contain much of the unwanted acids and unstable oxygenates. To assess such intermediate liquids, several pyrolytic lignins were prepared by mixing pyrolysis oil with water at 1:1 and 3:1 ratios. The carboxylic acidity in the pyrolytic lignin was reduced to 24 and 10 mg-KOH/g-lignin compared to 81 in the whole oil. These lignins were hydrotreated using Ni-Mo(S)/alumina, Pt/char, or Pd/C(activated) in a semi-batch 1 L stirred autoclave. The oil was stabilized under hydrogen at 150-280 degrees C, then water and light organics were removed by partial depressurization. Hydrodeoxygenation was then performed at 340-400 degrees C. Total pressure was controlled at 70 or 170 bar with hydrogen gas. Organic liquid yields of 39-56% were obtained. For many experiments the organic oxygen content was <7%, acidity was < 7 mg-KOH/g-oil, the volatility was greater than or equal to 94% and, on a carbon basis, the total yield of organic products miscible in hydrocarbons at a 1:10 ratio was over 50%. These properties are probably acceptable to a refinery.The residual liquids left in the reactor at the end of the experiment comprised 60-85% of the organic-phase product while the rest was condensate. 13C-NMR of the residual liquids showed that they were 50-80% aliphatic. 13C-NMR coupled with GC-MS identified phenolic compounds as the main oxygenates in most residual liquids.

  1. Economic contribution of lignins to ethanol production from biomass

    SciTech Connect (OSTI)

    Chum, H.L.; Parker, S.K.; Feinberg, D.A.; Wright, J.D.; Rice, P.A.; Sinclair, S.A.; Glasser, W.G.

    1985-05-01

    Lignin, one of the three major polymeric components of biomass (16% to 33% by weight in wood), has the highest specific heat content. Therefore, it can be burned for process fuel. Compared to coal, its fuel value is 2.2 cents/lb. This report investigates markets for lignin utilization of higher value. After lignin isolation from the process, purchase of replacement fuel (coal was analyzed), lignin sale for the manufacture of solid materials or higher value octane enhancers was evaluated. Polymeric applications evaluated were: surfactants, asphalt, carbon black, adhesives, and lignin plastics; agricultural applications were briefly reviewed. These lignins would generate coproduct credits of 25 cents to 150 cents/gallon of ethanol respectively for 7.5 cents to 60 cents/lb lignin value (isolation and eventual modification costs were taken into account). Overall markets for these polymeric applications were projected at 11 billion lb/year by the year 2000. These projections are intensities of demand and not actual shipments of lignins. In addition, this report investigates the possibility of converting lignins into mixtures of methyls aryl ethers and methyl substituted-aryl ethers which are high value octane enhancers, fully compatible with gasoline. The report intends to show that if fuel ethanol production in the billions of gallons scale occurs lignin markets would not be saturated. 10 refs., 14 figs., 36 tabs.

  2. p-Hydroxyphenyl (H) Units Lower the Degree of Polymerization in Lignin: Chemical Control in Lignin Biosynthesis

    SciTech Connect (OSTI)

    Sangha, A. K.; Parks, J. M.; Davis, M. F.; Smith, J. C.

    2013-01-01

    Lignin, composed predominantly of p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S) subunits, is a major component of plant cell walls that imparts resistance toward chemical and microbial deconstruction of plant biomass, rendering its conversion inefficient and costly. Previous studies have shown that alterating lignin composition, i.e., the relative abundance of H, G and S subunits, promises more efficient extraction of sugars from plant biomass. Smaller and less branched lignin chains are more easily extracted during pretreatment, making cellulose more readily degradable. Here, using density functional theory calculations, we show that the incorporation of H subunits into lignin via b-b and b-5 interunit linkages reduces the degree of polymerization in lignin. Frontier molecular orbital analyses of lignin dimers and trimers show that H as a terminal subunit on a growing lignin polymer linked via b-b and b-5 linkage cannot undergo radical formation, preventing further chain growth by endwise polymerization resulting in lignin polymers with lower degree of polymerization. These results indicate that, for endwise polymerization in lignin synthesis, there exists a chemical control that may lay a significant role in determining the structure of lignin.

  3. Lignin Valorization-final-sm

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Discovering effective methods of depolymerizing lignin will improve economics of biorefineries and create a renewable resource for chemicals Biofuels: Increasing the Value of Lignin Lignin Valorization Current lignocellulose biomass conversion to biofuels requires the breakdown of lignin to liberate sugars that can be converted into advanced fuels. The process results in a significant amount of lignin waste product that could be utilized for other byproducts improving the economics for

  4. Fluorescence analyzer for lignin

    DOE Patents [OSTI]

    Berthold, John W. (Salem, OH); Malito, Michael L. (Hubbard, OH); Jeffers, Larry (Alliance, OH)

    1993-01-01

    A method and apparatus for measuring lignin concentration in a sample of wood pulp or black liquor comprises a light emitting arrangement for emitting an excitation light through optical fiber bundles into a probe which has an undiluted sensing end facing the sample. The excitation light causes the lignin concentration to produce fluorescent emission light which is then conveyed through the probe to analyzing equipment which measures the intensity of the emission light. Measures a This invention was made with Government support under Contract Number DOE: DE-FC05-90CE40905 awarded by the Department of Energy (DOE). The Government has certain rights in this invention.

  5. Catalytic Hydrolytic Cleavage and Oxy-Cleavage of Lignin Linkages

    SciTech Connect (OSTI)

    Xia, Guanguang; Chen, Baowei; Zhang, Rui; Zhang, Z. Conrad

    2014-07-26

    In this work, new strategies involving organic bases were evaluated to depolymerize lignin to reduced molecular fragments in aqueous medium. NaOH as an inorganic base was also investigated as a reference. Full nature lignin samples are used for the study. As research tools to unravel the complexity of the macro lignin structure and bulky molecular size under this study, size exclusion chromatography and high resolution mass spectrometric analysis, typically used for protein characterizations, were used to follow the progress of lignin depolymerisation by measuring the molecular weight distribution of the products and determining the key molecular fingerprints, respectively. The results show that sodium phenoxide and guanidine carbonate are effective catalysts for lignin depolymerization. It is observed that there exists a synergism between H2O2 and the organic base, which is strongest with guanidine carbonate.

  6. Lignin blockers and uses thereof

    DOE Patents [OSTI]

    Yang, Bin (West Lebanon, NH); Wyman, Charles E. (Norwich, VT)

    2011-01-25

    Disclosed is a method for converting cellulose in a lignocellulosic biomass. The method provides for a lignin-blocking polypeptide and/or protein treatment of high lignin solids. The treatment enhances cellulase availability in cellulose conversion and allows for the determination of optimized pretreatment conditions. Additionally, ethanol yields from a Simultaneous Saccharification and Fermentation process are improved 5-25% by treatment with a lignin-blocking polypeptide and/or protein. Thus, a more efficient and economical method of processing lignin containing biomass materials utilizes a polypeptide/protein treatment step that effectively blocks lignin binding of cellulase.

  7. Lignin blockers and uses thereof

    DOE Patents [OSTI]

    Yang, Bin; Wyman, Charles E

    2013-11-12

    Disclosed is a method for converting cellulose in a lignocellulosic biomass. The method provides for a lignin-blocking polypeptide and/or protein treatment of high lignin solids. The treatment enhances cellulase availability in cellulose conversion and allows for the determination of optimized pretreatment conditions. Additionally, ethanol yields from a Simultaneous Saccharification and Fermentation process are improved 5-25% by treatment with a lignin-blocking polypeptide and/or protein.

  8. Lignin Valorization-final-sm

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    route that uses a hydrogen donor solvent, rather than gaseous hydrogen for tandem depolymerization and hydrogenation of lignin to smaller molecules. The approach...

  9. Method for reducing the sulfur content of a sulfur-containing hydrocarbon stream

    DOE Patents [OSTI]

    Mahajan, Devinder

    2004-12-28

    The sulfur content of a liquid hydrocarbon stream is reduced under mild conditions by contracting a sulfur-containing liquid hydrocarbon stream with transition metal particles containing the transition metal in a zero oxidation state under conditions sufficient to provide a hydrocarbon product having a reduced sulfur content and metal sulfide particles. The transition metal particles can be produced in situ by adding a transition metal precursor, e.g., a transition metal carbonyl compound, to the sulfur-containing liquid feed stream and sonicating the feed steam/transition metal precursor combination under conditions sufficient to produce the transition metal particles.

  10. Functionalized lignin, rubber containing functionalized lignin and products containing such rubber composition

    DOE Patents [OSTI]

    Benko, David Andrew; Hahn, Bruce Raymond; Cohen, Martin Paul; Dirk, Shawn Matthew; Cicotte, Kirsten Nicole

    2014-03-04

    The invention relates to functionalized lignin, rubber compositions which contain functionalized lignin and to products which have at least one component comprised of such rubber composition.

  11. Lignin-assisted coal depolymerization

    SciTech Connect (OSTI)

    Lalvani, S.B.

    1991-01-01

    Previous research has shown that addition of lignin-derived liquids to coal stirred in tetralin under mild reaction conditions (375{degree}C and 300--500 psig) results in a marked enhancement in the rate of coal depolymerization. A mathematical model was developed to study the kinetics of coal depolymerization in the presence of liquid-derived liquids. In the present study, a reaction pathway was formulated to explain the enhancement in coal depolymerization due to lignin (solid) addition. The model postulated assumes that the products of lignin obtained during thermolysis interact with the reactive moieties present in coal while simultaneous depolymerization of coal occurs. A good fit between the experimental data and the kinetic model was found. The results show that in addition to the enhancement in the rate of coal depolymerization, lignin also reacts (and enhances the extent of depolymerization of coal) with those reaction sites in coal that are not susceptible to depolymerization when coal alone is reacted in tetralin under identical reaction conditions. Additional work is being carried out to determine a thorough materials balance on the lignin-assisted coal depolymerization process. A number of liquid samples have been obtained which are being studied for their stability in various environments. 5 refs., 4 figs., 1 tab.

  12. CONTENTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.0 - HOISTING AND RIGGING IN HOSTILE ENVIRONMENTS February 18, 2010 Rev 1 Page 1 CHAPTER 18.0 TABLE OF CONTENTS TABLE OF CONTENTS..................................................................................................................................1 PAGINATION TABLE.....................................................................................................................................1 18.0 HOISTING AND RIGGING IN HOSTILE ENVIRONMENTS

  13. Liquid Fuels from Lignins: Annual Report

    SciTech Connect (OSTI)

    Chum, H. L.; Johnson, D. K.

    1986-01-01

    This task was initiated to assess the conversion of lignins into liquid fuels, primarily of lignins relevant to biomass-to-ethanol conversion processes. The task was composed of a literature review of this area and an experimental part to obtain pertinent data on the conversion of lignins germane to biomass-to-ethanol conversion processes.

  14. Cationic electrodepositable coating composition comprising lignin

    DOE Patents [OSTI]

    Fenn, David; Bowman, Mark P; Zawacky, Steven R; Van Buskirk, Ellor J; Kamarchik, Peter

    2013-07-30

    A cationic electrodepositable coating composition is disclosed. The present invention in directed to a cationic electrodepositable coating composition comprising a lignin-containing cationic salt resin, that comprises (A) the reaction product of: lignin, an amine, and a carbonyl compound; (B) the reaction product of lignin, epichlorohydrin, and an amine; or (C) combinations thereof.

  15. Process for conversion of lignin to reformulated, partially oxygenated gasoline

    DOE Patents [OSTI]

    Shabtai, Joseph S. (Salt Lake City, UT); Zmierczak, Wlodzimierz W. (Salt Lake City, UT); Chornet, Esteban (Golden, CO)

    2001-01-09

    A high-yield process for converting lignin into reformulated, partially oxygenated gasoline compositions of high quality is provided. The process is a two-stage catalytic reaction process that produces a reformulated, partially oxygenated gasoline product with a controlled amount of aromatics. In the first stage of the process, a lignin feed material is subjected to a base-catalyzed depolymerization reaction, followed by a selective hydrocracking reaction which utilizes a superacid catalyst to produce a high oxygen-content depolymerized lignin product mainly composed of alkylated phenols, alkylated alkoxyphenols, and alkylbenzenes. In the second stage of the process, the depolymerized lignin product is subjected to an exhaustive etherification reaction, optionally followed by a partial ring hydrogenation reaction, to produce a reformulated, partially oxygenated/etherified gasoline product, which includes a mixture of substituted phenyl/methyl ethers, cycloalkyl methyl ethers, C.sub.7 -C.sub.10 alkylbenzenes, C.sub.6 -C.sub.10 branched and multibranched paraffins, and alkylated and polyalkylated cycloalkanes.

  16. CONTENTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.0 - CRITICAL, SPECIAL, & ENGINEERED LIFTS January 4, 2016 Rev 1 Page 1 CHAPTER 3.0 TABLE OF CONTENTS 3.0 CRITICAL LIFTS ....................................................................................................................................... 3 3.1 SCOPE .......................................................................................................................................................... 3 3.2 CRITICAL LIFT DETERMINATION

  17. Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; Dugard, Christopher K.; Held, Michael A.; Klimek, John F.; Shreve, Jacob T.; Fowler, Matthew; Ziebell, Angela; Davis, Mark F.; et al

    2014-06-27

    Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 x 3 Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yieldmore » was shared. A genome-wide association study for lignin abundance and sugar yield of the 282- member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. Finally, these results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass.« less

  18. Method of altering lignin in trees

    DOE Patents [OSTI]

    MacKay, J.; O`Malley, D.; Whetten, R.; Sederoff, R.

    1998-10-20

    Methods of providing and breeding trees having more easily extractable lignin due to the presence of a cinnamyl alcohol dehydrogenase (Cad) null gene are presented. 16 figs.

  19. Method of altering lignin in trees

    DOE Patents [OSTI]

    MacKay, John (Raleigh, NC); O'Malley, David (Cary, NC); Whetten, Ross (Raleigh, NC); Sederoff, Ronald (Raleigh, NC)

    1998-01-01

    Methods of providing and breeding trees having more easily extractable lignin due to the presence of a cinnamyl alcohol dehydrogenase (Cad) null gene are presented.

  20. Contents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Program and Book of Abstracts Contents Organizers i-ii Detailed Program iii-viii Oral presentations 1-38 Posters P1-P27 Program Schematic back cover The LAPD Symposium brings together scientists from laser physics, low- temperature plasma chemistry and physics, and nuclear fusion. The Symposium is an important, unique, and fruitful source for cross-fertilization between these fields. Major topics include laser-aided diagnostics for fusion plasmas, industrial process plasmas, and environmental

  1. Contents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8 August 2005 Contents Bechtel Nevada achieves 5 million hours! 1 WSI graduates fresh members of security 1 protective forces Handling radiation emergencies 2 SiteLines features a new editor 2 Rocky Flats survey 3 NTS Swift Water Rescue Team practices on the 3 Colorado River Drilling Program overcomes challenges at the NTS 3 Toastmasters: making effective communication a 4 worldwide reality Atomic Testing Museum update 4 Two more successful shots at JASPER 5 Hazardous Substance Inventory users 5

  2. Preparation of lithium-ion battery anodes using lignin (Journal...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Preparation of lithium-ion battery anodes using lignin Citation Details In-Document Search Title: Preparation of lithium-ion battery anodes using lignin Authors:...

  3. Novel seed coat lignins in the Cactaceae: structure, distribution...

    Office of Scientific and Technical Information (OSTI)

    evolution of lignin diversity Citation Details In-Document Search Title: Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of ...

  4. Contents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 June/July 2005 Contents Fires burn Nevada Test Site in June NNSA/NSO and Department of Homeland Security break ground at the Nevada Test Site U1h ribbon cutting marks the remarkable New training grounds dedicated at NTS Changes enhance the EAP Unicorn subcritical experiment completes key milestone New communication system takes flight SiteLines goes online DNFSB visits U1a Funnel clouds at the Nevada Test Site Community Environmental Monitor receives EPA award Take Our Daughters and Sons to

  5. Method for recovering and using lignin in adhesive resins by extracting demethylated lignin

    DOE Patents [OSTI]

    Schroeder, Herbert A.

    1991-01-01

    Lignin, or a lignin derived material, which has been significantly demethylated (e.g., the demethylated lignin found in the raffinate produced as a by-product of dimethyl sulfide production which can be carried out using the spent liquor from wood pulping operations) can be isolated by a process wherein an organic solvent is added to a lignin-containing aqueous solution. The organic solvent is typically a polar, and at least a partially water-immiscible substance such as, for example, ethyl acetate. The resulting lignin-containing aqueous solution/organic solvent mixture is acidified to produce a water layer which is discarded and an organic solvent layer which contains the demethylated lignin. Upon its recovery, the demethylated lignin is dissolved in an alkaline solution to which an aldehyde source is added to produce a resol-type resin. The aldehyde source may be formaldehyde in solution, paraformaldehyde, hexamethylenetetramine, or other aldehydes including acetaldehyde, furfural, and their derivatives.

  6. Method for recovering and using lignin in adhesive resins by extracting demethylated lignin

    DOE Patents [OSTI]

    Schroeder, Herbert A. (Ft. Collins, CO)

    1991-01-01

    Lignin, or a lignin derived material, which has been significantly demethylated (e.g., the demethylated lignin found in the raffinate produced as a by-product of dimethyl sulfide production which can be carried out using the spent liquor from wood pulping operations) can be isolated by a process wherein an organic solvent is added to a lignin-containing aqueous solution. The organic solvent is typically a polar, and at least a partially water-immiscible substance such as, for example, ethyl acetate. The resulting lignin-containing aqueous solution/organic solvent mixture is acidified to produce a water layer which is discarded and an organic solvent layer which contains the demethylated lignin. Upon its recovery, the demethylated lignin is preferably dried and stored until it is used (along with an alkali, an aldehyde and an adhesive filler) in compounding an adhesive of the type generally used in the manufacture of plywood.

  7. Bio-inspired MOF-based Catalysts for Lignin Valorization.

    SciTech Connect (OSTI)

    Allendorf, Mark D.; Stavila, Vitalie; Ramakrishnan, Parthasarathi; Davis, Ryan Wesley

    2014-09-01

    Lignin is a potentially plentiful source of renewable organics, with ~50Mtons/yr produced by the pulp/paper industry and 200-300 Mtons/yr projected production by a US biofuels industry. This industry must process approximately 1 billion tons of biomass to meet the US Renewable Fuel goals. However, there are currently no efficient processes for converting lignin to value-added chemicals and drop-in fuels. Lignin is therefore an opportunity for production of valuable renewable chemicals, but presents staggering technical and economic challenges due to the quantities of material involved and the strong chemical bonds comprising this polymer. Aggressive chemistries and high temperatures are required to degrade lignin without catalysts. Moreover, chemical non-uniformity among lignins leads to complex product mixtures that tend to repolymerize. Conventional petrochemical approaches (pyrolysis, catalytic cracking, gasification) are energy intensive (400-800 degC), require complicated separations, and remove valuable chemical functionality. Low-temperature (25-200 degC) alternatives are clearly desirable, but enzymes are thermally fragile and incompatible with liquid organic compounds, making them impractical for large-scale biorefining. Alternatively, homogeneous catalysts, such as recently developed vanadium complexes, must be separated from product mixtures, while many heterogenous catalysts involve costly noble metals. The objective of this project is to demonstrate proof of concept that an entirely new class of biomimetic, efficient, and industrially robust synthetic catalysts based on nanoporous Metal- Organic Frameworks (MOFs) can be developed. Although catalytic MOFs are known, catalysis of bond cleavage reactions needed for lignin degradation is completely unexplored. Thus, fundamental research is required that industry and most sponsoring agencies are currently unwilling to undertake. We introduce MOFs infiltrated with titanium and nickel species as catalysts for the C-O bond hydrogenolysis in model compounds, which mimic the b-O-4, a-O-4, and 4-O-5 linkages of natural lignin. The versatile IRMOF-74(n) series is proposed as a platform for creating efficient hydrogenolysis catalysts as it not only displays tunable pore sizes, but also has the required thermal and chemical stability. The catalytic C-O bond cleavage occurs at 10 bar hydrogen pressure and temperatures as low as 120 degC. The conversion efficiency of the aromatic ether substrates into the corresponding hydrocarbons and phenols varies as PhCH 2 CH 2 OPh > PhCH 2 OPh > PhOPh (Ph = phenyl), while the catalytic activity generally follows the following trend Ni%40IRMOF-74>Ti%40IRMOF-74>IRMOF-74. Conversions as high as 80%, coupled with good selectivity for hydrogenolysis vs. hydrogenation, highlight the potential of MOF-based catalysts for the selective cleavage of recalcitrant aryl-ether bonds found in lignin and other biopolymers. This project supports the DOE Integrated Biorefinery Program goals, the objective of which is to convert biomass to fuels and high-value chemicals, by addressing an important technology gap: the lack of low-temperature catalysts suitable for industrial lignin degradation. Biomass, which is ~30 wt% lignin, constitutes a potentially major source of platform chemicals that could improve overall profitability and productivity of all energy-related products, thereby benefiting consumers and reducing national dependence on imported oil. Additionally, DoD has a strong interest in low-cost drop-in fuels (Navy Biofuel Initiative) and has signed a Memorandum of Understanding with DOE and USDA to develop a sustainable biofuels industry.

  8. Method for regulation of plant lignin composition

    DOE Patents [OSTI]

    Chapple, Clint (West Lafayette, IN)

    1999-01-01

    A method is disclosed for the regulation of lignin composition in plant tissue. Plants are transformed with a gene encoding an active F5H gene. The expression of the F5H gene results in increased levels of syringyl monomer providing a lignin composition more easily degraded with chemicals and enzymes.

  9. Characterization of electrospun lignin based carbon fibers

    SciTech Connect (OSTI)

    Poursorkhabi, Vida; Mohanty, Amar; Misra, Manjusri

    2015-05-22

    The production of lignin fibers has been studied in order to replace the need for petroleum based precursors for carbon fiber production. In addition to its positive environmental effects, it also benefits the economics of the industries which cannot take advantage of carbon fiber properties because of their high price. A large amount of lignin is annually produced as the byproduct of paper and growing cellulosic ethanol industry. Therefore, finding high value applications for this low cost, highly available material is getting more attention. Lignin is a biopolymer making about 15 – 30 % of the plant cell walls and has a high carbon yield upon carbonization. However, its processing is challenging due to its low molecular weight and also variations based on its origin and the method of separation from cellulose. In this study, alkali solutions of organosolv lignin with less than 1 wt/v% of poly (ethylene oxide) and two types of lignin (hardwood and softwood) were electrospun followed by carbonization. Different heating programs for carbonization were tested. The carbonized fibers had a smooth surface with an average diameter of less than 5?µm and the diameter could be controlled by the carbonization process and lignin type. Scanning electron microscopy (SEM) was used to study morphology of the fibers before and after carbonization. Thermal conductivity of a sample with amorphous carbon was 2.31?W/m.K. The electrospun lignin carbon fibers potentially have a large range of application such as in energy storage devices and water or gas purification systems.

  10. Engineering a monolignol 4-O-methyltransferase with high selectivity for the condensed lignin precursor coniferyl alchohol

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Cai, Yuanheng; Shanklin, John; Mohammad -Wadud Bhuiya; Liu, Chang -Jun

    2015-09-16

    Lignin, a rigid biopolymer in plant cell walls, is derived from the oxidative polymerization of three monolignols. The composition of monolignol monomers dictates the degree of lignin condensation, reactivity, and thus the degradability of plant cell walls. Guaiacyl lignin is regarded as the condensed structural unit. Polymerization of lignin is initiated through the deprotonation of the para-hydroxyl group of monolignols. Therefore, preferentially modifying the para-hydroxyl of a specific monolignol to deprive its dehydrogenation propensity would disturb the formation of particular lignin subunits. Here, we test the hypothesis that specific remodeling the active site of a monolignol 4-O-methyltransferase would create anmore » enzyme that specifically methylates the condensed guaiacyl lignin precursor coniferyl alcohol. Combining crystal structural information with combinatorial active site saturation mutagenesis and starting with the engineered promiscuous enzyme, MOMT5 (T133L/E165I/F175I/F166W/H169F), we incrementally remodeled its substrate binding pocket by the addition of four substitutions, i.e. M26H, S30R, V33S, and T319M, yielding a mutant enzyme capable of discriminately etherifying the para-hydroxyl of coniferyl alcohol even in the presence of excess sinapyl alcohol. The engineered enzyme variant has a substantially reduced substrate binding pocket that imposes a clear steric hindrance thereby excluding bulkier lignin precursors. Lastly, the resulting enzyme variant represents an excellent candidate for modulating lignin composition and/or structure in planta.« less

  11. Novel seed coat lignins in the Cactaceae: structure, distribution and

    Office of Scientific and Technical Information (OSTI)

    implications for the evolution of lignin diversity (Journal Article) | SciTech Connect Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Citation Details In-Document Search Title: Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Authors: Fang,Chen ; Yuki,Tobimatsu ; Lisa,Jackson ; Jin,Nakashima ; John,Ralph ; Richard A.,Dixon Publication Date:

  12. Novel seed coat lignins in the Cactaceae: structure, distribution and

    Office of Scientific and Technical Information (OSTI)

    implications for the evolution of lignin diversity (Journal Article) | SciTech Connect Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Citation Details In-Document Search Title: Novel seed coat lignins in the Cactaceae: structure, distribution and implications for the evolution of lignin diversity Authors: Fang,Chen ; Yuki,Tobimatsu ; Lisa,Jackson ; Jin,Nakashima ; John,Ralph ; Richard A.,Dixon Publication Date:

  13. Fourier Transform Infrared Imaging Showing Reduced Unsaturated Lipid Content in the Hippocampus of a mouse Model of Alzheimer's Disease

    SciTech Connect (OSTI)

    Leskovjan, A.C.; Kretlow, A.; Miller, L.M.

    2010-04-01

    Polyunsaturated fatty acids are essential to brain functions such as membrane fluidity, signal transduction, and cell survival. It is also thought that low levels of unsaturated lipid in the brain may contribute to Alzheimer's disease (AD) risk or severity. However, it is not known how accumulation of unsaturated lipids is affected in different regions of the hippocampus, which is a central target of AD plaque pathology, during aging. In this study, we used Fourier transform infrared imaging (FTIRI) to visualize the unsaturated lipid content in specific regions of the hippocampus in the PSAPP mouse model of AD as a function of plaque formation. Specifically, the unsaturated lipid content was imaged using the olefinic {double_bond}CH stretching mode at 3012 cm{sup -1}. The axonal, dendritic, and somatic layers of the hippocampus were examined in the mice at 13, 24, 40, and 56 weeks old. Results showed that lipid unsaturation in the axonal layer was significantly increased with normal aging in control (CNT) mice (p < 0.01) but remained low and relatively constant in PSAPP mice. Thus, these findings indicate that unsaturated lipid content is reduced in hippocampal white matter during amyloid pathogenesis and that maintaining unsaturated lipid content early in the disease may be critical in avoiding progression of the disease.

  14. Manipulation of lignin composition in plants using a tissue-specific promoter

    DOE Patents [OSTI]

    Chapple, Clinton C. S.

    2003-08-26

    The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

  15. Preliminary Economics for the Production of Pyrolysis Oil from Lignin in a Cellulosic Ethanol Biorefinery

    SciTech Connect (OSTI)

    Jones, Susanne B.; Zhu, Yunhua

    2009-04-01

    Cellulosic ethanol biorefinery economics can be potentially improved by converting by-product lignin into high valued products. Cellulosic biomass is composed mainly of cellulose, hemicellulose and lignin. In a cellulosic ethanol biorefinery, cellulose and hemicellullose are converted to ethanol via fermentation. The raw lignin portion is the partially dewatered stream that is separated from the product ethanol and contains lignin, unconverted feed and other by-products. It can be burned as fuel for the plant or can be diverted into higher-value products. One such higher-valued product is pyrolysis oil, a fuel that can be further upgraded into motor gasoline fuels. While pyrolysis of pure lignin is not a good source of pyrolysis liquids, raw lignin containing unconverted feed and by-products may have potential as a feedstock. This report considers only the production of the pyrolysis oil and does not estimate the cost of upgrading that oil into synthetic crude oil or finished gasoline and diesel. A techno-economic analysis for the production of pyrolysis oil from raw lignin was conducted. comparing two cellulosic ethanol fermentation based biorefineries. The base case is the NREL 2002 cellulosic ethanol design report case where 2000 MTPD of corn stover is fermented to ethanol (NREL 2002). In the base case, lignin is separated from the ethanol product, dewatered, and burned to produce steam and power. The alternate case considered in this report dries the lignin, and then uses fast pyrolysis to generate a bio-oil product. Steam and power are generated in this alternate case by burning some of the corn stover feed, rather than fermenting it. This reduces the annual ethanol production rate from 69 to 54 million gallons/year. Assuming a pyrolysis oil value similar to Btu-adjusted residual oil, the estimated ethanol selling price ranges from $1.40 to $1.48 (2007 $) depending upon the yield of pyrolysis oil. This is considerably above the target minimum ethanol selling price of $1.33 for the 2012 goal case process as reported in the 2007 State of Technology Model (NREL 2008). Hence, pyrolysis oil does not appear to be an economically attractive product in this scenario. Further research regarding fast pyrolysis of raw lignin from a cellulosic plant as an end product is not recommended. Other processes, such as high-pressure liquefaction or wet gasification, and higher value products, such as gasoline and diesel from fast pyrolysis oil should be considered in future studies.

  16. Modification of Lignin by Protein Cross-linking to Facilitate...

    Office of Scientific and Technical Information (OSTI)

    of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar Citation Details In-Document Search Title: Modification of Lignin by Protein Cross-linking to ...

  17. Process for producing phenolic compounds from lignins

    DOE Patents [OSTI]

    Agblevor, Foster A. (Lakewood, CO)

    1998-01-01

    A process for the production of low molecular weight phenolic compounds from lignins through the pyrolysis of the lignins in the presence of a strong base. In a preferred embodiment, potassium hydroxide is present in an amount of from about 0.1% to about 5% by weight, the pyrolysis temperature is from about 400.degree. C. to about 600.degree. C. at atmospheric pressure, and the time period for substantial completion of the reaction is from about 1-3 minutes. Examples of low molecular weight phenolic compounds produced include methoxyphenols, non-methoxylated phenols, and mixtures thereof.

  18. Process for producing phenolic compounds from lignins

    DOE Patents [OSTI]

    Agblevor, F.A.

    1998-09-15

    A process is described for the production of low molecular weight phenolic compounds from lignins through the pyrolysis of the lignins in the presence of a strong base. In a preferred embodiment, potassium hydroxide is present in an amount of from about 0.1% to about 5% by weight, the pyrolysis temperature is from about 400 C to about 600 C at atmospheric pressure, and the time period for substantial completion of the reaction is from about 1--3 minutes. Examples of low molecular weight phenolic compounds produced include methoxyphenols, non-methoxylated phenols, and mixtures thereof. 16 figs.

  19. Genetic engineering of syringyl-enriched lignin in plants

    DOE Patents [OSTI]

    Chiang, Vincent Lee; Li, Laigeng

    2004-11-02

    The present invention relates to a novel DNA sequence, which encodes a previously unidentified lignin biosynthetic pathway enzyme, sinapyl alcohol dehydrogenase (SAD) that regulates the biosynthesis of syringyl lignin in plants. Also provided are methods for incorporating this novel SAD gene sequence or substantially similar sequences into a plant genome for genetic engineering of syringyl-enriched lignin in plants.

  20. Genetics and chemistry of lignin degradation by Streptomyces

    SciTech Connect (OSTI)

    Crawford, D.L.

    1992-01-01

    Our research goal was to define the involvement of lignin peroxidases and other extracellular enzymes in lignin degradation by Streptomyces. We examined the biochemistry and genetics of lignin degrading enzyme production by several strains of Streptomyces. The lignin peroxidase ALiP-P3 of S. viridosporus was characterized kinetically and its activity optimized for oxidation of 2,4-dichlorophenol and vanillyl-acetone. Sensitive spectrophotometric assays were developed for monitoring oxidation of these substrates. ALiP-P3 reaction chemistry was examined using both spectrophotometric assays and gas chromatography/mass spectroscopy. Results showed that the enzyme oxidizes phenolic lignin substructure models in strong preference to nonphenolic ones. The peroxidase was also shown to depolymerize native lignin. We also cloned the ALip-P3 gene S. lividans in plasmid vector pIJ702. The cloned gene was partially sequenced, We also immunologically characterized the lignin peroxidase of S. viridosporus T7A and showed it to be structurally related to peroxidases produced by other lignin-solubilizing Streptomyces, but not the the H8 lignin peroxidase of P. chrysosporium. Studies with peroxidase deficient mutants of strain T7A showed that lignin peroxidases of S. viridosporus are directly involved in the solubilization of lignin. Additional research showed that other enzymes are also probably involved in lignin solubilization, possibly including extracellular esterases.

  1. Lignin-blocking treatment of biomass and uses thereof

    DOE Patents [OSTI]

    Yang, Bin (Hanover, NH); Wyman, Charles E. (Norwich, VT)

    2009-10-20

    Disclosed is a method for converting cellulose in a lignocellulosic biomass. The method provides for a lignin-blocking polypeptide and/or protein treatment of high lignin solids. The treatment enhances cellulase availability in cellulose conversion. Cellulase efficiencies are improved by the protein or polypeptide treatment. The treatment may be used in combination with steam explosion and acid prehydrolysis techniques. Hydrolysis yields from lignin containing biomass are enhanced 5-20%, and enzyme utilization is increased from 10% to 50%. Thus, a more efficient and economical method of processing lignin containing biomass materials utilizes a polypeptide/protein treatment step that effectively blocks lignin binding of cellulase.

  2. Modest hypoxia significantly reduces triglyceride content and lipid droplet size in 3T3-L1 adipocytes

    SciTech Connect (OSTI)

    Hashimoto, Takeshi; Yokokawa, Takumi; Endo, Yuriko; Iwanaka, Nobumasa; Higashida, Kazuhiko; Faculty of Sport Science, Waseda University, 2-579-15 Mikajima, Tokorozawa, Saitama 359-1192 ; Taguchi, Sadayoshi

    2013-10-11

    Highlights: •Long-term hypoxia decreased the size of LDs and lipid storage in 3T3-L1 adipocytes. •Long-term hypoxia increased basal lipolysis in 3T3-L1 adipocytes. •Hypoxia decreased lipid-associated proteins in 3T3-L1 adipocytes. •Hypoxia decreased basal glucose uptake and lipogenic proteins in 3T3-L1 adipocytes. •Hypoxia-mediated lipogenesis may be an attractive therapeutic target against obesity. -- Abstract: Background: A previous study has demonstrated that endurance training under hypoxia results in a greater reduction in body fat mass compared to exercise under normoxia. However, the cellular and molecular mechanisms that underlie this hypoxia-mediated reduction in fat mass remain uncertain. Here, we examine the effects of modest hypoxia on adipocyte function. Methods: Differentiated 3T3-L1 adipocytes were incubated at 5% O{sub 2} for 1 week (long-term hypoxia, HL) or one day (short-term hypoxia, HS) and compared with a normoxia control (NC). Results: HL, but not HS, resulted in a significant reduction in lipid droplet size and triglyceride content (by 50%) compared to NC (p < 0.01). As estimated by glycerol release, isoproterenol-induced lipolysis was significantly lowered by hypoxia, whereas the release of free fatty acids under the basal condition was prominently enhanced with HL compared to NC or HS (p < 0.01). Lipolysis-associated proteins, such as perilipin 1 and hormone-sensitive lipase, were unchanged, whereas adipose triglyceride lipase and its activator protein CGI-58 were decreased with HL in comparison to NC. Interestingly, such lipogenic proteins as fatty acid synthase, lipin-1, and peroxisome proliferator-activated receptor gamma were decreased. Furthermore, the uptake of glucose, the major precursor of 3-glycerol phosphate for triglyceride synthesis, was significantly reduced in HL compared to NC or HS (p < 0.01). Conclusion: We conclude that hypoxia has a direct impact on reducing the triglyceride content and lipid droplet size via decreased glucose uptake and lipogenic protein expression and increased basal lipolysis. Such an hypoxia-induced decrease in lipogenesis may be an attractive therapeutic target against lipid-associated metabolic diseases.

  3. Method for recovering and using lignin in adhesive resins

    DOE Patents [OSTI]

    Schroeder, Herbert A.

    1993-01-01

    Lignin, or a lignin derived material, which has been significantly demethylated (e.g., the demethylated lignin found in the raffinate produced as a by-product of dimethyl sulfide production which can be carried out using the spent liquor from wood pulping operations) can be isolated by a process wherein an organic solvent is added to a lignin-containing aqueous solution. The organic solvent is typically a polar, and at least a partially water-immiscible substance such as, for example, ethyl acetate. The resulting lignin-containing aqueous solution/organic solvent mixture is acidified to produce a water layer which is discarded and an organic solvent layer which contains the demethylated lignin. Upon its recovery, the demethylated lignin is dissolved in an alkaline solution to which an aldehyde source is added to produce a resol-type resin. The aldehyde source may be formaldehyde in solution, paraformaldehyde, hexamethylenetetramine, or other aldehydes including acetaldehyde, furfural, and their derivatives.

  4. Lignin-Derived Carbon Fiber as a Co-Product of Refining Cellulosic Biomass

    SciTech Connect (OSTI)

    Langholtz, Matthew H; Downing, Mark; Graham, Robin Lambert; Baker, Fred S; Compere, A L; Griffith, William {Bill} L; Boeman, Raymond G; Keller, Martin

    2014-01-01

    Lignin by-products from biorefineries has the potential to provide a low-cost alternative to petroleum-based precursors to manufacture carbon fiber, which can be combined with a binding matrix to produce a structural material with much greater specific strength and specific stiffness than conventional materials such as steel and aluminum. The market for carbon fiber is universally projected to grow exponentially to fill the needs of clean energy technologies such as wind turbines and to improve the fuel economies in vehicles through lightweighting. In addition to cellulosic biofuel production, lignin-based carbon fiber production coupled with biorefineries may provide $2,400 to $3,600 added value dry Mg-1 of biomass for vehicle applications. Compared to producing ethanol alone, the addition of lignin-derived carbon fiber could increase biorefinery gross revenue by 30% to 300%. Using lignin-derived carbon fiber in 15 million vehicles per year in the US could reduce fossil fuel consumption by 2-5 billion liters year-1, reduce CO2 emissions by about 6.7 million Mg year-1, and realize fuel savings through vehicle lightweighting of $700 to $1,600 per Mg biomass processed. The value of fuel savings from vehicle lightweighting becomes economical at carbon fiber price of $6.60 kg-1 under current fuel prices, or $13.20 kg-1 under fuel prices of about $1.16 l-1.

  5. Lignin from Transgenic Poplar Is Easier to Process - Energy Innovation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Portal Lignin from Transgenic Poplar Is Easier to Process Great Lakes Bioenergy Research Center Contact GLBRC About This Technology Technology Marketing Summary Lignin is an important plant cell wall component that provides structural support and vascular functions. It is one of the most abundant organic polymers on Earth, constituting about 30 percent of non-fossil organic carbon. However, the chemical structure of lignin is difficult to break down by chemical and enzymatic means, posing a

  6. Biological Lignin Depolymerization Presentation for BETO 2015 Project Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOE BioEnergy Technologies Office (BETO) Project Peer Review Date: March 25 th , 2015 Technology Review Area: Biochemical Conversion Biological Lignin Depolymerization (WBS 2.3.2.100) Principal Investigators: Gregg Beckham (NREL) John Gladden (SNL) Organizations: National Renewable Energy Laboratory and Sandia National Laboratory 2 | Bioenergy Technologies Office Project Goal Residual Biorefinery Lignin Goal and Outcome: develop a biological approach to depolymerize solid lignin for upgrading

  7. Solid Double-Layered Hydroxide Catalysts for Lignin Decomposition...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Biomass and Biofuels Biomass and Biofuels Find More Like This Return to Search Solid Double-Layered Hydroxide Catalysts for Lignin Decomposition National Renewable Energy...

  8. NREL Overcomes Obstacles in Lignin Valorization (Fact Sheet)...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ates), hydroxy acids, and fuel-range alkanes from lignin-derived streams. By coupling metabolic engineering of the biological funneling pathways to chemical catalysis, this...

  9. Carbohydrate and lignin are simultaneously solubilized from unpretreat...

    Office of Scientific and Technical Information (OSTI)

    Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature Citation Details In-Document Search Title: Carbohydrate ...

  10. Selective aerobic alcohol oxidation method for conversion of lignin into simple aromatic compounds

    DOE Patents [OSTI]

    Stahl, Shannon S; Rahimi, Alireza

    2015-03-03

    Described is a method to oxidize lignin or lignin sub-units. The method includes oxidation of secondary benzylic alcohol in the lignin or lignin sub-unit to a corresponding ketone in the presence of unprotected primarily aliphatic alcohol in the lignin or lignin sub-unit. The optimal catalyst system consists of HNO.sub.3 in combination with another Bronsted acid, in the absence of a metal-containing catalyst, thereby yielding a selectively oxidized lignin or lignin sub-unit. The method may be carried out in the presence or absence of additional reagents including TEMPO and TEMPO derivatives.

  11. Process for conversion of lignin to reformulated hydrocarbon gasoline

    DOE Patents [OSTI]

    Shabtai, Joseph S. (Salt Lake City, UT); Zmierczak, Wlodzimierz W. (Salt Lake City, UT); Chornet, Esteban (Golden, CO)

    1999-09-28

    A process for converting lignin into high-quality reformulated hydrocarbon gasoline compositions in high yields is disclosed. The process is a two-stage, catalytic reaction process that produces a reformulated hydrocarbon gasoline product with a controlled amount of aromatics. In the first stage, a lignin material is subjected to a base-catalyzed depolymerization reaction in the presence of a supercritical alcohol as a reaction medium, to thereby produce a depolymerized lignin product. In the second stage, the depolymerized lignin product is subjected to a sequential two-step hydroprocessing reaction to produce a reformulated hydrocarbon gasoline product. In the first hydroprocessing step, the depolymerized lignin is contacted with a hydrodeoxygenation catalyst to produce a hydrodeoxygenated intermediate product. In the second hydroprocessing step, the hydrodeoxygenated intermediate product is contacted with a hydrocracking/ring hydrogenation catalyst to produce the reformulated hydrocarbon gasoline product which includes various desirable naphthenic and paraffinic compounds.

  12. Reducing the moisture content of clean coals. Volume 2, High-G solid-bowl centrifuge: Final report

    SciTech Connect (OSTI)

    Kehoe, D.

    1992-12-01

    Coal moisture content can profoundly effect the cost of burning coal in utility boilers. Because of the large effect of coal moisture, the Empire State Electric Energy Research Corporation (ESEERCO) contracted with the Electric Power Research Institute to investigate advanced coal dewatering methods at its Coal Quality Development Center. This report contains the test result on the high-G solid-bowl centrifuge, the second of four devices to be tested. The high-G solid-bowl centrifuge removes water for coal by spinning the coal/water mixture rapidly in a rotating bowl. This causes the coal to cling to the sides of the bowl where it can be removed, leaving the water behind. Testing was performed at the CQDC to evaluate the effect of four operating variables (G-ratio, feed solids concentration, dry solids feed rate, and differential RPM) on the performance of the high-G solid-bowl centrifuge. Two centrifuges of different bowl diameter were tested to establish the effect of scale-up of centrifuge performance. Testing of the two centrifuges occurred from 1985 through 1987. CQDC engineers performed 32 tests on the smaller of the two centrifuges, and 47 tests on the larger. Equations that predict the performance of the two centrifuges for solids recovery, moisture content of the produced coal, and motor torque were obtained. The equations predict the observed data well. Traditional techniques of establishing the performance of centrifuge of different scale did not work well with the two centrifuges, probably because of the large range of G-ratios used in the testing. Cost of operating a commercial size bank of centrifuges is approximately $1.72 per ton of clean coal. This compares well with thermal drying, which costs $1.82 per ton of clean coal.

  13. Producing a True Lignin Depolymerase for Biobleaching Softwood Kraft Pulp

    SciTech Connect (OSTI)

    Simo Sarkanen

    2002-02-04

    This project constituted an intensive effort devoted to producing, from the white-rot fungus Tramets Cingulata, a lignin degrading enzyme (lignin depolymerase) that is directly able to biobleach or delignify softwood kraft pulp brownstock. To this end, the solutions in which T. cingulata was grown contained dissolved kraft lignin which fulfilled two functions; it behaved as a lignin deploymerase substrate and it also appeared to act as an inducer of enzyme expression. However, the lignin depolymerase isoenzymes (and other extracellular T. cingulata enzymes) interacted very strongly with both the kraft lignin components and the fungal hypae, so the isolating these proteins from the culture solutions proved to be unexpectedly difficult. Even after extensive experimentation with a variety of protein purification techniques, only one approach appeared to be capable of purifying lignin depolymerases to homogeneity. Unfortunately the procedure was extremely laborious; it involved the iso electric focusing of concentrated buffer-exchanged culture solutions followed by electro-elution of the desired protein bands from the appropriate polyacrylamide gel segments

  14. Potential role of lignin in tomorrow's wood utilization technologies

    SciTech Connect (OSTI)

    Glasser, W.G.

    1981-03-01

    Low-grade timber supplies and wood processing residues are presently converted into paper products, used for fuel, or remain totally unused. Competition for this resource will continue to mount, particularly when manufacturers of chemicals and liquid fuels enter the market with new technologies now under development. The type of technology that concentrates on depolymerization of carbohydrates will generate large quantities of lignin-rich residues. The potential of these lignins to contribute to the economic feasibility of new chemical wood process technologies may involve degradative depolymerization to phenols and benzene, or polymer conversion into a wide variety of dispersants, binders, reinforcing and antioxidizing agents, etc. Where lignin's fuel value lies around 3 to 4 cents/lb. (fall of 1979), its raw material value for phenol is reported to be almost 5 cents/lb., and the value of the polymeric materials is estimated to be between 6 and 20 cents/lb. At the lower end of this range of raw material values are ligninsulfonates, which contribute nearly 98 percent to the approximately 1.5 billion lb./yr. U.S. market for lignin products. Kraft lignins are located at the opposite end of this range. Novel bioconversion-type lignins are expected to be more similar in structure and properties to kraft than to sulfite lignins. Whereas application of the dispersant properties of ligninsulfonates in tertiary oil recovery operations is expected to constitute the most significant use of lignin in terms of volume, adhesive and resin applications hold the greatest promise in terms of value. Both utilization schemes seem to require pretreatments in the form of either polymeric fractionation or chemical modification. Potential savings from the use of polymeric lignins in material systems are great.

  15. NREL Overcomes Obstacles in Lignin Valorization (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-01-01

    This NREL Highlight is being produced for the 2015 February Alliance S&T Board meeting, and describes research that shows lignin can be converted into renewable fuels, chemicals, and materials.

  16. Two-Step Process Converts Lignin into Simple Aromatic Compounds...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lignin is a major component of non-edible biomass. It is a cheap byproduct of pulp and biofuel production and is one of the few naturally occurring sources of valuable aromatic ...

  17. Selective Conversion of Lignin into Simple Aromatic Compounds...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lignin is a major component of non-edible biomass (15-30 percent by weight; 40 percent by energy). It is a cheap byproduct of pulp and biofuel production and is one of the few ...

  18. Computational Study of Bond Dissociation Enthalpies for Substituted $\\beta$-O-4 Lignin Model Compounds

    SciTech Connect (OSTI)

    Younker, Jarod M; Beste, Ariana; Buchanan III, A C

    2011-01-01

    The biopolymer lignin is a potential source of valuable chemicals. Phenethyl phenyl ether (PPE) is representative of the dominant $\\beta$-O-4 ether linkage. Density functional theory (DFT) is used to calculate the Boltzmann-weighted carbon-oxygen and carbon-carbon bond dissociation enthalpies (BDEs) of substituted PPE. These values are important in order to understand lignin decomposition. Exclusion of all conformers that have distributions of less than 5\\% at 298 K impacts the BDE by less than 1 kcal mol$^{-1}$. We find that aliphatic hydroxyl/methylhydroxyl substituents introduce only small changes to the BDEs (0-3 kcal mol$^{-1}$). Substitution on the phenyl ring at the $ortho$ position substantially lowers the C-O BDE, except in combination with the hydroxyl/methylhydroxyl substituents, where the effect of methoxy substitution is reduced by hydrogen bonding. Hydrogen bonding between the aliphatic substituents and the ether oxygen in the PPE derivatives has a significant influence on the BDE. CCSD(T)-calculated BDEs and hydrogen bond strengths of $ortho$-substituted anisoles when compared with M06-2X values confirm that the latter method is sufficient to describe the molecules studied and provide an important benchmark for lignin model compounds.

  19. Lignin Utilization Presentation for BETO 2015 Project Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Lignin Utilization WBS 2.3.4.100 2015 DOE BioEnergy Technologies Office (BETO) Project Peer Review Date: March 24 th , 2015 Technology Area Review: Biochemical Conversion Principal Investigator: Gregg T. Beckham Organization: National Renewable Energy Laboratory This presentation does not contain any proprietary, confidential, or otherwise restricted information 2 Goal Statement Goal: develop viable processes to produce valuable co-products from lignin * Contribute to 2022 cost targets in

  20. Carbohydrate and lignin are simultaneously solubilized from unpretreated

    Office of Scientific and Technical Information (OSTI)

    switchgrass by microbial action at high temperature (Journal Article) | SciTech Connect Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature Citation Details In-Document Search Title: Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature Authors: Kataeva, Irina [1] ; Foston, Marcus [2] ; Yang, Sung-Jae [1] ; Pattahil, Sivakumar [1] ; Biswal, Ajaya K

  1. Methods for simultaneous control of lignin content and composition, and cellulose content in plants

    DOE Patents [OSTI]

    Chiang, Vincent Lee C.; Li, Laigeng

    2005-02-15

    The present invention relates to a method of concurrently introducing multiple genes into plants and trees is provided. The method includes simultaneous transformation of plants with multiple genes from the phenylpropanoid pathways including 4CL, CAld5H, AldOMT, SAD and CAD genes and combinations thereof to produce various lines of transgenic plants displaying altered agronomic traits. The agronomic traits of the plants are regulated by the orientation of the specific genes and the selected gene combinations, which are incorporated into the plant genome.

  2. Treatment of Lignin Precursors to Improve their Suitability for Carbon Fibers: A Literature Review

    SciTech Connect (OSTI)

    Paul, Ryan; Naskar, Amit; Gallego, Nidia; Dai, Xuliang; Hausner, Andrew

    2015-04-17

    Lignin has been investigated as a carbon fiber precursor since the 1960s. Although there have been a number of reports of successful lignin-based carbon fiber production at the lab scale, lignin-based carbon fibers are not currently commercially available. This review will highlight some of the known challenges, and also the reported methods for purifying and modifying lignin to improve it as a precursor. Lignin can come from different sources (e.g. hardwood, softwood, grasses) and extraction methods (e.g. organosolv, kraft), meaning that lignin can be found with a diversity of purity and structure. The implication of these conditions on lignin as carbon fiber precursor is not comprehensively known, especially as the lignin landscape is evolving. The work presented in this review will help guide the direction of a project between GrafTech and ORNL to develop lignin carbon fiber technology, as part of a cooperative agreement with the DOE Advanced Manufacturing Office.

  3. Lignin's potential contribution to the feasibility of biomass conversion to ethanol

    SciTech Connect (OSTI)

    Muller, P.C.; Glasser, W.G.

    1983-01-01

    The potential contribution of lignin toward the economic improvement of processes involving the bioconversion of lignocellulosics to liquid fuels such as ethyl alcohol was examined. This improvement in process economics is achieved by the employment of a two-product process scheme whereby lignin-rich residues separated from cellulosics during bioconversion are marketed as polymeric materials. Lignin's utility as a marketable macromolecule was assessed by (a) characterization of structural features in bioconversion lignins with reference to commercial lignin products, (b) by examining lignin in terms of its value as a component in polymer systems such as urethane and phenol-formaldehyde thermosetting adhesives, and (c) by identifying potential high-volume, high-value lignin market categories which could absorb lignin fractions produced in future bioconversion scenarios. 38 references, 7 figures, 4 tables.

  4. In situ micro-spectroscopic investigation of lignin in poplar cell walls pretreated by maleic acid

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zeng, Yining; Zhao, Shuai; Wei, Hui; Tucker, Melvin P.; Himmel, Michael E.; Mosier, Nathan S.; Meilan, Richard; Ding, Shi -You

    2015-08-27

    In higher plant cells, lignin provides necessary physical support for plant growth and resistance to attack by microorganisms. For the same reason, lignin is considered to be a major impediment to the process of deconstructing biomass to simple sugars by hydrolytic enzymes. Furthermore, the in situ variation of lignin in plant cell walls is important for better understanding of the roles lignin play in biomass recalcitrance.

  5. Synthetic Design Microorganisms for Lignin Fuels and Chemicals Presentation for BETO 2015 Project Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Synthetic Design Microorganisms for Lignin Fuels and Chemicals 3/26/2015 Synthetic Biology Joshua S. Yuan Associate Professor and Director Texas A&M University This presentation does contain proprietary information 1 Project Goal: Design of Microorganisms for Lignin Fuel * The proposed research aims to address one of the most challenging issues in biofuel production: the utilization of lignin for fungible fuels. * Project Outcome: A viable biological platform for conversion of lignin into

  6. Genetics and chemistry of lignin degradation by Streptomyces. Final technical report

    SciTech Connect (OSTI)

    Crawford, D.L.

    1992-12-31

    Our research goal was to define the involvement of lignin peroxidases and other extracellular enzymes in lignin degradation by Streptomyces. We examined the biochemistry and genetics of lignin degrading enzyme production by several strains of Streptomyces. The lignin peroxidase ALiP-P3 of S. viridosporus was characterized kinetically and its activity optimized for oxidation of 2,4-dichlorophenol and vanillyl-acetone. Sensitive spectrophotometric assays were developed for monitoring oxidation of these substrates. ALiP-P3 reaction chemistry was examined using both spectrophotometric assays and gas chromatography/mass spectroscopy. Results showed that the enzyme oxidizes phenolic lignin substructure models in strong preference to nonphenolic ones. The peroxidase was also shown to depolymerize native lignin. We also cloned the ALip-P3 gene S. lividans in plasmid vector pIJ702. The cloned gene was partially sequenced, We also immunologically characterized the lignin peroxidase of S. viridosporus T7A and showed it to be structurally related to peroxidases produced by other lignin-solubilizing Streptomyces, but not the the H8 lignin peroxidase of P. chrysosporium. Studies with peroxidase deficient mutants of strain T7A showed that lignin peroxidases of S. viridosporus are directly involved in the solubilization of lignin. Additional research showed that other enzymes are also probably involved in lignin solubilization, possibly including extracellular esterases.

  7. Recent Development in Chemical Depolymerization of Lignin: A Review

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Hai; Tucker, Melvin; Ji, Yun

    2013-01-01

    This article reviewed recent development of chemical depolymerization of lignins. There were five types of treatment discussed, including base-catalyzed, acid-catalyzed, metallic catalyzed, ionic liquids-assisted, and supercritical fluids-assisted lignin depolymerizations. The methods employed in this research were described, and the important results were marked. Generally, base-catalyzed and acid-catalyzed methods were straightforward, but the selectivity was low. The severe reaction conditions (high pressure, high temperature, and extreme pH) resulted in requirement of specially designed reactors, which led to high costs of facility and handling. Ionic liquids, and supercritical fluids-assisted lignin depolymerizations had high selectivity, but the high costs of ionic liquids recyclingmore » and supercritical fluid facility limited their applications on commercial scale biomass treatment. Metallic catalyzed depolymerization had great advantages because of its high selectivity to certain monomeric compounds and much milder reaction condition than base-catalyzed or acid-catalyzed depolymerizations. It would be a great contribution to lignin conversion if appropriate catalysts were synthesized.« less

  8. Graphitic biocarbon from metal-catalyzed hydrothermal carbonization of lignin

    SciTech Connect (OSTI)

    Demir, Muslum; Kahveci, Zafer; Aksoy, Burak; Palapati, Naveen K. R.; Subramanian, Arunkumar; Cullinan, Harry T.; El-Kaderi, Hani M.; Harris, Charles T.; Gupta, Ram B.

    2015-10-09

    Lignin is a high-volume byproduct from the pulp and paper industry and is currently burned to generate electricity and process heat. Moreover, the industry has been searching for high value-added uses of lignin to improve the process economics. In addition, battery manufacturers are seeking nonfossil sources of graphitic carbon for environmental sustainability. In our work, lignin (which is a cross-linked polymer of phenols, a component of biomass) is converted into graphitic porous carbon using a two-step conversion. Lignin is first carbonized in water at 300 °C and 1500 psi to produce biochar, which is then graphitized using a metal nitrate catalyst at 900–1100 °C in an inert gas at 15 psi. Graphitization effectiveness of three different catalysts—iron, cobalt, and manganese nitrates—is examined. The product is analyzed for morphology, thermal stability, surface properties, and electrical conductivity. Both temperature and catalyst type influenced the degree of graphitization. A good quality graphitic carbon was obtained using catalysis by Mn(NO3)2 at 900 °C and Co(NO3)2 at 1100 °C.

  9. Graphitic biocarbon from metal-catalyzed hydrothermal carbonization of lignin

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Demir, Muslum; Kahveci, Zafer; Aksoy, Burak; Palapati, Naveen K. R.; Subramanian, Arunkumar; Cullinan, Harry T.; El-Kaderi, Hani M.; Harris, Charles T.; Gupta, Ram B.

    2015-10-09

    Lignin is a high-volume byproduct from the pulp and paper industry and is currently burned to generate electricity and process heat. Moreover, the industry has been searching for high value-added uses of lignin to improve the process economics. In addition, battery manufacturers are seeking nonfossil sources of graphitic carbon for environmental sustainability. In our work, lignin (which is a cross-linked polymer of phenols, a component of biomass) is converted into graphitic porous carbon using a two-step conversion. Lignin is first carbonized in water at 300 °C and 1500 psi to produce biochar, which is then graphitized using a metal nitratemore » catalyst at 900–1100 °C in an inert gas at 15 psi. Graphitization effectiveness of three different catalysts—iron, cobalt, and manganese nitrates—is examined. The product is analyzed for morphology, thermal stability, surface properties, and electrical conductivity. Both temperature and catalyst type influenced the degree of graphitization. A good quality graphitic carbon was obtained using catalysis by Mn(NO3)2 at 900 °C and Co(NO3)2 at 1100 °C.« less

  10. Consolidated bioprocessing of Populus using Clostridium (Ruminiclostridium) thermocellum: a case study on the impact of lignin composition and structure

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Dumitrache, Alexandru; Akinosho, Hannah; Rodriguez, Miguel; Meng, Xianzhi; Yoo, Chang Geun; Natzke, Jace; Engle, Nancy L.; Sykes, Robert W.; Tschaplinski, Timothy J.; Muchero, Wellington; et al

    2016-02-04

    Background: Higher ratios of syringyl-to-guaiacyl (S/G) lignin components of Populus were shown to improve sugar release by enzymatic hydrolysis using commercial blends. Cellulolytic microbes are often robust biomass hydrolyzers and may offer cost advantages; however, it is unknown whether their activity can also be significantly influenced by the ratio of different monolignol types in Populus biomass. Hydrolysis and fermentation of autoclaved, but otherwise not pretreated Populus trichocarpa by Clostridium thermocellum ATCC 27405 was compared using feedstocks that had similar carbohydrate and total lignin contents but differed in S/G ratios. Results: Populus with an S/G ratio of 2.1 was converted moremore » rapidly and to a greater extent compared to similar biomass that had a ratio of 1.2. For either microbes or commercial enzymes, an approximate 50% relative difference in total solids solubilization was measured for both biomasses, which suggests that the differences and limitations in the microbial breakdown of lignocellulose may be largely from the enzymatic hydrolytic process. Unexpectedly, the reduction in glucan content per gram solid in the residual microbially processed biomass was similar (17–18%) irrespective of S/G ratio, pointing to a similar mechanism of solubilization that proceeded at different rates. Fermentation metabolome testing did not reveal the release of known biomass-derived alcohol and aldehyde inhibitors that could explain observed differences in microbial hydrolytic activity. Biomass-derived p-hydroxybenzoic acid was up to ninefold higher in low S/G ratio biomass fermentations, but was not found to be inhibitory in subsequent test fermentations. Cellulose crystallinity and degree of polymerization did not vary between Populus lines and had minor changes after fermentation. However, lignin molecular weights and cellulose accessibility determined by Simons’ staining were positively correlated to the S/G content. Conclusions: Higher S/G ratios in Populus biomass lead to longer and more linear lignin chains and greater access to surface cellulosic content by microbe-bound enzymatic complexes. Substrate access limitation is suggested as a primary bottleneck in solubilization of minimally processed Populus, which has important implications for microbial deconstruction of lignocellulose biomass. Our findings will allow others to examine different Populus lines and to test if similar observations are possible for other plant species.« less

  11. Computational Analysis of the Pyrolysis of ..beta..-O4 Lignin Model Compounds: Concerted vs. Homolytic Fragmentation

    SciTech Connect (OSTI)

    Clark, J. M.; Robichaud, D. J.; Nimlos, M. R.

    2012-01-01

    The thermochemical conversion of biomass to liquid transportation fuels is a very attractive technology for expanding the utilization of carbon neutral processes and reducing dependency on fossil fuel resources. As with all such emerging technologies, biomass conversion through gasification or pyrolysis has a number of obstacles that need to be overcome to make these processes cost competitive with the refining of fossil fuels. Our current efforts have focused on the investigation of the thermochemistry of the linkages between lignin units using ab initio calculations on dimeric lignin model compounds. All calculations were carried out using M062X density functional theory at the 6-311++G(d,p) basis set. The M062X method has been shown to be consistent with the CBS-QB3 method while being significantly less computationally expensive. To date we have only completed the study on the b-O4 compounds. The theoretical calculations performed in the study indicate that concerted elimination pathways dominate over bond homolysis reactions under typical pyrolysis conditions. However, this does not mean that concerted elimination will be the dominant loss process for lignin. Bimolecular radical chemistry could very well dwarf the unimolecular pathways investigated in this study. These concerted pathways tend to form stable, reasonably non-reactive products that would be more suited producing a fungible bio-oil for the production of liquid transportation fuels.

  12. Lignin-assisted coal depolymerization. Technical report, December 1, 1991--February 29, 1992

    SciTech Connect (OSTI)

    Lalvani, S.B.

    1992-08-01

    Previous research has shown that addition of lignin and lignin-derived liquids to coal stirred in tetralin under mild reaction conditions (375{degrees}C and 300--500 psig) results in a marked enhancement in the rate of coal depolymerization. In this quarterly report, overall mass balances on experiments conducted with tetralin, coal, lignin and coal-lignin mixture are reported. Overall mass recoveries of 95--99% of the total mass charged to the reactor were obtained. A number of experiments were conducted on coal, lignin and coal-lignin depolymerization. A careful statistical analysis of the data shows that coal depolymerization is enhanced by 10.4%, due to the lignin addition. The liquids obtained are being examined for their elemental composition, and molecular weight determination by size exclusion chromatography. The stability of the liquid products is being examined in various environments. The gaseous product analyses show that the major gases produced during the course of depolymerization are CO, CH{sub 4}, and CO{sub 2}. When coal and lignin are reacted together, the amount of CO and CH{sub 4}produced respectively 12% and 38% greater than the corresponding amount of gases calculated, based on the weighted average of values obtained for coal and lignin alone. The data obtained show that lignin addition to coal is synergistic in that not only is the extent of coal depolymerization increased, but the gas produced contains higher concentrations of more desirable gaseous products.

  13. ionic liquids biological-ly derived from lignin and hemicellulose

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    biological-ly derived from lignin and hemicellulose - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste

  14. Lignin-Feasting Microbe Holds Promise for Biofuels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lignin-Feasting Microbe Holds Promise for Biofuels - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste

  15. Inexpensive, Environmentally Friendly and Highly Permeable Lignin-Based Ion

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Exchangers - Energy Innovation Portal Industrial Technologies Industrial Technologies Find More Like This Return to Search Inexpensive, Environmentally Friendly and Highly Permeable Lignin-Based Ion Exchangers Lawrence Livermore National Laboratory Contact LLNL About This Technology Technology Marketing Summary For more than 10 years, a partnership between Kazakh and US researchers has led to the synthesis and testing of highly permeable ion-exchangers. These materials possess an increased

  16. Development of a prototype lignin concentration sensor. Final report. Draft

    SciTech Connect (OSTI)

    Jeffers, L.A.

    1994-11-01

    The ultimate objective of the DOE-sponsored program discussed in this report is to commercialize an instrument for real-time, in-situ measurement of lignin in wood pulp at a variety of locations in the pulp process stream. The instrument will be used as a primary sensor for process control in the pulp and paper industry. Work done by B&W prior to the initiation of this program had shown: there is a functional relationship between the fluorescence intensity and the Kappa number as measured at the pulp mill laboratory. Kappa number is a standard wet chemical method for determination of the lignin concentration; the relationship is one of decreasing intensity with Kappa number, indicating operation in the quenched fluorescence regime; a great deal of scatter in the data. Because of the preliminary nature of the study, the origin of the scatter was not identified. This report documents the results of laboratory measurements made on a variety of well defined pulp samples to generate the data necessary to: determine the feasibility of an instrument for on-line lignin concentration measurement using laser fluorescence; identify the preferred measurement strategy; define the range of applicability of the instrument; and to provide background information to guide the design of a field-worthy prototype.

  17. Characterization of Trapped Lignin-Degrading Microbes in Tropical Forest Soil

    SciTech Connect (OSTI)

    DeAngelis, Kristen; Allgaier, Martin; Chavarria, Yaucin; Fortney, Julian; Hugenholtz, Phillip; Simmons, Blake; Sublette, Kerry; Silver, Whendee; Hazen, Terry

    2011-07-14

    Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in the soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.

  18. On-line measurement of lignin in wood pulp by color shift of fluorescence

    DOE Patents [OSTI]

    Jeffers, L.A.; Malito, M.L.

    1996-01-23

    Lignin concentrations from wood pulp samples are measured by applying an excitation light at a selected wavelength to the samples in order to cause the lignin to emit fluorescence. A spectral distribution of the fluorescence emission is then determined. The lignin concentration is then calculated based on the spectral distribution signal. The spectral distribution is quantified by either a wavelength centroid method or a band ratio method. 6 figs.

  19. On-line measurement of lignin in wood pulp by color shift of fluorescence

    DOE Patents [OSTI]

    Jeffers, Larry A. (Washington Township, Stark County, OH); Malito, Michael L. (Liberty Township, Trumbull County, OH)

    1996-01-01

    Lignin concentrations from wood pulp samples are measured by applying an excitation light at a selected wavelength to the samples in order to cause the lignin to emit fluorescence. A spectral distribution of the fluorescence emission is then determined. The lignin concentration is then calculated based on the spectral distribution signal. The spectral distribution is quantified by either a wavelength centroid method or a band ratio method.

  20. Synthetic Metabolic Pathways for Bioconversion of Lignin Derivatives to Biofuels Presentation for BETO Project Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Synthetic Metabolic Pathways for Bioconversion of Lignin Derivatives to Biofuels WBS: 2.3.2.104 March 25, 2015 Technology Area Review: Biochemical Conversion Principal Investigator: Adam M. Guss Organization: Oak Ridge National Laboratory 2 Goal Statement * Goal: Develop microbial biocatalysts to convert lignin-rich streams into value-added products * Relevance: Adding value to the lignin fraction of plant biomass will improve the economics of biorefineries to enable a bioeconomy Fuels +

  1. ReaxFF Study of the Oxidation of Softwood Lignin in View of Carbon Fiber Production

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Beste, Ariana

    2014-01-01

    We investigate the oxidative, thermal conversion of softwood lignin by performing molecular dynamics simulations based on a reactive force field (ReaxFF). The lignin samples are constructed from coniferyl alcohol units, which are connected through linkages that are randomly selected from a natural distribution of linkages in softwood. The goal of this work is to simulate the oxidative stabilization step during carbon fiber production from lignin precursor. We find that at simulation conditions where stabilization reactions occur, the lignin fragments have already undergone extensive degradation. The 5-5 linkage shows the highest reactivity towards cyclization and dehydrogenation.

  2. Final Report: Investigation of Catalytic Pathways for Lignin Breakdown into Monomers and Fuels

    SciTech Connect (OSTI)

    Gluckstein, Jeffrey A; Hu, Michael Z.; Kidder, Michelle; McFarlane, Joanna; Narula, Chaitanya Kumar; Sturgeon, Matthew R

    2010-12-01

    Lignin is a biopolymer that comprises up to 35% of woody biomass by dry weight. It is currently underutilized compared to cellulose and hemicellulose, the other two primary components of woody biomass. Lignin has an irregular structure of methoxylated aromatic groups linked by a suite of ether and alkyl bonds which makes it difficult to degrade selectively. However, the aromatic components of lignin also make it promising as a base material for the production of aromatic fuel additives and cyclic chemical feed stocks such as styrene, benzene, and cyclohexanol. Our laboratory research focused on three methods to selectively cleave and deoxygenate purified lignin under mild conditions: acidolysis, hydrogenation and electrocatalysis. (1) Acidolysis was undertaken in CH2Cl2 at room temperature. (2) Hydrogenation was carried out by dissolving lignin and a rhodium catalyst in 1:1 water:methoxyethanol under a 1 atm H2 environment. (3) Electrocatalysis of lignin involved reacting electrically generated hydrogen atoms at a catalytic palladium cathode with lignin dissolved in a solution of aqueous methanol. In all of the experiments, the lignin degradation products were identified and quantified by gas chromatography mass spectroscopy and flame ionization detection. Yields were low, but this may have reflected the difficulty in recovering the various fractions after conversion. The homogeneous hydrogenation of lignin showed fragmentation into monomers, while the electrocatalytic hydrogenation showed production of polyaromatic hydrocarbons and substituted benzenes. In addition to the experiments, promising pathways for the conversion of lignin were assessed. Three conversion methods were compared based on their material and energy inputs and proposed improvements using better catalyst and process technology. A variety of areas were noted as needing further experimental and theoretical effort to increase the feasibility of lignin conversion to fuels.

  3. A NEW PROCESS DEVELOPED FOR SEPARATION OF LIGNIN FROM AMMONIUM HYDROXIDE PRETREATMENT SOLUTIONS

    SciTech Connect (OSTI)

    Sherman, S.; Gorensek, M.; Milliken, C.

    2010-12-14

    A method is described for separating lignin from liquid solutions resulting from the pretreatment of lignocellulosic materials such as switchgrass with ammonium hydroxide. The method involves a sequence of steps including acidification, evaporation, and precipitation or centrifugation that are performed under defined conditions, and results in a relatively pure, solid lignin product. The method is tested on ammonium hydroxide solutions containing lignin extracted from switchgrass. Experimental results show that the method is capable of recovering between 66-95% of dissolved lignin as a precipitated solid. Cost estimates of pilot-scale and industrial-scale expressions of the process indicate that breakeven lignin prices of $2.36/kg and $0.78/kg, respectively, may be obtainable with this recovery method.

  4. The Paleozoic origin of enzymatic mechanisms for lignin degradation reconstructed using 31 fungal genomes

    SciTech Connect (OSTI)

    Floudas, Dimitrios; Binder, Manfred; Riley, Robert; Barry, Kerrie; Blanchette, Robert A; Henrissat, Bernard; Martinez, Angel T.; Otillar, Robert; Spatafora, Joseph W.; Yadav, Jagit S.; Aerts, Andrea; Benoit, Isabelle; Boyd, Alex; Carlson, Alexis; Copeland, Alex; Coutinho, Pedro M.; de Vries, Ronald P.; Ferreira, Patricia; Findley, Keisha; Foster, Brian; Gaskell, Jill; Glotzer, Dylan; Gorecki, Pawel; Heitman, Joseph; Hesse, Cedar; Hori, Chiaki; Igarashi, Kiyohiko; Jurgens, Joel A.; Kallen, Nathan; Kersten, Phil; Kohler, Annegret; Kues, Ursula; Kumar, T. K. Arun; Kuo, Alan; LaButti, Kurt; Larrondo, Luis F.; Lindquist, Erika; Ling, Albee; Lombard, Vincent; Lucas, Susan; Lundell, Taina; Martin, Rachael; McLaughlin, David J.; Morgenstern, Ingo; Morin, Emanuelle; Murat, Claude; Nagy, Laszlo G.; Nolan, Matt; Ohm, Robin A.; Patyshakuliyeva, Aleksandrina; Rokas, Antonis; Ruiz-Duenas, Francisco J.; Sabat, Grzegorz; Salamov, Asaf; Samejima, Masahiro; Schmutz, Jeremy; Slot, Jason C.; St. John, Franz; Stenlid, Jan; Sun, Hui; Sun, Sheng; Syed, Khajamohiddin; Tsang, Adrian; Wiebenga, Ad; Young, Darcy; Pisabarro, Antonio; Eastwood, Daniel C.; Martin, Francis; Cullen, Dan; Grigoriev, Igor V.; Hibbett, David S.

    2012-03-12

    Wood is a major pool of organic carbon that is highly resistant to decay, owing largely to the presence of lignin. The only organisms capable of substantial lignin decay are white rot fungi in the Agaricomycetes, which also contains non?lignin-degrading brown rot and ectomycorrhizal species. Comparative analyses of 31 fungal genomes (12 generated for this study) suggest that lignin-degrading peroxidases expanded in the lineage leading to the ancestor of the Agaricomycetes, which is reconstructed as a white rot species, and then contracted in parallel lineages leading to brown rot and mycorrhizal species. Molecular clock analyses suggest that the origin of lignin degradation might have coincided with the sharp decrease in the rate of organic carbon burial around the end of the Carboniferous period.

  5. Down-regulation of p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H) and cinnamate 4-hydroxylase (C4H) genes in the lignin biosynthetic pathway of Eucalyptus urophylla x E. grandis leads to improved sugar release

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sykes, Robert W.; Gjersing, Erica L.; Foutz, Kirk; Rottmann, William H.; Kuhn, Sean A.; Foster, Cliff E.; Ziebell, Angela; Turner, Geoffrey B.; Decker, Stephen R.; Hinchee, Maud A. W.; et al

    2015-08-27

    In this study, lignocellulosic materials provide an attractive replacement for food-based crops used to produce ethanol. Understanding the interactions within the cell wall is vital to overcome the highly recalcitrant nature of biomass. One factor imparting plant cell wall recalcitrance is lignin, which can be manipulated by making changes in the lignin biosynthetic pathway. In this study, eucalyptus down-regulated in expression of cinnamate 4-hydroxylase (C4H, EC 1.14.13.11) or p-coumaroyl quinate/shikimate 3'-hydroxylase (C3'H, EC 1.14.13.36) were evaluated for cell wall composition and reduced recalcitrance.

  6. Lignin-assisted coal depolymerization. [Final] technical report, September 1, 1991--August 31, 1992

    SciTech Connect (OSTI)

    Lalvani, S.B.; Muchmore, C.B.; Koropchak, J.A.; Kim, Jong Won

    1992-12-31

    Liquefaction of an Illinois bituminous and a caustic lignin was studied in an initial hydrogen pressure of 140 psig. Experiments were conducted in the temperature range of 325-375{degree}C in tetralin. The addition of lignin to coal was found to be synergistic in that it significantly improves the quality and yield of the liquid products obtained. Kinetic data for coal conversion enhancement due to lignin addition were obtained. A mathematical model describing the reaction chemistry, using lignin, has been proposed and developed. The analysis of the results indicates that the intermediates produced from lignin were responsible for enhancement in coal depolymerization rate, however, the intermediates are short-lived as compared to the time needed for a significant coal conversion yield. Coal depolymerization rate was found to be a function of time; compared to processing coal alone, it doubled upon reacting coal with lignin at 375{degree}C and after 67 minutes from the beginning of the experiment. Overall mass recoveries of 95--98% of the total mass charged to the reactor were obtained. A careful statistical analysis of the data shows that coal depolymerization yield is enhanced by 11.9% due to the lignin addition. The liquids obtained were examined for their elemental composition, and molecular weight determination by size exclusion chromatography. The stability of liquid products was characterized by determining their solubility in pentane and benzene, and by evaluating the molecular weight.

  7. Recent Progress in Producing #11;Lignin-Based Carbon Fibers for Functional Applications

    SciTech Connect (OSTI)

    Paul, Ryan; Burwell, Deanna; Dai, Xuliang; Naskar, Amit; Gallego, Nidia; Akato, Kokouvi

    2015-10-29

    Lignin, a biopolymer, has been investigated as a renewable and low-cost carbon fiber precursor since the 1960s. Although successful lab-scale production of lignin-based carbon fibers has been reported, there are currently not any commercial producers. This paper will highlight some of the known challenges with converting lignin-based precursors into carbon fiber, and the reported methods for purifying and modifying lignin to improve it as a precursor. Several of the challenges with lignin are related to its diversity in chemical structure and purity, depending on its biomass source (e.g. hardwood, softwood, grasses) and extraction method (e.g. organosolv, kraft). In order to make progress in this field, GrafTech and Oak Ridge National Laboratory are collaborating to develop lignin-based carbon fiber technology and to demonstrate it in functional applications, as part of a cooperative agreement with the DOE Advanced Manufacturing Office. The progress made to date with producing lignin-based carbon fiber for functional applications, as well as developing and qualifying a supply chain and value proposition, are also highlighted.

  8. Mechanistic Investigation of Acid-Catalyzed Cleavage of Aryl-Ether Linkages: Implications for Lignin Depolymerization

    SciTech Connect (OSTI)

    Sturgeon, M. R.; Kim, S.; Chmely, S. C.; Foust, T. D.; Beckham, G. T.

    2013-01-01

    Carbon-oxygen bonds are the primary inter-monomer linkages lignin polymers in plant cell walls, and as such, catalyst development to cleave these linkages is of paramount importance to deconstruct biomass to its constituent monomers for the production of renewable fuels and chemicals. For many decades, acid catalysis has been used to depolymerize lignin. Lignin is a primary component of plant cell walls, which is connected primarily by aryl-ether linkages, and the mechanism of its deconstruction by acid is not well understood, likely due to its heterogeneous and complex nature compared to cellulose. For effective biomass conversion strategies, utilization of lignin is of significant relevance and as such understanding the mechanisms of catalytic lignin deconstruction to constituent monomers and oligomers is of keen interest. Here, we present a comprehensive experimental and theoretical study of the acid catalysis of a range of dimeric species exhibiting the b-O-4 linkage, the most common inter-monomer linkage in lignin. We demonstrate that the presence of a phenolic species dramatically increases the rate of cleavage in acid at 150 degrees C. Quantum mechanical calculations on dimers with the para-hydroxyl group demonstrate that this acid-catalyzed pathway differs from the nonphenolic dimmers. Importantly, this result implies that depolymerization of native lignin in the plant cell wall will proceed via an unzipping mechanism wherein b-O-4 linkages will be cleaved from the ends of the branched, polymer chains inwards toward the center of the polymer. To test this hypothesis further, we synthesized a homopolymer of b-O-4 with a phenolic hydroxyl group, and demonstrate that it is cleaved in acid from the end containing the phenolic hydroxyl group. This result suggests that genetic modifications to lignin biosynthesis pathways in plants that will enable lower severity processes to fractionate lignin for upgrading and for easier access to the carbohydrate fraction of the plant cell wall.

  9. Use and value of reactive lignin. Final report

    SciTech Connect (OSTI)

    Frank, M.E.; Mednick, R.L.; Stern, K.M.

    1988-03-01

    New York State has ample reserves of wood that are not suitable for lumber nor paper making. The Energy Authority has several research projects to utilize wood for the production of fuels and energy intensive chemicals. The Energy Authority and Chem Systems set out to characterize the market potential for lignins derived as by-products of wood-to-ethanol processes. Based on these analyses and subsequent ranking of the potential applications, three end uses (Phenol-Formaldehyde resin adhesives, carbon black substitutes and diesel fuel cetane enhancers) were characterized as having a high potential of commercial success. Epoxies were characterized as having a low potential. The prospects of the remaining end uses (activated carbon replacements, polyurethanes, dietary adsorbents, phenol/benzene and asphalt extenders) were classified as intermediate, along with those of the Urea-Formaldehyde resin portion of the adhesive market.

  10. Controlling porosity in lignin-derived nanoporous carbon for supercapacitor applications

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jeon, Ju-Won; Zhang, Libing; Lutkenhaus, Jodie L.; Laskar, Dhrubojyoti D.; Lemmon, John P.; Choi, Daiwon; Nandasiri, Manjula I.; Hashmi, Ali; Xu, Jie; Motkuri, Radha K.; et al

    2015-02-01

    Low-cost renewable lignin has been used as a precursor to produce porous carbons. However, to date, it has not been easy to obtain high surface area porous carbon without activation processes or templating agents. Here, we demonstrate that low molecular weight lignin yields highly porous carbon (1092 m² g⁻¹) with more graphitization through direct carbonization without additional activation processes or templating agents. We found that molecular weight and oxygen consumption during carbonization are critical factors to obtain high surface area, graphitized porous carbons. This highly porous carbon from low-cost renewable lignin sources is a good candidate for supercapacitor electrode materials.

  11. Modification of Lignin by Protein Cross-linking to Facilitate Production of

    Office of Scientific and Technical Information (OSTI)

    Biofuels From Poplar (Technical Report) | SciTech Connect Technical Report: Modification of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar Citation Details In-Document Search Title: Modification of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar The limited supply of fossil fuels and the associated environmental issues associated with their utilization has resulted in much effort put forth to promote renewable resources of

  12. Center for Nanophase Materials Sciences (CNMS) - ORNL develops lignin-based

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    thermoplastic conversion process ORNL DEVELOPS LIGNIN-BASED THERMOPLASTIC CONVERSION PROCESS (Newswise) Turning lignin, a plant's structural "glue" and a byproduct of the paper and pulp industry, into something considerably more valuable is driving a research effort headed by Amit Naskar of Oak Ridge National Laboratory... Other ORNL authors are Tomonori Saito, Rebecca Brown, Marcus Hunt, Deanna Pickel, Joseph Pickel, Jamie Messman, Frederick Baker and Martin Keller. The research

  13. NREL Refines Method to Convert Lignin to Nylon Precursor - News Releases |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NREL Refines Method to Convert Lignin to Nylon Precursor Recent Findings Published in Energy & Environmental Science February 26, 2015 A new study from the Energy Department's National Renewable Energy Laboratory (NREL) demonstrates the conversion of lignin-derived compounds to adipic acid, an important industrial dicarboxylic acid produced for its use as a precursor to nylon, plasticizers, lubricants, polyesters, and other popular products and chemicals. The demonstration is an

  14. Modification of Lignin by Protein Cross-linking to Facilitate Production of

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Biofuels From Poplar (Technical Report) | SciTech Connect Modification of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar Citation Details In-Document Search Title: Modification of Lignin by Protein Cross-linking to Facilitate Production of Biofuels From Poplar The limited supply of fossil fuels and the associated environmental issues associated with their utilization has resulted in much effort put forth to promote renewable resources of energy. Switching to

  15. Characterization of Lignin Derived from Water-only and Dilute Acid Flowthrough Pretreatment of Poplar Wood at Elevated Temperatures

    SciTech Connect (OSTI)

    Zhang, Libing; Yan, Lishi; Wang, Zheming; Laskar, Dhrubojyoti D.; Swita, Marie S.; Cort, John R.; Yang, Bin

    2015-12-01

    Background: Flowthrough pretreatment of biomass has high potential to valorize lignin derivatives to high-value products, which is vital to enhance the economy of biorefinery plants. Comprehensive understanding of lignin behaviors and solubilization chemistry in aqueous pretreatment such as water-only and dilute acid flowthrough pretreatment is of fundamental importance to achieve the goal of providing flexible platform for lignin utilization. Results: In this study, the effects of flowthrough pretreatment conditions on lignin separation from poplar wood were reported as well as the characteristics of three sub-sets of lignin produced from the pretreatment, including residual lignin in pretreated solid residues (ReL), recovered insoluble lignin in pretreated liquid (RISL), and recovered soluble lignin in pretreatment liquid (RSL). Both the water-only and 0.05% (w/w) sulfuric acid pretreatments were performed at temperatures from 160 to 270°C on poplar wood in a flowthrough reactor system for 2-10 min. Results showed that water-only flowthrough pretreatment primarily removed syringyl (S units). Increased temperature and/or the addition of sulfuric acid enhanced the removal of guaiacyl (G units) compared to water-only pretreatments at lower temperatures, resulting in nearly complete removal of lignin from the biomass. Results also suggested that more RISL was recovered than ReL and RSL in both dilute acid and water-only flowthrough pretreatment at elevated temperatures. NMR spectra of the RISL revealed significant ?-O-4 cleavage, ?-? deoxygenation to form cinnamyl-like end groups, and slight ?-5 repolymerization in both water-only and dilute acid flowthrough pretreatments. Conclusions: Elevated temperature and/or dilute acid greatly enhanced lignin removal to almost 100% by improving G unit removal besides S unit removal in flowthrough system. A new lignin chemistry transformation pathway was proposed and revealed the complexity of lignin structural change during hot water and dilute acid flowthrough pretreatment.

  16. Lignin-assisted coal depolymerization. [Quarterly] report, March 1, 1992--May 31, 1992

    SciTech Connect (OSTI)

    Lalvani, S.B.; Muchmore, C.B.; Koropchak, J.A.; Kim, Jong Won

    1992-10-01

    In the last report, it was shown that when lignin is added to coal, the rate of coal depolymerization is enhanced. The results,-reported were based upon a number of experiments conducted for the following three reasons: (i) to generate enough quantities of liquid products so that their stability in various environments can be ascertained, (ii) to closely characterize the reaction products, so that individual atomic mass balances can be performed, and (iii) to determine the reproducibility of the experiments conducted. The stability of liquid products was characterized by determining their solubility in pentane and benzene. Exposure of the coal- and coal+lignin-derived liquids to air at 40 and 80{degrees}C led to a decrease in the pentane-soluble and asphaltene fractions with a concomitant enhancement in the benzene insoluble fraction. However, relatively no degradation was observed for the liquid samples exposed to an inert (N{sub 2}) atmosphere. Preliminary data show that the coal+lignin-derived liquids are more stable than that obtained by coal liquefaction. In this quarterly report, individual atomic mass balances on various experiments conducted with coal, lignin and coal+lignin mixtures are also reported. Although the overall mass recoveries of 95--98% of the total mass charged to the reactor were obtained, the atomic mass balance data are somewhat difficult to interpret due to the possible incorporation of tetralin (solvent) in the reaction products.

  17. Lignin-assisted coal depolymerization. Technical report, September 1, 1991--November 30, 1991

    SciTech Connect (OSTI)

    Lalvani, S.B.

    1991-12-31

    Previous research has shown that addition of lignin-derived liquids to coal stirred in tetralin under mild reaction conditions (375{degree}C and 300--500 psig) results in a marked enhancement in the rate of coal depolymerization. A mathematical model was developed to study the kinetics of coal depolymerization in the presence of liquid-derived liquids. In the present study, a reaction pathway was formulated to explain the enhancement in coal depolymerization due to lignin (solid) addition. The model postulated assumes that the products of lignin obtained during thermolysis interact with the reactive moieties present in coal while simultaneous depolymerization of coal occurs. A good fit between the experimental data and the kinetic model was found. The results show that in addition to the enhancement in the rate of coal depolymerization, lignin also reacts (and enhances the extent of depolymerization of coal) with those reaction sites in coal that are not susceptible to depolymerization when coal alone is reacted in tetralin under identical reaction conditions. Additional work is being carried out to determine a thorough materials balance on the lignin-assisted coal depolymerization process. A number of liquid samples have been obtained which are being studied for their stability in various environments. 5 refs., 4 figs., 1 tab.

  18. Top Value-Added Chemicals from Biomass - Volume II—Results of Screening for Potential Candidates from Biorefinery Lignin

    SciTech Connect (OSTI)

    Holladay, John E.; White, James F.; Bozell, Joseph J.; Johnson, David

    2007-10-01

    This report evaluates lignin’s role as a renewable raw material resource. Opportunities that arise from utilizing lignin fit into one of three categories: 1)power, fuel and syngas (generally near-term opportunities) 2) macromolecules (generally medium-term opportunities) 3) aromatics and miscellaneous monomers (long-term opportunities). Biorefineries will receive and process massive amounts of lignin. For this reason, how lignin can be best used to support the economic health of the biorefinery must be defined. An approach that only considers process heat would be shortsighted. Higher value products present economic opportunities and the potential to significantly increase the amount of liquid transportation fuel available from biomass. In this analysis a list of potential uses of lignin was compiled and sorted into “product types” which are broad classifications (listed above as power—fuel—syngas; macromolecules; and aromatics). In the first “product type” (power—fuel—gasification) lignin is used purely as a carbon source and aggressive means are employed to break down its polymeric structure. In the second “product type” (macromolecules) the opposite extreme is considered and advantage of the macromolecular structure imparted by nature is retained in high-molecular weight applications. The third “product type” (aromatics) lies somewhere between the two extremes and employs technologies that would break up lignin’s macromolecular structure but maintain the aromatic nature of the building block molecules. The individual opportunities were evaluated based on their technical difficulty, market, market risk, building block utility, and whether a pure material or a mixture would be produced. Unlike the “Sugars Top 10” report it was difficult to identify the ten best opportunities, however, the potential opportunities fell nicely into near-, medium- and long-term opportunities. Furthermore, the near-, medium- and long-term opportunities roughly align with the three “product types.” From this analysis a list of technical barriers was developed which can be used to identify research needs. Lignin presents many challenges for use in the biorefinery. Chemically it differs from sugars having a complex aromatic substructure. Unlike cellulose, which has a relatively simple substructure of glucose subunits, lignin has a high degree of variability in its structure which differs both from biomass source and from the recovery process used. In addition to its variability lignin is also reactive and to some degree less stable thermally and oxidatively to other biomass streams. What this means is that integrating a lignin process stream within the biorefinery will require identifying the best method to separate lignin from biomass cost-effectively.

  19. NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin (Journal

    Office of Scientific and Technical Information (OSTI)

    Article) | SciTech Connect NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin Citation Details In-Document Search Title: NMR Characterization of C3H and HCT Down-Regulated Alfalfa Lignin Authors: Yunqiao,Pu ; Fang,Chen ; Angela,Ziebell ; Brian H.,Davison ; Arthur J.,Ragauskas ; , Publication Date: 2009-12-01 OSTI Identifier: 1151964 Resource Type: Journal Article Resource Relation: Journal Name: BioEnergy Research; Journal Volume: 2; Journal Issue: 4 Research Org: BioEnergy

  20. Method of separating lignocellulosic material into lignin, cellulose and dissolved sugars

    DOE Patents [OSTI]

    Black, Stuart K. (Denver, CO); Hames, Bonnie R. (Westminster, CO); Myers, Michele D. (Dacono, CO)

    1998-01-01

    A method for separating lignocellulosic material into (a) lignin, (b) cellulose, and (c) hemicellulose and dissolved sugars. Wood or herbaceous biomass is digested at elevated temperature in a single-phase mixture of alcohol, water and a water-immiscible organic solvent (e.g., a ketone). After digestion, the amount of water or organic solvent is adjusted so that there is phase separation. The lignin is present in the organic solvent, the cellulose is present in a solid pulp phase, and the aqueous phase includes hemicellulose and any dissolved sugars.

  1. Method of separating lignocellulosic material into lignin, cellulose and dissolved sugars

    DOE Patents [OSTI]

    Black, S.K.; Hames, B.R.; Myers, M.D.

    1998-03-24

    A method is described for separating lignocellulosic material into (a) lignin, (b) cellulose, and (c) hemicellulose and dissolved sugars. Wood or herbaceous biomass is digested at elevated temperature in a single-phase mixture of alcohol, water and a water-immiscible organic solvent (e.g., a ketone). After digestion, the amount of water or organic solvent is adjusted so that there is phase separation. The lignin is present in the organic solvent, the cellulose is present in a solid pulp phase, and the aqueous phase includes hemicellulose and any dissolved sugars.

  2. New perspective on glycoside hydrolase binding to lignin from pretreated corn stover

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Yarbrough, John M.; Mittal, Ashutosh; Mansfield, Elisabeth; Taylor, II, Larry E.; Hobdey, Sarah E.; Sammond, Deanne W.; Bomble, Yannick J.; Crowley, Michael F.; Decker, Stephen R.; Himmel, Michael E.; et al

    2015-12-18

    In this study, non-specific binding of cellulases to lignin has been implicated as a major factor in the loss of cellulase activity during biomass conversion to sugars. It is believed that this binding may strongly impact process economics through loss of enzyme activities during hydrolysis and enzyme recycling scenarios. The current model suggests glycoside hydrolase activities are lost though non-specific/non-productive binding of carbohydrate-binding domains to lignin, limiting catalytic site access to the carbohydrate components of the cell wall.

  3. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","Connecticut Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic...

  4. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    ,"Worksheet Name","Description"," Of Series","Frequency","Latest Data for" ,"Data 1","North Carolina Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic...

  5. Reductive deconstruction of organosolv lignin catalyzed by zeolite supported nickel nanoparticles

    SciTech Connect (OSTI)

    Kasakov, Stanislav; Shi, Hui; Camaioni, Donald M.; Zhao, Chen; Barath, Eszter; Jentys, Andreas; Lercher, Johannes A.

    2015-11-01

    Mechanistic aspects of deconstruction and hydrodeoxygenation of organosolv lignin using supported Ni catalysts with (Ni/HZSM-5 and Ni/HBEA) and without Brønsted acid sites (Ni/SiO2) are reported. Lignin was deconstructed and converted to saturated cyclic hydrocarbons ranging from C5 to C14. In the one-stage reaction, full conversion with total yield of 70 ± 5 wt.% saturated hydrocarbons was achieved at 593 K and 20 bar H2. The organosolv lignin used consists of seven to eight monolignol subunits and has an average molecular weight of ca. 1200 g mol-1. The monolignols were mainly guaiacyl, syringyl and phenylcoumaran, randomly interconnected through β-O-4, 4-O-5, β-1, 5-5’ and β-β ether bonds. In situ IR spectroscopy was used to follow the changes in lignin constituents during reaction. The proposed reaction pathways for the catalytic transformation of this organosolv lignin to alkanes start with the hydrogenolysis of aryl alkyl ether bonds, followed by hydrogenation of the aromatic compounds on Ni to cyclic alcohols. Oxygen is removed from the alcohols via dehydration on Brønsted acid sites to yield cyclic alkenes that are further hydrogenated to alkanes. Formation of condensation products may occur via intermolecular recombination of aromatic monomers or alkylation of aromatic compounds by alkenes. The financial support from TUM-PNNL cooperation project “Development of new methods for in situ characterization in liquid phase reactions” (CN-177939) is highly appreciated. The work by S.K., H.S., and J.A.L was partially supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences.

  6. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    ,,"(202) 586-8800",,,"10272015 9:02:05 AM" "Back to Contents","Data 1: Crude Oil Production" "Sourcekey","MCRFPUS1","MCRFPP11","MCRFPFL1","MCRFPNY1","MCRFPPA1","MCRFPV...

  7. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    ,,"(202) 586-8800",,,"10272015 9:02:06 AM" "Back to Contents","Data 1: Crude Oil Production" "Sourcekey","MCRFPUS1","MCRFPP11","MCRFPFL1","MCRFPNY1","MCRFPPA1","MCRFPV...

  8. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    to Contents","Data 1: U.S. Refinery & Blender Net Input" "Sourcekey","MTTRIUS1","MCRRIU... "Date","U.S. Refinery and Blender Net Input of Crude Oil and Petroleum ...

  9. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    ...201982" ,"Data 2","Refiner and Blender Net Inputs",6,"Weekly","3182016","49... "Back to Contents","Data 2: Refiner and Blender Net Inputs" "Sourcekey","WBCRINUS2","W...

  10. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    to Contents","Data 1: U.S. Refinery and Blender Net Production" "Sourcekey","MTTRPUS1","M... "Date","U.S. Refinery and Blender Net Production of Crude Oil and Petroleum ...

  11. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Contents","Data 1: Spot Price" "Sourcekey","RNGWHHD","NGMEPG0PLCNUSDMMBTU" "Date","Henry Hub Natural Gas Spot Price (Dollars per Million Btu)","U.S. Natural Gas Liquid ...

  12. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    AM" "Back to Contents","Data 1: Price of Liquefied U.S. Natural Gas Re-Exports to Brazil (Dollars per Thousand Cubic Feet)" "Sourcekey","NGMEPG0ERENUS-NBRDMCF"...

  13. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    AM" "Back to Contents","Data 1: Liquefied U.S. Natural Gas Exports by Vessel to Japan (Million Cubic Feet)" "Sourcekey","NGMEPG0EVENUS-NJAMMCF" "Date","Liquefied U.S....

  14. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    "Back to Contents","Data 1: Price of Liquefied U.S. Natural Gas Exports by Vessel to Japan (Dollars per Thousand Cubic Feet)" "Sourcekey","NGMEPG0EVENUS-NJADMCF"...

  15. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    AM" "Back to Contents","Data 1: Price of Liquefied U.S. Natural Gas Re-Exports to Japan (Dollars per Thousand Cubic Feet)" "Sourcekey","NGMEPG0ERENUS-NJADMCF"...

  16. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    ..."Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"2262016 2:17:08 PM" "Back to Contents","Data 1: Natural Gas Underground Storage ...

  17. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Consumption of Heat Content of Natural Gas (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","U.S. Total Consumption of Heat Content of Natural Gas (BTU per Cubic Foot)",1,"Annual",2014 ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  18. Determination of Structural Carbohydrates and Lignin in Biomass: Laboratory Analytical Procedure (LAP) (Revised July 2011)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Determination of Structural Carbohydrates and Lignin in Biomass Laboratory Analytical Procedure (LAP) Issue Date: April 2008 Revision Date: August 2012 (Version 08-03-2012) A. Sluiter, B. Hames, R. Ruiz, C. Scarlata, J. Sluiter, D. Templeton, and D. Crocker Technical Report NREL/TP-510-42618 Revised August 2012 NREL is a national laboratory of the U.S. Department of Energy, Office of Energy Efficiency & Renewable Energy, operated by the Alliance for Sustainable Energy, LLC. National

  19. "Bionic" Liquids from Lignin: Joint BioEnergy Institute Results Pave

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the Way for Closed-Loop Biofuel Refineries Bionic" Liquids from Lignin: Joint BioEnergy Institute Results Pave the Way for Closed-Loop Biofuel Refineries - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure

  20. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    SciTech Connect (OSTI)

    D Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  1. Differential Expression in Phanerochaete chrysosporium of Membrane-Associated Proteins Relevant to Lignin Degradation

    SciTech Connect (OSTI)

    Shary, Semarjit; Kapich, Alexander N.; Panisko, Ellen A.; Magnuson, Jon K.; Cullen, Dan; Hammel, Ken

    2008-10-02

    Fungal lignin-degrading systems must include membrane-associated proteins that participate in diverse processes such as uptake and oxidation of lignin fragments, secretion of ligninolytic secondary metabolites, and defense of the mycelium against ligninolytic oxidants. Despite their importance, little is known about the nature or regulation of these membrane-associated components. We grew the white rot basidiomycete Phanerochaete chrysosporium on cellulose or glucose as the carbon source and monitored the mineralization of a 14C-labeled synthetic lignin by these cultures to assess their ligninolytic competence. The results showed that the cellulose-grown cultures were ligninolytic, whereas the glucose-grown ones were not. We isolated microsomal membrane fractions from both types of culture and analyzed tryptic digests of them by shotgun liquid chromatography/tandem mass spectrometry. Comparison of the results against the predicted P. chrysosporium proteome showed that a catalase (Joint Genome Institute P. chrysosporium protein I.D. 124398), an alcohol oxidase (126879), two transporters (137220 and 132234), and two cytochrome P450s (5011 and 8912) were up-regulated under ligninolytic conditions. Real time reverse transcription polymerase chain reaction assays showed that RNA transcripts encoding all of these proteins were also up-regulated in ligninolytic cultures. Catalase 124398, alcohol oxidase 126879, and transporter 137220 were found in a proteomic analysis of partially purified plasma membranes from ligninolytic P. chrysosporium, and are therefore most likely associated with the outer envelope of the fungus.

  2. Radical Coupling Reactions in Lignin Synthesis: A Density Functional Theory Study

    SciTech Connect (OSTI)

    Sangha, A. K.; Parks, J. M.; Standaert, R. F.; Ziebell, A.; Davis, M.; Smith, J. C.

    2012-04-26

    Lignin is a complex, heterogeneous polymer in plant cell walls that provides mechanical strength to the plant stem and confers resistance to degrading microbes, enzymes, and chemicals. Lignin synthesis initiates through oxidative radical-radical coupling of monolignols, the most common of which are p-coumaryl, coniferyl, and sinapyl alcohols. Here, we use density functional theory to characterize radical-radical coupling reactions involved in monolignol dimerization. We compute reaction enthalpies for the initial self- and cross-coupling reactions of these monolignol radicals to form dimeric intermediates via six major linkages observed in natural lignin. The 8-O-4, 8-8, and 8-5 coupling are computed to be the most favorable, whereas the 5-O-4, 5-5, and 8-1 linkages are less favorable. Overall, p-coumaryl self- and cross-coupling reactions are calculated to be the most favorable. For cross-coupling reactions, in which each radical can couple via either of the two sites involved in dimer formation, the more reactive of the two radicals is found to undergo coupling at its site with the highest spin density.

  3. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbblpd_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_cons_psup_dc_nus_mbblpd_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 2:54:27 PM" "Back to Contents","Data 1: U.S. Product Supplied for Crude Oil and Petroleum Products"

  4. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbblpd_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_move_exp_dc_nus-z00_mbblpd_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 2:56:04 PM" "Back to Contents","Data 1: U.S. Exports of Crude Oil and Petroleum Products"

  5. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbblpd_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_move_imp_dc_nus-z00_mbblpd_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 3:35:39 PM" "Back to Contents","Data 1: U.S. Imports of Crude Oil and Petroleum Products"

  6. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Consumers",52,"Monthly","12/2015","01/15/2012" ,"Data 2","Heat Content of Natural Gas Delivered to Consumers",52,"Annual",2015,"06/30/2003" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016" ,"Excel File Name:","ngm25vmall.xls" ,"Available from Web

  7. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbbl_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_cons_psup_dc_nus_mbbl_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 2:54:26 PM" "Back to Contents","Data 1: U.S. Product Supplied for Crude Oil and Petroleum Products"

  8. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbbl_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_move_exp_dc_nus-z00_mbbl_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 2:56:03 PM" "Back to Contents","Data 1: U.S. Exports of Crude Oil and Petroleum Products"

  9. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbbl_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_move_imp_dc_nus-z00_mbbl_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 3:35:17 PM" "Back to Contents","Data 1: U.S. Imports of Crude Oil and Petroleum Products"

  10. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Alaska Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  11. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Alabama Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  12. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Arkansas Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  13. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Arizona Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  14. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","California Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  15. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Colorado Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  16. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","District of Columbia Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  17. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Delaware Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  18. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Florida Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  19. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Georgia Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  20. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Hawaii Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  1. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Iowa Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  2. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Idaho Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  3. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Illinois Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  4. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Indiana Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  5. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Kansas Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  6. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Kentucky Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  7. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Louisiana Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  8. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Massachusetts Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  9. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Maryland Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  10. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Maine Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  11. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Michigan Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  12. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Minnesota Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  13. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Missouri Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  14. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Mississippi Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  15. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Montana Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  16. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","North Dakota Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  17. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Nebraska Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  18. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","New Hampshire Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  19. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","New Jersey Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  20. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","New Mexico Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  1. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Nevada Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  2. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","New York Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  3. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Ohio Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  4. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Oklahoma Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  5. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Oregon Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  6. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Pennsylvania Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  7. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Rhode Island Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  8. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","South Carolina Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  9. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","South Dakota Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  10. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Tennessee Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  11. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Texas Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  12. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Utah Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  13. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Virginia Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  14. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Vermont Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  15. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Washington Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  16. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Wisconsin Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  17. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","West Virginia Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release

  18. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Deliveries to Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Wyoming Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot)",1,"Monthly","12/2015" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  19. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Other Sectors Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","U.S. Heat Content of Natural Gas Deliveries to Other Sectors Consumers (BTU per Cubic Foot)",1,"Annual",2014 ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  20. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Electric Power Consumers (BTU per Cubic Foot)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","U.S. Heat Content of Natural Gas Deliveries to Electric Power Consumers (BTU per Cubic Foot)",1,"Annual",2014 ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016"

  1. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Consumed" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","District of Columbia Heat Content of Natural Gas Consumed",1,"Monthly","12/2015","01/15/2013" ,"Release Date:","02/29/2016" ,"Next Release Date:","03/31/2016" ,"Excel File

  2. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbblpd_a.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_crd_crpdn_adc_mbblpd_a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 2:54:42 PM" "Back to Contents","Data 1: Crude Oil Production"

  3. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    mbbl_a.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/pet/pet_crd_crpdn_adc_mbbl_a.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"3/9/2016 2:54:41 PM" "Back to Contents","Data 1: Crude Oil Production"

  4. Catalytic Hydrothermal Gasification of Lignin-Rich Biorefinery Residues and Algae Final Report

    SciTech Connect (OSTI)

    Elliott, Douglas C.; Neuenschwander, Gary G.; Hart, Todd R.; Rotness, Leslie J.; Zacher, Alan H.; Santosa, Daniel M.; Valkenburt, Corinne; Jones, Susanne B.; Tjokro Rahardjo, Sandra A.

    2009-11-03

    This report describes the results of the work performed by PNNL using feedstock materials provided by the National Renewable Energy Laboratory, KL Energy and Lignol lignocellulosic ethanol pilot plants. Test results with algae feedstocks provided by Genifuel, which provided in-kind cost share to the project, are also included. The work conducted during this project involved developing and demonstrating on the bench-scale process technology at PNNL for catalytic hydrothermal gasification of lignin-rich biorefinery residues and algae. A technoeconomic assessment evaluated the use of the technology for energy recovery in a lignocellulosic ethanol plant.

  5. Restricting lignin and enhancing sugar deposition in secondary cell walls enhances monomeric sugar release after low temperature ionic liquid pretreatment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Scullin, Chessa; Cruz, Alejandro G.; Chuang, Yi -De; Simmons, Blake A.; Loque, Dominique; Singh, Seema

    2015-07-04

    Lignocellulosic biomass has the potential to be a major source of renewable sugar for biofuel production. Before enzymatic hydrolysis, biomass must first undergo a pretreatment step in order to be more susceptible to saccharification and generate high yields of fermentable sugars. Lignin, a complex, interlinked, phenolic polymer, associates with secondary cell wall polysaccharides, rendering them less accessible to enzymatic hydrolysis. Herein, we describe the analysis of engineered Arabidopsis lines where lignin biosynthesis was repressed in fiber tissues but retained in the vessels, and polysaccharide deposition was enhanced in fiber cells with little to no apparent negative impact on growth phenotype.

  6. Restricting lignin and enhancing sugar deposition in secondary cell walls enhances monomeric sugar release after low temperature ionic liquid pretreatment

    SciTech Connect (OSTI)

    Scullin, Chessa; Cruz, Alejandro G.; Chuang, Yi -De; Simmons, Blake A.; Loque, Dominique; Singh, Seema

    2015-07-04

    Lignocellulosic biomass has the potential to be a major source of renewable sugar for biofuel production. Before enzymatic hydrolysis, biomass must first undergo a pretreatment step in order to be more susceptible to saccharification and generate high yields of fermentable sugars. Lignin, a complex, interlinked, phenolic polymer, associates with secondary cell wall polysaccharides, rendering them less accessible to enzymatic hydrolysis. Herein, we describe the analysis of engineered Arabidopsis lines where lignin biosynthesis was repressed in fiber tissues but retained in the vessels, and polysaccharide deposition was enhanced in fiber cells with little to no apparent negative impact on growth phenotype.

  7. Energy Crops Engineered for Increased Sugar Extraction through...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a superior biofuel feedstock. Until now, plants with decreased lignin content have exhibited defects such as reduced size or sturdiness that made them unsuitable biofuel ...

  8. Conceptual design assessment for the co-firing of bio-refinery supplied lignin project. Quarterly report, June 23--July 1, 2000

    SciTech Connect (OSTI)

    Berglund, T.; Ranney, J.T.; Babb, C.L.

    2000-07-27

    The Conceptual Design Assessment for the Co-Firing of Bio-Refinery Supplied Lignin Project was successfully kicked off on July 23, 2000 during a meeting at the TVA-PPI facility in Muscle Shoals, AL. An initial timeline for the study was distributed, issues of concern were identified and a priority actions list was developed. Next steps include meeting with NETL to discuss de-watering and lignin fuel testing, the development of the mass balance model and ethanol facility design criteria, providing TVA-Colbert with preliminary lignin fuel analysis and the procurement of representative feed materials for the pilot and bench scale testing of the hydrolysis process.

  9. Base-Catalyzed Depolymerization of Lignin with Heterogeneous Catalysts: Cooperative Research and Development Final Report, CRADA Number CRD-13-513

    SciTech Connect (OSTI)

    Beckham, Gregg T.

    2015-08-04

    We will synthesize and screen solid catalysts for the depolymerization of lignin to monomeric and oligomeric oxygenated species, which could be fractionated and integrated into refinery intermediate streams for selective upgrading, or catalytically upgraded to fuels and chemicals. This work will primarily focus on the synthesis and application of layered double hydroxides (LDHs) as recyclable, heterogeneous catalysts for depolymerization of lignin model compounds and softwood lignin. LDHs have been shown in our group to offer good supports and catalysts to promote base-catalyzed depolymerization of lignin model compounds and in preliminary experiments for the depolymerization of lignin from an Organosolv process. We will also include additional catalyst supports such as silica, alumina, and carbon as identified in ongoing and past efforts at NREL. This work will consist of two tasks. Overall, this work will be synergistic with ongoing efforts at NREL, funded by the DOE Biomass Program, on the development of catalysts for lignin depolymerization in the context of biochemical and thermochemical conversion of corn stover and other biomass feedstocks to advanced fuels and chemicals.

  10. Studies on Supercapacitor Electrode Material from Activated Lignin-Derived Mesoporous Carbon

    SciTech Connect (OSTI)

    Saha, Dipendu; Li, Yunchao; Bi, Zhonghe; Chen, Jihua; Keum, Jong Kahk; Hensley, Dale K; Grappe, Hippolyte A.; Meyer III, Harry M; Dai, Sheng; Paranthaman, Mariappan Parans; Naskar, Amit K

    2014-01-01

    We synthesized mesoporous carbon from pre-cross-linked lignin gel impregnated with a surfactant as the pore-forming agent, and then activated the carbon through physical and chemical methods to obtain activated mesoporous carbon. The activated mesoporous carbons exhibited 1.5- to 6-fold increases in porosity with a maximum BET specific surface area of 1148 m2/g and a pore volume of 1.0 cm3/g. Slow physical activation helped retain dominant mesoporosity; however, aggressive chemical activation caused some loss of the mesopore volume fraction. Plots of cyclic voltammetric data with the capacitor electrode made from these carbons showed an almost rectangular curve depicting the behavior of ideal double-layer capacitance. Although the pristine mesoporous carbon exhibited the same range of surface-area-based capacitance as that of other known carbon-based supercapacitors, activation decreased the surface-area-based specific capacitance and increased the gravimetric-specific capacitance of the mesoporous carbons. Surface activation lowered bulk density and electrical conductivity. Warburg impedance as a vertical tail in the lower frequency domain of Nyquist plots supported good supercapacitor behavior for the activated mesoporous carbons. Our work demonstrated that biomass-derived mesoporous carbon materials continue to show potential for use in specific electrochemical applications.

  11. Advanced Recombinant Manganese Peroxidase for Biosynthesis of Lignin Bioproducts, Phase I Final Report, STTR Grant #: DE-SC0007503.

    SciTech Connect (OSTI)

    Beatty, Christopher; Kitner, Joshua; Lajoie, Curtis; McClain, Sean; Potochnik, Steve

    2012-12-13

    The core purpose of this Phase I STTR was to evaluate the feasibility of a new method of producing a recombinant version of manganese peroxidase (MnP) enzyme. MnP is a potentially valuable enzyme for producing high value lignin products and also for industrial de-coloring operations such as biobleaching of pulp and color removal from textile dye effluents. This lignin-modifying enzyme is produced in small amounts by the native host, a white rot fungus. Previous work by Oregon State University developed a secreted recombinant version of the enzyme in the yeast Pichia pastoris. Unfortunately, the expression is barely moderate and the enzyme is heavily glycosylated, which inhibits purification. In this work, the gene for the enzyme is given a tag which targets production of the enzyme to the peroxisome. This is a promising approach since this location is also where heme and hydrogen peroxide are sequestered, which are both necessary cofactors for MnP. More than ten recombinant strains were constructed, verified, and expressed in the Pichia system. Constitutive (GAP) and methanol-induced promoters (AOX) were tried for peroxisomal targeted, cytosolic, and secreted versions of MnP. Only the secreted strains showed activity. The amount of expression was not significantly changed. The degree of glycosylation was lessened using the AOX (methanol) promotoer, but the resulting enzyme was still not able to be purified using immobilized metal affinity chromatography. Additional work beyond the scope of the defined Phase I project was undertaken to construct, verify, and express Pichia strains that mutated the MnP glycosylation sites to inhibit this process. These strains did not show significant activity. The cause is not known, but it is possible that these sites are important to the structure of the enzyme. Also beyond the scope proposed for our Phase I STTR, the team collaborated with AbSci, a startup with a new E. coli based expression system focused on the production of antibodies and enzymes containing disulfide bonds and requiring folding/post-translational modification. With only limited time remaining in the Phase I schedule, a single construct was made to produce MnP with this system. The enzyme was produced in the soluble fraction of the cell lysate, but no activity was measured. MnP from the existing recombinant source was used to act on lignin. The lignin was from a Kraft process and had a molecular weight of about 10,000 Da. Using 1000 Da dialysis membranes and UV-visible spectroscopy, no modification of either lignin was evident in the dialysate or the retentate. Assays using 2,6 dimethoxy phenol (DMP) as a substrate showed consistent activity throughout the project. In summary, these results fell far short of our expectations. A Phase II proposal was not submitted. Possible reasons for the failure of peroxisomal targeting include destruction by native hydrogen peroxide, native proteases, or unforeseen causes. The AbSci system was only lighted tested and further work may yield a strain with active enzyme. The lack of evidence for lignin modification may be due to the techniques employed. NMR or GC-MS studies may reveal evidence of modification.

  12. CONTENT MODEL HOW-TO

    Energy Science and Technology Software Center (OSTI)

    003241MLTPL00 Content Model Guidelines  https://github.com/usgin/usginspecs/wiki/Content-Model-Guidelines 

  13. Effects of fungal degradation on the CuO oxidation products of lignin: A controlled laboratory study

    SciTech Connect (OSTI)

    Hedges, J.I.; Weliky, K.; Devol, A.H. ); Blanchette, R.A. )

    1988-11-01

    Duplicate samples of birch wood were degraded for 0, 4, 8 and 12 weeks by the white-rot fungus, Phlebia tremellosus, and for 12 weeks by 6 other white-rot and brown-rot fungi. P. tremellosus caused progressive weight losses and increased the H/C and O/C of the remnant wood by preferentially degrading the lignin component of the middle lamellae. Total yields of syringyl phenols were decreased 1.5 times as fast as total vanillyl phenol yields. Within both phenol families, aldehyde precursors were degraded faster than precursors of the corresponding ketones, which were obtained in constant proportion to the total phenol yield. Although two other white-rot fungi caused similar lignin compositional trends, a fourth white-rot species, Coriolus versicolor, simultaneously eroded all cell wall components and did not concentrate polysaccharides in the remnant wood. The brown-rot fungi also preferentially attacked syringyl structural units, but degraded all phenol precursors at a much slower rate than the white-rotters and did not produce excess vanillic acid. Degradation by P. tremellosus linearly increased the vanillic acid/vanillin ratio, (Ad/Al)v, of the remnant birch wood throughout the 12 week degradation study and exponentially decreased the absolute yields of total vanillyl phenols, total syringyl phenols and the syringyl/vanillyl phenol ratio, S/V. At the highest (Ad/Al)v of 0.50 total yields of syringyl and vanillyl phenols were decreased by 65% and 80%, respectively, with a resulting reduction of 40% in the original S/V. Many of the diagenetically related compositional trends that have been previously reported for lignins in natural environments can be explained by white-rot fungal degradation.

  14. Top Value-Added Chemicals from Biomass - Volume II„Results of Screening for Potential Candidates from Biorefinery Lignin

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Top Value-Added Chemicals from Biomass Volume II-Results of Screening for Potential Candidates from Biorefinery Lignin 1 JE Holladay 2 JJ Bozell 1 JF White 3 D Johnson 1 Pacific Northwest National Laboratory 2 University of Tennessee 3 National Renewable Energy Laboratory October 2007 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 PNNL-16983 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the

  15. Fermilab Today - Related Content

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Related Content Subscribe | Contact Fermilab Today | Archive | Classifieds Search GO Classifieds Director's Corner Physics in a Nutshell Frontier Science Result Tip of the Week...

  16. Table of Contents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TABLE OF CONTENTS INTRODUCTION J. B. Natowitz, Director SECTION I: NUCLEAR STRUCTURE, FUNDAMENTAL INTERACTIONS AND ASTROPHYSICS SECTION II: HEAVY ION REACTIONS SECTION III: NUCLEAR...

  17. TABLE OF CONTENTS

    National Nuclear Security Administration (NNSA)

    AC05-00OR22800 TABLE OF CONTENTS Contents Page # TOC - i SECTION A - SOLICITATION/OFFER AND AWARD ......................................................................... A-i SECTION B - SUPPLIES OR SERVICES AND PRICES/COSTS ........................................................ B-i B.1 SERVICES BEING ACQUIRED ....................................................................................B-2 B.2 TRANSITION COST, ESTIMATED COST, MAXIMUM AVAILABLE FEE, AND AVAILABLE FEE (Modification 295,

  18. Contents.key

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Paul Clavin Contents Combustion Waves and Fronts in Flows P. Clavin and G. Searby Cambridge University Press (to appear) Orders of magnitude 2 Lecture 1: 1-1: Overall...

  19. TABLE OF CONTENTS

    Energy Savers [EERE]

    008 High Temperature Superconductivity for Electric Systems Peer Review Final Report i TABLE OF CONTENTS High Temperature Superconductivity for Electric Systems Program Overview ...... 1 The Peer Review................................................................................................................ 3 Review Criteria ................................................................................................................. 5 Guidelines

  20. Table_of_Contents

    Energy Savers [EERE]

    Table of Contents 1. Physical Security .............................................................................................................................. 1-1 101. Headquarters Security Badges ........................................................................................ 101-1 102. HSPD-12 Badges and the PIV Process ........................................................................... 102-1 103. Prohibited Articles

  1. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect (OSTI)

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  2. Reduced waste generation, FY 1986

    SciTech Connect (OSTI)

    Not Available

    1986-02-01

    The United States Department of Energy is committed to the principles of minimizing the quantity and transuranic content of its transuranium (TRU) waste being generated at its nuclear facilities. The reasons are to reduce costs associated with waste handling and disposal, and also to reduce radiation exposure to workers and risk for radionuclide release to man and the environment. The purpose of this document is to provide the USDOE with a plan of research and development tasks for waste minimization, and is prepared so as to provide the maximum impact on volumes based on cost/benefit factors. The document is to be updated annually or as needed to reflect current and future tasks. The Reduced Waste Generation (RWG) tasks encompass a wide range of activities with the principal goals of (1) preventing the generation of waste and (2) converting TRU waste into low-level wastes (LLW) by sorting or decontamination. Concepts for reducing the volume such as in incineration and compaction are considered within the discipline of Reduced Waste Generation, but are considered as somewhat developed technology with only a need for implementation. 33 refs.

  3. Table of Contents

    Energy Savers [EERE]

    COMMUNICATIONS REQUIREMENTS OF SMART GRID TECHNOLOGIES October 5, 2010 i Table of Contents I. Introduction and Executive Summary.......................................................... 1 a. Overview of Smart Grid Benefits and Communications Needs................. 2 b. Summary of Recommendations .................................................................... 5 II. Federal Government Smart Grid Initiatives ................................................ 7 a. DOE Request for Information

  4. Chemical Characterization and Water Content Determination of Bio-Oils Obtained from Various Biomass Species using 31P NMR Spectroscopy

    SciTech Connect (OSTI)

    David, K.; Ben, H.; Muzzy, J.; Feik, C.; Iisa, K.; Ragauskas, A.

    2012-03-01

    Pyrolysis is a promising approach to utilize biomass for biofuels. One of the key challenges for this conversion is how to analyze complicated components in the pyrolysis oils. Water contents of pyrolysis oils are normally analyzed by Karl Fischer titration. The use of 2-chloro-4,4,5,5,-tetramethyl-1,3,2-dioxaphospholane followed by {sup 31}P NMR analysis has been used to quantitatively analyze the structure of hydroxyl groups in lignin and whole biomass. Results: {sup 31}P NMR analysis of pyrolysis oils is a novel technique to simultaneously characterize components and analyze water contents in pyrolysis oils produced from various biomasses. The water contents of various pyrolysis oils range from 16 to 40 wt%. The pyrolysis oils obtained from Loblolly pine had higher guaiacyl content, while that from oak had a higher syringyl content. Conclusion: The comparison with Karl Fischer titration shows that {sup 31}P NMR could also reliably be used to measure the water content of pyrolysis oils. Simultaneously with analysis of water content, quantitative characterization of hydroxyl groups, including aliphatic, C-5 substituted/syringyl, guaiacyl, p-hydroxyl phenyl and carboxylic hydroxyl groups, could also be provided by {sup 31}P NMR analysis.

  5. Contents TRU Waste Celebration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 September 2005 A publication for all members of the NNSA/NSO family Contents TRU Waste Celebration by Katherine Schwartz On July 28, 2005, Bechtel Nevada hosted a function to commemorate the dedication and hard work of every Joanne Norton of meeting the milestone of completion of characterization of all legacy waste drums stored at the NTS for 30 years." , assistant general manager for Environmental Management at BN, was equally pleased. making direct contact with it. the dedicated

  6. NESEA Newsletter Content

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NESEA Newsletter Content Middle School Curriculum Created by Northeast Sustainable Energy Association (NESEA) Click on the links below to take you to the Chapter heading: Solar Panels: The Basics Solar Cells: P-N Junction Solar Panels: Amps, Volts and Power Solar Panels: Manufacture Solar Panels: PV Applications & More Parts of a Solar Cell Getting Started with Gears 123456789012345678901234567890121234567890123 123456789012345678901234567890121234567890123 PREMIER MIDDLE SCHOOL MODEL SOLAR

  7. Personalized professional content recommendation

    DOE Patents [OSTI]

    Xu, Songhua

    2015-10-27

    A personalized content recommendation system includes a client interface configured to automatically monitor a user's information data stream transmitted on the Internet. A hybrid contextual behavioral and collaborative personal interest inference engine resident to a non-transient media generates automatic predictions about the interests of individual users of the system. A database server retains the user's personal interest profile based on a plurality of monitored information. The system also includes a server programmed to filter items in an incoming information stream with the personal interest profile and is further programmed to identify only those items of the incoming information stream that substantially match the personal interest profile.

  8. Personalized professional content recommendation

    DOE Patents [OSTI]

    Xu, Songhua

    2015-11-05

    A personalized content recommendation system includes a client interface configured to automatically monitor a user's information data stream transmitted on the Internet. A hybrid contextual behavioral and collaborative personal interest inference engine resident to a non-transient media generates automatic predictions about the interests of individual users of the system. A database server retains the user's personal interest profile based on a plurality of monitored information. The system also includes a server programmed to filter items in an incoming information stream with the personal interest profile and is further programmed to identify only those items of the incoming information stream that substantially match the personal interest profile.

  9. Microsoft Word - contents

    Office of Legacy Management (LM)

    GJO-2001-272-TAR MAC-GWDUR 1.1 UMTRA Ground Water Project Site Observational Work Plan for the Durango, Colorado, UMTRA Project Site January 2002 Prepared by U.S. Department of Energy Grand Junction Office Grand Junction, Colorado Project Number UGW 511-0006-10-000 Document Number U0143200 Work Performed Under DOE Contract Number DE-AC13-96GJ87335 This page intentionally left blank Document Number U0143200 Contents DOE/Grand Junction Office Site Observational Work Plan -Durango, Colorado January

  10. Preparation of brightness stabilization agent for lignin containing pulp from biomass pyrolysis oils

    DOE Patents [OSTI]

    Agblevor, Foster A. (Blacksburg, VA); Besler-Guran, Serpil (Flemington, NJ)

    2001-01-01

    A process for producing a brightness stabilization mixture of water-soluble organic compounds from biomass pyrolysis oils comprising: a) size-reducing biomass material and pyrolyzing the size-reduced biomass material in a fluidized bed reactor; b) separating a char/ash component while maintaining char-pot temperatures to avoid condensation of pyrolysis vapors; c) condensing pyrolysis gases and vapors, and recovering pyrolysis oils by mixing the oils with acetone to obtain an oil-acetone mixture; d) evaporating acetone and recovering pyrolysis oils; e) extracting the pyrolysis oils with water to obtain a water extract; f) slurrying the water extract with carbon while stirring, and filtering the slurry to obtain a colorless filtrate; g) cooling the solution and stabilizing the solution against thermally-induced gelling and solidification by extraction with ethyl acetate to form an aqueous phase lower layer and an organic phase upper layer; h) discarding the upper organic layer and extracting the aqueous layer with ethyl acetate, and discarding the ethyl acetate fraction to obtain a brown-colored solution not susceptible to gelling or solidification upon heating; i) heating the solution to distill off water and other light components and concentrating a bottoms fraction comprising hydroxyacetaldehyde and other non-volatile components having high boiling points; and j) decolorizing the stabilized brown solution with activated carbon to obtain a colorless solution.

  11. Reducing Power Factor Cost

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Low power factor is expensive and inefficient. Many utility companies charge you an additional fee if your power factor is less than 0.95. Low power factor also reduces your electrical system's distribu- tion capacity by increasing current flow and causing voltage drops. This fact sheet describes power factor and explains how you can improve your power factor to reduce electric bills and enhance your electrical system's capacity. REDUCING POWER FACTOR COST To understand power factor, visualize a

  12. Reducible oxide based catalysts

    DOE Patents [OSTI]

    Thompson, Levi T.; Kim, Chang Hwan; Bej, Shyamal K.

    2010-04-06

    A catalyst is disclosed herein. The catalyst includes a reducible oxide support and at least one noble metal fixed on the reducible oxide support. The noble metal(s) is loaded on the support at a substantially constant temperature and pH.

  13. Table of Contents

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    U U . . S S . . D D E E P P A A R R T T M M E E N N T T O O F F E E N N E E R R G G Y Y O O F F F F I I C C E E O O F F I I N N S S P P E E C C T T O O R R G G E E N N E E R R A A L L Semiannual Report toCongress DOE/IG-0065 April 1 - September 30, 2013 TABLE OF CONTENTS From the Desk of the Inspector General ..................................................... 2 Impacts Key Accomplishments ............................................................................................... 3

  14. Reduced shear power spectrum

    SciTech Connect (OSTI)

    Dodelson, Scott; /Fermilab /Chicago U., Astron. Astrophys. Ctr. /Northwestern U.; Shapiro, Charles; /Chicago U. /KICP, Chicago; White, Martin J.; /UC, Berkeley, Astron.

    2005-08-01

    Measurements of ellipticities of background galaxies are sensitive to the reduced shear, the cosmic shear divided by (1-{kappa}) where {kappa} is the projected density field. They compute the difference between shear and reduced shear both analytically and with simulations. The difference becomes more important an smaller scales, and will impact cosmological parameter estimation from upcoming experiments. A simple recipe is presented to carry out the required correction.

  15. reduce CFRP embodied energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    reduce CFRP embodied energy - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future Stationary Power Energy Conversion Efficiency Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering Grid Modernization Battery Testing Nuclear Fuel Cycle Defense Waste Management Programs

  16. Naval electrochemical corrosion reducer

    DOE Patents [OSTI]

    Clark, Howard L. (Ballston Lake, NY)

    1991-10-01

    A corrosion reducer for use with ships having a hull, a propeller mounted a propeller shaft and extending through the hull, bearings supporting the shaft, at least one thrust bearing and one seal. The improvement includes a current collector and a current reduction assembly for reducing the voltage between the hull and shaft in order to reduce corrosion due to electrolytic action. The current reduction assembly includes an electrical contact, the current collector, and the hull. The current reduction assembly further includes a device for sensing and measuring the voltage between the hull and the shaft and a device for applying a reverse voltage between the hull and the shaft so that the resulting voltage differential is from 0 to 0.05 volts. The current reduction assembly further includes a differential amplifier having a voltage differential between the hull and the shaft. The current reduction assembly further includes an amplifier and a power output circuit receiving signals from the differential amplifier and being supplied by at least one current supply. The current selector includes a brush assembly in contact with a slip ring over the shaft so that its potential may be applied to the differential amplifier.

  17. Visual Analysis of Weblog Content

    SciTech Connect (OSTI)

    Gregory, Michelle L.; Payne, Deborah A.; McColgin, Dave; Cramer, Nick O.; Love, Douglas V.

    2007-03-26

    In recent years, one of the advances of the World Wide Web is social media and one of the fastest growing aspects of social media is the blogosphere. Blogs make content creation easy and are highly accessible through web pages and syndication. With their growing influence, a need has arisen to be able to monitor the opinions and insight revealed within their content. In this paper we describe a technical approach for analyzing the content of blog data using a visual analytic tool, IN-SPIRE, developed by Pacific Northwest National Laboratory. We highlight the capabilities of this tool that are particularly useful for information gathering from blog data.

  18. JOBAID-LAUNCHING ONLINE CONTENT

    Broader source: Energy.gov [DOE]

    In this jobaid you will learn how to launch Online Content "Items" or Courses. In the LMS you can launch most anything as an "item": documents, courses, webpages and track users that have completed...

  19. ARM - Measurement - Ice water content

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    content ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Measurement : Ice water content The concentration (mass/vol) of ice water particles in a cloud. Categories Atmospheric State, Cloud Properties Instruments The above measurement is considered scientifically relevant for the following instruments. Refer to the datastream (netcdf) file headers of each instrument for a list of all available measurements, including

  20. ARM - Measurement - Liquid water content

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    content ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Measurement : Liquid water content The concentration (mass/vol) of liquid water droplets in a cloud. Categories Cloud Properties Instruments The above measurement is considered scientifically relevant for the following instruments. Refer to the datastream (netcdf) file headers of each instrument for a list of all available measurements, including those recorded

  1. Pressure reducing regulator

    DOE Patents [OSTI]

    Whitehead, John C. (Davis, CA); Dilgard, Lemoyne W. (Willits, CA)

    1995-01-01

    A pressure reducing regulator that controls its downstream or outlet pressure to a fixed fraction of its upstream or inlet pressure. The regulator includes a housing which may be of a titanium alloy, within which is located a seal or gasket at the outlet end which may be made of annealed copper, a rod, and piston, each of which may be made of high density graphite. The regulator is insensitive to temperature by virtue of being without a spring or gas sealed behind a diaphragm, and provides a reference for a system in which it is being used. The rod and piston of the regulator are constructed, for example, to have a 1/20 ratio such that when the downstream pressure is less than 1/20 of the upstream pressure the regulator opens and when the downstream pressure exceeds 1/20 of the upstream pressure the regulator closes.

  2. Pressure reducing regulator

    DOE Patents [OSTI]

    Whitehead, J.C.; Dilgard, L.W.

    1995-10-10

    A pressure reducing regulator that controls its downstream or outlet pressure to a fixed fraction of its upstream or inlet pressure is disclosed. The regulator includes a housing which may be of a titanium alloy, within which is located a seal or gasket at the outlet end which may be made of annealed copper, a rod, and piston, each of which may be made of high density graphite. The regulator is insensitive to temperature by virtue of being without a spring or gas sealed behind a diaphragm, and provides a reference for a system in which it is being used. The rod and piston of the regulator are constructed, for example, to have a 1/20 ratio such that when the downstream pressure is less than 1/20 of the upstream pressure the regulator opens and when the downstream pressure exceeds 1/20 of the upstream pressure the regulator closes. 10 figs.

  3. CONTENTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    responsible contractor's processes and, as a minimum, shall be signed and dated by the following: 1. Technical Approver (see Appendix A for definition) 2. Manager responsible...

  4. CONTENTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    results shall be reported based on calculated concentration or activity values (whether negative, positive, or zero) using the appropriate blank for each nuclide (see Section...

  5. Contents

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Wages and salaries 2 1,575 1,596 1,566 Social security costs 126 120 116 Pension costs ... contracts represent mark-to-market movements on certain physical and financial ...

  6. contents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    signal is often digitized to around 12 bits of information at the RTU. The communication media between the supervisory site and the RTUs are designed to handle packets of this...

  7. CONTENTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    organization (such as Safety or Quality Assurance). Depending upon the site-specific organizational structure, the following reviewapprovals are recommended: DOERL-92-36,...

  8. CONTENTS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Effective Date: 6107 Vol. 2: iv LIST OF TERMS ALARA as low as reasonably achievable ASTM American Society for Testing and Materials CFR Code of Federal Regulations CWP...

  9. Contents

    National Nuclear Security Administration (NNSA)

    ® ALOHA A R E A L L O C A T I O N S O F H A Z A R D O U S A T M O S P H E R E S User's Manual M A R C H 2 0 0 4 c a e o ® C O M P U T E R - A I D ED M A N A G E M E N T O F E M E R G E N C Y O P E R A T I O N S * U N IT E D STA T E S * E N V IR O N M E N T A L P R O TE C T I O N A G E N C Y NAT I ONA L O C E A N IC A ND ATMOSPH ER IC A D M IN IST RATION U .S . D E P A R TM ENT OF CO M M E R C E U.S. ENVIRONMENTAL PROTECTION AGENCY NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION Chemical

  10. EERE Website Content Checklist | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    EERE Website Content Checklist EERE Website Content Checklist This checklist is a tool to guide EERE content developers and editors in creating and reviewing content for websites. Microsoft Office document icon EERE Website Content Checklist More Documents & Publications Plain Language Compliance Report (2012) Templates and Examples - Statistics and Search Log Analysis DOE-STD-1029-92

  11. New system reduces sludge management costs

    SciTech Connect (OSTI)

    Roll, R.R. ); Koser, M.R. )

    1993-06-01

    This article describes a recently completed a $2.7-million project to upgrade the sludge dewatering and stabilizing system at a 48-mgd wastewater treatment facility in Niagara Fall, New York. The work was necessitated by the deteriorated condition of the plant's original vacuum filters and increasing costs to landfill the dewatered sludge. The new equipment has restored sludge production capacity while reducing the final material's moisture content. The Niagara Falls plant is one of the few municipal physical-chemical treatment plants built in this country, and is the largest still functioning. Constructed in the mid-1970s, it was designed to treat a combination of domestic sewage and industrial wastes. One third of the flow and one half of the solids are industrial in nature. The changes made reduced electrical power consumption and sanitary landfill costs.

  12. Content of System Design Descriptions

    Office of Environmental Management (EM)

    DOE-STD-3024-2011 August 2011 ________________________ Superseding DOE-STD-3024-98 DOE STANDARD CONTENT OF SYSTEM DESIGN DESCRIPTIONS U.S. Department of Energy AREA EDCO Washington, D.C. 20585 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. NOT MEASUREMENT SENSITIVE DOE-STD-3024-2011 ii Available on the Department of Energy Technical Standards web page at http://www.hss.energy.gov/nuclearsafety/ns/techstds/ DOE-STD-3024-2011 iii CONTENTS PAGE Foreword

  13. Reducing gas generators and methods for generating a reducing gas

    DOE Patents [OSTI]

    Scotto, Mark Vincent; Perna, Mark Anthony

    2015-11-03

    One embodiment of the present invention is a unique reducing gas generator. Another embodiment is a unique method for generating a reducing gas. Other embodiments include apparatuses, systems, devices, hardware, methods, and combinations for generating reducing gas. Further embodiments, forms, features, aspects, benefits, and advantages of the present application will become apparent from the description and figures provided herewith.

  14. Cast, heat-resistant austenitic stainless steels having reduced alloying element content

    DOE Patents [OSTI]

    Muralidharan, Govindarajan [Knoxville, TN; Sikka, Vinod Kumar [Oak Ridge, TN; Maziasz, Philip J [Oak Ridge, TN; Pankiw, Roman I [Greensburg, PA

    2011-08-23

    A cast, austenitic steel composed essentially of, expressed in weight percent of the total composition, about 0.4 to about 0.7 C, about 20 to about 30 Cr, about 20 to about 30 Ni, about 0.5 to about 1 Mn, about 0.6 to about 2 Si, about 0.05 to about 1 Nb, about 0.05 to about 1 W, about 0.05 to about 1.0 Mo, balance Fe, the steel being essentially free of Ti and Co, the steel characterized by at least one microstructural component selected from the group consisting of MC, M.sub.23C.sub.6, and M(C, N).

  15. Cast, heat-resistant austenitic stainless steels having reduced alloying element content

    DOE Patents [OSTI]

    Muralidharan, Govindarajan (Knoxville, TN) [Knoxville, TN; Sikka, Vinod Kumar (Oak Ridge, TN) [Oak Ridge, TN; Maziasz, Philip J. (Oak Ridge, TN) [Oak Ridge, TN; Pankiw, Roman I. (Greensburg, PA) [Greensburg, PA

    2010-07-06

    A cast, austenitic steel composed essentially of, expressed in weight percent of the total composition, about 0.4 to about 0.7 C, about 20 to about 30 Cr, about 20 to about 30 Ni, about 0.5 to about 1 Mn, about 0.6 to about 2 Si, about 0.05 to about 1 Nb, about 0.05 to about 1 W, about 0.05 to about 1.0 Mo, balance Fe, the steel being essentially free of Ti and Co, the steel characterized by at least one microstructural component selected from the group consisting of MC, M.sub.23C.sub.6, and M(C, N).

  16. Method of reducing multipole content in a conductor assembly during manufacture

    DOE Patents [OSTI]

    Meinke, Rainer (Melbourne, FL)

    2011-08-09

    A method for manufacture of a conductor assembly. The assembly is of the type which, when conducting current, generates a magnetic field or in which, in the presence of a changing magnetic field, a voltage is induced. In an example embodiment one or more first coil rows are formed. The assembly has multiple coil rows about an axis with outer coil rows formed about inner coil rows. A determination is made of deviations from specifications associated with the formed one or more first coil rows. One or more deviations correspond to a magnitude of a multipole field component which departs from a field specification. Based on the deviations, one or more wiring patterns are generated for one or more second coil rows to be formed about the one or more first coil rows. The one or more second coil rows are formed in the assembly. The magnitude of each multipole field component that departs from the field specification is offset.

  17. Method of reducing multipole content in a conductor assembly during manufacture

    DOE Patents [OSTI]

    Meinke, Rainer

    2013-08-20

    A method for manufacture of a conductor assembly. The assembly is of the type which, when conducting current, generates a magnetic field or in which, in the presence of a changing magnetic field, a voltage is induced. In an example embodiment one or more first coil rows are formed. The assembly has multiple coil rows about an axis with outer coil rows formed about inner coil rows. A determination is made of deviations from specifications associated with the formed one or more first coil rows. One or more deviations correspond to a magnitude of a multipole field component which departs from a field specification. Based on the deviations, one or more wiring patterns are generated for one or more second coil rows to be formed about the one or more first coil rows. The one or more second coil rows are formed in the assembly. The magnitude of each multipole field component that departs from the field specification is offset.

  18. SECTION J - TABLE OF CONTENTS

    National Nuclear Security Administration (NNSA)

    Conformed to Mod 0108 DE-NA0000622 Section J Page i PART III - LIST OF DOCUMENTS, EXHIBITS, AND OTHER ATTACHMENTS SECTION J LIST OF APPENDICES TABLE OF CONTENTS Appendix A Statement of Work (Replaced by Mod 002; Modified Mod 016; Replaced Mod 029) Appendix B Performance Evaluation Plan (Replaced by Mods 002, 016, 020, 029, 0084) Appendix C Contractor's Transition Plan Appendix D Sensitive Foreign Nations Control Appendix E Performance Guarantee Agreement(s) Appendix F National Work Breakdown

  19. Reduced

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Stati Uniti, 4 35127 Padova, Italy a P. Martin Consorzio RFX, Associazione EURATOM-ENEA sulla Fusione, Corso Stati Uniti, 4 35127 Padova, Italy a and Dipartimento di Fisica ...

  20. CONTENTS OF A VISIT REQUEST

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    CONTENTS OF A VISIT REQUEST All visit requests are required to be submitted via JPAS according to AFI 31-101 and the NISPOM. Our SMO code is KV1MFSCC6. Please do not send an annual visit request for the conference. Use the dates of the conference for the duration of the visit. Please list Bing Serafico, 505-853-0451 as the Point of Contract for the visit. NOTE: Only use the following information if your companies DO NOT have access to JPAS. All faxed visit request for personnel that are in JPAS

  1. Oxygen-reducing catalyst layer

    DOE Patents [OSTI]

    O'Brien, Dennis P. (Maplewood, MN); Schmoeckel, Alison K. (Stillwater, MN); Vernstrom, George D. (Cottage Grove, MN); Atanasoski, Radoslav (Edina, MN); Wood, Thomas E. (Stillwater, MN); Yang, Ruizhi (Halifax, CA); Easton, E. Bradley (Halifax, CA); Dahn, Jeffrey R. (Hubley, CA); O'Neill, David G. (Lake Elmo, MN)

    2011-03-22

    An oxygen-reducing catalyst layer, and a method of making the oxygen-reducing catalyst layer, where the oxygen-reducing catalyst layer includes a catalytic material film disposed on a substrate with the use of physical vapor deposition and thermal treatment. The catalytic material film includes a transition metal that is substantially free of platinum. At least one of the physical vapor deposition and the thermal treatment is performed in a processing environment comprising a nitrogen-containing gas.

  2. Reducing Regulatory Burden | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Request for information on reducing regulatory burden PDF icon Reducing Regulatory Burden More Documents & Publications Reducing Regulatory Burden Reducing Regulatory Burden

  3. Energy.gov Content Management System

    Broader source: Energy.gov [DOE]

    Energy.gov Content Management SystemEERE's websites are hosted in Energy.gov's Drupal content management system (CMS), which is maintained by the U.S. Department of Energy's Public Affairs Office.

  4. Template:ContentAssist | Open Energy Information

    Open Energy Info (EERE)

    ContentAssist Jump to: navigation, search This is the ContentAssist template. It is intended for inclusion on any page and will highlight extracted energy-related terms from the...

  5. An examination of content similarity within the memory of HPC applications.

    SciTech Connect (OSTI)

    Levy, Scott N.; Bridges, Patrick G.; Ferreira, Kurt Brian; Thompson, Aidan Patrick; Trott, Christian Robert

    2013-01-01

    Memory content similarity has been e ectively exploited for more than a decade to reduce memory consumption. By consolidating duplicate and similar pages in the address space of an application, we can reduce the amount of memory it consumes without negatively a ecting the application's perception of the memory resources available to it. In addition to memory de-duplication, there may be many other ways that we can exploit memory content similarity to improve system characteristics. In this paper, we examine the memory content similarity of several HPC applications. By characterizing the memory contents of these applications, we hope to provide a basis for ef- forts to e ectively exploit memory content similarity to improve system performance beyond memory deduplication. We show that several applications exhibit signi cant similarity and consider the source of the similarity.

  6. Reduce air, reduce compliance cost new patented spray booth technology

    SciTech Connect (OSTI)

    McGinnis, F.

    1997-12-31

    A New Paint Spray Booth System that dramatically reduces air volumes normally required for capturing and controlling paint overspray that contains either Volatile Organic Compounds (VOC) or Hazardous Air Pollutants (HAP), or both. In turn, a substantial reduction in capital equipment expenditures for air abatement systems and air make-up heaters as well as related annual operating expenses is realized.

  7. Microbial methods of reducing technetium

    DOE Patents [OSTI]

    Wildung, Raymond E. [Richland, WA; Garland, Thomas R. [Greybull, WY; Gorby, Yuri A. [Richland, WA; Hess, Nancy J. [Benton City, WA; Li, Shu-Mei W. [Richland, WA; Plymale, Andrew E. [Richland, WA

    2001-01-01

    The present invention is directed toward a method for microbial reduction of a technetium compound to form other compounds of value in medical imaging. The technetium compound is combined in a mixture with non-growing microbial cells which contain a technetium-reducing enzyme system, a stabilizing agent and an electron donor in a saline solution under anaerobic conditions. The mixture is substantially free of an inorganic technetium reducing agent and its reduction products. The resulting product is Tc of lower oxidation states, the form of which can be partially controlled by the stabilizing agent. It has been discovered that the microorganisms Shewanella alga, strain Bry and Shewanelia putrifacians, strain CN-32 contain the necessary enzyme systems for technetium reduction and can form both mono nuclear and polynuclear reduced Tc species depending on the stabilizing agent.

  8. Diagnosing the Causes and Severity of One-sided Message Contention

    SciTech Connect (OSTI)

    Tallent, Nathan R.; Vishnu, Abhinav; van Dam, Hubertus; Daily, Jeffrey A.; Kerbyson, Darren J.; Hoisie, Adolfy

    2015-02-11

    Two trends suggest network contention for one-sided messages is poised to become a performance problem that concerns application developers: an increased interest in one-sided programming models and a rising ratio of hardware threads to network injection bandwidth. Unfortunately, it is difficult to reason about network contention and one-sided messages because one-sided tasks can either decrease or increase contention. We present effective and portable techniques for diagnosing the causes and severity of one-sided message contention. To detect that a message is affected by contention, we maintain statistics representing instantaneous (non-local) network resource demand. Using lightweight measurement and modeling, we identify the portion of a message's latency that is due to contention and whether contention occurs at the initiator or target. We attribute these metrics to program statements in their full static and dynamic context. We characterize contention for an important computational chemistry benchmark on InfiniBand, Cray Aries, and IBM Blue Gene/Q interconnects. We pinpoint the sources of contention, estimate their severity, and show that when message delivery time deviates from an ideal model, there are other messages contending for the same network links. With a small change to the benchmark, we reduce contention up to 50% and improve total runtime as much as 20%.

  9. Reduced-vibration tube array

    DOE Patents [OSTI]

    Bruck, Gerald J.; Bartolomeo, Daniel R.

    2004-07-20

    A reduced-vibration tube array is disclosed. The array includes a plurality of tubes in a fixed arrangement and a plurality of damping members positioned within the tubes. The damping members include contoured interface regions characterized by bracing points that selectively contact the inner surface of an associated tube. Each interface region is sized and shaped in accordance with the associated tube, so that the damping member bracing points are spaced apart a vibration-reducing distance from the associated tube inner surfaces at equilibrium. During operation, mechanical interaction between the bracing points and the tube inner surfaces reduces vibration by a damage-reducing degree. In one embodiment, the interface regions are serpentine shaped. In another embodiment, the interface regions are helical in shape. The interface regions may be simultaneously helical and serpentine in shape. The damping members may be fixed within the associated tubes, and damping member may be customized several interference regions having attributes chosen in accordance with desired flow characteristics and associated tube properties.

  10. Standard Format and Content for Emergency Plans

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-08-21

    This volume addresses recommended emergency plan format and content for Operational Emergency Base Programs and Operational Emergency Hazardous Material Programs. Canceled by DOE G 151.1-3.

  11. Application Content and Evaluation Criteria/Process

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Development Manager Preliminary Application Content * Separate applications for each topic * Title should identify the topic area * Application - SF 424 * Project Narrative -...

  12. Training Program Content, 4/10/95

    Broader source: Energy.gov [DOE]

    The objective of this surveillance is to evaluate the effectiveness of the contractor's program for establishing the content of training programs.  The process to be evaluated includes (1)...

  13. Method for creating high carbon content products from biomass oil

    DOE Patents [OSTI]

    Parker, Reginald; Seames, Wayne

    2012-12-18

    In a method for producing high carbon content products from biomass, a biomass oil is added to a cracking reactor vessel. The biomass oil is heated to a temperature ranging from about 100.degree. C. to about 800.degree. C. at a pressure ranging from about vacuum conditions to about 20,700 kPa for a time sufficient to crack the biomass oil. Tar is separated from the cracked biomass oil. The tar is heated to a temperature ranging from about 200.degree. C. to about 1500.degree. C. at a pressure ranging from about vacuum conditions to about 20,700 kPa for a time sufficient to reduce the tar to a high carbon content product containing at least about 50% carbon by weight.

  14. Ferroelectric capacitor with reduced imprint

    DOE Patents [OSTI]

    Evans, Jr., Joseph T. (13609 Verbena Pl., NE., Albuquerque, NM 87112); Warren, William L. (7716 Wm. Moyers Ave., NE., Albuquerque, NM 87122); Tuttle, Bruce A. (12808 Lillian Pl., NE., Albuquerque, NM 87122); Dimos, Duane B. (6105 Innsbrook Ct., NE., Albuquerque, NM 87111); Pike, Gordon E. (1609 Cedar Ridge, NE., Albuquerque, NM 87112)

    1997-01-01

    An improved ferroelectric capacitor exhibiting reduced imprint effects in comparison to prior art capacitors. A capacitor according to the present invention includes top and bottom electrodes and a ferroelectric layer sandwiched between the top and bottom electrodes, the ferroelectric layer comprising a perovskite structure of the chemical composition ABO.sub.3 wherein the B-site comprises first and second elements and a dopant element that has an oxidation state greater than +4. The concentration of the dopant is sufficient to reduce shifts in the coercive voltage of the capacitor with time. In the preferred embodiment of the present invention, the ferroelectric element comprises Pb in the A-site, and the first and second elements are Zr and Ti, respectively. The preferred dopant is chosen from the group consisting of Niobium, Tantalum, and Tungsten. In the preferred embodiment of the present invention, the dopant occupies between 1 and 8% of the B-sites.

  15. Reducing carbon dioxide to products

    DOE Patents [OSTI]

    Cole, Emily Barton; Sivasankar, Narayanappa; Parajuli, Rishi; Keets, Kate A

    2014-09-30

    A method reducing carbon dioxide to one or more products may include steps (A) to (C). Step (A) may bubble said carbon dioxide into a solution of an electrolyte and a catalyst in a divided electrochemical cell. The divided electrochemical cell may include an anode in a first cell compartment and a cathode in a second cell compartment. The cathode may reduce said carbon dioxide into said products. Step (B) may adjust one or more of (a) a cathode material, (b) a surface morphology of said cathode, (c) said electrolyte, (d) a manner in which said carbon dioxide is bubbled, (e), a pH level of said solution, and (f) an electrical potential of said divided electrochemical cell, to vary at least one of (i) which of said products is produced and (ii) a faradaic yield of said products. Step (C) may separate said products from said solution.

  16. MapReduce SVM Game

    SciTech Connect (OSTI)

    Vineyard, Craig M.; Verzi, Stephen J.; James, Conrad D.; Aimone, James B.; Heileman, Gregory L.

    2015-08-10

    Despite technological advances making computing devices faster, smaller, and more prevalent in today's age, data generation and collection has outpaced data processing capabilities. Simply having more compute platforms does not provide a means of addressing challenging problems in the big data era. Rather, alternative processing approaches are needed and the application of machine learning to big data is hugely important. The MapReduce programming paradigm is an alternative to conventional supercomputing approaches, and requires less stringent data passing constrained problem decompositions. Rather, MapReduce relies upon defining a means of partitioning the desired problem so that subsets may be computed independently and recom- bined to yield the net desired result. However, not all machine learning algorithms are amenable to such an approach. Game-theoretic algorithms are often innately distributed, consisting of local interactions between players without requiring a central authority and are iterative by nature rather than requiring extensive retraining. Effectively, a game-theoretic approach to machine learning is well suited for the MapReduce paradigm and provides a novel, alternative new perspective to addressing the big data problem. In this paper we present a variant of our Support Vector Machine (SVM) Game classifier which may be used in a distributed manner, and show an illustrative example of applying this algorithm.

  17. MapReduce SVM Game

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Vineyard, Craig M.; Verzi, Stephen J.; James, Conrad D.; Aimone, James B.; Heileman, Gregory L.

    2015-08-10

    Despite technological advances making computing devices faster, smaller, and more prevalent in today's age, data generation and collection has outpaced data processing capabilities. Simply having more compute platforms does not provide a means of addressing challenging problems in the big data era. Rather, alternative processing approaches are needed and the application of machine learning to big data is hugely important. The MapReduce programming paradigm is an alternative to conventional supercomputing approaches, and requires less stringent data passing constrained problem decompositions. Rather, MapReduce relies upon defining a means of partitioning the desired problem so that subsets may be computed independently andmore » recom- bined to yield the net desired result. However, not all machine learning algorithms are amenable to such an approach. Game-theoretic algorithms are often innately distributed, consisting of local interactions between players without requiring a central authority and are iterative by nature rather than requiring extensive retraining. Effectively, a game-theoretic approach to machine learning is well suited for the MapReduce paradigm and provides a novel, alternative new perspective to addressing the big data problem. In this paper we present a variant of our Support Vector Machine (SVM) Game classifier which may be used in a distributed manner, and show an illustrative example of applying this algorithm.« less

  18. Reducing Regulatory Burden | Department of Energy

    Energy Savers [EERE]

    Burden Reducing Regulatory Burden Request for information on reducing regulatory burden PDF icon Reducing Regulatory Burden More Documents & Publications Reducing Regulatory Burden; Retrospective Review Under E.O. 13563 Reducing Regulatory Burden Department of Energy Request for Information: Reducing Regulatory Burden (Reply Comments)

  19. Reduced vibration motor winding arrangement

    DOE Patents [OSTI]

    Slavik, Charles J. (Rexford, NY); Rhudy, Ralph G. (Scotia, NY); Bushman, Ralph E. (Lathem, NY)

    1997-01-01

    An individual phase winding arrangement having a sixty electrical degree phase belt width for use with a three phase motor armature includes a delta connected phase winding portion and a wye connected phase winding portion. Both the delta and wye connected phase winding portions have a thirty electrical degree phase belt width. The delta and wye connected phase winding portions are each formed from a preselected number of individual coils each formed, in turn, from an unequal number of electrical conductor turns in the approximate ratio of .sqroot.3. The individual coils of the delta and wye connected phase winding portions may either be connected in series or parallel. This arrangement provides an armature winding for a three phase motor which retains the benefits of the widely known and utilized thirty degree phase belt concept, including improved mmf waveform and fundamental distribution factor, with consequent reduced vibrations and improved efficiency.

  20. Reduced vibration motor winding arrangement

    DOE Patents [OSTI]

    Slavik, C.J.; Rhudy, R.G.; Bushman, R.E.

    1997-11-11

    An individual phase winding arrangement having a sixty electrical degree phase belt width for use with a three phase motor armature includes a delta connected phase winding portion and a wye connected phase winding portion. Both the delta and wye connected phase winding portions have a thirty electrical degree phase belt width. The delta and wye connected phase winding portions are each formed from a preselected number of individual coils each formed, in turn, from an unequal number of electrical conductor turns in the approximate ratio of {radical}3. The individual coils of the delta and wye connected phase winding portions may either be connected in series or parallel. This arrangement provides an armature winding for a three phase motor which retains the benefits of the widely known and utilized thirty degree phase belt concept, including improved mmf waveform and fundamental distribution factor, with consequent reduced vibrations and improved efficiency. 4 figs.

  1. Table of Contents for Desk Guide

    Energy Savers [EERE]

    September, 2014 U. S. Department of Energy - Real Estate Desk Guide Revised 2014 Real Estate Desk Guide Table of Contents Chapter 1-- Purpose of Desk Guide............................................................................... 1 Chapter 2-- Introduction ................................................................................................. 3 Chapter 3-- Planning Policy ........................................................................................... 9 Chapter 4-- Real

  2. Widget:ContentAssist | Open Energy Information

    Open Energy Info (EERE)

    ContentAssist Jump to: navigation, search This widget generates a bar of recommended reading related to the page on which it is embedded. Additionally, this widget mines the...

  3. Position Paper for High Moisture Content Waste

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for High Moisture Content Waste Revision 0, November 3, 1998 Prepared by: Nevada Test Site Generator Work Group High Moisture Content Waste Subgroup EXECUTIVE SUMMARY During the 1995 Annual Waste Generator Workshop, discussions were held regarding several areas of concern to waste generators currently shipping Low Level Waste to the Nevada Test Site. A goal to resolving these areas of concern was the establishment of an NVO-325 Work Group. In January of 1996 the NVO-325 Work Group was formalized

  4. BETO Quiz - Interactive Content | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    BETO Quiz - Interactive Content BETO Quiz - Interactive Content Welcome to the Bioenergy Quiz! Navigate through the quiz by clicking on the circular buttons and selecting the correct answers to the questions. Use the scrollbar to move down the page and view all of the information displayed. Hover over words and phrases highlighted in orange for an explanation of terms. Share the information by clicking on the buttons in the Share This block. Use the arrow button found in the bottom right-hand

  5. Reducing Your Electricity Use | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Appliances & Electronics » Reducing Your Electricity Use Reducing Your Electricity Use An energy audit can help you find the most effective ways to save money and reduce energy use in your home. | Photo courtesy of Dennis Schroeder, NREL. An energy audit can help you find the most effective ways to save money and reduce energy use in your home. | Photo courtesy of Dennis Schroeder, NREL. Reducing energy use in your home saves you money, increases our energy security, and reduces the

  6. PROJECT PROFILE: Scientific Approach to Reducing Photovoltaic...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    PROJECT PROFILE: Scientific Approach to Reducing Photovoltaic Module Material Costs While Increasing Durability PROJECT PROFILE: Scientific Approach to Reducing Photovoltaic Module ...

  7. Reducing Photovoltaic Costs | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Photovoltaics Reducing Photovoltaic Costs Reducing Photovoltaic Costs Photo of gloved hands pouring liquid from a glass bottle to glass beaker. The development of more ...

  8. RH-TRU Waste Content Codes

    SciTech Connect (OSTI)

    Washington TRU Solutions

    2007-07-01

    The Remote-Handled Transuranic (RH-TRU) Content Codes (RH-TRUCON) document describes the inventory of RH-TRU waste within the transportation parameters specified by the Remote-Handled Transuranic Waste Authorized Methods for Payload Control (RH-TRAMPAC).1 The RH-TRAMPAC defines the allowable payload for the RH-TRU 72-B. This document is a catalog of RH-TRU 72-B authorized contents by site. A content code is defined by the following components: • A two-letter site abbreviation that designates the physical location of the generated/stored waste (e.g., ID for Idaho National Laboratory [INL]). The site-specific letter designations for each of the sites are provided in Table 1. • A three-digit code that designates the physical and chemical form of the waste (e.g., content code 317 denotes TRU Metal Waste). For RH-TRU waste to be transported in the RH-TRU 72-B, the first number of this three-digit code is “3.” The second and third numbers of the three-digit code describe the physical and chemical form of the waste. Table 2 provides a brief description of each generic code. Content codes are further defined as subcodes by an alpha trailer after the three-digit code to allow segregation of wastes that differ in one or more parameter(s). For example, the alpha trailers of the subcodes ID 322A and ID 322B may be used to differentiate between waste packaging configurations. As detailed in the RH-TRAMPAC, compliance with flammable gas limits may be demonstrated through the evaluation of compliance with either a decay heat limit or flammable gas generation rate (FGGR) limit per container specified in approved content codes. As applicable, if a container meets the watt*year criteria specified by the RH-TRAMPAC, the decay heat limits based on the dose-dependent G value may be used as specified in an approved content code. If a site implements the administrative controls outlined in the RH-TRAMPAC and Appendix 2.4 of the RH-TRU Payload Appendices, the decay heat or FGGR limits based on a 10-day shipping period (rather than the standard 60-day shipping period) may be used as specified in an approved content code. Requests for new or revised content codes may be submitted to the WIPP RH-TRU Payload Engineer for review and approval, provided all RH-TRAMPAC requirements are met.

  9. Reducing Power Factor Cost | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing Power Factor Cost Reducing Power Factor Cost Low power factor is expensive and inefficient. Many utility companies charge an additional fee if your power factor is less than 0.95. Low power factor also reduces your electrical system's distribution capacity by increasing current flow and causing voltage drops. This fact sheet describes power factor and explains how you can improve your power factor to reduce electric bills and enhance your electrical system's capacity. PDF icon Reducing

  10. AVLIS documentation overview and tables of contents

    SciTech Connect (OSTI)

    Not Available

    1984-11-15

    Three documents constitute the executive summary series in Data Package III: this document (Documentation Overview and Tables of Contents (E001)) plus the AVLIS Production Plant Executive Summary (E010) and the AVLIS Production Plant Overall Design Report (E020). They provide progressively greater detail on the key information and conclusions contained within the data package. The Executive Summary and Overall Design Report present summaries of each Data Package III document. They are intended to provide a global overview of AVLIS Production Plant deployment including program planning, project management, schedules, engineering design, production, operations, capital cost, and operating cost. The purpose of Overview and Tables of Contents is threefold: to briefly review AVLIS goals for Data Package III documentation, to present an overview of the contents of the data package, and to provide a useful guide to information contained in the numerous documents comprising the package.

  11. CH-TRU Waste Content Codes

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2008-01-16

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  12. Local content of bipartite qubit correlations

    SciTech Connect (OSTI)

    Branciard, Cyril; Gisin, Nicolas [Group of Applied Physics, University of Geneva, 1211 Geneva (Switzerland); Scarani, Valerio [Centre for Quantum Technologies and Department of Physics, National University of Singapore, 117543 Singapore (Singapore)

    2010-02-15

    One of the last open problems concerning two qubits in a pure state is to find the exact local content of their correlation, in the sense of Elitzur, Popescu, and Rohrlich (EPR2) [A. C. Elitzur, S. Popescu, and D. Rohrlich, Phys. Lett. A162, 25 (1992)]. We propose an EPR2 decomposition that allows us to prove, for a wide range of states |{psi}({theta})>=cos{theta}|00>+sin{theta}|11>, that their local content is p{sub L}({theta})=cos2{theta}. We also share reflections on how to possibly extend this result to all two-qubit pure states.

  13. Remote-Handled Transuranic Content Codes

    SciTech Connect (OSTI)

    Washington TRU Solutions

    2006-12-01

    The Remote-Handled Transuranic (RH-TRU) Content Codes (RH-TRUCON) document describes the inventory of RH-TRU waste within the transportation parameters specified by the Remote-Handled Transuranic Waste Authorized Methods for Payload Control (RH-TRAMPAC).1 The RH-TRAMPAC defines the allowable payload for the RH-TRU 72-B. This document is a catalog of RH-TRU 72-B authorized contents by site. A content code is defined by the following components: • A two-letter site abbreviation that designates the physical location of the generated/stored waste (e.g., ID for Idaho National Laboratory [INL]). The site-specific letter designations for each of the sites are provided in Table 1. • A three-digit code that designates the physical and chemical form of the waste (e.g., content code 317 denotes TRU Metal Waste). For RH-TRU waste to be transported in the RH-TRU 72-B, the first number of this three-digit code is “3.” The second and third numbers of the three-digit code describe the physical and chemical form of the waste. Table 2 provides a brief description of each generic code. Content codes are further defined as subcodes by an alpha trailer after the three-digit code to allow segregation of wastes that differ in one or more parameter(s). For example, the alpha trailers of the subcodes ID 322A and ID 322B may be used to differentiate between waste packaging configurations. As detailed in the RH-TRAMPAC, compliance with flammable gas limits may be demonstrated through the evaluation of compliance with either a decay heat limit or flammable gas generation rate (FGGR) limit per container specified in approved content codes. As applicable, if a container meets the watt*year criteria specified by the RH-TRAMPAC, the decay heat limits based on the dose-dependent G value may be used as specified in an approved content code. If a site implements the administrative controls outlined in the RH-TRAMPAC and Appendix 2.4 of the RH-TRU Payload Appendices, the decay heat or FGGR limits based on a 10-day shipping period (rather than the standard 60-day shipping period) may be used as specified in an approved content code.

  14. OpenEI:Core content policies | Open Energy Information

    Open Energy Info (EERE)

    Core content policies Jump to: navigation, search OpenEI models its core content policies after those established by the Wikipedia.1 Specifically, the OpenEI core content...

  15. Genetics and Molecular Biology of Hydrogen Metabolism in Sulfate-Reducing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Bacteria (Technical Report) | SciTech Connect Genetics and Molecular Biology of Hydrogen Metabolism in Sulfate-Reducing Bacteria Citation Details In-Document Search Title: Genetics and Molecular Biology of Hydrogen Metabolism in Sulfate-Reducing Bacteria The degradation of our environment and the depletion of fossil fuels make the exploration of alternative fuels evermore imperative. Among the alternatives is biohydrogen which has high energy content by weight and produces only water when

  16. Method of determining a content of a nuclear waste container

    DOE Patents [OSTI]

    Bernardi, Richard T. (Prospect Heights, IL); Entwistle, David (Buffalo Grove, IL)

    2003-04-22

    A method and apparatus are provided for identifying contents of a nuclear waste container. The method includes the steps of forming an image of the contents of the container using digital radiography, visually comparing contents of the image with expected contents of the container and performing computer tomography on the container when the visual inspection reveals an inconsistency between the contents of the image and the expected contents of the container.

  17. Table of Contents for Desk Guide

    Energy Savers [EERE]

    May, 2013 U. S. Department of Energy - Real Estate Desk Guide Revised 2013 Real Estate Desk Guide Table of Contents Chapter 1-- Purpose of Desk Guide ........................................................................ 1 Chapter 2-- Introduction ......................................................................................... 3 Chapter 3-- Planning Policy .................................................................................... 7 Chapter 4-- Real Estate Function

  18. T-663: Cisco Content Services Gateway ICMP Processing Flaw Lets...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    3: Cisco Content Services Gateway ICMP Processing Flaw Lets Remote Users Deny Service T-663: Cisco Content Services Gateway ICMP Processing Flaw Lets Remote Users Deny Service July...

  19. Similarity Engine: Using Content Similarity to Improve Memory...

    Office of Scientific and Technical Information (OSTI)

    Engine: Using Content Similarity to Improve Memory Resilience. Citation Details In-Document Search Title: Similarity Engine: Using Content Similarity to Improve Memory Resilience. ...

  20. Widget:DivContentWrapper | Open Energy Information

    Open Energy Info (EERE)

    div For example: Widget:DivContentWrapper | classui-corner-all | stylebackground-color: green; padding: 5px; color: white; | contentText Text Retrieved from "http:...

  1. Headquarters Facilities Master Security Plan- Table of Contents

    Broader source: Energy.gov [DOE]

    2016 Headquarters Facilities Master Security Plan - Table of Contents Table of Contents for the 2016 Headquarters Facilities Master Security Plan (HQFMSP).

  2. Does Water Content or Flow Rate Control Colloid Transport in...

    Office of Scientific and Technical Information (OSTI)

    Does Water Content or Flow Rate Control Colloid Transport in Unsaturated Porous Media? Citation Details In-Document Search Title: Does Water Content or Flow Rate Control Colloid ...

  3. Genome Sequence of a Chromium-Reducing Strain, Bacillus cereus S612

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Dongping; Boukhalfa, Hakim; Ware, Doug S.; Reimus, Paul W.; Daligault, Hajnalka E.; Gleasner, Cheryl D.; Johnson, Shannon L.; Li, Po-E

    2015-12-10

    We report here the genome sequence of an effective chromium-reducing bacterium,Bacillus cereusstrain S612. We found that the size of the draft genome sequence is approximately 5.4 Mb, with a G+C content of 35%, and it is predicted to contain 5,450 protein-coding genes.

  4. Genome Sequence of a Chromium-Reducing Strain, Bacillus cereus S612

    SciTech Connect (OSTI)

    Wang, Dongping; Boukhalfa, Hakim; Ware, Doug S.; Reimus, Paul W.; Daligault, Hajnalka E.; Gleasner, Cheryl D.; Johnson, Shannon L.; Li, Po-E

    2015-12-10

    We report here the genome sequence of an effective chromium-reducing bacterium,Bacillus cereusstrain S612. We found that the size of the draft genome sequence is approximately 5.4 Mb, with a G+C content of 35%, and it is predicted to contain 5,450 protein-coding genes.

  5. Application Content and Evaluation Criteria/Process

    Office of Environmental Management (EM)

    Evaluation Criteria/Process Reginald Tyler Golden Field Office Office of Hydrogen, Fuel Cells and Infrastructure Technologies Application Content o Separate Applications for Each Major Topic o Title Should Identify the Topic Area o Application - SF 424 o Budget File - SF 424A o Project Summary - 1 page, non-proprietary Project Narrative o Provide clear description of the technical concept and how you plan to accomplish the work. o Include a description of the relevance of and justification for

  6. Remote possibly hazardous content container sampling device

    DOE Patents [OSTI]

    Volz, David L. (59 La Paloma, Los Alamos, NM 87544)

    1998-01-01

    The present invention relates to an apparatus capable of sampling enclosed containers, where the contents of the container is unknown. The invention includes a compressed air device capable of supplying air pressure, device for controlling the amount of air pressure applied, a pneumatic valve, a sampling device having a hollow, sampling insertion needle suspended therein and device to communicate fluid flow between the container and a containment vessel, pump or direct reading instrument.

  7. EXECUTIVE SUMMARY- Inserted before Table of Contents

    National Nuclear Security Administration (NNSA)

    DRAFT ENVIRONMENTAL ASSESSMENT FOR REMOVAL ACTIONS AT THE TECHNICAL AREA III CLASSIFIED WASTE LANDFILL, SANDIA NATIONAL LABORATORIES, NEW MEXICO DOE/EA-1729 June 2010 National Nuclear Security Administration Sandia Site Office P.O. Box 5400 Albuquerque, New Mexico 87185-5400 DOE/EA-1729: Environmental Assessment for Removal Actions at the Technical Area III June 2010 Classified Waste Landfill, Sandia National Laboratories, New Mexico i TABLE OF CONTENTS Section Page 1.0 PURPOSE AND NEED FOR

  8. Analysis of Joint Masonry Moisture Content Monitoring

    SciTech Connect (OSTI)

    Ueno, Kohta

    2015-10-01

    Adding insulation to the interior side of walls of masonry buildings in cold (and wet) climates may cause performance and durability problems. Some concerns, such as condensation and freeze-thaw, have known solutions, but wood members embedded in the masonry structure will be colder (and potentially wetter) after an interior insulation retrofit. Moisture content & relative humidity were monitored at joist ends in historic mass brick masonry walls retrofitted with interior insulation in a cold climate (Zone 5A); data were collected from 2012-2015. Eleven joist ends were monitored in all four orientations. One limitation of these results is that the renovation is still ongoing, with limited wintertime construction heating and no permanent occupancy to date. Measurements show that many joists ends remain at high moisture contents, especially at north- and east-facing orientations, with constant 100% RH conditions at the worst cases. These high moisture levels are not conducive for wood durability, but no evidence for actual structural damage has been observed. Insulated versus non-insulated joist pockets do not show large differences. South facing joists have safe (10-15%) moisture contents. Given the uncertainty pointed out by research, definitive guidance on the vulnerability of embedded wood members is difficult to formulate. In high-risk situations, or when a very conservative approach is warranted, the embedded wood member condition can be eliminated entirely, supporting the joist ends outside of the masonry pocket.

  9. Web Content Analysis and Inventories: Template and FY 2014 Inventory |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Content Analysis and Inventories: Template and FY 2014 Inventory Web Content Analysis and Inventories: Template and FY 2014 Inventory A content inventory and analysis will help identify content that needs to be updated, edited, added, or removed for maintenance. They're also recommended prior to starting a website redesign. This content template and sample inventory were created in Excel. The sample lists URLs, page names, navigation, navigation hierarchy, and section

  10. Healthy habits: reducing our carbon footprint

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Healthy habits: reducing our carbon footprint Healthy habits: reducing our carbon footprint We're dedicated to cutting greenhouse gas emissions by 30 percent across the Lab, from facilities to transportation. January 30, 2014 Healthy habits: reducing our carbon footprint From monitoring storm water run-off in Los Alamos Canyon to riding their bikes to work, employees in the field all over the Lab's 36 square miles see the landscape around them as an inspiration and reminder to go green at work

  11. Combustion with reduced carbon in the ash

    DOE Patents [OSTI]

    Kobayashi, Hisashi; Bool, III, Lawrence E.

    2005-12-27

    Combustion of coal in which oxygen is injected into the coal as it emerges from burner produces ash having reduced amounts of carbon.

  12. Reducing Your Electricity Use | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    An energy audit can help you find the most effective ways to save money and reduce energy use in your home. | Photo courtesy of Dennis Schroeder, NREL. An energy audit can help you find the most effective ways to save money and reduce energy use in your home. | Photo courtesy of Dennis Schroeder, NREL. Reducing energy use in your home saves you money, increases our energy security, and reduces the pollution that is emitted from non-renewable sources of energy. If you are planning to install a

  13. Innovative Computational Tools for Reducing Exploration Risk...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    of Water-Rock Interactions and Magnetotelluric Surveys Innovative Computational Tools for Reducing Exploration Risk Through Integration of Water-Rock Interactions and ...

  14. Reduced AC losses in HTS coated conductors

    DOE Patents [OSTI]

    Ashworth, Stephen P.

    2004-10-05

    Methods for reducing hysteresis losses in superconductor coated ribbons where a flux distribution is set into the superconductor coated ribbon prior to the application of alternating current.

  15. Reducing Logistics Footprints and Replenishment Demands: Nano...

    Office of Scientific and Technical Information (OSTI)

    Water Treatment Citation Details In-Document Search Title: Reducing Logistics Footprints and Replenishment Demands: Nano-engineered Silica Aerogels a Proven Method for Water ...

  16. Industrial Assessment Centers Small Manufacturers Reduce Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOEEE-1278 Industrial Assessment Centers Small Manufacturers Reduce Energy & Increase Productivity Since 1976, the Industrial Assessment Centers (IACs), administered by the US...

  17. Reduce Radiation Losses from Heating Equipment

    Broader source: Energy.gov [DOE]

    This tip sheet describes how to save process heating energy and costs by reducing expensive heat losses from industrial heating equipment, such as furnaces.

  18. Electronic structure of graphene oxide and reduced graphene oxide monolayers

    SciTech Connect (OSTI)

    Sutar, D. S.; Singh, Gulbagh; Divakar Botcha, V.

    2012-09-03

    Graphene oxide (GO) monolayers obtained by Langmuir Blodgett route and suitably treated to obtain reduced graphene oxide (RGO) monolayers were studied by photoelectron spectroscopy. Upon reduction of GO to form RGO C1s x-ray photoelectron spectra showed increase in graphitic carbon content, while ultraviolet photoelectron spectra showed increase in intensity corresponding to C2p-{pi} electrons ({approx}3.5 eV). X-ray excited Auger transitions C(KVV) and plasmon energy loss of C1s photoelectrons have been analyzed to elucidate the valence band structure. The effective number of ({pi}+{sigma}) electrons as obtained from energy loss spectra was found to increase by {approx}28% on reduction of GO.

  19. Predicting Individual Affect of Health Interventions to Reduce HPV Prevalence

    SciTech Connect (OSTI)

    Corley, Courtney D.; Mihalcea, Rada; Mikler, Armin R.; Sanfilippo, Antonio P.

    2011-04-01

    Recently, human papilloma virus has been implicated to cause several throat and oral cancers and hpv is established to cause most cervical cancers. A human papilloma virus vaccine has been proven successful to reduce infection incidence in FDA clinical trials and it is currently available in the United States. Current intervention policy targets adolescent females for vaccination; however, the expansion of suggested guidelines may extend to other age groups and males as well. This research takes a first step towards automatically predicting personal beliefs, regarding health intervention, on the spread of disease. Using linguistic or statistical approaches, sentiment analysis determines a texts affective content. Self-reported HPV vaccination beliefs published in web and social media are analyzed for affect polarity and leveraged as knowledge inputs to epidemic models. With this in mind, we have developed a discrete-time model to facilitate predicting impact on the reduction of HPV prevalence due to arbitrary age and gender targeted vaccination schemes.

  20. Analysis of Joist Masonry Moisture Content Monitoring

    SciTech Connect (OSTI)

    Ueno, Kohta

    2015-10-08

    There are many existing buildings with load-bearing mass masonry walls, whose energy performance could be improved with the retrofit of insulation. However, adding insulation to the interior side of walls of such masonry buildings in cold (and wet) climates may cause performance and durability problems. Some concerns, such as condensation and freeze-thaw have known solutions. But wood members embedded in the masonry structure will be colder (and potentially wetter) after an interior insulation retrofit. Moisture content & relative humidity were monitored at joist ends in historic mass brick masonry walls retrofitted with interior insulation in a cold climate (Zone 5A); data were collected from 2012-2015. Eleven joist ends were monitored in all four orientations. One limitation of these results is that the renovation is still ongoing, with limited wintertime construction heating and no permanent occupancy to date. Measurements show that many joists ends remain at high moisture contents, especially at north- and east-facing orientations, with constant 100% RH conditions at the worst cases. These high moisture levels are not conducive for wood durability, but no evidence for actual structural damage has been observed. Insulated vs. non-insulated joist pockets do not show large differences. South facing joists have safe (10-15%) moisture contents. Given the uncertainty pointed out by research, definitive guidance on the vulnerability of embedded wood members is difficult to formulate. In high-risk situations, or when a very conservative approach is warranted, the embedded wood member condition can be eliminated entirely, supporting the joist ends outside of the masonry pocket.

  1. Reducing Regulatory Burden | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    As part of its implementation of Executive Order 13563, ''Improving Regulation and Regulatory Review,'' PDF icon RRB_EO_13563.pdf More Documents & Publications Reducing Regulatory Burden; Retrospective Review Under E.O. 13563 Reducing Regulatory Burden EO 13563 Third RFI

  2. Reduction of carbon content in waste-tire combustion ashes by bio-thermal treatment

    SciTech Connect (OSTI)

    Chen, C.C.; Lee, W.J.; Shih, S.I.; Mou, J.L.

    2009-07-01

    Application of bio-catalyst (NOE-7F) in thermal treatment can adequately dispose dark-black fly ashes from co-combustion of both waste tires and coal. After thermal treatment of fly ashes by adding 10% NOE-7F, the carbon contents reduced by 37.6% and the weight losses increased by 405%, compared with the fly ashes without mixing with NOE-7F. The combustion behaviors of wasted tires combustion fly ashes with NOE-7F were also investigated by both thermogravimetric analysis (TGA) and differential thermal analysis (DTA). The results verify that NOE-7F has positive effects on the combustion of residual carbon and toxic polycyclic aromatic hydrocarbons (PAHs) enhance the energy release and reduce the toxicity during the process of thermal treatment. Furthermore, using NOE-7F to dispose high-carbon content fly ashes did improve the compressive strength of fly ashes and concrete mixtures. Therefore, NOE-7F is a promising additive which could decrease treatment cost of high-carbon content fly ashes and reduce the amount of survival toxic PAHs.

  3. Reducing the negative human-health impacts of bioenergy crop emissions through region-specific crop selection

    Office of Scientific and Technical Information (OSTI)

    lopscience iopscience.iop.org Home Search Collections Journals About Contact us My lOPscience Reducing the negative human-health impacts of bioenergy crop emissions through region- specific crop selection This content has been downloaded from IOPscience. Please scroll down to see the full text. View the table of contents for this issue, or go to the journal homepage for more Download details: IP Address: 192.107.175.131 This content was downloaded on 30/07/2015 at 20:46 Please note that terms

  4. SWS Online Tool now includes Multifamily Content, plus a How...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SWS Online Tool now includes Multifamily Content, plus a How-To Webinar SWS Online Tool now includes Multifamily Content, plus a How-To Webinar This announcement contains...

  5. THE STELLAR CONTENT OF OBSCURED GALACTIC GIANT H II REGIONS....

    Office of Scientific and Technical Information (OSTI)

    THE STELLAR CONTENT OF OBSCURED GALACTIC GIANT H II REGIONS. VII. W3 Citation Details In-Document Search Title: THE STELLAR CONTENT OF OBSCURED GALACTIC GIANT H II REGIONS. VII. W3...

  6. West Virginia Heat Content of Natural Gas Deliveries to Consumers...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot) West Virginia Heat Content of Natural Gas Deliveries to Consumers (BTU per Cubic Foot) Year Jan Feb Mar Apr...

  7. Improved Technique of Hydrogen Content Analysis by Slow Neutron Scattering

    DOE R&D Accomplishments [OSTI]

    Rainwater, L. J.; Havens, W. W. Jr.

    1945-02-28

    A slow-neutron-transmission method fro determining the H content of fluorcarbons is described (G.Y.)

  8. Process for reducing aqueous nitrate to ammonia

    DOE Patents [OSTI]

    Mattus, Alfred J. (Oak Ridge, TN)

    1993-01-01

    Powdered aluminum is added to a nitrate-containing alkaline, aqueous solution to reduce the nitrate and/or nitrite to ammonia and co-produce a sinterable ceramic product.

  9. Process for reducing aqueous nitrate to ammonia

    DOE Patents [OSTI]

    Mattus, A.J.

    1993-11-30

    Powdered aluminum is added to a nitrate-containing alkaline, aqueous solution to reduce the nitrate and/or nitrite to ammonia and co-produce a sinterable ceramic product. 3 figures.

  10. Reducing Your Electricity Use | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    If you are planning to install a small renewable energy system to make your own electricity, such as a solar electric system or small wind turbine, reducing your electricity...

  11. National Renewable Energy Laboratory To Reduce Staff

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    To Reduce Staff Last updated: November 14, 1995 For information contact: Robert Noun, (303) 275-3062 Kerry Masson (303) 275-4083 Golden, Colo., November 3, 1995 -- The U.S. Department of Energy's (DOE) National Renewable Energy Laboratory (NREL) announced today a schedule for restructuring and reducing its work force in response to impending reductions in federal research budgets. Work force reductions may ultimately eliminate more than 10 percent of the present work force of about 900 full-time

  12. Reducing mode circulating fluid bed combustion

    DOE Patents [OSTI]

    Lin, Yung-Yi (Katy, TX); Sadhukhan, Pasupati (Katy, TX); Fraley, Lowell D. (Sugarland, TX); Hsiao, Keh-Hsien (Houston, TX)

    1986-01-01

    A method for combustion of sulfur-containing fuel in a circulating fluid bed combustion system wherein the fuel is burned in a primary combustion zone under reducing conditions and sulfur captured as alkaline sulfide. The reducing gas formed is oxidized to combustion gas which is then separated from solids containing alkaline sulfide. The separated solids are then oxidized and recycled to the primary combustion zone.

  13. Reduced waste generation technical work plan

    SciTech Connect (OSTI)

    Not Available

    1987-05-01

    The United States Department of Energy has established policies for avoiding plutonium losses to the waste streams and minimizing the generation of wastes produced at its nuclear facilities. This policy is evidenced in DOE Order 5820.2, which states Technical and administrative controls shall be directed towards reducing the gross volume of TRU waste generated and the amount of radioactivity in such waste.'' To comply with the DOE directive, the Defense Transuranic Waste Program (DTWP) supports and provides funding for specific research and development tasks at the various DOE sites to reduce the generation of waste. This document has been prepared to give an overview of current and past Reduced Waste Generation task activities which are to be based on technical and cost/benefit factors. The document is updated annually, or as needed, to reflect the status of program direction. Reduced Waste Generation (RWG) tasks encompass a wide range of goals which are basically oriented toward (1) avoiding the generation of waste, (2) changing processes or operations to reduce waste, (3) converting TRU waste into LLW by sorting or decontamination, and (4) reducing volumes through operations such as incineration or compaction.

  14. Infrared photoemitting diode having reduced work function

    DOE Patents [OSTI]

    Hirschfeld, Tomas B. (Livermore, CA)

    1984-01-01

    In electro-optical detectors which include as elements a photoemitting photocathode and anode, a photoemitting diode is fabricated which lowers the diode's work function, thus reducing the cooling requirement typically needed for this type of device. The work function is reduced by sandwiching between the photocathode and anode a liquid medium of the formula NR.sub.3 and having an electron affinity for the electrons of the photocathode, which liquid medium permits free electrons leaving the photocathode to remain as stable solvated species in the liquid medium. Thus, highly light-absorbent, and therefore thin, metallic layers can be used for detection, thereby reducing dark current at a given temperature, with a consequent reduction in cooling requirements at constant detector performance.

  15. Infrared photoemitting diode having reduced work function

    DOE Patents [OSTI]

    Hirschfeld, T.B.

    1982-05-06

    In electro-optical detectors which include as elements a photoemitting photocathode and anode, a photoemitting diode is fabricated which lowers the diode's work function, thus reducing the cooling requirement typically needed for this type of device. The work function is reduced by sandwiching between the photocathode and anode a liquid meidum of the formula NR/sub 3/ and having an electron affinity for the electrons of the photocathode, which liquid medium permits free electrons leaving the photocathode to remain as stable solvated species in the liquid medium. Thus, highly light-absorbent, and therefore thin, metallic layers can be used for detection, thereby reducing dark current at a given temperature, with a consequent reduction in cooling requirements at constant detector performance.

  16. Process for reducing beta activity in uranium

    DOE Patents [OSTI]

    Briggs, Gifford G. (Cincinnatti, OH); Kato, Takeo R. (Cincinnatti, OH); Schonegg, Edward (Cleves, OH)

    1986-01-01

    This invention is a method for lowering the beta radiation hazards associated with the casting of uranium. The method reduces the beta radiation emitted from the as-cast surfaces of uranium ingots. The method also reduces the amount of beta radiation emitters retained on the interiors of the crucibles that have been used to melt the uranium charges and which have undergone cleaning in a remote handling facility. The lowering of the radioactivity is done by scavenging the beta emitters from the molten uranium with a molten mixture containing the fluorides of magnesium and calcium. The method provides a means of collection and disposal of the beta emitters in a manner that reduces radiation exposure to operating personnel in the work area where the ingots are cast and processed.

  17. Process for reducing beta activity in uranium

    DOE Patents [OSTI]

    Briggs, G.G.; Kato, T.R.; Schonegg, E.

    1985-04-11

    This invention is a method for lowering the beta radiation hazards associated with the casting of uranium. The method reduces the beta radiation emitted from the as-cast surfaces of uranium ingots. The method also reduces the amount of beta radiation emitters retained on the interiors of the crucibles that have been used to melt the uranium charges and which undergone cleaning in a remote handling facility. The lowering of the radioactivity is done by scavenging the beta emitters from the molten uranium with a molten mixture containing the fluorides of magnesium and calcium. The method provides a means of collection and disposal of the beta emitters in a manner that reduces radiation exposure to operating personnel in the work area where the ingots are cast and processed. 5 tabs.

  18. Light gas gun with reduced timing jitter

    DOE Patents [OSTI]

    Laabs, G.W.; Funk, D.J.; Asay, B.W.

    1998-06-09

    Gas gun with reduced timing jitter is disclosed. A gas gun having a prepressurized projectile held in place with a glass rod in compression is described. The glass rod is destroyed with an explosive at a precise time which allows a restraining pin to be moved and free the projectile. 4 figs.

  19. Light gas gun with reduced timing jitter

    DOE Patents [OSTI]

    Laabs, Gary W. (Los Alamos, NM); Funk, David J. (Los Alamos, NM); Asay, Blaine W. (Los Alamos, NM)

    1998-01-01

    Gas gun with reduced timing jitter. A gas gun having a prepressurized projectile held in place with a glass rod in compression is described. The glass rod is destroyed with an explosive at a precise time which allows a restraining pin to be moved and free the projectile.

  20. Projection screen having reduced ambient light scattering

    DOE Patents [OSTI]

    Sweatt, William C. (Albuquerque, NM)

    2010-05-11

    An apparatus and method for improving the contrast between incident projected light and ambient light reflected from a projection screen are described. The efficiency of the projection screen for reflection of the projected light remains high, while permitting the projection screen to be utilized in a brightly lighted room. Light power requirements from the projection system utilized may be reduced.

  1. Energy Detectives Help Pennsylvania Town Reduce Costs

    Broader source: Energy.gov [DOE]

    Judith Mondre spent the past two months learning the ins and outs of Upper Darby Township, Pa.'s energy usage. She's analyzed energy bills, observed town facilities and interviewed staff to put together a plan to help the municipality reduce its total energy usage.

  2. Expanded Content Envelope For The Model 9977 Packaging

    SciTech Connect (OSTI)

    Abramczyk, G. A.; Loftin, B. M.; Nathan, S. J.; Bellamy, J. S.

    2013-07-30

    An Addendum was written to the Model 9977 Safety Analysis Report for Packaging adding a new content consisting of DOE-STD-3013 stabilized plutonium dioxide materials to the authorized Model 9977 contents. The new Plutonium Oxide Content (PuO{sub 2}) Envelope will support the Department of Energy shipment of materials between Los Alamos National Laboratory and Savannah River Site facilities. The new content extended the current content envelope boundaries for radioactive material mass and for decay heat load and required a revision to the 9977 Certificate of Compliance prior to shipment. The Addendum documented how the new contents/configurations do not compromise the safety basis presented in the 9977 SARP Revision 2. The changes from the certified package baseline and the changes to the package required to safely transport this material is discussed.

  3. Educating Consumers: New Content on Diesel Vehicles, Diesel Exhaust Fluid,

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Selective Catalytic Reduction Technologies on the AFDC | Department of Energy Educating Consumers: New Content on Diesel Vehicles, Diesel Exhaust Fluid, and Selective Catalytic Reduction Technologies on the AFDC Educating Consumers: New Content on Diesel Vehicles, Diesel Exhaust Fluid, and Selective Catalytic Reduction Technologies on the AFDC Showcases new content added to the AFDC including: Diesel Vehicles, Diesel Exhaust Fluid, Selective Catalytic Reduction Technologies, and an

  4. Web Content Analysis and Inventories | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Office of Energy Efficiency and Renewable Energy (EERE) recommends periodic content inventories and analyses of its websites. They will help identify content that needs to be updated, edited, added, or removed for maintenance. They're also recommended prior to starting a website redesign. EERE asks that all Web Coordinators and their teams review their websites' content at least once a year. It is an important part of website maintenance. Ultimately, it ensures that your team is: Aware of what

  5. CRF Researchers Are Source for 2015 QTR Sidebar Content

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Are Source for 2015 QTR Sidebar Content - Sandia Energy Energy Search Icon Sandia Home Locations Contact Us Employee Locator Energy & Climate Secure & Sustainable Energy Future ...

  6. Energy.gov Content Management System Data Tables

    Broader source: Energy.gov [DOE]

    For Office of Energy Efficiency and Renewable Energy (EERE) websites, follow these guidelines for creating Section 508-compliant data tables in the Energy.gov content management system.

  7. Section 15: Content of Compliance Recertification Application(s)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Content of Compliance Recertification Application(s) (40 CFR § 194.15) United States Department of Energy Waste Isolation Pilot Plant Carlsbad Field Office Carlsbad, New Mexico Compliance Recertification Application 2014 Content of Compliance Recertification Application(s) (40 CFR § 194.15) Table of Contents 15.0 Content of Compliance Recertification Application(s) (40 CFR § 194.15) 15.1 Requirements 15.2 Background 15.3 1998 Certification Decision 15.4 Changes in the CRA-2004 15.5 EPA's

  8. Web Content Analysis and Inventories: Template and FY 2014 Inventory...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    They're also recommended prior to starting a website redesign. This content template and sample inventory were created in Excel. The sample lists URLs, page names, navigation, ...

  9. Domestic Material Content in Molten-Salt Concentrating Solar...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Domestic Material Content in Molten-Salt Concentrating Solar Power Plants Craig Turchi, Parthiv Kurup, Sertac Akar, and Francisco Flores Technical Report NRELTP-5500-64429 August...

  10. Energy.gov Content Management System Requirements and Guidance...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Learn more about coding outside of the Energy.gov Content Management System. Communication Standards & Guidelines Home Publications, Exhibits, & Logos Websites & Digital Media Web ...

  11. EERE Program Management Guide - Cover and Table of Contents

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    .........5-35 December 2007 http:www1.eere.energy.govbaprogmgmtguide.html i EERE Program Management Guide Table of Contents ...

  12. FETC Programs for Reducing Greenhouse Gas Emissions

    SciTech Connect (OSTI)

    Ruether, J.A.

    1998-02-01

    Mark Twain once quipped that everyone talks about the weather but no one does anything about it. With interest in global climate change on the rise, researchers in the fossil-energy sector are feeling the heat to provide new technology to permit continued use of fossil fuels but with reduced emissions of so-called `greenhouse gases.` Three important greenhouse gases, carbon dioxide, methane, and nitrous oxide, are released to the atmosphere in the course of recovering and combusting fossil fuels. Their importance for trapping radiation, called forcing, is in the order given. In this report, we briefly review how greenhouse gases cause forcing and why this has a warming effect on the Earth`s atmosphere. Then we discuss programs underway at FETC that are aimed at reducing emissions of methane and carbon dioxide.

  13. Device for reducing vehicle aerodynamic resistance

    DOE Patents [OSTI]

    Graham, Sean C.

    2006-08-22

    A device for reducing vehicle aerodynamic resistance for vehicles having a generally rectangular body disposed above rear wheels, comprising a plurality of load bearing struts attached to the bottom of the rectangular body adjacent its sides, a plurality of opposing flat sheets attached to the load bearing struts, and angled flaps attached to the lower edge of the opposing sheets defining an obtuse angle with the opposing flat sheets extending inwardly with respect to the sides of the rectangular body to a predetermined height above the ground, which, stiffen the opposing flat sheets, bend to resist damage when struck by the ground, and guide airflow around the rear wheels of the vehicle to reduce its aerodynamic resistance when moving.

  14. Methods of reducing vehicle aerodynamic drag

    SciTech Connect (OSTI)

    Sirenko V.; Rohatgi U.

    2012-07-08

    A small scale model (length 1710 mm) of General Motor SUV was built and tested in the wind tunnel for expected wind conditions and road clearance. Two passive devices, rear screen which is plate behind the car and rear fairing where the end of the car is aerodynamically extended, were incorporated in the model and tested in the wind tunnel for different wind conditions. The conclusion is that rear screen could reduce drag up to 6.5% and rear fairing can reduce the drag by 26%. There were additional tests for front edging and rear vortex generators. The results for drag reduction were mixed. It should be noted that there are aesthetic and practical considerations that may allow only partial implementation of these or any drag reduction options.

  15. Quantum cryptographic system with reduced data loss

    DOE Patents [OSTI]

    Lo, Hoi-Kwong; Chau, Hoi Fung

    1998-01-01

    A secure method for distributing a random cryptographic key with reduced data loss. Traditional quantum key distribution systems employ similar probabilities for the different communication modes and thus reject at least half of the transmitted data. The invention substantially reduces the amount of discarded data (those that are encoded and decoded in different communication modes e.g. using different operators) in quantum key distribution without compromising security by using significantly different probabilities for the different communication modes. Data is separated into various sets according to the actual operators used in the encoding and decoding process and the error rate for each set is determined individually. The invention increases the key distribution rate of the BB84 key distribution scheme proposed by Bennett and Brassard in 1984. Using the invention, the key distribution rate increases with the number of quantum signals transmitted and can be doubled asymptotically.

  16. Quantum cryptographic system with reduced data loss

    DOE Patents [OSTI]

    Lo, H.K.; Chau, H.F.

    1998-03-24

    A secure method for distributing a random cryptographic key with reduced data loss is disclosed. Traditional quantum key distribution systems employ similar probabilities for the different communication modes and thus reject at least half of the transmitted data. The invention substantially reduces the amount of discarded data (those that are encoded and decoded in different communication modes e.g. using different operators) in quantum key distribution without compromising security by using significantly different probabilities for the different communication modes. Data is separated into various sets according to the actual operators used in the encoding and decoding process and the error rate for each set is determined individually. The invention increases the key distribution rate of the BB84 key distribution scheme proposed by Bennett and Brassard in 1984. Using the invention, the key distribution rate increases with the number of quantum signals transmitted and can be doubled asymptotically. 23 figs.

  17. Cascaded Microinverter PV System for Reduced Cost

    SciTech Connect (OSTI)

    Bellus, Daniel R.; Ely, Jeffrey A.

    2013-04-29

    In this project, a team led by Delphi will develop and demonstrate a novel cascaded photovoltaic (PV) inverter architecture using advanced components. This approach will reduce the cost and improve the performance of medium and large-sized PV systems. The overall project objective is to develop, build, and test a modular 11-level cascaded three-phase inverter building block for photovoltaic applications and to develop and analyze the associated commercialization plan. The system will be designed to utilize photovoltaic panels and will supply power to the electric grid at 208 VAC, 60 Hz 3-phase. With the proposed topology, three inverters, each with an embedded controller, will monitor and control each of the cascade sections, reducing costs associated with extra control boards. This report details the final disposition on this project.

  18. Erratum: "Reduced model prediction of electron temperature profiles...

    Office of Scientific and Technical Information (OSTI)

    Erratum: "Reduced model prediction of electron temperature profiles in ... Title: Erratum: "Reduced model prediction of electron temperature profiles in ...

  19. Apparatus for reducing solvent luminescence background emissions

    DOE Patents [OSTI]

    Affleck, Rhett L. (Los Alamos, NM); Ambrose, W. Patrick (Los Alamos, NM); Demas, James N. (Charlottesville, VA); Goodwin, Peter M. (Jemez Springs, NM); Johnson, Mitchell E. (Pittsburgh, PA); Keller, Richard A. (Los Alamos, NM); Petty, Jeffrey T. (Los Alamos, NM); Schecker, Jay A. (Sante Fe, NM); Wu, Ming (Los Alamos, NM)

    1998-01-01

    The detectability of luminescent molecules in solution is enhanced by reducing the background luminescence due to impurity species also present in the solution. A light source that illuminates the solution acts to photolyze the impurities so that the impurities do not luminesce in the fluorescence band of the molecule of interest. Molecules of interest may be carried through the photolysis region in the solution or may be introduced into the solution after the photolysis region.

  20. Apparatus for reducing solvent luminescence background emissions

    DOE Patents [OSTI]

    Affleck, R.L.; Ambrose, W.P.; Demas, J.N.; Goodwin, P.M.; Johnson, M.E.; Keller, R.A.; Petty, J.T.; Schecker, J.A.; Wu, M.

    1998-11-10

    The detectability of luminescent molecules in solution is enhanced by reducing the background luminescence due to impurity species also present in the solution. A light source that illuminates the solution acts to photolyze the impurities so that the impurities do not luminesce in the fluorescence band of the molecule of interest. Molecules of interest may be carried through the photolysis region in the solution or may be introduced into the solution after the photolysis region. 6 figs.

  1. Device for reducing vehicle aerodynamic resistance

    DOE Patents [OSTI]

    Graham, Sean C.

    2005-02-15

    A device for a vehicle with a pair of swinging rear doors, which converts flat sheets of pliable material hinged to the sides of the vehicle adjacent the rear thereof into effective curved airfoils that reduce the aerodynamic resistance of the vehicle, when the doors are closed by hand, utilizing a plurality of stiffeners disposed generally parallel to the doors and affixed to the sheets and a plurality of collapsible tension bearings struts attached to each stiffener and the adjacent door.

  2. NREL Transportation Project to Reduce Fuel Usage

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Transportation Project to Reduce Fuel Usage For more information contact: Sarah Holmes Barba, 303-275-3023 email: Sarah Barba Golden, Colo., Mar. 23, 2001 - The Jefferson County Seniors Resource Center (SRC) Paratransit Service has become an important part of Eulalia Gaillard's life since her stroke in 1996. She calls on SRC to drive her to cardiologist, neurologist and chiropractor appointments each week. "It's wonderful," Gaillard says. "I'd give this program 150 plus in regards

  3. Reducing Petroleum Despendence in California: Uncertainties About

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Light-Duty Diesel | Department of Energy Petroleum Despendence in California: Uncertainties About Light-Duty Diesel Reducing Petroleum Despendence in California: Uncertainties About Light-Duty Diesel 2002 DEER Conference Presentation: Center for Energy Efficiency and Renewable Technologies PDF icon 2002_deer_phillips.pdf More Documents & Publications Diesel Use in California Future Potential of Hybrid and Diesel Powertrains in the U.S. Light-Duty Vehicle Market Dumping Dirty Diesels: The

  4. Renewable Energy Can Help Reduce Oil Dependency

    ScienceCinema (OSTI)

    Arvizu, Dan

    2013-05-29

    In a speech to the Economic Club of Kansas City on June 23, 2010, NREL Director Dan Arvizu takes a realistic look at how renewable energy can help reduce America's dependence on oil, pointing out that the country gets as much energy from renewable sources now as it does from offshore oil production. For a transcript, visit http://www.nrel.gov/director/pdfs/energy_overview_06_10.pdf

  5. Consideration of Factors Affecting Strip Effluent PH and Sodium Content

    SciTech Connect (OSTI)

    Peters, T.

    2015-07-29

    A number of factors were investigated to determine possible reasons for why the Strip Effluent (SE) can sometimes have higher than expected pH values and/or sodium content, both of which have prescribed limits. All of the factors likely have some impact on the pH values and Na content.

  6. Application Content and Evaluation Criteria/Process | Department of Energy

    Energy Savers [EERE]

    Presentation on Application Content and Evaluation Criteria/Process presented at the PEM fuel cell pre-solicitation meeting held May 26, 2005 in Arlington, VA. PDF icon fc_wrkshp_reg.pdf More Documents & Publications Application Content and Evaluation Criteria/Process Microsoft Word - aDE-FOA-0000096.rtf Microsoft Word - FOA cover sheet.doc

  7. Segmented electrode hall thruster with reduced plume

    DOE Patents [OSTI]

    Fisch, Nathaniel J.; Raitses, Yevgeny

    2004-08-17

    An apparatus and method for thrusting plasma, utilizing a Hall thruster with segmented electrodes along the channel, which make the acceleration region as localized as possible. Also disclosed are methods of arranging the electrodes so as to minimize erosion and arcing. Also disclosed are methods of arranging the electrodes so as to produce a substantial reduction in plume divergence. The use of electrodes made of emissive material will reduce the radial potential drop within the channel, further decreasing the plume divergence. Also disclosed is a method of arranging and powering these electrodes so as to provide variable mode operation.

  8. Zigzag laser with reduced optical distortion

    DOE Patents [OSTI]

    Albrecht, Georg F. (Livermore, CA); Comaskey, Brian (Stockton, CA); Sutton, Steven B. (Manteca, CA)

    1994-01-01

    The architecture of the present invention has been driven by the need to solve the beam quality problems inherent in Brewster's angle tipped slab lasers. The entrance and exit faces of a solid state slab laser are cut perpendicular with respect to the pump face, thus intrinsically eliminating distortion caused by the unpumped Brewster's angled faces. For a given zigzag angle, the residual distortions inherent in the remaining unpumped or lightly pumped ends may be reduced further by tailoring the pump intensity at these ends.

  9. Zigzag laser with reduced optical distortion

    DOE Patents [OSTI]

    Albrecht, G.F.; Comaskey, B.; Sutton, S.B.

    1994-04-19

    The architecture of the present invention has been driven by the need to solve the beam quality problems inherent in Brewster's angle tipped slab lasers. The entrance and exit faces of a solid state slab laser are cut perpendicular with respect to the pump face, thus intrinsically eliminating distortion caused by the unpumped Brewster's angled faces. For a given zigzag angle, the residual distortions inherent in the remaining unpumped or lightly pumped ends may be reduced further by tailoring the pump intensity at these ends. 11 figures.

  10. Distributed Bragg Reflectors With Reduced Optical Absorption

    DOE Patents [OSTI]

    Klem, John F. (Albuquerque, NM)

    2005-08-16

    A new class of distributed Bragg reflectors has been developed. These distributed Bragg reflectors comprise interlayers positioned between sets of high-index and low-index quarter-wave plates. The presence of these interlayers is to reduce photon absorption resulting from spatially indirect photon-assisted electronic transitions between the high-index and low-index quarter wave plates. The distributed Bragg reflectors have applications for use in vertical-cavity surface-emitting lasers for use at 1.55 .mu.m and at other wavelengths of interest.

  11. Method and apparatus for reducing mixed waste

    DOE Patents [OSTI]

    Elliott, Michael L. (Kennewick, WA); Perez, Jr., Joseph M. (Richland, WA); Chapman, Chris C. (Richland, WA); Peters, Richard D. (Pasco, WA)

    1995-01-01

    The present invention is a method and apparatus for in-can waste reduction. The method is mixing waste with combustible material prior to placing the waste into a waste reduction vessel. The combustible portion is ignited, thereby reducing combustible material to ash and non-combustible material to a slag. Further combustion or heating may be used to sinter or melt the ash. The apparatus is a waste reduction vessel having receiving canister connection means on a first end, and a waste/combustible mixture inlet on a second end. An oxygen supply is provided to support combustion of the combustible mixture.

  12. Working Together to Reduce Our Environmental Footprint

    Broader source: Energy.gov (indexed) [DOE]

    MONDAY April 13 - TUESDAY April 21 All Day * Earth Day Displays * Forrestal First Floor, Ground Floor, & DOE Cafeteria MONDAY APRIL 20 11:00 A.M. - 2:30 P.M. * Environmental Film Series * Forrestal Small Auditorium GJ-015 See two excellent films related to reducing our carbon footprint and evaluating the environmental consequences of some of the products we use on a regular basis. 11:00-12:30 Tapped 1:00-2:30 Bag It TUESDAY April 21 12:00 P.M. - 1:00 P.M. * Green Tips for the Home Workshop *

  13. Domestic Material Content in Molten-Salt Concentrating Solar Power Plants

    SciTech Connect (OSTI)

    Turchi, Craig; Kurup, Parthiv; Akar, Sertac; Flores, Francisco

    2015-08-26

    This study lists material composition data for two concentrating solar power (CSP) plant designs: a molten-salt power tower and a hypothetical parabolic trough plant, both of which employ a molten salt for the heat transfer fluid (HTF) and thermal storage media. The two designs have equivalent generating and thermal energy storage capacities. The material content of the saltHTF trough plant was approximately 25% lower than a comparably sized conventional oil-HTF parabolic trough plant. The significant reduction in oil, salt, metal, and insulation mass by switching to a salt-HTF design is expected to reduce the capital cost and LCOE for the parabolic trough system.

  14. Exploiting Genetic Variation of Fiber Components and Morphology in Juvenile Loblolly Pine

    SciTech Connect (OSTI)

    Chang, Hou-Min; Kadia, John F.; Li, Bailian; Sederoff, Ron

    2005-06-30

    In order to ensure the global competitiveness of the Pulp and Paper Industry in the Southeastern U.S., more wood with targeted characteristics have to be produced more efficiently on less land. The objective of the research project is to provide a molecular genetic basis for tree breeding of desirable traits in juvenile loblolly pine, using a multidisciplinary research approach. We developed micro analytical methods for determine the cellulose and lignin content, average fiber length, and coarseness of a single ring in a 12 mm increment core. These methods allow rapid determination of these traits in micro scale. Genetic variation and genotype by environment interaction (GxE) were studied in several juvenile wood traits of loblolly pine (Pinus taeda L.). Over 1000 wood samples of 12 mm increment cores were collected from 14 full-sib families generated by a 6-parent half-diallel mating design (11-year-old) in four progeny tests. Juvenile (ring 3) and transition (ring 8) for each increment core were analyzed for cellulose and lignin content, average fiber length, and coarseness. Transition wood had higher cellulose content, longer fiber and higher coarseness, but lower lignin than juvenile wood. General combining ability variance for the traits in juvenile wood explained 3 to 10% of the total variance, whereas the specific combining ability variance was negligible or zero. There were noticeable full-sib family rank changes between sites for all the traits. This was reflected in very high specific combining ability by site interaction variances, which explained from 5% (fiber length) to 37% (lignin) of the total variance. Weak individual-tree heritabilities were found for cellulose, lignin content and fiber length at the juvenile and transition wood, except for lignin at the transition wood (0.23). Coarseness had moderately high individual-tree heritabilities at both the juvenile (0.39) and transition wood (0.30). Favorable genetic correlations of volume and stem straightness were found with cellulose content, fiber length and coarseness, suggesting that selection on growth or stem straightness would results in favorable response in chemical wood traits. We have developed a series of methods for application of functional genomics to understanding the molecular basis of traits important to tree breeding for improved chemical and physical properties of wood. Two types of technologies were used, microarray analysis of gene expression, and profiling of soluble metabolites from wood forming tissues. We were able to correlate wood property phenotypes with expression of specific genes and with the abundance of specific metabolites using a new database and appropriate statistical tools. These results implicate a series of candidate genes for cellulose content, lignin content, hemicellulose content and specific extractible metabolites. Future work should integrate such studies in mapping populations and genetic maps to make more precise associations of traits with gene locations in order to increase the predictive power of molecular markers, and to distinguish between different candidate genes associated by linkage or by function. This study has found that loblolly pine families differed significantly for cellulose yield, fiber length, fiber coarseness, and less for lignin content. The implication for forest industry is that genetic testing and selection for these traits is possible and practical. With sufficient genetic variation, we could improve cellulose yield, fiber length, fiber coarseness, and reduce lignin content in Loblolly pine. With the continued progress in molecular research, some candidate genes may be used for selecting cellulose content, lignin content, hemicellulose content and specific extractible metabolites. This would accelerate current breeding and testing program significantly, and produce pine plantations with not only high productivity, but desirable wood properties as well.

  15. Hybrid reduced order modeling for assembly calculations

    SciTech Connect (OSTI)

    Bang, Y.; Abdel-Khalik, H. S.; Jessee, M. A.; Mertyurek, U.

    2013-07-01

    While the accuracy of assembly calculations has considerably improved due to the increase in computer power enabling more refined description of the phase space and use of more sophisticated numerical algorithms, the computational cost continues to increase which limits the full utilization of their effectiveness for routine engineering analysis. Reduced order modeling is a mathematical vehicle that scales down the dimensionality of large-scale numerical problems to enable their repeated executions on small computing environment, often available to end users. This is done by capturing the most dominant underlying relationships between the model's inputs and outputs. Previous works demonstrated the use of the reduced order modeling for a single physics code, such as a radiation transport calculation. This manuscript extends those works to coupled code systems as currently employed in assembly calculations. Numerical tests are conducted using realistic SCALE assembly models with resonance self-shielding, neutron transport, and nuclides transmutation/depletion models representing the components of the coupled code system. (authors)

  16. Adaptive h -refinement for reduced-order models: ADAPTIVE h -refinement for reduced-order models

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Carlberg, Kevin T.

    2014-11-05

    Our work presents a method to adaptively refine reduced-order models a posteriori without requiring additional full-order-model solves. The technique is analogous to mesh-adaptive h-refinement: it enriches the reduced-basis space online by ‘splitting’ a given basis vector into several vectors with disjoint support. The splitting scheme is defined by a tree structure constructed offline via recursive k-means clustering of the state variables using snapshot data. This method identifies the vectors to split online using a dual-weighted-residual approach that aims to reduce error in an output quantity of interest. The resulting method generates a hierarchy of subspaces online without requiring large-scale operationsmore » or full-order-model solves. Furthermore, it enables the reduced-order model to satisfy any prescribed error tolerance regardless of its original fidelity, as a completely refined reduced-order model is mathematically equivalent to the original full-order model. Experiments on a parameterized inviscid Burgers equation highlight the ability of the method to capture phenomena (e.g., moving shocks) not contained in the span of the original reduced basis.« less

  17. Process for decomposing lignin in biomass

    DOE Patents [OSTI]

    Rector, Kirk Davin; Lucas, Marcel; Wagner, Gregory Lawrence; Kimball, David Bryan; Hanson, Susan Kloek

    2014-10-28

    A mild inexpensive process for treating lignocellulosic biomass involves oxidative delignification of wood using an aqueous solution prepared by dissolving a catalytic amount of manganese (III) acetate into water and adding hydrogen peroxide. Within 4 days and without agitation, the solution was used to convert poplar wood sections into a fine powder-like delignified, cellulose rich materials that included individual wood cells.

  18. Real-time monitoring of plutonium content in uranium-plutonium alloys

    SciTech Connect (OSTI)

    Li, Shelly Xiaowei; Westphal, Brian Robert; Herrmann, Steven Douglas

    2015-09-01

    A method and device for the real-time, in-situ monitoring of Plutonium content in U--Pu Alloys comprising providing a crucible. The crucible has an interior non-reactive to a metallic U--Pu alloy within said interior of said crucible. The U--Pu alloy comprises metallic uranium and plutonium. The U--Pu alloy is heated to a liquid in an inert or reducing atmosphere. The heated U--Pu alloy is then cooled to a solid in an inert or reducing atmosphere. As the U--Pu alloy is cooled, the temperature of the U--Pu alloy is monitored. A solidification temperature signature is determined from the monitored temperature of the U--Pu alloy during the step of cooling. The amount of Uranium and the amount of Plutonium in the U--Pu alloy is then determined from the determined solidification temperature signature.

  19. Electrospray ion source with reduced analyte electrochemistry

    DOE Patents [OSTI]

    Kertesz, Vilmos; Van Berkel, Gary J

    2013-07-30

    An electrospray ion (ESI) source and method capable of ionizing an analyte molecule without oxidizing or reducing the analyte of interest. The ESI source can include an emitter having a liquid conduit, a working electrode having a liquid contacting surface, a spray tip, a secondary working electrode, and a charge storage coating covering partially or fully the liquid contacting surface of the working electrode. The liquid conduit, the working electrode and the secondary working electrode can be in liquid communication. The electrospray ion source can also include a counter electrode proximate to, but separated from, said spray tip. The electrospray ion source can also include a power system for applying a voltage difference between the working electrodes and a counter-electrode. The power system can deliver pulsed voltage changes to the working electrodes during operation of said electrospray ion source to minimize the surface potential of the charge storage coating.

  20. Device for reducing vehicle aerodynamic resistance

    DOE Patents [OSTI]

    Graham, Sean C.

    2006-03-07

    A device for reducing vehicle aerodynamic resistance for vehicles having a generally rectangular flat front face comprising a plurality of load bearing struts of a predetermined size attached to the flat front face adjacent the sides and top thereof, a pair of pliable opposing flat sheets having an outside edge portion attached to the flat front face adjacent the sides thereof and an upper edge with a predetermined curve; the opposing flat sheets being bent and attached to the struts to form effective curved airfoil shapes, and a top pliable flat sheet disposed adjacent the top of the flat front face and having predetermined curved side edges, which, when the top sheet is bent and attached to the struts to form an effective curved airfoil shape, mate with the curved upper edges of the opposing sheets to complete the aerodynamic device.

  1. Multiple hearth furnace for reducing iron oxide

    DOE Patents [OSTI]

    Brandon, Mark M. (Charlotte, NC); True, Bradford G. (Charlotte, NC)

    2012-03-13

    A multiple moving hearth furnace (10) having a furnace housing (11) with at least two moving hearths (20) positioned laterally within the furnace housing, the hearths moving in opposite directions and each moving hearth (20) capable of being charged with at least one layer of iron oxide and carbon bearing material at one end, and being capable of discharging reduced material at the other end. A heat insulating partition (92) is positioned between adjacent moving hearths of at least portions of the conversion zones (13), and is capable of communicating gases between the atmospheres of the conversion zones of adjacent moving hearths. A drying/preheat zone (12), a conversion zone (13), and optionally a cooling zone (15) are sequentially positioned along each moving hearth (30) in the furnace housing (11).

  2. Reducing VOC Press Emission from OSB Manufacturing

    SciTech Connect (OSTI)

    Dr. Gary D. McGinnis; Laura S. WIlliams; Amy E. Monte; Jagdish Rughani: Brett A. Niemi; Thomas M. Flicker

    2001-12-31

    Current regulations require industry to meet air emission standards with regard to particulates, volatile organic compounds (VOCs), hazardous air pollutants (HAPs) and other gases. One of many industries that will be affected by the new regulations is the wood composites industry. This industry generates VOCs, HAPs, and particulates mainly during the drying and pressing of wood. Current air treatment technologies for the industry are expensive to install and operate. As regulations become more stringent, treatment technologies will need to become more efficient and cost effective. The overall objective of this study is to evaluate the use of process conditions and chemical additives to reduce VOC/HAPs in air emitted from presses and dryers during the production of oriented strand board.

  3. Nanotexturing of surfaces to reduce melting point.

    SciTech Connect (OSTI)

    Garcia, Ernest J.; Zubia, David; Mireles, Jose; Marquez, Noel; Quinones, Stella

    2011-11-01

    This investigation examined the use of nano-patterned structures on Silicon-on-Insulator (SOI) material to reduce the bulk material melting point (1414 C). It has been found that sharp-tipped and other similar structures have a propensity to move to the lower energy states of spherical structures and as a result exhibit lower melting points than the bulk material. Such a reduction of the melting point would offer a number of interesting opportunities for bonding in microsystems packaging applications. Nano patterning process capabilities were developed to create the required structures for the investigation. One of the technical challenges of the project was understanding and creating the specialized conditions required to observe the melting and reshaping phenomena. Through systematic experimentation and review of the literature these conditions were determined and used to conduct phase change experiments. Melting temperatures as low as 1030 C were observed.

  4. Electrospray ion source with reduced analyte electrochemistry

    DOE Patents [OSTI]

    Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

    2011-08-23

    An electrospray ion (ESI) source and method capable of ionizing an analyte molecule without oxidizing or reducing the analyte of interest. The ESI source can include an emitter having a liquid conduit, a working electrode having a liquid contacting surface, a spray tip, a secondary working electrode, and a charge storage coating covering partially or fully the liquid contacting surface of the working electrode. The liquid conduit, the working electrode and the secondary working electrode can be in liquid communication. The electrospray ion source can also include a counter electrode proximate to, but separated from, said spray tip. The electrospray ion source can also include a power system for applying a voltage difference between the working electrodes and a counter-electrode. The power system can deliver pulsed voltage changes to the working electrodes during operation of said electrospray ion source to minimize the surface potential of the charge storage coating.

  5. Method of data communications with reduced latency

    DOE Patents [OSTI]

    Blocksome, Michael A; Parker, Jeffrey J

    2013-11-05

    Data communications with reduced latency, including: writing, by a producer, a descriptor and message data into at least two descriptor slots of a descriptor buffer, the descriptor buffer comprising allocated computer memory segmented into descriptor slots, each descriptor slot having a fixed size, the descriptor buffer having a header pointer that identifies a next descriptor slot to be processed by a DMA controller, the descriptor buffer having a tail pointer that identifies a descriptor slot for entry of a next descriptor in the descriptor buffer; recording, by the producer, in the descriptor a value signifying that message data has been written into descriptor slots; and setting, by the producer, in dependence upon the recorded value, a tail pointer to point to a next open descriptor slot.

  6. Reducing the losses of optical metamaterials

    SciTech Connect (OSTI)

    Fang, Anan

    2010-12-15

    The field of metamaterials is driven by fascinating and far-reaching theoretical visions, such as perfect lenses, invisibility cloaking, and enhanced optical nonlinearities. However, losses have become the major obstacle towards real world applications in the optical regime. Reducing the losses of optical metamaterials becomes necessary and extremely important. In this thesis, two approaches are taken to reduce the losses. One is to construct an indefinite medium. Indefinite media are materials where not all the principal components of the permittivity and permeability tensors have the same sign. They do not need the resonances to achieve negative permittivity, {var_epsilon}. So, the losses can be comparatively small. To obtain indefinite media, three-dimensional (3D) optical metallic nanowire media with different structures are designed. They are numerically demonstrated that they are homogeneous effective indefinite anisotropic media by showing that their dispersion relations are hyperbolic. Negative group refraction and pseudo focusing are observed. Another approach is to incorporate gain into metamaterial nanostructures. The nonlinearity of gain is included by a generic four-level atomic model. A computational scheme is presented, which allows for a self-consistent treatment of a dispersive metallic photonic metamaterial coupled to a gain material incorporated into the nanostructure using the finite-difference time-domain (FDTD) method. The loss compensations with gain are done for various structures, from 2D simplified models to 3D realistic structures. Results show the losses of optical metamaterials can be effectively compensated by gain. The effective gain coefficient of the combined system can be much larger than the bulk gain counterpart, due to the strong local-field enhancement.

  7. Reduction of FeO contents in sinter under high bed operation

    SciTech Connect (OSTI)

    Fujii, K.; Hazama, K.; Hoshikuma, Y.; Tarumoto, S.; Nunomura, S.; Hirota, N.

    1996-12-31

    High-bed operation (bed height more than 700 mm) is currently being carried out at the Kure No. 1 sintering plant. Before initiating this high-bed operation, the authors conducted sinter pot tests at various bed heights to investigate the effect of bed height on sintering. The following results were obtained from these pot tests: Heightening of the sinter bed increased yield at the upper layer, but at the lower layer, the yield reached a maximum value at a certain bed height. From observation of the sinter cakes, the reduction in yield is attributed to uneven burn caused by surplus heat at the lower layers. Therefore, when high-bed operation is carried out, reduction of the burning energy (reduction of the FeO content in the sinter) is required. This high-bed operation with lower FeO content has enabled the company to reduce fuel consumption and SiO{sub 2} content, while maintaining high yield and high sinter quality.

  8. Intelligent Data Management (IDM) for a Content-Based Image Retrieval System

    Energy Science and Technology Software Center (OSTI)

    2002-10-08

    With the availability of low-cost, high-performance computers, memory, and disk storage media, image libraries and content-based image retrieval (CBIR) technologies are becoming more prevalent. CBIR refers to technologies and systems that index large digital image libraries using image content derived from visual characteristics of the image such as color, texture and structure. Although large repositories can be readily assembled, the efficiency of these systems to retrieve the most relevant imagery is still a function ofmore » capacity and long-term storage. Due to the rapid growth in the size of image libraries and the high potential for data redundancy, the Intelligent Data Management (IDM) method has been developed to achieve a reduction in redundancy (IDM) method has been developed to achieve a reduction in redundancy that facilities either: (1) the long-term storage of the most information-rich image content (i.e., maintaining the same DB capacity but keeping data for a longer period of time), or (2) a reduction in the size of the repository capacity which results in improved performance (i.e., storage and retrieval efficiency) and reduced time for indexing.« less

  9. Recommending personally interested contents by text mining, filtering, and interfaces

    DOE Patents [OSTI]

    xu, Songhua

    2015-11-05

    A personalized content recommendation system includes a client interface device configured to monitor a user's information data stream. A collaborative filter remote from the client interface device generates automated predictions about the interests of the user. A database server stores personal behavioral profiles and user's preferences based on a plurality of monitored past behaviors and an output of the collaborative user personal interest inference engine. A programmed personal content recommendation server filters items in an incoming information stream with the personal behavioral profile and identifies only those items of the incoming information stream that substantially matches the personal behavioral profile. The identified personally relevant content is then recommended to the user following some priority that may consider the similarity between the personal interest matches, the context of the user information consumption behaviors that may be shown by the user's content consumption mode.

  10. Recommending personally interested contents by text mining, filtering, and interfaces

    DOE Patents [OSTI]

    Xu, Songhua

    2015-10-27

    A personalized content recommendation system includes a client interface device configured to monitor a user's information data stream. A collaborative filter remote from the client interface device generates automated predictions about the interests of the user. A database server stores personal behavioral profiles and user's preferences based on a plurality of monitored past behaviors and an output of the collaborative user personal interest inference engine. A programmed personal content recommendation server filters items in an incoming information stream with the personal behavioral profile and identifies only those items of the incoming information stream that substantially matches the personal behavioral profile. The identified personally relevant content is then recommended to the user following some priority that may consider the similarity between the personal interest matches, the context of the user information consumption behaviors that may be shown by the user's content consumption mode.

  11. Recent content in Linked Open Data Workshop in Washington, D...

    Open Energy Info (EERE)

    Recent content in Linked Open Data Workshop in Washington, D.C. Home Name Post date sort icon Type Detailed Planning Kicks Off Jweers 27 Sep 2012 - 06:53 Blog entry Notes from the...

  12. A Review Of Water Contents Of Nominally Anhydrous Natural Minerals...

    Open Energy Info (EERE)

    Of Water Contents Of Nominally Anhydrous Natural Minerals In The Mantles Of Earth, Mars And The Moon Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal...

  13. This content has been downloaded from IOPscience. Please scroll...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    C11003 2013 JINST 8 C11003 Contents 1 Introduction and motivation 1 2 Model of detector system and noise sources 2 3 Simulation results 2 3.1 Constant signal model 2 3.2 Pulse...

  14. Recent content in Databus | OpenEI Community

    Open Energy Info (EERE)

    Question Groups Menu You must login in order to post into this group. Recent content Hello-Sorry for the delay in... Use of DynamicAggregationProcessor I submitted a pull...

  15. Energy.gov Content Management System Requirements and Guidance

    Broader source: Energy.gov [DOE]

    The Office of Energy Efficiency and Renewable Energy's (EERE's) websites are hosted in Energy.gov's Drupal content management system (CMS), which is maintained by the U.S. Department of Energy's Public Affairs Office.

  16. T-544: Cisco Security Advisory: Cisco Content Services Gateway...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    a single content service to be active on the Cisco CSG2 and can be exploited via crafted TCP packets. A three-way handshake is not required to exploit either of these...

  17. Mercury Contents of Natural Thermal and Mineral Fluids, In- U...

    Open Energy Info (EERE)

    Paper 713 Jump to: navigation, search OpenEI Reference LibraryAdd to library Book Section: Mercury Contents of Natural Thermal and Mineral Fluids, In- U.S. Geological...

  18. On-Bill Financing: Reducing Cost Barriers to Energy Efficiency...

    Office of Environmental Management (EM)

    On-Bill Financing: Reducing Cost Barriers to Energy Efficiency Improvements (201) On-Bill Financing: Reducing Cost Barriers to Energy Efficiency Improvements (201) October 8...

  19. A Reduced Mechanism for Biodiesel Surrogates with Low Temperature...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reduced Mechanism for Biodiesel Surrogates with Low Temperature Chemistry Title A Reduced Mechanism for Biodiesel Surrogates with Low Temperature Chemistry Publication Type...

  20. Reducing Energy Demand in Buildings Through State Energy Codes...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing Energy Demand in Buildings Through State Energy Codes Reducing Energy Demand in ... More Documents & Publications Technology Performance Exchange - 2013 BTO Peer Review ...

  1. DOE Announces Webinars on Reducing Energy Use in Buildings, Integratin...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing Energy Use in Buildings, Integrating Bioenergy into the Classroom, and More DOE Announces Webinars on Reducing Energy Use in Buildings, Integrating Bioenergy into the ...

  2. Petroleum Reduction Strategies to Reduce Vehicle Miles Traveled

    Broader source: Energy.gov [DOE]

    For reducing greenhouse gas emissions, the table below describes petroleum reduction strategies to reduce vehicle miles traveled, as well as guidance and best practices for each strategy.

  3. Low-Cost Packaged CHP System with Reduced Emissions - Presentation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Low-Cost Packaged CHP System with Reduced Emissions - Presentation by Cummins Power Generation, June 2011 Low-Cost Packaged CHP System with Reduced Emissions - Presentation by ...

  4. Reducing Cost Barriers to Energy Efficiency Improvements (201...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing Cost Barriers to Energy Efficiency Improvements (201) Reducing Cost Barriers to Energy Efficiency Improvements (201) Better Buildings Residential Network Peer Exchange...

  5. Improved Monitor Design and Configuration for Reducing Reported...

    Office of Environmental Management (EM)

    Design and Configuration for Reducing Reported Tritium Discharges from the Orphee Research Reactor Improved Monitor Design and Configuration for Reducing Reported Tritium...

  6. Project Profile: Reducing the Cost of Thermal Energy Storage...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing the Cost of Thermal Energy Storage for Parabolic Trough Solar Power Plants Project Profile: Reducing the Cost of Thermal Energy Storage for Parabolic Trough Solar Power...

  7. Reduced Call-Backs with High Performance Production Builders...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reduced Call-Backs with High Performance Production Builders - Building America Top Innovation Reduced Call-Backs with High Performance Production Builders - Building America Top ...

  8. IRS Parking Facility Lighting Retrofit Reduces Annual Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    IRS Parking Facility Lighting Retrofit Reduces Annual Energy Use by 76% IRS Parking Facility Lighting Retrofit Reduces Annual Energy Use by 76% IRS Parking Facility Lighting ...

  9. Advanced Soft Switching Inverter for Reducing Switching and Power...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Soft Switching Inverter for Reducing Switching and Power Losses Advanced Soft Switching Inverter for Reducing Switching and Power Losses 2009 DOE Hydrogen Program and Vehicle...

  10. Advanced Soft Switching Inverter for Reducing Switching and Power...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Soft Switching Inverter for Reducing Switching and Power Losses Advanced Soft Switching Inverter for Reducing Switching and Power Losses 2010 DOE Vehicle Technologies and Hydrogen...

  11. Next-Generation Power Electronics: Reducing Energy Waste and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Next-Generation Power Electronics: Reducing Energy Waste and Powering the Future Next-Generation Power Electronics: Reducing Energy Waste and Powering the Future January 15, 2014 - ...

  12. Department of Energy Request for Information: Reducing Regulatory...

    Office of Environmental Management (EM)

    Request for Information: Reducing Regulatory Burden (Reply Comments) Department of Energy Request for Information: Reducing Regulatory Burden (Reply Comments) Comments on RFI on...

  13. Metal and Glass Manufacturers Reduce Costs by Increasing Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Metal and Glass Manufacturers Reduce Costs by Increasing Energy Efficiency in Process Heating Systems Metal and Glass Manufacturers Reduce Costs by Increasing Energy Efficiency in...

  14. Milestone Reached: New Process Reduces Cost and Risk of Biofuel...

    Office of Environmental Management (EM)

    Milestone Reached: New Process Reduces Cost and Risk of Biofuel Production from Bio-Oil Upgrading Milestone Reached: New Process Reduces Cost and Risk of Biofuel Production from ...

  15. Development and Validation of a Reduced Mechanism for Biodiesel...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    a Reduced Mechanism for Biodiesel Surrogates for Compression Ignition Engine Applications Development and Validation of a Reduced Mechanism for Biodiesel Surrogates for ...

  16. Unconventional Oil and Gas Projects Help Reduce Environmental...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Unconventional Oil and Gas Projects Help Reduce Environmental Impact of Development Unconventional Oil and Gas Projects Help Reduce Environmental Impact of Development April 17, ...

  17. COLLOQUIUM: Cybersnooping: Collection and Analysis of Metadata and Content

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    | Princeton Plasma Physics Lab November 20, 2013, 4:00pm to 5:15pm Colloquia MBG Auditorium COLLOQUIUM: Cybersnooping: Collection and Analysis of Metadata and Content Professor Edward Felten Princeton University Abstract: PDF icon COLL.11.20.13.pdf Recent reports indicate that governments (and perhaps others) have been collecting large amount of metadata and possibly content of phone calls, emails, and other communications. This talk will review what we know about current collection

  18. Energy.gov Content Management System Webforms | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Webforms Energy.gov Content Management System Webforms For Office of Energy Efficiency and Renewable Energy (EERE) websites, Energy.gov's content management system (CMS) has the ability to create webforms. Although webforms are technically easy to create, there are certain federal regulations-such as the Paperwork Reduction Act and Privacy Impact Assessment-to consider before you collect information from the general public. To review the process for adding webforms, log in to the CMS and go to

  19. Similarity Engine: Using Content Similarity to Improve Memory Resilience.

    Office of Scientific and Technical Information (OSTI)

    (Conference) | SciTech Connect Conference: Similarity Engine: Using Content Similarity to Improve Memory Resilience. Citation Details In-Document Search Title: Similarity Engine: Using Content Similarity to Improve Memory Resilience. Abstract not provided. Authors: Levy, Scott N. ; Ferreira, Kurt Brian ; Bridges, Patrick G Publication Date: 2016-01-01 OSTI Identifier: 1239385 Report Number(s): SAND2016-0499C 618682 DOE Contract Number: AC04-94AL85000 Resource Type: Conference Resource

  20. DOE NEPA Guidance and Requirements - Search Index - List of Contents |

    Office of Environmental Management (EM)

    Department of Energy List of Contents DOE NEPA Guidance and Requirements - Search Index - List of Contents Return to Download Page The NEPA Guidance and Requirements - Search Index includes: A Brief Guide - DOE-wide Contracts For NEPA Documentation [DOE][2003] A Citizen's Guide to the NEPA - Having Your Voice Heard [CEQ][2007] A Resource Handbook on DOE Transportation Risk Assessment [DOE][2002] Actions During the NEPA Process - Interim Actions [DOE][2003] Administrative Record Guidance

  1. DOE NEPA Guidance and Requirements - Search Index - Table of Contents |

    Office of Environmental Management (EM)

    Department of Energy Table of Contents DOE NEPA Guidance and Requirements - Search Index - Table of Contents Return to Download Page The DOE NEPA Guidance and Requirements - Search Index includes: NEPA Guidance and Requirements Documents Issued by Published A Brief Guide - DOE-wide Contracts For NEPA Documentation DOE 2003 A Citizen's Guide to the NEPA - Having Your Voice Heard CEQ 2007 A Resource Handbook on DOE Transportation Risk Assessment DOE 2002 Actions During the NEPA Process -

  2. Exploiting Data Similarity to Reduce Memory Footprints

    SciTech Connect (OSTI)

    Biswas, S; de Supinski, B R; Schulz, M; Franklin, D; Sherwood, T; Chong, F T

    2011-01-28

    Memory size has long limited large-scale applications on high-performance computing (HPC) systems. Since compute nodes frequently do not have swap space, physical memory often limits problem sizes. Increasing core counts per chip and power density constraints, which limit the number of DIMMs per node, have exacerbated this problem. Further, DRAM constitutes a significant portion of overall HPC system cost. Therefore, instead of adding more DRAM to the nodes, mechanisms to manage memory usage more efficiently - preferably transparently - could increase effective DRAM capacity and thus the benefit of multicore nodes for HPC systems. MPI application processes often exhibit significant data similarity. These data regions occupy multiple physical locations across the individual rank processes within a multicore node and thus offer a potential savings in memory capacity. These regions, primarily residing in heap, are dynamic, which makes them difficult to manage statically. Our novel memory allocation library, SBLLmalloc, automatically identifies identical memory blocks and merges them into a single copy. SBLLmalloc does not require application or OS changes since we implement it as a user-level library. Overall, we demonstrate that SBLLmalloc reduces the memory footprint of a range of MPI applications by 32.03% on average and up to 60.87%. Further, SBLLmalloc supports problem sizes for IRS over 21.36% larger than using standard memory management techniques, thus significantly increasing effective system size. Similarly, SBLLmalloc requires 43.75% fewer nodes than standard memory management techniques to solve an AMG problem.

  3. Reducing the Consequences of a Nuclear Detonation.

    SciTech Connect (OSTI)

    Buddemeier, B R

    2007-11-09

    The 2002 National Strategy to Combat Weapons of Mass Destruction states that 'the United States must be prepared to respond to the use of WMD against our citizens, our military forces, and those of friends and allies'. Scenario No.1 of the 15 Department of Homeland Security national planning scenarios is an improvised nuclear detonation in the national capitol region. An effective response involves managing large-scale incident response, mass casualty, mass evacuation, and mass decontamination issues. Preparedness planning activities based on this scenario provided difficult challenges in time critical decision making and managing a large number of casualties within the hazard area. Perhaps even more challenging is the need to coordinate a large scale response across multiple jurisdictions and effectively responding with limited infrastructure and resources. Federal response planning continues to make improvements in coordination and recommending protective actions, but much work remains. The most critical life-saving activity depends on actions taken in the first few minutes and hours of an event. The most effective way to reduce the enormous national and international social and economic disruptions from a domestic nuclear explosion is through planning and rapid action, from the individual to the federal response. Anticipating response resources for survivors based on predicted types and distributions of injuries needs to be addressed.

  4. Method and apparatus for reducing the harmonic currents in alternating-current distribution networks

    DOE Patents [OSTI]

    Beverly, L.H.; Hance, R.D.; Kristalinski, A.L.; Visser, A.T.

    1996-11-19

    An improved apparatus and method reduce the harmonic content of AC line and neutral line currents in polyphase AC source distribution networks. The apparatus and method employ a polyphase Zig-Zag transformer connected between the AC source distribution network and a load. The apparatus and method also employs a mechanism for increasing the source neutral impedance of the AC source distribution network. This mechanism can consist of a choke installed in the neutral line between the AC source and the Zig-Zag transformer. 23 figs.

  5. Method and apparatus for reducing the harmonic currents in alternating-current distribution networks

    DOE Patents [OSTI]

    Beverly, Leon H. (Lockport, IL); Hance, Richard D. (Elburn, IL); Kristalinski, Alexandr L. (Naperville, IL); Visser, Age T. (Geneva, IL)

    1996-01-01

    An improved apparatus and method reduce the harmonic content of AC line and neutral line currents in polyphase AC source distribution networks. The apparatus and method employ a polyphase Zig-Zag transformer connected between the AC source distribution network and a load. The apparatus and method also employs a mechanism for increasing the source neutral impedance of the AC source distribution network. This mechanism can consist of a choke installed in the neutral line between the AC source and the Zig-Zag transformer.

  6. Geochemical, mineralogical and microbiological characteristics of sediment from a naturally reduced zone in a uranium-contaminated aquife

    SciTech Connect (OSTI)

    Campbell, K M; K Kukkadapu, R K; Qafoku, N P; Peacock, A D; Lesher, E; Williams, K H; Bargar, J R; Wilkins, M J; Figueroa, L; Ranville, J; Davis, J A; Long, P E

    2012-05-23

    Localized zones or lenses of naturally reduced sediments have the potential to play a significant role in the fate and transport of redox-sensitive metals and metalloids in aquifers. To assess the mineralogy, microbiology and redox processes that occur in these zones, several cores from a region of naturally occurring reducing conditions in a U-contaminated aquifer (Rifle, CO) were examined. Sediment samples from a transect of cores ranging from oxic/suboxic Rifle aquifer sediment to naturally reduced sediment were analyzed for U and Fe content, oxidation state, and mineralogy; reduced S phases; and solid-phase organic C content using a suite of analytical and spectroscopic techniques on bulk sediment and size fractions. Solid-phase U concentrations were higher in the naturally reduced zone, with a high proportion of the U present as U(IV). The sediments were also elevated in reduced S phases and Fe(II), indicating it is very likely that U(VI), Fe(III), and SO4 reduction has occurred or is occurring in the sediment. The microbial community was assessed using lipid- and DNA-based techniques, and statistical redundancy analysis was performed to determine correlations between the microbial community and the geochemistry. Increased concentrations of solid-phase organic C and biomass in the naturally reduced sediment suggests that natural bioreduction is stimulated by a zone of increased organic C concentration associated with fine-grained material and lower permeability to groundwater flow. Characterization of the naturally bioreduced sediment provides an understanding of the natural processes that occur in the sediment under reducing conditions and how they may impact natural attenuation of radionuclides and other redox sensitive materials. Results also suggest the importance of recalcitrant organic C for maintaining reducing conditions and U immobilization.

  7. Technetium Sorption By Cementitious Materials Under Reducing Conditions

    SciTech Connect (OSTI)

    Kaplan, Daniel I.; Estes, Shanna L.; Arai, Yuji; Powell, Brian A.

    2013-07-18

    The objective of this study was to measure Tc sorption to cementitious materials under reducing conditions to simulate Saltstone Disposal Facility conditions. Earlier studies were conducted and the experimental conditions were found not to simulate those of the facility. Through a five month subcontract with Clemson University, sorption of {sup 99}Tc to four cementitious materials was examined within an anaerobic glovebag targeting a 0.1% H{sub 2}(g)/ 99.9% N{sub 2}(g) atmosphere. Early experiments based on Tc sorption and Eh indicated that 0.1% H{sub 2}(g) (a reductant) was necessary to preclude experimental impacts from O{sub 2}(g) diffusion into the glovebag. Preliminary data to date (up to 56 days) indicates that sorption of {sup 99}Tc to cementitious materials increased with increasing slag content for simulated saltstone samples. This is consistent with the conceptual model that redox active sulfide groups within the reducing slag facilitate reduction of Tc(VII) to Tc(IV). These experiments differ from previous experiments where a 2% H{sub 2}(g) atmosphere was maintained (Kaplan et al., 2011 (SRNL-STI-2010-00668)). The impact of the 2% H{sub 2}(g) reducing atmosphere on this data was examined and determined to cause the reduction of Tc in experimental samples without slag. In the present ongoing study, after 56 days, Tc sorption by the 50-year old cement samples (no slag) was undetectable, whereas Tc sorption in the cementitious materials containing slag continues to increase with contact time (measured after 1, 4, 8, 19 and 56 days). Sorption was not consistent with spike concentrations and steady state has not been demonstrated after 56 days. The average conditional K{sub d} value for the Vault 2 cementitious material was 873 mL/g (17% slag), for the TR547 Saltstone (45% slag) the conditional K{sub d} was 168 mL/g, and for TR545 (90% slag) the conditional K{sub d} was 1,619 mL/g. It is anticipated that additional samples will be collected until steady state conditions are established to permit measuring more representative K{sub d} and solubility values under these experimental conditions. The purpose of this revision is to correct K{sub d} values reported in the original document. This document reports results for the first 56 days of a 319 day experiment. After the experiment had finished and all the data were compiled for QA/QC analysis, a mistake in the K{sub d} calculations was found. The K{sub d} values reported in revision 0 of this report were essentially one order of magnitude higher than the actual values. In this revision, the text references to K{sub d} values have been updated along with the data in Figure 2 and Appendix B. Between the time the original document was issued, Janurary 2012, and this document was issued, a final report (Estes et al. 2012; SRNL-STI-2012-00596, Rev. 0) describing all the corrected data for the 319 day experiment was issued. This document does not contain any data that is not already reported in the final report (SRNL-STI-2012-00596, Rev. 0).

  8. NEMA Comments on Reducing Regulatory Burden | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing Regulatory Burden NEMA Comments on Reducing Regulatory Burden The National Electrical Manufacturers Association (NEMA) thanks you for the opportunity to provide comments on the Department of Energy's efforts to make its regulatory program more effective and less burdensome in achieving its regulatory objectives. PDF icon NEMA_Comments_on_Reducing_Reg_Burden.pdf More Documents & Publications NEMA Comments on DOE Reducing Regulatory Burden RFI NEMA Comments on DOE Reducing Regulatory

  9. Reducing Regulatory Burden; Retrospective Review Under E.O. 13563 |

    Energy Savers [EERE]

    Department of Energy Burden; Retrospective Review Under E.O. 13563 Reducing Regulatory Burden; Retrospective Review Under E.O. 13563 Request for information on reducing regulatory burden, E.O. 13563 PDF icon Reducing Regulatory Burden; Retrospective Review Under E.O. 13563 More Documents & Publications Notice of Availability of Preliminary Plan for Retrospective Analysis of Existing Rules Reducing Regulatory Burden Reducing Regulatory Burden

  10. Alternative Fuels Data Center: Knoxville Utilities Board Reduces Petroleum

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Use Knoxville Utilities Board Reduces Petroleum Use to someone by E-mail Share Alternative Fuels Data Center: Knoxville Utilities Board Reduces Petroleum Use on Facebook Tweet about Alternative Fuels Data Center: Knoxville Utilities Board Reduces Petroleum Use on Twitter Bookmark Alternative Fuels Data Center: Knoxville Utilities Board Reduces Petroleum Use on Google Bookmark Alternative Fuels Data Center: Knoxville Utilities Board Reduces Petroleum Use on Delicious Rank Alternative Fuels

  11. Alternative Fuels Data Center: Dallas Police Department Reduces Vehicle

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Idling Dallas Police Department Reduces Vehicle Idling to someone by E-mail Share Alternative Fuels Data Center: Dallas Police Department Reduces Vehicle Idling on Facebook Tweet about Alternative Fuels Data Center: Dallas Police Department Reduces Vehicle Idling on Twitter Bookmark Alternative Fuels Data Center: Dallas Police Department Reduces Vehicle Idling on Google Bookmark Alternative Fuels Data Center: Dallas Police Department Reduces Vehicle Idling on Delicious Rank Alternative Fuels

  12. Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Use Michigan Fleet Reduces Gasoline and Diesel Use to someone by E-mail Share Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Facebook Tweet about Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Twitter Bookmark Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Google Bookmark Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Delicious Rank Alternative Fuels Data

  13. Alternative Fuels Data Center: Reynolds Logistics Reduces Fuel Costs With

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    EVs Reynolds Logistics Reduces Fuel Costs With EVs to someone by E-mail Share Alternative Fuels Data Center: Reynolds Logistics Reduces Fuel Costs With EVs on Facebook Tweet about Alternative Fuels Data Center: Reynolds Logistics Reduces Fuel Costs With EVs on Twitter Bookmark Alternative Fuels Data Center: Reynolds Logistics Reduces Fuel Costs With EVs on Google Bookmark Alternative Fuels Data Center: Reynolds Logistics Reduces Fuel Costs With EVs on Delicious Rank Alternative Fuels Data

  14. Alternative Fuels Data Center: Students Reduce Vehicle Idling in San

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Antonio, Texas Students Reduce Vehicle Idling in San Antonio, Texas to someone by E-mail Share Alternative Fuels Data Center: Students Reduce Vehicle Idling in San Antonio, Texas on Facebook Tweet about Alternative Fuels Data Center: Students Reduce Vehicle Idling in San Antonio, Texas on Twitter Bookmark Alternative Fuels Data Center: Students Reduce Vehicle Idling in San Antonio, Texas on Google Bookmark Alternative Fuels Data Center: Students Reduce Vehicle Idling in San Antonio, Texas on

  15. Alternative Fuels Data Center: Tennessee Reduces Pollution With Propane

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Hybrid Trolleys Tennessee Reduces Pollution With Propane Hybrid Trolleys to someone by E-mail Share Alternative Fuels Data Center: Tennessee Reduces Pollution With Propane Hybrid Trolleys on Facebook Tweet about Alternative Fuels Data Center: Tennessee Reduces Pollution With Propane Hybrid Trolleys on Twitter Bookmark Alternative Fuels Data Center: Tennessee Reduces Pollution With Propane Hybrid Trolleys on Google Bookmark Alternative Fuels Data Center: Tennessee Reduces Pollution With

  16. Alternative Fuels Data Center: Wisconsin Reduces Emissions With Natural Gas

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Trucks Wisconsin Reduces Emissions With Natural Gas Trucks to someone by E-mail Share Alternative Fuels Data Center: Wisconsin Reduces Emissions With Natural Gas Trucks on Facebook Tweet about Alternative Fuels Data Center: Wisconsin Reduces Emissions With Natural Gas Trucks on Twitter Bookmark Alternative Fuels Data Center: Wisconsin Reduces Emissions With Natural Gas Trucks on Google Bookmark Alternative Fuels Data Center: Wisconsin Reduces Emissions With Natural Gas Trucks on Delicious

  17. RH-TRU Waste Content Codes (RH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2007-08-01

    The Remote-Handled Transuranic (RH-TRU) Content Codes (RH-TRUCON) document describes the inventory of RH-TRU waste within the transportation parameters specified by the Remote-Handled Transuranic Waste Authorized Methods for Payload Control (RH-TRAMPAC).1 The RH-TRAMPAC defines the allowable payload for the RH-TRU 72-B. This document is a catalog of RH-TRU 72-B authorized contents by site. A content code is defined by the following components: • A two-letter site abbreviation that designates the physical location of the generated/stored waste (e.g., ID for Idaho National Laboratory [INL]). The site-specific letter designations for each of the sites are provided in Table 1. • A three-digit code that designates the physical and chemical form of the waste (e.g., content code 317 denotes TRU Metal Waste). For RH-TRU waste to be transported in the RH-TRU 72-B, the first number of this three-digit code is “3.” The second and third numbers of the three-digit code describe the physical and chemical form of the waste. Table 2 provides a brief description of each generic code. Content codes are further defined as subcodes by an alpha trailer after the three-digit code to allow segregation of wastes that differ in one or more parameter(s). For example, the alpha trailers of the subcodes ID 322A and ID 322B may be used to differentiate between waste packaging configurations. As detailed in the RH-TRAMPAC, compliance with flammable gas limits may be demonstrated through the evaluation of compliance with either a decay heat limit or flammable gas generation rate (FGGR) limit per container specified in approved content codes. As applicable, if a container meets the watt*year criteria specified by the RH-TRAMPAC, the decay heat limits based on the dose-dependent G value may be used as specified in an approved content code. If a site implements the administrative controls outlined in the RH-TRAMPAC and Appendix 2.4 of the RH-TRU Payload Appendices, the decay heat or FGGR limits based on a 10-day shipping period (rather than the standard 60-day shipping period) may be used as specified in an approved content code. Requests for new or revised content codes may be submitted to the WIPP RH-TRU Payload Engineer for review and approval, provided all RH-TRAMPAC requirements are met.

  18. Method for reducing pressure drop through filters, and filter exhibiting reduced pressure drop

    DOE Patents [OSTI]

    Sappok, Alexander; Wong, Victor

    2014-11-18

    Methods for generating and applying coatings to filters with porous material in order to reduce large pressure drop increases as material accumulates in a filter, as well as the filter exhibiting reduced and/or more uniform pressure drop. The filter can be a diesel particulate trap for removing particulate matter such as soot from the exhaust of a diesel engine. Porous material such as ash is loaded on the surface of the substrate or filter walls, such as by coating, depositing, distributing or layering the porous material along the channel walls of the filter in an amount effective for minimizing or preventing depth filtration during use of the filter. Efficient filtration at acceptable flow rates is achieved.

  19. Turbidimetric determination of the total glucozinolate content of rape

    SciTech Connect (OSTI)

    Kononova, R.V.; Chaika, I.K.; Levitskii, A.P.; Lucashenok, E.V.

    1986-03-01

    The objective of the investigation was to develop a procedure for the determination of the total GZ (glucozinolate--non-nurishing substances found in rapeseed) content from the content of sulfate ion SO/sup 2 -4/which is formed in the fermentative hydrolysis of GZ, based on the degree of turbidity formed by the addition of a barium chloride solution in the presence of the surfactant Tween-80 (poly(20)ethoxysorbitan monooleate.). The supernatant liquid is used to determine the SO/sup 2 -4 -/ion before and after fermentative hydrolysis. The GZ content of the analyzed sample of rapeseed raw material was calculated from an equation. Data show that the precision, reliability, and reproducibility of the results obtained by the proposed method are satisfactory. The procedure can be sued for serial analysis in selection establishments as well as feed production plants.

  20. Measurement of Moisture Content in Sand, Slag, and Crucible Materials

    SciTech Connect (OSTI)

    Gray, J.H.

    1999-09-20

    The deinventory process at Rocky Flats (RFETS) has included moisture content measurements of sand, slag, and crucible (SSC) materials by performing weight loss measurements at 210 degrees - 220 degrees Celsius on representative samples prior to packaging for shipment. Shipping requirements include knowledge of the moisture content. Work at the Savannah River Technology Center (SRTC) showed that the measurement at 210 degrees - 220 degrees Celsius did not account for all of the moisture. The objective of the work in this report was to determine if the measurement at 210 degrees - 220 degrees Celsius at RFETS could be used to set upper bounds on moisture content and therefore, eliminate the need for RFETS to unpack, reanalyze and repack the material.

  1. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2004-10-01

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  2. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2007-08-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  3. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2007-06-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  4. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2007-09-20

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  5. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2007-02-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  6. RH-TRU Waste Content Codes (RH TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions

    2007-05-01

    The Remote-Handled Transuranic (RH-TRU) Content Codes (RH-TRUCON) document describes the inventory of RH-TRU waste within the transportation parameters specified by the Remote-Handled Transuranic Waste Authorized Methods for Payload Control (RH-TRAMPAC).1 The RH-TRAMPAC defines the allowable payload for the RH-TRU 72-B. This document is a catalog of RH-TRU 72-B authorized contents by site. A content code is defined by the following components: • A two-letter site abbreviation that designates the physical location of the generated/stored waste (e.g., ID for Idaho National Laboratory [INL]). The site-specific letter designations for each of the sites are provided in Table 1. • A three-digit code that designates the physical and chemical form of the waste (e.g., content code 317 denotes TRU Metal Waste). For RH-TRU waste to be transported in the RH-TRU 72-B, the first number of this three-digit code is “3.” The second and third numbers of the three-digit code describe the physical and chemical form of the waste. Table 2 provides a brief description of each generic code. Content codes are further defined as subcodes by an alpha trailer after the three-digit code to allow segregation of wastes that differ in one or more parameter(s). For example, the alpha trailers of the subcodes ID 322A and ID 322B may be used to differentiate between waste packaging configurations. As detailed in the RH-TRAMPAC, compliance with flammable gas limits may be demonstrated through the evaluation of compliance with either a decay heat limit or flammable gas generation rate (FGGR) limit per container specified in approved content codes. As applicable, if a container meets the watt*year criteria specified by the RH-TRAMPAC, the decay heat limits based on the dose-dependent G value may be used as specified in an approved content code. If a site implements the administrative controls outlined in the RH-TRAMPAC and Appendix 2.4 of the RH-TRU Payload Appendices, the decay heat or FGGR limits based on a 10-day shipping period (rather than the standard 60-day shipping period) may be used as specified in an approved content code.

  7. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2006-06-20

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  8. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-08-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  9. CH-TRU Waste Content Codes (CH TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2004-12-01

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  10. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2006-08-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  11. CH-TRU Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-10-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  12. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-01-30

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  13. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2006-12-20

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  14. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2006-09-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  15. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-11-20

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  16. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-03-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  17. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2006-01-18

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  18. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-01-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codesand corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  19. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-12-15

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  20. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-06-20

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  1. CH-TRU Waste Content Codes (CH-TRUCON)

    SciTech Connect (OSTI)

    Washington TRU Solutions LLC

    2005-05-01

    The CH-TRU Waste Content Codes (CH-TRUCON) document describes the inventory of the U.S. Department of Energy (DOE) CH-TRU waste within the transportation parameters specified by the Contact-Handled Transuranic Waste Authorized Methods for Payload Control (CH-TRAMPAC). The CH-TRAMPAC defines the allowable payload for the Transuranic Package Transporter-II (TRUPACT-II) and HalfPACT packagings. This document is a catalog of TRUPACT-II and HalfPACT authorized contents and a description of the methods utilized to demonstrate compliance with the CH-TRAMPAC. A summary of currently approved content codes by site is presented in Table 1. The CH-TRAMPAC describes "shipping categories" that are assigned to each payload container. Multiple shipping categories may be assigned to a single content code. A summary of approved content codes and corresponding shipping categories is provided in Table 2, which consists of Tables 2A, 2B, and 2C. Table 2A provides a summary of approved content codes and corresponding shipping categories for the "General Case," which reflects the assumption of a 60-day shipping period as described in the CH-TRAMPAC and Appendix 3.4 of the CH-TRU Payload Appendices. For shipments to be completed within an approximately 1,000-mile radius, a shorter shipping period of 20 days is applicable as described in the CH-TRAMPAC and Appendix 3.5 of the CH-TRU Payload Appendices. For shipments to WIPP from Los Alamos National Laboratory (LANL), Nevada Test Site, and Rocky Flats Environmental Technology Site, a 20-day shipping period is applicable. Table 2B provides a summary of approved content codes and corresponding shipping categories for "Close-Proximity Shipments" (20-day shipping period). For shipments implementing the controls specified in the CH-TRAMPAC and Appendix 3.6 of the CH-TRU Payload Appendices, a 10-day shipping period is applicable. Table 2C provides a summary of approved content codes and corresponding shipping categories for "Controlled Shipments" (10-day shipping period).

  2. Microsoft Word - Appendix C_DisposalCellContents.doc

    Office of Legacy Management (LM)

    Disposal Cell Contents Table C-1. Contents of the Weldon Spring, Missouri, Disposal Cell U.S. Department of Energy Weldon Spring Site LTS&M Plan July 2005 Doc. No. S0079000 Page C-3 Work Zone Per WP437 and Material Description Cell Placement Considerations Occupied Cell Volume (cy) Raffinate Pits Work Zone CSS Grout Produced in CSS Plant and pumped to cell. Volume as determined at the plant. 188,443.00 Raffinate Pit 4 residual sludge Stabilized in situ with grout then mixed with TSA

  3. Reducing the Cost of Solar Cells

    SciTech Connect (OSTI)

    Scanlon, B.

    2012-04-01

    Solar-powered electricity prices could soon approach those of power from coal or natural gas thanks to collaborative research with solar startup Ampulse Corporation at the National Renewable Energy Laboratory. Silicon wafers account for almost half the cost of today's solar photovoltaic panels, so reducing or eliminating wafer costs is essential to bringing prices down. Current crystalline silicon technology converts energy in a highly efficient manner; however, that technology is manufactured with processes that could stand some improvement. The industry needs a method that is less complex, creates less waste and uses less energy. First, half the refined silicon is lost as dust in the wafer-sawing process, driving module costs higher. Wafers are sawn off of large cylindrical ingots, or boules, of silicon. A typical 2-meter boule loses as many as 6,000 potential wafers during sawing. Second, the wafers produced are much thicker than necessary. To efficiently convert sunlight into electricity, the wafers need be only one-tenth the typical thickness. NREL, the Oak Ridge National Laboratory and Ampulse have partnered on an approach to eliminate this waste and dramatically lower the cost of the finished solar panels. By using a chemical vapor deposition process to grow the silicon on inexpensive foil, Ampulse is able to make the solar cells just thick enough to convert most of the solar energy into electricity. No more sawdust - and no more wasting refined silicon materials. NREL developed the technology to grow high-quality silicon and ORNL developed the metal foil that has the correct crystal structure to support that growth. Ampulse is installing a pilot manufacturing line in NREL's Process Development Integration Laboratory, where solar companies can work closely with lab scientists on integrated equipment to answer pressing questions related to their technology development, as well as rapidly overcoming R and D challenges and risk. NREL's program is focused on transformative innovation in the domestic PV industry. With knowledge and expertise acquired from the PDIL pilot production line tools, Ampulse plans to design a full-scale production line to accommodate long rolls of metal foil. The Ampulse process 'goes straight from pure silicon-containing gas to high-quality crystal silicon film,' said Brent Nelson, the operational manager for the Process Development Integration Laboratory. 'The advantage is you can make the wafer just as thin as you need it - 10 microns or less.' Most of today's solar cells are made out of wafer crystalline silicon, though thin-film cells made of more exotic elements such as copper, indium, gallium, arsenic, cadmium, tellurium and others are making a strong push into the market. The advantage of silicon is its abundance, because it is derived from sand. Silicon's disadvantage is that purifying it into wafers suitable for solar cells can be expensive and energy intensive. Manufacturers add carbon and heat to sand to produce metallurgical-grade silicon, which is useful in other industries, but not yet suitable for making solar cells. So this metallurgical-grade silicon is then converted to pure trichlorosilane (SiCl3) or silane (SiH4) gas. Typically, the purified gas is then converted to create a silicon feedstock at 1,000 degrees Celsius. This feedstock is melted at 1,414 C and recrystallized into crystal ingots that are finally sawed into wafers. The Ampulse method differs in that it eliminates the last two steps in the traditional process and works directly with the silane gas growing only the needed silicon right onto a foil substrate. A team of NREL scientists had developed a way to use a process called hot-wire chemical vapor deposition to thicken silicon wafers with near perfect crystal structure. Using a hot tungsten filament much like the one found in an incandescent light bulb, the silane gas molecules are broken apart and deposited onto the wafer using the chemical vapor deposition technique at about 700 C - a much lower temperature than needed to make the wafer. The hot filament dec

  4. Reducing fuel consumption on the field, by continuously measuring...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Impact of Real Field Diesel Quality Variability on Engine Emissions and Fuel Consumption Solutions for Onboard Optimisation On Board Fuel Quality Sensor BioDiesel Content On-board ...

  5. Apparatus for storing high magnetic fields having reduced mechanical forces and reduced magnetic pollution

    DOE Patents [OSTI]

    Prueitt, M.L.; Mueller, F.M.; Smith, J.L.

    1991-04-09

    The present invention identifies several configurations of conducting elements capable of storing extremely high magnetic fields for the purpose of energy storage or for other uses, wherein forces experienced by the conducting elements and the magnetic field pollution produced at locations away from the configuration are both significantly reduced over those which are present as a result of the generation of such high fields by currently proposed techniques. It is anticipated that the use of superconducting materials will both permit the attainment of such high fields and further permit such fields to be generated with vastly improved efficiency. 15 figures.

  6. Apparatus for storing high magnetic fields having reduced mechanical forces and reduced magnetic pollution

    DOE Patents [OSTI]

    Prueitt, Melvin L. (Los Alamos, NM); Mueller, Fred M. (Los Alamos, NM); Smith, James L. (Los Alamos, NM)

    1991-01-01

    The present invention identifies several configurations of conducting elements capable of storing extremely high magnetic fields for the purpose of energy storage or for other uses, wherein forces experienced by the conducting elements and the magnetic field pollution produced at locations away from the configuration are both significantly reduced over those which are present as a result of the generation of such high fields by currently proposed techniques. It is anticipated that the use of superconducting materials will both permit the attainment of such high fields and further permit such fields to be generated with vastly improved efficiency.

  7. Energy Permitting Wizard Helps Reduce Project Barriers in Hawai...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Permitting Wizard Helps Reduce Project Barriers in Hawai'i Energy Permitting Wizard Helps Reduce Project Barriers in Hawai'i To address the complex permitting process for renewable...

  8. Reducing LED Costs Through Innovation | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reducing LED Costs Through Innovation Reducing LED Costs Through Innovation November 19, 2013 - 3:49pm Addthis A combination solid-state laser turret cutter and stamping machine ...

  9. EERE Success Story-Milestone Reached: New Process Reduces Cost...

    Energy Savers [EERE]

    Milestone Reached: New Process Reduces Cost and Risk of Biofuel Production from Bio-Oil Upgrading EERE Success Story-Milestone Reached: New Process Reduces Cost and Risk of Biofuel ...

  10. Construction of energy-stable projection-based reduced order...

    Office of Scientific and Technical Information (OSTI)

    Construction of energy-stable projection-based reduced order models Prev Next Title: Construction of energy-stable projection-based reduced order models Our paper aims to ...

  11. Reduce Waste and Save Energy this Holiday Season | Department...

    Broader source: Energy.gov (indexed) [DOE]

    Wrap your gifts with recycled paper to reduce waste and save money. | Photo courtesy of istockphotodiane555 Wrap your gifts with recycled paper to reduce waste and save money. |...

  12. Process for producing enriched uranium having a {sup 235}U content of at least 4 wt. % via combination of a gaseous diffusion process and an atomic vapor laser isotope separation process to eliminate uranium hexafluoride tails storage

    DOE Patents [OSTI]

    Horton, J.A.; Hayden, H.W. Jr.

    1995-05-30

    An uranium enrichment process capable of producing an enriched uranium, having a {sup 235}U content greater than about 4 wt. %, is disclosed which will consume less energy and produce metallic uranium tails having a lower {sup 235}U content than the tails normally produced in a gaseous diffusion separation process and, therefore, eliminate UF{sub 6} tails storage and sharply reduce fluorine use. The uranium enrichment process comprises feeding metallic uranium into an atomic vapor laser isotope separation process to produce an enriched metallic uranium isotopic mixture having a {sup 235} U content of at least about 2 wt. % and a metallic uranium residue containing from about 0.1 wt. % to about 0.2 wt. % {sup 235} U; fluorinating this enriched metallic uranium isotopic mixture to form UF{sub 6}; processing the resultant isotopic mixture of UF{sub 6} in a gaseous diffusion process to produce a final enriched uranium product having a {sup 235}U content of at least 4 wt. %, and up to 93.5 wt. % or higher, of the total uranium content of the product, and a low {sup 235}U content UF{sub 6} having a {sup 235}U content of about 0.71 wt. % of the total uranium content of the low {sup 235}U content UF{sub 6}; and converting this low {sup 235}U content UF{sub 6} to metallic uranium for recycle to the atomic vapor laser isotope separation process. 4 figs.

  13. Process for producing enriched uranium having a .sup.235 U content of at least 4 wt. % via combination of a gaseous diffusion process and an atomic vapor laser isotope separation process to eliminate uranium hexafluoride tails storage

    DOE Patents [OSTI]

    Horton, James A. (Livermore, CA); Hayden, Jr., Howard W. (Oakridge, TN)

    1995-01-01

    An uranium enrichment process capable of producing an enriched uranium, having a .sup.235 U content greater than about 4 wt. %, is disclosed which will consume less energy and produce metallic uranium tails having a lower .sup.235 U content than the tails normally produced in a gaseous diffusion separation process and, therefore, eliminate UF.sub.6 tails storage and sharply reduce fluorine use. The uranium enrichment process comprises feeding metallic uranium into an atomic vapor laser isotope separation process to produce an enriched metallic uranium isotopic mixture having a .sup.235 U content of at least about 2 wt. % and a metallic uranium residue containing from about 0.1 wt. % to about 0.2 wt. % .sup.235 U; fluorinating this enriched metallic uranium isotopic mixture to form UF.sub.6 ; processing the resultant isotopic mixture of UF.sub.6 in a gaseous diffusion process to produce a final enriched uranium product having a .sup.235 U content of at least 4 wt. %, and up to 93.5 wt. % or higher, of the total uranium content of the product, and a low .sup.235 U content UF.sub.6 having a .sup.235 U content of about 0.71 wt. % of the total uranium content of the low .sup.235 U content UF.sub.6 ; and converting this low .sup.235 U content UF.sub.6 to metallic uranium for recycle to the atomic vapor laser isotope separation process.

  14. FY 2009 Progress Report for Lightweighting Materials - Cover and Contents

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Lightweighting MateriaLs annual progress report 2009 Contents � 1. Introduction � Introduction.........................................................................................................................................................1-1 2. Automotive Metals - Wrought A. Thermomechanical Processing Design for Lightweight Materials....................................................................2-1 B. Development of High-Volume Warm Forming of Low-Cost Magnesium

  15. Application Content and Evaluation Criteria/Process | Department of Energy

    Energy Savers [EERE]

    This presentation by Jill Gruber of the DOE Golden Field Office was given at the Manufacturing Pre-Solicitation Workshop in Arlington, Va., on May 18, 2007. PDF icon manufacturing_foa_gruber.pdf More Documents & Publications Application Content and Evaluation Criteria/Process Manufacturing Pre-Solicitation Transcript Microsoft Word - rDE-FOA-0000080.rtf

  16. Department of Energy Request for Information: Reducing Regulatory Burden

    Energy Savers [EERE]

    (Reply Comments) | Department of Energy Request for Information: Reducing Regulatory Burden (Reply Comments) Department of Energy Request for Information: Reducing Regulatory Burden (Reply Comments) Comments on RFI on reducing regulatory burden PDF icon Department of Energy Request for Information: Reducing Regulatory Burden (Reply Comments) More Documents & Publications Re: Regulatory Burden RFI RegReview_ReplyComments_Lennox_Hearth_Products.PDF .Hearth, Patio & Barbecue

  17. Comments on reducing regulatory burden | Department of Energy

    Energy Savers [EERE]

    reducing regulatory burden Comments on reducing regulatory burden Comments on reducing regulatory burden from Ingersoll Rand, Residential Solutions, manufacturer of Trane and American Standard residential air conditioners, heat pumps, furnaces, and accessories PDF icon Comments on reducing regulatory burden More Documents & Publications Regulatory Burden RFI [76 FR 75798] Notice of Availability of Preliminary Plan for Retrospective Analysis of Existing Rules 2014-09-18 Issuance: Energy

  18. NAESCO Comments on Reducing Regulatory Burden RFI Final | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy NAESCO Comments on Reducing Regulatory Burden RFI Final NAESCO Comments on Reducing Regulatory Burden RFI Final The National Association of Energy Service Companies (NAESCO) appreciates the opportunity to submit these comments in response to the Request for Information (RFI) entitled, "Reducing Regulatory Burden," published in the Federal Register on May 15, 2012. PDF icon NAESCO_Cmts_Reducing_Reg_Burden_RFI_Final.pdf More Documents & Publications FPCC Regulatory

  19. Reduce Waste and Save Energy this Holiday Season

    Broader source: Energy.gov [DOE]

    Reduce waste and save energy this holiday season whether you're shopping, eating, partying, decorating, or wrapping.

  20. NREL Reduces Climate Control Loads in Electric Vehicles (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2014-08-01

    NREL demonstrates that zonal climate control can reduce air conditioning power and improve range while maintaining driver thermal sensation.

  1. Reduced Regeneration Energy CO2 Adsorbent | Center for Gas

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SeparationsRelevant to Clean Energy Technologies | Blandine Jerome Reduced Regeneration Energy CO2 Adsorbent

  2. Reducing Cost Barriers to Energy Efficiency Improvements (201)

    Broader source: Energy.gov [DOE]

    Better Buildings Residential Network Peer Exchange Call Series: On Bill Financing: Reducing Cost Barriers to Energy Efficiency Improvements (201)

  3. Helping Alaska Native Communities Reduce Their Energy Costs | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Helping Alaska Native Communities Reduce Their Energy Costs Helping Alaska Native Communities Reduce Their Energy Costs May 3, 2013 - 12:50pm Addthis The Energy Department is helping Alaska Native communities reduce their energy costs by investing in renewable energy and energy efficiency upgrades. | Photo courtesy of Western Community Energy. The Energy Department is helping Alaska Native communities reduce their energy costs by investing in renewable energy and energy efficiency

  4. Alternative Fuels Data Center: Delaware Reduces Truck Idling With

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Electrified Parking Areas Delaware Reduces Truck Idling With Electrified Parking Areas to someone by E-mail Share Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Facebook Tweet about Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Twitter Bookmark Alternative Fuels Data Center: Delaware Reduces Truck Idling With Electrified Parking Areas on Google Bookmark Alternative Fuels Data Center: Delaware

  5. EPA Presentation: Reducing Pollution from Power Plants, October 29, 2010 |

    Office of Environmental Management (EM)

    Department of Energy EPA Presentation: Reducing Pollution from Power Plants, October 29, 2010 EPA Presentation: Reducing Pollution from Power Plants, October 29, 2010 Presentation to the Electricity Advisory Committe on October 29, 2010 by the US Environmental Protection Agency Office of Air and Radiation on Reducing Pollution from Power Plants and the need for additional rule making. PDF icon Reducing Pollution from Power Plants More Documents & Publications EEI Presentation: The

  6. Table 41. No. 2 Diesel Fuel Prices by Sulfur Content, Sales...

    U.S. Energy Information Administration (EIA) Indexed Site

    Content, Sales Type, and PAD District 242 Energy Information Administration Petroleum Marketing Annual 1997 Table 41. No. 2 Diesel Fuel Prices by Sulfur Content, Sales Type,...

  7. Table 41. No. 2 Diesel Fuel Prices by Sulfur Content, Sales...

    U.S. Energy Information Administration (EIA) Indexed Site

    Content, Sales Type, and PAD District 242 Energy Information Administration Petroleum Marketing Annual 1996 Table 41. No. 2 Diesel Fuel Prices by Sulfur Content, Sales Type,...

  8. WFIP NOAA Final Report - Page i DE-EE0003080 TABLE OF CONTENTS

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    WFIP NOAA Final Report - Page i DE-EE0003080 TABLE OF CONTENTS TABLE OF CONTENTS ................................................................................................................................. i Executive Summary .................................................................................................................................. 1 1. Project Overview

  9. MapReduceXMT v. Beta 0.1

    Energy Science and Technology Software Center (OSTI)

    2010-02-24

    The MapReduceXMT library ports the MapReduce framework onto the Cray XMT. MapReduce is a programming paradigm and an approach to data management for unstructured problems. It has gained relevance due to its ability to map serial operations onto parallel distributed architectures, significantly improving developer/analyst productivity. The MapReduceXMT implements the key aspects of MapReduce for the Cray XMT, a massively threaded system that is inherently difficult to program. MapReduceXMT allows users to utilize the machine effectivelymore » and efficiently without extensive training in multi-threaded programming. The MapReduceXMT library ports the MapReduce framework onto the Cray XMT. MapReduce is a programming paradigm and an approach to data management for unstructured problems. It has gained relevance due to its ability to map serial operations onto parallel distributed architectures, significantly improving developer/analyst productivity. The MapReduceXMT implements the key aspects of MapReduce for the Cray XMT, a massively threaded system that is inherently difficult to program. MapReduceXMT allows users to utilize the machine effectively and efficiently without extensive training in multi-threaded programming.« less

  10. Reduce Pumping Costs Through Optimum Pipe Sizing | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pumping Costs Through Optimum Pipe Sizing Reduce Pumping Costs Through Optimum Pipe Sizing This tip sheet discusses how to reduce pumping system costs through optimum pipe sizing. PUMPING SYSTEMS TIP SHEET #9 PDF icon Reduce Pumping Costs Through Optimum Pipe Sizing (October 2005) More Documents & Publications Select an Energy-Efficient Centrifugal Pump Effect of Intake on Compressor Performance Pump Selection Considerations

  11. Innovative Computational Tools for Reducing Exploration Risk Through

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Integration of Water-Rock Interactions and Magnetotelluric Surveys | Department of Energy Computational Tools for Reducing Exploration Risk Through Integration of Water-Rock Interactions and Magnetotelluric Surveys Innovative Computational Tools for Reducing Exploration Risk Through Integration of Water-Rock Interactions and Magnetotelluric Surveys Innovative Computational Tools for Reducing Exploration Risk Through Integration of Water-Rock Interactions and Magnetotelluric Surveys

  12. Sodium iron hexacyanoferrate with high Na content as a Na-rich cathode material for Na-ion batteries

    SciTech Connect (OSTI)

    Guo, Ya; Yu, Xiqian; You, Ya; Yin, Yaxia; Nam, Kyung -Wan

    2015-01-01

    Owing to the worldwide abundance and low-cost of Na, room-temperature Na-ion batteries are emerging as attractive energy storage systems for large-scale grids. Increasing the Na content in cathode material is one of the effective ways to achieve high energy density. Prussian blue and its analogues (PBAs) are promising Na-rich cathode materials since they can theoretically store two Na ions per formula. However, increasing the Na content in PBAs cathode materials is a big challenge in the current. Here we show that sodium iron hexacyanoferrate with high Na content could be obtained by simply controlling the reducing agent and reaction atmosphere during synthesis. The Na content can reach as high as 1.63 per formula, which is the highest value for sodium iron hexacyanoferrate. This Na-rich sodium iron hexacyanoferrate demonstrates a high specific capacity of 150 mA h g-1 and remarkable cycling performance with 90% capacity retention after 200 cycles. Furthermore, the Na intercalation/de-intercalation mechanism is systematically studied by in situ Raman, X-ray diffraction and X-ray absorption spectroscopy analysis for the first time. The Na-rich sodium iron hexacyanoferrate could function as a plenteous Na reservoir and has great potential as a cathode material toward practical Na-ion batteries.

  13. Sodium iron hexacyanoferrate with high Na content as a Na-rich cathode material for Na-ion batteries

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    You, Ya; Yu, Xi -Qian; Yin, Ya -Xia; Nam, Kyung -Wan; Guo, Yu -Guo

    2014-10-27

    Owing to the worldwide abundance and low-cost of Na, room-temperature Na-ion batteries are emerging as attractive energy storage systems for large-scale grids. Increasing the Na content in cathode material is one of the effective ways to achieve high energy density. Prussian blue and its analogues (PBAs) are promising Na-rich cathode materials since they can theoretically store two Na ions per formula. However, increasing the Na content in PBAs cathode materials is a big challenge in the current. Here we show that sodium iron hexacyanoferrate with high Na content could be obtained by simply controlling the reducing agent and reaction atmospheremore » during synthesis. The Na content can reach as high as 1.63 per formula, which is the highest value for sodium iron hexacyanoferrate. This Na-rich sodium iron hexacyanoferrate demonstrates a high specific capacity of 150 mA h g-1 and remarkable cycling performance with 90% capacity retention after 200 cycles. Furthermore, the Na intercalation/de-intercalation mechanism is systematically studied by in situ Raman, X-ray diffraction and X-ray absorption spectroscopy analysis for the first time. As a result, the Na-rich sodium iron hexacyanoferrate could function as a plenteous Na reservoir and has great potential as a cathode material toward practical Na-ion batteries.« less

  14. Sodium iron hexacyanoferrate with high Na content as a Na-rich cathode material for Na-ion batteries

    SciTech Connect (OSTI)

    You, Ya; Yu, Xi -Qian; Yin, Ya -Xia; Nam, Kyung -Wan; Guo, Yu -Guo

    2014-10-27

    Owing to the worldwide abundance and low-cost of Na, room-temperature Na-ion batteries are emerging as attractive energy storage systems for large-scale grids. Increasing the Na content in cathode material is one of the effective ways to achieve high energy density. Prussian blue and its analogues (PBAs) are promising Na-rich cathode materials since they can theoretically store two Na ions per formula. However, increasing the Na content in PBAs cathode materials is a big challenge in the current. Here we show that sodium iron hexacyanoferrate with high Na content could be obtained by simply controlling the reducing agent and reaction atmosphere during synthesis. The Na content can reach as high as 1.63 per formula, which is the highest value for sodium iron hexacyanoferrate. This Na-rich sodium iron hexacyanoferrate demonstrates a high specific capacity of 150 mA h g-1 and remarkable cycling performance with 90% capacity retention after 200 cycles. Furthermore, the Na intercalation/de-intercalation mechanism is systematically studied by in situ Raman, X-ray diffraction and X-ray absorption spectroscopy analysis for the first time. As a result, the Na-rich sodium iron hexacyanoferrate could function as a plenteous Na reservoir and has great potential as a cathode material toward practical Na-ion batteries.

  15. A study of the viability of exploiting memory content similarity to improve resilience to memory errors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Levy, Scott; Ferreira, Kurt B.; Bridges, Patrick G.; Thompson, Aidan P.; Trott, Christian

    2014-12-09

    Building the next-generation of extreme-scale distributed systems will require overcoming several challenges related to system resilience. As the number of processors in these systems grow, the failure rate increases proportionally. One of the most common sources of failure in large-scale systems is memory. In this paper, we propose a novel runtime for transparently exploiting memory content similarity to improve system resilience by reducing the rate at which memory errors lead to node failure. We evaluate the viability of this approach by examining memory snapshots collected from eight high-performance computing (HPC) applications and two important HPC operating systems. Based on themore » characteristics of the similarity uncovered, we conclude that our proposed approach shows promise for addressing system resilience in large-scale systems.« less

  16. A study of the viability of exploiting memory content similarity to improve resilience to memory errors

    SciTech Connect (OSTI)

    Levy, Scott; Ferreira, Kurt B.; Bridges, Patrick G.; Thompson, Aidan P.; Trott, Christian

    2014-12-09

    Building the next-generation of extreme-scale distributed systems will require overcoming several challenges related to system resilience. As the number of processors in these systems grow, the failure rate increases proportionally. One of the most common sources of failure in large-scale systems is memory. In this paper, we propose a novel runtime for transparently exploiting memory content similarity to improve system resilience by reducing the rate at which memory errors lead to node failure. We evaluate the viability of this approach by examining memory snapshots collected from eight high-performance computing (HPC) applications and two important HPC operating systems. Based on the characteristics of the similarity uncovered, we conclude that our proposed approach shows promise for addressing system resilience in large-scale systems.

  17. Deposition of device quality low H content, amorphous silicon films

    DOE Patents [OSTI]

    Mahan, A.H.; Carapella, J.C.; Gallagher, A.C.

    1995-03-14

    A high quality, low hydrogen content, hydrogenated amorphous silicon (a-Si:H) film is deposited by passing a stream of silane gas (SiH{sub 4}) over a high temperature, 2,000 C, tungsten (W) filament in the proximity of a high temperature, 400 C, substrate within a low pressure, 8 mTorr, deposition chamber. The silane gas is decomposed into atomic hydrogen and silicon, which in turn collides preferably not more than 20--30 times before being deposited on the hot substrate. The hydrogenated amorphous silicon films thus produced have only about one atomic percent hydrogen, yet have device quality electrical, chemical, and structural properties, despite this lowered hydrogen content. 7 figs.

  18. Deposition of device quality low H content, amorphous silicon films

    DOE Patents [OSTI]

    Mahan, Archie H. (Golden, CO); Carapella, Jeffrey C. (Evergreen, CO); Gallagher, Alan C. (Louisville, CO)

    1995-01-01

    A high quality, low hydrogen content, hydrogenated amorphous silicon (a-Si:H) film is deposited by passing a stream of silane gas (SiH.sub.4) over a high temperature, 2000.degree. C., tungsten (W) filament in the proximity of a high temperature, 400.degree. C., substrate within a low pressure, 8 mTorr, deposition chamber. The silane gas is decomposed into atomic hydrogen and silicon, which in turn collides preferably not more than 20-30 times before being deposited on the hot substrate. The hydrogenated amorphous silicon films thus produced have only about one atomic percent hydrogen, yet have device quality electrical, chemical, and structural properties, despite this lowered hydrogen content.

  19. Method and apparatus for determining fat content of tissue

    DOE Patents [OSTI]

    Weber, Thomas M. (Albuquerque, NM); Spletzer, Barry L. (Albuquerque, NM); Bryan, Jon R. (Edgewood, NM); Dickey, Fred M. (Albuquerque, NM); Shagam, Richard N. (Albuquerque, NM); Gooris, Luc (Rancho Santa Margarita, CA)

    2001-01-01

    A method and apparatus for determining characteristics of tissue is disclosed. The method comprises supplying optical energy to a tissue and detecting at a plurality of locations consequent energy scattered by the tissue. Analysis of the scattered energy as taught herein provides information concerning the properties of the tissue, specifically information related to the fat and lean content and thickness of the tissue. The apparatus comprises a light source adapted to deliver optical energy to a tissue. A plurality of detectors can be mounted at different positions relative to the source to detect energy scattered by the tissue. A signal processor as taught herein can determine characteristics of the tissue from the signals from the detectors and locations of the detectors, specifically information related to the fat and lean content and thickness of the tissue.

  20. State-of-the-Art Solar Simulator Reduces Measurement Time and Uncertainty (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-04-01

    One-Sun Multisource Solar Simulator (OSMSS) brings accurate energy-rating predictions that account for the nonlinear behavior of multijunction photovoltaic devices. The National Renewable Energy Laboratory (NREL) is one of only a few International Organization for Standardization (ISO)-accredited calibration labs in the world for primary and secondary reference cells and modules. As such, it is critical to seek new horizons in developing simulators and measurement methods. Current solar simulators are not well suited for accurately measuring multijunction devices. To set the electrical current to each junction independently, simulators must precisely tune the spectral content with no overlap between the wavelength regions. Current simulators do not have this capability, and the overlaps lead to large measurement uncertainties of {+-}6%. In collaboration with LabSphere, NREL scientists have designed and implemented the One-Sun Multisource Solar Simulator (OSMSS), which enables automatic spectral adjustment with nine independent wavelength regions. This fiber-optic simulator allows researchers and developers to set the current to each junction independently, reducing errors relating to spectral effects. NREL also developed proprietary software that allows this fully automated simulator to rapidly 'build' a spectrum under which all junctions of a multijunction device are current matched and behave as they would under a reference spectrum. The OSMSS will reduce the measurement uncertainty for multijunction devices, while significantly reducing the current-voltage measurement time from several days to minutes. These features will enable highly accurate energy-rating predictions that take into account the nonlinear behavior of multijunction photovoltaic devices.