National Library of Energy BETA

Sample records for reads exogenously derived

  1. Power Reading USC Kortschak Center

    E-Print Network [OSTI]

    Zhou, Chongwu

    at the pictures, charts, diagrams, maps, etc. 2. Skim: Read the first sentence of every paragraph; statements and organization. *derived from: williamette.edu/dept/lcenter/study_strategies/reading2remember.html #12;ISR: Input

  2. Drosophila lifespan enhancement by exogenous bacteria

    E-Print Network [OSTI]

    Seroude, Laurent

    Drosophila lifespan enhancement by exogenous bacteria Ted Brummel*, Alisa Ching*, Laurent Seroude with customary procedure. The experiments revealed that the presence of bacteria during the first week of adult life can enhance lifespan, despite unchanged food intake. Later in life, the presence of bacteria can

  3. Exogenous Versus Endogenous for Chaotic Business Cycles

    E-Print Network [OSTI]

    Marat Akhmet; Zhanar Akhmetova; Mehmet Onur Fen

    2015-09-03

    We propose a novel approach to generate chaotic business cycles in a deterministic setting. Rather than producing chaos endogenously, we consider aggregate economic models with limit cycles and equilibriums, subject them to chaotic exogenous shocks and obtain chaotic cyclical motions. Thus, we emphasize that chaotic cycles, which are inevitable in economics, are not only interior properties of economic models, but also can be considered as a result of interaction of several economical systems. This provides a comprehension of chaos (unpredictability, lack of forecasting) and control of chaos as a global economic phenomenon from the deterministic point of view. We suppose that the results of our paper are contribution to the mixed exogenous-endogenous theories of business cycles in classification by P.A. Samuelson [76]. Moreover, they demonstrate that the irregularity of the extended chaos can be structured, and this distinguishes them from the generalized synchronization. The advantage of the knowledge of the structure is that by applying instruments, which already have been developed for deterministic chaos one can control the chaos, emphasizing a parameter or a type of motion. For the globalization of cyclic chaos phenomenon we utilize new mechanisms such that entrainment by chaos, attraction of chaotic cycles by equilibriums and bifurcation of chaotic cycles developed in our earlier papers.

  4. Read: What Kathmandu is Reading?

    E-Print Network [OSTI]

    Fineprint Bookclub

    2011-01-05

    and professionals. Sixty percent of hi s cliental consists of tourists. "Tourists," he says, "buy mostly maps and geography books to know more about the region they are planning to travel to." He adds, "Each single tourist usually buys 5 to 7 fictions to read... to recommend I enjoyed Khalid Hosseini's novel "The Kite Runner" and Samrat Upadhyay's short stories in "The Royal Ghosts". In non-fiction, I liked Suketu Mehta's "Maximum City", a book about Mumbai. I also finished reading Ron Chernow's biography...

  5. ORIGINAL PAPER Autism and urinary exogenous neuropeptides: development

    E-Print Network [OSTI]

    Hammock, Bruce D.

    ORIGINAL PAPER Autism and urinary exogenous neuropeptides: development of an on-line SPE / Published online: 23 May 2007 # Springer-Verlag 2007 Abstract Autism is a complex neurodevelopmental disor- der with unknown etiology. One hypothesis regarding etiology in autism is the "opioid peptide excess

  6. Optimal combined wind power forecasts using exogeneous variables

    E-Print Network [OSTI]

    Optimal combined wind power forecasts using exogeneous variables Fannar ¨Orn Thordarson Kongens to the Klim wind farm using three WPPT forecasts based on different weather forecasting systems. It is shown of the thesis is combined wind power forecasts using informations from meteorological forecasts. Lyngby, January

  7. International Environmental Agreements with Endogenous or Exogenous Risk

    E-Print Network [OSTI]

    Karp, Larry S.

    Agreement (IEA). Exogenous and endogenous risk have different implications for the (expected) level of equilibrium participation in an IEA. Our paper is the first to examine the effect of risk aversion on equilibrium IEA participation under endogenous risk. We also extend and clarify Boucher and Bra- moulle (2010

  8. Fundamentals of Chinese Reading 

    E-Print Network [OSTI]

    Nixon, Jessie

    2009-11-26

    A large corpus of data of natural reading in Chinese was explored using linear mixed effects analyses conducted in R....

  9. Introducing a digital library reading appliance into a reading group

    E-Print Network [OSTI]

    Marshall, Cathy

    Introducing a digital library reading appliance into a reading group Catherine C. Marshall, Morgan will we read digital library materials? This paper describes the reading practices of an on-going reading group, and how these practices changed when we introduced XLibris, a digital library reading appliance

  10. Abstract --Most logistics network design models assume exogenous customer demand that is independent of the service

    E-Print Network [OSTI]

    Graves, Stephen C.

    Abstract -- Most logistics network design models assume exogenous customer demand for the network design decision making process. Index Terms -- Logistics Network Design, Demand Classes, Benefits. In most logistics network design models, the customer demand is exogenous and defined as a uniform

  11. Contracting with reading costs and renegotiation costs

    E-Print Network [OSTI]

    Brennan, James R.

    2007-01-01

    Reading Costs, Competition, and ContractReading Costs . . . . . . . . . . . . . . . . C. EquilibriumUnconscionability A?ect Reading Costs . . . . . . . . . .

  12. Leadership Development Readings

    Broader source: Energy.gov [DOE]

    The Leadership Development Readings is a comprehensive list of more than 700 ECQ-related leadership readings organized by ECQ intended to assist all current and aspiring government leaders’ efforts to broaden their organizational and management experience and expand their knowledge in the five Executive Core Qualifications as well as Fundamental Competencies.

  13. Effects of Exogenously Applied Indole-3-Acetic Acid (IAA) to Cotton 

    E-Print Network [OSTI]

    Clement, Jenny D.

    2011-08-08

    elongation in cotton fiber development. An increase in IAA at specific fiber developmental stages may promote increased lint percent and longer fibers. Objectives of this research project were to determine how exogenous applications in a field environment...

  14. Barium Titanate Nanoparticles as Exogenous Contrast Agents in Second Harmonic Optical Coherence Tomography 

    E-Print Network [OSTI]

    Pearson, Jeremy T

    2013-05-06

    I propose and demonstrate a method by which barium titanate nanoparticle clusters can be used as exogenous contrast agents in Second Harmonic Optical Coherence Tomography imaging systems to localize and highlight desired ...

  15. Reading context in design

    E-Print Network [OSTI]

    Agrawal, Vivek

    1993-01-01

    This study explores how, in the process of design, the reading of an existing order in the organizing features of a setting potentiates form. For this purpose, a design exercise on a site in the city of Jaipur in India has ...

  16. Endogenous and exogenous dynamics of pressure fluctuations in an impinging entrained-flow gasifier

    E-Print Network [OSTI]

    Niu, Miao-Ren; Zhou, Wei-Xing; Wang, Fu-Chen; Yu, Zun-Hong

    2007-01-01

    On a laboratory-scale testing platform of impinging entrained-flow gasifier with two opposed burners, the pressure fluctuation signals were measured with a stainless steel water-cooled probe. Phenomenological investigations of the endogenous and exogenous dynamics in the fluctuations of pressure were carried out by performing the mean-variance analysis and separating the endogenous and exogenous components of the signals. Non-universal dynamics with power-law behaviors have been found not only in the original signals but also in their components. A new inequality was obtained showing that the exogenous exponent is smallest while the overall dynamic exponent is the largest. The results highlight that the dynamics of pressure fluctuations in the first fifteen minutes of the gasification process is driven dominantly by the ignition process. The method can be readily applied to the other multiphase systems like bubble column, fluidized bed, etc.

  17. Motivation sharpens exogenous spatial attention Jan B. Engelmann(1) and Luiz Pessoa(2)

    E-Print Network [OSTI]

    Pessoa, Luiz

    1 Motivation sharpens exogenous spatial attention Jan B. Engelmann(1) and Luiz Pessoa(2) (1) Jan B (lpessoa@indiana.edu). #12;2 ABSTRACT Although both attention and motivation affect behavior, how these two participants performed a spatially-cued forced-choice localization task under varying levels of motivation

  18. Poster Session 08: Bystander and other Low Dose Effect Exogenous carbon monoxide suppresses adaptive response induced

    E-Print Network [OSTI]

    Yu, Peter K.N.

    Poster Session 08: Bystander and other Low Dose Effect Exogenous carbon monoxide suppresses; adaptive response; zebrafish embryos Journal of Radiation Research, 2014, 55, i115 Supplement doi: 10 prepared medium with the chemical at different time points after the application of the priming dose. Our

  19. Effects of exogenous carbon monoxide on radiation-induced bystander effect in zebrafish embryos in vivo

    E-Print Network [OSTI]

    Yu, Peter K.N.

    that the dose-response of radiation in the low-dose regime deviated from the LNT model. A notable example radiation are linearly proportional to the absorbed dose, evidence accumulated in the past decades showed as a pharmaceutical agent to release a low dose of exogenous carbon monoxide (CO) to attenuate the effect on bystander

  20. Planning in The Face of Frequent Exogenous Events Christian Fritz and Sheila A. McIlraith

    E-Print Network [OSTI]

    McIlraith, Sheila

    Planning in The Face of Frequent Exogenous Events Christian Fritz and Sheila A. Mc,sheila}@cs.toronto.edu Abstract Generating optimal plans in highly dynamic environments is challenging. Plans are predicated on an assumed initial state, but this state can change unexpectedly during plan genera- tion, potentially

  1. Mutations in yhiT enable utilization of exogenous pyrimidine intermediates in Salmonella enterica

    E-Print Network [OSTI]

    Coller, Jeff

    Mutations in yhiT enable utilization of exogenous pyrimidine intermediates in Salmonella enterica auxotrophs of Salmonella enterica serovar Typhimurium LT2. The gain-of-function phenotypes both resulted from a continual supply of deoxyribo- and ribonucleoside triphosphates. In Escherichia coli and Salmonella enterica

  2. Cryptographic aspects of quantum reading

    E-Print Network [OSTI]

    Gaetana Spedalieri

    2015-09-03

    Besides achieving secure communication between two spatially-separated parties, another important issue in modern cryptography is related to secure communication in time, i.e., the possibility to confidentially store information on a memory for later retrieval. Here we explore this possibility in the setting of quantum reading, which exploits quantum entanglement to efficiently read data from a memory whereas classical strategies (e.g., based on coherent states or their mixtures) cannot retrieve any information. From this point of view, the technique of quantum reading can provide a new form of technological security for data storage.

  3. Reading File Bonneville Power Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reading File Bonneville Power Administration P.O. Box 3621 Portland, Oregon 97208-3621 POWER SERVICES In reply refer to: PG-5 Ms. Renata Kurschner Director, Generation Resource...

  4. Reading Room | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Energy Public Reading Room 1166 Athens Tech Road Elberton, GA 30635-6711 Contact: Joel Seymour Phone: 706-213-3800 Fax: 706-213-3884 Email: joels@sepa.doe.gov Strategic Petroleum...

  5. Holographic Labeling And Reading Machine For Authentication And Security Appications

    DOE Patents [OSTI]

    Weber, David C. (Rancho Santa Margarita, CA); Trolinger, James D. (Costa Mesa, CA)

    1999-07-06

    A holographic security label and automated reading machine for marking and subsequently authenticating any object such as an identification badge, a pass, a ticket, a manufactured part, or a package is described. The security label is extremely difficult to copy or even to read by unauthorized persons. The system comprises a holographic security label that has been created with a coded reference wave, whose specification can be kept secret. The label contains information that can be extracted only with the coded reference wave, which is derived from a holographic key, which restricts access of the information to only the possessor of the key. A reading machine accesses the information contained in the label and compares it with data stored in the machine through the application of a joint transform correlator, which is also equipped with a reference hologram that adds additional security to the procedure.

  6. 11th Grade Students' English Reading Motivation, Language Problems and Reading Achievement in Taiwan 

    E-Print Network [OSTI]

    Su, Jung-Hsuan

    2012-07-16

    ’ English reading motivation and its relationship with perceived language problems and reading achievement. 302 11th grade students from an urban district in southern Taiwan participated in the study. Measures included an English reading comprehension...

  7. Running head: Reading Mathematical Proofs

    E-Print Network [OSTI]

    Inglis, Matthew

    , and is increasingly seen as essential to a coherent school-level mathematics curriculum (e.g., Cowen, 1991; Hanna, 2007; National Council of Teachers of Mathematics [NCTM], 2000; Selden & Selden, 2003; Weber, 2008. #12;4 In this paper we report the first direct comparison of the proof reading behavior of research

  8. Derived Types What Are Derived Types?

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    Derived Types #12;What Are Derived Types? As usual, a hybrid of two, unrelated concepts C++, Python orientation comes in #12;Simple Derived Types TYPE Wheel INTEGER :: spokes REAL :: diameter, width CHARACTER(LEN=15) :: material END TYPE Wheel That defines a derived type Wheel Using derived types needs a special

  9. Derived Types What Are Derived Types?

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    Derived Types #12;What Are Derived Types? As usual, a hybrid of two, unrelated concepts C object orientation comes in This course will only describe the former. #12;Simple Derived Types TYPE That defines a derived type Wheel Using derived types needs a special syntax TYPE(Wheel) :: w1 #12;More

  10. Read

    E-Print Network [OSTI]

    Fineprint Bookclub

    2009-01-01

    !I.t" hi. d! ....... gol ""l1:li_8 InoaIpIano: FClrNftj, A l1>li '" Notr\\I'.1rodII - --..... FCIr NioIj, ~­ - ­ """ NoI "Ioo_ ~_. ~ In """ ........ Nod"rIa OM IIIkId ib:lLll ~ .. d~fIII doIILIl, Fhak, and h 1I"OllIw, Amllob~ au_ ta/IIod .r... !I.t" hi. d! ....... gol ""l1:li_8 InoaIpIano: FClrNftj, A l1>li '" Notr\\I'.1rodII - --..... FCIr NioIj, ~­ - ­ """ NoI "Ioo_ ~_. ~ In """ ........ Nod"rIa OM IIIkId ib:lLll ~ .. d~fIII doIILIl, Fhak, and h 1I"OllIw, Amllob~ au_ ta/IIod .r...

  11. Asbestos fibers mediate transformation of monkey cells by exogenous plasmid DNA

    SciTech Connect (OSTI)

    Appel, J.D.; Fasy, T.M.; Kohtz, D.S.; Kohtz, J.D.; Johnson, E.M. (Mount Sinai School of Medicine of the City Univ. of New York, NY (USA))

    1988-10-01

    The authors have tested the ability of chrysotile asbestos fibers to introduce plasmid DNA into monkey COS-7 cells and the ability of this DNA to function in both replication and gene expression. Chrysotile fibers are at least as effective as calcium phosphate in standard transfection assays at optimal ratios of asbestos to DNA. After transfection with chrysotile, a minor percentage of introduced plasmid DNA bearing a simian virus 40 origin of replication replicates after 24 hr. Fragmentation of entering DNA is more prominent with asbestos than with calcium phosphate, and after 72 hr most DNA introduced by asbestos is associated with chromosomal DNA. Cells transfected with plasmid p11-4, bearing the p53 protooncogene, express this gene. Cells transfected with pSV2-neo express a gene conferring resistance of antibiotic G418, allowing isolation of colonies of transformed cells after 18 days. The introduction of exogenous DNA into eukaryotic cells could cause mutations in several ways and thus contribute to asbestos-induced oncogenesis.

  12. Tracking Reading: Dual Task Costs of Oral Reading for Young Versus Older Adults

    E-Print Network [OSTI]

    Kemper, Susan; Bontempo, Daniel; Schmalzried, RaLynn Cheri; McKedy, Whitney; Tagliaferri, Bruno; Kieweg, Doug

    2014-02-01

    A digital pursuit rotor was used to monitor oral reading costs by time-locking tracking performance to the auditory wave form produced as young and older adults were reading out short paragraphs. Multilevel modeling was ...

  13. Interrelationship of endogenous and exogenous prostaglandins with uterine involution and postpartum interval in beef cows and heifers 

    E-Print Network [OSTI]

    Tolleson, Douglas Ray

    1986-01-01

    Interrelationship of Endogenous and Exogenous Prostaglandins with Uterine Involution and Postpartum Interval in Beef Cows and Heifers (August 1986) Douglas Ray Tolleson, B. S. , Texas ALM University Chairman of Advisory Committee: Dr. Ronald D. Randel A review... ALPHA PRODUCTION BY THE INVOLUTING BOVINE UTERUS AT 14 AND 35 DAYS POSTPARTUM: PATTERN OF RELEASE AND RESPONSE TO PHYSICAL MANIPULATION. 26 28 33 44 47 Introduction. . . . . . . . . Materia1s and Methods. Resu1ts. Discussion. CHAPTER V...

  14. Implications for Dual Language Administrative Leadership: A Comparison of the English Reading Achievement of Third Grade Students among Three Instructional Programs in a Rural School District 

    E-Print Network [OSTI]

    Trejo, Martha A.

    2015-08-12

    This quantitative study is derived from a need to know how the leadership can support the teachers in a Two Way Dual Language (TWDL) program and a need of a comparative analysis to compare the English reading Texas Assessment ...

  15. Global warming debates: the reading course

    E-Print Network [OSTI]

    Huybers, Peter

    Global warming debates: the reading course Spring 2014 Instructors: Peter Huybers and Eli Tziperman of global warming", please prepare by reading "the climate of man", IPCC introduction, and Lindzen article. background basics. l 1. Mountain Glaciers: Are mountain glaciers melting? Due to global warming? First, see

  16. Online Reading Lists Instructions for Academic Staff

    E-Print Network [OSTI]

    Brierley, Andrew

    the heading `Subject Guides and Reading Lists') Enter Reading Lists link. Then Sign in (top right) using your will be asked to set up a profile ­ this takes just a minute and enables students to search for lists associated software you will need to install a `Bookmarklet' tool. `Bookmarks' is the term used by the software

  17. Reading for Thursday Emissions scenario summary

    E-Print Network [OSTI]

    Schweik, Charles M.

    emissions, for year 2000 #12;USA ­ CO2 emissions from fossil fuel combustion (2005) US EPA #12;#12;#12;Decreasing 13C strongly suggests that the source of atmospheric CO2 is fossil carbon #12;Line of evidence #1Reading for Thursday · Emissions scenario summary: ­ Read pages 3-6 · IPCC Chapter 11 (Regional

  18. REGISTRATION FORM CUNY GRADUATE CENTER LANGUAGE READING PROGRAM

    E-Print Network [OSTI]

    Johnson Jr.,, Ray

    REGISTRATION FORM CUNY GRADUATE CENTER LANGUAGE READING PROGRAM First name order payable to CUNY GRADUATE CENTER and send it to the CUNY Graduate Center Language Reading Program: ________________________________________ Date: ____________________ If a course is cancelled by the Language Reading Program, registrants

  19. Exogenous contrast agents for thermoacoustic imaging: An investigation into the underlying sources of contrast

    SciTech Connect (OSTI)

    Ogunlade, Olumide Beard, Paul

    2015-01-15

    Purpose: Thermoacoustic imaging at microwave excitation frequencies is limited by the low differential contrast exhibited by high water content tissues. To overcome this, exogenous thermoacoustic contrast agents based on gadolinium compounds, iron oxide, and single wall carbon nanotubes have previously been suggested and investigated. However, these previous studies did not fully characterize the electric, magnetic, and thermodynamic properties of these agents thus precluding identification of the underlying sources of contrast. To address this, measurements of the complex permittivity, complex permeability, DC conductivity, and Grüneisen parameter have been made. These measurements allowed the origins of the contrast provided by each substance to be identified. Methods: The electric and magnetic properties of the contrast agents were characterized at 3 GHz using two rectangular waveguide cavities. The DC conductivity was measured separately using a conductivity meter. Thermoacoustic signals were then acquired and compared to those generated in water. Finally, 3D electromagnetic simulations were used to decouple the different contributions to the absorbed power density. Results: It was found that the gadolinium compounds provided appreciable electric contrast but not originating from the gadolinium itself. The contrast was either due to dissociation of the gadolinium salt which increased ionic conductivity or its nondissociated polar fraction which increased dielectric polarization loss or a combination of both. In addition, very high concentrations were required to achieve appreciable contrast, to the extent that the Grüneisen parameter increased significantly and became a source of contrast. Iron oxide particles were found to produce low but measurable dielectric contrast due to dielectric polarization loss, but this is attributed to the coating of the particles not the iron oxide. Single wall carbon nanotubes did not provide measurable contrast of any type. Conclusions: It is concluded that gadolinium based contrast agents, iron oxide particles, and single walled carbon nanotubes have little intrinsic merit as thermoacoustic contrast agents. Simple electrolytes such as saline which yield high contrast based on ionic conductivity provide much higher dielectric contrast per unit solute concentration and are likely to be significantly more effective as contrast agents.

  20. Quantum Reading of Unitary Optical Devices

    E-Print Network [OSTI]

    Michele Dall'Arno; Alessandro Bisio; Giacomo Mauro D'Ariano

    2015-02-20

    We address the problem of quantum reading of optical memories, namely the retrieving of classical information stored in the optical properties of a media with minimum energy. We present optimal strategies for ambiguous and unambiguous quantum reading of unitary optical memories, namely when one's task is to minimize the probability of errors in the retrieved information and when perfect retrieving of information is achieved probabilistically, respectively. A comparison of the optimal strategy with coherent probes and homodyne detection shows that the former saves orders of magnitude of energy when achieving the same performances. Experimental proposals for quantum reading which are feasible with present quantum optical technology are reported.

  1. "Big data" workshop Digital Reading Network

    E-Print Network [OSTI]

    Bradstock, Burton

    change issues across science, politics, environment, etc. · Harvested the complete content of about 3 change politics": climate, change, countries, world, environmental, international, development, global of readings `social class theory ideology political production ideological historical marxist marx bourgeois

  2. De Novo Sequencing with Short Reads: Does the Read Length Matter? (2009 JGI User Meeting)

    ScienceCinema (OSTI)

    Pezner, Pavel A

    2011-04-25

    Pavel Pevzner of UC San Diego spoke about "De Novo Sequencing with Short Reads" on March 26, 2009 during the 4th Annual User Meeting

  3. DERIVED FUNCTORS GROTHENDIECK DUALITY

    E-Print Network [OSTI]

    Lipman, Joseph

    NOTES ON DERIVED FUNCTORS AND GROTHENDIECK DUALITY Joseph Lipman In Foundations of Grothendieck the basics of derived categories and functors, and of the rich formalism, over ringed spaces, of the derived of the derived functor Rf when f is a quasi-proper map of concentrated schemes, the twisted inverse image

  4. DOE-ID FOIA Reading Room

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE Project TapsofofDoubleReading Room READING ROOM

  5. Absolute Time Derivatives

    E-Print Network [OSTI]

    T. Matolcsi; P. Van

    2006-10-23

    A four dimensional treatment of nonrelativistic space-time gives a natural frame to deal with objective time derivatives. In this framework some well known objective time derivatives of continuum mechanics appear as Lie-derivatives. Their coordinatized forms depends on the tensorial properties of the relevant physical quantities. We calculate the particular forms of objective time derivatives for scalars, vectors, covectors and different second order tensors from the point of view of a rotating observer. The relation of substantial, material and objective time derivatives is treated.

  6. Global warming debates: the reading course

    E-Print Network [OSTI]

    Huybers, Peter

    Global warming debates: the reading course spring 2012 Instructors: Eli Tziperman and Peter Huybers Hurricanes due to global warming? Apr 7: Stratospheric cooling: Why is the stratosphere cooling? Apr 14: Mid will be the impact of global warming on agriculture? Apr 28: Final Debate: Take sides! Should we act to curb global

  7. Global warming debates: the reading course

    E-Print Network [OSTI]

    Huybers, Peter

    Global warming debates: the reading course spring 2010 Instructors: Eli Tziperman and Peter Huybers Hurricanes due to global warming? Apr 7: Stratospheric cooling: Why is the stratosphere cooling? Apr 14: Mid will be the impact of global warming on agriculture? Apr 28: Final Debate: Take sides! Should we act to curb global

  8. Problem Solving Framework Read the problem carefully.

    E-Print Network [OSTI]

    Minnesota, University of

    Problem Solving Framework Read the problem carefully. Draw a useful picture (sketch) that shows how identified in Step 1. 1. Understand the Problem 2. Analyze the Problem 3. Construct a Solution Apply constraint equations) to eliminate the unwanted unknowns? Use math (algebra/calculus) to solve for target

  9. Automatic Object Colocation Based on Read Barriers

    E-Print Network [OSTI]

    Mössenböck, Hanspeter

    matches their access order in the program. We implemented this optimization for Sun Microsystems' Java HotSpotTM VM. The garbage collector, which moves objects during collection, assigns consecutive ad- dresses-called hot-field tables, which are then used by the garbage collector for colocation decisions. Read barriers

  10. Earth Minerals Did you read chapter 29

    E-Print Network [OSTI]

    Hart, Gus

    1 Chapter 29 Earth Minerals Did you read chapter 29 before coming to class? A. Yes B. No Lets play that begins in Hawaii Other "Hot Spots" around the world The interior structure of Earth has been determined outer core #12;2 What is different on earth (as opposed to other planets)? Continents Why does

  11. Classical Mechanics (Prof. P. L. Read)

    E-Print Network [OSTI]

    Read, Peter L.

    Classical Mechanics (Prof. P. L. Read) Lecture 1 Photograph © Andrew Dunn, 5 November 2004. #12;What is Classical Mechanics? · .. rational mechanics will be the science of motion resulting from any Mechanics? · System of mathematical physics developed since the time of Galileo, Newton & Kepler · Concerned

  12. A survey of reading services provided to students with reading disabilities 

    E-Print Network [OSTI]

    Christen, Margaret Harding

    2009-05-15

    of special education services provided. Results showed that there was minimal provision of special education services for reading disabled students. When the results were analyzed by degree of disability the correlation was weak while the analysis...

  13. The Evaluation and Use of Extensive Reading Materials 

    E-Print Network [OSTI]

    Tignanelli, Rosana

    2007-06-29

    The current investigation is based on the topic of “The evaluation and use of extensive reading materials”. Throughout this research, I attempted to find out whether a theory-based exploration on the evaluation and use of extensive reading...

  14. How to Read Your Electric Meter | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Your Electric Meter How to Read Your Electric Meter July 2, 2012 - 8:21pm Addthis The difference between one month's reading and the next is the amount of energy units that have...

  15. How to Read Residential Electric and Natural Gas Meters | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    How to Read Residential Electric and Natural Gas Meters How to Read Residential Electric and Natural Gas Meters An electromechanical electric meter on the side of a house. | Photo...

  16. Evolving and Packaging Reading Technologies Victor R. Basili

    E-Print Network [OSTI]

    Basili, Victor R.

    . The experiments range from early read- ing vs. testing experiments to various Cleanroom ex- periments, such as the Cleanroom development approach, which is highly dependent on reading techniques and meth- ods. That is, reading technology is fundamental to Cleanroom development. In what follows, we will discuss the evolution

  17. WORD READING AND PICTURE NAMING IN ITALIAN Elizabeth Bates

    E-Print Network [OSTI]

    2 WORD READING AND PICTURE NAMING IN ITALIAN Elizabeth Bates University of California, San Diego ("Cross- linguistic studies of aphasia" -- NIH DC00216). The word-reading portion was supported Jolla, CA 92093-0526 (USA); bates@crl.ucsd.edu. #12;3 WORD READING AND PICTURE NAMING IN ITALIAN

  18. meraculous: de novo genome assembly with short paired-end reads

    SciTech Connect (OSTI)

    Chapman, Jarrod A.; Ho, Isaac; Sunkara, Sirisha; Luo, Shujun; Schroth, Gary P.; Rokhsar, Daniel S.

    2011-08-01

    We describe a new algorithm, meraculous, for whole genome assembly of deep paired-end short reads, and apply it to the assembly of a dataset of paired 75-bp Illumina reads derived from the 15.4 megabase genome of the haploid yeast Pichia stipitis. More than 95% of the genome is recovered, with no errors; half the assembled sequence is in contigs longer than 101 kilobases and in scaffolds longer than 269 kilobases. Incorporating fosmid ends recovers entire chromosomes. Meraculous relies on an efficient and conservative traversal of the subgraph of the k-mer (deBruijn) graph of oligonucleotides with unique high quality extensions in the dataset, avoiding an explicit error correction step as used in other short-read assemblers. A novel memory-efficient hashing scheme is introduced. The resulting contigs are ordered and oriented using paired reads separated by ~280 bp or ~3.2 kbp, and many gaps between contigs can be closed using paired-end placements. Practical issues with the dataset are described, and prospects for assembling larger genomes are discussed.

  19. THE RELATIONSHIP OF READING STRATEGIES AND SELF-EFFICACY WITH THE READING COMPREHENSION OF HIGH SCHOOL STUDENTS IN INDONESIA

    E-Print Network [OSTI]

    Tobing, Irene Rebecca Angela

    2013-08-31

    The purpose of this study was to investigate the relationship of reading strategies and self-efficacy with the reading comprehension of high school students in Indonesia. A convenience sample of 138 high school students from a state high school...

  20. Secure Compressed Reading in Smart Grids

    E-Print Network [OSTI]

    Cai, Sheng; Chen, Minghua; Yan, Jianxin; Jaggi, Sidharth

    2012-01-01

    Smart Grids measure energy usage in real-time and tailor supply and delivery accordingly, in order to improve power transmission and distribution. For the grids to operate effectively, it is critical to collect readings from massively-installed smart meters to control centers in an efficient and secure manner. In this paper, we propose a secure compressed reading scheme to address this critical issue. We observe that our collected real-world meter data express strong temporal correlations, indicating they are sparse in certain domains. We adopt Compressed Sensing technique to exploit this sparsity and design an efficient meter data transmission scheme. Our scheme achieves substantial efficiency offered by compressed sensing, without the need to know beforehand in which domain the meter data are sparse. This is in contrast to traditional compressed-sensing based scheme where such sparse-domain information is required a priori. We then design specific dependable scheme to work with our compressed sensing based ...

  1. Method and apparatus for reading thermoluminescent phosphors

    DOE Patents [OSTI]

    Braunlich, Peter F. (SW. 730 City View, Pullman, WA 99163); Tetzlaff, Wolfgang (Pullman, WA)

    1987-01-01

    An apparatus and method for rapidly reading thermoluminescent phosphors to determine the amount of luminescent energy stored therein. The stored luminescent energy is interpreted as a measure of the total exposure of the thermoluminescent phosphor to ionizing radiation. The thermoluminescent phosphor reading apparatus uses a laser to generate a laser beam. The laser beam power level is monitored by a laser power detector and controlled to maintain the power level nearly constant. A shutter or other laser beam interrupting means is used to control exposure of the thermoluminescent phosphor to the laser beam. The laser beam can be equalized using an optical equalizer so that the laser beam has an approximately uniform power density across the beam. The heated thermoluminescent phosphor emits a visible or otherwise detectable luminescent emission which is measured as an indication of the radiation exposure of the thermoluminescent phosphors. Also disclosed are preferred signal processing and control circuits.

  2. Credit derivatives in Brazil

    E-Print Network [OSTI]

    Rüther, Henrique

    2007-01-01

    The amounts outstanding of credit derivatives have grown exponentially over the past years, and these financial intruments that allow market participants to trade credit risk have become very popular in Europe and in the ...

  3. Definitions Derived from Neutrosophics

    E-Print Network [OSTI]

    Florentin Smarandache

    2003-01-28

    Thirty-three new definitions are presented, derived from neutrosophic set, neutrosophic probability, neutrosophic statistics, and neutrosophic logic. Each one is independent, short, with references and cross references like in a dictionary style.

  4. TruRead | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergyTrailTrosky, Minnesota: EnergyMichigan:Ohio:TruRead

  5. READING FILE COPY F-e

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on Global Technology OUTSIDEContract No.Proposed toREADING

  6. Reading Room | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4)9 Federal Register / Vol. 76,EXAMPLE 4Reading Room |

  7. NEPA Reading Room | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJessework usesof Energy Moving Forward tocomponentStatementsReading Room

  8. Reading the Cosmic Writing on the Wall

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProton DeliveryRadioactiveRare | National NuclearReading

  9. Policy Implications: Replacing the Reading TAKS Cut Scores with the Common Core Curriculum Reading Cut Scores on Three Middle School Campuses 

    E-Print Network [OSTI]

    Thaemlitz, Kristi

    2013-07-30

    reading rigor to ensure academic success is key for educators. Although Texas opted not to adopt the Common Core Curriculum Standards and the accompanying Stretch Lexile measures for reading that require higher reading levels at each grade, Texas educators...

  10. the university of reading chaplaincy including location maps for central Reading

    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    Street 3.30pm, 6pm www.stlaurencereading.com Welcome to Reading A very warm welcome from the University. The Chaplaincy Centre The Chaplains run a drop-in centre on the Whiteknights campus in Park House Lodge, behind the main library. Our library, kitchen, quiet room and common room are open every week day during office

  11. Topic 2: Backtracking andTopic 2: Backtracking and Recommended ReadingsRecommended Readings

    E-Print Network [OSTI]

    Stephenson, Ben

    Recommended Readings ·· Chapter 3 from Programming in PrologChapter 3 from Programming in Prolog 2 Searching for the AnswerSearching for the Answer ·· Two notions of correctnessTwo notions of correctness ­­ Logical conjunction shouldn't matter ·· In practice, Prolog searches for an answerIn practice, Prolog searches

  12. Seasonal Maize Forecasting for South Africa and Zimbabwe Derived from an Agroclimatological Model

    E-Print Network [OSTI]

    Martin, Randall

    ) and sea level pressure (SLP) readings to anticipate water-stress six months prior to harvest-economic variability. Explored within is a new approach to seasonal crop forecasting, one derived from crop water, and other climatic factors over the period 1961-1994 are compared with calculated available water from

  13. Reading Tea Leaves: How Humans Interpret Topic Models

    E-Print Network [OSTI]

    Boyd-Graber, Jordan

    Reading Tea Leaves: How Humans Interpret Topic Models Jonathan Chang Jordan Boyd-Graber Sean, Blei Reading Tea Leaves #12;Topic Models in a Nutshell From an input corpus words to topics Forget Red Light, Green Light: A 2-Tone L.E.D. to Simplify Screens Corpus Chang, Boyd-Graber, Wang, Gerrish

  14. Read-out electronics for DC squid magnetic measurements

    DOE Patents [OSTI]

    Ganther, Jr., Kenneth R. (Olathe, KS); Snapp, Lowell D. (Independence, MO)

    2002-01-01

    Read-out electronics for DC SQUID sensor systems, the read-out electronics incorporating low Johnson noise radio-frequency flux-locked loop circuitry and digital signal processing algorithms in order to improve upon the prior art by a factor of at least ten, thereby alleviating problems caused by magnetic interference when operating DC SQUID sensor systems in magnetically unshielded environments.

  15. M.A. IN ROMANCE LANGUAGES READING LIST

    E-Print Network [OSTI]

    Li, X. Rong

    Río) 9. Florencia Pinar (in Miguel Angel Pérez Priego, (ed.) Poesía femenina en los cancioneros). SUGGESTED READINGS: Francisco Rico. Historia y crítica de la literatura española, 1/1 (primer suplemento. Historia crítica de la literatura española. N.B. * Indicates works to be read in their entirety. "Del Río

  16. "Hot little prophets": reading, mysticism, and Walt Whitman's disciples 

    E-Print Network [OSTI]

    Marsden, Steven Jay

    2004-11-15

    ??????????????????? 25 A Pr?cis of Chapters?????????????????????? 36 II ?A WOMAN WAITS FOR ME?: ANNE GILCHRIST AND LEAVES OF GRASS?????????????????????. 39 III ?SO SACRED?THE EXPLICATING NOTE?: DOCTOR RICHARD MAURICE BUCKE READING ?COSMIC... Illuminations????????????????????????? 128 Man?s Moral Nature?????????????????????? 140 Biography and Exegesis????????????????????.. 148 Comparative Readings and a Community of Believers????????.. 155 Cosmic Consciousness...

  17. Dalhousie Libraries e-Reserves Service Library Readings in OWL

    E-Print Network [OSTI]

    Dellaire, Graham

    will look like this: #12;Dalhousie Libraries can Provide URLs to these Types of Electronic MaterialDalhousie Libraries e-Reserves Service Library Readings in OWL #12;Course Reserves Faculty now have 2 options for Reserve materials: NEW Option: Upload a course reading list and Library staff will

  18. Pushing schedule derivation method

    SciTech Connect (OSTI)

    Henriquez, B. [Compania Siderurgica Huachipato S.A., Talcahuano (Chile)

    1996-12-31

    The development of a Pushing Schedule Derivation Method has allowed the company to sustain the maximum production rate at CSH`s Coke Oven Battery, in spite of having single set oven machinery with a high failure index as well as a heat top tendency. The stated method provides for scheduled downtime of up to two hours for machinery maintenance purposes, periods of empty ovens for decarbonization and production loss recovery capability, while observing lower limits and uniformity of coking time.

  19. Temporal aspects of follicular growth and steroidogenesis in response to exogenous follicle-stimulating hormone administration during a superovulation regimen 

    E-Print Network [OSTI]

    Kemper, Caroline Nann

    1993-01-01

    group received bi-daily injections of pituitary-derived follicle-stimulating hormone (28 mg over 4 days) and heifers designated as saline received bi-daily injections of saline. Plasma was collected every 12 h for the first 48 h of the experiment...

  20. Quantum reading under a local energy constraint

    E-Print Network [OSTI]

    Gaetana Spedalieri; Cosmo Lupo; Stefano Mancini; Samuel L. Braunstein; Stefano Pirandola

    2015-09-03

    Nonclassical states of light play a central role in many quantum information protocols. Their quantum features have been exploited to improve the readout of information from digital memories, modelled as arrays of microscopic beam splitters [S. Pirandola, Phys. Rev. Lett. 106, 090504 (2011)]. In this model of quantum reading, a nonclassical source of light with Einstein-Podolski-Rosen correlations has been proven to retrieve more information than any classical source. In particular, the quantum-classical comparison has been performed under a global energy constraint, i.e., by fixing the mean total number of photons irradiated over each memory cell. In this paper we provide an alternative analysis which is based on a local energy constraint, meaning that we fix the mean number of photons per signal mode irradiated over the memory cell. Under this assumption, we investigate the critical number of signal modes after which a nonclassical source of light is able to beat any classical source irradiating the same number of signals.

  1. Reading the Tea Leaves: How Utilities in the West Are Managing Carbon Regulatory Risk in their Resource Plans

    E-Print Network [OSTI]

    Barbose, Galen

    2008-01-01

    ATIONAL L ABORATORY Reading the Tea Leaves: How Utilities inemployer. LBNL-44E Reading the Tea Leaves: How Utilities in

  2. READING LIST Microeconomics Theory 1: 26:220:501

    E-Print Network [OSTI]

    ., "Collective Labor Supply and Welfare," Journal of Political Economy 100 (3, June 1992): 437-67. Hirshleifer, J. and Savage, L., "The Utility Analysis of Choices Involving Risk," in AEA, Readings in Price Theory. *Pauly, M

  3. How to Read Residential Electric and Natural Gas Meters | Department...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    courtesy of iStockphotofstockfoto You can read your own meters to help monitor your electric or gas energy use. During the heating season, your energy use should be compared...

  4. Exploring Reading and Mathematics Integration in Preschool-Aged Children 

    E-Print Network [OSTI]

    Godwin, Amber Joyce

    2015-07-23

    research had already been conducted on the effects of using reading and mathematics instruction concurrently with young children. The results of this meta-synthesis indicated that although that type of symbiotic instruction is gathering research interest...

  5. Relations among musical skills, phonological processing, and early reading

    E-Print Network [OSTI]

    Trainor, Laurel J.

    analysis skills used in the processing of language, such as blending and segmenting sounds, are similar & Gregory, 1993). If early read- ing skill is closely linked to skill in processing the auditory components

  6. Call Description cread highspeed, synchronous read from a CFS file

    E-Print Network [OSTI]

    Torczon, Virginia

    Call Description cread high­speed, synchronous read from a CFS file cwrite high­speed, synchronous write to a CFS file gilow global MIN operation used for integer scalars gopf make a global operation

  7. High School Reading Intervention in the Special Education Classroom

    E-Print Network [OSTI]

    Goodwin, Vanessa Anne

    2011-01-01

    California. Mission employed an RTI model to provide readinguse of a Response to Intervention (RTI) model in the generalof adopting a multi-tiered RTI model to provide reading

  8. CENTRIFUGAL FORCES: READING RUSSIA'S REGIONAL IDENTITIES AND INITIATIVES

    E-Print Network [OSTI]

    Huang, Wei

    CENTRIFUGAL FORCES: READING RUSSIA'S REGIONAL IDENTITIES AND INITIATIVES Thursday, March 26 and Natural Heritage, Moscow, Russia), " : , " ("The Centrifugality of the Centripetal: Space, Identity and Industry as Centrifugal Forces in Tsarist Transcaucasia" Helen Hundley (History, Wichita State U

  9. Reading Municipal Light Department- Residential Renewable Energy Rebates

    Broader source: Energy.gov [DOE]

    Reading Municipal Light Department (RMLD) offers rebates of $1.00/watt for solar photovoltaic and small wind installations for residential customers. A $0.25/watt adder is available for using local...

  10. THE JOURNAL OF CHEMICAL PHYSICS 137, 034901 (2012) Derivation of free energy expressions for tube models from

    E-Print Network [OSTI]

    Schieber, Jay D.

    2012-01-01

    to a harmonic bending term in the free energy of the continuous chain, similar to that derived by Read et al the degree of entanglement an outcome of the model instead of a variable. In summary, this paper constitutes then include a modulus and a relaxation time for each mode, and usually one or more parameters per mode to capt

  11. Engagement in Reading and Access to Print: The Relationship of Home and School to Overall Reading Achievement Among Fourth Grade English Speakers 

    E-Print Network [OSTI]

    Allaith, Zainab A.

    2013-04-05

    The present study puts forward two models which examine the relationship between at home at school variables of (1) engagement in shared and independent reading and (2) access to print with reading achievement. Participants were fourth grade English...

  12. Higher-derivative Schwinger model

    SciTech Connect (OSTI)

    Amaral, R.L.P.G.; Belvedere, L.V.; Lemos, N.A. (Instituto de Fisica, Universidade Federal Fluminense, Outeiro de Sao Joao Batista s/n, 24020 Centro, Niteroi, Rio de Janeiro (Brazil)); Natividade, C.P. (Departamento de Matematica, Universidade Estadual Paulista, Campus de Guaratingueta, 12500 Sao Paulo, Sao Paulo (Brazil))

    1993-04-15

    Using the operator formalism, we obtain the bosonic representation for the free fermion field satisfying an equation of motion with higher-order derivatives. Then, we consider the operator solution of a generalized Schwinger model with higher-derivative coupling. Since the increasing of the derivative order implies the introduction of an equivalent number of extra fermionic degrees of freedom, the mass acquired by the gauge field is bigger than the one for the standard two-dimensional QED. An analysis of the problem from the functional integration point of view corroborates the findings of canonical quantization, and corrects certain results previously announced in the literature on the basis of Fujikawa's technique.

  13. Energy From the Sun ( Rookie Read About Science)

    E-Print Network [OSTI]

    Ohta, Shigemi

    Energy From the Sun ( Rookie Read About Science) By Alan Fowler Age Range: 5 and up Grade Level Series: Green Power Hardcover: 64 pages Bibliography Solar Power (Energy for Today) Age Range: 7 and up Grade Level: 2 and up Series: Energy for Today Paperback: 24 pages Done In The Sun Anne Hillerman Age

  14. Urban Pollution Control Strategies Reading: pages 422-437

    E-Print Network [OSTI]

    Toohey, Darin W.

    ATOC 3500 Urban Pollution Control Strategies Reading: pages 422-437 Details to come #12;#12;Urban Pollution Control Strategies What we know so far: · Different regions have different issues, but two types, warm, NOx, HCs, ozone, CO) · Pollution is made worse by meteorological conditions called "inversions

  15. Readings for Artificial Intelligence CS63 Fall 2007

    E-Print Network [OSTI]

    Meeden, Lisa A.

    Readings for Artificial Intelligence CS63 Fall 2007 1. A proposal for the Dartmouth Summer Research Project on Artificial Intelligence, John McCarthy, Marvin Minsky, Nathaniel Rochester, and Claude Shannon Norvig (2003). Chapter 3 from Artificial Intelligence: A modern approach, Second edition, Prentice Hall

  16. the university of reading chaplaincy Places of worship

    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    to Reading A very warm welcome from the University Chaplains! This leaflet includes the majority of places-in centre on the Whiteknights campus in Park House Lodge, behind the main library, which is open to all. Our library, kitchen, quiet room and common room are open every week day during office hours. Student Faith

  17. The University of Reading Helen Dacre Evaluating pollution transport in

    E-Print Network [OSTI]

    Dacre, Helen

    and PM10 concentrations for 16 urban areas and 16 UK regions Forecast for East (last updated at 10 Outline Air pollution forecasting Offline forecasting Online forecasting Aim Overview of ETEX 2 case Conclusions and future work #12;The University of Reading Helen Dacre Offline Air Pollution Forecasting

  18. Functional Genomics: It's All How You Read It

    E-Print Network [OSTI]

    Boguski, Mark S.

    Functional Genomics: It's All How You Read It Philip Hieter and Mark Boguski "Functional genomics to functional genomics? An informal poll of colleagues indicates that the term is widely used, but has many genomics websites that have sprung up over the last 12 months clearly demonstrates that interpretations

  19. Why Advertise The Age (Mon) is read by

    E-Print Network [OSTI]

    Peters, Richard

    OVERVIEW EDUCATION #12;Why Advertise The Age (Mon) is read by: ·358,000 tertiary qualified: 659,000 Education Advertising Contact Information Liza Kwaks ­ Account Manager Ph: 03 8667 4243 Email opportunities for advertisers to reach parents, students, teacher and education professionals. Profile* 44% 56

  20. Light and Matter: Reading Messages from the Cosmos

    E-Print Network [OSTI]

    Crenshaw, Michael

    1 Chapter 5 Light and Matter: Reading Messages from the Cosmos How do we experience light? · The warmth of sunlight tells us that light is a form of energy · We can measure the amount of energy emitted ) Colors of Light · White light is made up of many different colors How do light and matter interact

  1. Ab Initio Whole Genome Shotgun Assembly With Mated Short Reads

    E-Print Network [OSTI]

    Toronto, University of

    Ab Initio Whole Genome Shotgun Assembly With Mated Short Reads Paul Medvedev1 and Michael Brudno1 these technologies are already being used for rese- quencing individuals once a reference genome exists, it has not been shown if it is possible to use them for ab initio genome assembly. In this paper, we give a novel

  2. Supplementary Material: Large Scale Read Classification for Next Generation Sequencing

    E-Print Network [OSTI]

    Liang, Huizhi "Elly"

    genomics. 1 Introduction This document provides a list of sequences used in the study Large Scale Read.3 Bordetella bronchiseptica RB50 chromosome, complete genome 2 Negative NC_009495.1 Clostridium botulinum A str. ATCC 3502 chromosome, complete genome 2 Negative NC_022121.1 Chlamydia trachomatis strain J/31

  3. Reading and Collaboration in a Digital Age Cathy Marshall

    E-Print Network [OSTI]

    Marshall, Cathy

    for storage, in a few years at least some high-end appliances will house hundreds, if not thousands, of books simultaneously, and certainly laptops with software book readers will house thousands or tends of thousands, and technology interventions #12;#12;Reading. is it: Private? Individual? Stationary? Passive? Immersive? Soggy

  4. Optical fuel pin scanner. [Patent application; for reading identifications

    DOE Patents [OSTI]

    Kirchner, T.L.; Powers, H.G.

    1980-12-09

    This patent relates to an optical identification system developed for post-irradiation disassembly and analysis of fuel bundle assemblies. The apparatus is designed to be lowered onto a stationary fuel pin to read identification numbers or letters imprinted on the circumference of the top fuel pin and cap. (DLC)

  5. An Evaluation of Early Reading First on Emergent Literacy Skills: Preschool through Middle of First Grade 

    E-Print Network [OSTI]

    Tani-Prado, Sophia

    2010-10-12

    Early Reading First is a federal initiative that seeks to buffer against the detrimental effects of poverty on children?s academic outcomes by incorporating all of the elements supported by scientifically-based reading ...

  6. Testing a Multicomponent Model of Reading Comprehension for Seventh- and Eighth-Grade Students 

    E-Print Network [OSTI]

    Smith, Stacey Rafferty

    2013-04-27

    Reading is a complex construct with multiple components that have been theorized and empirically tested. Two multicomponent reading comprehension models were tested in this study to extend understanding of the relation of ...

  7. The Unholy Grail: A Social Reading of Chrétien de Troyes's Conte du Graal (review)

    E-Print Network [OSTI]

    Over, Kristen Lee

    1996-01-01

    Z E L L E S , The Unholy Grail: A Social Reading of Chretienthe very vast corpus of Grail scholarship, Brigitte Cazellesunderstandably opens The Unholy Grail: A Social Reading of

  8. Linking Family Background and Home Language with English Reading Comprehension amog Bi/Multilinguals 

    E-Print Network [OSTI]

    Yulia, Astri

    2013-04-24

    The purpose of this study is to examine the links between family background and home language factors on English reading achievement among bi/multilingual students. To explore the potential predictors of English reading achievement among bi...

  9. Screening English Learners with Oral Reading Fluency: The Prevalence of Word Callers

    E-Print Network [OSTI]

    Knight-Teague, Kerri Theresa Colleen

    2011-01-01

    Literacy Instruction, SES, and Word- Reading Achievement in2003). They Can Read the Words, but They Can’t Understand:Teachers' Perceptions of Word Callers and Related Literacy

  10. A study of teacher solicitations and student responses during read-alouds with kindergarten, first grade, and second grade students 

    E-Print Network [OSTI]

    Garcia, Norma Garza

    2009-06-02

    Read-alouds can be very useful in the classroom to assist students in gaining knowledge and improving reading skills. Educational research documents that there is a link between reading aloud to children and successful ...

  11. Derivative

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) AugustA. GeographicYucca fault (Class A)10 |

  12. An investigation of concurrent ERP and self-paced reading methodologies

    E-Print Network [OSTI]

    Kuperberg, Gina

    An investigation of concurrent ERP and self-paced reading methodologies TALI DITMAN,a PHILLIP J (ERP) studies of language processing have presented words at a fixed rate using rapid serial visual to read at a natural pace. The present study employed simultaneous self-paced reading and ERP meth

  13. Exploration of Short Reads Genome Mapping in Hardware Edward Fernandez, Walid Najjar

    E-Print Network [OSTI]

    Najjar, Walid A.

    Exploration of Short Reads Genome Mapping in Hardware Edward Fernandez, Walid Najjar Department, such as Illumina/Solexa Genome Analyzer and ABI SOLiD, can generate hundreds of millions of short DNA "reads" from a single run. These reads must be matched against a reference genome to identify their original location

  14. Sol-gel derived sorbents

    DOE Patents [OSTI]

    Sigman, Michael E.; Dindal, Amy B.

    2003-11-11

    Described is a method for producing copolymerized sol-gel derived sorbent particles for the production of copolymerized sol-gel derived sorbent material. The method for producing copolymerized sol-gel derived sorbent particles comprises adding a basic solution to an aqueous metal alkoxide mixture for a pH.ltoreq.8 to hydrolyze the metal alkoxides. Then, allowing the mixture to react at room temperature for a precalculated period of time for the mixture to undergo an increased in viscosity to obtain a desired pore size and surface area. The copolymerized mixture is then added to an immiscible, nonpolar solvent that has been heated to a sufficient temperature wherein the copolymerized mixture forms a solid upon the addition. The solid is recovered from the mixture, and is ready for use in an active sampling trap or activated for use in a passive sampling trap.

  15. Magnetic cellulose-derivative structures

    DOE Patents [OSTI]

    Walsh, Myles A. (Falmouth, MA); Morris, Robert S. (Fairhaven, MA)

    1986-09-16

    Structures to serve as selective magnetic sorbents are formed by dissolving a cellulose derivative such as cellulose triacetate in a solvent containing magnetic particles. The resulting solution is sprayed as a fine mist into a chamber containing a liquid coagulant such as n-hexane in which the cellulose derivative is insoluble but in which the coagulant is soluble or miscible. On contact with the coagulant, the mist forms free-flowing porous magnetic microspheric structures. These structures act as containers for the ion-selective or organic-selective sorption agent of choice. Some sorbtion agents can be incorporated during the manufacture of the structure.

  16. Magnetic cellulose-derivative structures

    DOE Patents [OSTI]

    Walsh, M.A.; Morris, R.S.

    1986-09-16

    Structures to serve as selective magnetic sorbents are formed by dissolving a cellulose derivative such as cellulose triacetate in a solvent containing magnetic particles. The resulting solution is sprayed as a fine mist into a chamber containing a liquid coagulant such as n-hexane in which the cellulose derivative is insoluble but in which the coagulant is soluble or miscible. On contact with the coagulant, the mist forms free-flowing porous magnetic microspheric structures. These structures act as containers for the ion-selective or organic-selective sorption agent of choice. Some sorption agents can be incorporated during the manufacture of the structure. 3 figs.

  17. Town of Reading, Massachusetts (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergy Facilities BiomassInformationTownReading,

  18. Apparatuses and methods for laser reading of thermoluminescent phosphors

    DOE Patents [OSTI]

    Braunlich, Peter F. (SW. 730 City View, Pullman, WA 99163); Tetzlaff, Wolfgang (Pullman, WA)

    1989-01-01

    Apparatuses and methods for rapidly reading thermoluminescent phosphors to determine the amount of luminescent energy stored therein. The stored luminescent energy is interpreted as a measure of the total exposure of the thermoluminescent phosphor to ionizing radiation. The thermoluminescent phosphor reading apparatus uses a laser to generate a laser beam. The laser beam power level is monitored by a laser power detector and controlled to maintain the power level at a desired value or values which can vary with time. A shutter or other laser beam interrupting means is used to control exposure of the thermoluminescent phosphor to the laser beam. The laser beam can be equalized using an opitcal equalizer so that the laser beam has an approximately uniform power density across the beam. The heated thermoluminescent phosphor emits a visible or otherwise detectable luminescent emission which is measured as an indication of the radiation exposure of the thermoluminscent phosphors. Also disclosed are preferred signal processing and control circuits including one system using a digital computer. Also disclosed are time-profiled laser power cycles for pre-anneal, read and post-anneal treatment of phosphors.

  19. DERIVED CATEGORIES AND TILTING BERNHARD KELLER

    E-Print Network [OSTI]

    Keller, Bernhard - Institut de Mathématiques de Jussieu, Université Paris 7

    DERIVED CATEGORIES AND TILTING BERNHARD KELLER Abstract. We review the basic definitions of derived categories and deri* *ved functors. We that each tilting triple yields an* * equiv- alence between derived categories. We establish its

  20. Quaternion Derivatives: The GHR Calculus

    E-Print Network [OSTI]

    Dongpo Xu; Cyrus Jahanchahi; Clive C. Took; Danilo P. Mandic

    2014-09-25

    Quaternion derivatives in the mathematical literature are typically defined only for analytic (regular) functions. However, in engineering problems, functions of interest are often real-valued and thus not analytic, such as the standard cost function. The HR calculus is a convenient way to calculate formal derivatives of both analytic and non-analytic functions of quaternion variables, however, both the HR and other functional calculus in quaternion analysis have encountered an essential technical obstacle, that is, the traditional product rule is invalid due to the non- commutativity of the quaternion algebra. To address this issue, a generalized form of the HR derivative is proposed based on a general orthogonal system. The so introduced generalization, called the generalized HR (GHR) calculus, encompasses not just the left- and right-hand versions of quaternion derivative, but also enables solutions to some long standing problems, such as the novel product rule, the chain rule, the mean-valued theorem and Taylor's theorem. At the core of the proposed approach is the quaternion rotation, which can naturally be applied to other functional calculi in non-commutative settings. Examples on using the GHR calculus in adaptive signal processing support the analysis.

  1. DERIVATION OF STOCHASTIC ACCELERATION MODEL CHARACTERISTICS FOR...

    Office of Scientific and Technical Information (OSTI)

    DERIVATION OF STOCHASTIC ACCELERATION MODEL CHARACTERISTICS FOR SOLAR FLARES FROM RHESSI HARD X-RAY OBSERVATIONS Citation Details In-Document Search Title: DERIVATION OF STOCHASTIC...

  2. Derived Hom-Tensor adjointness. Local duality.

    E-Print Network [OSTI]

    2009-02-07

    Lectures on Grothendieck Duality. II: Derived Hom-Tensor adjointness. Local duality. Joseph Lipman. February 16, 2009. Contents. 1 Left-derived functors.

  3. Macrobiotic Vertical Transport of Litter Derived Carbon

    E-Print Network [OSTI]

    Post, Wilfred M.

    Macrobiotic Vertical Transport of Litter Derived Carbon (Earthworm Phase) Mac Callaham Corey Babb in each treatment Sampling #12;Macrobiotic Vertical Transport of Litter Derived Carbon (millipede phase

  4. DERIVED CATEGORIES AND TILTING BERNHARD KELLER

    E-Print Network [OSTI]

    Keller, Bernhard - Institut de Mathématiques de Jussieu, Université Paris 7

    DERIVED CATEGORIES AND TILTING BERNHARD KELLER Abstract. We review the basic definitions of derived categories and derived functors. We illustrate them on simple but non trivial examples. Then we explain Happel's theorem which states that each tilting triple yields an equiv- alence between derived categories

  5. A pilot study of reading to improve self-esteem 

    E-Print Network [OSTI]

    Bagnall, Norma Hayes

    1977-01-01

    to Children' s Reading, 3rd ed. (Ne Y rrr: pookeee rs hhoDay anan~o. , 1969), p. 9. Charlotte S. Huck, Children's Literature in the Ele entary Hoh ol, trite VoOr: HHoY, KXne~raan i~ns on, 1976), p. 26. 6 Ruth Strang, "Zvaluation oi Development... from the repressed to the outgoing stage in his relationships with other children. Q estion ~e' ht: "HHo d es he rele*e * ther children in a work/study situation?" measures 17 whether or not the child can be depended on to oarry out assigned tasks...

  6. Port Reading, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) |Texas: EnergyOklahoma:Ewen, New York:Reading, New Jersey:

  7. Read Your E-mail | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on GlobalRachel2RateCaseElementsOxide FuelRead Your E-mail

  8. Binder enhanced refuse derived fuel

    DOE Patents [OSTI]

    Daugherty, Kenneth E. (Lewisville, TX); Venables, Barney J. (Denton, TX); Ohlsson, Oscar O. (Naperville, IL)

    1996-01-01

    A refuse derived fuel (RDF) pellet having about 11% or more particulate calcium hydroxide which is utilized in a combustionable mixture. The pellets are used in a particulate fuel bring a mixture of 10% or more, on a heat equivalent basis, of the RDF pellet which contains calcium hydroxide as a binder, with 50% or more, on a heat equivalent basis, of a sulphur containing coal. Combustion of the mixture is effective to produce an effluent gas from the combustion zone having a reduced SO.sub.2 and polycyclic aromatic hydrocarbon content of effluent gas from similar combustion materials not containing the calcium hydroxide.

  9. The Read Out Controller for the ATLAS New Small Wheel

    E-Print Network [OSTI]

    Coliban, Radu Mihai; The ATLAS collaboration; Tulbure, Traian Tiberiu; Ivanovici, Mihail; Martoiu, Victor Sorin; Levinson, Lorne; Vermeulen, Jos

    2015-01-01

    In the upgrade process of the ATLAS detector, the innermost stations of the endcaps (Small Wheels, SW) will be replaced. The New Small Wheel (NSW) will have two chamber technologies, one for the Level-1 trigger function (small-strip Thin Gap Chambers, sTGC) and one primarily dedicated to precision tracking (Micromegas detectors, MM). Custom front-end Application Specific Integrated Circuits (ASICs) will be used to read and filter information from both the sTGC and MM detectors. In the context of the New Small Wheel data path, we designed the Read Out Controller (ROC) ASIC for handling, preprocessing and formatting the data generated by the NSW VMM upstream chips. The ROC will concentrate the data streams from 8 VMMs, filter data based on the BCID and transmit the data to FELIX via the L1DDC. ROC is composed of 8 VMM Capture modules, a cross-bar and 4 SubROC modules. The output data is sent via 4 high-speed e-links.

  10. Effect of environmental factors on film badge dosimetry readings of dental office personnel

    SciTech Connect (OSTI)

    Collett, W.K.; Kaugars, G.E.; Broga, D.W. (Univ. of Florida, Gainesville (USA))

    1990-12-01

    Inadvertent exposure of film badges to environmental factors may produce fogging of the film and yield higher radiation exposure readings. Common environmental factors in everyday living were studied to assess their effect on film badge readings. Only heat appeared to have any significant effect, because moisture, chemicals, pressure, cold temperature, and non-work-related electromagnetic radiation did not substantially alter film badge readings. Therefore not all unexplained high readings on personnel film badge reports may be due to heat or other common environmental factors evaluated in this study.

  11. Deconnable self-reading pocket dosimeter containment with self-contained light

    DOE Patents [OSTI]

    Stevens, Robyn L. (Idaho Falls, ID); Arnold, Greg N. (Idaho Falls, ID); McBride, Ryan G. (Rexburg, ID)

    1996-01-01

    A container for a self-reading pocket dosimeter includes a transparent tube for receiving the self-reading pocket dosimeter, a light source mounted at one end of the transparent tube, and an eyepiece mounted on an opposite end of the transparent tube for viewing a read-out of the self-reading pocket dosimeter. The container may further include an activation device for selectively supplying power to the light source. The container both protects the dosimeter from being contaminated and provides a light source for viewing the dosimeter.

  12. How do Džon and Džein Read Russian? On-Line Vocabulary and its Place in the Reading Process.

    E-Print Network [OSTI]

    Comer, William J.; Keefe, Leann

    2000-01-01

    When reading authentic texts, intermediate-level students face many problems (lack of vocabulary, difficulties with word order and syntax, unfamiliar target language discourse practices) that can significantly impede their ...

  13. A study on real estate derivatives

    E-Print Network [OSTI]

    Lim, Jong Yoon, S.M. Massachusetts Institute of Technology

    2006-01-01

    All major asset classes including stocks and bonds have a well developed derivative market. Derivatives enable counterparties to reflect a view on a particular market, without having to trade the underlying asset. This ...

  14. Macrobiotic Vertical Transport of Litter Derived Carbon

    E-Print Network [OSTI]

    Post, Wilfred M.

    Macrobiotic Vertical Transport of Litter Derived Carbon (UPDATE) Mac Callaham Corey Babb Paul vertical transport of litter derived carbon-millipede phase More germane to upland sites Sampled uplands

  15. Equivalence of Conventionally-Derived and Parthenote-Derived Human Embryonic Stem Cells

    E-Print Network [OSTI]

    2011-01-01

    Equivalence of Conventionally-Derived andParthenote- Derived Human Embryonic Stem Cells Julie V.cell (hESC) lines can be derived via multiple means, it is

  16. Method and apparatus for reading meters from a video image

    DOE Patents [OSTI]

    Lewis, Trevor J. (Irwin, PA); Ferguson, Jeffrey J. (North Huntingdon, PA)

    1997-01-01

    A method and system to enable acquisition of data about an environment from one or more meters using video images. One or more meters are imaged by a video camera and the video signal is digitized. Then, each region of the digital image which corresponds to the indicator of the meter is calibrated and the video signal is analyzed to determine the value indicated by each meter indicator. Finally, from the value indicated by each meter indicator in the calibrated region, a meter reading is generated. The method and system offer the advantages of automatic data collection in a relatively non-intrusive manner without making any complicated or expensive electronic connections, and without requiring intensive manpower.

  17. Method and apparatus for reading free falling dosimeter punchcodes

    DOE Patents [OSTI]

    Langsted, James M. (Golden, CO)

    1992-12-22

    A punchcode reader is provided for reading data encoded in a punchcode hole array on a dosimeter. The dosimeter falls through a passage in the reader containing photosensor detectors disposed along the passage which provide output signals to a microprocessor. The signals are processed to determine the orientation of the dosimeter in the reader, the location and state of punchcode holes in a two row array thereby decoding the encoded data. Multiple rate of fall calculations are made, and if appropriate matching of the punchcode array is not obtained in three tries, an error signal is outputted to the operator. The punchcode reader also provides for storage of data from multiple dosimeters passed through the reader, and for the output of decoded data to an external display or a computer for further processing.

  18. Method and apparatus for reading free falling dosimeter punchcodes

    DOE Patents [OSTI]

    Langsted, J.M.

    1992-12-22

    A punchcode reader is provided for reading data encoded in a punchcode hole array on a dosimeter. The dosimeter falls through a passage in the reader containing photosensor detectors disposed along the passage which provide output signals to a microprocessor. The signals are processed to determine the orientation of the dosimeter in the reader, the location and state of punchcode holes in a two row array thereby decoding the encoded data. Multiple rate of fall calculations are made, and if appropriate matching of the punchcode array is not obtained in three tries, an error signal is output to the operator. The punchcode reader also provides for storage of data from multiple dosimeters passed through the reader, and for the output of decoded data to an external display or a computer for further processing. 8 figs.

  19. On the Derivation of Relative Clauses in Teotitlán del Valle Zapotec

    E-Print Network [OSTI]

    Kalivoda, Nick; Zyman, Erik

    2015-01-01

    of the modifier. Low readings of RC-head modifiers arerelativization and “low” readings of RC-head modifiers)of TdVZ relatives. Low Readings of RC-Head Modifiers Another

  20. Genetic Optimization Using Derivatives Jasjeet S. Sekhon

    E-Print Network [OSTI]

    Sekhon, Jasjeet S.

    Genetic Optimization Using Derivatives by Jasjeet S. Sekhon and Walter R. Mebane, Jr. Draft://macht.arts.cornell.edu/wrm1/. #12;Abstract Genetic Optimization Using Derivatives We describe a new computer program unconstrained optimization problems. The program, called GENOUD (GENetic Optimization Using Derivatives

  1. The Fourth Partial Derivative In Transport Dynamics

    E-Print Network [OSTI]

    Trinh Khanh Tuoc

    2010-01-11

    A new fourth partial derivative is introduced for the study of transport dynamics. It is a Lagrangian partial derivative following the path of diffusion, not the path of convection. Use of this derivative decouples the effect of diffusion and convection and simplifies the analysis of transport processes.

  2. Development of the beta-pressure derivative 

    E-Print Network [OSTI]

    Hosseinpour-Zoonozi, Nima

    2007-04-25

    The proposed work provides a new definition of the pressure derivative function [that is the �²-derivative function, ��p �²d(t)], which is defined as the derivative of the logarithm of pressure drop data with respect ...

  3. Postgraduate Scholarship Pricing temperature derivatives and modelling

    E-Print Network [OSTI]

    Banaji,. Murad

    the volumetric risk of the energy units sold, rather than the price risk of each unit. Weather derivativesPostgraduate Scholarship Pricing temperature derivatives and modelling the market price of risk: Pricing temperature derivatives and modelling the market price of risk. Main Supervisor: A. Alexandridis

  4. Derived Equivalences of Orders Alexander Zimmermann

    E-Print Network [OSTI]

    Zimmermann, Alexander

    Derived Equivalences of Orders Alexander Zimmermann Abstract Using the result of Roggenkamp with Steffen K¨onig [17]. The last section gives a definition and first properties of Picard groups of derived Derived categories arose first in algebraic geometry in the early 60's and proved there to be a powerful

  5. Derived critical loci I -Basics Gabriele Vezzosi

    E-Print Network [OSTI]

    Vezzosi, Gabriele

    Derived critical loci I - Basics Gabriele Vezzosi Dipartimento di Sistemi ed Informatica Universit`a di Firenze Italy Notes ­ September 2011 Contents 1 Introduction 1 2 Koszul complexes and derived zero . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 2.2 Affine derived zero loci . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 2

  6. HOCHSCHILD COHOMOLOGY AND DERIVED PICARD BERNHARD KELLER

    E-Print Network [OSTI]

    Keller, Bernhard - Institut de Mathématiques de Jussieu, Université Paris 7

    HOCHSCHILD COHOMOLOGY AND DERIVED PICARD GROUPS BERNHARD KELLER Dedicated to Idun Reiten- rived Picard group and deduce that it is preserved under derived equivalences. 1. Introduction groups of the bimodule A by itself or as morphisms from A to A[i] in the derived category D(Aop A) of A

  7. HOCHSCHILD COHOMOLOGY AND DERIVED PICARD BERNHARD KELLER

    E-Print Network [OSTI]

    Keller, Bernhard - Institut de Mathématiques de Jussieu, Université Paris 7

    HOCHSCHILD COHOMOLOGY AND DERIVED PICARD GROUPS BERNHARD KELLER Dedicated to Idun Reiten­ rived Picard group and deduce that it is preserved under derived equivalences. 1. Introduction extension groups of the bimodule A by itself or as morphisms from A to A[i] in the derived category D(A op

  8. 2015 no.1. January 23rd National Library Special Collections Reading Room

    E-Print Network [OSTI]

    From the University Librarian 2015 no.1. January 23rd National Library Special Collections Reading Room Opened this month ­ Photo National Library of Australia HR News/Staffing Eline Martinsen is now for organising this. New reading room opened at NLA. The National Library of Australia opened its new Special

  9. Compressed Meter Reading for Delay-sensitive and Secure Load Report in Smart Grid

    E-Print Network [OSTI]

    Qiu, Robert Caiming

    1 Compressed Meter Reading for Delay-sensitive and Secure Load Report in Smart Grid Husheng Li, Rukun Mao, Lifeng Lai and Robert. C. Qiu Abstract-- It is a key task in smart grid to send the readings years, the technology of smart grid has attracted significant studies in both communities of power

  10. Why System Safety Professionals Should Read Accident Reports C. M. Holloway*, C. W. Johnson

    E-Print Network [OSTI]

    Johnson, Chris

    Why System Safety Professionals Should Read Accident Reports C. M. Holloway*, C. W. Johnson *NASA, who regularly read accident reports reap important benefits. These benefits include an improved accident reports regularly. This is a shame. People from many different disciplines have much to gain

  11. Tips for Reading Scholarly and Journal Articles What is a scholarly journal/journal article?

    E-Print Network [OSTI]

    Snider, Barry B.

    Tips for Reading Scholarly and Journal Articles What is a scholarly journal/journal article? The purpose of research is to find and create new knowledge. Scholarly journals, and the peerreviewed to date in their research fields, faculty members are often reading several books and journals at the same

  12. The visual word form area: expertise for reading in the fusiform gyrus

    E-Print Network [OSTI]

    Coulson, Seana

    The visual word form area: expertise for reading in the fusiform gyrus Bruce D. McCandliss1 localize a region of visual cortex that is especially responsive to visual words. This brain specialization is essential to rapid reading ability because it enhances perception of words by becoming specifically tuned

  13. Stress Processing Sensitivity in Reading Korean and English Words* Yongsoon Kanga

    E-Print Network [OSTI]

    Stress Processing Sensitivity in Reading Korean and English Words* Yongsoon Kanga , Seunghyun Baeka@hanmail.net Abstract. The present study explored the sensitivity to stress patterns of sixty-four ninth- graders) concurrently. Students' productive stress processing abilities were assessed in reading Korean real words

  14. English as a second language teachers' perceptions and use of classroom-based reading assessment. 

    E-Print Network [OSTI]

    Jia, Yueming

    2006-04-12

    and how are they used? 2) What are ESL teachersÂ? perceptions regarding the function and effectiveness of classroom-based reading assessments? 3) What and how do external factors influence ESL teachersÂ? use of classroom-based reading assessments? 4) What...

  15. The particpation and performance of students with emotional disturbance on state accountability assessment in reading 

    E-Print Network [OSTI]

    Carr George, Catherine Elizabeth

    2009-05-15

    With IQ - With Select Cases Removed ............................................. 110 Table 19 Logistic Regression Predicting Participation Status With Setting - With Select Cases Removed ...................................... 111 Table 20... Logistic Regression for Participation Status in Reading and Ethnicity - With Select Cases Removed ..................................... 111 Table 21 Logistic Regression Predicting Participation Status With Instructional Setting in Reading, IQ...

  16. The Relationship of Student Use of the Scholastic ReadAbout Software Systemon Texas Assessment of Knowledge and Skills (TAKS) Reading Test Scores as Reported in Student Records of Third and Fourth Grade Students at Comal Independent School District, Texas 

    E-Print Network [OSTI]

    McGlothlin, Ross M.

    2010-01-14

    The purpose of this study was to examine the effect of Scholastic, Incorporated's ReadAbout software system on student achievement in the subject of reading. The study assessed the relationship between the amount of time ...

  17. Total-derivative supersymmetry breaking

    SciTech Connect (OSTI)

    Haba, Naoyuki; Uekusa, Nobuhiro

    2010-05-15

    On an interval compactification in supersymmetric theory, boundary conditions for bulk fields must be treated carefully. If they are taken arbitrarily following the requirement that a theory is supersymmetric, the conditions could give redundant constraints on the theory. We construct a supersymmetric action integral on an interval by introducing brane interactions with which total-derivative terms under the supersymmetry transformation become zero due to a cancellation. The variational principle leads equations of motion and also boundary conditions for bulk fields, which determine boundary values of bulk fields. By estimating mass spectrum, spontaneous supersymmetry breaking in this simple setup can be realized in a new framework. This supersymmetry breaking does not induce a massless R axion, which is favorable for phenomenology. It is worth noting that fermions in hyper-multiplet, gauge bosons, and the fifth-dimensional component of gauge bosons can have zero-modes (while the other components are all massive as Kaluza-Klein modes), which fits the gauge-Higgs unification scenarios.

  18. Department of Music modules -recommended reading for our two undergraduate courses: BA in Music and BA in Music Technology

    E-Print Network [OSTI]

    Sussex, University of

    Department of Music modules - recommended reading for our two undergraduate courses: BA in Music and BA in Music Technology These books are recommended selected Music Department modules (note that detailed week by week reading lists

  19. MAIN-BELT COMET 238P/READ REVISITED

    SciTech Connect (OSTI)

    Hsieh, Henry H.; Meech, Karen J.; Pittichova, Jana, E-mail: hsieh@ifa.hawaii.edu, E-mail: meech@ifa.hawaii.edu, E-mail: jana@ifa.hawaii.edu [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

    2011-07-20

    We present a series of observations of the return of activity in main-belt comet (MBC) 238P/Read. Using data obtained in 2010 July and August when 238P appeared to be largely inactive, we find best-fit IAU phase function parameters of H = 19.05 {+-} 0.05 mag, corresponding to a nucleus radius of r{sub n} {approx} 0.4 km (assuming an albedo of p{sub R} = 0.05), and G = -0.03 {+-} 0.05. Observations from 2010 September onward show a clear rise in activity, causing both a notable change in visible morphology and increasing photometric excesses beyond what would be expected based on bare nucleus observations. By the end of the observing period reported on here, the dust mass in the coma shows indications of reaching a level comparable to that observed in 2005, but further observations are highly encouraged once 238P again becomes observable from Earth in mid-2011 to confirm whether this level of activity is achieved, or if the comet shows a noticeable drop in activity strength compared with 2005. Comet 238P is now the second MBC (after 133P/Elst-Pizarro) observed to exhibit recurrent activity, providing strong corroboration for the conclusion that it is a true comet whose active episodes are driven by sublimation of volatile ice.

  20. Extending Bauer's corollary to fractional derivatives

    E-Print Network [OSTI]

    David W. Dreisigmeyer; Peter M. Young

    2004-02-11

    We comment on the method of Dreisigmeyer and Young [D. W. Dreisigmeyer and P. M. Young, J. Phys. A \\textbf{36}, 8297, (2003)] to model nonconservative systems with fractional derivatives. It was previously hoped that using fractional derivatives in an action would allow us to derive a single retarded equation of motion using a variational principle. It is proven that, under certain reasonable assumptions, the method of Dreisigmeyer and Young fails.

  1. Producing Transportation Fuels via Photosynthetically-derived...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    technology using cyanobacteria. This technology has potential to produce biofuels and green chemicals (1) at cost that is competitive with conventional ethylene and derivatives...

  2. An extension of the classical derivative

    E-Print Network [OSTI]

    Diego Dominici

    2006-03-24

    We extend the usual definition of the derivative in a way that Calculus I students can easily comprehend and which allows calculations at branch points.

  3. Calibration by Optimization Without Using Derivatives

    E-Print Network [OSTI]

    Markus Lazar

    2015-03-06

    Mar 6, 2015 ... Abstract: Applications in engineering frequently require the ... to upper and lower bounds without relying on the knowledge of the derivative of f .

  4. Generalized Gravitational Entropy from Total Derivative Action

    E-Print Network [OSTI]

    Dong, Xi

    2015-01-01

    We investigate the generalized gravitational entropy from total derivative terms in the gravitational action. Following the method of Lewkowycz and Maldacena, we find that the generalized gravitational entropy from total derivatives vanishes. We compare our results with the work of Astaneh, Patrushev, and Solodukhin. We find that if total derivatives produced nonzero entropy, the holographic and the field-theoretic universal terms of entanglement entropy would not match. Furthermore, the second law of thermodynamics could be violated if the entropy of total derivatives did not vanish.

  5. Proceedings of refuse-derived fuel (RDF)

    SciTech Connect (OSTI)

    Saltiel, C. )

    1991-01-01

    This book contains proceedings of Refuse-Derived Fuel (RDF)-Quality. Standards and Processing. Topics covered include: An Overview of RDF Processing Systems: Current Status, Design Features, and Future Trends. The Impact of Recycling and Pre-Combustion Processing of Municipal Solid Waste on Fuel Properties and Steam Combustion. The Changing Role of Standards in the Marketing of RDF. Refuse Derived Fuel Quality Requirements for Firing in Utility, Industrial or Dedicated Boilers. Refuse-Derived Fuel Moisture Effects on Boiler Performance and Operability. Refuse Derived Fuels: Technology, Processing, Quality and Combustion Experiences.

  6. Biomass Derivatives Competitive with Heating Oil Costs.

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Biomass Derivatives Competitive with Heating Oil Costs Transportation fuel Heat or electricity * Data are from literature, except heating oil is adjusted from 2011 winter average *...

  7. Tetrahydroquinoline Derivatives as Potent and Selective Factor...

    Office of Scientific and Technical Information (OSTI)

    Derivatives as Potent and Selective Factor XIa Inhibitors Authors: Quan, Mimi L. ; Wong, Pancras C. ; Wang, Cailan ; Woerner, Francis ; Smallheer, Joanne M. ; Barbera, Frank...

  8. Derived Hom-Tensor adjointness. Local duality.

    E-Print Network [OSTI]

    2009-02-22

    Feb 16, 2009 ... 1 Left-derived functors. Tensor and Tor. 2 Hom -Tensor adjunction. 3 Abstract local duality. 4 Concrete local duality. 5 Residues and duality for ...

  9. Derived Hochschild Cohomology and Grothendieck Duality: local ...

    E-Print Network [OSTI]

    2008-05-24

    May 20, 2008 ... 6 Relative dualizing complexes in Commutative Algebra. 7 Back to schemes. Joseph Lipman (Purdue University). Derived Hochschild and ...

  10. A review of "Reading the Renaissance: Ideas and Idioms from Shakespeare to Milton." by Marc Berley, ed. 

    E-Print Network [OSTI]

    Frances Malpezzi

    2003-01-01

    for future literary studies. The essays are thus concerned with reading the Renaissance and with mis-readings of it. Three of the essays focus on Shakespeare. Frank Kermode in ?On Certain Verses of Shakespeare? argues for the importance of understanding... as well as British models. In his essay Stanley Stewart does not focus on a specific poem by Donne but instead cites readings and mis-readings of the poet as he excori- ates postmodern criticism in his ?Reading Donne: Old and New His- and Her...

  11. A multi-period equilibrium pricing model of weather derivatives

    E-Print Network [OSTI]

    Lee, Yongheon; Oren, Shmuel S.

    2010-01-01

    Y. : Valuation and hedging of weather derivatives on monthlyJ. Risk 31. Yoo, S. : Weather derivatives and seasonaleffects and valuation of weather derivatives. Financ. Rev.

  12. A Multi-period Equilibrium Pricing Model of Weather Derivatives

    E-Print Network [OSTI]

    Lee, Yongheon; Oren, Shmuel S.

    2008-01-01

    2002). On modelling and pricing weather derivatives. Applied2003). Arbitrage-fee pricing of weather derivatives based onfects and valuation of weather derivatives. The Financial

  13. Endothelial influences enhance human pluripotent stem cell -derived cardiomyocyte maturation

    E-Print Network [OSTI]

    Wei, Karen A.

    2011-01-01

    Human embryonic stem cell-derived cardiomyocytes survive andet al. , Cardiomyocytes derived from human embryonic stemcardiac function by hESC-derived cardiomyocytes correlates

  14. INFORMATION ON MEMBRANES DERIVED FROM ELECTRICAL SURFACE CHARGE MEASUREMENTS

    E-Print Network [OSTI]

    Tenforde, Tom S.

    2012-01-01

    V/cm) for fi cell lines derived from both Swiss and Balb 148 INFORMATION ON MEMBRANES DERIVED FROM ELECTRICAL SURFACEINFORMATION ON MEMBRANES DERIVED FROM ELECTRICAL SURFACE

  15. The Direction of Optimal Skin Incisions Derived From Striae Distensae.

    E-Print Network [OSTI]

    Lemperle, Gottfried

    2015-01-01

    of Optimal Skin Incisions Derived from Striae Distensaestriae lines. These are derived from the striae compositecal incisions and scars derived from the Internet. Incision

  16. Derivatives of Isogeometric Functions on Rational Patches

    E-Print Network [OSTI]

    Jüttler, Bert

    patch in Rd , then the graph of an isogeometric function is a d-dimensional patch (a hyper and their derivatives. Given a geometry mapping as an n- dimensional NURBS patch in Rd , an isogeometric function for the derivatives of the isogeometric functions as parametric patches. We deal with domains represented by n-dimensional

  17. Efficient Short-Read Assembly of Eukaryotic Genomes (2010 JGI/ANL HPC Workshop)

    ScienceCinema (OSTI)

    Chapman, Jarrod

    2011-06-03

    Jarrod Chapman of the DOE JGI gives a presentation on "Efficient Short-Read Assembly of Eukaryotic Genomes" at the JGI/Argonne HPC Workshop on January 25, 2010.

  18. Using Arabic (L1) in testing reading comprehension in English (L2) as a foreign language 

    E-Print Network [OSTI]

    Al-Qudairy, Abdullah H. A.

    2011-06-29

    The purpose of this study was to investigate the effect of using Arabic (L1) as a language of questions and answers in testing reading comprehension in English (L2), and to explore student and teacher opinions about ...

  19. "Reading Between the Brides": Lucrezia Vizzana's Componimenti musicali in Textual and Musical Context

    E-Print Network [OSTI]

    Mitchell, Katrina

    2011-12-31

    ABSTRACT “Reading Between the Brides”: Lucrezia Vizzana's Componimenti musicali in Textual and Musical Context There had never been a Bolognese nun known to have published her music when Lucrezia Vizzana's Componimenti ...

  20. Risk Assessment , David Ehrenfeld, EPA-U. Wash., May 17, 2012 Selected Readings

    E-Print Network [OSTI]

    Doty, Sharon Lafferty

    Risk Assessment , David Ehrenfeld, EPA-U. Wash., May 17, 2012 Selected Readings Normal Accidents. Drilling Down: The Gulf oil debacle and our energy dilemma, Joseph Tainter & Tadeusz Patzek, Springer, 2012

  1. The Effectiveness of Shared Reading Interventions with Families of Hispanic Prekindergarten Students 

    E-Print Network [OSTI]

    Hasbun, Tracey

    2012-02-14

    The purpose of this study was to examine the effects of parent or caregiver shared-reading interventions on Hispanic prekindergarten students’ language and literacy scores. In addition, this study investigated the effects ...

  2. Rapid Evolutionary Placement of Short Sequence Reads (2010 JGI/ANL HPC Workshop)

    ScienceCinema (OSTI)

    Stamatakis, Alexis [Technical University of Munich

    2011-06-08

    Alexis Stamatakis of the Technical University of Munich gives a presentation on "Rapid Evolutionary Placement of Short Sequence Reads" at the JGI/Argonne HPC Workshop on January 26, 2010.

  3. Trinity and organism: towards a new reading of Herman Bavinck’s Organic motif 

    E-Print Network [OSTI]

    Eglinton, James Perman

    2010-11-26

    This thesis attempts to provide a new reading of the organic motif as found in the works of the Dutch Neo-Calvinist theologian Herman Bavinck (1854-1921). Noting the recent collapse of the previously dominant 'two Bavincks‘ ...

  4. More than pretty pictures? How illustrations affect parent-child story reading and children's story recall

    E-Print Network [OSTI]

    Greenhoot, Andrea Follmer; Beyer, Alisa M.; Curtis, Jennifer

    2014-07-22

    condition recalled more story events than those in the Non-Illustrated condition. Story reading measures predicted recall, but did not completely account for picture effects. These results suggest that illustrations enhance young preschoolers' story recall...

  5. A Two-Study Examination Of Student Engagement And Its Relation To Adolescent Reading Comprehension 

    E-Print Network [OSTI]

    Anderson, Leah A

    2015-05-01

    the impact of classroom practices and conditions on comprehension in the treatment condition. Cognitive engagement did not significantly predict comprehension outcomes, nor did it act as a mediator. Students’ entry-level reading skills did not interact...

  6. Centrifugal and centripetal forces in the discourse of early years reading instruction 

    E-Print Network [OSTI]

    Hunt, Christopher George

    2010-11-25

    This thesis reports on a research project investigating how a sample of eight teachers of P2 children in Scotland encouraged dialogic interaction in their reading groups while following prescriptive policy. The research ...

  7. "Centrifugal Forces," Spring, 2015 Centrifugal Forces: Reading Russia's Regional Identities and Initiatives

    E-Print Network [OSTI]

    Huang, Wei

    "Centrifugal Forces," Spring, 2015 Centrifugal Forces: Reading Russia's Regional Identities and articulating their particular identities and interests. Proposals for "Centrifugal Forces" will resist "Moscow and periphery. "Centrifugal Forces" will be a three-day conference offering broad interdisciplinary perspectives

  8. Parallel Assembly of Large Genomes from Paired Short Reads (2010 JGI/ANL HPC Workshop)

    ScienceCinema (OSTI)

    Aluru, Srinivas [Iowa State University

    2011-06-08

    Srinivas Aluru from Iowa State University gives a presentation on "Parallel Assembly of Large Genomes from Paired Short Reads" at the JGI/Argonne HPC Workshop on January 25, 2010.

  9. Integrating weather derivatives for managing risks

    SciTech Connect (OSTI)

    Bilski, B. [WeatherWise USA LLC, Pittsburgh, PA (United States)

    1999-11-01

    As deregulation and customer choice loom on the horizon, many energy utilities and other energy suppliers are scrambling to find new services that add value for consumers. Many are also seeking opportunities for increasing efficiency to ensure that costs remain competitive. Integrating weather derivatives with marketing programs and financial management can produce attractive new services and increase efficiency. Weather derivatives can be used to create innovative consumer services, such as a guaranteed annual energy bill which is unaffected by weather and energy price changes. They can also be used to protect the earnings of energy suppliers from one of their most significant financial risks, unpredictable weather. There are three basic types of weather derivatives available today. Option or insurance based derivatives (options), swaps or hedge based derivatives (swaps) and packages where other services are combined with one or both of the above.

  10. 1st Reading February 6, 2005 16:35 WSPC/178-JTCC 00151

    E-Print Network [OSTI]

    Lee, EokKyun

    1st Reading February 6, 2005 16:35 WSPC/178-JTCC 00151 Journal of Theoretical and Computational in single pores with idealized geometry such as slit-like35 pores2­10,20 or cylindrical pores.11,24­26 and the theoretical studies on such model system may provide 1 #12;1st Reading February 6, 2005 16:35 WSPC/178-JTCC

  11. Derived Differential Geometry Prof Joyce 14 lectures TT 2015 Overview

    E-Print Network [OSTI]

    Burton, Geoffrey R.

    1 Derived Differential Geometry Prof Joyce 14 lectures TT 2015 Overview Derived Differential Geometry is the study of derived smooth manifolds and orbifolds, where "derived" is in the sense

  12. Proportional-Integral-Derivative Control Derivative Filtering and Integral Anti-Windup

    E-Print Network [OSTI]

    Proportional-Integral-Derivative Control with Derivative Filtering and Integral Anti 2015 Neil Avenue, Columbus, OH 43210-1272 March 22, 2002 Abstract First, you will design a proportional controller to meet a given set of specifications. Then, you will design a proportional integral derivative

  13. Student Offer Letter Terms and Conditions. These notes are important. Please read them carefully. These terms and conditions should be read in conjunction with

    E-Print Network [OSTI]

    Birmingham, University of

    Student Offer Letter Terms and Conditions. These notes are important. Please read them carefully Prospectuses, as appropriate · The Offer Letter · The Code of Practice on Admissions · The University's Royal accept any offer of a place in order to establish what support is available and the information we need

  14. 6/26/12 ACS Applied Materials & Interfaces: Most Read Articles (ACS Publications) 1/3pubs.acs.org/action/showMostReadArticles?journalCode=aamick

    E-Print Network [OSTI]

    Aksay, Ilhan A.

    .org/action/showMostReadArticles?journalCode=aamick Advertisements Info for Advertisers Browse By Issue Select Decade Select Volume Select Issue Advertisements Info. Sreekumaran Nair, Peng Shengjie, Yang Shengyuan, and Seeram Ramakrishna Synthesis of Natural Cellulose Legacy Archives ACS Mobile Video User Resources About Us ACS Members Librarians Authors & Reviewers

  15. Growing attraction of refuse-derived fuels

    SciTech Connect (OSTI)

    Singh, R.

    1981-09-08

    A review of Dr. Andrew Porteous' book, Refuse Derived Fuels is presented. The escalating price of fossil fuel, particularily oil, together with the high cost of handling and transporting refuse makes the idea of refuse-derived fuel production an attractive and economic proposition. Refuse-derived fuel production is discussed and the various manufacturing processes in the UK and the USA are described. The pyrolysis of refuse for the production of gas, oil or heat and the production of methane and ethyl alcohol or other possibilities for refuse conversion.

  16. Direct synthesis of pyridine and pyrimidine derivatives

    E-Print Network [OSTI]

    Hill, Matthew D. (Matthew Dennis)

    2008-01-01

    I. Synthesis of Substituted Pyridine Derivatives via the Ruthenium-Catalyzed Cycloisomerization of 3-Azadienynes. The two-step conversion of various N-vinyl and N-aryl amides to the corresponding substituted pyridines and ...

  17. SCM Forcing Data Derived from NWP Analyses

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Jakob, Christian

    2008-01-15

    Forcing data, suitable for use with single column models (SCMs) and cloud resolving models (CRMs), have been derived from NWP analyses for the ARM (Atmospheric Radiation Measurement) Tropical Western Pacific (TWP) sites of Manus Island and Nauru.

  18. Isatin Derivatives as Inhibitors of Microtubule Assembly

    E-Print Network [OSTI]

    Beckman, Karen

    2008-09-04

    This thesis describes the rationale, design, and syntheses of derivatives of isatin (1-H-indole-2,3-dione). Isatin was identified, during a high throughput screen of 10,000 compounds, as a potential scaffold for ...

  19. Tax Credit for Forest Derived Biomass

    Broader source: Energy.gov [DOE]

    Forest-derived biomass includes tree tops, limbs, needles, leaves, and other woody debris leftover from activities such as timber harvesting, forest thinning, fire suppression, or forest health m...

  20. Confidence Measures Derived from an Acceptor HMM 

    E-Print Network [OSTI]

    Williams, Gethin; Renals, Steve

    In this paper we define a number of confidence measures derived from an acceptor HMM and evaluate their performance for the task of utterance verification using the North American Business News (NAB) and Broadcast News (BN) corpora. Results...

  1. Deriving Mathisson - Papapetrou equations from relativistic pseudomechanics

    E-Print Network [OSTI]

    R. R. Lompay

    2005-03-12

    It is shown that the equations of motion of a test point particle with spin in a given gravitational field, so called Mathisson - Papapetrou equations, can be derived from Euler - Lagrange equations of the relativistic pseudomechanics -- relativistic mechanics, which side by side uses the conventional (commuting) and Grassmannian (anticommuting) variables. In this approach the known difficulties of the Mathisson - Papapetrou equations, namely, the problem of the choice of supplementary conditions and the problem of higher derivatives are not appear.

  2. A SPICE model for Si microstrip detectors and read-out electronics

    SciTech Connect (OSTI)

    Bacchetta, N.; Candelori, A.; Bisello, D.; Calgarotto, C.; Paccagnella, A.

    1996-06-01

    The authors have developed a SPICE model of silicon microstrip detector and its read-out electronics. The SPICE model of an AC-coupled single-sided polysilicon-biased silicon microstrip detector has been implemented by using a RC network containing up to 19 strips. The main parameters of this model have been determined by direct comparison with DC and AC measurements. The simulated interstrip and coupling impedance and phase angle are in good agreement with experimental results, up to a frequency of 1 MHz. The authors have used the PreShape 32 as the read-out chip for both the simulation and the measurements. It consists of a charge sensitive preamplifier followed by a shaper and a buffer. The SPICE parameters have been adjusted to fit the experimental results obtained for the configuration where every strip is connected to the read-out electronics and kept the same for the different read-out configurations they have considered. By adding 2 further capacitances simulating the parasitic contributions between the read-out channels of the PS32 chip, a satisfactory matching between the experimental data and the simulated curves has been reached on both rising and trailing edges of the signal. Such agreement deteriorates only for strips far from the strip where the signal has been applied.

  3. The Effects of Video Self-Modeling on the Decoding Skills of Children At Risk for Reading Disabilities

    E-Print Network [OSTI]

    Ayala, Sandra M

    2010-01-01

    enacted response to intervention (RTI) programs as a way ofresponse to intervention (RTI) reading program received anof words in each student’s RTI instruction lesson. Viewing

  4. Second derivatives for approximate spin projection methods

    SciTech Connect (OSTI)

    Thompson, Lee M.; Hratchian, Hrant P.

    2015-02-07

    The use of broken-symmetry electronic structure methods is required in order to obtain correct behavior of electronically strained open-shell systems, such as transition states, biradicals, and transition metals. This approach often has issues with spin contamination, which can lead to significant errors in predicted energies, geometries, and properties. Approximate projection schemes are able to correct for spin contamination and can often yield improved results. To fully make use of these methods and to carry out exploration of the potential energy surface, it is desirable to develop an efficient second energy derivative theory. In this paper, we formulate the analytical second derivatives for the Yamaguchi approximate projection scheme, building on recent work that has yielded an efficient implementation of the analytical first derivatives.

  5. Quadratic forms and Clifford algebras on derived stacks

    E-Print Network [OSTI]

    Vezzosi, Gabriele

    Quadratic forms and Clifford algebras on derived stacks Gabriele Vezzosi Institut de Math structures in derived algebraic geometry. We define derived n-shifted quadratic complexes, over derived affine stacks and over general derived stacks, and give several examples of those. We define

  6. High ethanol producing derivatives of Thermoanaerobacter ethanolicus

    DOE Patents [OSTI]

    Ljungdahl, Lars G. (Athens, GA); Carriera, Laura H. (Athens, GA)

    1983-01-01

    Derivatives of the newly discovered microorganism Thermoanaerobacter ethanolicus which under anaerobic and thermophilic conditions continuously ferment substrates such as starch, cellobiose, glucose, xylose and other sugars to produce recoverable amounts of ethanol solving the problem of fermentations yielding low concentrations of ethanol using the parent strain of the microorganism Thermoanaerobacter ethanolicus are disclosed. These new derivatives are ethanol tolerant up to 10% (v/v) ethanol during fermentation. The process includes the use of an aqueous fermentation medium, containing the substrate at a substrate concentration greater than 1% (w/v).

  7. High ethanol producing derivatives of Thermoanaerobacter ethanolicus

    DOE Patents [OSTI]

    Ljungdahl, L.G.; Carriera, L.H.

    1983-05-24

    Derivatives of the newly discovered microorganism Thermoanaerobacter ethanolicus which under anaerobic and thermophilic conditions continuously ferment substrates such as starch, cellobiose, glucose, xylose and other sugars to produce recoverable amounts of ethanol solving the problem of fermentations yielding low concentrations of ethanol using the parent strain of the microorganism Thermoanaerobacter ethanolicus are disclosed. These new derivatives are ethanol tolerant up to 10% (v/v) ethanol during fermentation. The process includes the use of an aqueous fermentation medium, containing the substrate at a substrate concentration greater than 1% (w/v).

  8. Barriers to growth in the US real estate derivatives market

    E-Print Network [OSTI]

    Venter, Jani

    2007-01-01

    Commercial real estate is an important asset class but it does not yet have a well-developed derivatives market in the United States. A derivative is a contract that derives its value from an underlying index or asset. ...

  9. SEP Request for Approval Form 2 - Other Derived Energy Sources...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2 - Other Derived Energy Sources SEP Request for Approval Form 2 - Other Derived Energy Sources SEP-Request-for-Approval-Form-2Other-Derived-Energy-Sources.docx More Documents &...

  10. Brain Derived Vision Algorithm on High Performance Architectures

    E-Print Network [OSTI]

    2009-01-01

    Granger, R. : Novel brain-derived algorithms scale linearly37:345–369 17. Brain derived vision on IBM CELL: http://10.1007/s10766-009-0106-9 Brain Derived Vision Algorithm on

  11. Development/Plasticity/Repair Dorsally and Ventrally Derived Oligodendrocytes Have

    E-Print Network [OSTI]

    Richardson, William D.

    Development/Plasticity/Repair Dorsally and Ventrally Derived Oligodendrocytes Have Similar derived oligodendrocyte (OL) lineage cells have different properties. We generated a dual reporter mouse line to color code ventrally and dorsally derived OLPs (vOLPs and d

  12. Constraining Higher Derivative Supergravity with Scattering Amplitudes

    E-Print Network [OSTI]

    Yifan Wang; Xi Yin

    2015-03-05

    We study supersymmetry constraints on higher derivative deformations of type IIB supergravity by consideration of superamplitudes. Combining constraints of on-shell supervertices and basic results from string perturbation theory, we give a simple argument for the non-renormalization theorem of Green and Sethi, and some of its generalizations.

  13. Derivation of a Stochastic Neutron Transport Equation

    E-Print Network [OSTI]

    Edward J. Allen

    2010-04-14

    Stochastic difference equations and a stochastic partial differential equation (SPDE) are simultaneously derived for the time-dependent neutron angular density in a general three-dimensional medium where the neutron angular density is a function of position, direction, energy, and time. Special cases of the equations are given such as transport in one-dimensional plane geometry with isotropic scattering and transport in a homogeneous medium. The stochastic equations are derived from basic principles, i.e., from the changes that occur in a small time interval. Stochastic difference equations of the neutron angular density are constructed, taking into account the inherent randomness in scatters, absorptions, and source neutrons. As the time interval decreases, the stochastic difference equations lead to a system of Ito stochastic differential equations (SDEs). As the energy, direction, and position intervals decrease, an SPDE is derived for the neutron angular density. Comparisons between numerical solutions of the stochastic difference equations and independently formulated Monte Carlo calculations support the accuracy of the derivations.

  14. Equity and Equity Index Derivatives Trading Strategies

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Indexes 20 Theoretical (Fair) Value 21 Basis 22 Cost of Carry = Basis Equity Index Futures Strategies 23e u r e x Equity and Equity Index Derivatives Trading Strategies e u r e x #12;Please Note The definitions of "basis" and "cost of carry" have been changed in this version of the brochure. In previous

  15. Higher Derivative D-brane Couplings 

    E-Print Network [OSTI]

    Guo, Guangyu

    2012-10-19

    supersymmetry. In the third part, we obtain the higher derivative D-brane action by using both linearized T-duality and string disc amplitude computation. We evaluate disc amplitude of one R-R field C^(p-3) and two NS-NS fields in the presence of a single Dp...

  16. Derivation of a poroelastic flexural shell model

    E-Print Network [OSTI]

    Mikelic, Andro

    2015-01-01

    In this paper we investigate the limit behavior of the solution to quasi-static Biot's equations in thin poroelastic flexural shells as the thickness of the shell tends to zero and extend the results obtained for the poroelastic plate by Marciniak-Czochra and Mikeli\\'c. We choose Terzaghi's time corresponding to the shell thickness and obtain the strong convergence of the three-dimensional solid displacement, fluid pressure and total poroelastic stress to the solution of the new class of shell equations. The derived bending equation is coupled with the pressure equation and it contains the bending moment due to the variation in pore pressure across the shell thickness. The effective pressure equation is parabolic only in the normal direction. As additional terms it contains the time derivative of the middle-surface flexural strain. Derivation of the model presents an extension of the results on the derivation of classical linear elastic shells by Ciarlet and collaborators to the poroelastic shells case. The n...

  17. Biofuels and bio-products derived from

    E-Print Network [OSTI]

    Ginzel, Matthew

    NEED Biofuels and bio- products derived from lignocellulosic biomass (plant materials) are part improve the energy and carbon efficiencies of biofuels production from a barrel of biomass using chemical and thermal catalytic mechanisms. The Center for Direct Catalytic Conversion of Biomass to Biofuels IMPACT

  18. Wave function derivation of the JIMWLK equation

    E-Print Network [OSTI]

    Alexey V. Popov

    2008-12-16

    Using the stationary lightcone perturbation theory, we propose the complete and careful derivation the JIMWLK equation. We show that the rigorous treatment requires the knowledge of a boosted wave function with second order accuracy. Previous wave function approaches are incomplete and implicitly used the time ordered perturbation theory, which requires a usage of an external target field.

  19. High speed point derivative microseismic detector

    DOE Patents [OSTI]

    Uhl, J.E.; Warpinski, N.R.; Whetten, E.B.

    1998-06-30

    A high speed microseismic event detector constructed in accordance with the present invention uses a point derivative comb to quickly and accurately detect microseismic events. Compressional and shear waves impinging upon microseismic receiver stations disposed to collect waves are converted into digital data and analyzed using a point derivative comb including assurance of quiet periods prior to declaration of microseismic events. If a sufficient number of quiet periods have passed, the square of a two point derivative of the incoming digital signal is compared to a trip level threshold exceeding the determined noise level to declare a valid trial event. The squaring of the derivative emphasizes the differences between noise and signal, and the valid event is preferably declared when the trip threshold has been exceeded over a temporal comb width to realize a comb over a given time period. Once a trial event has been declared, the event is verified through a spatial comb, which applies the temporal event comb to additional stations. The detector according to the present invention quickly and accurately detects initial compressional waves indicative of a microseismic event which typically exceed the ambient cultural noise level by a small amount, and distinguishes the waves from subsequent larger amplitude shear waves. 9 figs.

  20. High speed point derivative microseismic detector

    DOE Patents [OSTI]

    Uhl, James Eugene (Albuquerque, NM); Warpinski, Norman Raymond (Albuquerque, NM); Whetten, Ernest Blayne (Albuquerque, NM)

    1998-01-01

    A high speed microseismic event detector constructed in accordance with the present invention uses a point derivative comb to quickly and accurately detect microseismic events. Compressional and shear waves impinging upon microseismic receiver stations disposed to collect waves are converted into digital data and analyzed using a point derivative comb including assurance of quiet periods prior to declaration of microseismic events. If a sufficient number of quiet periods have passed, the square of a two point derivative of the incoming digital signal is compared to a trip level threshold exceeding the determined noise level to declare a valid trial event. The squaring of the derivative emphasizes the differences between noise and signal, and the valid event is preferably declared when the trip threshold has been exceeded over a temporal comb width to realize a comb over a given time period. Once a trial event has been declared, the event is verified through a spatial comb, which applies the temporal event comb to additional stations. The detector according to the present invention quickly and accurately detects initial compressional waves indicative of a microseismic event which typically exceed the ambient cultural noise level by a small amount, and distinguishes the waves from subsequent larger amplitude shear waves.

  1. Derivative of Map of Banach algebra

    E-Print Network [OSTI]

    Aleks Kleyn

    2015-05-14

    Let $A$ be Banach algebra over commutative ring $D$. The map $f:A\\rightarrow A\\ $ is called differentiable in the Gateaux sense, if $$f(x+a)-f(x)=\\partial f(x)\\circ a+o(a)$$ where the Gateaux derivative $\\partial f(x)$ of map $f$ is linear map of increment $a$ and $o$ is such continuous map that $$ \\lim_{a\\rightarrow 0}\\frac{|o(a)|}{|a|}=0 $$ Assuming that we defined the Gateaux derivative $\\partial^{n-1} f(x)$ of order $n-1$, we define $$ \\partial^n f(x)\\circ(a_1\\otimes...\\otimes a_n) =\\partial(\\partial^{n-1} f(x)\\circ(a_1\\otimes...\\otimes a_{n-1}))\\circ a_n $$ the Gateaux derivative of order $n$ of map $f$. Since the map $f(x)$ has all derivatives, then the map $f(x)$ has Taylor series expansion $$ f(x)=\\sum_{n=0}^{\\infty}(n!)^{-1}\\partial^n f(x_0)\\circ(x-x_0)^n $$

  2. For the proper use of the instrument, be sure to read this instruction manual. Even after you

    E-Print Network [OSTI]

    Skemer, Philip

    for maintenance of the instrument performance are available for seven years from the date of installationFor the proper use of the instrument, be sure to read this instruction manual. Even after you read-1 XM-17410 SPECIMEN DECONVOLUTION PROGRAM #12;XM-17410-1 NOTICE · This instrument must not be modified

  3. For the proper use of the instrument, be sure to read this instruction manual. Even after you

    E-Print Network [OSTI]

    Skemer, Philip

    of the instrument performance are available for seven years from the date of installation. Thereafter, some of thoseFor the proper use of the instrument, be sure to read this instruction manual. Even after you read PHASE ANALYSIS PROGRAM #12;XM-17530-1 NOTICE · This instrument must not be modified, and products other

  4. For the proper use of the instrument, be sure to read this instruction manual. Even after you

    E-Print Network [OSTI]

    Skemer, Philip

    for maintenance of the instrument performance are available for seven years from the date of installationFor the proper use of the instrument, be sure to read this instruction manual. Even after you read-17560-1 XM-17560 AUTOMATIC PARTICLE ANALYSIS PROGRAM #12;XM-17560-1 NOTICE · This instrument must

  5. For the proper use of the instrument, be sure to read this instruction manual. Even after you

    E-Print Network [OSTI]

    Skemer, Philip

    For the proper use of the instrument, be sure to read this instruction manual. Even after you read ELECTRON GUN #12;XM-10110-1 NOTICE · This instrument must not be modified, and products other than those manufac- tured by JEOL Ltd. must not be attached to this instrument, without prior writ- ten permission

  6. For the proper use of the instrument, be sure to read this instruction manual. Even after you

    E-Print Network [OSTI]

    Skemer, Philip

    for maintenance of the instrument performance are available for seven years from the date of installationFor the proper use of the instrument, be sure to read this instruction manual. Even after you read-17520 ELEMENT RATIO MAP PROGRAM #12;XM-17520-1 NOTICE · This instrument must not be modified

  7. School of Mathematical and Physical Sciences, University of Reading, Silver Renewal, November 2013. Athena SWAN Silver Department award renewal

    E-Print Network [OSTI]

    School of Mathematical and Physical Sciences, University of Reading, Silver Renewal, November 2013. 1 Athena SWAN Silver Department award renewal application Name of institution: University of Reading of university Bronze award: renewed November 2011 Level of award applied for: Silver renewal Athena SWAN Silver

  8. Detailed Characterization of Lubricant-Derived Ash-Related Species...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Characterization of Lubricant-Derived Ash-Related Species in Diesel Exhaust and Aftertreatment Systems Detailed Characterization of Lubricant-Derived Ash-Related Species in Diesel...

  9. Derivative-free optimization for parameter estimation in computational...

    Office of Scientific and Technical Information (OSTI)

    Derivative-free optimization for parameter estimation in computational nuclear physics Citation Details In-Document Search Title: Derivative-free optimization for parameter...

  10. Low-Emissions Burner Technology using Biomass-Derived Liquid...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Low-Emissions Burner Technology using Biomass-Derived Liquid Fuels Low-Emissions Burner Technology using Biomass-Derived Liquid Fuels This factsheet describes a project that...

  11. The Impact of Using Derived Fuel Consumption Maps to Predict...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Impact of Using Derived Fuel Consumption Maps to Predict Fuel Consumption The Impact of Using Derived Fuel Consumption Maps to Predict Fuel Consumption Poster presented at the...

  12. BILIWG Meeting: High Pressure Steam Reforming of Bio-Derived...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    High Pressure Steam Reforming of Bio-Derived Liquids (Presentation) BILIWG Meeting: High Pressure Steam Reforming of Bio-Derived Liquids (Presentation) Presented at the 2007...

  13. Bio-Derived Liquids to Hydrogen Distributed Reforming Targets...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Targets (Presentation) Bio-Derived Liquids to Hydrogen Distributed Reforming Targets (Presentation) Presented at the 2007 Bio-Derived Liquids to Hydrogen Distributed Reforming...

  14. A new read-out architecture for the ATLAS Tile Calorimeter Phase-II Upgrade

    E-Print Network [OSTI]

    Valero, Alberto; The ATLAS collaboration

    2015-01-01

    TileCal is the Tile hadronic calorimeter of the ATLAS experiment at the LHC. The LHC has planned a series of upgrades culminating in the High Luminosity LHC (HL-LHC) which will increase of order five times the LHC nominal instantaneous luminosity. TileCal will undergo an upgrade to accommodate to the HL-LHC parameters. The TileCal read-out electronics will be redesigned introducing a new read-out strategy. The data generated in the detector will be transferred to the new Read-Out Drivers (sRODs) located in off-detector for every bunch crossing before any event selection is applied. Furthermore, the sROD will be responsible of providing preprocessed trigger information to the ATLAS first level of trigger. It will implement pipeline memories to cope with the latencies and rates specified in the new trigger schema and in overall it will represent the interface between the data acquisition, trigger and control systems and the on-detector electronics. The new TileCal read-out architecture will be presented includi...

  15. Neuroimaging reveals dual routes to reading in simultaneous proficient readers of two orthographies

    E-Print Network [OSTI]

    gyrus for English and left inferior parietal lobule (L-IPL) for Hindi, whereas, sequential readers showed higher activation along the L-IPL for reading both languages. We suggest that early simultaneous reported cortical differences across languages due to orthographic depth (Paulesu et al., 2000

  16. SOAP3: GPU-based Compressed Indexing and Ultra-fast Parallel Alignment of Short Reads

    E-Print Network [OSTI]

    Lam, Tak-Wah

    Kong Zhiheng Li, Ruibang Luo, Bingqiang Wang, Chang Yu Beijing Genome Institute, Shenzhen, China-throughput software to align the enormous number of short reads (patterns) with reference genomes (such as the human genome). In the past few years, a number of very fast alignment software (e.g., Maq, SOAP2, ZOOM, Bowtie

  17. Two Experiments Comparing Reading with Listening for Human Processing of Conversational Telephone Speech

    E-Print Network [OSTI]

    Two Experiments Comparing Reading with Listening for Human Processing of Conversational Telephone of no experiment that directly compares Switchboard and Fishertype CTS transcripts with audio in terms of human. Abstract We report on results of two experiments designed to compare subjects' ability to extract

  18. Galen Sasaki EE 260 University of Hawaii 1 Read Only Memory (ROM)

    E-Print Network [OSTI]

    Sasaki, Galen H.

    Galen Sasaki EE 260 University of Hawaii 1 Read Only Memory (ROM) C language int d[8] Array cells Combinational Circuit Galen Sasaki EE 260 University of Hawaii 2 Outline · Truth table of ROM · How to use the odd sized ROM · 2732 #12;Galen Sasaki EE 260 University of Hawaii 3 Truth Table a2 a1 a

  19. QAA Good Practice Knowledgebase case study University of Reading: Web-based support for assessment

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    QAA Good Practice Knowledgebase case study University of Reading: Web-based support for assessment Theme Assessment and feedback Sub-themes Web-based support Feature of good practice as identified by Institutional Review November 2012 (quoted directly from the review report) The University offers excellent web

  20. Top Photo: John A. Read/FEMA National Center for Environmental Health

    E-Print Network [OSTI]

    Top Photo: John A. Read/FEMA National Center for Environmental Health Division of Emergency the environmental problem of sediments and other pollutants entering surface waters but do not address public health detention basins, retention ponds, media filtration devices, below-ground devices) frequently hold standing

  1. Briefing on the Medical Innovation Bill House of Commons Second Reading 6 March 2015

    E-Print Network [OSTI]

    Rambaut, Andrew

    Briefing on the Medical Innovation Bill House of Commons Second Reading ­ 6 March 2015 Summary We that the Medical Innovation Bill will not achieve its aim of encouraging medical innovation, and could result. Background The Medical Innovation Bill is a Private Members Bill introduced by Lord Saatchi, which aims

  2. P&T Dossier Compilation Best Practices: Read departments Role and Scope. Attend appropriate training.

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    P&T Dossier Compilation Best Practices: Read departments Role and Scope. Attend appropriate. Adobe Acrobat Pro is a good tool to use when compiling your dossier. It has many features to assist the web. 4. When you choose an Option for compiling your dossier, follow it through the entire dossier. 5

  3. Erasure Codes for Reading and Writing (Technical Report tr-ri-06-274)

    E-Print Network [OSTI]

    Schindelhauer, Christian

    Erasure Codes for Reading and Writing (Technical Report tr-ri-06-274) Mario Mense1 and Christian code y of length n and arbitrarily chosen parameters k r, w n, our RW codes provide a linear (n, k, d to rewrite y completely if x changes. In addition, for a subset of the RW codes, all mentioned parameters

  4. Stat 328 Reading on Six Sigma, TQM, Statistics and Business Process Improvement

    E-Print Network [OSTI]

    Vardeman, Stephen B.

    Stat 328 Reading on Six Sigma, TQM, Statistics and Business Process Improvement Primarily Adapted 28, 2001 1 Statistics and Six Sigma Programs The modern global business environment is ...ercely Sigma." The name originated at Motorola Corpo- ration in the late 1980's. Six Sigma programs at General

  5. Spatial-frequency and contrast properties of reading in central and peripheral vision

    E-Print Network [OSTI]

    Tjan, Bosco

    such as lexical access, attention, or other cognitive influences. For example, Rayner and his colleagues developed variables affect eye movements in reading (Rayner, Reichle, & Pollatsek, 1998; Reichle, Pollatsek, Fisher, & Rayner, 1998; Reichle, Rayner, & Pollatsek, 1999). O'Regan postulated that words are identified most

  6. Short Outline of Readings for Geog. 549 Chapter 1. Introduction -Watersheds and Water: Essential Resources

    E-Print Network [OSTI]

    James, L. Allan

    Short Outline of Readings for Geog. 549 Chapter 1. Introduction - Watersheds and Water: Essential Resources PART ONE - ENVIRONMENTAL ASPECTS OF WATER RESOURCES Section I. Physical Hydrology Chapter 2. History of the Hydrologic Cycle and Water Properties (omitted) Chapter 3. Atmospheric Water and Global

  7. Assembly free comparative genomics of short-read sequence data discovers the needles in the haystack

    E-Print Network [OSTI]

    Assembly free comparative genomics of short-read sequence data discovers the needles of Biological Sciences, Texas Tech University, Lubbock, TX 79409, USA Abstract Most comparative genomic analyses an assembly free analysis of SRS data that discovers sequence variants among focal genomes by tabulating

  8. Blogging as Social Activity, or, Would You Let 900 Million People Read Your Diary?

    E-Print Network [OSTI]

    Nardi, Bonnie

    Blogging as Social Activity, or, Would You Let 900 Million People Read Your Diary? Bonnie A. Nardi mgumbrec@psych.stanford.edu ABSTRACT "Blogging" is a Web-based form of communication that is rapidly becoming mainstream. In this paper, we report the results of an ethnographic study of blogging, focusing

  9. SeqEntropy: Genome-Wide Assessment of Repeats for Short Read Sequencing

    E-Print Network [OSTI]

    Chen, Chaur-Chin

    analysis of human genome [1] and for rapid full genome sequencing and typing of various organisms. The 1000 Genomes Project, launched in 2008, bSeqEntropy: Genome-Wide Assessment of Repeats for Short Read Sequencing Hsueh-Ting Chu1,2 , William

  10. Academic Language Proficiency Development and Its Impact on Reading Comprehension: Within and Across Languages 

    E-Print Network [OSTI]

    Spies, Tracy

    2012-07-16

    A path model of second language (L2; English) oral language and reading comprehension variables was tested on a sample of 100 Spanish-speaking English-language learners enrolled in a transitional bilingual program over a 3-year period. The data...

  11. NRES 725 PLANT PHYSIOLOGICAL ECOLOGY Reading List Water Balance of Plants

    E-Print Network [OSTI]

    Nowak, Robert S.

    1 NRES 725 ­ PLANT PHYSIOLOGICAL ECOLOGY Fall 2008 Reading List ­ Water Balance of Plants I) Water Balance of Plants A) Water potential B) Soil, plant, air continuum C) Physiological control 1) Roots-256 *Steudle (01) Ann Rev Plant Phy Mol Biol 52:847-875 Kirkham (05) pp 207-216 Kramer & Boyer (95) pp 115

  12. HapFACS License Agreement Read the following terms and conditions carefully before downloading, installing or

    E-Print Network [OSTI]

    Lisetti, Christine

    HapFACS License Agreement Read the following terms and conditions carefully before downloading acceptance of these terms and conditions. LICENSE This End User License Agreement ("License" or "License licensing all or any portion of such Software. 1. Grant of License. So long as you are in compliance

  13. Making Write Less Blocking for Read Accesses in Phase Change Memory

    E-Print Network [OSTI]

    Zhu, Yifeng

    for read accesses caused by uninterrupted serialized writes. Micro-write breaks a large write into multiple-computing technology achieves much less power saving on memory chips than processors. While the power dissipation, the background power of DRAM chips stills accounts for more than 40% of DRAM power [2]. Fortunately, phase

  14. Chemistry Course Reading List * Physical Chemistry, P W Atkins, Oxford University Press (8th

    E-Print Network [OSTI]

    Oxford, University of

    Chemistry Course Reading List * Physical Chemistry, P W Atkins, Oxford University Press (8th edn.) 2006, [7th edn. 2001] * Inorganic Chemistry, Shriver and Atkins, Oxford University Press (4th edn) 2006, (previous edn., 1999] Chemistry of the Elements, Greenwood & Earnshaw, Pergamon (2nd edn.), 1997 [1st edn

  15. 16. Wave-particle interaction Reading: Shu, Vol.II, Ch.29

    E-Print Network [OSTI]

    Pohl, Martin Karl Wilhelm

    16. Wave-particle interaction Reading: Shu, Vol.II, Ch.29 16.1 Landau damping We started our discussion of hydromagnetic waves with simple one-dimensional electrostatic fluctuations, the Langmuir waves, whose dispersion relation is = p = e2 ne 0 me Can the waves change plasma properties or, vice versa

  16. Graphical Overlays: Using Layered Elements to Aid Chart Reading Nicholas Kong and Maneesh Agrawala

    E-Print Network [OSTI]

    O'Brien, James F.

    controls to viewers. We demonstrate several examples of each overlay type for bar, pie and line charts.g., pie charts, line charts, scatterplots, etc.) use different visual encodings for the data, common chartGraphical Overlays: Using Layered Elements to Aid Chart Reading Nicholas Kong and Maneesh Agrawala

  17. IT'S BACK BY POPULAR DEMAND The 2014 Labe Family Summer Reading Club

    E-Print Network [OSTI]

    on Monday, September 1, 2014. One point will be awarded for each page read there will be no entry fee to participate; this will allow the non-readers in the family RULEBOOK 1. Eligibility. Each page of a book counts as one point toward your

  18. Economics 492c Directed Readings: The Economics of Sustainability: Community, Markets and Technology

    E-Print Network [OSTI]

    Phani, A. Srikantha

    Economics 492c Directed Readings: The Economics of Sustainability: Community, Markets and by appointment Description of the Course: Students of economics are provided with a strong grounding in formal them with the skills and knowledge to tackle economic problems. This course builds upon that tradition

  19. Delivering the Green: The Future of California's Freight Transportation System Summary and Reading List

    E-Print Network [OSTI]

    California at Davis, University of

    Delivering the Green: The Future of California's Freight Transportation System Summary and Reading List California's freight sector is a critical part of California's economic engine, generating. California's freight sector, including trucks, trains, and ships is also the largest contributor to ozone

  20. Measures of the sentence intonation of read and spontaneous speech in American English

    E-Print Network [OSTI]

    Lieberman, Philip; Katz, William; Jongman, Allard; Zimmerman, Roger; Miller, Mark

    1985-02-01

    . An objective all?points least?squares best?fit procedure was tested on this corpus and on a set of sentences that had been produced in both spontaneous and read speech by six speakers. The all?points linear regression line was a better descriptor of the F 0...

  1. Reading of Electronic Documents: The Usability of Linear, Fisheye, and Overview+Detail Interfaces

    E-Print Network [OSTI]

    Reading of Electronic Documents: The Usability of Linear, Fisheye, and Overview+Detail Interfaces, and an overview+detail interface for electronic documents. Using these interfaces, 20 subjects wrote essays and answered questions about scientific documents. Essays written using the overview+detail interface received

  2. An Exploratory Study of a Shared-Book Reading Intervention Involving Spanish-Speaking Latino Families 

    E-Print Network [OSTI]

    Vaquero, Juana

    2014-11-19

    The present pilot study examined the effectiveness of a 12-week parent-delivered shared book-reading curriculum in Spanish using a pre-, post-between-groups, with a 12-month follow-up test design. Twenty Spanish-speaking ...

  3. Derivation of evolutionary payoffs from observable behavior

    E-Print Network [OSTI]

    Feigel, Alexander; Engel, Assaf

    2008-01-01

    Interpretation of animal behavior, especially as cooperative or selfish, is a challenge for evolutionary theory. Strategy of a competition should follow from corresponding Darwinian payoffs for the available behavioral options. The payoffs and decision making processes, however, are difficult to observe and quantify. Here we present a general method for the derivation of evolutionary payoffs from observable statistics of interactions. The method is applied to combat of male bowl and doily spiders, to predator inspection by sticklebacks and to territorial defense by lions, demonstrating animal behavior as a new type of game theoretical equilibrium. Games animals play may be derived unequivocally from their observable behavior, the reconstruction, however, can be subjected to fundamental limitations due to our inability to observe all information exchange mechanisms (communication).

  4. A derivative standard for polarimeter calibration

    SciTech Connect (OSTI)

    Mulhollan, G.; Clendenin, J.; Saez, P. [and others

    1996-10-01

    A long-standing problem in polarized electron physics is the lack of a traceable standard for calibrating electron spin polarimeters. While several polarimeters are absolutely calibrated to better than 2%, the typical instrument has an inherent accuracy no better than 10%. This variability among polarimeters makes it difficult to compare advances in polarized electron sources between laboratories. The authors have undertaken an effort to establish 100 nm thick molecular beam epitaxy grown GaAs(110) as a material which may be used as a derivative standard for calibrating systems possessing a solid state polarized electron source. The near-bandgap spin polarization of photoelectrons emitted from this material has been characterized for a variety of conditions and several laboratories which possess well calibrated polarimeters have measured the photoelectron polarization of cathodes cut from a common wafer. Despite instrumentation differences, the spread in the measurements is sufficiently small that this material may be used as a derivative calibration standard.

  5. Uncertainty estimates for derivatives and intercepts

    SciTech Connect (OSTI)

    Clark, E.L.

    1990-01-01

    Straight line least squares fits of experimental data are widely used in the analysis of test results to provide derivatives and intercepts. A method for evaluating the uncertainty in these parameters is described. The method utilizes conventional least squares results and is applicable to experiments where the independent variable is controlled, but not necessarily free of error. A Monte Carlo verification of the method is given 7 refs., 2 tabs.

  6. Uncertainty estimates for derivatives and intercepts

    SciTech Connect (OSTI)

    Clark, E.L.

    1994-09-01

    Straight line least squares fits of experimental data are widely used in the analysis of test results to provide derivatives and intercepts. A method for evaluating the uncertainty in these parameters is described. The method utilizes conventional least squares results and is applicable to experiments where the independent variable is controlled, but not necessarily free of error. A Monte Carlo verification of the method is given.

  7. Triamine chelants, their derivatives, complexes and conjugates

    DOE Patents [OSTI]

    Troutner, D.E.; John, C.S.; Pillai, M.R.A.

    1995-03-07

    A group of functionalized triamine chelants and their derivatives that form complexes with radioactive metal ions are disclosed. The complexes can be covalently attached to a protein or an antibody or antibody fragment and used for therapeutic and/or diagnostic purposes. The chelants are of the formula, as shown in the accompanying diagrams, wherein n, m, R, R{sup 1}, R{sup 2} and L are defined in the specification.

  8. Enhanced Coset Symmetries and Higher Derivative Corrections

    E-Print Network [OSTI]

    Neil Lambert; Peter West

    2006-08-17

    After dimensional reduction to three dimensions, the lowest order effective actions for pure gravity, M-theory and the Bosonic string admit an enhanced symmetry group. In this paper we initiate study of how this enhancement is affected by the inclusion of higher derivative terms. In particular we show that the coefficients of the scalar fields associated to the Cartan subalgebra are given by weights of the enhanced symmetry group.

  9. The relationship between reading comprehension skill assessment methods and academic success for first semester students in a selected Bachelor of Science in Nursing program in Texas 

    E-Print Network [OSTI]

    Cook, Jennifer D. M.

    2007-04-25

    This retrospective descriptive study addressed the relationship between reading comprehension skills as measured by the Nelson-Denny Reading Test and the Nurse Entrance Test and indices of academic success (i.e., grade point average of prerequisite...

  10. Two-point derivative dispersion relations

    E-Print Network [OSTI]

    Erasmo Ferreira; Javier Sesma

    2014-03-24

    A new derivation is given for the representation, under certain conditions, of the integral dispersion relations of scattering theory through local forms. The resulting expressions have been obtained through an independent procedure to construct the real part, and consist of new mathematical structures of double infinite summations of derivatives. In this new form the derivatives are calculated at the generic value of the energy $E$ and separately at the reference point $E=m$ that is the lower limit of the integration. This new form may be more interesting in certain circumstances and directly shows the origin of the difficulties in convergence that were present in the old truncated forms called standard-DDR. For all cases in which the reductions of the double to single sums were obtained in our previous work, leading to explicit demonstration of convergence, these new expressions are seen to be identical to the previous ones. We present, as a glossary, the most simplified explicit results for the DDR's in the cases of imaginary amplitudes of forms $(E/m)^\\lambda[\\ln (E/m)]^n$, that cover the cases of practical interest in particle physics phenomenology at high energies. We explicitly study the expressions for the cases with $\\lambda$ negative odd integers, that require identification of cancelation of singularities, and provide the corresponding final results.

  11. A Model for Tuberculosis with Exogeneous Reinfection

    E-Print Network [OSTI]

    Feng, Z., et al.

    2000-05-16

    immunodeficiency virus, in ``Tuberculosis: A Comprehensive Inter- national Approach'' (L. B. Reichman and E. S. Hershfield, Eds.),. Lung Biology in Health and ...

  12. Transformation of spatial and perturbation derivatives of travel time

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    Transformation of spatial and perturbation derivatives of travel time at a general interface and perturbation parameters. We derive the explicit equations for transforming these travel­time derivatives Hamiltonian function and are applicable to the transformation of travel­time derivatives in both isotropic

  13. Contemporary Mathematics Derived Canonical Algebras as One-Point Extensions

    E-Print Network [OSTI]

    Barot, Michael

    Contemporary Mathematics Derived Canonical Algebras as One-Point Extensions Michael Barot-dimensional algebra by a -module M is derived canonical, i.e. derived equivalent to a canonical algebra. We give the conditions are even sufficient. As a further result we obtain that, if is derived canonical then the one

  14. p. 9: Third paragraph. "The right-hand side of the this equation" should read "The right-hand side of this equation".

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    Errata p. 9: Third paragraph. "The right-hand side of the this equation" should read "The right- hand side of this equation". p. 70: Exercise 4.7 should read: "A particle moves under the influence/(k a). " p. 74: Equation (5.10), and following line. "24h 56m 04s " should read "23h 56m 04s

  15. Balance Calibration – A Method for Assigning a Direct-Reading Uncertainty to an Electronic Balance.

    SciTech Connect (OSTI)

    Mike Stears

    2010-07-01

    Paper Title: Balance Calibration – A method for assigning a direct-reading uncertainty to an electronic balance. Intended Audience: Those who calibrate or use electronic balances. Abstract: As a calibration facility, we provide on-site (at the customer’s location) calibrations of electronic balances for customers within our company. In our experience, most of our customers are not using their balance as a comparator, but simply putting an unknown quantity on the balance and reading the displayed mass value. Manufacturer’s specifications for balances typically include specifications such as readability, repeatability, linearity, and sensitivity temperature drift, but what does this all mean when the balance user simply reads the displayed mass value and accepts the reading as the true value? This paper discusses a method for assigning a direct-reading uncertainty to a balance based upon the observed calibration data and the environment where the balance is being used. The method requires input from the customer regarding the environment where the balance is used and encourages discussion with the customer regarding sources of uncertainty and possible means for improvement; the calibration process becomes an educational opportunity for the balance user as well as calibration personnel. This paper will cover the uncertainty analysis applied to the calibration weights used for the field calibration of balances; the uncertainty is calculated over the range of environmental conditions typically encountered in the field and the resulting range of air density. The temperature stability in the area of the balance is discussed with the customer and the temperature range over which the balance calibration is valid is decided upon; the decision is based upon the uncertainty needs of the customer and the desired rigor in monitoring by the customer. Once the environmental limitations are decided, the calibration is performed and the measurement data is entered into a custom spreadsheet. The spreadsheet uses measurement results, along with the manufacturer’s specifications, to assign a direct-read measurement uncertainty to the balance. The fact that the assigned uncertainty is a best-case uncertainty is discussed with the customer; the assigned uncertainty contains no allowance for contributions associated with the unknown weighing sample, such as density, static charges, magnetism, etc. The attendee will learn uncertainty considerations associated with balance calibrations along with one method for assigning an uncertainty to a balance used for non-comparison measurements.

  16. The Synthesis of Carboracycles Derived from B,B'-Bis(aryl) Derivatives of Icosahedral ortho-Carborane

    E-Print Network [OSTI]

    Hawthorne, M. Frederick

    The Synthesis of Carboracycles Derived from B,B'-Bis(aryl) Derivatives of Icosahedral ortho)] compounds in high yields. The anisole derivatives 3 and 8 were deprotected to yield the corresponding bis(O)Me). Deprotection of compound 11 led to the corresponding acetyl derivative 18 (R' C(O)Me). Bis- anisole 3

  17. Deriving time from the geometry of space

    E-Print Network [OSTI]

    James M. Chappell; John G. Hartnett; Nicolangelo Iannella; Derek Abbott

    2015-04-08

    The Minkowski formulation of special relativity reveals the essential four-dimensional nature of spacetime, consisting of three space and one time dimension. Recognizing its fundamental importance, a variety of arguments have been proposed over the years attempting to derive the Minkowski spacetime structure from fundamental physical principles. In this paper we illustrate how Minkowski spacetime follows naturally from the geometric properties of three dimensional Clifford space modeled with multivectors. This approach also generalizes spacetime to an eight dimensional space as well as doubling the size of the Lorentz group. This description of spacetime also provides a new geometrical interpretation of the nature of time.

  18. Derivation of an Applied Nonlinear Schroedinger Equation.

    SciTech Connect (OSTI)

    Pitts, Todd Alan; Laine, Mark Richard; Schwarz, Jens; Rambo, Patrick K.; Karelitz, David B.

    2015-01-01

    We derive from first principles a mathematical physics model useful for understanding nonlinear optical propagation (including filamentation). All assumptions necessary for the development are clearly explained. We include the Kerr effect, Raman scattering, and ionization (as well as linear and nonlinear shock, diffraction and dispersion). We explain the phenomenological sub-models and each assumption required to arrive at a complete and consistent theoretical description. The development includes the relationship between shock and ionization and demonstrates why inclusion of Drude model impedance effects alters the nature of the shock operator. Unclassified Unlimited Release

  19. The relationship between technology integration reading instruction and reading achievement in high performing campuses as reported by PEIMS and third grade classroom teachers in selected South Texas school districts 

    E-Print Network [OSTI]

    Bauer, Hilaria

    2006-04-12

    The purpose of this study was to investigate how the implementation of technology in the classroom impacts third grade readers with high reading scores in the Texas Assessment of Knowledge and Skills (TAKS). The secondary ...

  20. A review of "The Romantic Legacy of Paradise Lost: Reading against the grain" by Jonathan Shears 

    E-Print Network [OSTI]

    Urban, David V.

    2013-01-01

    ? and ?contextual studies.? As a snapshot of recent work by both junior and senior scholars in the ?eld, To Repair the Ruins speaks to the methodological vigor, diversity, and eclecticism of American Milton studies today. Jonathan Shears. ?e Romantic Legacy... and Romantic literature? and ?the legacy that Romantic readings of Paradise Lost have held, and still hold, on the critical consciousness? (?). Respecting but consciously setting his argument against Lucy Newlyn?s Paradise Lost and the Romantic Reader...

  1. The politics of mind reading: cartography and brain science in the discourse of medicine 

    E-Print Network [OSTI]

    Osbun, Joshua William

    2013-02-22

    this ideology in the discourse is present. I notice in my reading that the method of cartography becomes markedly different in the Renaissance beginning with the theorist Andreas Vesalius, who detaches himself I'rom a metaphysical awareness of the body... and provided an avenue by v hich Renaissance physicians could explore other realms of knov, ledge regarding the body. V. Vesalius Andreas Vesalius was a Belgian anatomist and artist who lived Irom 1514 to 1564. Lois Magner describes Vesalius' achievement...

  2. Primer on electricity futures and other derivatives

    SciTech Connect (OSTI)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  3. A review of "Formal Matters: Reading the Materials of English Renaissance Literature" edited by Allison K. Deutermann and Andras Kisery 

    E-Print Network [OSTI]

    Stanwood, P. G.

    2015-01-01

    have done so. This book is an anthology that wants to display the best kind of current Renaissance literary criti- cism, which views the importance of close reading while making use of historical, cultural, and bibliographic analysis. This promise...

  4. U-152: OpenSSL "asn1_d2i_read_bio()" DER Format Data Processing Vulnerability

    Broader source: Energy.gov [DOE]

    The vulnerability is caused due to a type casting error in the "asn1_d2i_read_bio()" function when processing DER format data and can be exploited to cause a heap-based buffer overflow.

  5. The COMT Val/Met polymorphism is associated with reading-related skills and consistent patterns of functional neural

    E-Print Network [OSTI]

    PAPER The COMT Val/Met polymorphism is associated with reading- related skills and consistent. In particular, we found that the COMT Val/Met polymorphism at rs4680, which results in the substitution

  6. Investigating the Selection of Example Sentences for Unknown Target Words in ICALL Reading Texts for L2 German 

    E-Print Network [OSTI]

    Segler, Thomas M.

    2007-06-26

    This thesis considers possible criteria for the selection of example sentences for difficult or unknown words in reading texts for students of German as a Second Language (GSL). The examples are intended to be provided ...

  7. Subjectively homogeneous noise over written text as a tool to investigate the perceptual mechanisms involved in reading

    E-Print Network [OSTI]

    Gosselin, Frédéric

    ). Reading has also been studied via eye tracking (e.g., O'Regan, 1990; Rayner, 1998; Rayner & Pollatsek, 1989; Rayner & Sereno, 1994). Such studies found more fixations on names, verbs, and adjectives (about

  8. Early Response-to-Intervention Measures and Criteria as Predictors of Reading Disability in 3rd Grade

    E-Print Network [OSTI]

    Beach, Kristen Dawn

    2012-01-01

    among traditional and RTI-based definitions of readingResponse-to- Intervention ( RtI) framework for identifyingderived from a longitudinal RtI project executed in low-

  9. Fostering success in reading: a survey of teaching methods and collaboration practices of high performing elementary schools in Texas 

    E-Print Network [OSTI]

    Evans Jr., Richard Austin

    2006-08-16

    variety of different texts, including social studies and science, than do less successful students. In addition, students need to 20 experience vast quantities of ?successful reading experiences? to become independent, proficient readers (Allington...

  10. Early Response-to-Intervention Measures and Criteria as Predictors of Reading Disability in 3rd Grade

    E-Print Network [OSTI]

    Beach, Kristen Dawn

    2012-01-01

    the behavioral sciences (3rd ed. ). Hillsdale, NJ: Erlbaum.Test of Language Development (3rd ed. ). Austin, TX: Pro-Ed,of Reading Disability in 3rd Grade A Dissertation submitted

  11. DRAFT final version accepted for publication in Personal and Ubiquitous Computing "Resistance is Futile": Reading Science Fiction Alongside

    E-Print Network [OSTI]

    Dourish,Paul

    DRAFT ­ final version accepted for publication in Personal and Ubiquitous Computing "Resistance is Futile": Reading Science Fiction Alongside Ubiquitous Computing Paul Dourish University of California methodological value for ubiquitous computing. 1 Introduction Mark Weiser's paper outlining the ubiquitous

  12. A review of "Autobiography and Gender in Early Modern Literature: Reading Women's Lives, 1600-1680" by Sharon Cadman Seelig 

    E-Print Network [OSTI]

    Campbell, Julie D.

    2007-01-01

    Seelig. Autobiography and Gender in Early Modern Literature: Reading Women?s Lives, 1600-1680. Cambridge: Cambridge University Press, 2006. 214pp. 75.00 cloth; Review by JULIE D. CAMPBELL, EASTERN ILLINOIS UNIVERSITY. In this study on autobiography... making or the author?s?? (11). Seelig then provides close readings of the texts based on her responses to such questions. She summarizes her intentions by stating, ?My goal is not to arrive at an absolute definition of these forms [of autobiography...

  13. A review of "To Repair the Ruins: Reading Milton" edited by Mary C. Fenton and Louis Schwartz 

    E-Print Network [OSTI]

    Welch, Anthony

    2013-01-01

    rejects familiar models of readerly recogni- tion and self-discovery, seeking instead to foster forms of reading, and loving, that move beyond all sel?sh expectations of ??nding oneself? in a moral lesson or a decoded riddle (???). Further historicizing.... Jonathan Shears. ?e Romantic Legacy of Paradise Lost: Reading against the Grain. Farnham and Burlington, VT: Ashgate, ????. ix + ??? pp. ???.??/$??.??. Review by ??? ? ?. ?????, ???? ? ???????. In this helpful book, Jonathan Shears focuses on ?the...

  14. A review of "Reading Material in Early Modern England: Print, Gender, and Literacy." by Heidi Brayman Hackel 

    E-Print Network [OSTI]

    Lissa Beauchamp

    2006-01-01

    ?who one was and how one read were considered one and the same: iden- tity, that is, determined interpretation? (83), and presumably vice versa too. And because ?preliminaries and marginalia are the most explicitly collabora- tive parts of a printed... ?attention from men of letters to men and women of leisure? (3). In other words, she focuses her analysis of reading on the materiality of the text and of readers themselves as opposed to the ?theoretical constructs, variously described as ?mock,? ?ideal...

  15. Automation of Nested Matrix and Derivative Operations Robert Kalaba

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    Automation of Nested Matrix and Derivative Operations Robert Kalaba Departments of Electrical of special functions a=x, b=y, c = ab, (4) a=log(c), z=a+d. #12;Automation of Matrix Derivative Operations

  16. Higher Derivative Corrections to O-Plane Actions 

    E-Print Network [OSTI]

    Wang, Zhao

    2014-11-17

    Higher derivative corrections to effective actions are very important and of great interest in string theory. The aim of this dissertation is to develop a method to constrain the higher derivative corrections to O-plane ...

  17. Optimal design of derivatives in illiquid market: an alternative approach

    E-Print Network [OSTI]

    Vargiolu, Tiziano

    by Barrieu and El Karoui in [1, 2] for the design of derivatives in illiquid markets. Its motivation is the Optimal design of derivatives in illiquid * market: an alternative approach Grazia De Silvestro

  18. Symbolic Neural Networks Derived from Stochastic Grammar Domain Models 1 Symbolic Neural Networks Derived from Stochastic

    E-Print Network [OSTI]

    Mjolsness, Eric

    Symbolic Neural Networks Derived from Stochastic Grammar Domain Models 1 Symbolic Neural Networks neural network architectures with some of the expressive power of a semantic network and also some of the pattern recognition and learning capabilities of more conventional neural networks. For example

  19. Read More...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-RichProton DeliveryRadioactiveRare

  20. Derivative Securities G63.2791.001, Fall 2007

    E-Print Network [OSTI]

    -based pricing of derivative securities. Topics include: arbitrage; risk-neutral valuation; the log, and other interest-based derivatives; credit risk and credit derivatives. This section versus Steve Allen, one every couple of weeks. Col- laboration on homework is encouraged (homeworks are not exams

  1. Derivations of Marcus's formula G.F. Bertsch1

    E-Print Network [OSTI]

    Bertsch George F.

    Derivations of Marcus's formula G.F. Bertsch1 1 Institute for Nuclear Theory and Dept. of Physics, University of Washington, Seattle, Washington Abstract Two derivations of Marcus's formula for transition rates are presented. The first derivation is based on the Landau-Zener transition rate formula

  2. Biomass-Derived Energy Products and Co-Products Market

    E-Print Network [OSTI]

    Biomass-Derived Energy Products and Co-Products Market This report identifies the bio-fuels and co & Earth Science & Technology ­ University of Hawai`i at Manoa #12;Biomass-Derived Energy Products and Co agency thereof. #12;Biomass Derived Energy Products and Co- Products Market and Off-take Study Hawaii

  3. Carbohydrate-derived aminoalcohol ligands for asymmetric Reformatsky reactions

    E-Print Network [OSTI]

    Davis, Ben G.

    Carbohydrate-derived aminoalcohol ligands for asymmetric Reformatsky reactions Daniel P. G of functionally and stereochemically diverse DD-glucosamine-derived tertiary aminoalcohol ligands have been used bromoacetate-3 and difluorobromoacetate4 -derived Reformatsky reagents 2a­c (Scheme 1). A general, enan

  4. RNA Interference: Endogenous siRNAs Derived from Transposable

    E-Print Network [OSTI]

    Jiggins, Francis

    RNA Interference: Endogenous siRNAs Derived from Transposable Elements The Piwi-interacting RNARNAs are about 22 nt long, are derived from host-expressed fold-back structures, and associate primarily with Ago1 [5]. Conversely, antiviral siRNAs (viRNAs), are about 21 nt, are derived from double

  5. Groups of Autoequivalences of Derived Categories of Smooth Projective Varieties

    E-Print Network [OSTI]

    Ploog, David

    Groups of Autoequivalences of Derived Categories of Smooth Projective Varieties David Ploog #12;#12;Contents Introduction 4 Notation 6 1 Generalities on Fourier-Mukai transforms 7 1.1 Derived actions and derived categories 38 3.1 Linearisations for finite groups

  6. Satellite Products and Services Review Board ATBD: Satellite-Derived

    E-Print Network [OSTI]

    Miami, University of

    Satellite Products and Services Review Board ATBD: Satellite-Derived Ocean Heat Content Version 1.0 July 2012 ___________________________________ #12;NOAA /RSMAS ATBD : Satellite-Derived Ocean Heat/STAR) #12;NOAA /RSMAS ATBD : Satellite-Derived Ocean Heat Content Product Page 3 of 32 TABLE OF CONTENTS

  7. COVERING THEORY FOR LINEAR CATEGORIES WITH APPLICATION TO DERIVED CATEGORIES

    E-Print Network [OSTI]

    Liu, Shiping

    COVERING THEORY FOR LINEAR CATEGORIES WITH APPLICATION TO DERIVED CATEGORIES RAYMUNDO BAUTISTA-Schmidt categories preserves irreducible morphisms and almost splits sequences. Specializing to derived categories between the bounded derived categories of finite dimensional modules. As an application, we show that each

  8. Managing Derived Data in the Gaea Scientific DBMS \\Lambda

    E-Print Network [OSTI]

    Ward, Matthew

    Managing Derived Data in the Gaea Scientific DBMS \\Lambda Nabil I. Hachem, Ke Qiu, Michael Gennert, precision). One kind of metadata which needs spe­ cial attention is the data derivation information, i, and derivation. While the spatial and temporal extents have been studied and formal semantics to those extents

  9. Prediction of Transposable Element Derived Enhancers Using Chromatin Modification Profiles

    E-Print Network [OSTI]

    Jordan, King

    Prediction of Transposable Element Derived Enhancers Using Chromatin Modification Profiles Ahsan enhancers derived from transposable element (TE) sequences. To do this, a computational approach was taken hematopoietic cell types, GM12878 and K562. We predicted the locations of 2,107 and 1,448 TE-derived enhancers

  10. Primary version Derived equivalences and almost D-split sequences

    E-Print Network [OSTI]

    Xi, Changchang

    Primary version Derived equivalences and almost D-split sequences Wei Hu and Changchang Xi School introduce almost D-split sequences and provide several new methods to construct derived equivalences. In particular, we obtain derived equivalences from Auslander-Reiten sequences (or n-almost split sequences

  11. Leakage-Resilient Cryptography with Key Derived from Sensitive Data

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Leakage-Resilient Cryptography with Key Derived from Sensitive Data Konrad Durnoga , Tomasz Kazana subject to adversarial leakage. We propose a method to derive keys for such protocols on-the-fly from the actual keys are derived from. That is, an adversary can hardly gain any knowledge about the private data

  12. ORIGINAL PAPER Comparing land surface phenology derived from satellite

    E-Print Network [OSTI]

    Small, Eric

    ORIGINAL PAPER Comparing land surface phenology derived from satellite and GPS network microwave, a normalized mi- crowave reflectance index (NMRI) derived from GPS base station measurements is sensitive, and their derived SOS metrics for a subset of 24 homogenous land cover sites to investigate VOD and NMRI

  13. Selection and comparative analysis of novel prostate carcinoma dissemination variants : roles in metastasis of tumor-derived pro-uPA and neutrophil-derived MMP-9

    E-Print Network [OSTI]

    Bekes, Erin Marie

    2010-01-01

    of Metastasis Variants Derived from Human Prostate Carcinomaof Metastasis Variants Derived from Human Prostate Carcinomaof Metastasis Variants Derived from Human Prostate Carcinoma

  14. Phys. Med. Biol. 43 (1998) 24072412. Printed in the UK PII: S0031-9155(98)90934-4 Effects of read-out light sources and ambient light on

    E-Print Network [OSTI]

    Yu, Peter K.N.

    1998-01-01

    laser, light emitting diode (LED) and incandescent read-out light sources produce an equivalent dose

  15. Jet flames of a refuse derived fuel

    SciTech Connect (OSTI)

    Weber, Roman; Kupka, Tomasz; Zajac, Krzysztof

    2009-04-15

    This paper is concerned with combustion of a refuse derived fuel in a small-scale flame. The objective is to provide a direct comparison of the RDF flame properties with properties of pulverized coal flames fired under similar boundary conditions. Measurements of temperature, gas composition (O{sub 2}, CO{sub 2}, CO, NO) and burnout have demonstrated fundamental differences between the coal flames and the RDF flames. The pulverized coals ignite in the close vicinity of the burner and most of the combustion is completed within the first 300 ms. Despite the high volatile content of the RDF, its combustion extends far into the furnace and after 1.8 s residence time only a 94% burnout has been achieved. This effect has been attributed not only to the larger particle size of fluffy RDF particles but also to differences in RDF volatiles if compared to coal volatiles. Substantial amounts of oily tars have been observed in the RDF flames even though the flame temperatures exceeded 1300 C. The presence of these tars has enhanced the slagging propensity of RDF flames and rapidly growing deposits of high carbon content have been observed. (author)

  16. Derivation of dose conversion factors for tritium

    SciTech Connect (OSTI)

    Killough, G. G.

    1982-03-01

    For a given intake mode (ingestion, inhalation, absorption through the skin), a dose conversion factor (DCF) is the committed dose equivalent to a specified organ of an individual per unit intake of a radionuclide. One also may consider the effective dose commitment per unit intake, which is a weighted average of organ-specific DCFs, with weights proportional to risks associated with stochastic radiation-induced fatal health effects, as defined by Publication 26 of the International Commission on Radiological Protection (ICRP). This report derives and tabulates organ-specific dose conversion factors and the effective dose commitment per unit intake of tritium. These factors are based on a steady-state model of hydrogen in the tissues of ICRP's Reference Man (ICRP Publication 23) and equilibrium of specific activities between body water and other tissues. The results differ by 27 to 33% from the estimate on which ICRP Publication 30 recommendations are based. The report also examines a dynamic model of tritium retention in body water, mineral bone, and two compartments representing organically-bound hydrogen. This model is compared with data from human subjects who were observed for extended periods. The manner of combining the dose conversion factors with measured or model-predicted levels of contamination in man's exposure media (air, drinking water, soil moisture) to estimate dose rate to an individual is briefly discussed.

  17. Spin Wave Diffraction Control and Read-out with a Quantum Memory for Light

    E-Print Network [OSTI]

    Gabriel Hétet; David Guéry-Odelin

    2015-01-06

    A scheme for control and read-out of diffracted spins waves to propagating light fields is presented. Diffraction is obtained via sinusoidally varying lights shifts and ideal one-to-one mapping to light is realized using a gradient echo quantum memory. We also show that dynamical control of the diffracted spin waves spatial orders can be implemented to realize a quantum pulse sequencer for temporal modes that have high time-bandwidth products. Full numerical solutions suggest that both co-propagating and couterpropagating light shift geometries can be used, making the proposal applicable to hot and cold atomic vapours as well as solid state systems with two-level atoms.

  18. Hours of service Reading week March 3rd -7th, 2014

    E-Print Network [OSTI]

    Kambhampati, Patanjali

    Hours of service Reading week March 3rd -7th, 2014 www.mcgill.ca/foodservices Residential Dining Halls Monday-Friday March 3rd -7th Week-end March 8th and 9th Bishop Mountain Hall March 1st and 2nd 10:00 am-2:00 pm March 3rd-7th 10:00 am-2:00 pm 5:00 pm-7:00 pm March 8th 10:00 am-2:00 pm March 9th

  19. A review of "Reading Early Modern Women’s Writing" by Paul Salzman 

    E-Print Network [OSTI]

    Campbell, Julie D.

    2008-01-01

    r e v i e w s 193 There is much in these writings to interest social historians too. Anne records details of domestic affairs, including references to beauty, clothes, pregnancy and childbirth, and the management of her servants, but also....00. Review by Ju l i e D Ca m p b e l l , ea s t e r n il l i n o i s un i v e r s i t y . Salzman?s study of the history of reading early modern English women?s writing has two key features: it provides a general overview of the women writers who...

  20. Microsoft PowerPoint - EM SSAB Chairs Webinar - (3) Tyborowski Presentation.042213 [Read-Only]

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (BillionProvedTravelInformation Resources»Jim ManionBrochure MediationMichael[Read-Only] |Chairs'4

  1. 3rd Reading April 20, 2006 16:56 WSPC/SPI-B368 Advances in Geosciences Vol. 5 ch11

    E-Print Network [OSTI]

    Oke, Peter

    3rd Reading April 20, 2006 16:56 WSPC/SPI-B368 Advances in Geosciences Vol. 5 ch11 #12;3rd Reading and Prediction System (OceanMAPS) for operational implementation at the Bureau of Meteorology (Bureau). 87 #12;3rd Reading April 20, 2006 16:56 WSPC/SPI-B368 Advances in Geosciences Vol. 5 ch11 88 G. B

  2. Identification and characterization of Kaposi's sarcoma-associated herpesvirus open reading frame 11 promotor activation

    SciTech Connect (OSTI)

    Chen, Lei [Los Alamos National Laboratory

    2008-01-01

    Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Core promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.

  3. Nanoscale Reinforced, Polymer Derived Ceramic Matrix Coatings

    SciTech Connect (OSTI)

    Rajendra Bordia

    2009-07-31

    The goal of this project was to explore and develop a novel class of nanoscale reinforced ceramic coatings for high temperature (600-1000 C) corrosion protection of metallic components in a coal-fired environment. It was focused on developing coatings that are easy to process and low cost. The approach was to use high-yield preceramic polymers loaded with nano-size fillers. The complex interplay of the particles in the polymer, their role in controlling shrinkage and phase evolution during thermal treatment, resulting densification and microstructural evolution, mechanical properties and effectiveness as corrosion protection coatings were investigated. Fe-and Ni-based alloys currently used in coal-fired environments do not possess the requisite corrosion and oxidation resistance for next generation of advanced power systems. One example of this is the power plants that use ultra supercritical steam as the working fluid. The increase in thermal efficiency of the plant and decrease in pollutant emissions are only possible by changing the properties of steam from supercritical to ultra supercritical. However, the conditions, 650 C and 34.5 MPa, are too severe and result in higher rate of corrosion due to higher metal temperatures. Coating the metallic components with ceramics that are resistant to corrosion, oxidation and erosion, is an economical and immediate solution to this problem. Good high temperature corrosion protection ceramic coatings for metallic structures must have a set of properties that are difficult to achieve using established processing techniques. The required properties include ease of coating complex shapes, low processing temperatures, thermal expansion match with metallic structures and good mechanical and chemical properties. Nanoscale reinforced composite coatings in which the matrix is derived from preceramic polymers have the potential to meet these requirements. The research was focused on developing suitable material systems and processing techniques for these coatings. In addition, we investigated the effect of microstructure on the mechanical properties and oxidation protection ability of the coatings. Coatings were developed to provide oxidation protection to both ferritic and austentic alloys and Ni-based alloys. The coatings that we developed are based on low viscosity pre-ceramic polymers. Thus they can be easily applied to any shape by using a variety of techniques including dip-coating, spray-coating and painting. The polymers are loaded with a variety of nanoparticles. The nanoparticles have two primary roles: control of the final composition and phases (and hence the properties); and control of the shrinkage during thermal decomposition of the polymer. Thus the selection of the nanoparticles was the most critical aspect of this project. Based on the results of the processing studies, the performance of selected coatings in oxidizing conditions (both static and cyclic) was investigated.

  4. Writing for the Web--Some Guidelines Recommended reading: Letting Go of the Words: Writing Web Content that Works by Janice

    E-Print Network [OSTI]

    Cantlon, Jessica F.

    Writing for the Web--Some Guidelines Recommended reading: Letting Go of the Words: Writing Web Content that Works by Janice (Ginny) Redish Web content

  5. Massive Gravity from Higher Derivative Gravity with Boundary Conditions

    E-Print Network [OSTI]

    Minjoon Park; Lorenzo Sorbo

    2012-10-29

    With an appropriate choice of parameters, a higher derivative theory of gravity can describe a normal massive sector and a ghost massless sector. We show that, when defined on an asymptotically de Sitter spacetime with Dirichlet boundary conditions, such a higher derivative gravity can provide a framework for a unitary theory of massive gravity in four spacetime dimensions. The resulting theory is free not only of higher derivative ghosts but also of the Boulware-Deser mode.

  6. Convergence of derivative expansions in scalar field theory

    E-Print Network [OSTI]

    Tim R. Morris; John F. Tighe

    2001-02-06

    The convergence of the derivative expansion of the exact renormalisation group is investigated via the computation of the beta function of massless scalar lambda phi^4 theory. The derivative expansion of the Polchinski flow equation converges at one loop for certain fast falling smooth cutoffs. Convergence of the derivative expansion of the Legendre flow equation is trivial at one loop, but also can occur at two loops and in particular converges for an exponential cutoff.

  7. Methods for deoxygenating biomass-derived pyrolysis oil

    DOE Patents [OSTI]

    Brandvold, Timothy A.

    2015-07-14

    Methods for deoxygenating a biomass-derived pyrolysis oil are provided. A method comprising the steps of diluting the biomass-derived pyrolysis oil with a phenolic-containing diluent to form a diluted pyoil-phenolic feed is provided. The diluted pyoil-phenolic feed is contacted with a deoxygenating catalyst in the presence of hydrogen at hydroprocessing conditions effective to form a low-oxygen biomass-derived pyrolysis oil effluent.

  8. Palladium-Catalyzed Asymmetric Dearomatization of Naphthalene Derivatives

    E-Print Network [OSTI]

    Kessler, Florian

    An intramolecular enantioselective metal-catalyzed dearomatization reaction is described. This procedure allows the dearomatization of naphthalene derivatives through an electrophilic aromatic substitution-type reaction ...

  9. MA 16020 – EXAM FORMULAS THE SECOND DERIVATIVE TEST ...

    E-Print Network [OSTI]

    2015-10-21

    MA 16020 – EXAM FORMULAS. THE SECOND DERIVATIVE TEST. Suppose f is a function of two variables x and y, and that all the second-order partial ...

  10. Explore the Genetic Frontier: Labeling Foods Derived from Biotechnology 

    E-Print Network [OSTI]

    Vestal, Andy; Hawkins, Carole

    2002-10-19

    Today's food labels provide consumers with nutrition information. This publication discusses the content of labels on foods derived from biotechnology and the agencies that regulate such labeling....

  11. Agenda for the Derived Liquids to Hydrogen Distributed Reforming...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Reforming Targets Bio-Derived Liquids to Hydrogen Distributed Reforming Working Group (BILIWG) Kick-Off Meeting Proceedings Hilton Garden Inn-BWI,Baltimore, MD October 24, 2006...

  12. Bio-Derived Liquids to Hydrogen Distributed Reforming Targets

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation by Arlene Anderson at the October 24, 2006 Bio-Derived Liquids to Hydrogen Distributed Reforming Working Group Kick-Off Meeting.

  13. Methods for deoxygenating biomass-derived pyrolysis oil

    DOE Patents [OSTI]

    Baird, Lance Awender; Brandvold, Timothy A.

    2015-06-30

    Methods for deoxygenating a biomass-derived pyrolysis oil are provided. A method for deoxygenating a biomass-derived pyrolysis oil comprising the steps of combining a biomass-derived pyrolysis oil stream with a heated low-oxygen-pyoil diluent recycle stream to form a heated diluted pyoil feed stream is provided. The heated diluted pyoil feed stream has a feed temperature of about 150.degree. C. or greater. The heated diluted pyoil feed stream is contacted with a first deoxygenating catalyst in the presence of hydrogen at first hydroprocessing conditions effective to form a low-oxygen biomass-derived pyrolysis oil effluent.

  14. Low-Emissions Burner Technology using Biomass-Derived Liquid...

    Broader source: Energy.gov (indexed) [DOE]

    biomass-derived liquid fuels, such as glycerin or fatty acids, as a substitute for natural gas. low-emissionsburnertechnologyfactsheet.pdf More Documents & Publications...

  15. Exploring Hydrogen Generation from Biomass-Derived Sugar and...

    Broader source: Energy.gov (indexed) [DOE]

    at Virent, Inc. in Madison developed new cost-effective methods to produce hydrogen from renewable resources like biomass-derived sugar and sugar alcohols. Hydrogen can...

  16. Phenylnaphthalene Derivatives as Heat Transfer Fluids for Concentratin...

    Office of Scientific and Technical Information (OSTI)

    Report: Phenylnaphthalene Derivatives as Heat Transfer Fluids for Concentrating Solar Power: Loop Experiments and Final Report Citation Details In-Document Search Title:...

  17. The Inverse Problem for Derivative Securities of Interest Rate

    E-Print Network [OSTI]

    2008-02-02

    May 26, 2000 ... Following the general method for derivative security pricing 1], we get the partial differential equation for a zero-coupon bond in the form. @V.

  18. Bio-Derived Liquids to Hydrogen Distributed Reforming Working...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Purification Working Group (PURIWG) & Hydrogen Production Technical Team Bio-Derived Liquids to Hydrogen Distributed Reforming Working Group (BILIWG), Hydrogen Separation...

  19. Production of Chemical Derivatives from Renewables

    SciTech Connect (OSTI)

    Davison, Brian; Nghiem, John; Donnelly, Mark; Tsai, Shih-Perng; Frye, John; Landucci, Ron; Griffin, Michael

    1996-06-01

    The purpose of this Cooperative Research and Development Agreement (CRADA) between Lockheed Martin Energy Research Corp., (LMER), Argonne National Laboratory (ANL), National Renewable Energy Laboratory (NREL), and Battelle Memorial Institute, operator of Pacific Northwest National Laboratory (PNNL), (collectively referred to as the 'Contractor'), and Applied Carbochemicals, Inc. (Participant) was to scale-up from bench results an economically promising and competitive process for the production of chemical derivatives from biologically produced succinic acid. The products that were under consideration for production from the succinic acid platform included 1,4-butanediol, {gamma}y-butyrolactone, 2-pyrrolidinone and N-methyl pyrrolidinone. Preliminary economic analyses indicated that this platform was competitive with the most recent petrochemical routes. The Contractors and participant are hereinafter jointly referred to as the 'Parties.' Research to date in succinic acid fermentation, separation and genetic engineering resulted in a potentially economical process based on the use of an Escherichia coli strain AFP111 with suitable characteristics for the production of succinic acid from glucose. Economic analysis has shown that higher value commodity chemicals can be economically produced from succinic acid based on preliminary laboratory findings and predicted catalytic parameters. At the time, the current need was to provide the necessary laboratory follow-up information to properly optimize, design and operate a pilot scale process. The purpose of the pilot work was to validate the integrated process, assure 'robustness' of the process, define operating conditions, and provide samples for potential customer evaluation. The data from the pilot scale process was used in design and development of a full scale production facility. A new strain, AFP111 (patented), discovered at ANL was tested and developed for process use at the Oak Ridge National Laboratory (ORNL) and ANL. The operability and product formation are attractive for this strain and effort was being directed at process development and optimization. Key to the transition from the fermentative production unit operation to the chemical catalysis is the 'clean-up' of fermentation broth, succinic acid formation from the salt, and succinic acid concentration. These steps are accomplished by a two-stage membrane ED separation process developed at AWL. Although the current process is well developed, possible modifications and optimization may be called for as development work continues in both the fermentation and catalysis areas. Research to date performed at PNNL has demonstrated that succinic acid can be converted to value added chemicals such as 1,4-butanediol, {gamma}-butyrolactone, N-methyl pyrrolidinone, and 2 pyrrolidinone with high conversion and selectivities. Continued research will be performed in catalyst development and reaction condition optimization to move this work from the bench scale to the pilot scale. All development of the process was guided by the NREL technoeconomic model. The model showed that direct aqueous phase catalysis of succinic acid to 1,4-butanediol, {gamma}-butyrolactone, and N-methyl pyrrolidinone provided significant economical advantages in the market, the margin, and the return on capital investment over existing petrochemical processes for production of these compounds. The model also provided the baseline for evaluating current laboratory research. As data from the bench and pilot work were made available the model was modified and appropriate sensitivities ran to determine impact of the process changes and optimization. The report will present the planned CRADA tasks followed by the results. The results section has an overall project summary follwed by more detailed reports from the participants. This is a nonproprietary report; additional proprietary information may be made available subject to acceptance of the appropriate proprietary information agreements.

  20. A review of "New World, Known World: Shaping Knowledge in Early Anglo-American Writing." by David Read

    E-Print Network [OSTI]

    Scheick, William J.

    2007-01-01

    , and provide a brief comparison and contrast of Bacon?s and Cavendish?s literary style in order ?to gain insight into each author?s conception of the human condition? (159); finally and similarly, by reading The Blazing World together with John Milton?s... as I began: The major premise of Rebecca Totaro?s Suffering in Paradise: The Bubonic Plague in English Literature from More to Milton is intriguing. David Read. New World, Known World: Shaping Knowledge in Early Anglo-American Writing. Columbia...

  1. Activation of the retina's regenerative potential by embryonic stem cell-derived microvesicles

    E-Print Network [OSTI]

    Katsman, Diana

    2012-01-01

    2012) Embryonic stem cell-derived microvesicles induce geneby embryonic stem cell-derived microvesicles induces changesby embryonic stem cell derived-microvesicles induces

  2. Development and potential of HMGB1-derived immunostimulatory peptides as adjuvants in cancer immunotherapy

    E-Print Network [OSTI]

    Saenz, Rebecca Kathleen

    2011-01-01

    Dendritic Cells by an HMGB1- Derived Peptide Adjuvant” 2011,The activity of the HMGB1-derived immunostimulatory peptidemodifier. * This table is derived from material found in

  3. Coastal Ocean Studies in Southern San Diego Using High-Frequency Radar Derived Surface Currents

    E-Print Network [OSTI]

    Kim, Sung Yong

    2009-01-01

    high-frequency radar derived surface current measured andcoastal region Chapter 5 derived surface current by viib) vector current map derived from HF radars in southern San

  4. Adipose-Derived Perivascular Stem Cells Heal Critical Size Mouse Calvarial Defects

    E-Print Network [OSTI]

    Megerdichian, Silva

    2013-01-01

    stromal  cells  derived  from  the  infrapatellar  fat  C.  M.   et  al.  Adipose-­?derived  adult  stromal  cells  Human  bone  marrow-­? derived  mesenchymal  stem  cells  

  5. Host resistance and pathogen-derived hormone affect the outcome of a fungal-plant interaction

    E-Print Network [OSTI]

    Cole, Stephanie Joy

    2012-01-01

    resistance and pathogen-derived hormone affect the outcomeresistance and pathogen-derived hormone affect the outcomemetabolites. These pathogen-derived hormones can alter plant

  6. The role of brain-derived neurotrophic factor in cortical motor learning

    E-Print Network [OSTI]

    Von dem Bussche, Mary

    2007-01-01

    T. , and Nakamura, S. , Brain-derived neurotrophic factor-dependent transfer of brain-derived neurotrophic factor toneurotrophic factors brain-derived neurotrophic factor and

  7. Generation of Cardiomyocytes from Human Endogenous and Pluripotent Stem-Cell Derived Endothelial Cells

    E-Print Network [OSTI]

    Truong, Raymond

    2013-01-01

    Embryonic Stem Cell Lines Derived from Human Blastocysts.Human Embryonic Stem Cell-Derived Oligodendrocyte ProgenitorPluripotent Stem Cell-Derived Cardiovascular Progenitor

  8. Bacterial artificial chromosome derived simian varicella virus is pathogenic in vivo

    E-Print Network [OSTI]

    2013-01-01

    E: Regulation of macrophage-derived chemokine (MDC, CCL22)artificial chromosome derived simian varicella virus isartificial chromosome derived simian varicella virus is

  9. Brain-derived neurotrophic factor rescues synaptic plasticity in a mouse model of fragile X syndrome.

    E-Print Network [OSTI]

    2007-01-01

    in mice lacking brain- derived neurotrophic factor. Procterm potentiation by brain- derived neurotrophic factor. JCM, Simmons DA (2007b) Brain-derived neurotrophic factor

  10. Seed Packaging and Seed Characteristics in a Raphanus Hybrid-Derived Lineage

    E-Print Network [OSTI]

    Heredia, Sylvia Margarita

    2012-01-01

    reproduction in the hybrid-derived invasive, California wildreproduction in the hybrid-derived invasive, California wildreproduction in the hybrid-derived invasive, California wild

  11. AMPA receptor-induced local brain-derived neurotrophic factor signaling mediates motor recovery after stroke.

    E-Print Network [OSTI]

    Clarkson, Andrew N; Overman, Justine J; Zhong, Sheng; Mueller, Rudolf; Lynch, Gary; Carmichael, S Thomas

    2011-01-01

    polymorphism in the brain-derived neurotrophic factor gene (Chronic elevation of brain-derived neurotrophic factor bysustained increases in brain-derived neurotrophic fac- tor

  12. Biosynthetic investigations of ansamycin natural products from marine-derived actinomycetes

    E-Print Network [OSTI]

    Wilson, Micheal Christopher

    2011-01-01

    metabolite from marine-derived Streptomyces sp. NTK 227. Jfrom Australian marine- derived and terrestrial Streptomyces3-hydroxy-3-methylproline derived from isoleucine. J Chem

  13. Another Look at Velar Deletion in Turkish, with Special Attention to the Derived Environment Condition

    E-Print Network [OSTI]

    Inkelas, Sharon

    2009-01-01

    Paul. 1993. Blocking in non-derived environments. PhoneticsPress. Lubowicz, Anna. 2002. Derived environment effects inHall, T. Alan. 2006. Derived environment blocking effects in

  14. Coastal ocean studies in southern San Diego using high- frequency radar derived surface currents

    E-Print Network [OSTI]

    Kim, Sung Yong

    2009-01-01

    high-frequency radar derived surface current measured andcoastal region Chapter 5 derived surface current by viib) vector current map derived from HF radars in southern San

  15. Naturally derived myocardial matrix as an injectable scaffold for cardiac repair

    E-Print Network [OSTI]

    Singelyn, Jennifer Marie

    2010-01-01

    and others. Cardiomyocytes derived from human embryonic stemhydrogel helps bone marrow-derived mononuclear cells restoredelivery of platelet-derived growth factor improves

  16. THE GENERATING HYPOTHESIS IN THE DERIVED CATEGORY OF A RING

    E-Print Network [OSTI]

    Hovey, Mark

    THE GENERATING HYPOTHESIS IN THE DERIVED CATEGORY OF A RING MARK HOVEY, KEIR LOCKRIDGE, AND GENA PUNINSKI Abstract. We show that a strong form (the fully faithful version) of the generating hypothesis the original form (the faithful version) of the generating hypothesis holds in the derived category of R

  17. The derivative expansion approach to the interaction between close surfaces

    E-Print Network [OSTI]

    C. D. Fosco; F. C. Lombardo; F. D. Mazzitelli

    2014-06-18

    The derivative expansion approach to the calculation of the interaction between two surfaces, is a generalization of the proximity force approximation, a technique of widespread use in different areas of physics. The derivative expansion has so far been applied to seemingly unrelated problems in different areas; it is our principal aim here to present the approach in its full generality. To that end, we introduce an unified setting, which is independent of any particular application, provide a formal derivation of the derivative expansion in that general setting, and study some its properties. With a view on the possible application of the derivative expansion to other areas, like nuclear and colloidal physics, we also discuss the relation between the derivative expansion and some time-honoured uncontrolled approximations used in those contexts. By putting them under similar terms as the derivative expansion, we believe that the path is open to the calculation of next to leading order corrections also for those contexts. We also review some results obtained within the derivative expansion, by applying it to different concrete examples and highlighting some important points.

  18. BPS States in Supersymmetric Chiral Models with Higher Derivative Terms

    E-Print Network [OSTI]

    Muneto Nitta; Shin Sasaki

    2014-11-04

    We study the higher derivative chiral models with four supercharges and BPS states in these models. The off-shell Lagrangian generically includes higher powers of the auxiliary fields F which causes distinct on-shell branches associated with the solutions to the auxiliary fields equation. We point out that the model admits a supersymmetric completion of arbitrary higher derivative bosonic models of a single complex scalar field and an arbitrary scalar potential can be introduced even without superpotentials. As an example, we present a supersymmetric extension of the Faddeev-Skyrme model without four time derivatives, in contrast to the previously proposed supersymmetric Faddeev-Skyrme-like model containing four time derivatives. In general, higher derivative terms together with a superpotential result in deformed scalar potentials. We find that higher derivative corrections to 1/2 BPS domain walls and 1/2 BPS lumps are exactly canceled out while the 1/4 BPS lumps (as compact baby Skyrmions) depend on a characteristic feature of the higher derivative models. We also find a new 1/4 BPS condition for domain wall junctions which generically receives higher derivative corrections.

  19. Optimal design of derivatives in illiquid market: an alternative approach

    E-Print Network [OSTI]

    Vargiolu, Tiziano

    Optimal design of derivatives in illiquid market: an alternative approach Grazia De Silvestro introduced by Barrieu and El Karoui in [1, 2] for the design of derivatives in illiquid markets. Its in a financial market. In the case when the utility and the loss functions are exponential, we characterise

  20. Designing Agents for Derivatives Markets: a preliminary framework

    E-Print Network [OSTI]

    McBurney, Peter

    Designing Agents for Derivatives Markets: a preliminary framework Omar Baqueiro Espinosa, Wiebe van framework for a model of agents which are able to trade in futures and options derivatives markets. We design a basic logical model for the exchange process and extend it to depict futures and options

  1. Optimal design of derivatives in illiquid market: an alternative approach

    E-Print Network [OSTI]

    Vargiolu, Tiziano

    Optimal design of derivatives in illiquid market: an alternative approach #3; Grazia De Silvestro in a #12;nancial market. In the case when the utility and the loss functions are exponential, we the new approach introduced by Barrieu and El Karoui in [1, 2] for the design of derivatives in illiquid

  2. Carbohydrate Derived-Pseudo-Lignin Can Retard Cellulose Biological Conversion

    E-Print Network [OSTI]

    California at Riverside, University of

    ARTICLE Carbohydrate Derived-Pseudo-Lignin Can Retard Cellulose Biological Conversion Rajeev Kumar derived pseudo-lignin on cellulose conversion at the moderate to low enzyme loadings necessary for favorable economics, dilute acid pretreatment of Avicel cellulose alone and mixed with beechwood xylan

  3. On Termination and Derivation Lengths for Ground Rewrite Systems

    E-Print Network [OSTI]

    Giesl, Juergen

    On Termination and Derivation Lengths for Ground Rewrite Systems Dieter Hofbauer 1 Universit¨at GH@theory.informatik.uni­kassel.de Abstract. It is shown that for terminating ground term rewrite systems the length of derivations a suitable interpretation into the natural numbers. Terminating ground systems are not necessarily

  4. PSERC 98-21 "Analytic and Experimentally-Derived

    E-Print Network [OSTI]

    PSERC 98-21 "Analytic and Experimentally-Derived Estimates of Market Power in Deregulated, January 5-8, 1999nd "Analytic and Experimentally-Derived Estimates of Market Power in Deregulated constraints or load characteristics, or retail customers facing suppliers or marketing agents having more than

  5. NOVEL SLURRY PHASE DIESEL CATALYSTS FOR COAL-DERIVED SYNGAS

    SciTech Connect (OSTI)

    Dr. Dragomir B. Bukur; Dr. Ketil Hanssen; Alec Klinghoffer; Dr. Lech Nowicki; Patricia O'Dowd; Dr. Hien Pham; Jian Xu

    2001-01-07

    This report describes research conducted to support the DOE program in novel slurry phase catalysts for converting coal-derived synthesis gas to diesel fuels. The primary objective of this research program is to develop attrition resistant catalysts that exhibit high activities for conversion of coal-derived syngas.

  6. An alternative derivation of Einstein's Doppler shift and aberration formulae

    E-Print Network [OSTI]

    Jean Reignier

    2009-02-06

    I propose an alternative, purely kinematical, derivation of Einstein's Doppler formula. It is valid for periodic signals of any shape that propagate with the velocity of light. The formula is asymptotic in a parameter proportional to the relative variation of the distance source-receiver during one period. As a by-product, I also derive an alternative proof of Einstein's aberration formulae.

  7. Non-Derivable Itemset Mining Toon Calders and Bart Goethals

    E-Print Network [OSTI]

    Antwerpen, Universiteit

    .calders,bart.goethals}@ua.ac.be University of Antwerp, Belgium Abstract All frequent itemset mining algorithms rely heavily on the monotonicNon-Derivable Itemset Mining Toon Calders and Bart Goethals {toon-derivable itemsets a useful and tractable alternative to mining all frequent itemsets. Keywords: Data mining

  8. PRICING PRECIPITATION BASED DERIVATIVES RENE CARMONA AND PAVEL DIKO

    E-Print Network [OSTI]

    Carmona, Rene

    PRICING PRECIPITATION BASED DERIVATIVES REN´E CARMONA AND PAVEL DIKO ABSTRACT. We consider the problem of pricing a derivative contract written on the precipitation at a specific location during of the underlying precipitation. Our model is based on pulse Poisson process models widely used in hydrology. We

  9. Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs

    E-Print Network [OSTI]

    Mandal, Debabrata

    Most archaea and bacteria use a modified C in the anticodon wobble position of isoleucine tRNA to base pair with A but not with G of the mRNA. This allows the tRNA to read the isoleucine codon AUA without also reading the ...

  10. A Publication of the Haskins Literacy Initiative Volume 1, Number 1 Summer 2007 ore than half of 4th graders in Connecticut read below grade level,

    E-Print Network [OSTI]

    of 4th graders in Connecticut read below grade level, whatever their race, means or gender, and economically. In Connecticut, forecasts for future prison construction are based on Grade 3 reading failure is being delivered in a growing number of schools in Connecticut--with promising results. Understanding how

  11. Rosalie Wells / Woolf Essay Prize 2013 "It was certainly an odd monster that one made up by reading the historians first and the

    E-Print Network [OSTI]

    Lasenby, Joan

    in a kitchen chopping up suet" What is the benefit of reading history alongside literature and vice versa intense in the 16th and 17th centuries. Reading history alongside literature and vice versa is not merely? Virginia Woolf presented us with the perplexing paradox of women in history in `A room of one's own'; `She

  12. Tumor CellDerived and Macrophage-Derived Cathepsin B Promotes Progression and Lung Metastasis of Mammary Cancer

    E-Print Network [OSTI]

    Bogyo, Matthew

    Tumor Cell­Derived and Macrophage-Derived Cathepsin B Promotes Progression and Lung Metastasis of mammary cancers compared with wild-type PyMT mice. Lung metastasis volumes were significantly reduced in PyMT;ctsb+/À , an effect that was not further enhanced in PyMT;ctsbÀ/À mice. Furthermore, lung

  13. Deep Packet Filter with Dedicated Logic and Read Only Memories Young H. Cho and William H. Mangione-Smith

    E-Print Network [OSTI]

    Cho, Young Hyun

    Deep Packet Filter with Dedicated Logic and Read Only Memories Young H. Cho and William H. Mangione is a computationally expensive task. The speed of the search pattern module determines the overall performance of deep of deep packet filters to detect application level attacks in the packet payloads. Deep packet filters

  14. -Supplementary Material -Electrical read-out of individual nuclear spin trajectories in a single-molecule magnet

    E-Print Network [OSTI]

    . Terbium Double-Decker 1 S3. Nuclear Spin Read-Out 2 S4. Quantum Tunnelling of Magnetization 3 S5. Quantum magnetic field sweeps in three dimensions at field sweep rates up to 0.2 T/s. S2. TERBIUM DOUBLE-DECKER We

  15. Research in Applied Mathematics in the UK The definition of Applied Mathematics employed in the Research Assessment Exercise reads as

    E-Print Network [OSTI]

    Abrahams, I. David

    in the Research Assessment Exercise reads as follows: Applied Mathematics consists of the development of events are significant so that probabilistic formulations and methods are required. In addition, and particle laden gases, with or without phase change), with applications in the oil industry, in studies

  16. Is Your Journal Scholarly? Your professor has asked you to read and cite scholarly or peer-reviewed journals

    E-Print Network [OSTI]

    Hamburger, Peter

    Is Your Journal Scholarly? TIPS: Your professor has asked you to read and cite scholarly or peer-reviewed journals in your research assignment. Databases may include all three type of articles; some library databases have a checkbox to Limit your search to Scholarly, Peer-Reviewed, Refereed or Academic journals

  17. COLORADO STATE UNIVERSITY CSU MOUNTAIN CAMPUS PLEASE READ THIS DOCUMENT COMPLETELY BEFORE SIGNING. ITS EFFECT IS TO RELEASE

    E-Print Network [OSTI]

    Schumacher, Russ

    COLORADO STATE UNIVERSITY ­ CSU MOUNTAIN CAMPUS PLEASE READ THIS DOCUMENT COMPLETELY BEFORE SIGNING MOUNTAIN CAMPUS, AND TO WAIVE ALL CLAIMS FOR DAMAGES OR LOSSES AGAINST THE UNIVERSITY WHICH MAY ARISE FROM University to participate in the First-Year Mountain Experience Outdoor Orientation at the CSU Mountain

  18. Reading achievement of English language learners in 50/50 and 90/10 two-way dual language programs 

    E-Print Network [OSTI]

    Cox, Nano Kathleen

    2009-05-15

    , Espa?ol (CTBS Espa?ol) (CTB/ McGraw-Hill, 1985), which was the Spanish equivalent of the English CAT. Cazabon et al. (1993) found that the English reading and math achievement of English Amigos was very similar to the English comparison students...

  19. An examination of reading levels of pre-service agricultural education teachers and the TExES exam 

    E-Print Network [OSTI]

    Woodward, Carol Ann Cohea

    2009-06-02

    by the researcher and a computerized reading appraisal provided by Taylor Associates. The results from the TExES were evaluated on a pass/fail basis instead of a numerical score. The Pearson product moment correlation coefficient revealed a low but positive...

  20. PLAN OF STUDY (POS) INSTRUCTIONS Read Instructions Before Processing and Submitting the Plan of Study Form (POS)

    E-Print Network [OSTI]

    Virginia Tech

    PLAN OF STUDY (POS) INSTRUCTIONS Read Instructions Before Processing and Submitting the Plan of Study Form (POS) The POS allows electronic signatures from the student, faculty advisor and all this particular form. The electronicPOS is to be submitted to your ECE Graduate Academic Advisor by the deadline

  1. READ AND SIGN THE PARTIAL ASSUMPTION OF RISK ON REVERSE Risk Management 12/2012 Risk Management

    E-Print Network [OSTI]

    Cina, Jeff

    READ AND SIGN THE PARTIAL ASSUMPTION OF RISK ON REVERSE Risk Management 12/2012 Risk Management Conditions of Volunteer Service Please send completed form to the Office of Risk Management: riskmanagement ___________________________________________ (name/title of department supervisor) and the Office of Risk Management, (541) 346-8316, within 24 hours

  2. Logical metonymy resolution in a words-as-cues framework: Evidence from self-paced reading and probe recognition.

    E-Print Network [OSTI]

    Padó, Sebastian

    the icing The baker began spreading the icing). Longer reading times at the target verb position in a high-typicality condition (baker + icing spread) compared to a low-typicality (but still plausible) condition (child + icing AUFTRAGEN / The baker began the icing SPREAD), we obtain an analogous effect of typicality at 100 ms ISI

  3. Supplemental Material ReadMe file: A user's guide for the vitality model with initial Gaussian distribution

    E-Print Network [OSTI]

    Washington at Seattle, University of

    Supplemental Material ReadMe file: A user's guide for the vitality model with initial Gaussian distribution parameter fitting routine and the R functions contained in file vitality.gaussian.R. Ting Li and James J. Anderson University of Washington June 11, 2009 The supplemental R file vitality

  4. STFC Introductory Summer School m.j.owens@reading.ac.uk18 Sept 2012 Solar Variability and

    E-Print Network [OSTI]

    · The climate system · Solar variability · Solar effects on climate ­ Regional and global effects · The futureSTFC Introductory Summer School m.j.owens@reading.ac.uk18 Sept 2012 Solar Variability and Climate in our Sun must cause changes in our climate · But we need to consider (a) The potential for changing

  5. Inflationary models with non-minimally derivative coupling

    E-Print Network [OSTI]

    Yang, Nan; Gong, Yungui

    2015-01-01

    We derive the second order correction to the scalar and tensor spectral tilts for the inflationary models with non-minimally derivative coupling. The non-minimally kinetic coupling to Einstein tensor brings the energy scale in the inflationary models down to be sub-Planckian. In the high friction limit, the Lyth bound is modified with an extra suppression factor, so that the field excursion of the inflaton is sub-Planckian. The inflationary models with non-minimally derivative coupling are more consistent with observations.

  6. Inflationary models with non-minimally derivative coupling

    E-Print Network [OSTI]

    Nan Yang; Qing Gao; Yungui Gong

    2015-04-22

    We derive the second order correction to the scalar and tensor spectral tilts for the inflationary models with non-minimally derivative coupling. The non-minimally kinetic coupling to Einstein tensor brings the energy scale in the inflationary models down to be sub-Planckian. In the high friction limit, the Lyth bound is modified with an extra suppression factor, so that the field excursion of the inflaton is sub-Planckian. The inflationary models with non-minimally derivative coupling are more consistent with observations.

  7. Deriving emissions time series from sparse atmospheric mole fractions

    E-Print Network [OSTI]

    Rigby, Matthew

    A growth-based Bayesian inverse method is presented for deriving emissions of atmospheric trace species from temporally sparse measurements of their mole fractions. This work is motivated by many recent studies that have ...

  8. Demonstration of a Carbonate Fuel Cell on Coal Derived Gas 

    E-Print Network [OSTI]

    Rastler, D. M.; Keeler, C. G.; Chi, C. V.

    1993-01-01

    Several studies indicate that carbonate fuel cell systems have the potential to offer efficient, cost competitive, and environmentally preferred power plants operating on natural gas or coal derived gas (“syn-gas”). To date, however, no fuel cell...

  9. Bio-Derived Liquids to Hydrogen Distributed Reforming Targets

    E-Print Network [OSTI]

    Development Manager, U.S. DOE Office of Energy Efficiency and Renewable Energy Hydrogen, Fuel Cells BILI panel. Bio-Derived Renewable Liquids Dist. Electrolysis Central Wind Electrolysis Biomass Gasification Solar

  10. An alternative derivation of the Minimal massive 3D gravity

    E-Print Network [OSTI]

    Ahmet Baykal

    2014-12-23

    By using the algebra of exterior forms and the first order formalism with constraints, an alternative derivation of the field equations for the Minimal massive 3D gravity model is presented.

  11. Sol-gel-derived Epitaxial Nanocomposite Thin Films with Large...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sol-gel-derived Epitaxial Nanocomposite Thin Films with Large Sharp Magnetoelectric Effect Home Author: B. Liu, T. Sun, J. He, V. P. Dravid Year: 2010 Abstract: Nanostructures of...

  12. Derivation of the Camassa-Holm equations for elastic waves

    E-Print Network [OSTI]

    H. A. Erbay; S. Erbay; A. Erkip

    2015-02-10

    In this paper we provide a formal derivation of both the Camassa-Holm equation and the fractional Camassa-Holm equation for the propagation of small-but-finite amplitude long waves in a nonlocally and nonlinearly elastic medium. We first show that the equation of motion for the nonlocally and nonlinearly elastic medium reduces to the improved Boussinesq equation for a particular choice of the kernel function appearing in the integral-type constitutive relation. We then derive the Camassa-Holm equation from the improved Boussinesq equation using an asymptotic expansion valid as nonlinearity and dispersion parameters tend to zero independently. Our approach follows mainly the standard techniques used widely in the literature to derive the Camassa-Holm equation for shallow water waves. The case where the Fourier transform of the kernel function has fractional powers is also considered and the fractional Camassa-Holm equation is derived using the asymptotic expansion technique.

  13. Tolman temperature once again: A derivation from gravitational surface action

    E-Print Network [OSTI]

    Majhi, Bibhas Ranjan

    2015-01-01

    The temperature distribution in presence of gravity, as measured by a local observer, is given by the Tolman expression. Here I derive the same only from the Gibbon's-Hawking-York surface term. In this process no explicit use of Einstein's equations of motion is done. Therefore, the present one is an off-shell analysis. Finally I discuss the importance and various implications of the derivation.

  14. Simple derivation from postulates of generalized vacuum Maxwell equations

    E-Print Network [OSTI]

    Chun Wa Wong

    2013-05-11

    The two postulates of special relativity plus the postulates of conserved charges, both electric and magnetic, and a resulting linear system are sufficient for the derivation of the generalized vacuum Maxwell equations with both charges. The derivative admits another set of Maxwell equations for charges that are the opposite-parity partners of the usual electric and magnetic charges. These new charges and their photons are parts of the parallel universe of dark matter.

  15. Intake retention functions and derived investigation levels for selected radioelements 

    E-Print Network [OSTI]

    Buitron Sanchez, Susana

    1990-01-01

    , Sr. (Chair of Committee) Milton . McLain (Member) Wesl E. Bolch (Member) Dan ightower (Member) ohn W. oston, Sr (Department Head) August 1990 ABSTRACT Intake Retention Functions and Derived Investigation Levels for Selected Radioelements... for radionuclide exposure control. Here, both routes of entry into the body are considered, i. e. , inhalation and ingestion, and ALI values are tabulated for both. 2. Introduction of the term Derived Air Concentration (DAC) instead of the term (MPC)a to prevent...

  16. N=4 Supersymmetric Gauge Theory in the Derivative Expansion

    E-Print Network [OSTI]

    Chalmers, G

    2002-01-01

    Maximally supersymmetric gauge theories have experienced renewed interest due to the AdS/CFT correspondence and its conjectured S-duality. These gauge theories possess a large amount of symmetry and have quasi-integrable properties. We derive the amplitudes in the derivative expansion of the spontaneously broken examples and perform all loop integrations. The S-matrix is found via an algebraic recursion and at each order is SL(2,Z) invariant.

  17. Jonathan Chang, Jordan Boyd-Graber, Chong Wang, Sean Gerrish, and David M. Blei. Reading Tea Leaves: How Humans Interpret Topic Models. Neural Information Processing Systems, 2009, 9 pages.

    E-Print Network [OSTI]

    Boyd-Graber, Jordan

    Jonathan Chang, Jordan Boyd-Graber, Chong Wang, Sean Gerrish, and David M. Blei. Reading Tea Leaves. @inproceedings{Chang:Boyd-Graber:Wang:Gerrish:Blei-2009, Title = {Reading Tea Leaves: How Humans Interpret Topic}, } 1 #12;Reading Tea Leaves: How Humans Interpret Topic Models Jonathan Chang Facebook 1601

  18. Evolution of the ReadOut System of the ATLAS experiment

    E-Print Network [OSTI]

    Borga, A; The ATLAS collaboration; Green, B; Kugel, A; Joos, M; Panduro Vazquez, W; Schumacher, J; Teixeira-Dias, P; Tremblet, L; Vandelli, W; Vermeulen, J; Werner, P; Wickens, F

    2014-01-01

    The ReadOut System (ROS) is a central and essential part of the ATLAS DAQ system. It receives and buffers data of events accepted by the first-level trigger from all subdetectors and first-level trigger subsystems. Event data are subsequently forwarded to the High-Level Trigger system and Event Builder via a 1 GbE-based network. The ATLAS ROS is completely renewed in view of the demanding conditions expected during LHC Run 2 and Run 3, to replace obsolete technologies and space constraints require it to be compact. The new ROS will consist of roughly 100 Linux-based 2U high rack mounted server PCs, each equipped with 2 PCIe I/O cards and two four 10 GbE interfaces. The FPGA-based PCIe I/O cards, developed by the ALICE collaboration, will be configured with ATLAS-specific firmware, the so-called RobinNP firmware. They will provide the connectivity to about 2000 optical point-to-point links conveying the ATLAS event data. This dense configuration provides an excellent test bench for studying I/O efficiency and ...

  19. Optimization of etching and reading procedures for the Autoscan 60 track etch system

    SciTech Connect (OSTI)

    McKeever, R.; Devine, R.; Coennen, C.

    1997-02-11

    The Los Alamos National Laboratory is charged with measuring the occupational exposure to radiological workers and contractors throughout the Laboratory, which includes many different sites with multiple and varied radiation fields. Of concern here are the high energy neutrons such as those generated during accelerator operations at Los Alamos Neutron Science Center (LANSCE). In 1993, the Los Alamos National Laboratory purchased an Autoscan 60 automated reader for use with chemically etched CR39 detectors. The dosimeter design employed at LANL uses a plastic, hemispherical case, encompassing a polystyrene pyramidal detector holder. The pyramidal holder supports three detectors at a 35{degree} angle. Averaging the results of the three detectors minimizes the angular dependence normally associated with a planar dosimeter. The Autoscan 60 is an automated reading system for use with CR39 chemical etch detectors. The detectors are immersed in an etch solution to enhance the visibility of the damage sites caused by recoil proton impact with the hydrogen atoms in the detector. The authors decided to increase the etch time from six hours to 15 hours, while retaining the 70 C temperature. The reason for the change in the etch is to enhance the sensitivity and precision of the CR39 detector as indicated by this study.

  20. Apparatus for reading two-dimensional electrophoretograms containing. beta. -ray-emitting labeled compounds

    DOE Patents [OSTI]

    Anderson, H.L.; Kinnison, W.W.; Lillberg, J.W.

    1985-04-30

    An apparatus and method for electronically reading planar two-dimensional ..beta..-ray emitter-labeled gel electrophoretograms. A single, flat rectangular multiwire proportional chamber is placed in close proximity to the gel and the assembly placed in an intense uniform magnetic field disposed in a perpendicular manner to the rectangular face of the proportional chamber. Beta rays emitted in the direction of the proportional chamber are caused to execute helical motions which substantially preserve knowledge the coordinates of their origin in the gel. Perpendicularly oriented, parallel wire, parallel plane cathodes electronically sense the location of the ..beta..-rays from ionization generated thereby in a detection gas coupled with an electron avalanche effect resulting from the action of a parallel wire anode located therebetween. A scintillator permits the present apparatus to be rendered insensitive when signals are generated from cosmic rays incident on the proportional chamber. Resolution for concentrations of radioactive compounds in the gel exceeds 700-..mu..m. The apparatus and method of the present invention represent a significant improvement over conventional autoradiographic techniques in dynamic range, linearity and sensitivity of data collection. A concentration and position map for gel electrophoretograms having significant concentrations of labeled compounds and/or highly radioactive labeling nuclides can generally be obtained in less than one hour.

  1. Apparatus and method for reading two-dimensional electrophoretograms containing .beta.-ray-emitting labeled compounds

    DOE Patents [OSTI]

    Anderson, Herbert L. (Santa Fe, NM); Kinnison, W. Wayne (Los Alamos, NM); Lillberg, John W. (Los Alamos, NM)

    1987-01-01

    Apparatus and method for electronically reading planar two dimensional .beta.-ray emitter-labeled gel electrophoretograms. A single, flat rectangular multiwire proportional chamber is placed in close proximity to the gel and the assembly placed in an intense uniform magnetic field disposed in a perpendicular manner to the rectangular face of the proportional chamber. Beta rays emitted in the direction of the proportional chamber are caused to execute helical motions which substantially preserve knowledge of the coordinates of their origin in the gel. Perpendicularly oriented, parallel wire, parallel plane cathodes electronically sense the location of the .beta.-rays from ionization generated thereby in a detection gas coupled with an electron avalanche effect resulting from the action of a parallel wire anode located therebetween. A scintillator permits the present apparatus to be rendered insensitive when signals are generated from cosmic rays incident on the proportional chamber. Resolution for concentrations of radioactive compounds in the gel exceeds 700 .mu.m. The apparatus and method of the present invention represent a significant improvement over conventional autoradiographic techniques in dynamic range, linearity and sensitivity of data collection. A concentration and position map for gel electrophoretograms having significant concentrations of labeled compounds and/or highly radioactive labeling nuclides can generally be obtained in less than one hour.

  2. Read/write head having a GMR sensor biased by permanent magnets located between the GMR and the pole shields

    DOE Patents [OSTI]

    Yuan, Samuel W. (San Carlos, CA); Rottmayer, Robert Earl (Fremont, CA); Carey, Matthew J. (San Jose, CA)

    1999-01-01

    A compact read/write head having a biased giant magnetoresistive sensor. Permanent magnet films are placed adjacent to the giant magnetoresistive sensor operating in the current-perpendicular-to the-plane (Cpp) mode and spaced with respect to the sensor by conducting films. These permanent magnet films provide a magnetic bias. The bias field is substantial and fairly uniform across sensor height. Biasing of the giant magnetoresistive sensor provides distinguishable response to the rising and falling edges of a recorded pulse on an adjacent recording medium, improves the linearity of the response, and helps to reduce noise. This read/write head is much simpler to fabricate and pattern and provides an enhanced uniformity of the bias field throughout the sensor.

  3. Literature survey of properties of synfuels derived from coal

    SciTech Connect (OSTI)

    Flores, F.

    1982-08-01

    This report contains the results of a literature survey conducted by NASA Lewis Research Center. The survey objective was to systematically assemble existing data on the physical, chemical, and elemental composition and structural characteristics of synthetic fuels (liquids and gases) derived from coal. The report contains the survey results compiled to October 1980. The report includes the following: (1) a general description of fuel properties, with emphasis on those properties required for synfuels to be used in gas-turbine systems for industry and utilities; (2) description of the four major concepts for converting coal into liquid fuels (pyrolysis, solvent extraction, catalytic liquefaction and indirect liquefaction); (3) data obtained from the literature on full range syncrudes and certain distillate cuts for fuels derived by various processes; (4) description of upgrading processes for coal liquids and characterization data for upgraded fuels; (5) data plots illustrating trends in the properties of fuels derived by several processes; (6) description of the most important concepts in coal gasification (fixed bed, fluidized bed, entrained flow and underground gasification) and characterization data for coal-derived gases; (7) a source list and bibliography on syncrude production and upgrading programs; and (8) a listing of some Federal energy contracts for coal-derived synthetic fuels production.

  4. Convergent genetic linkage and associations to language, speech and reading measures in families of probands with Specific Language Impairment

    E-Print Network [OSTI]

    Rice, Mabel L.; Smith, Shelley D.; Gayan, Javier

    2009-12-05

    linkage and associations to language, speech and reading measures in families of probands with Specific Language Impairment Mabel L. Rice & Shelley D. Smith & Javier Gayán Received: 23 June 2008 /Accepted: 5 August 2009 /Published online: 26 August 2009... [1–3], the search for candidate genes remains inconclusive [4] with the exception of a recently identified candidate, CNTNAP2 [5]. In contrast, candidate genes are identified for the closely related clinical conditions of Speech Sound Disorder (SSD...

  5. Equation (30) should read Equation (E1) should be the same as Equation (38). Accordingly, the inlined

    E-Print Network [OSTI]

    van de Walle, Axel

    Equation (30) should read F (T2) T2 = F (T1) T1 + Z 1/T2 1/T1 E d (1/T) Equation (E1) should be the same as Equation (38). Accordingly, the inlined equation just below Equation (E11) should be: ¡ kAB/ kAAkBB - 1 ¢ ¿ 1. To facilitate comparisons, Equation (E14) gives the effective cluster interac- tion using

  6. Tackling Higher Derivative Ghosts with the Euclidean Path Integral

    E-Print Network [OSTI]

    Michele Fontanini; Mark Trodden

    2011-02-21

    An alternative to the effective field theory approach to treat ghosts in higher derivative theories is to attempt to integrate them out via the Euclidean path integral formalism. It has been suggested that this method could provide a consistent framework within which we might tolerate the ghost degrees of freedom that plague, among other theories, the higher derivative gravity models that have been proposed to explain cosmic acceleration. We consider the extension of this idea to treating a class of terms with order six derivatives, and find that for a general term the Euclidean path integral approach works in the most trivial background, Minkowski. Moreover we see that even in de Sitter background, despite some difficulties, it is possible to define a probability distribution for tensorial perturbations of the metric.

  7. Methods and apparatuses for deoxygenating biomass-derived pyrolysis oil

    DOE Patents [OSTI]

    Baird, Lance Awender; Brandvold, Timothy A.

    2015-10-20

    Embodiments of methods and apparatuses for deoxygenating a biomass-derived pyrolysis oil are provided. In one example, a method comprises the steps of separating a low-oxygen biomass-derived pyrolysis oil effluent into a low-oxygen-pyoil organic phase stream and an aqueous phase stream. Phenolic compounds are removed from the aqueous phase stream to form a phenolic-rich diluent recycle stream. A biomass-derived pyrolysis oil stream is diluted and heated with the phenolic-rich diluent recycle stream to form a heated diluted pyoil feed stream. The heated diluted pyoil feed stream is contacted with a deoxygenating catalyst in the presence of hydrogen to deoxygenate the heated diluted pyoil feed stream.

  8. Higher Derivative Corrections to Manifestly Supersymmetric Nonlinear Realizations

    E-Print Network [OSTI]

    Muneto Nitta; Shin Sasaki

    2014-11-05

    When global symmetries are spontaneously broken in supersymmetric vacua, there appear quasi-Nambu-Goldstone (NG) fermions as superpartners of NG bosons. In addition to these, there can appear quasi-NG bosons in general. The quasi-NG bosons and fermions together with the NG bosons are organized into chiral multiplets. K\\"ahler potentials of low-energy effective theories were constructed some years ago as supersymmetric nonlinear realizations. It is known that higher derivative terms in the superfield formalism often encounter with the auxiliary field problem; the auxiliary fields are acted by space-time derivatives and cannot be eliminated. In this paper, we construct higher derivative corrections to supersymmetric nonlinear realizations in the off-shell superfield formalism free from the auxiliary field problem. As an example, we present manifestly supersymmetric chiral Lagrangian.

  9. SYNTHESIS OF METHACRYLATES FROM COAL-DERIVED SYNGAS

    SciTech Connect (OSTI)

    Jang, B.W.L.; Spivey, J.J.; Gogate, M.R.; Zoeller, J.R.; Colberg, R.D.; Choi, G.N.

    1999-12-01

    Research Triangle Institute (RTI), Eastman Chemical Company, and Bechtel have developed a novel process for synthesis of methyl methacrylate (MMA) from coal-derived syngas, under a contract from the US Department of Energy/Fossil Energy Technology Center (DOE/FETC). This project has resulted in five US patents (four already published and one pending publication). It has served as the basis for the technical and economic assessment of the production of this high-volume intermediate from coal-derived synthesis gas. The three-step process consists of the synthesis of a propionate from ethylene carbonylation using coal-derived CO, condensation of the propionate with formaldehyde to form methacrylic acid (MAA); and esterification of MAA with methanol to yield MMA. The first two steps, propionate synthesis and condensation catalysis, are the key technical challenges and the focus of the research presented here.

  10. Finished Prokaryotic Genome Assemblies from a Low-cost Combination of Short and Long Reads (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    ScienceCinema (OSTI)

    Yin, Shuangye (Broad Institute)

    2013-02-11

    Shuangye Yin on "Finished prokaryotic genome assemblies from a low-cost combination of short and long reads" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.

  11. MetaVelvet: An Extension of Velvet Assembler to de novo Metagenome Assembly from Short Sequence Reads (Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    ScienceCinema (OSTI)

    Sakakibara, Yasumbumi [Keio University

    2013-01-22

    Keio University's Yasumbumi Sakakibara on "MetaVelvet: An Extension of Velvet Assembler to de novo Metagenome Assembly from Short Sequence Reads" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  12. UOA 22, Statistics and Operational Research This statement should be read alongside the statement for Main Panel F and the generic statement.

    E-Print Network [OSTI]

    Abrahams, I. David

    UOA 22, Statistics and Operational Research This statement should be read alongside the statement and theoretical research in statistics, probability and the more mathematical aspects of operational research. UOA statistics, applied probability, probability theory, operational research, biostatistics, social statistics

  13. Analysis of the principal's perceptions of the implementation and impact of the accelerated reader and other selected reading strategies used by Texas gold performance elementary schools 

    E-Print Network [OSTI]

    Elmore, Olivia Carol

    2005-08-29

    Knowledge of the implementation practices of successful elementary schools will be beneficial to other elementary principals who seek to improve student success in reading. This study examined perceptions of principals ...

  14. Ethos and answerability in the novelized epic: passional readings of Elizabeth Barrett Browning's Aurora Leigh, David Jones's In Parenthesis, and Chenjerai Hove's Bones 

    E-Print Network [OSTI]

    Sibley, Pamela Jean

    2009-05-15

    of the incarnated Christ, and Mikhail Bakhtin’s notion of ‚answerability.? As an alternative to theories of reading and interpretation based on the arbitrariness of linguistic meaning, radical skepticism, and the death of the author, the approach defined...

  15. High-Stakes Reading Assessment and English Oral Language Development: A Study of Third Grade English Language Learners in a Texas School District 

    E-Print Network [OSTI]

    Acosta, Sandra

    2011-08-08

    between oral language and reading performance in third grade Hispanic ELLS, and (c) the impact of instructional program model on ELLs’ oral language development. Two parallel systematic reviews were conducted searching CSA, Ebsco and Wilson electronic...

  16. ResearchPapersToRead.xls 2/4/05 10:50 PM selections 1/17/2005/ cs674 -index 49804

    E-Print Network [OSTI]

    Ryder, Barbara G.

    ResearchPapersToRead.xls 2/4/05 10:50 PM selections 1/17/2005/ cs674 - index 49804 revised 2 SAS03 F. Lo

  17. Leave of Absence with Full or Partial Pay I hereby acknowledge that I have read, understand, and agree to follow the rules

    E-Print Network [OSTI]

    Farritor, Shane

    Leave of Absence with Full or Partial Pay I hereby acknowledge that I have read, understand of absence with pay has agreed to resume his or her duties at the University of Nebraska upon termination

  18. A Two-Study Investigation of Fidelity of Early Reading Interventions: Examining the Quality of the Research Base and an Application of Program Differentiation 

    E-Print Network [OSTI]

    Fogarty, Melissa

    2012-10-19

    This research consisted of two studies. The purpose of the first study was to examine the presence and quality of fidelity of implementation as reported in recent early reading intervention research. A comprehensive search of kindergarten through...

  19. Finished Prokaryotic Genome Assemblies from a Low-cost Combination of Short and Long Reads (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    SciTech Connect (OSTI)

    Yin, Shuangye (Broad Institute) [Broad Institute

    2012-06-01

    Shuangye Yin on "Finished prokaryotic genome assemblies from a low-cost combination of short and long reads" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.

  20. Stabilization of linear higher derivative gravity with constraints

    SciTech Connect (OSTI)

    Chen, Tai-jun; Lim, Eugene A. E-mail: eugene.a.lim@gmail.com

    2014-05-01

    We show that the instabilities of higher derivative gravity models with quadratic curvature invariant ?R{sup 2}+?R{sub ??}R{sup ??} can be removed by judicious addition of constraints at the quadratic level of metric fluctuations around Minkowski/de Sitter background. With a suitable parameter choice, we find that the instabilities of helicity-0, 1, 2 modes can be removed while reducing the dimensionality of the original phase space. To retain the renormalization properties of higher derivative gravity, Lorentz symmetry in the constrained theory is explicitly broken.

  1. Derivative expansion at small mass for the spinor effective action

    SciTech Connect (OSTI)

    Dunne, Gerald V.; Huet, Adolfo; Hur, Jin; Min, Hyunsoo

    2011-05-15

    We study the small-mass limit of the one-loop spinor effective action, comparing the derivative expansion approximation with exact numerical results that are obtained from an extension to spinor theories of the partial-wave cutoff method. In this approach, one can compute numerically the renormalized one-loop effective action for radially separable gauge field background fields in spinor QED. We highlight an important difference between the small-mass limit of the derivative expansion for spinor and scalar theories.

  2. Constraints on Automorphic Forms of Higher Derivative Terms from Compactification

    E-Print Network [OSTI]

    Finn Gubay; Neil Lambert; Peter West

    2010-08-04

    By dimensionally reducing the higher derivative corrections of ten-dimensional IIB theory on a torus we deduce constraints on the E_{n+1} automorphic forms that occur in d=10-n dimensions. In particular we argue that these automorphic forms involve the representation of E_{n+1} with fundamental weight \\lambda^{n+1}, which is also the representation to which the string charges in d dimensions belong. We also consider a similar calculation for the reduction of higher derivative terms in eleven-dimensional M-theory.

  3. TANK VAPOR CHEMICALS OF POTENTIAL CONCERN & EXISTING DIRECT READING INSTRUMENTION & PERSONAL PROTECTIVE EQUIPMENT CONSIDERATIONS

    SciTech Connect (OSTI)

    BUTLER, N.K.

    2004-11-01

    This document takes the newly released Industrial Hygiene Chemical Vapor Technical Basis (RPP-22491) and evaluates the chemicals of potential concern (COPC) identified for selected implementation actions by the industrial hygiene organization. This document is not intended as a hazard analysis with recommended controls for all tank farm activities. Not all of the chemicals listed are present in all tanks; therefore, hazard analyses can and should be tailored as appropriate. Detection of each chemical by current industrial hygiene non-specific instrumentation in use at the tank farms is evaluated. Information gaps are identified and recommendations are made to resolve these needs. Of the 52 COPC, 34 can be detected with existing instrumentation. Three additional chemicals could be detected with a photoionization detector (PID) equipped with a different lamp. Discussion with specific instrument manufacturers is warranted. Consideration should be given to having the SapphIRe XL customized for tank farm applications. Other instruments, sampling or modeling techniques should be evaluated to estimate concentrations of chemicals not detected by direct reading instruments. In addition, relative instrument response needs to be factored in to action levels used for direct reading instruments. These action levels should be correlated to exposures to the COPC and corresponding occupational exposure limits (OELs). The minimum respiratory protection for each of the COPC is evaluated against current options. Recommendations are made for respiratory protection based on each chemical. Until exposures are sufficiently quantified and analyzed, the current use of supplied air respiratory protection is appropriate and protective for the COPC. Use of supplied air respiratory protection should be evaluated once a detailed exposure assessment for the COPC is completed. The established tank farm OELs should be documented in the TFC-PLN-34. For chemicals without an established tank farm OEL, consideration should be given to adopting protective limits from NIOSH, AIHA, or developing OELs. Protective gloves and suits are evaluated for each chemical for which information is available. Information gaps are identified for some of the compounds and materials. Recommendations are made for resolving these needs. Based on available information, Silver Shield{reg_sign} gloves are promising for tank farm applications. However, permeation testing documentation is needed for the COPC and mixtures for Silver Shield{reg_sign} gloves to evaluate their protectiveness. North Safety Products is expected to provide the requested documentation. Multiple Tychem{reg_sign} products are available. There is overlap between chemicals and effective materials. Further hazard evaluation to determine actual hazards and permeation testing documentation is required to assess the efficacy of a single Tychem{reg_sign} product for tank farm applications. All of this chemical specific data is combined into a spreadsheet that will assist the industrial hygienist in the selection of monitoring instruments, respiratory protection selection and protective clothing for performing work at a specific tank(s).

  4. Brief reports: Lysosomal cross-correction by hematopoietic stem cell-derived macrophages via tunneling nanotubes

    E-Print Network [OSTI]

    2015-01-01

    by Hematopoietic Stem Cell-Derived Macrophages Via Tunnelingwith primary macro- phages derived from Ctns 2/2 mice stablytransfer from bone-marrow-derived stromal cells to pulmonary

  5. Is Serum Brain-Derived NeurotrophicFactor a Biomarker for Cognitive Enhancementin Schizophrenia?

    E-Print Network [OSTI]

    Vinogradov, Sophia

    2009-01-01

    S, Jones KR (2003): Brain-derived neuro- trophic factor ischemical study of brain-derived neurotrophic factor and itsP, et al. (2001): Brain-derived neurotrophic factor and

  6. Morphological derived-environment effects in gestural coordination: A case study of Norwegian clusters

    E-Print Network [OSTI]

    Bradley, Travis G.

    2007-01-01

    157-233. Lubowicz, A. 2002. Derived environment effects in2002. Gestural timing and derived-environment effects inP. 1993. Blocking in non-derived environments. In: Hargus,

  7. Pedogenic Thresholds and Soil Process Domains in Basalt-Derived Soils

    E-Print Network [OSTI]

    Vitousek, PM; Chadwick, OA

    2013-01-01

    rejuvenation of weathering-derived nutri- ent supply in anProcess Domains in Basalt-Derived Soils Peter M. Vitousekand domains in basalt-derived soils on two rainfall

  8. Regulation of norrin receptor frizzled-4 by Wnt2 in colon-derived cells

    E-Print Network [OSTI]

    Planutis, Kestutis; Planutiene, Marina; Moyer, Mary Pat; Nguyen, Anthony V; Perez, Cherlyn A; Holcombe, Randall F

    2007-01-01

    in normal colonic mucosa-derived NCM460 cells but not in theby the colon cancer-derived cell lines would favor continuedfrizzled-4 by Wnt2 in colon-derived cells Kestutis Planutis

  9. The role of let-7 in human embryonic stem cell-derived neural precursor cells

    E-Print Network [OSTI]

    Chen, Connie

    2012-01-01

    L. (2010). Neural crest-derived stem cells. Stembook,A.V. (2011). Human ESC-derived neural crest model reveals ahuman embryonic stem cell-derived motoneurons. Stem Cell 25:

  10. An XMRV Derived Retroviral Vector as a Tool for Gene Transfer

    E-Print Network [OSTI]

    Cervantes-Garcia, Daniel; Rojas-Martinez, Augusto; Camerini, David

    2011-01-01

    Garcia et al. : An XMRV Derived Retroviral Vector as a ToolREPORT Open Access An XMRV Derived Retroviral Vector as ain vivo. Many retroviral vectors are derived from the mouse

  11. Effects of glial cell line-derived neurotrophic factor on cultured murine retinal progenitor cells

    E-Print Network [OSTI]

    Wang, Jinmei; Yang, Jing; Gu, Ping; Klassen, Henry

    2010-01-01

    of glial cell line-derived neurotrophic factor (GDNF)F. GDNF: a glial cell line-derived neurotrophic factor forlevel glial cell line-derived neurotrophic factor delivery

  12. Plasma-Derived Exosomal Survivin, a Plausible Biomarker for Early Detection of Prostate Cancer

    E-Print Network [OSTI]

    2012-01-01

    of dendritic cell-derived exosomes. Blood Cells Mol Dis 35:Plasma-Derived Exosomal Survivin, a Plausible Biomarker forprogress has shown that tumor-derived exosomes play multiple

  13. Induced pluripotent stem-cell-derived models of sporadic and familial Alzheimer's disease

    E-Print Network [OSTI]

    Israel, Mason Arthur

    2011-01-01

    Induced pluripotent stem-cell-derived models of sporadic andcells, glia and neurons derived from human pluripotent stemhuman ES and iPS cell-derived neurons. Proc. Natl. Acad.

  14. Characterization of Dental-Pulp Derived Islet-like Cell Aggregates and the Role of GABA

    E-Print Network [OSTI]

    Egli, Jennifer Lynn

    2012-01-01

    S. Mesenchymal stem cells derived from dental tissues vs.umbilical cord blood-derived cells into insulin-producingfrom Murine Adipose Tissue-Derived Stem Cells. Stem Cells

  15. Human Apolipoprotein A-I-Derived Amyloid: Its Association with Atherosclerosis

    E-Print Network [OSTI]

    2011-01-01

    Human Apolipoprotein A-I-Derived Amyloid: Its AssociationHuman Apolipoprotein A-I-Derived Amyloid 38. De Felice FG,occurring amyloidosis derived from apolipoprotein AI. Am J

  16. REVIEW PAPER Biodeterioration of crude oil and oil derived

    E-Print Network [OSTI]

    Appanna, Vasu

    REVIEW PAPER Biodeterioration of crude oil and oil derived products: a review Natalia A. Yemashova January 2007 Ó Springer Science+Business Media B.V. 2007 Abstract Biodeterioration of crude oil and oil of operational problems. Nowadays various test-systems are utilized for microbial monitoring in crude oils

  17. Mechanical Integrators Derived from a Discrete Variational Principle

    E-Print Network [OSTI]

    Marsden, Jerrold

    Mechanical Integrators Derived from a Discrete Variational Principle Jerey M. Wendlandt1;2 Mechanical Engineering, University of California at Berkeley, Berkeley, CA 94720, USA Jerrold E. Marsden3 for mechanical system simulation are created by using discrete algorithms to approximate the continuous equations

  18. DERIVING PROGNOSTIC EQUATIONS FOR CLOUD FRACTION AND LIQUID WATER CONTENT

    E-Print Network [OSTI]

    DERIVING PROGNOSTIC EQUATIONS FOR CLOUD FRACTION AND LIQUID WATER CONTENT Vincent E. Larson1 1 that accounts for how liquid water varies with both total water content and temperature. The variable s has- ter content, ql , and cloud fraction, C. This provides in- formation about partial cloudiness. Tiedtke

  19. Utility-Based Pricing of the Weather Derivatives Hlne Hamisultane *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ;1. Introduction Weather impacts many sectors of the economy such as agriculture, construction, tourism and energy), in 1999. Weather derivatives are financial instruments based on a weather index. They give a payment 0 equal to the cost of the hedging portfolio at time 0. Mathematically, this price corresponds

  20. Tolerance Analysis of Assemblies Using Kinematically Derived Sensitivities

    E-Print Network [OSTI]

    , which may be added to a kinematic model, resulting in an "equivalent variational mechanism" (EVM), which and kinematic/dynamic properties of mechanisms. Chapter 1. Introduction 1.1 Background Information ToleranceTolerance Analysis of Assemblies Using Kinematically Derived Sensitivities ADCATS Report No. 99

  1. SINGULAR FORWARD-BACKWARD STOCHASTIC DIFFERENTIAL EQUATIONS AND EMISSIONS DERIVATIVES

    E-Print Network [OSTI]

    Carmona, Rene

    SINGULAR FORWARD-BACKWARD STOCHASTIC DIFFERENTIAL EQUATIONS AND EMISSIONS DERIVATIVES REN´E CARMONA and why they appear naturally as models for the valuation of CO2 emission allowances. Single phase cap is motivated by the mathematical analysis of the emissions markets, as implemented for example in the European

  2. Synthesis and characterization of interfacially polymerized films of tetraphenylporphyrin derivatives

    SciTech Connect (OSTI)

    Li, W.; Wamser, C.C.

    1995-10-01

    Thin films of polymeric porphyrins have been made by interfacial polymerization of derivatives of tetraphenyl porphyrins, in particular by condensation of a dichloromethane solution of the acid chloride derivative (TCCPP) with a buffered aqueous solution of either the amine derivative (TAPP) or the phenol derivative (THPP). Spectroscopic and other studies are consistent with cross-linked polyamide or polyester network structures. The polyamide and polyester films display a novel asymmetry of functional groups on opposite sides of the film; excess amine (or hydroxyl) groups appear on one side of the film and excess carboxyl groups on the other. Film thickness can be correlated with the intensity of the UV-visible absorption spectrum, x (in nm) = 120 A{sub max} (at the Soret peak), with typical thicknesses in the range 10-500 nm, easily controlled by reaction time and conditions. Significantly thicker films (up to several {mu}m) can be prepared using an aliphatic diamine orpolyamine as the comonomer with TCCPP. Addition of 2, 6-lutidine to the organic phase substantially increases the rate of polymerization, which is especially useful for TAPP reactions. In addition, control experiments show that TCCPP with lutidine in CH{sub 2}Cl{sub 2} reacts at the interface with an aqueous pH 3 buffer, giving a very thin, easily hydrolyzed film, apparently due to anhydride linkages formed by condensation reactions with partially hydrolyzed TCCPP. 56 refs., 11 figs., 4 tabs.

  3. Fuel and fuel blending components from biomass derived pyrolysis oil

    DOE Patents [OSTI]

    McCall, Michael J.; Brandvold, Timothy A.; Elliott, Douglas C.

    2012-12-11

    A process for the conversion of biomass derived pyrolysis oil to liquid fuel components is presented. The process includes the production of diesel, aviation, and naphtha boiling point range fuels or fuel blending components by two-stage deoxygenation of the pyrolysis oil and separation of the products.

  4. ComputerDerived Nuclear "Grade" and Breast Cancer Prognosis

    E-Print Network [OSTI]

    Street, Nick

    Wolberg 1 Computer­Derived Nuclear "Grade" and Breast Cancer Prognosis William H. Wolberg, M.D., W of nuclear grade are subjective, yet still prognostically important. Now, computer­based analytical techniques can objectively and accurately measure size, shape, and texture features that constitute nuclear

  5. Advertising in Google Search Deriving a bidding strategy

    E-Print Network [OSTI]

    Boucherie, Richard J.

    Advertising in Google Search Deriving a bidding strategy in the biggest auction on earth. Anne the perspective of the advertiser. It presents a model for the expected profit per view, depending on either the bid or the obtained position of the advertiser. In a subsequent analysis, the position and bid

  6. Compact and low-power continuous-time derivative circuit

    E-Print Network [OSTI]

    Graham, David W.

    . In this Letter, we provide a description of the design criteria of `frequency-normalised' continuous-power derivative circuit that is able to fulfil all of these criteria. It consists of 1. a capacitor to perform in continuous- time circuits to realise low-power implementations and local processing on the sensor data

  7. Radiohalogenated thienylethylamine derivatives for evaluating local cerebral blood flow

    DOE Patents [OSTI]

    Goodman, Mark M. (Knoxville, TN); Knapp, Jr., Furn F. (Oak Ridge, TN)

    1990-01-01

    Radiopharmaceuticals useful in brain imaging comprising radiohalogenated thienylethylamine derivatives. The compounds are 5-halo-thiophene-2-isopropyl amines able to cross the blood-brain barrier and be retained for a sufficient length of time to allow the evaluation or regional blood flow by radioimaging of the brain.

  8. Neutral hydrogen density profiles derived from geocoronal N. stgaard,1

    E-Print Network [OSTI]

    Mende, Stephen B.

    Neutral hydrogen density profiles derived from geocoronal imaging N. Østgaard,1 S. B. Mende,1 H. U an empirical model of the neutral hydrogen density distribution at high altitudes (>3.5 RE geocentric distance from interplanetary hydrogen are obtained from a model. Assuming that the exosphere at high altitudes

  9. Assessing experimentally derived interactions in a small world

    E-Print Network [OSTI]

    Goldberg, Debra S.

    Assessing experimentally derived interactions in a small world Debra S. Goldberg and Frederick P networks have also been shown to have the small-world network properties of cohesive neighborhoods and short aver- age distances between vertices. Although much analysis has been done on small-world networks

  10. Hamilton-Jacobi formulation of systems within Caputo's fractional derivative

    E-Print Network [OSTI]

    Eqab M. Rabei; Ibtesam Almayteh; Sami I. Muslih; Dumitru Baleanu

    2007-03-26

    In this paper we develop a fractional Hamilton-Jacobi formulation for discrete systems in terms of fractional Caputo derivatives. The fractional action function is obtained and the solutions of the equations of motion are recovered. An example is studied in details.

  11. Subject Positions and Derivational Scope Calculation in Minimalist Syntax

    E-Print Network [OSTI]

    Subject Positions and Derivational Scope Calculation in Minimalist Syntax: A Phase-Based Approach without any other special implement. 1 Introduction This paper explores the correlation between subject in subject positions across languages. We claim that unlike English Nominative Case, C, rather than

  12. Financial derivative pricing under probability operator via Esscher transfomation

    SciTech Connect (OSTI)

    Achi, Godswill U., E-mail: achigods@yahoo.com [Department of Mathematics, Abia State Polytechnic Aba, P.M.B. 7166, Aba, Abia State (Nigeria)

    2014-10-24

    The problem of pricing contingent claims has been extensively studied for non-Gaussian models, and in particular, Black- Scholes formula has been derived for the NIG asset pricing model. This approach was first developed in insurance pricing{sup 9} where the original distortion function was defined in terms of the normal distribution. This approach was later studied6 where they compared the standard Black-Scholes contingent pricing and distortion based contingent pricing. So, in this paper, we aim at using distortion operators by Cauchy distribution under a simple transformation to price contingent claim. We also show that we can recuperate the Black-Sholes formula using the distribution. Similarly, in a financial market in which the asset price represented by a stochastic differential equation with respect to Brownian Motion, the price mechanism based on characteristic Esscher measure can generate approximate arbitrage free financial derivative prices. The price representation derived involves probability Esscher measure and Esscher Martingale measure and under a new complex valued measure ? (u) evaluated at the characteristic exponents ?{sub x}(u) of X{sub t} we recuperate the Black-Scholes formula for financial derivative prices.

  13. Electricity derivatives and risk management S.J. Denga,

    E-Print Network [OSTI]

    Oren, Shmuel S.

    Electricity derivatives and risk management S.J. Denga, *, S.S. Orenb a School of Industrial Electricity spot prices in the emerging power markets are volatile, a consequence of the unique physical attributes of electricity production and distribution. Uncontrolled exposure to market price risks can lead

  14. Electricity derivatives and risk management S.J. Denga,*

    E-Print Network [OSTI]

    Electricity derivatives and risk management S.J. Denga,* , S.S. Orenb a School of Industrial Engineering and Operations Research, University of California, Berkeley, CA 94720, USA Abstract Electricity of electricity production and distribution. Uncontrolled exposure to market price risks can lead to devastating

  15. Incorporating Seasonality into Search Suggestions Derived from Intranet Query Logs

    E-Print Network [OSTI]

    Kruschwitz, Udo

    Incorporating Seasonality into Search Suggestions Derived from Intranet Query Logs Stephen Dignum performed on query logs collected for major Web search engines, query log analysis to enhance search search engine can be enhanced by adapting the search system to real users' search behaviour through

  16. Triamines and their derivatives as bifunctional chelating agents

    DOE Patents [OSTI]

    Troutner, D.E.; John, C.S.; Pillai, M.R.A.

    1992-03-31

    A group of functionalized triamine chelants and their derivatives that form complexes with radioactive metal ions are disclosed. The complexes can be covalently attached to a protein or an antibody or antibody fragment and used for therapeutic and/or diagnostic purposes. No Drawings

  17. Robust Replication of Volatility Derivatives and Roger Lee

    E-Print Network [OSTI]

    Lee, Roger

    The tradeoff between risk and return is a central theme of finance, and volatility and variance of returns are standard measures of risk. The volatility of a stock is revealed by the market price of an option, allow us to replicate volatility derivatives, by dynamic trading in standard options and the underlying

  18. Deriving Displacement from a 3 axis Accelerometer Mr. Andrew Blake

    E-Print Network [OSTI]

    Winstanley, Graham

    Deriving Displacement from a 3 axis Accelerometer Mr. Andrew Blake University of Brighton CMIS, Additive 1. Introduction The Nintendo WiiTM, Sony's Playstation 3TM and Microsoft's Xbox 360TM all feature a 1000 seconds is 1,000,000 times greater than that at 1 second. Any small offset errors

  19. Mining All Non-Derivable Frequent Itemsets Toon Calders1

    E-Print Network [OSTI]

    Antwerpen, Universiteit

    , Belgium 2 University of Limburg, Belgium Abstract. Recent studies on frequent itemset mining algorithms reMining All Non-Derivable Frequent Itemsets Toon Calders1 and Bart Goethals2 1 University of Antwerp representation of the frequent itemsets, instead of mining all fre- quent itemsets. The main goal of this paper

  20. SURVEILLANCE OF PHOTOVOLTAIC SOLAR ENERGY SYSTEMS USING METEOSAT DERIVED IRRADIANCES

    E-Print Network [OSTI]

    Heinemann, Detlev

    be related to a bad performance of numerous PV systems: the overall energy production 1 #12;(and thus. Regarding the increasing pay-back rates for PV energy (0.99 DM/kWh in Germany from spring 2000 onwardsSURVEILLANCE OF PHOTOVOLTAIC SOLAR ENERGY SYSTEMS USING METEOSAT DERIVED IRRADIANCES Annette Hammer

  1. Biofuel derived from Microalgae Corn-based Ethanol

    E-Print Network [OSTI]

    Blouin-Demers, Gabriel

    · E10 vs. E85 choice · Examined of corn-based ethanol fuel systems on the following: - environmentalBiofuel derived from Microalgae Corn-based Ethanol #12;Outline · Production processes for each;Definitions Biofuel: clean fuel made from animal and plant fats and tissues (Hollebone, 2008) Ethanol

  2. A Comparison of Derivative-Free Optimization Methods for Groundwater

    E-Print Network [OSTI]

    Kelley, C. T. "Tim"

    A Comparison of Derivative-Free Optimization Methods for Groundwater Supply and Hydraulic Capture, 244 Wood Street, Lexington, MA 02420-9108 USA Abstract Management decisions involving groundwater-documented community problems are used for illustration purposes: a groundwater supply problem and a hydraulic capture

  3. Lorentz and SU(3) groups derived from cubic quark algebra

    E-Print Network [OSTI]

    Richard Kerner

    2009-01-26

    We show that the Lorentz and the SU(3) groups can be derived from the covariance principle conserving a $Z_3$-graded three-form on a $Z_3$-graded cubic algebra representing quarks endowed with non-standard commutation laws.

  4. Space-time models derived from Schwarzschild's solution

    E-Print Network [OSTI]

    Lluis Bel

    2008-12-09

    We discuss two space-time models: one is expanding, the other is static. They are both derived from Schwarzschild's exterior solution. But they differ in the implementation of the parallelism at a distance and the choice of their master frame of reference.

  5. Path integral derivations of novel complex trajectory methods

    E-Print Network [OSTI]

    Jeremy Schiff; Yair Goldfarb; David J. Tannor

    2008-07-30

    Path integral derivations are presented for two recently developed complex trajectory techniques for the propagation of wave packets, Complex WKB and BOMCA. Complex WKB is derived using a standard saddle point approximation of the path integral, but taking into account the hbar dependence of both the amplitude and the phase of the intial wave function, thus giving rise to the need for complex classical trajectories. BOMCA is derived using a modification of the saddle point technique, in which the path integral is approximated by expanding around a near-classical path, chosen so that up to some predetermined order there is no need to add any correction terms to the leading order approximation. Both Complex WKB and BOMCA give the same leading order approximation; in Complex WKB higher accuracy is achieved by adding correction terms, while in BOMCA no additional terms are ever added -higher accuracy is achieved by changing the path along which the original approximation is computed. The path integral derivation of the methods explains the need to incorporate contributions from more than one trajectory, as observed in previous numerical work. On the other hand, it emerges that the methods provide efficient schemes for computing the higher order terms in the asymptotic evaluation of path integrals. The understanding we develop of BOMCA suggests that there should exist near-classical trajectories that give exact quantum dynamical results when used in the computation of the path integral keeping just the leading order term. We also apply our path integral techniques to give a compact derivation of the semiclassical approximation to the coherent state propagator.

  6. Credit Derivatives: Overview and Hedge-Based Pricing Credit Derivatives: Overview and Hedge-Based Pricing Chapter 2

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Li-1 at Ti and a defaultable bond paying Li-1 + spar . spar chosen so that at onset the value is 1 minimize this by increasing the protection taken by the CDS. This means that ¯s = spar . Credit Derivatives

  7. Cosmological perturbations in non-local higher-derivative gravity

    SciTech Connect (OSTI)

    Craps, Ben; Jonckheere, Tim De; Koshelev, Alexey S. E-mail: Tim.De.Jonckheere@vub.ac.be

    2014-11-01

    We study cosmological perturbations in a non-local higher-derivative model of gravity introduced by Biswas, Mazumdar and Siegel. We extend previous work, which had focused on classical scalar perturbations around a cosine hyperbolic bounce solution, in three ways. First, we point out the existence of a Starobinsky solution in this model, which is more attractive from a phenomenological point of view (even though it has no bounce). Second, we study classical vector and tensor pertuxsxrbations. Third, we show how to quantize scalar and tensor perturbations in a de Sitter phase (for choices of parameters such that the model is ghost-free). Our results show that the model is well-behaved at this level, and are very similar to corresponding results in local f(R) models. In particular, for the Starobinsky solution of non-local higher-derivative gravity, we find the same tensor-to-scalar ratio as for the conventional Starobinsky model.

  8. Higher Derivative Corrections to Charged Fluids in 2n Dimensions

    E-Print Network [OSTI]

    Banerjee, Nabamita; Jain, Akash

    2015-01-01

    We study anomalous charged fluid in $2n$-dimensions ($n\\geq 2$) up to sub-leading derivative order. Only the effect of gauge anomaly is important at this order. Using the Euclidean partition function formalism, we find the constraints on different sub-leading order transport coefficients appearing in parity-even and odd sectors of the fluid. We introduce a new mechanism to count different fluid data at arbitrary derivative order. We show that only the knowledge of independent scalar-data is sufficient to find the constraints. In appendix we further extend this analysis to obtain fluid data at sub-sub-leading order (where both gauge and gravitational anomaly contribute) for parity-odd fluid.

  9. Backreaction effects due to matter coupled higher derivative gravity

    E-Print Network [OSTI]

    Lata Kh Joshi; P. Ramadevi

    2014-11-28

    AdS-hydrodynamics has proven to be a useful tool for obtaining transport coefficients observed in the collective flow of strongly coupled fluids like quark gluon plasma (QGP). Particularly, the ratio of shear viscosity to entropy density ${\\eta/ s}$ obtained from elliptic flow measurements can be matched with the computation done in the dual gravity theory. The experimentally observed temperature dependence of ${\\eta/ s}$ requires the study of scalar matter coupled AdS gravity including higher derivative curvature corrections. We obtain the backreaction to the metric for such a matter coupled AdS gravity in $D$-dimensional spacetime due to the higher derivative curvature corrections. Then, we present the backreaction corrections to shear-viscosity $\\eta$ and entropy density $s$.

  10. Higher Derivative Corrections to Charged Fluids in 2n Dimensions

    E-Print Network [OSTI]

    Nabamita Banerjee; Suvankar Dutta; Akash Jain

    2015-02-25

    We study anomalous charged fluid in $2n$-dimensions ($n\\geq 2$) up to sub-leading derivative order. Only the effect of gauge anomaly is important at this order. Using the Euclidean partition function formalism, we find the constraints on different sub-leading order transport coefficients appearing in parity-even and odd sectors of the fluid. We introduce a new mechanism to count different fluid data at arbitrary derivative order. We show that only the knowledge of independent scalar-data is sufficient to find the constraints. In appendix we further extend this analysis to obtain fluid data at sub-sub-leading order (where both gauge and gravitational anomaly contribute) for parity-odd fluid.

  11. Apparatuses and methods for deoxygenating biomass-derived pyrolysis oil

    DOE Patents [OSTI]

    Kalnes, Tom N.

    2015-12-29

    Apparatuses and methods for deoxygenating a biomass-derived pyrolysis oil are provided herein. In one example, the method comprises of dividing a feedstock stream into first and second feedstock portions. The feedstock stream comprises the biomass-derived pyrolysis oil and has a temperature of about 60.degree. C. or less. The first feedstock portion is combined with a heated organic liquid stream to form a first heated diluted pyoil feed stream. The first heated diluted pyoil feed stream is contacted with a first deoxygenating catalyst in the presence of hydrogen to form an intermediate low-oxygen pyoil effluent. The second feedstock portion is combined with the intermediate low-oxygen pyoil effluent to form a second heated diluted pyoil feed stream. The second heated diluted pyoil feed stream is contacted with a second deoxygenating catalyst in the presence of hydrogen to form additional low-oxygen pyoil effluent.

  12. In situ electrochemical dilatometry of carbide-derived carbons

    SciTech Connect (OSTI)

    Hantel, M M; Presser, Volker; Gogotsi, Yury

    2011-01-01

    The long life durability and extraordinary stability of supercapacitors are ascribed to the common concept that the charge storage is purely based on double-layer charging. Therefore the ideal supercapacitor electrode should be free of charge induced microscopic structural changes. However, recent in-situ investigations on different carbon materials for supercapacitor electrodes have shown that the charge and discharge is accompanied by dimensional changes of the electrode up to several percent. This work studies the influence of the pore size on the expansion behavior of carbon electrodes derived from titanium carbide-derived carbons with an average pore size between 5 and 8 Using tetraethylammonium tetrafluoroborate in acetonitrile, the swelling of the electrodes was measured by in situ dilatometry. The experiments revealed an increased expansion on the negatively charged electrode for pores below 6 , which could be described with pore swelling.

  13. A Vacuum Solution with Torsion in Higher-Derivative Gravity

    E-Print Network [OSTI]

    Kouzou Nishida

    2012-09-02

    In this paper, we provide a vacuum solution with torsion in quadratic Riemann-curvature gravity. Physically, the solution means that vacuum can have a nonzero vacuum field with large torsion. We show that the Einstein-Hilbert action can be derived if we expand the quadratic curvature of the Lagrangian in a torsion-free Riemannian space-time around a nonzero vacuum field. We also show that the cosmological constant caused by a nonzero vacuum field is equal to zero.

  14. Massive graviton on arbitrary background: derivation, syzygies, applications

    E-Print Network [OSTI]

    Laura Bernard; Cedric Deffayet; Mikael von Strauss

    2015-04-16

    We give the detailed derivation of the fully covariant form of the quadratic action and the derived linear equations of motion for a massive graviton in an arbitrary background metric (which were presented in arXiv:1410.8302 [hep-th]). Our starting point is the de Rham-Gabadadze-Tolley (dRGT) family of ghost free massive gravities and using a simple model of this family, we are able to express this action and these equations of motion in terms of a single metric in which the graviton propagates, hence removing in particular the need for a "reference metric" which is present in the non perturbative formulation. We show further how 5 covariant constraints can be obtained including one which leads to the tracelessness of the graviton on flat space-time and removes the Boulware-Deser ghost. This last constraint involves powers and combinations of the curvature of the background metric. The 5 constraints are obtained for a background metric which is unconstrained, i.e. which does not have to obey the background field equations. We then apply these results to the case of Einstein space-times, where we show that the 5 constraints become trivial, and Friedmann-Lema\\^{\\i}tre-Robertson-Walker space-times, for which we correct in particular some results that appeared elsewhere. To reach our results, we derive several non trivial identities, syzygies, involving the graviton fields, its derivatives and the background metric curvature. These identities have their own interest. We also discover that there exist backgrounds for which the dRGT equations cannot be unambiguously linearized.

  15. The Higgs mass derived from the U(3) Lie group

    E-Print Network [OSTI]

    Ole L. Trinhammer; Henrik G. Bohr; Mogens Stibius Jensen

    2015-07-07

    The Higgs mass value is derived from a Hamiltonian on the Lie group U(3) where we relate strong and electroweak energy scales. The baryon states of nucleon and delta resonances originate in specific Bloch wave degrees of freedom coupled to a Higgs mechanism which also gives rise to the usual gauge boson masses. The derived Higgs mass is around 125 GeV. From the same Hamiltonian we derive the relative neutron to proton mass ratio and the N and Delta mass spectra. All compare rather well with the experimental values. We predict scarce neutral flavor baryon singlets that should be visible in scattering cross sections for negative pions on protons, in photoproduction on neutrons, in neutron diffraction dissociation experiments and in invariant mass spectra of protons and negative pions in B-decays. The fundamental predictions are based on just one length scale and the fine structure constant. More particular predictions rely also on the weak mixing angle and the up-down quark flavor mixing matrix element. With differential forms on the measure-scaled wavefunction, we could generate approximate parton distribution functions for the u and d valence quarks of the proton that compare well with established experimental analysis.

  16. Evaluation of cement kiln laboratories testing hazardous waste derived fuels

    SciTech Connect (OSTI)

    Nichols, R.E.

    1998-12-31

    Cement kiln operators wishing to burn hazardous waste derived fuels in their kilns must submit applications for Resource Conservation Recovery Act permits. One component of each permit application is a site-specific Waste Analysis Plan. These Plans describe the facilities` sampling and analysis procedures for hazardous waste derived fuels prior to receipt and burn. The Environmental Protection Agency has conducted on-site evaluations of several cement kiln facilities that were under consideration for Resource Conservation Recovery Act permits. The purpose of these evaluations was to determine if the on-site sampling and laboratory operations at each facility complied with their site-specific Waste Analysis Plans. These evaluations covered sampling, laboratory, and recordkeeping procedures. Although all the evaluated facilities were generally competent, the results of those evaluations revealed opportunities for improvement at each facility. Many findings were noted for more than one facility. This paper will discuss these findings, particularly those shared by several facilities (specific facilities will not be identified). Among the findings to be discussed are the ways that oxygen bombs were scrubbed and rinsed, the analytical quality control used, Burn Tank sampling, and the analysis of pH in hazardous waste derived fuels.

  17. Benzene-derived N2-(4-hydroxyphenyl)-deoxyguanosine adduct: UvrABC incision and its conformation in DNA

    E-Print Network [OSTI]

    Hang, Bo

    2010-01-01

    p- benzoquinone DNA adducts derived from benzene are highlyphenol and hydroquinone derived mainly from diet andendonuclease toward the benzene-derived DNA adduct, pBQ-C.

  18. Brain-derived neurotrophic factor restores synaptic plasticity in a knock-in mouse model of Huntington's disease.

    E-Print Network [OSTI]

    2007-01-01

    term potentiation by brain-derived neurotrophic factor. JNeurobiology of Disease Brain-Derived Neurotrophic Factorbe rescued with brain-derived neurotrophic factor (BDNF).

  19. Transplantation of Adult Mouse iPS Cell-Derived Photoreceptor Precursors Restores Retinal Structure and Function in Degenerative Mice

    E-Print Network [OSTI]

    2011-01-01

    the phenomenon of HESC-derived RPE: anatomy of cell genesis,population of donor-derived photoreceptor cells (indicatedof human embryonic stem cell-derived photoreceptors restores

  20. Brain-derived neurotrophic factor promotes long-term potentiation-related cytoskeletal changes in adult hippocampus.

    E-Print Network [OSTI]

    Rex, Christopher S; Lin, Ching-Yi; Kramár, Eniko A; Chen, Lulu Y; Gall, Christine M; Lynch, Gary

    2007-01-01

    RC, Nicoll RA (1998) Brain-derived neurotrophic fac- tor (term potentiation by brain-derived neurotrophic factor. JSystems/Cognitive Brain-Derived Neurotrophic Factor Promotes

  1. Platelet-derived growth factor and transforming growth factor beta synergistically potentiate inflammatory mediator synthesis by fibroblast-like synoviocytes

    E-Print Network [OSTI]

    Rosengren, Sanna; Corr, Maripat; Boyle, David L

    2010-01-01

    et al. , Platelet-derived growth factor and transformingactivated by platelet-derived growth factor. Clin Expmesylate inhibits platelet derived growth factor stimulated

  2. ARM: SIRS: derived, correction of downwelling shortwave diffuse hemispheric measurements using Dutton and full algorithm

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Laura Riihimaki

    1997-03-21

    SIRS: derived, correction of downwelling shortwave diffuse hemispheric measurements using Dutton and full algorithm

  3. Molecular Structures of Fulvalenes Derived from Methylidenecycloproparenes: X-ray Structure Determinations and ab

    E-Print Network [OSTI]

    Apeloig, Yitzhak

    Molecular Structures of Fulvalenes Derived from Methylidenecycloproparenes: X-ray Structure methylidenecyclopropabenzene 3, the derived parent tria-, penta-, and heptafulvalene derivatives 4-6, and the crystalline derivatives 7, 8, and 9. The hydrocarbons are found to be polar, and the cycloproparenylidene moiety acts

  4. Facilitated phosphatidylserine flip-flop across vesicle and cell membranes using urea-derived synthetic translocases

    E-Print Network [OSTI]

    Smith, Bradley D.

    Facilitated phosphatidylserine flip-flop across vesicle and cell membranes using urea-derived)amine derivatives with appended urea and sulfonamide groups are shown to facilitate the translocation of fluorescent a library of tren-derived receptors and uncovered some active derivatives with appended urea groups.16

  5. Facilitated Phospholipid Flip-Flop Using Synthetic Steroid-Derived Translocases

    E-Print Network [OSTI]

    Smith, Bradley D.

    Facilitated Phospholipid Flip-Flop Using Synthetic Steroid-Derived Translocases Timothy N. Lambert research.4 Previously, we have reported that tris(2-aminoethyl)amine (tren)-derived translocases can of significantly more active synthetic translocases derived from cholic acid.6 Cholate derivatives 1-5 were

  6. Higher Derivative Gravity from the Universal Renormalization Group Machine

    E-Print Network [OSTI]

    F. Saueressig; K. Groh; S. Rechenberger; O. Zanusso

    2012-02-28

    We study the renormalization group flow of higher derivative gravity, utilizing the functional renormalization group equation for the average action. Employing a recently proposed algorithm, termed the universal renormalization group machine, for solving the flow equation, all the universal features of the one-loop beta-functions are recovered. While the universal part of the beta-functions admits two fixed points, we explicitly show that the existence of one of them depends on the choice of regularization scheme, indicating that it is most probably unphysical.

  7. Study of the derivative expansions for the nuclear structure functions

    E-Print Network [OSTI]

    I. Ruiz Simo; M. J. Vicente Vacas

    2008-07-31

    We study the convergence of the series expansions sometimes used in the analysis of the nuclear effects in Deep Inelastic Scattering (DIS) proccesses induced by leptons. The recent advances in statistics and quality of the data, in particular for neutrinos calls for a good control of the theoretical uncertainties of the models used in the analysis. Using realistic nuclear spectral functions which include nucleon correlations, we find that the convergence of the derivative expansions to the full results is poor except at very low values of $x$.

  8. Regional Production Economics for Ethylene and Propylene Derivatives 

    E-Print Network [OSTI]

    McCormack, G.; Pavone, T.

    1990-01-01

    copolymer (PP-BC) * Acrylonit~ile (ACN) * P~opylene glycol (PG) * Cumene (CUM) * 2-Ethylhexanol (2EH) * Isop~opyl alcohol (IPA) 59 TECHNOLOGY ALTERNATIVES Most of the olefin derivatives c~r be made using a variety of processes and sla~ting materlals... * PG- Dow chlo~ohydrin * CUM- benzene alkylation * 2-EH- Union Carbide rhodium * IPA- Deutsche Texaco direct hydration REPRESENTATIVE CAPACITY One requirement fo~ establishing ESL-IE-90-06-10 Proceedings from the 12th National Industrial Energy...

  9. Limited demand seen for scrubber-derived fertilizers

    SciTech Connect (OSTI)

    Not Available

    1985-12-01

    By-product marketability of scrubber-derived materials to the fertilizer industry will likely make only a small contribution to the acid rain problem. Those who claim the ammonia-based flue-gas materials will have an economic market cite the Bhara process undergoing testing at Indianapolis Power and Light for the removal of nitrogen oxides and sulfur dioxide, but fertilizer spokesmen feel the market will be limited to certain areas in the Midwest and the Pacific Northwest. This would reduce economic benefits. The Ebara material is easier to handle than ammonia, and should have a competitive price.

  10. Higher derivatives and power spectrum in effective single field inflation

    E-Print Network [OSTI]

    Jinn-Ouk Gong; Min-Seok Seo; Spyros Sypsas

    2015-03-10

    We study next-to-leading corrections to the effective action of the curvature perturbation obtained by integrating out the coupled heavy isocurvature perturbation. These corrections result from including higher order derivative operators, weighted by the mass scale of the heavy physics, in the effective theory expansion. We find that the correction terms are suppressed by the ratio of the Hubble parameter to the heavy mass scale. The corresponding corrections to the power spectrum of the curvature perturbation are presented for a simple illustrative example.

  11. THERMOCHEMICAL CONVERSION OF FERMENTATION-DERIVED OXYGENATES TO FUELS

    SciTech Connect (OSTI)

    Ramasamy, Karthikeyan K.; Wang, Yong

    2013-06-01

    At present ethanol generated from renewable resources through fermentation process is the dominant biofuel. But ethanol suffers from undesirable fuel properties such as low energy density and high water solubility. The production capacity of fermentation derived oxygenates are projected to rise in near future beyond the current needs. The conversion of oxygenates to hydrocarbon compounds that are similar to gasoline, diesel and jet fuel is considered as one of the viable option. In this chapter the thermo catalytic conversion of oxygenates generated through fermentation to fuel range hydrocarbons will be discussed.

  12. Ab Initio Derivation of Model Energy Density Functionals

    E-Print Network [OSTI]

    Dobaczewski, J

    2015-01-01

    I propose a simple and manageable method that allows for deriving coupling constants of model energy density functionals (EDFs) directly from ab initio calculations performed for finite fermion systems. A proof-of-principle application allows for linking properties of finite nuclei, determined by using the nuclear nonlocal Gogny functional, to the coupling constants of the quasilocal Skyrme functional. The method does not rely on properties of infinite fermion systems but on the ab initio calculations in finite systems. It also allows for quantifying merits of different model EDFs in describing the ab initio results.

  13. Ab Initio Derivation of Model Energy Density Functionals

    E-Print Network [OSTI]

    J. Dobaczewski

    2015-07-07

    I propose a simple and manageable method that allows for deriving coupling constants of model energy density functionals (EDFs) directly from ab initio calculations performed for finite fermion systems. A proof-of-principle application allows for linking properties of finite nuclei, determined by using the nuclear nonlocal Gogny functional, to the coupling constants of the quasilocal Skyrme functional. The method does not rely on properties of infinite fermion systems but on the ab initio calculations in finite systems. It also allows for quantifying merits of different model EDFs in describing the ab initio results.

  14. A derivation of linearized Griffith energies from nonlinear models

    E-Print Network [OSTI]

    Manuel Friedrich

    2015-04-07

    We derive Griffith functionals in the framework of linearized elasticity from nonlinear and frame indifferent energies in brittle fracture via Gamma-convergence. The convergence is given in terms of rescaled displacement fields measuring the distance of deformations from piecewise rigid motions. The configurations of the limiting model consist of partitions of the material, corresponding piecewise rigid deformations and displacement fields which are defined separately on each component of the cracked body. Apart from the linearized Griffith energy the limiting functional comprises also the segmentation energy which is necessary to disconnect the parts of the specimen.

  15. On Higher Derivative Terms in Tachyon Effective Actions

    E-Print Network [OSTI]

    N. D. Lambert; I. Sachs

    2001-05-08

    We reconstruct the tachyon effective action for unstable D-branes in superstring theory by examining its behaviour near exactly marginal deformations, where the ambigous higher derivative terms can be eliminated. We then compare this action with that obtained in boundary string field theory and find remarkable agreement. In particular, the tension for lower dimensional branes and the BI-action for the centre of mass motion are reprodued exactly. We also comment on the action for tachyons on the kink in a D-brane/anti-D-brane system and on bosonic string theory.

  16. Can physics laws be derived from monogenic functions?

    E-Print Network [OSTI]

    Jose B. Almeida

    2006-01-25

    This is a paper about geometry and how one can derive several fundamental laws of physics from a simple postulate of geometrical nature. The method uses monogenic functions analysed in the algebra of 5-dimensional spacetime, exploring the 4-dimensional waves that they generate. With this method one is able to arrive at equations of relativistic dynamics, quantum mechanics and electromagnetism. Fields as disparate as cosmology and particle physics will be influenced by this approach in a way that the paper only suggests. The paper provides an introduction to a formalism which shows prospects of one day leading to a theory of everything and suggests several areas of future development.

  17. Hydrogen from Bio-Derived Liquids (Presentation) | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12,ExecutiveFinancingR Walls -Hydro-Pac Inc.,1Activityfrom Bio-Derived Liquids

  18. Reading the tea leaves : the Tea Party movement, the conservative establishment and the collapse of climate change legislation

    E-Print Network [OSTI]

    Dineen, Kathryn P. (Kathryn Patricia)

    2011-01-01

    The Tea Party movement, which derives its name and revolutionary zeal from the 1773 Boston Tea Party anti-tax protest, emerged in response to the Obama Administration's economic stimulus package and later coalesced around ...

  19. Brazilian Dairy Model: Impacts of Agricultural Policies and Exogenous Shocks 

    E-Print Network [OSTI]

    Rodrigues Carvalho, Glauco

    2015-04-28

    structural econometric model of the Brazilian dairy sector is used to analyze the consequences of changes in policies and other variables of interest on the production, consumption, and milk prices. A stochastic approach is also developed that incorporates...

  20. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...