Sample records for readiness level trl

  1. Development of Technology Readiness Level (TRL) Metrics and Risk Measures

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.; Anderson, K. K.; Sivaramakrishnan, Chandrika; Lansing, Carina

    2012-10-01T23:59:59.000Z

    This is an internal project milestone report to document the CCSI Element 7 team's progress on developing Technology Readiness Level (TRL) metrics and risk measures. In this report, we provide a brief overview of the current technology readiness assessment research, document the development of technology readiness levels (TRLs) specific to carbon capture technologies, describe the risk measures and uncertainty quantification approaches used in our research, and conclude by discussing the next steps that the CCSI Task 7 team aims to accomplish.

  2. CCSI Technology Readiness Levels Likelihood Model (TRL-LM) User’s Guide

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.; Sivaramakrishnan, Chandrika; Lansing, Carina

    2013-03-26T23:59:59.000Z

    This is the manual for the Carbon Capture Simulation Initiative (CCSI) Technology Readiness Level Likelihood model based on PNNL velo.

  3. An Analysis of TRL-Based Cost and Schedule Models

    E-Print Network [OSTI]

    Kenley, C. Robert

    2012-04-30T23:59:59.000Z

    The GAO's, NASA's, and the DoD's adoption of the technology readiness level (TRL) scale to improve technology management has led to the emergence of many TRL-based models that are used to monitor technology maturation, ...

  4. TRL Computer System User’s Guide

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.

    2014-01-31T23:59:59.000Z

    We have developed a wiki-based graphical user-interface system that implements our technology readiness level (TRL) uncertainty models. This document contains the instructions for using this wiki-based system.

  5. Technology Readiness Levels for Advanced Nuclear Fuels and Materials Development

    SciTech Connect (OSTI)

    Jon Carmack

    2014-01-01T23:59:59.000Z

    The Technology Readiness Level (TRL) process is used to quantitatively assess the maturity of a given technology. The TRL process has been developed and successfully used by the Department of Defense (DOD) for development and deployment of new technology and systems for defense applications. In addition, NASA has also successfully used the TRL process to develop and deploy new systems for space applications. Advanced nuclear fuels and materials development is a critical technology needed for closing the nuclear fuel cycle. Because the deployment of a new nuclear fuel forms requires a lengthy and expensive research, development, and demonstration program, applying the TRL concept to the advanced fuel development program is very useful as a management and tracking tool. This report provides definition of the technology readiness level assessment process as defined for use in assessing nuclear fuel technology development for the Advanced Fuel Campaign (AFC).

  6. Early Market TRL/MRL Analysis

    SciTech Connect (OSTI)

    Ronnebro, Ewa; Stetson, Ned

    2013-12-01T23:59:59.000Z

    he focus of this report is TRL/MRL analysis of hydrogen storage; it documents the methodology and results of an effort to identify hydrogen storage technologies’ technical and manufacturing readiness for early market motive and non-motive applications and to provide a path forward toward commercialization. Motive applications include materials handling equipment (MHE) and ground support equipment (GSE), such as forklifts, tow tractors, and specialty vehicles such as golf carts, lawn mowers and wheel chairs. Non-motive applications are portable, stationary or auxiliary power units (APUs) and include portable laptops, backup power, remote sensor power, and auxiliary power for recreational vehicles, hotels, hospitals, etc. Hydrogen storage technologies assessed include metal hydrides, chemical hydrides, sorbents, gaseous storage, and liquid storage. The assessments are based on a combination of Technology Readiness Level (TRL) and Manufacturing Readiness Level (MRL) designations that enable evaluation of hydrogen storage technologies at varying levels of development. The manufacturing status could be established from eight risk elements: Technical Maturity, Design, Materials, Cost & Funding, Process Capability, Personnel, Facilities and Manufacturing Planning. This approach provides a logical methodology and roadmap to enable the identification of hydrogen storage technologies, their advantages/disadvantages, gaps and R&D needs on an unbiased and transparent scale that is easily communicated to interagency partners. This technology readiness assessment (TRA) report documents the process used to conduct the TRA/MRA (technology and manufacturing readiness assessment), reports the TRL and MRL for each assessed technology and provides recommendations based on the findings. To investigate the state of the art and needs to mature the technologies, PNNL prepared a questionnaire to assign TRL and MRL for each hydrogen storage technology. The questionnaire was sent to identified hydrogen storage technology developers and manufacturers who were asked to perform a self-assessment. We included both domestic and international organizations including U.S. national laboratories, U.S. companies, European companies and Japanese companies. PNNL collected the data and performed an analysis to deduce the level of maturity and to provide program recommendations.

  7. September 4-5, 2008/ARR TRL Assessment of Fusion Power Plant

    E-Print Network [OSTI]

    Raffray, A. René

    September 4-5, 2008/ARR 1 TRL Assessment of Fusion Power Plant Subsystems A. René Raffray of tritium throughout the entire plant, including breeding and recovery. 12. Power Extraction: Understand how the readiness level of the blanket subsystem for a fusion power plant (DEMO and beyond) · In order to develop

  8. On the integration of technology readiness levels at Sandia National Laboratories.

    SciTech Connect (OSTI)

    Bailey, Beatriz R.; Mitchell, John Anthony

    2006-09-01T23:59:59.000Z

    Integrating technology readiness levels (TRL) into the management of engineering projects is critical to the mitigation of risk and improved customer/supplier communications. TRLs provide a common framework and language with which consistent comparisons of different technologies and approaches can be made. At Sandia National Laboratories, where technologies are developed, integrated and deployed into high consequence systems, the use of TRLs may be transformational. They are technology independent and span the full range of technology development including scientific and applied research, identification of customer requirements, modeling and simulation, identification of environments, testing and integration. With this report, we provide a reference set of definitions for TRLs and a brief history of TRLs at Sandia National Laboratories. We then propose and describe two approaches that may be used to integrate TRLs into the NW SMU business practices. In the first approach, we analyze how TRLs can be integrated within concurrent qualification as documented in TBP-100 [1]. In the second approach we take a look at the product realization process (PRP) as documented in TBP-PRP [2]. Both concurrent qualification and product realization are fundamental to the way weapons engineering work is conducted at this laboratory and the NWC (nuclear weapons complex) as a whole. Given the current structure and definitions laid out in the TBP-100 and TBP-PRP, we believe that integrating TRLs into concurrent qualification (TBP-100) rather than TBP-PRP is optimal. Finally, we note that our charter was to explore and develop ways of integrating TRLs into the NW SMU and therefore we do not significantly cover the development and history of TRLs. This work was executed under the auspices and direction of Sandia's Weapon Engineering Program. Please contact Gerry Sleefe, Deputy Program Director, for further information.

  9. Technology and Manufacturing Readiness of Early Market Motive and Non-Motive Hydrogen Storage Technologies for Fuel Cell Applications

    SciTech Connect (OSTI)

    Ronnebro, Ewa

    2012-06-16T23:59:59.000Z

    PNNL’s objective in this report is to provide DOE with a technology and manufacturing readiness assessment to identify hydrogen storage technologies’ maturity levels for early market motive and non-motive applications and to provide a path forward toward commercialization. PNNL’s Technology Readiness Assessment (TRA) is based on a combination of Technology Readiness Level (TRL) and Manufacturing Readiness Level (MRL) designations that enable evaluation of hydrogen storage technologies in varying levels of development. This approach provides a logical methodology and roadmap to enable the identification of hydrogen storage technologies, their advantages/disadvantages, gaps and R&D needs on an unbiased and transparent scale that is easily communicated to interagency partners. The TRA report documents the process used to conduct the TRA, reports the TRL and MRL for each assessed technology and provides recommendations based on the findings.

  10. Final Report on HOLODEC 2 Technology Readiness Level

    SciTech Connect (OSTI)

    Shaw, RA; Spuler, SM; Beals, M; Black, N; Fugal, JP; Lu, L

    2012-06-18T23:59:59.000Z

    During the period of this project, the Holographic Detector for Clouds 2 (HOLODEC 2) instrument has advanced from a laboratory-proven instrument with some initial field testing to a fully flight-tested instrument capable of providing useful cloud microphysics measurements. This can be summarized as 'Technology Readiness Level 8: Technology is proven to work - Actual technology completed and qualified through test and demonstration.' As part of this project, improvements and upgrades have been made to the optical system, the instrument power control system, the data acquisition computer, the instrument control software, the data reconstruction and analysis software, and some of the basic algorithms for estimating basic microphysical variables like droplet diameter. Near the end of the project, the instrument flew on several research flights as part of the IDEAS 2011 project, and a small sample of data from the project is included as an example. There is one caveat in the technology readiness level stated above: the upgrades to the instrument power system were made after the flight testing, so they are not fully field proven. We anticipate that there will be an opportunity to fly the instrument as part of the IDEAS project in fall 2012.

  11. Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of...

    Broader source: Energy.gov (indexed) [DOE]

    Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE...

  12. NGNP – Creating Validated TRL and TDRMs for Critical Systems, Subsystems, and Components

    SciTech Connect (OSTI)

    John W. Collins; John M. Beck; Emmanuel O. Opare; Layne F. Pincock

    2008-09-01T23:59:59.000Z

    This report introduces two draft Next Generation Nuclear Plant (NGNP) Technology Development Roadmaps (TDRMs) and documents the methods used to create them. As such, this report depicts the development of the hardware needed to successfully operate the NGNP and identifies this hardware by the area of the plant it supports and by system, subsystem, and component (SSC). Several options exist for which technologies are selected to fulfill the functions of the NGNP. These options are represented by differing SSCs and are grouped into reference designs. Each SSC associated with each reference design is evaluated, rated, and assigned a technology readiness level (TRL). A rollup of the TRLs allows for comparison of the various reference designs. A TDRM then documents the tasks needed to obtain information in key discriminating criteria to support technology down selection and the tasks and test required to sufficiently mature the technology and reduce the likelihood of technological failure upon installation. This report presents the path forward, methods, and tools used to understand the requirements, manage the uncertainty, and mitigate the risk for the NGNP project. The key tool, TDRMs, is the means to facilitate NGNP risk-informed decision making, technology down selection, and technology qualification and maturation while serving to coordinate engineering, research and development, and licensing efforts.

  13. Turner Hunt Ocean Renewable (TRL 4 System) - THOR's Power Method...

    Broader source: Energy.gov (indexed) [DOE]

    More Documents & Publications CX-004722: Categorical Exclusion Determination Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE Water Power...

  14. Resolute Marine Energy, Inc (TRL 1 2 3 Component) | Department...

    Broader source: Energy.gov (indexed) [DOE]

    devwaveactptoelectricgenrmeachertok1.ppt More Documents & Publications Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE CX-004795:...

  15. Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine Project Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine Project Dehlsen (TRL 5 6 System) -...

  16. An evaluation of fusion energy R&D gaps using Technology Readiness Levels

    E-Print Network [OSTI]

    for prioritization. #12;The topic of fusion energy R&D gaps is receiving increased attention page 2 of 16 In EUAn evaluation of fusion energy R&D gaps using Technology Readiness Levels M. S. Tillack to develop and apply this technology assessment approach to fusion energy are reported here. #12;We adopted

  17. Property:Technology Readiness Level | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to:Ezfeedflag Jump to:ID8/OrganizationTechProbSolutions Jump to: navigation, search PropertyLevel

  18. Northwest Energy Innovations (TRL 5 6 System)- WETNZ MtiMode Wave Energy Converter Advancement Project

    Broader source: Energy.gov [DOE]

    Northwest Energy Innovations (TRL 5 6 System) - WETNZ MtiMode Wave Energy Converter Advancement Project

  19. Northwest Energy Innovations (TRL 5 6 System) - WETNZ MtiMode...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Northwest Energy Innovations (TRL 5 6 System) - WETNZ MtiMode Wave Energy Converter Advancement Project Northwest Energy Innovations (TRL 5 6 System) - WETNZ MtiMode Wave Energy...

  20. Preliminary Technology Maturation Plan for Immobilization of High-Level Waste in Glass Ceramics

    SciTech Connect (OSTI)

    Vienna, John D.; Crum, Jarrod V.; Sevigny, Gary J.; Smith, G L.

    2012-09-30T23:59:59.000Z

    A technology maturation plan (TMP) was developed for immobilization of high-level waste (HLW) raffinate in a glass ceramics waste form using a cold-crucible induction melter (CCIM). The TMP was prepared by the following process: 1) define the reference process and boundaries of the technology being matured, 2) evaluate the technology elements and identify the critical technology elements (CTE), 3) identify the technology readiness level (TRL) of each of the CTE’s using the DOE G 413.3-4, 4) describe the development and demonstration activities required to advance the TRLs to 4 and 6 in order, and 5) prepare a preliminary plan to conduct the development and demonstration. Results of the technology readiness assessment identified five CTE’s and found relatively low TRL’s for each of them: • Mixing, sampling, and analysis of waste slurry and melter feed: TRL-1 • Feeding, melting, and pouring: TRL-1 • Glass ceramic formulation: TRL-1 • Canister cooling and crystallization: TRL-1 • Canister decontamination: TRL-4 Although the TRL’s are low for most of these CTE’s (TRL-1), the effort required to advance them to higher values. The activities required to advance the TRL’s are listed below: • Complete this TMP • Perform a preliminary engineering study • Characterize, estimate, and simulate waste to be treated • Laboratory scale glass ceramic testing • Melter and off-gas testing with simulants • Test the mixing, sampling, and analyses • Canister testing • Decontamination system testing • Issue a requirements document • Issue a risk management document • Complete preliminary design • Integrated pilot testing • Issue a waste compliance plan A preliminary schedule and budget were developed to complete these activities as summarized in the following table (assuming 2012 dollars). TRL Budget Year MSA FMP GCF CCC CD Overall $M 2012 1 1 1 1 4 1 0.3 2013 2 2 1 1 4 1 1.3 2014 2 3 1 1 4 1 1.8 2015 2 3 2 2 4 2 2.6 2016 2 3 2 2 4 2 4.9 2017 2 3 3 2 4 2 9.8 2018 3 3 3 3 4 3 7.9 2019 3 3 3 3 4 3 5.1 2020 3 3 3 3 4 3 14.6 2021 3 3 3 3 4 3 7.3 2022 3 3 3 3 4 3 8.8 2023 4 4 4 4 4 4 9.1 2024 5 5 5 5 5 5 6.9 2025 6 6 6 6 6 6 6.9 CCC = canister cooling and crystallization; FMP = feeding, melting, and pouring; GCF = glass ceramic formulation; MSA = mixing, sampling, and analyses. This TMP is intended to guide the development of the glass ceramics waste form and process to the point where it is ready for industrialization.

  1. Software Technology Readiness for the Smart Grid

    SciTech Connect (OSTI)

    Tugurlan, Maria C.; Kirkham, Harold; Chassin, David P.

    2011-06-13T23:59:59.000Z

    Abstract Budget and schedule overruns in product development due to the use of immature technologies constitute an important matter for program managers. Moreover, unexpected lack of technology maturity is also a problem for buyers. Both sides of the situation would benefit from an unbiased measure of technology maturity. This paper presents the use of a software maturity metric called Technology Readiness Level (TRL), in the milieu of the smart grid. For most of the time they have been in existence, power utilities have been protected monopolies, guaranteed a return on investment on anything they could justify adding to the rate base. Such a situation did not encourage innovation, and instead led to widespread risk-avoidance behavior in many utilities. The situation changed at the end of the last century, with a series of regulatory measures, beginning with the Public Utility Regulatory Policy Act of 1978. However, some bad experiences have actually served to strengthen the resistance to innovation by some utilities. Some aspects of the smart grid, such as the addition of computer-based control to the power system, face an uphill battle. It is our position that the addition of TRLs to the decision-making process for smart grid power-system projects, will lead to an environment of more confident adoption.

  2. Bayer Material Science (TRL 1 2 3 System)- River Devices to Recover Energy with Advanced Materials(River DREAM)

    Broader source: Energy.gov [DOE]

    Bayer Material Science (TRL 1 2 3 System) - River Devices to Recover Energy with Advanced Materials(River DREAM)

  3. Ocean Renewable Power Co (ORPC) (TRL 7 8 System)- TidGen (TM) Power System Commercialization Project

    Broader source: Energy.gov [DOE]

    Ocean Renewable Power Co (ORPC) (TRL 7 8 System) - TidGen (TM) Power System Commercialization Project

  4. Princeton Power Systems (TRL 5 6 Component)- Marine High-Voltage Power Conditioning and Transmission System with Integrated Energy Storage

    Broader source: Energy.gov [DOE]

    Princeton Power Systems (TRL 5 6 Component) - Marine High-Voltage Power Conditioning and Transmission System with Integrated Energy Storage

  5. Readiness Assurance

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysis andBHoneywell9/%2A en7/%2A en Readiness

  6. Bayer Material Science (TRL 1 2 3 System) - River Devices to...

    Broader source: Energy.gov (indexed) [DOE]

    Water Power Program Peer Review Meeting Agenda Water Power Program: 2011 Peer Review Report Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE...

  7. Free Flow Energy (TRL 1 2 3 Component) - Design and Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Free Flow Energy (TRL 1 2 3 Component) - Design and Development of a Cross-Platform Submersible Generator Optimized for the Conditions of Current Energy Conversion Free Flow Energy...

  8. System Verification Through Reliability, Availability, Maintainability (RAM) Analysis & Technology Readiness Levels (TRLs)

    SciTech Connect (OSTI)

    Emmanuel Ohene Opare, Jr.; Charles V. Park

    2011-06-01T23:59:59.000Z

    The Next Generation Nuclear Plant (NGNP) Project, managed by the Idaho National Laboratory (INL), is authored by the Energy Policy Act of 2005, to research, develop, design, construct, and operate a prototype fourth generation nuclear reactor to meet the needs of the 21st Century. A section in this document proposes that the NGNP will provide heat for process heat applications. As with all large projects developing and deploying new technologies, the NGNP is expected to meet high performance and availability targets relative to current state of the art systems and technology. One requirement for the NGNP is to provide heat for the generation of hydrogen for large scale productions and this process heat application is required to be at least 90% or more available relative to other technologies currently on the market. To reach this goal, a RAM Roadmap was developed highlighting the actions to be taken to ensure that various milestones in system development and maturation concurrently meet required availability requirements. Integral to the RAM Roadmap was the use of a RAM analytical/simulation tool which was used to estimate the availability of the system when deployed based on current design configuration and the maturation level of the system.

  9. Zero Energy Ready Home | Department of Energy

    Office of Environmental Management (EM)

    Home Zero Energy Ready Home Look for the Label Look for the Label The DOE Zero Energy Ready Home label is a symbol of excellence. Learn what's behind this new level of performance....

  10. DOE Zero Energy Ready Home Consolidated Renewable Energy Ready...

    Office of Environmental Management (EM)

    Consolidated Renewable Energy Ready Checklist DOE Zero Energy Ready Home Consolidated Renewable Energy Ready Checklist All homes certified as DOE Zero Energy Ready Homes must meet...

  11. Laminar Flow Control Flight Experiment Design

    E-Print Network [OSTI]

    Tucker, Aaron 1975-

    2012-11-29T23:59:59.000Z

    ?s Airframe Technology subproject [2]. The task is charged 2 with increasing the Technology Readiness Level (TRL) from a laboratory environment (TRL 4) at the Texas A&M University Flight Research Laboratory to an operationally relevant flight environment...

  12. adjustment model based: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary: The GAO's, NASA's, and the DoD's adoption of the technology readiness level (TRL) scale to improve technology management has led to the emergence of many TRL-based...

  13. US Synthetic Corp (TRL 4 Component)- The Development of Open, Water Lubricated Polycrystalline Diamond Thrust Bearings for use in Marine Hydrokinetic (MHK) Energy Machines

    Broader source: Energy.gov [DOE]

    US Synthetic Corp (TRL 4 Component) - The Development of Open, Water Lubricated Polycrystalline Diamond Thrust Bearings for use in Marine Hydrokinetic (MHK) Energy Machines

  14. PV Solar Ready

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Boudra: This report presents guidelines for designing and building new houses that are Solar Ready. Following Solar Ready guidelines will streamline the process of equipping these...

  15. Ready, set...go!

    SciTech Connect (OSTI)

    Alexandre, Melanie

    2010-06-16T23:59:59.000Z

    The objectives of this paper are: (1) Discuss organizational readiness for changes in an ergonomics program or intervention; (2) Assessing organizational readiness; (3) Benefits and challenges of change; and (4) Case studies of ergonomic programs that were 'not ready' and 'ready'.

  16. approaches 22nd symposium: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Engineering 941 W Symposium MIT, Cambridge, MA, March 29-31, 2004 ABSTRACT NASA's Technology Readiness Levels (TRL) approach de Weck, Olivier L. First Page Previous Page 1...

  17. Technology Readiness Assessment Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-09-15T23:59:59.000Z

    The Guide assists individuals and teams involved in conducting Technology Readiness Assessments (TRAs) and developing Technology Maturation Plans (TMPs) for the DOE capital asset projects subject to DOE O 413.3B. Cancels DOE G 413.3-4.

  18. Emergency Readiness Assurance Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1992-02-27T23:59:59.000Z

    To establish the requirements of the Emergency Readiness Assurance Program with a goal of assurting that the Department of Energy (DOE) Emergency Management System (EMS) is ready to respond promptly, efficiently, and effectively to any emergency involving DOE facilities or requiring DOE assistance. Cancels DOE O 5500.10 dated 4-30-91. Chg 1 dated 2-27-92. Change 1 canceled by DOE O 151.1 of 9-25-95.

  19. Webinar: Marketing and Sales Solutions for Zero Energy Ready Homes

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy Zero Energy Ready Home (ZERH) Program represents a whole new level of home performance, with rigorous requirements that ensure outstanding levels of energy savings,...

  20. ats technology readiness: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ats technology readiness First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Technology Readiness Level...

  1. Community Readiness Assessments | Department of Energy

    Energy Savers [EERE]

    Community Readiness Assessments Better Buildings Residential Network Program Sustainability Peer Exchange Call Series: Community Readiness Assessments, Call Slides and...

  2. Hydrogen Infrastructure Market Readiness Workshop: Preliminary...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Workshop: Preliminary Results Hydrogen Infrastructure Market Readiness Workshop: Preliminary Results Preliminary results from the Hydrogen Infrastructure Market Readiness Workshop...

  3. Ready, set, go . . . well maybe

    SciTech Connect (OSTI)

    Alexandre, Melanie M; Bartolome, Terri-Lynn C

    2011-02-28T23:59:59.000Z

    The agenda for this presentation is: (1) understand organizational readiness for changes; (2) review benefits and challenges of change; (3) share case studies of ergonomic programs that were 'not ready' and some that were 'ready'; and (4) provide some ideas for facilitating change.

  4. Technology Readiness and the Smart Grid

    SciTech Connect (OSTI)

    Kirkham, Harold; Marinovici, Maria C.

    2013-02-27T23:59:59.000Z

    Technology Readiness Levels (TRLs) originated as a way for the National Aeronautics and Space Administration (NASA) to monitor the development of systems being readied for space. The technique has found wide application as part of the more general topic of system engineering. In this paper, we consider the applicability of TRLs to systems being readied for the smart grid. We find that there are many useful parallels, and much to be gained by this application. However, TRLs were designed for a developer who was also a user. That is not usually the case for smart grid developments. We consider the matter from the point of view of the company responsible for implementation, typically a utility, and we find that there is a need for connecting the many standards in the industry. That connection is explored, and some new considerations are introduced.

  5. DOE Zero Energy Ready Home Solar Hot Water-Ready Checklist |...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Solar Hot Water-Ready Checklist DOE Zero Energy Ready Home Solar Hot Water-Ready Checklist DOE Zero Energy Ready Home National Program encourages, but does not require,...

  6. Ready, set, go . . . well maybe

    E-Print Network [OSTI]

    Alexandre, Melanie M

    2011-01-01T23:59:59.000Z

    at the 2011 Applied Ergonomics Conference By Melaniesustainable? Case study of ergonomics program that was ‘ notwas not! Case study of ergonomics program that was ‘ready’

  7. Development of a Robotic Simulation Platform for Spacecraft Proximity Operations and Contact Dynamics Experiments

    E-Print Network [OSTI]

    Probe, Austin Breien

    2013-12-03T23:59:59.000Z

    A major challenge facing the introduction of new technologies and techniques in space flight is the high cost required to raise the Technological Readiness Level (TRL) prior to flight. This is a result of the cost and scarcity of developmental...

  8. Evaluation of Coarse Sun Sensor in a Miniaturized Distributed Relative Navigation System: An Experimental and Analytical Investigation

    E-Print Network [OSTI]

    Maeland, Lasse

    2012-07-16T23:59:59.000Z

    Rendezvous Sensor SMEX Small Explorer SNR Signal to Noise Ratio SSC Swedish Space Corporation SSLS Space Borne Laser System STS Space Transportation System TRL Technology Readiness Level TTL Transistor-Transistor Logic UT The University of Texas VBS... in multiple missions. Small 5 satellites have been identi ed as a low cost option for technology demonstrations to increase Technology Readiness Levels (TRL), as well as Earth science, communica- tion and responsive-space missions for the military [15...

  9. Readiness Review RM | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo.FrequencyEO-05-01:RegulatoryReadiness

  10. Webinar: Ventilation and Filtration Strategies with Indoor airPLUS and Zero Energy Ready Homes

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy Zero Energy Ready Home (ZERH) Program represents a whole new level of home performance, with rigorous requirements that ensure outstanding levels of energy savings,...

  11. ZERH Webinar: Energy- and Water- Efficiency in the DOE Zero Energy Ready Home Program

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy Zero Energy Ready Home (ZERH) Program represents a whole new level of home performance, with rigorous requirements that ensure outstanding levels of energy savings,...

  12. Implementation plan for WRAP Module 1 operational readiness review

    SciTech Connect (OSTI)

    Irons, L.G.

    1994-11-04T23:59:59.000Z

    The Waste Receiving and Processing Module 1 (WRAP 1) will be used to receive, sample, treat, and ship contact-handled (CH) transuranic (TRU), low-level waste (LLW), and low-level mixed waste (LLMW) to storage and disposal sites both on the Hanford site and off-site. The primary mission of WRAP 1 is to characterize and certify CH waste in 55-gallon and 85-gallon drums; and its secondary function is to certify CH waste standard waste boxes (SWB) and boxes of similar size for disposal. The WRAP 1 will provide the capability for examination (including x-ray, visual, and contents sampling), limited treatment, repackaging, and certification of CH suspect-TRU waste in 55-gallon drums retrieved from storage, as well as newly generated CH LLW and CH TRU waste drums. The WRAP 1 will also provide examination (X-ray and visual only) and certification of CH LLW and CH TRU waste in small boxes. The decision to perform an Operational Readiness Review (ORR) was made in accordance with WHC-CM-5-34, Solid Waste Disposal Operations Administration, Section 1.4, Operational Readiness Activities. The ORR will ensure plant and equipment readiness, management and personnel readiness, and management programs readiness for the initial startup of the facility. This implementation plan is provided for defining the conduct of the WHC ORR.

  13. EM Performs Tenth Technology Readiness Assessment

    Broader source: Energy.gov [DOE]

    WASHINGTON, D.C. – EM recently completed its tenth Technology Readiness Assessment (TRA) since piloting the TRA process in 2006.

  14. Solar Ready: An Overview of Implementation Practices

    SciTech Connect (OSTI)

    Watson, A.; Guidice, L.; Lisell, L.; Doris, L.; Busche, S.

    2012-01-01T23:59:59.000Z

    This report explores three mechanisms for encouraging solar ready building design and construction: solar ready legislation, certification programs for solar ready design and construction, and stakeholder education. These methods are not mutually exclusive, and all, if implemented well, could contribute to more solar ready construction. Solar ready itself does not reduce energy use or create clean energy. Nevertheless, solar ready building practices are needed to reach the full potential of solar deployment. Without forethought on incorporating solar into design, buildings may be incompatible with solar due to roof structure or excessive shading. In these cases, retrofitting the roof or removing shading elements is cost prohibitive. Furthermore, higher up-front costs due to structural adaptations and production losses caused by less than optimal roof orientation, roof equipment, or shading will lengthen payback periods, making solar more expensive. With millions of new buildings constructed each year in the United States, solar ready can remove installation barriers and increase the potential for widespread solar adoption. There are many approaches to promoting solar ready, including solar ready legislation, certification programs, and education of stakeholders. Federal, state, and local governments have the potential to implement programs that encourage solar ready and in turn reduce barriers to solar deployment. With the guidance in this document and the examples of jurisdictions and organizations already working to promote solar ready building practices, federal, state, and local governments can guide the market toward solar ready implementation.

  15. ARM - Ingest Readiness Form

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006Datastreamstwrcam40m DocumentationJanuary 9, 2009 [Events,

  16. Construction Readiness RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.AttachmentEnergyGeneratingConstruction

  17. Readiness Review RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring SolarNo.FrequencyEO-05-01:Regulatory

  18. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposed Action(InsertAbout theSystems3,SOLID OXIDE

  19. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposed Action(InsertAbout theSystems3,SOLID OXIDEDECEMBER

  20. Technology Readiness Assessment Report

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2Uranium Transferon the PassingRoutingEnergy TechnologistDepartment

  1. Nuclear explosives testing readiness evaluation

    SciTech Connect (OSTI)

    Valk, T.C.

    1993-09-01T23:59:59.000Z

    This readiness evaluation considers hole selection and characterization, verification, containment issues, nuclear explosive safety studies, test authorities, event operations planning, canister-rack preparation, site preparation, diagnostic equipment setup, device assembly facilities and processes, device delivery and insertion, emplacement, stemming, control room activities, readiness briefing, arming and firing, test execution, emergency response and reentry, and post event analysis to include device diagnostics, nuclear chemistry, and containment. This survey concludes that the LLNL program and its supporting contractors could execute an event within six months of notification, and a second event within the following six months, given the NET group`s evaluation and the following three restraints: (1) FY94 (and subsequent year) funding is essentially constant with FY93, (2) Preliminary work for the initial event is completed to the historical sic months status, (3) Critical personnel, currently working in dual use technologies, would be recallable as needed.

  2. Transportation System Readiness and Resiliency Assessment Framework: Readiness and Assess Resiliency of

    E-Print Network [OSTI]

    Transportation System Readiness and Resiliency Assessment Framework: Readiness and Assess Resiliency of Transportation Systems (Infrastructure, Systems, Organization and Services) to Deter, Detect Flows Passenger Flows Supply Chain Efficiency Transportation: Energy Environment Safety Security Vehicle

  3. Hydrogen Infrastructure Market Readiness: Opportunities and Potential...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Opportunities and Potential for Near-term Cost Reductions. Proceedings of the Hydrogen Infrastructure Market Readiness Workshop and Summary of Feedback Provided through the...

  4. Richmond Electric Vehicle Initiative Electric Vehicle Readiness...

    Broader source: Energy.gov (indexed) [DOE]

    The REVi plan addresses the electric vehicle market in Richmond and then addresses a regional plan, policies, and analysis of the the communities readiness. richmondevinitiative....

  5. Richmond Electric Vehicle Initiative Electric Vehicle Readiness...

    Broader source: Energy.gov (indexed) [DOE]

    reflect those of the United States Government or any agency thereof. Richmond Electric Vehicle Initiative Readiness Plan | 1 Table of Contents Executive Summary...

  6. Technology Readiness Assessments | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Documents Available for Download August 1, 2013 Technology Readiness Assessment (TRA)Technology Maturation Plan (TMP) Process Guide This document is a guide for those involved in...

  7. Uranium Processing Facility Site Readiness Subproject Completed...

    National Nuclear Security Administration (NNSA)

    Field Offices Welcome to the NNSA Production Office NPO News Releases Uranium Processing Facility Site Readiness Subproject Completed ... Uranium Processing Facility Site...

  8. Organizational Readiness in Specialty Mental Health Care

    E-Print Network [OSTI]

    Hamilton, Alison B.; Cohen, Amy N.; Young, Alexander S.

    2010-01-01T23:59:59.000Z

    et al. Assessing the organizational social context (OSC) of1– 15. Rosenheck R. Organizational process: a missing linkSimpson DD. Assessing organizational readiness for change. J

  9. Are You Ready? A Texas Hurricane

    E-Print Network [OSTI]

    Are You Ready? A Texas Hurricane Survival Guide evacuation information Evacuation information ___ plastic garbage bags and ties ___ liquid soap, detergent, disinfectant, household chlorine bleach

  10. Sandia National Laboratories: verify operational readiness of...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    verify operational readiness of SWiFT controller systems Scaled Wind Farm Technology Facility Baselining Project Accelerates Work On April 7, 2014, in Energy, Facilities, News,...

  11. DOE Zero Energy Ready Home Verification...

    Broader source: Energy.gov (indexed) [DOE]

    Zero Energy Ready Home Verification Summary DRAFT REMRate - Residential Energy Analysis and Rating Software v14.5.1 This information does not constitute any warranty of energy...

  12. Mission and Readiness Assessment for Fusion Nuclear Facilities

    SciTech Connect (OSTI)

    G.H. Neilson, et. al.

    2012-12-12T23:59:59.000Z

    Magnetic fusion development toward DEMO will most likely require a number of fusion nuclear facilities (FNF), intermediate between ITER and DEMO, to test and validate plasma and nuclear technologies and to advance the level of system integration. The FNF mission space is wide, ranging from basic materials research to net electricity demonstration, so there is correspondingly a choice among machine options, scope, and risk in planning such a step. Readiness requirements to proceed with a DEMO are examined, and two FNF options are assessed in terms of the contributions they would make to closing DEMO readiness gaps, and their readiness to themselves proceed with engineering design about ten years from now. An advanced tokamak (AT) pilot plant with superconducting coils and a mission to demonstrate net electricity generation would go a long way toward DEMO. As a next step, however, a pilot plant would entail greater risk than a copper-coil FNSF-AT with its more focussed mission and technology requirements. The stellarator path to DEMO is briefly discussed. Regardless of the choice of FNF option, an accompanying science and technology development program, also aimed at DEMO readiness, is absolutely essential.

  13. DOE Zero Energy Ready Home National Program Requirements (Rev...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    4) DOE Zero Energy Ready Home National Program Requirements (Rev. 04) U.S. Department of Energy Zero Energy Ready Home National Program Requirements (Rev. 04) DOE Zero Energy Ready...

  14. Zero Energy Ready Home Events | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Residential Buildings Zero Energy Ready Home Zero Energy Ready Home Events Zero Energy Ready Home Events September 2014 < prev next > Sun Mon Tue Wed Thu Fri Sat 31 1 2 3 4 5...

  15. Roundtable on Sustainable Biofuels Certification Readiness Study

    E-Print Network [OSTI]

    Roundtable on Sustainable Biofuels Certification Readiness Study: Hawai`i Biofuel Projects Prepared 12.1 Deliverable Bioenergy Analyses Prepared by Hawai`i Biofuel Foundation And NCSI Americas Inc agency thereof. #12;1 RSB Certification Readiness Study: Hawaii Biofuel Projects Prepared For Hawaii

  16. Effects of Parent Expectations and Involvement on the School Readiness of Children in Head Start

    E-Print Network [OSTI]

    Cook, Krystal Tisha'

    2010-10-12T23:59:59.000Z

    EFFECTS OF PARENT EXPECTATIONS AND INVOLVEMENT ON THE SCHOOL READINESS OF CHILDREN IN HEAD START A Dissertation by KRYSTAL TISHA? COOK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of children enrolled in Head Start. The study examined how these iv parent variables were related to children?s school readiness, and differences between ethnic groups, gender groups, and level of risk. The study tested a model whereby the effect...

  17. Accelerating the Electrification of U.S. Drive Trains: Ready...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ready and Affordable Technology Solutions for Domestically Manufactured Advanced Batteries Accelerating the Electrification of U.S. Drive Trains: Ready and Affordable...

  18. EV Community Readiness projects: New York City and Lower Hudson...

    Broader source: Energy.gov (indexed) [DOE]

    ACCOMPLISHMENTS NYCLHVCC: Clean Cities 2011 EV Community Readiness DUANE Reade's Smith EV at Plug-In Day in Times Square Clean Cities 2011 Community Readiness & Planning...

  19. Readiness Review Training - Development of Criteria And Review...

    Office of Environmental Management (EM)

    Development of Criteria And Review Approach Documents Readiness Review Training - Development of Criteria And Review Approach Documents November 8-9, 2010 Readiness Review Training...

  20. DOE Zero Energy Ready Home Case Study: Transformation Inc., Production...

    Energy Savers [EERE]

    Transformation Inc., Production House, Devens, MA DOE Zero Energy Ready Home Case Study: Transformation Inc., Production House, Devens, MA Case study of a DOE Zero Energy Ready...

  1. Ready, Set . . . Get Prepped for Monday's Launch of the 'America...

    Energy Savers [EERE]

    Ready, Set . . . Get Prepped for Monday's Launch of the 'America's Next Top Energy Innovator' Challenge Ready, Set . . . Get Prepped for Monday's Launch of the 'America's Next Top...

  2. DOE Zero Energy Ready Home Case Study: Weiss Building & Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOE Zero Energy Ready Home Case Study: Weiss Building & Development LLC., Custom Home, Downers Grove, IL DOE Zero Energy Ready Home Case Study: Weiss Building & Development LLC.,...

  3. Energy -- and Water -- Efficiency in the DOE Zero Energy Ready...

    Office of Environmental Management (EM)

    Energy -- and Water -- Efficiency in the DOE Zero Energy Ready Home Program Webinar (Text Version) Energy -- and Water -- Efficiency in the DOE Zero Energy Ready Home Program...

  4. Lightning Arrestor Connectors Production Readiness

    SciTech Connect (OSTI)

    Marten, Steve; Linder, Kim; Emmons, Jim; Gomez, Antonio; Hasam, Dawud; Maurer, Michelle

    2008-10-20T23:59:59.000Z

    The Lightning Arrestor Connector (LAC), part “M”, presented opportunities to improve the processes used to fabricate LACs. The A## LACs were the first production LACs produced at the KCP, after the product was transferred from Pinnellas. The new LAC relied on the lessons learned from the A## LACs; however, additional improvements were needed to meet the required budget, yield, and schedule requirements. Improvement projects completed since 2001 include Hermetic Connector Sealing Improvement, Contact Assembly molding Improvement, development of a second vendor for LAC shells, general process improvement, tooling improvement, reduction of the LAC production cycle time, and documention of the LAC granule fabrication process. This report summarizes the accomplishments achieved in improving the LAC Production Readiness.

  5. Modeling Renewable Energy Readiness: The UAE Context

    E-Print Network [OSTI]

    Choucri, Nazli

    Modeling technology policy is becoming an increasingly important capability to steer states and societies toward sustainability. This paper presents a simulation-modeling approach to evaluate renewable energy readiness, ...

  6. Superconducting Partnership with Readiness Review Update

    E-Print Network [OSTI]

    1 Superconducting Partnership with Industry: Readiness Review Update Mike Gouge, ORNL Steve Ashworth, LANL Paul Bakke, DOE-Golden DOE 2004 Superconductivity Peer Review July 27-29, 2004 #12;2 SPI

  7. Are You Ready? Jimmy L. Lagunero

    E-Print Network [OSTI]

    Dong, Yingfei

    Are You Ready? Jimmy L. Lagunero Emergency Management Coordinator University of Hawai,,i "Emergency ? ? ? Jimmy L. Lagunero UHM Emergency Management Coordinator phone: 808-956-0773 fax: 808-956-

  8. Hydrogen Infrastructure Market Readiness Workshop Agenda

    Broader source: Energy.gov (indexed) [DOE]

    NRELDOE Hydrogen Infrastructure Market Readiness Workshop Agenda Page 1 of 2 NRELDOE Workshop at the Gaylord National, Washington D.C., February 16-17, 2011 Transitioning to an...

  9. Labeling of Ready-Made Street Dresses. 

    E-Print Network [OSTI]

    Drake, Phyllis; Grimes, Mary Anna

    1959-01-01T23:59:59.000Z

    This bulletin reports consumers' interest in and Labels on dresses costing under $20 pr use of label information on ready-made street more of the needed information than dresses dresses, the availability of such information and in- $20 or more.... dustry practices in the provision of labels. The data were obtained in 1956-57 by interviews with 992 ur- Both retailers and manufacturers emp' ban who bought ready-made dresses in the the importance of label information concernin year previous...

  10. DOE Zero Energy Ready Home PV-Ready Checklist DOE Zero Energy Ready Home National Program Requirements Mandatory Requirement 7

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy Ready Home PV-Ready

  11. NHI Component Technical Readiness Evaluation System

    SciTech Connect (OSTI)

    Steven R. Sherman; Dane F. Wilson; Steven J. Pawel

    2007-09-01T23:59:59.000Z

    A decision process for evaluating the technical readiness or maturity of components (i.e., heat exchangers, chemical reactors, valves, etc.) for use by the U.S. DOE Nuclear Hydrogen Initiative is described. This system is used by the DOE NHI to assess individual components in relation to their readiness for pilot-scale and larger-scale deployment and to drive the research and development work needed to attain technical maturity. A description of the evaluation system is provided, and examples are given to illustrate how it is used to assist in component R&D decisions.

  12. DOE Zero Energy Ready Home Case Study: Ithaca Neighborhood Housing...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Zero Energy Ready Home: Montlake Modern - Seattle, Washington Building America Whole-House Solutions for New Homes: EcoVillage: A Net Zero Energy Ready Community, Ithaca, New York...

  13. DOE Zero Energy Ready Home Case Study: Garbett Homes, Herriman...

    Energy Savers [EERE]

    Garbett Homes, Herriman, UT, Production Home DOE Zero Energy Ready Home Case Study: Garbett Homes, Herriman, UT, Production Home Case study of a DOE Zero Energy Ready Home in...

  14. ENERGY STAR Webinar: Zero Energy Ready Home Program

    Broader source: Energy.gov [DOE]

    Once a home is as good as ENERGY STAR, the modest added “lift” to bring a home up to DOE’s Zero Energy Ready specs unleashes a wave of powerful value messages.  DOE Zero Energy Ready Homes live...

  15. DOE Zero Energy Ready Home National Program Requirements (Rev...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5) DOE Zero Energy Ready Home National Program Requirements (Rev. 05) U.S. Department of Energy Zero Energy Ready Home National Program Requirements (Rev. 05), May, 11, 2015. DOE...

  16. Solar Ready Vets: Preparing Our Veterans to Join the Growing...

    Office of Environmental Management (EM)

    Solar Ready Vets: Preparing Our Veterans to Join the Growing Solar Workforce Solar Ready Vets: Preparing Our Veterans to Join the Growing Solar Workforce April 6, 2015 - 2:27pm...

  17. An assessment of the value of retail ready packaging

    E-Print Network [OSTI]

    Jackson, Kathleen Anne

    2008-01-01T23:59:59.000Z

    Use of retail-ready packaging reduces the costs of replenishing store shelves by eliminating the labor of removing packaging materials and stocking individual items on shelves. While reducing costs for retailers, retail-ready ...

  18. DOE Zero Ready Home Case Study: Mandalay Homes, Pronghorn Ranch...

    Broader source: Energy.gov (indexed) [DOE]

    Zero Energy Ready Home certifi ed, every home will have a Home Energy Rating System (HERS) score of 50 or less. Everson fi rst heard about the DOE Zero Energy Ready Home program...

  19. DOE Zero Energy Ready Home National Program Requirements (Rev. 04)

    Broader source: Energy.gov [DOE]

    U.S. Department of Energy Zero Energy Ready Home National Program Requirements (Rev. 04), April 21, 2014.

  20. Human Resources Organizational Readiness Project: An Overview

    E-Print Network [OSTI]

    Finzi, Adrien

    and easily interface with SAP software Managed by a special Human Resources project team Will be undertaken in close coordination with the BUworks program team HR Organizational Readiness Project BUworks / SAP of SAP Enhanced data security within the new system Current job "system" is 30 years old ­ it must

  1. Roundtable on Sustainable Biofuels Certification Readiness Study

    E-Print Network [OSTI]

    Roundtable on Sustainable Biofuels Certification Readiness Study: Hawai`i Biofuel Projects Prepared 12.1 Deliverable (item 2) Bioenergy Analyses Prepared by Hawai`i Biofuel Foundation And NCSI Americas: Hawaii Biofuel Projects Prepared For Hawaii Natural Energy Institute School of Ocean Earth Sciences

  2. Is Your Home as Ready for Summer as You Are? | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |Is Your Home as Ready for Summer as You Are? Is Your Home as Ready

  3. Operational Readiness Team: OPERATIONAL READINESS REVIEW PLAN FOR THE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for RenewableSpeeding accessSpeedingOctoberResearchOpen→ globalOPERATING PLAN2 Falloak

  4. Marine and Hydrokinetic Technology Readiness Level | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOfRose Bend < MHKconvertersourcesourceCharacterization 2Information

  5. Readiness Review | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiation Protection Radiation ProtectionRaising funds forAdvancedAdvanced

  6. Integrated Approach to Documenting Readiness for a Potential Criticality Incident

    SciTech Connect (OSTI)

    Carlisle, Bruce S.; Prichard, Andrew W.; Jones, Robert A.

    2013-11-11T23:59:59.000Z

    There have been 60 highly publicized criticality accidents1 over the last 60 years and the nature of the hazard is unique. Recent studies2 discuss the benefits of knowing what to expect during and immediately following these events. Emergency planning and response standards2 provide an effective tool for establishing an adequate level of readiness to a criticality accident. While these planning requirements cover a broad spectrum of activities to establish readiness, a concise and routinely reviewed criticality accident scenario may be the most valuable tool in developing a cohesive understanding and response to these challenging events. Using a guideline3 for criticality safety evaluations the analytical work and emergency planning to mitigate a criticality accident at the Radiochemical Processing Laboratory at the Pacific Northwest National Laboratory, was developed. Using a single document the analysis that established the accident characteristics, response scenario based on emergency staffing and planning, and anticipated dose consequences were integrated. This single document approach provides a useful platform to integrate the initial planning and guide the review of proposed changes to emergency response plans.

  7. NERSC application readiness case studies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1AllocationsNOVAPlayed NUGPresentationsUsersWins

  8. Planning and Conducting Readiness Reviews

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA Administrative Judgea.Work Plan for FY 2013 A list of3006-2010

  9. TECHNOLOGY READINESS ASSESSMENT-OVERVIEW

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposed Action(InsertAbout theSystems3,SOLID

  10. Application Readiness Across DOE Labs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About BecomeTechnologiesVehicle PartsAnnual Energy OutlookS S

  11. NGNP Infrastructure Readiness Assessment: Consolidation Report

    SciTech Connect (OSTI)

    Brian K Castle

    2011-02-01T23:59:59.000Z

    The Next Generation Nuclear Plant (NGNP) project supports the development, demonstration, and deployment of high temperature gas-cooled reactors (HTGRs). The NGNP project is being reviewed by the Nuclear Energy Advisory Council (NEAC) to provide input to the DOE, who will make a recommendation to the Secretary of Energy, whether or not to continue with Phase 2 of the NGNP project. The NEAC review will be based on, in part, the infrastructure readiness assessment, which is an assessment of industry's current ability to provide specified components for the FOAK NGNP, meet quality assurance requirements, transport components, have the necessary workforce in place, and have the necessary construction capabilities. AREVA and Westinghouse were contracted to perform independent assessments of industry's capabilities because of their experience with nuclear supply chains, which is a result of their experiences with the EPR and AP-1000 reactors. Both vendors produced infrastructure readiness assessment reports that identified key components and categorized these components into three groups based on their ability to be deployed in the FOAK plant. The NGNP project has several programs that are developing key components and capabilities. For these components, the NGNP project have provided input to properly assess the infrastructure readiness for these components.

  12. DOE Zero Energy Ready Home Solar Hot Water-Ready Checklist

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy Ready Home PV-Ready

  13. Getting ready for MeerKat and the SKA with KAT7 and SALT

    E-Print Network [OSTI]

    Jarrett, Thomas H.

    Getting ready for MeerKat and the SKA with KAT7 and SALT Claude Carignan SA SKA Research Chair READY WITH KAT 7 (LINE) gas stars #12;GETTING READY WITH KAT 7 (LINE) #12;GETTING READY WITH SALT (Fabry-Perot High Resolu4on mode) NGC 5055 observed with a 2m class telescope #12;GETTING READY WITH SALT

  14. DOE Zero Energy Ready Home: Better Business for Builders Webinar...

    Broader source: Energy.gov (indexed) [DOE]

    Better Business for Builders Webinar Transcript DOE Zero Energy Ready Home: Better Business for Builders Webinar Transcript Below is the text version of the webinar, DOE Zero...

  15. EV Community Readiness projects: Clean Energy Coalition (MI...

    Broader source: Energy.gov (indexed) [DOE]

    link the Michigan PEV Community Readiness Plan to relevant websites and other appropriate media outlets; incorporate the Plan into the PEV Taskforce website. Clean Cities Recovery...

  16. Technology Readiness Assessment (TRA)/Technology Maturation Plan...

    Broader source: Energy.gov (indexed) [DOE]

    is a guide for those involved in conducting TRAs and developing TMPs for DOE-EM. Technology Readiness Assessment (TRA)Technology Maturation Plan (TMP) Process Guide More...

  17. EV Community Readiness projects: Center for the Commercialization...

    Broader source: Energy.gov (indexed) [DOE]

    - Project AccomplishmentsProgress: * Readiness Plan Completed * Private and Utility Business Models completed - Collaborations: * Wide range of local and state organizations,...

  18. DOE Zero Ready Home Case Study: Southern Energy Homes, First...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and water heating installed or conduit and electric panel space installed for future solar equipment installation. The DOE Zero Energy Ready-certified home actually exceeded the...

  19. EV Community Readiness projects: Delaware Valley Regional Planning...

    Broader source: Energy.gov (indexed) [DOE]

    Department of Mines, Minerals and Energy EV Community Readiness projects: Center for the Commercialization of Electric Technologies (TX); City of Austin, Austin Energy (TX)...

  20. Independent Oversight Review of the NNSA Production Office Readiness...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    RR Readiness Review SAA Startup Approval Authority SIAP Site Integrated Assessment Plan SME Subject Matter Expert SNR Startup Notification Report SSTA Senior Scientific Technical...

  1. DOE Zero Energy Ready Home National Program Requirements (Rev...

    Broader source: Energy.gov (indexed) [DOE]

    U.S. Department of Energy Zero Energy Ready Home National Program Requirements (Rev. 04), April 21, 2014. doezeroenergyreadyhomerequirementsrev04.pdf More Documents &...

  2. DOE Zero Energy Ready Home Webinar: Building Energy Optimization...

    Broader source: Energy.gov (indexed) [DOE]

    Building Energy Optimization (BEopt) Software DOE Zero Energy Ready Home Webinar: Building Energy Optimization (BEopt) Software This webinar was presented on May 15, 2014 and gives...

  3. LHCb commissioning and readiness for first data

    E-Print Network [OSTI]

    Helge Voss; for the LHCb Collaboration

    2009-06-08T23:59:59.000Z

    LHCb has been installed by spring 2008, followed by intensive testing and commissioning of the system in order to be ready for first data taking. Despite the horizontal geometry of the LHCb detector it was possible to collect over one million useful cosmic events that allowed a first time alignment of the sub-detectors. Moreover events from beam dumps during the LHC synchronisation tests provided very useful data for further time and spacial alignment of the detector. Here we present an overview of our commissioning activities, the current status and an outlook on the startup in 2009.

  4. Project Get Ready | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere I Geothermal PwerPerkins County, Nebraska:Precourt Institute for EnergyWister|ProductionProfitCatalystReady

  5. Reduced gravity Rankine cycle system design and optimization study with passive vortex phase separation

    E-Print Network [OSTI]

    Supak, Kevin Robert

    2008-10-10T23:59:59.000Z

    environments.1,2,3) This phase separator has been flight tested on thousands of parabolas aboard NASA reduced gravity aircraft and has achieved a NASA technology readiness level (TRL) of 6. Along with its ability to separate liquid and vapor...

  6. Reduced gravity rankine cycle design and optimization with passive vortex phase separation

    E-Print Network [OSTI]

    Supak, Kevin Robert

    2009-05-15T23:59:59.000Z

    environments.1,2,3) This phase separator has been flight tested on thousands of parabolas aboard NASA reduced gravity aircraft and has achieved a NASA technology readiness level (TRL) of 6. Along with its ability to separate liquid and vapor...

  7. An Approach to Technology Risk Management Ricardo Valerdi

    E-Print Network [OSTI]

    de Weck, Olivier L.

    in parametric cost estimation models. Introduction The rapid change of Information Technology has madeAn Approach to Technology Risk Management Ricardo Valerdi USC Center for Software Engineering 941 W Symposium MIT, Cambridge, MA, March 29-31, 2004 ABSTRACT NASA's Technology Readiness Levels (TRL) approach

  8. FEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 13

    E-Print Network [OSTI]

    Tullos, Desiree

    FEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 13 Shelter T aking shelter is often a critical in your home for sev- eral days without electricity or water services following a winter storm. We also an emergency toilet, if necessary. · Use a garbage container, pail or #12;14 ARE YOU READY? FEDERAL EMERGENCY

  9. FEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 83

    E-Print Network [OSTI]

    Tullos, Desiree

    FEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 83 National Security Emergencies I n addition uncomfortable or if something does not seem right. #12;84 ARE YOU READY? FEDERAL EMERGENCY MANAGEMENT AGENCY 4- rupted--electricity, telephone, natural gas, gasoline pumps, cash registers, ATM machines, and internet

  10. 4 ARE YOU READY? FEDERAL EMERGENCY MANAGEMENT AGENCY

    E-Print Network [OSTI]

    Tullos, Desiree

    4 ARE YOU READY? FEDERAL EMERGENCY MANAGEMENT AGENCY Emergency Planning and Disaster Supplies if you have questions. #12;FEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 5 9. Take a first aid and when to shut off water, gas, and electricity at the main switches. Consult with your local utili- ties

  11. MENTOR READINESS ASSESSMENT Effective and Ineffective Characteristics of a Mentor

    E-Print Network [OSTI]

    Maranas, Costas

    MENTOR READINESS ASSESSMENT Effective and Ineffective Characteristics of a Mentor The ten characteristics below serve as a measure for determining your readiness to be a mentor. There are five effective Characteristics 1. Spot the Potential & Believe in Others Effective mentors have a positive view of others

  12. Capture-ready power plants : options, technologies and economics

    E-Print Network [OSTI]

    Bohm, Mark (Mark C.)

    2006-01-01T23:59:59.000Z

    A plant can be considered to be capture-ready if, at some point in the future it can be retrofitted for carbon capture and sequestration and still be economical to operate. The concept of capture-ready is not a specific ...

  13. DOE Zero Energy Ready Home Case Study, BPC Green Builders, Custom...

    Broader source: Energy.gov (indexed) [DOE]

    Fairfield, CT More Documents & Publications DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury, CT DOE Zero Energy Ready Home Case Study: Shore Road Project -...

  14. Using ISMS Principles and Functions in Developing an ARRA Readiness Review Process

    Broader source: Energy.gov [DOE]

    Presenter: Linda K. Rogers, Assessments & Readiness Programs Manager, Bechtel Jacobs Company, LLC Track 8-8

  15. DOE Zero Energy Ready Home: Durable Energy Builders, Houston...

    Energy Savers [EERE]

    roof, 11,500 gallon rainwater cistern to supply most of the home's drinking water, hurricane-proof roof, and triple-pane windows. DOE Zero Energy Ready Home: Durable Energy...

  16. aec readiness group: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    DOE 2006 Superconductivity Peer Review July 25-27, 2006 12;2 SPI Readiness Review Program Budget: 210 Kyear from DOE 100 K - LANL (3 cable projects) 110 K - ORNL (all 33...

  17. ats technical readiness: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    DOE-Golden DOE 2006 Superconductivity Peer Review July 25-27, 2006 12;2 SPI Readiness Review Program Budget: 210 Kyear from DOE 100 K - LANL (3 cable projects) 110 K - ORNL...

  18. affecting school readiness: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    DOE-Golden DOE 2006 Superconductivity Peer Review July 25-27, 2006 12;2 SPI Readiness Review Program Budget: 210 Kyear from DOE 100 K - LANL (3 cable projects) 110 K - ORNL...

  19. Building America Zero Energy Ready Home Case Study: Imery Group...

    Broader source: Energy.gov (indexed) [DOE]

    wall, spray foamed walls and attic plus rigid foam and coated OSB. The Imery Group: Proud Green Home - Serenbe, GA More Documents & Publications DOE Zero Energy Ready Home Case...

  20. DOE Zero Energy Ready Home Case Study: Southeast Volusia Habitat...

    Energy Savers [EERE]

    executive director for the Habitat affiliate. "We started doing ENERGY STAR about 5 years ago, and DOE Builders Challenge 3 years ago, and then DOE Zero Energy Ready Home...

  1. Building America Top Innovations 2013 Profile - Zero Energy-Ready...

    Broader source: Energy.gov (indexed) [DOE]

    Many Building America teams (ARBI, BA-PIRC, BSC, CARB, IBACOS, NorthernSTAR, PHI, etc.) have worked with home builders to design and test zero-energy-ready homes....

  2. Are Batteries Ready for Plug-in Hybrid Buyers?

    E-Print Network [OSTI]

    Axsen, Jonn; Kurani, Kenneth S; Burke, Andy

    2009-01-01T23:59:59.000Z

    higher power density batteries have reduced energy density,2008 UCD-ITS-WP-09-02 Are batteries ready for plug-in hybridprograms mischaracterize the batteries needed to start

  3. Are Batteries Ready for Plug-in Hybrid Buyers?

    E-Print Network [OSTI]

    Axsen, Jonn; Burke, Andy; Kurani, Kenneth S

    2010-01-01T23:59:59.000Z

    237–253. Burke, A. , 2007. Batteries and ultracapacitors forresults with lithium-ion batteries. In: Proceedings (CD)locate/tranpol Are batteries ready for plug-in hybrid

  4. Are batteries ready for plug-in hybrid buyers?

    E-Print Network [OSTI]

    Axsen, Jonn; Kurani, Kenneth S.; Burke, Andrew

    2008-01-01T23:59:59.000Z

    higher power density batteries have reduced energy density,2008 UCD-ITS-WP-09-02 Are batteries ready for plug-in hybridprograms mischaracterize the batteries needed to start

  5. DOE Zero Energy Ready Home Case Study: Preferred Builders, Old...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    study of a DOE Zero Energy Ready Home in Old Greenwich, CT, that scored HERS 42 without PV or HERS 20 with PV. This 2,700-square-foot custom home has advanced framed walls with...

  6. DOE Zero Energy Ready Home Case Study, Dwell Development, Seattle...

    Energy Savers [EERE]

    blown cellulose, R-42 XPS under slab, triple-pane windows, and a ductless mini-split heat pump. Dwell Development - Seattle, WA More Documents & Publications DOE Zero Energy Ready...

  7. DOE Zero Energy Ready Home: Healthy Efficient Homes - Spirit...

    Energy Savers [EERE]

    basement walls are ICF plus two 2-inch layers of EPS. The house also has a mini-split heat pump, fresh air fan intake, and a solar hot water heater. DOE Zero Energy Ready Home:...

  8. DOE Zero Energy Ready Home: Leganza Residence - Greenbank, Washington...

    Energy Savers [EERE]

    (SIPs) walls, a 10.25-inch SIPS roof, an R-20 insulated slab, a 2-ton ground source heat pump, radiant floor heat, 7.1 kWh PV, and triple-pane windows. DOE Zero Energy Ready...

  9. DOE Zero Ready Home Case Study: Brookside Development, Singer...

    Broader source: Energy.gov (indexed) [DOE]

    measures that ensure the home is wired and plumbed for solar photovoltaic and water heating panels as soon as the homeowner is ready to install them. The home was honored with a...

  10. EV Community Readiness projects: New York City and Lower Hudson...

    Broader source: Energy.gov (indexed) [DOE]

    EV Community Readiness projects: New York City and Lower Hudson Valley Clean Communities, Inc. (NY, MA, PA); NYSERDA (ME, NH, VT, MA, RI, CT, NY, NJ, PA, DE, MD, DC) EV Community...

  11. DOE Zero Energy Ready Home Efficient Hot Water Distribution I...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    I -- What's At Stake Webinar (Text Version) DOE Zero Energy Ready Home Efficient Hot Water Distribution I -- What's At Stake Webinar (Text Version) Below is the text version of the...

  12. DOE Zero Energy Ready Home Efficient Hot Water Distribution II...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    -- How to Get it Right Webinar (Text Version) DOE Zero Energy Ready Home Efficient Hot Water Distribution II -- How to Get it Right Webinar (Text Version) Below is the text...

  13. DOE Zero Energy Ready Home Webinar: Ducts in Conditioned Space

    Broader source: Energy.gov [DOE]

    DOE Challenge Home is a blueprint for zero energy ready homes.  When we make that statement – it’s impossible to justify huge thermal losses from ducts in unconditioned spaces.  That’s why one of...

  14. academic school readiness: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    you're ready to develop an academic plan of study? An academic plan of study degree audit & your academic catalog. To draft your academic plan of study, you need: - a pencil...

  15. DOE Zero Energy Ready Home National Program Requirements

    Energy Savers [EERE]

    Zero Energy Ready Home National Program Requirements (Rev. 04) April 21, 2014 Effective for Homes Revised April 21, 2014 Page 1 of 9 Permitted Starting 6212014 To qualify as a...

  16. DOE Zero Energy Ready Home Case Study, Caldwell and Johnson,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Home Case study of a DOE Zero Energy Ready Home in Exeter, Rhode Island, that scored HERS 43 without PV. This 2,000 ft2 custom home has a spray- foamed attic and walls, plus...

  17. DOE Zero Energy Ready Home Case Study, Transformations, Inc....

    Energy Savers [EERE]

    House, Devens, MA Case study of a DOE Zero Energy Ready Home in Devens, MA that scored HERS 34 without PV or HERS -21 with PV. This 3,168 ft2 custom home has R-46 double-stud...

  18. DOE Zero Ready Home Case Study: Cobblestone Homes, 2014 Model...

    Broader source: Energy.gov (indexed) [DOE]

    Challenge Home and made it a true zero energy home with a -4 Home Energy Rating System (HERS) score," said Melissa. Cobblestone's fi rst DOE Zero Energy Ready Home scored a HERS 49...

  19. DOE Zero Energy Ready Home PV-Ready Checklist | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-Ready Checklist DOE Zero

  20. DOE Zero Energy Ready Home Solar Hot Water-Ready Checklist | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-Ready ChecklistEnergy

  1. LWRS ATR Irradiation Testing Readiness Status

    SciTech Connect (OSTI)

    Kristine Barrett

    2012-09-01T23:59:59.000Z

    The Light Water Reactor Sustainability (LWRS) Program was established by the U.S. Department of Energy Office of Nuclear Energy (DOE-NE) to develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of the current reactors. The LWRS Program is divided into four R&D Pathways: (1) Materials Aging and Degradation; (2) Advanced Light Water Reactor Nuclear Fuels; (3) Advanced Instrumentation, Information and Control Systems; and (4) Risk-Informed Safety Margin Characterization. This report describes an irradiation testing readiness analysis in preparation of LWRS experiments for irradiation testing at the Idaho National Laboratory (INL) Advanced Test Reactor (ATR) under Pathway (2). The focus of the Advanced LWR Nuclear Fuels Pathway is to improve the scientific knowledge basis for understanding and predicting fundamental performance of advanced nuclear fuel and cladding in nuclear power plants during both nominal and off-nominal conditions. This information will be applied in the design and development of high-performance, high burn-up fuels with improved safety, cladding integrity, and improved nuclear fuel cycle economics

  2. Preliminary Technology Readiness Assessment (TRA) for the Calcine Disposition Project Volume 1 (CDP)

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie CroftPRELIMINARY TECHNOLOGY READINESS

  3. Human Resources Organizational Readiness Project Over the past 18 months, hundreds of employees from across the University brought their institutional

    E-Print Network [OSTI]

    Finzi, Adrien

    Human Resources Organizational Readiness Project Over the past 18 months, hundreds of employees implement SAP. What is the Human Resources Organizational Readiness Project? In preparation for the BUworks Program, the Human Resources Organizational Readiness Project will collect, organize and standardize

  4. EMERGENCY READINESS ASSURANCE PLAN (ERAP) FOR FISCAL YEAR (FY) 2014

    SciTech Connect (OSTI)

    Bush, Shane

    2014-09-01T23:59:59.000Z

    This Emergency Readiness Assurance Plan (ERAP) for Fiscal Year (FY) 2014 in accordance with DOE O 151.1C, “Comprehensive Emergency Management System.” The ERAP documents the readiness of the INL Emergency Management Program using emergency response planning and preparedness activities as the basis. It describes emergency response planning and preparedness activities, and where applicable, summarizes and/or provides supporting information in tabular form for easy access to data. The ERAP also provides budget, personnel, and planning forecasts for FY-15. Specifically, the ERAP assures the Department of Energy Idaho Operations Office that stated emergency capabilities at INL are sufficient to implement PLN-114, “INL Emergency Plan/RCRA Contingency Plan.

  5. DOE Zero Energy Ready Home Second Production Builder Round Table

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy Ready Home PV-Ready

  6. DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury...

    Energy Savers [EERE]

    BPC Green Builders, Danbury, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury, CT Case study of a DOE Zero Energy Ready home in Danbury, CT, that scored HERS...

  7. What to Expect When Readying to Move Spent Nuclear Fuel from...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    What to Expect When Readying to Move Spent Nuclear Fuel from Commercial Nuclear Power Plants What to Expect When Readying to Move Spent Nuclear Fuel from Commercial Nuclear Power...

  8. DOE Zero Energy Ready Home Case Study: Palo Duro Homes, Albuquerque...

    Energy Savers [EERE]

    Zero Energy Ready Home Case Study: Palo Duro Homes, Albuquerque, NM Case study of a New Mexico-based home builder who has built more DOE Zero Energy Ready certified homes than...

  9. DOE Zero Energy Ready Home Case Study: New Town Builders, Denver...

    Energy Savers [EERE]

    New Town Builders, Denver, CO, Production Home DOE Zero Energy Ready Home Case Study: New Town Builders, Denver, CO, Production Home Case study of a DOE Zero Energy Ready Home in...

  10. DOE Zero Energy Ready Home Case Study: Palo Duro Homes Inc.,...

    Energy Savers [EERE]

    Palo Duro Homes Inc., Albuquerque, NM, Production DOE Zero Energy Ready Home Case Study: Palo Duro Homes Inc., Albuquerque, NM, Production Case study of a DOE Zero Energy Ready...

  11. DOE Zero Energy Ready Home Case Study: KB Home, San Marcos, CA...

    Energy Savers [EERE]

    KB Home, San Marcos, CA, Production Home DOE Zero Energy Ready Home Case Study: KB Home, San Marcos, CA, Production Home Case study of a DOE Zero Energy Ready Home in San Marcos,...

  12. DOE Zero Ready Home Case Study: TC Legend Homes, Cedarwood, Bellingham...

    Broader source: Energy.gov (indexed) [DOE]

    installed that ensure the home is ready for solar photovoltaic and solar water heating panels when the homeowner is ready to purchase them. This is the second home Clifton...

  13. Text-Alternative Version: ENERGY STAR® for SSL: Getting Ready for September 30

    Broader source: Energy.gov [DOE]

    Below is the text-alternative version of the ENERGY STAR® for SSL: Getting Ready for September 30 webcast.

  14. A Qualitative Readiness-Requirements Assessment Model for Enterprise Big-Data Infrastructure Investment

    SciTech Connect (OSTI)

    Olama, Mohammed M [ORNL] [ORNL; McNair, Wade [ORNL] [ORNL; Sukumar, Sreenivas R [ORNL] [ORNL; Nutaro, James J [ORNL] [ORNL

    2014-01-01T23:59:59.000Z

    In the last three decades, there has been an exponential growth in the area of information technology providing the information processing needs of data-driven businesses in government, science, and private industry in the form of capturing, staging, integrating, conveying, analyzing, and transferring data that will help knowledge workers and decision makers make sound business decisions. Data integration across enterprise warehouses is one of the most challenging steps in the big data analytics strategy. Several levels of data integration have been identified across enterprise warehouses: data accessibility, common data platform, and consolidated data model. Each level of integration has its own set of complexities that requires a certain amount of time, budget, and resources to implement. Such levels of integration are designed to address the technical challenges inherent in consolidating the disparate data sources. In this paper, we present a methodology based on industry best practices to measure the readiness of an organization and its data sets against the different levels of data integration. We introduce a new Integration Level Model (ILM) tool, which is used for quantifying an organization and data system s readiness to share data at a certain level of data integration. It is based largely on the established and accepted framework provided in the Data Management Association (DAMA-DMBOK). It comprises several key data management functions and supporting activities, together with several environmental elements that describe and apply to each function. The proposed model scores the maturity of a system s data governance processes and provides a pragmatic methodology for evaluating integration risks. The higher the computed scores, the better managed the source data system and the greater the likelihood that the data system can be brought in at a higher level of integration.

  15. READY4SmartCities ICT Roadmap and Data Interoperability for Energy Systems in Smart Cities

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    READY4SmartCities ­ ICT Roadmap and Data Interoperability for Energy Systems in Smart Cities and Data Interoperability for Energy Systems in Smart Cities Project Acronym: READY4SmartCities Grant of the Ready4SmartCities project is to support energy data interoperability in the context of SmartCities

  16. Guidelines for Final Camera-Ready Manuscripts and XXX ZZZ

    E-Print Network [OSTI]

    Tachizawa, Kazuya

    Guidelines for Final Camera-Ready Manuscripts XXX YYY* and XXX ZZZ * Department of Information to the directions reported in this document. I. INTRODUCTION This document shows guidelines for preparing a final.45 in). The space between the two columns is 4mm (0.17 in). Paragraph indentation is 3.5 mm (0.14 in). D

  17. Ready to eat breakfast cereals from food-grade sorghums

    E-Print Network [OSTI]

    Cruz y Celis Ehlinger, Laura Penelope

    1993-01-01T23:59:59.000Z

    Two food-grade sorghum hybrids, ATx63 I *Tx436 (non waxy), and B.BON 34, (waxy), were micronized and evaluated for their potential use in ready to eat breakfast cereals (RTE-BC). Whole and decorticated grains were exposed to infra-red burners...

  18. Recycling readiness of advanced batteries for electric vehicles

    SciTech Connect (OSTI)

    Jungst, R.G.

    1997-09-01T23:59:59.000Z

    Maximizing the reclamation/recycle of electric-vehicle (EV) batteries is considered to be essential for the successful commercialization of this technology. Since the early 1990s, the US Department of Energy has sponsored the ad hoc advanced battery readiness working group to review this and other possible barriers to the widespread use of EVs, such as battery shipping and in-vehicle safety. Regulation is currently the main force for growth in EV numbers and projections for the states that have zero-emission vehicle (ZEV) programs indicate about 200,000 of these vehicles would be offered to the public in 2003 to meet those requirements. The ad hoc Advanced Battery Readiness Working Group has identified a matrix of battery technologies that could see use in EVs and has been tracking the state of readiness of recycling processes for each of them. Lead-acid, nickel/metal hydride, and lithium-ion are the three EV battery technologies proposed by the major automotive manufacturers affected by ZEV requirements. Recycling approaches for the two advanced battery systems on this list are partly defined, but could be modified to recover more value from end-of-life batteries. The processes being used or planned to treat these batteries are reviewed, as well as those being considered for other longer-term technologies in the battery recycling readiness matrix. Development efforts needed to prepare for recycling the batteries from a much larger EV population than exists today are identified.

  19. Ready...Set...MENTOR! A Speed Mentoring Toolkit

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    Ready...Set...MENTOR! A Speed Mentoring Toolkit Introduction: Mentoring describes a developmental relationship between a mentor, who is a person with experience, skills and knowledge, and a protégé, who and work contexts. Informal mentoring may emerge between partners who spontaneously discover each other

  20. U.S. Department of Energy Technology Readiness Assessment Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-10-12T23:59:59.000Z

    This Guide assists individuals and teams involved in conducting Technology Readiness Assessments and developing Technology Maturation Plans for the DOE capital acquisition asset projects subject to DOE O 413.3A, Program and Project Management for the Acquisition of Capital Assets, dated 7-28-06. Canceled by DOE G 413.3-4A. Does not cancel other directives.

  1. Annual Tour Ready to Explore New Mexico's Lower Pecos River

    E-Print Network [OSTI]

    Nebraska-Lincoln, University of

    Annual Tour Ready to Explore New Mexico's Lower Pecos River By Steve Ress The itinerary is set and the seats have been filled for an early June bus tour to New Mexico's lower Pecos River basin compacts on Nebraska's Republican River and New Mexico's Pecos River to see what can be learned from

  2. Operational readiness review phase-1 final report for WRAP-1

    SciTech Connect (OSTI)

    Bowen, W., Westinghouse Hanford

    1996-12-27T23:59:59.000Z

    This report documents the Operational Readiness Review for WRAP-1 Phase-1 operations. The report includes all criteria, lines of inquiry with resulting Findings and Observations. The review included assessing operational capability of the organization and the computer controlled process and facility systems.

  3. Verification of Readiness to Start Up or Restart Nuclear Facilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2010-04-16T23:59:59.000Z

    The order establishes requirements for verifying readiness for startup of new Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations, and for restart of existing Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations that have been shut down. Cancels DOE O 425.1C. Adm Chg 1, dated 4-2-13.

  4. Fitting and Altering Ready-to-Wear: Basic Principles.

    E-Print Network [OSTI]

    Saunders, Becky

    1980-01-01T23:59:59.000Z

    straight to the floor with creases follow ing the lengthwise grainline in the center of each leg. 15. Hems hang straight. 16. Long sleeves end at the wrist bone . References Brinkley, Jeanne and Ann Aletti'. "Altering Ready-to-Wear Fashion." Chas. A...

  5. How ready is `capture ready'? May 2008 SCCS for WWF -1(44) -www.geos.ed.ac.uk/sccs Nils.Markusson@ed.ac.uk S.Haszeldine@ed.ac.uk

    E-Print Network [OSTI]

    Haszeldine, Stuart

    ..........................................................................................................12 2. Reviewing and investigating capture readiness.................................................13 2.1 The structure of the problem

  6. Uranium Downblending and Disposition Project Technology Readiness

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group current C3EDepartment of Energy Office ofStephanieMaterial

  7. Solar Ready Vets | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our Instagram Secretary Moniz9MorganYouof Energy Projects to Reduce

  8. Hawaii Gets 'EV Ready' | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To:Department of Energy Completing theWhiz! | DepartmentTheLast July,

  9. Readiness Assurance | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA groupTuba City,Enriched UraniumPhysical Security Systems(PA)About| | National

  10. Readiness Assurance | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved: 5-13-14 FEDERALAmerica TreatyWastewantsRequests|| National Nuclear

  11. ApplicationReadinessLunchNP.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProductsAlternative FuelsSanta3Appliance andApplication forF

  12. Mira Computational Readiness Assessment | Argonne Leadership Computing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE625DataNeutrino mode fitAdvisory Board

  13. ORISE: Asset Readiness Management System (ARMS)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated CodesTransparencyDOE Project *1980-1981 U.S. ORApplied healthAsset

  14. Construction Readiness RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergy This partAs theFebruary09 FY1,The Construction

  15. Wind Offshore Port Readiness | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartment of EnergyThe U.S. DepartmentEnergyWilliam E.Muchstudy will

  16. Readiness Review RM | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010In addition to 1National Broadband

  17. Time to Start Getting Ready for Cori

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in2, 2003 (Next ReleaseThomasTheoriesClean1,6,Time to

  18. Readiness Review Training - Member | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergy Small TeamNOT MEASUREMENT SENSITIVE,Department ofDocuments |

  19. Verification of Readiness to Start Up or Restart Nuclear Facilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2010-04-16T23:59:59.000Z

    The order establishes requirements for verifying readiness for startup of new Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations, and for restart of existing Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations that have been shut down. Cancels DOE O 425.1C. Adm Chg 1, dated 4-2-13, cancels DOE O 425.1D.

  20. Taking the Challenge at Singer Village--A Cold Climate Zero Energy Ready Home

    SciTech Connect (OSTI)

    Puttagunta, S.; Gaakye, O.

    2014-10-01T23:59:59.000Z

    After progressively incorporating ENERGY STAR(R) for Homes Versions 1, 2, and 3 into its standard practices over the years, this builder, Brookside Development, was seeking to build an even more sustainable product that would further increase energy efficiency, while also addressing indoor air quality, water conservation, renewable-ready, and resiliency. These objectives align with the framework of the DOE Challenge Home program, which 'builds upon the comprehensive building science requirements of ENERGY STAR for Homes Version 3, along with proven Building America innovations and best practices. Other special attribute programs are incorporated to help builders reach unparalleled levels of performance with homes designed to last hundreds of years.' CARB partnered with Brookside Development on the design optimization and construction of the first home in a small development of seven planned new homes being built on the old Singer Estate in Derby, CT.

  1. DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury...

    Broader source: Energy.gov (indexed) [DOE]

    BPC Green Builders: Trolle Residence - Danbury, CT More Documents & Publications DOE Zero Energy Ready Home Case Study, BPC Green Builders, Custom Home, New Fairfield, CT DOE Zero...

  2. DOE Zero Energy Ready Home High-Performance Home Sales Training Part II Webinar (Text Version)

    Broader source: Energy.gov [DOE]

    Below is the text version of the webinar DOE Zero Energy Ready Home High-Performance Home Sales Training Part II, presented in February 2015.

  3. DOE Zero Energy Ready Home Case Study, Nexus EnergyHomes, Frederick...

    Energy Savers [EERE]

    Study, Nexus EnergyHomes, Frederick, MD, Production DOE Zero Energy Ready Home Case Study, Nexus EnergyHomes, Frederick, MD, Production This urban infill community features a...

  4. 324 Building B-Cell Pressurized Water Reactor Spent Fuel Packaging & Shipment RL Readiness Assessment Final Report [SEC 1 Thru 3

    SciTech Connect (OSTI)

    HUMPHREYS, D C

    2002-08-01T23:59:59.000Z

    A parallel readiness assessment (RA) was conducted by independent Fluor Hanford (FH) and U. S. Department of Energy, Richland Operations Office (RL) team to verify that an adequate state of readiness had been achieved for activities associated with the packaging and shipping of pressurized water reactor fuel assemblies from B-Cell in the 324 Building to the interim storage area at the Canister Storage Building in the 200 Area. The RL review was conducted in parallel with the FH review in accordance with the Joint RL/FH Implementation Plan (Appendix B). The RL RA Team members were assigned a FH RA Team counterpart for the review. With this one-on-one approach, the RL RA Team was able to assess the FH Team's performance, competence, and adherence to the implementation plan and evaluate the level of facility readiness. The RL RA Team agrees with the FH determination that startup of the 324 Building B-Cell pressurized water reactor spent nuclear fuel packaging and shipping operations can safely proceed, pending completion of the identified pre-start items in the FH final report (see Appendix A), completion of the manageable list of open items included in the facility's declaration of readiness, and execution of the startup plan to operations.

  5. NCTCOG Solar Ready II Project: Clean Air Through Energy Efficiency

    E-Print Network [OSTI]

    Clark,L.

    2014-01-01T23:59:59.000Z

    Clean Air Through Energy Efficiency November 20, 2014 NCTCOG Solar Ready II Project Lori Clark Principal Air Quality Planner ESL-KT-14-11-12 CATEE 2014: Clean Air Through Efficiency Conference, Dallas, Texas Nov. 18-20 U.S. Department of Energy Sun...Shot Initiative Rooftop Solar Challenge 2 ESL-KT-14-11-12 CATEE 2014: Clean Air Through Efficiency Conference, Dallas, Texas Nov. 18-20 U.S. Department of Energy (DOE) SunShot Initiative The U.S. Department of Energy SunShot Initiative is a collaborative national...

  6. NCTCOG Solar Ready II Project: Clean Air Through Energy Efficiency 

    E-Print Network [OSTI]

    Clark,L.

    2014-01-01T23:59:59.000Z

    for connecting solar power to the electric grid, and increasing access to financing, teams will clear a path for rapid expansion of solar energy and serve as models for other communities across the nation. 4 ESL-KT-14-11-12 CATEE 2014: Clean Air Through...Clean Air Through Energy Efficiency November 20, 2014 NCTCOG Solar Ready II Project Lori Clark Principal Air Quality Planner ESL-KT-14-11-12 CATEE 2014: Clean Air Through Efficiency Conference, Dallas, Texas Nov. 18-20 U.S. Department of Energy Sun...

  7. Slideshow: Ready, Set, NASCAR Green at Richmond International Raceway |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreakingMayDepartment of Energy Ready, Set, NASCAR Green at Richmond

  8. Smart Grid Ready PV Inverters with Utility Communication | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreakingMayDepartment of Energy Ready,Smart Grid RFI Public Comments

  9. DOE Zero Energy Ready Home Partner Central | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-Ready Checklist DOE

  10. DOE Zero Energy Ready Home Partner Resources | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-Ready Checklist DOEPartner

  11. DOE Zero Energy Ready Home Resources | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-Ready Checklist

  12. DOE Zero Energy Ready Home Verification | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-Ready

  13. DOE Zero Energy Ready Home Webinar: Building Energy Optimization (BEopt)

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftware | Department

  14. DOE Zero Energy Ready Home: Building America Solution Center | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftware |

  15. DOE Zero Energy Ready Home: Durable Energy Builders, Houston, Texas |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftware |Department

  16. DOE Zero Energy Ready Home: Leganza Residence - Greenbank, Washington |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftwareDepartment of

  17. DOE Zero Energy Ready Home: Montlake Modern - Seattle, Washington |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftwareDepartment

  18. Ghana-Climate Finance Readiness Programme | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdfGetec AG Contracting Jump to: navigation, search Name: GetecGeysersforReadiness

  19. Capture-Ready Power Plants -Options, Technologies and Economics Mark C. Bohm

    E-Print Network [OSTI]

    1 Capture-Ready Power Plants - Options, Technologies and Economics by Mark C. Bohm Bachelor and Policy Program #12;2 #12;3 Capture-ready Power Plants ­ Options, Technologies and Costs by Mark C. Bohm for the Degree of Master of Science in Technology and Policy ABSTRACT A plant can be considered to be capture

  20. Weed Management Costs, Weed Best Management Practices, and The Roundup Ready Weed Management Program

    E-Print Network [OSTI]

    Mitchell, Paul D.

    substantially increase weed management costs and so discourage adoption. This paper uses survey results: glyphosate, resistance management, BMP adoption, telephone survey, herbicide #12;2 INTRODUCTION Roundup ReadyWeed Management Costs, Weed Best Management Practices, and The Roundup Ready® Weed Management

  1. Connecting Ready-to-Work Americans with Ready-to-Be-Filled Jobs in

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.Attachment FY2011-40(10 CFRResourcesMay

  2. Carbon Characterization Laboratory Readiness to Receive Irradiated Graphite Samples

    SciTech Connect (OSTI)

    Karen A. Moore

    2011-05-01T23:59:59.000Z

    The Carbon Characterization Laboratory (CCL) is located in Labs C19 and C20 of the Idaho National Laboratory Research Center. The CCL was established under the Next Generation Nuclear Plant Project to support graphite and ceramic composite research and development activities. The research conducted in this laboratory will support the Advanced Graphite Creep experiments—a major series of material irradiation experiments within the Next Generation Nuclear Plant Graphite program. The CCL is designed to characterize and test low activated irradiated materials such as high purity graphite, carbon-carbon composites, silicon-carbide composite, and ceramic materials. The laboratory is fully capable of characterizing material properties for both irradiated and nonirradiated materials. Major infrastructural modifications were undertaken to support this new radiological facility at Idaho National Laboratory. Facility modifications are complete, equipment has been installed, radiological controls and operating procedures have been established and work management documents have been created to place the CCL in readiness to receive irradiated graphite samples.

  3. 2010 Manufacturing Readiness Assessment Update to the 2008 Report for Fuel Cell Stacks and Systems for the Backup Power and Materials Handling Equipment Markets

    SciTech Connect (OSTI)

    Wheeler, D.; Ulsh, M.

    2012-08-01T23:59:59.000Z

    In 2008, the National Renewable Energy Laboratory (NREL), under contract to the US Department of Energy (DOE), conducted a manufacturing readiness assessment (MRA) of fuel cell systems and fuel cell stacks for back-up power and material handling applications (MHE). To facilitate the MRA, manufacturing readiness levels (MRL) were defined that were based on the Technology Readiness Levels previously established by the US Department of Energy (DOE). NREL assessed the extensive existing hierarchy of MRLs developed by Department of Defense (DoD) and other Federal entities, and developed a MRL scale adapted to the needs of the Fuel Cell Technologies Program (FCTP) and to the status of the fuel cell industry. The MRL ranking of a fuel cell manufacturing facility increases as the manufacturing capability transitions from laboratory prototype development through Low Rate Initial Production to Full Rate Production. DOE can use MRLs to address the economic and institutional risks associated with a ramp-up in polymer electrolyte membrane (PEM) fuel cell production. In 2010, NREL updated this assessment, including additional manufacturers, an assessment of market developments since the original report, and a comparison of MRLs between 2008 and 2010.

  4. Operational readiness review for the Waste Experimental Reduction Facility. Final report

    SciTech Connect (OSTI)

    Not Available

    1993-11-01T23:59:59.000Z

    An Operational Readiness Review (ORR) at the Idaho National Engineering Laboratory`s (INEL`s) Waste Experimental Reduction Facility (WERF) was conducted by EG&G Idaho, Inc., to verify the readiness of WERF to resume operations following a shutdown and modification period of more than two years. It is the conclusion of the ORR Team that, pending satisfactory resolution of all pre-startup findings, WERF has achieved readiness to resume unrestricted operations within the approved safety basis. ORR appraisal forms are included in this report.

  5. Development of a culturally appropriate process for assessing distance learning readiness in Latin America 

    E-Print Network [OSTI]

    Villalobos Peñ alosa, Patricia

    2009-05-15T23:59:59.000Z

    The purpose of this study was to develop an instrument for assessing distance learning readiness of institutions in Latin America for international projects of food and agriculture with higher education institutions in the ...

  6. DOE Zero Ready Home Case Study: BPC Green Builders, Trolle Residence...

    Broader source: Energy.gov (indexed) [DOE]

    BPC Green Builders Trolle Residence Danbury, CT DOE ZERO ENERGY READY HOME(tm) The U.S. Department of Energy invites home builders across the country to meet the extraordinary...

  7. DOE ZERH Webinar: Updates to the DOE Zero Energy Ready Home Specs...

    Energy Savers [EERE]

    updated the DOE Zero Energy Ready Home specs, we've continued to track our partner feedback and other industry issues. This brings us to the release of Revision 05, which...

  8. DOE Zero Energy Ready Home Case Study: TC Legend Homes, Bellingham, WA

    Broader source: Energy.gov [DOE]

    Case study of a DOE Zero Energy Ready home in Bellingham, WA, that achieves HERS 43 without PV or HERS 13 with 3.2 kW of PV.

  9. DOE Zero Energy Ready Home Going Green and Building Strong: Building...

    Office of Environmental Management (EM)

    2 Webinar (Text Version) DOE Zero Energy Ready Home Going Green and Building Strong: Building a FORTIFIED Home -- Part 2 Webinar (Text Version) Below is the text version of the...

  10. DOE Zero Ready Home Case Study: Green Extreme Homes & Carl Franklin...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    certifi ed to the high performance requirements of the U.S. Department of Energy's Zero Energy Ready Home program, thanks to a successful collaboration between the non-profi t...

  11. DOE Zero Energy Ready Home Case Study 2013: KB Home, San Marcos...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy (DOE) Zero Energy Ready Home. The home is one of KB Homes' ZeroHouse 2.0 models, a net-zero-energy home that produces more energy each year than it consumes. "It is an honor...

  12. DOE Zero Energy Ready Home Case Study: e2 Homes, Winter Park...

    Energy Savers [EERE]

    study of a DOE Zero Energy Ready Home in Winter Park, FL, that scored HERS 57 without PV or HERS -7 with PV. This 4,305-square-foot custom home has autoclaved aerated concrete...

  13. DOE Zero Energy Ready Home Case Study: Boulder ZED Design Build...

    Energy Savers [EERE]

    inch of closed-cell foam below the roof deck in the vaulted ceilings, a ground-source heat pump, ERV, and triple-pane windows. DOE Zero Energy Ready Home: Boulder ZED Design Build,...

  14. DOE Zero Energy Ready Home Case Study 2013: StreetScape Development...

    Broader source: Energy.gov (indexed) [DOE]

    being made solar-ready with conduit and wiring installed to the roof and the electrical panel but solar panels have not yet been installed. Homeowner Quintin expresses some regret...

  15. DOE Zero Energy Ready Home Case Study 2013: Mandalay Homes, Phoenix...

    Broader source: Energy.gov (indexed) [DOE]

    owner of Mandalay Homes, fi rst heard about the U.S. Department of Energy's Zero Energy Ready Home program, he was skeptical. The production home builder was focusing much of...

  16. FOOD SAFETY INFOSHEET: BE READY FOR STORMS If the power goes out what

    E-Print Network [OSTI]

    Liskiewicz, Maciej

    (without cream or custard), cookies and muffins and certain hard cheeses. Keep the refrigerator and freezer thermometer ready to check foods. · have items that don't require refrigeration and can be eaten cold

  17. Application of the cumulative risk model in predicting school readiness in Head Start children

    E-Print Network [OSTI]

    Rodriguez-Escobar, Olga Lydia

    2009-05-15T23:59:59.000Z

    outcomes. This study built on this literature by investigating how child, parent, and family risk factors predicted school readiness in Head Start children using two statistical models. Specific aims of this study included identifying 1) to what degree...

  18. Financing Capture Ready Coal-Fired Power Plants in China by Issuing Capture Options

    E-Print Network [OSTI]

    Liang, Xi; Reiner, David; Gibbons, Jon; Li, Jia

    investors diversify risk, and offer global warming investors an alternative investment opportunity. As a detailed case study, we assess the value of a Capture Option and Capture Ready plant for a 600 MW supercritical pulverized coal power plant in China...

  19. DOE ZERH Webinar: Technical Resources for Marketing and Selling Zero Energy Ready Homes

    Broader source: Energy.gov [DOE]

    Plan review… energy modeling… field inspections… certification…done!  Right?  If only it were that simple to successfully transition to Zero Energy Ready Homes.  The reality is that there’s a lot...

  20. The Sandia MEMS Passive Shock Sensor : FY08 testing for functionality, model validation, and technology readiness.

    SciTech Connect (OSTI)

    Walraven, Jeremy Allen; Blecke, Jill; Baker, Michael Sean; Clemens, Rebecca C.; Mitchell, John Anthony; Brake, Matthew Robert; Epp, David S.; Wittwer, Jonathan W.

    2008-10-01T23:59:59.000Z

    This report summarizes the functional, model validation, and technology readiness testing of the Sandia MEMS Passive Shock Sensor in FY08. Functional testing of a large number of revision 4 parts showed robust and consistent performance. Model validation testing helped tune the models to match data well and identified several areas for future investigation related to high frequency sensitivity and thermal effects. Finally, technology readiness testing demonstrated the integrated elements of the sensor under realistic environments.

  1. Effects of glyphosate over-the-top applications on the reproductive growth of Roundup Ready cotton

    E-Print Network [OSTI]

    Mery Suarez, Ramon Felipe

    2003-01-01T23:59:59.000Z

    EFFECTS OF GLYPHOSATE OVER-THE-TOP APPLICATIONS ON THE REPRODUCTIVE GROWTH OF ROUNDUP READY COTTON A Thesis by RAMON FELIPE MERY SUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2003 Major Subject: Molecular and Environmental Plant Sciences EFFECTS OF GLYPHOSATE OVER-THE-TOP APPLICATIONS ON THE REPRODUCTIVE GROWTH OF ROUNDUP READY COTTON A Thesis by RAMON FELIPE MERY SUAREZ...

  2. Summary - Savannah River Site Tank 48H Waste Treatment Project

    Office of Environmental Management (EM)

    ng (FBSR). Th deciding which ng the Tank 48 he TRA Team m determined t ts (CTEs) and t ess Level (TRL) on Process: stem (TRL3) atment System RA reports, please v govPages...

  3. Guidelines for Participating in the DOE Zero Energy Ready Home...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    for the new window specs (see End Note 12 of the Rev.05 specs). Meet 2012 International Energy Conservation Code levels for insulation. In some states 2015 IECC insulation levels...

  4. Scientific Solutions (TRL 5 6 Component) - Underwater Active Acoustic

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy atLLC - FE DKT. 10-160-LNG -EnergyProcess|2 (TextScienceScience.gov?

  5. READY FOR TODAY. PREPARING FOR TOMORROW. The Joint Operating Environment is intended to inform joint concept

    E-Print Network [OSTI]

    Sainudiin, Raazesh

    READY FOR TODAY. PREPARING FOR TOMORROW. #12;The Joint Operating Environment is intended to inform. Inquiries about the Joint Operating Environment should be directed to USJFCOM Public Affairs, 1562 Mitscher R O N M E N T ( J O E ) #12;While U.S. Joint Forces Command's Joint Operating Environment (JOE

  6. Capture-Ready Coal Plants -Options, Technologies and Economics Mark C. Bohm1

    E-Print Network [OSTI]

    1 Capture-Ready Coal Plants - Options, Technologies and Economics Mark C. Bohm1 , Howard J. Herzog1 be employed during the initial design and construction of a both pulverized coal and integrated gasification the Internet in the summer of 2006 [7]. Introduction Interest in the construction of coal-fired power

  7. Capture-ready coal plants--Options, technologies and Mark C. Bohm a

    E-Print Network [OSTI]

    Capture-ready coal plants--Options, technologies and economics Mark C. Bohm a , Howard J. Herzog a. Introduction Interest in the construction of coal-fired power generation has increased significantly in recent the construction of coal-fired plants. Worldwide, the installed capacity of coal-fired plants is expected

  8. Guidelines for Final Camera-Ready Manuscripts XXXXX Miya and YYYYY ZZZZ

    E-Print Network [OSTI]

    Tachizawa, Kazuya

    Guidelines for Final Camera-Ready Manuscripts XXXXX Miya and YYYYY ZZZZ Department of Information to the directions reported in this document. I. INTRODUCTION This document shows guidelines for preparing a final is 4mm (0.17 in). Paragraph indentation is 3.5 mm (0.14 in). D. Style The style of the paper is single

  9. Ohio-Kentucky-Indiana Regional Council of Governments Go Solar Ready – Solar Map

    Broader source: Energy.gov [DOE]

    The Ohio-Kentucky-Indiana Regional Council of Governments Go Solar Ready Map provides general information about the estimated annual solar energy potential on building rooftops in the OKI region. The intention of this tool is to provide the user a general understanding of the solar energy available on rooftops in the OKI tristate region.

  10. DOE Zero Energy Ready Home Case Study, e2Homes, Winterpark, FL, Custom Homes

    Broader source: Energy.gov [DOE]

    Case study of a DOE Zero Energy Ready Home in Winter Park, FL that scored HERS 57 without PV or HERS -7 with PV. This 4,305 ft2 custom home has autoclaved aerated concrete walls, a sealed attic with R-20 spray foam, and ductless mini-split heat pumps.

  11. Department of Materials Science and Engineering Four Year Plan (201213 Catalog, ready for calculus)

    E-Print Network [OSTI]

    Barrash, Warren

    Department of Materials Science and Engineering Four Year Plan (201213 Catalog, ready Mechanical Behavior of Materials 3 ENGR 210 Statics 3 MSE 380 Materials Science and Engineering Lab 2 MATH by the student's advisor. #12;Department of Materials Science and Engineering Four Year Plan (201213

  12. Department of Materials Science and Engineering Four Year Plan (201314 Catalog, ready for calculus)

    E-Print Network [OSTI]

    Barrash, Warren

    Department of Materials Science and Engineering Four Year Plan (201314 Catalog, ready 360 Engineering Statistics 3 MSE 380 Materials Science and Engineering Lab 2 Technical or engineering) MSE 482 Senior Project II 3 MSE 404L Materials Analysis Lab 1 Technical or engineering elective 3

  13. DOE Zero Energy Ready Home Case Study: TC Legend Homes, Bellingham...

    Broader source: Energy.gov (indexed) [DOE]

    study of a DOE Zero Energy Ready home in Bellingham, WA, that achieves HERS 43 without PV or HERS 13 with 3.2 kW of PV. The 1,055-ft2 two-story production home has 6-in. SIP...

  14. Focus Sheet | Hazardous Waste Checklist How to be ready for state hazardous waste

    E-Print Network [OSTI]

    Wilcock, William

    storage cabinet. Avoid accumulating a lot of waste ­ keep areas clear. EPO ­ Hazardous Waste Checklist 07Focus Sheet | Hazardous Waste Checklist How to be ready for state hazardous waste inspectors. See a hazardous waste inspection. ons, rrosive. n hemicals? ical waste. Waste-like chemicals have als Are you

  15. MOVIE "CHICAGO CITY COUNCIL: READY FOR REFORM?" (27 minutes/color)

    E-Print Network [OSTI]

    Illinois at Chicago, University of

    , transportation, and health care. 8. Investigate how many of the reform proposals were in place twenty years afterMOVIE ­ "CHICAGO CITY COUNCIL: READY FOR REFORM?" (27 minutes/color) SYNOPSIS Following the death of Mayor Harold Washington, residents and reformers of Chicago still hoped for continued reform in Chicago

  16. Operational Readiness Review Final Report For F-Canyon Restart. Phase 1

    SciTech Connect (OSTI)

    McFarlane, A.F.; Spangler, J.B.

    1995-04-05T23:59:59.000Z

    An independent WSRC Operational Readiness Review was performed for the restart of Phase 1 processing in F-Canyon, Building 221-F. Readiness to restart the Second Plutonium Cycle process and solvent recovery was assessed. The ORR was conducted by an ORR board of ten members with the support of a subject matter expert. The chairman and four members were drawn from the Operational Safety Evaluation Department, ESH& QA Division; additional members were drawn from other WSRC divisions, independent of the F-Canyon operating division (NMPD). Based on the results of the readiness verification assessments performed according to the ORR plan and the validation of pre-restart corrective actions, the WSRC independent ORR Board has concluded that the facility has achieved the state of readiness committed to in the Restart Plan. Also, based on the scope of the ORR, it is the opinion of the board that F-Canyon Phase 1 processes can be restarted without undue risk to the safety of the public and onsite workers and without undue risk to the environment.

  17. Organizational readiness for innovation in health care: some lessons from the recent literature

    E-Print Network [OSTI]

    Birmingham, University of

    PA P E R S Organizational readiness for innovation in health care: some lessons from the recent into organizational contexts and receptive climates for innovation can only be developed incrementally over time for innovation. Key organizational strategies for embedding innovation include: development of incentives

  18. Financing Capture Ready Coal-Fired Power Plants in China by Issuing Capture Options

    E-Print Network [OSTI]

    Aickelin, Uwe

    Financing Capture Ready Coal-Fired Power Plants in China by Issuing Capture Options Xi Liang, Jia supercritical pulverized coal power plant in China, using a cash flow model with Monte-Carlo simulations Defense Council) O&M (Operating & Maintenance) PC Power Plant (Pulverized Coal Fired Power Plant) ROA

  19. Dow Jones Reprints: This copy is for your personal, non-commercial use only. To order presentation-ready copies for distribution to your colleagues, clients or customers, use the Order Reprints tool at the bottom of any article or visit www.djreprints.com

    E-Print Network [OSTI]

    Kuzmanovic, Aleksandar

    million project to map all plant biology research, from the level of molecules to organisms to entireDow Jones Reprints: This copy is for your personal, non-commercial use only. To order presentation-ready By ROBERT LEE HOTZ If all goes well, researchers Friday may power up the Large Hadron Collider -- a $6

  20. Planning and Conducting Readiness Reviews - DOE Directives, Delegations,

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for RenewableSpeedingBiomassPPPOPetroleum ReservesThrustBonneville PowerAfter theaand

  1. Colorado Community Readiness Efforts for PEVs Support State Policy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T, Inc.'sEnergyTexas1. FeedstockCLEAN AIREmergencyNewsEnergyTeams

  2. Building America Zero Energy Ready Home Case Study: Southeast Volusia

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJune 2,The BigSiding RetrofitforCamberly Homes - SilverGreen

  3. What's Your PEV Readiness Score? | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradley Nickell DirectorThe&ManagementEfficiency |A N EThisPEV

  4. EECBG Success Story: LEDs Ready for Takeoff at Louisiana Airport |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S.ContaminationJulySavannah River SiteDepartment of Energy Members ofofWater

  5. Recovery Act's HWCTR Project Empty of Equipment, Ready for Grouting |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015of 2005UNS Electric,RM ExitPropertySeptember 16,DeliveryBuilding

  6. Uranium Processing Facility Site Readiness Subproject Completed on Time and

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA groupTuba City,EnrichedSupplemental Directives |andAbout Us / Our Programs /Under

  7. Uranium Processing Facility Site Readiness Subproject Completed on Time and

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved: 5-13-14Russian Nuclear Warheads Arrives in United StatesUniversityUnder

  8. Preliminary Technology Readiness Assessment (TRA) for the Calcine

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie Croft

  9. Readiness Review Training - Team Leader | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - TProcuring

  10. SRS Tank 48H Waste Treatment Project Technology Readiness Assessment

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSARDevelopmental AssignmentApril 2,

  11. Tank Waste Feed Delivery System Readiness at the Hanford Site

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssues DOE'sSummaryDepartmentEnergyonWIPP 11-3458Taking StepsAudit

  12. Sustainability Assessment of Workforce Well-Being and Mission Readiness |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014,Zaleski -BlueprintThis document detailsEnergyIn SustainX

  13. DOE Zero Energy Ready Home Partner Central | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable EnergyDepartment

  14. DOE Zero Energy Ready Home Resources | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable

  15. Are You Ready for Fall? | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy:Whether you'reInc.: FederalInter‐stage Piping inDepartment ofThis

  16. Synthetic muscle developed with PPPL scientists' help ready for launch |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposed Action(Insert DirectiveSynthetic fuel

  17. Zero Energy Ready Home Update Newsletter | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartment of EnergyThePatricia2012) | DepartmentAs a DOEReady Home Update

  18. Preliminary Technology Readiness Assessment (TRA) for the Calcine

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHA AdministrativeofDepartment of-Department|EA-97-12|

  19. Uranium Downblending and Disposition Project Technology Readiness Assessment

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2Uranium TransferonUS-India EnergyUnlocking CustomerOutreachReport onEducation

  20. The Valles Caldera is ready for its close-up

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect, National.** #andUserThe

  1. Module Embedded Microinverter Smart Grid Ready Residential Solar Electric

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaeferApril 1,(EAC)TABLE OF CONTENTSTogetherTheSystem | Department of Energy

  2. Readiness Review Training - Development of Criteria And Review Approach

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergy Small TeamNOT MEASUREMENT SENSITIVE,Department ofDocuments | Department

  3. Technology Readiness Assessment Guide - DOE Directives, Delegations, and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over Our InstagramStructureProposedPAGESafety Tag:8,, 20153AssistanceKey toDepartment

  4. Microsoft Word - 15-GM.02, Rev. 8 - ready to issue

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighandSWPA / SPRA / USACE SWPA /9-1595:UFC649:UFC02/18/14Department 1

  5. New DOE Report Investigates Port Readiness for Offshore Wind | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaeferAprilOverview | Department of1-93Energy Carlsbad FieldEnergy

  6. Fast pandemic detection tool ready to fight flu

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC) Environmental Assessments (EA)Budget » FY 2014FacilitiesSheet2 C STEC

  7. Slideshow: Ready, Set, NASCAR Green at Richmond International Raceway |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014,Zaleski - PolicyWork Force with evenControl SystemsAgenda Microsoft

  8. Are You Ready for Fall? | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department of Energy | DecemberCommoditiesLLCGroup Charter2006 JuneThis week,

  9. NERSC Hosts Application Readiness and Portability Meeting with OLCF and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1AllocationsNOVA Portal: Submit2014ftp ftp14,ALCF

  10. The ATLAS Trigger System: Ready for Run-2

    E-Print Network [OSTI]

    Nakahama, Yu; The ATLAS collaboration

    2015-01-01T23:59:59.000Z

    The ATLAS trigger has been used very successfully for the online event selection during the first run of the LHC between 2009-2013 at a centre-of-mass energy between 900 GeV and 8 TeV. The trigger system consists of a hardware Level-1 (L1) and a software based high-level trigger (HLT) that reduces the event rate from the design bunch-crossing rate of 40 MHz to an average recording rate of a few hundred Hz. During the next data-taking period starting in early 2015 (Run-2) the LHC will operate at a centre-of-mass energy of about 13 TeV resulting in roughly five times higher trigger rates. We will review the upgrades to the ATLAS Trigger system that have been implemented during the shutdown and that will allow us to cope with these increased trigger rates while maintaining or even improving our efficiency to select relevant physics processes. This includes changes to the L1 calorimeter trigger, the introduction of a new L1 topological trigger module, improvements in the L1 muon system and the merging of the prev...

  11. Influence of Agricultural Dual Credit on Student College Readiness Self-Efficacy

    E-Print Network [OSTI]

    Neely, Alanna L.

    2013-07-12T23:59:59.000Z

    INFLUENCE OF AGRICULTURAL DUAL CREDIT ON STUDENT COLLEGE READINESS SELF-EFFICACY A Record of Study by ALANNA LEE NEELY Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... should consider earning postsecondary degrees and credentials. The Completion Agenda states: This increased focus on college completion (not simply college access) is reflected in, for example, President Obama?s goal for the United States...

  12. DOE Zero Ready Home Case Study: Amerisips Homes, Miller-Bloch Residence, Johns Island, SC

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy Ready Home

  13. DOE Zero Ready Home Case Study: AquaZephyr, Eco-Vilage Ithaca, Ithaca NY

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy Ready

  14. Distributed thermal energy storage in the residential sector: commercialization-readiness assessment and implementation strategy

    SciTech Connect (OSTI)

    None

    1980-08-01T23:59:59.000Z

    The readiness of each of three candidate TES systems for near-term commercialization was examined. It was concluded that of these, TES for residential space and hot-water heating are technically and economically ready for commercialization. TES systems are unlikely to be more attractive than standard-heat-pump systems in all areas of the country; however, in many regions, particularly in the northeast and north central states, TES appears to be more attractive. In the not-too-distant future, use of TES with heat pumps may prove to be the best system nationwide. For the third system, TES for residential space cooling, it was found that those units that are presently technically viable would be too costly except in a few parts of the country; more development will be required before these systems could be commercialized on a national scale. TES systems that might be used in commercial buildings (e.g., stores and office buildings) were not examined. Environmental, market and economic, and institutional-readiness studies are presented. Market penetration and benefit analysis are summarized. Barriers to commercialization are identified along with strategies for overcoming the barriers. Schedules and resource requirements are discussed. Summaries of the study techniques and additional information are given in the appendices. (MCW)

  15. DOE Zero Ready Home Case Study: Southern Energy Homes, First DOE Zero Energy Ready Manufactured Home, Russelville, AL

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergyBoilersPlant |AddressingNM,FORTIFIEDDepartmentSouthern

  16. UTILITY ADVANCED TURBINE SYSTEMS(ATS) TECHNOLOGY READINESS TESTING

    SciTech Connect (OSTI)

    Kenneth A. Yackly

    2001-06-01T23:59:59.000Z

    The following paper provides an overview of GE's H System{trademark} technology, and specifically, the design, development, and test activities associated with the DOE Advanced Turbine Systems (ATS) program. There was intensive effort expended in bringing this revolutionary advanced technology program to commercial reality. In addition to describing the magnitude of performance improvement possible through use of H System{trademark} technology, this paper discusses the technological milestones during the development of the first 9H (50Hz) and 7H (60 Hz) gas turbines. To illustrate the methodical product development strategy used by GE, this paper discusses several technologies that were essential to the introduction of the H System{trademark}. Also included are analyses of the series of comprehensive tests of materials, components and subsystems that necessarily preceded full scale field testing of the H System{trademark}. This paper validates one of the basic premises with which GE started the H System{trademark} development program: exhaustive and elaborate testing programs minimized risk at every step of this process, and increase the probability of success when the H System{trademark} is introduced into commercial service. In 1995, GE, the world leader in gas turbine technology for over half a century, in conjunction with the DOE National Energy Technology Laboratory's ATS program, introduced its new generation of gas turbines. This H System{trademark} technology is the first gas turbine ever to achieve the milestone of 60% fuel efficiency. Because fuel represents the largest individual expense of running a power plant, an efficiency increase of even a single percentage point can substantially reduce operating costs over the life of a typical gas-fired, combined-cycle plant in the 400 to 500 megawatt range. The H System{trademark} is not simply a state-of-the-art gas turbine. It is an advanced, integrated, combined-cycle system in which every component is optimized for the highest level of performance. The unique feature of an H-technology combined-cycle system is the integrated heat transfer system, which combines both the steam plant reheat process and gas turbine bucket and nozzle cooling. This feature allows the power generator to operate at a higher firing temperature than current technology units, thereby resulting in dramatic improvements in fuel-efficiency. The end result is the generation of electricity at the lowest, most competitive price possible. Also, despite the higher firing temperature of the H System{trademark}, the combustion temperature is kept at levels that minimize emission production. GE has more than 3.6 million fired hours of experience in operating advanced technology gas turbines, more than three times the fired hours of competitors' units combined. The H System{trademark} design incorporates lessons learned from this experience with knowledge gleaned from operating GE aircraft engines. In addition, the 9H gas turbine is the first ever designed using ''Design for Six Sigma'' methodology, which maximizes reliability and availability throughout the entire design process. Both the 7H and 9H gas turbines will achieve the reliability levels of our F-class technology machines. GE has tested its H System{trademark} gas turbine more thoroughly than any previously introduced into commercial service. The H System{trademark} gas turbine has undergone extensive design validation and component testing. Full-speed, no-load testing of the 9H was achieved in May 1998 and pre-shipment testing was completed in November 1999. The 9H will also undergo approximately a half-year of extensive demonstration and characterization testing at the launch site. Testing of the 7H began in December 1999, and full speed, no-load testing was completed in February 2000. The 7H gas turbine will also be subjected to extensive demonstration and characterization testing at the launch site.

  17. Readiness of the ATLAS Liquid Argon Calorimeter for LHC Collisions

    E-Print Network [OSTI]

    The ATLAS Collaboration

    2010-05-25T23:59:59.000Z

    The ATLAS liquid argon calorimeter has been operating continuously since August 2006. At this time, only part of the calorimeter was readout, but since the beginning of 2008, all calorimeter cells have been connected to the ATLAS readout system in preparation for LHC collisions. This paper gives an overview of the liquid argon calorimeter performance measured in situ with random triggers, calibration data, cosmic muons, and LHC beam splash events. Results on the detector operation, timing performance, electronics noise, and gain stability are presented. High energy deposits from radiative cosmic muons and beam splash events allow to check the intrinsic constant term of the energy resolution. The uniformity of the electromagnetic barrel calorimeter response along eta (averaged over phi) is measured at the percent level using minimum ionizing cosmic muons. Finally, studies of electromagnetic showers from radiative muons have been used to cross-check the Monte Carlo simulation. The performance results obtained using the ATLAS readout, data acquisition, and reconstruction software indicate that the liquid argon calorimeter is well-prepared for collisions at the dawn of the LHC era.

  18. AVTA: Reports on Plug-in Electric Vehicle Readiness at 3 DOD Facilities

    Broader source: Energy.gov [DOE]

    The Vehicle Technologies Office's Advanced Vehicle Testing Activity carries out testing on a wide range of advanced vehicles and technologies on dynamometers, closed test tracks, and on-the-road. These results provide benchmark data that researchers can use to develop technology models and guide future research and development. The following reports analyze data and survey results on readiness for the use of plug-in electric vehicles on the Naval Air Station Jacksonville, Naval Station Mayport, and Joint Base Lewis McChord, as informed by the AVTA's testing on plug-in electric vehicle charging equipment. This research was conducted by Idaho National Laboratory.

  19. Data Center Energy Efficiency and Renewable Energy Site Assessment: Anderson Readiness Center; Salem, Oregon

    SciTech Connect (OSTI)

    Metzger, I.; Van Geet, O.

    2014-06-01T23:59:59.000Z

    This report summarizes the results from the data center energy efficiency and renewable energy site assessment conducted for the Oregon Army National Guard in Salem, Oregon. A team led by NREL conducted the assessment of the Anderson Readiness Center data centers March 18-20, 2014 as part of ongoing efforts to reduce energy use and incorporate renewable energy technologies where feasible. Although the data centers in this facility account for less than 5% of the total square footage, they are estimated to be responsible for 70% of the annual electricity consumption.

  20. Ohio-Kentucky-Indiana Regional Council of Governments Solar Ready Construction Guidelines

    Broader source: Energy.gov [DOE]

    These voluntary guidelines are developed for the local governments of the OKI region to provide guidance for residential developers, home builders, and architects in the design and construction of new residential buildings. These guidelines are intended to guide a developer, architect, or other interested party through the components of building design required to prepare a building for future solar installation. These guidelines include best practices for solar-ready building design to minimize the costs of future solar installation while maximizing potential system efficiency and apply to site selection, building design, and building construction.

  1. DOE Zero Energy Ready Home: Better Business for Builders Webinar Transcript

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftware | Department|

  2. DOE Zero Energy Ready Home: Healthy Efficient Homes - Spirit Lake, Iowa |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the YouTube| Department ofDepartment of EnergyCustom Home|PV-ReadySoftware

  3. DOE Zero Ready Home Case Study: BPC Green Builders, Trolle Residence, Danbury, CT

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy ReadyBPC Green

  4. DOE Zero Ready Home Case Study: Brookside Development, Singer Village, Derby, CT

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy ReadyBPC

  5. DOE Zero Ready Home Case Study: Clifton View Homes, Kaltenbach Residence, Clinton, WA

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials |Production | Zero Energy ReadyBPCKaltenbach

  6. RISK REDUCTION THROUGH USE OF EXTERNAL TECHNICAL REVIEWS, TECHNOLOGY READINESS ASSESSMENTS AND TECHNICAL RISK RATINGS - 9174

    SciTech Connect (OSTI)

    Cercy, M; Steven P Schneider, S; Kurt D Gerdes, K

    2008-12-12T23:59:59.000Z

    The U.S. Department of Energy's Office of Environmental Management (DOE-EM) was established to achieve the safe and compliant disposition of legacy wastes and facilities from defense nuclear applications. A large majority of these wastes and facilities are 'one-of-a-kind' and unique to DOE. Many of the programs to treat these wastes have been 'first-of-a-kind' and unprecedented in scope and complexity. This has meant that many of the technologies needed to successfully disposition these wastes were not yet developed or required significant re-engineering to be adapted for DOE-EM's needs. The DOE-EM program believes strongly in reducing the technical risk of its projects and has initiated several efforts to reduce those risks: (1) Technology Readiness Assessments to reduce the risks of deployment of new technologies; (2) External Technical Reviews as one of several steps to ensure the timely resolution of engineering and technology issues; and (3) Technical Risk Ratings as a means to monitor and communicate information about technical risks. This paper will present examples of how Technology Readiness Assessments, External Technical Reviews, and Technical Risk Ratings are being used by DOE-EM to reduce technical risks.

  7. RISK REDUCTION THROUGH USE OF EXTERNAL TECHNICAL REVIEWS, TECHNOLOGY READINESS ASSESSMENTS AND TECHNICAL RISK RATINGS - 9174

    SciTech Connect (OSTI)

    Cercy, M; Steven P Schneider, S; Kurt D Gerdes, K

    2009-01-15T23:59:59.000Z

    The U.S. Department of Energy's Office of Environmental Management (DOE-EM) was established to achieve the safe and compliant disposition of legacy wastes and facilities from defense nuclear applications. A large majority of these wastes and facilities are 'one-of-a-kind' and unique to DOE. Many of the programs to treat these wastes have been 'first-of-a-kind' and unprecedented in scope and complexity. This has meant that many of the technologies needed to successfully disposition these wastes were not yet developed or required significant re-engineering to be adapted for DOE-EM's needs. The DOE-EM program believes strongly in reducing the technical risk of its projects and has initiated several efforts to reduce those risks: (1) Technology Readiness Assessments to reduce the risks of deployment of new technologies; (2) External Technical Reviews as one of several steps to ensure the timely resolution of engineering and technology issues; and (3) Technical Risk Ratings as a means to monitor and communicate information about technical risks. This paper will present examples of how Technology Readiness Assessments, External Technical Reviews, and Technical Risk Ratings are being used by DOE-EM to reduce technical risks.

  8. Report of independent consultants reviewing Integrated Test Stands (ITS) performance and readiness of DARHT for construction start

    SciTech Connect (OSTI)

    Not Available

    1993-08-01T23:59:59.000Z

    Independent consultants met at Los Alamos, June 15 and 16, 1993, to review progress on the commissioning of the Integrated Test Stand (ITS) for DARHT and to provide DOE with technical input on readiness for construction of the first radiographic arm of DARHT. The consultants concluded that all milestones necessary for demonstrating the performance of the DARHT accelerator have been met and that the project is ready for construction to resume. The experimental program using ITS should be continued to quantify the comparison of experiment and theory, to test improvements on the injector insulator, and to better evaluate the interaction of the beam and the target.

  9. OTM and UTARI personnel will perform Technology

    E-Print Network [OSTI]

    Huang, Haiying

    OTM and UTARI personnel will perform Technology Readiness (TRL) & Manufacturing Readiness (MRL to the Office of Technology Management via the OTM webpage OTM and UTARI personnel will review the IPD and meet for the technology; At the same time, OTM may assist in obtaining funding (SBIR/STTR, etc.) and/or technology may (a

  10. Epistemic levels

    E-Print Network [OSTI]

    Greco, Daniel (Daniel Louis)

    2012-01-01T23:59:59.000Z

    In this dissertation I defend some controversial "level-bridging" principles in epistemology. In the first chapter, I defend the KK principle-the principle that if one knows that P, then one knows that one knows that P. I ...

  11. Welcome to the Operation READY 2002 collection Flexible formats: print, CD-ROM, DVD video and Web

    E-Print Network [OSTI]

    1 Welcome to the Operation READY 2002 collection Flexible formats: print, CD-ROM, DVD video and Web and deployment New and updated videos Family Assistance Center Workshops and sessions are shorter Scenarios are shorter Lessons are self-contained Planning and executing a FACEX added New and updated video Homecoming

  12. First Commercial US Mixed Waste Vitrification Facility: Permits, Readiness Reviews, and Delisting of Final Wasteform

    SciTech Connect (OSTI)

    Pickett, J.B. [Westinghouse Savannah River Company, AIKEN, SC (United States); Norford, S.W.; Diener, G.A.

    1998-06-01T23:59:59.000Z

    Westinghouse Savannah River Co. (WSRC) contracted GTS Duratek (Duratek) to construct and operate the first commercial vitrification facility to treat an F-006 mixed (radioactive/hazardous) waste in the United States. The permits were prepared and submitted to the South Carolina state regulators by WSRC - based on a detailed design by Duratek. Readiness Assessments were conducted by WSRC and Duratek at each major phase of the operation (sludge transfer, construction, cold and radioactive operations, and a major restart) and approved by the Savannah River Department of Energy prior to proceeding. WSRC prepared the first `Upfront Delisting` petition for a vitrified mixed waste. Lessons learned with respect to the permit strategy, operational assessments, and delisting from this `privatization` project will be discussed.

  13. Katharine Page-Atomic-level insights for better materials

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |Is Your Home as Ready for(SC)JointJournalandKaslina Love

  14. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from ENSDF

  15. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from

  16. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2 O

  17. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2 O3

  18. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2 O3Be

  19. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2

  20. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2B

  1. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2BBe

  2. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li from2BBeNe

  3. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4Li

  4. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiB from

  5. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiB fromC

  6. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiB fromCNe

  7. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiB fromCNe9

  8. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiB fromCNe9C

  9. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiB

  10. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiBN from

  11. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiBN from5 H

  12. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiBN from5 H6

  13. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiBN from5

  14. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiBN from58 C

  15. Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4LiBN from58

  16. Hanford Site River Protection Project High-Level Waste Safe Storage and Retrieval

    SciTech Connect (OSTI)

    Aromi, E. S.; Raymond, R. E.; Allen, D. I.; Payne, M. A.; DeFigh-Price, C.; Kristofzski, J. G.; Wiegman, S. A.

    2002-02-25T23:59:59.000Z

    This paper provides an update from last year and describes project successes and issues associated with the management and work required to safely store, enhance readiness for waste feed delivery, and prepare for treated waste receipts for the approximately 53 million gallons of mixed and high-level waste currently in aging tanks at the Hanford Site. The Hanford Site is a 560 square-mile area in southeastern Washington State near Richland, Washington.

  17. Hydrogen Infrastructure Market Readiness: Opportunities and Potential for Near-term Cost Reductions; Proceedings of the Hydrogen Infrastructure Market Readiness Workshop and Summary of Feedback Provided through the Hydrogen Station Cost Calculator

    SciTech Connect (OSTI)

    Melaina, M. W.; Steward, D.; Penev, M.; McQueen, S.; Jaffe, S.; Talon, C.

    2012-08-01T23:59:59.000Z

    Recent progress with fuel cell electric vehicles (FCEVs) has focused attention on hydrogen infrastructure as a critical commercialization barrier. With major automakers focused on 2015 as a target timeframe for global FCEV commercialization, the window of opportunity is short for establishing a sufficient network of hydrogen stations to support large-volume vehicle deployments. This report describes expert feedback on the market readiness of hydrogen infrastructure technology from two activities.

  18. Tool Helps Utilities Assess Readiness for Electric Vehicle Charging (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2011-10-01T23:59:59.000Z

    NREL research helps answer a fundamental question regarding electric vehicles: Is the grid ready to handle them? Environmental, economic and security concerns regarding oil consumption make electrifying the transportation sector a high national priority. NREL's Center for Transportation Technologies & Systems (CTTS) has developed a framework for utilities to evaluate the plug-in vehicle (PEV) readiness of distribution transformers. Combining a wealth of vehicle performance statistics with load data from partner utilities including the Hawaiian Electric Company and Xcel Energy, NREL analyzed the thermal loading characteristics of distribution transformers due to vehicle charging. After running millions of simulations replicating varying climates and conditions, NREL is now able to predict aging rates for transformers when PEVs are added to existing building loads. With the NREL tool, users define simulation parameters by inputting vehicle trip and weather data; transformer load profiles and ratings; PEV penetration, charging rates and battery sizes; utility rates; the number of houses on each transformer; and public charging availability. Transformer load profiles, drive cycles, and ambient temperature data are then run through the thermal model to produce a one-year timeseries of the hotspot temperature. Annual temperature durations are calculated to help determine the annual aging rate. Annual aging rate results are grouped by independent variables. The most useful measure is transformer mileage, a measure of how many electrically-driven miles must be supplied by the transformer. Once the spectrum analysis has been conducted for an area or utility, the outputs can be used to help determine if more detailed evaluation is necessary, or if transformer replacement is required. In the majority of scenarios, transformers have enough excess capacity to charge PEVs. Only in extreme cases does vehicle charging have negative long-term impact on transformers. In those cases, upgrades to larger transformers would be recommended. NREL analysis also showed opportunity for newly-installed smart grids to offset distribution demands by time-shifting the charging loads. Most importantly, the model demonstrated synergies between PEVs and distributed renewables, not only providing clean renewable energy for vehicles, but also reducing demand on the entire distribution infrastructure by supplying loads at the point of consumption.

  19. A wind turbine blade is ready to be lifted into place at the Windy Point Wind Farm in the Columbia River Gorge. Photo: C. Bruce Forster

    E-Print Network [OSTI]

    A wind turbine blade is ready to be lifted into place at the Windy Point Wind Farm in the Columbia with juvenile bypass systems to keep the smolts out of the turbines. But given the gravity of the [salmon

  20. Fuel-Flexible Gasification-Combustion Technology for Production of H2 and Sequestration-Ready CO2

    SciTech Connect (OSTI)

    Parag Kulkarni; Jie Guan; Raul Subia; Zhe Cui; Jeff Manke; Arnaldo Frydman; Wei Wei; Roger Shisler; Raul Ayala; om McNulty; George Rizeq; Vladimir Zamansky; Kelly Fletcher

    2008-03-31T23:59:59.000Z

    In the near future, the nation will continue to rely on fossil fuels for electricity, transportation, and chemicals. It is necessary to improve both the process efficiency and environmental impact of fossil fuel utilization including greenhouse gas management. GE Global Research (GEGR) investigated an innovative fuel-flexible Unmixed Fuel Processor (UFP) technology with potential to produce H{sub 2}, power, and sequestration-ready CO{sub 2} from coal and other solid fuels. The UFP technology offers the long-term potential for reduced cost, increased process efficiency relative to conventional gasification and combustion systems, and near-zero pollutant emissions. GE was awarded a contract from U.S. DOE NETL to investigate and develop the UFP technology. Work started on the Phase I program in October 2000 and on the Phase II effort in April 2005. In the UFP technology, coal, water and air are simultaneously converted into (1) hydrogen rich stream that can be utilized in fuel cells or turbines, (2) CO{sub 2} rich stream for sequestration, and (3) high temperature/pressure vitiated air stream to produce electricity in a gas turbine expander. The process produces near-zero emissions with an estimated efficiency higher than Integrated Gasification Combined Cycle (IGCC) process with conventional CO{sub 2} separation. The Phase I R&D program established the chemical feasibility of the major reactions of the integrated UFP technology through lab-, bench- and pilot-scale testing. A risk analysis session was carried out at the end of Phase I effort to identify the major risks in the UFP technology and a plan was developed to mitigate these risks in the Phase II of the program. The Phase II effort focused on three high-risk areas: economics, lifetime of solids used in the UFP process, and product gas quality for turbines (or the impact of impurities in the coal on the overall system). The economic analysis included estimating the capital cost as well as the costs of hydrogen and electricity for a full-scale UFP plant. These costs were benchmarked with IGCC polygen plants with similar level of CO{sub 2} capture. Based on the promising economic analysis comparison results (performed with the help from Worley Parsons), GE recommended a 'Go' decision in April 2006 to continue the experimental investigation of the UFP technology to address the remaining risks i.e. solids lifetime and the impact of impurities in the coal on overall system. Solids attrition and lifetime risk was addressed via bench-scale experiments that monitor solids performance over time and by assessing materials interactions at operating conditions. The product gas under the third reactor (high-temperature vitiated air) operating conditions was evaluated to assess the concentration of particulates, pollutants and other impurities relative to the specifications required for gas turbine feed streams. During this investigation, agglomeration of solids used in the UFP process was identified as a serious risk that impacts the lifetime of the solids and in turn feasibility of the UFP technology. The main causes of the solids agglomeration were the combination of oxygen transfer material (OTM) reduction at temperatures {approx}1000 C and interaction between OTM and CO{sub 2} absorbing material (CAM) at high operating temperatures (>1200 C). At the end of phase II, in March 2008, GEGR recommended a 'No-go' decision for taking the UFP technology to the next level of development, i.e. development of a 3-5 MW prototype system, at this time. GEGR further recommended focused materials development research programs on improving the performance and lifetime of solids materials used in UFP or chemical looping technologies. The scale-up activities would be recommended only after mitigating the risks involved with the agglomeration and overall lifetime of the solids. This is the final report for the phase II of the DOE-funded Vision 21 program entitled 'Fuel-Flexible Gasification-Combustion Technology for Production of H{sub 2} and Sequestration-Ready CO{sub 2}' (DOE Award No.

  1. Readiness Assessments for the Shipment of TRU from West Jefferson, Ohio

    SciTech Connect (OSTI)

    Duffy, M. A.

    2003-02-26T23:59:59.000Z

    From 1943 through 1986, Battelle Memorial Institute (BMI) performed research and development work at its own facilities for the U.S. Department of Energy (DOE) and its predecessor agencies. The most highly contaminated facilities, comprising BMI's Nuclear Sciences Area, are located on 11 acres in West Jefferson, Ohio. Three buildings in this area were used to study nuclear reactor fuels, fuel element components, reactor designs, and radiochemistry analyses: one building contained nuclear hot cells, a second building contained a critical assembly and radiochemistry laboratory, and a third building once housed a nuclear research reactor. The Columbus Environmental Management Project (CEMP), one of the DOE Ohio Field Office's radioactive cleanup sites, oversees the Battelle Columbus Laboratories Decommissioning Project (BCLDP) for the decontamination and decommissioning (D&D) of BMI's Nuclear Sciences Area. The BCLDP mission is to decontaminate the Nuclear Sciences Area to a condition that is suitable for use without restrictions and to dispose of or store the associated radioactive waste at a suitable DOE-approved facility. During decontamination work, the CEMP is expected to generate approximately 120, 55-gallon drums of transuranic (TRU) waste, or about 20 truckloads. This TRU waste will be transported to DOE's Hanford nuclear facility in Washington State for temporary storage, prior to its ultimate disposal at the Waste Isolation Pilot Plant (WIPP). This paper presents a detailed approach for conducting readiness assessments for TRU waste shipments from any DOE site. It is based on demonstrating satisfaction of the 18 core requirements contained in DOE Order 425.1B, Startup and Restart of Nuclear Facilities, that are derived from the seven guiding principles of DOE's integrated safety management system.

  2. WHAT DO THREAT LEVELS AND RESPONSE LEVELS MEAN? THREAT LEVELS

    E-Print Network [OSTI]

    Edinburgh, University of

    WHAT DO THREAT LEVELS AND RESPONSE LEVELS MEAN? THREAT LEVELS: The UK Threat Level is decided by the Government's Joint Terrorism Analysis Centre (JTAC). It is the system to assess the threat to the UK from Threat Levels: Low - an attack is unlikely Moderate - an attack is possible, but not likely Substantial

  3. SIMULTANEOUS PRODUCTION OF HIGH-PURITY HYDROGEN AND SEQUESTRATION-READY CO2 FROM SYNGAS

    SciTech Connect (OSTI)

    Linda Denton; Hana Lorethova; Tomasz Wiltowski; Court Moorefield; Parag Kulkarni; Vladimir Zamansky; Ravi Kumar

    2003-12-01T23:59:59.000Z

    This final report summarizes the progress made on the program ''Simultaneous Production of High-Purity Hydrogen and Sequestration-Ready CO{sub 2} from Syngas (contract number DE-FG26-99FT40682)'', during October 2000 through September of 2003. GE Energy and Environmental Research (GE-EER) and Southern Illinois University (SIU) at Carbondale conducted the research work for this program. This program addresses improved methods to efficiently produce simultaneous streams of high-purity hydrogen and separated carbon dioxide from synthesis gas (syngas). The syngas may be produced through either gasification of coal or reforming of natural gas. The process of production of H{sub 2} and separated CO{sub 2} utilizes a dual-bed reactor and regenerator system. The reactor produces hydrogen and the regenerator produces separated CO{sub 2}. The dual-bed system can be operated under either a circulating fluidized-bed configuration or a cyclic fixed-bed configuration. Both configurations were evaluated in this project. The experimental effort was divided into lab-scale work at SIU and bench-scale work at GE-EER. Tests in a lab-scale fluidized bed system demonstrated the process for the conversion of syngas to high purity H{sub 2} and separated CO{sub 2}. The lab-scale system generated up to 95% H{sub 2} (on a dry basis). Extensive thermodynamic analysis of chemical reactions between the syngas and the fluidized solids determined an optimum range of temperature and pressure operation, where the extent of the undesirable reactions is minimum. The cycling of the process between hydrogen generation and oxygen regeneration has been demonstrated. The fluidized solids did not regenerate completely and the hydrogen purity in the reuse cycle dropped to 70% from 95% (on a dry basis). Changes in morphology and particle size may be the most dominant factor affecting the efficiency of the repeated cycling between hydrogen production and oxygen regeneration. The concept of simultaneous production of hydrogen and separated stream of CO{sub 2} was proved using a fixed bed 2 reactor system at GE-EER. This bench-scale cyclic fixed-bed reactor system designed to reform natural gas to syngas has been fabricated in another coordinated DOE project. This system was modified to reform natural gas to syngas and then convert syngas to H{sub 2} and separated CO{sub 2}. The system produced 85% hydrogen (dry basis).

  4. Report on the oversight assessment of the operational readiness review of the Replacement Tritium Facility at Savannah River Site

    SciTech Connect (OSTI)

    Lee, B.T.

    1993-03-01T23:59:59.000Z

    This report presents the results of an oversight assessment (OA) conducted by the US Department of Energy's (DOE) Office of Environment, Safety and Health (EH) of operational readiness review (ORR) activities for the Replacement Tritium Facility (RTF) located at Savannah River Site (SRS). The EH OA of this facility took place concurrently with an ORR conducted by the DOE Office of Defense Programs (DP). The DP ORR was conducted from January 19 through February 5, 1993. The EH OA was performed in accordance with the protocol and procedures specified in EH Program for Oversight Assessment of Operational Readiness Evaluations for Startups and Restarts,'' dated September 15, 1992. The EH OA Team evaluated the DP ORR to determine whether it was thorough and demonstrated sufficient inquisitiveness to verify that the implementation of programs and procedures adequately ensures the protection of worker safety and health. The EH OA Team performed its evaluation of the DP ORR in the following technical areas: occupational safety, industrial hygiene, and respiratory protection; fire protection; and chemical safety. In the areas of fire protection and chemical safety, the EH OA Team conducted independent vertical-slice reviews to confirm DP ORR results. Within each technical area, the EH OA Team reviewed the DP ORR Plan, including the Criteria Review and Approach Documents (CRADs); the qualifications of individual DP ORR team members; the performance of planned DP ORR activities; and the results of the DP ORR.

  5. Process improvement to the inspection readiness plan in chemical weapons convention challenge inspections. Master`s thesis

    SciTech Connect (OSTI)

    Triplett, W.M.

    1997-09-01T23:59:59.000Z

    This thesis identified current Information Technology initiatives to help improve the Navy`s Inspection Readiness Plan for Chemical Warfare Convention (CWC) Challenge Inspection. The CWC is an intensive inspection. The Challenge Inspection allows for a team of international inspectors to inspect a naval facility suspected of violating the CWC on very short notice. This thesis begins with a review of the CWC Challenge Inspection timeline. It then describes the Navy`s Inspection Readiness Plan for CWC Challenge Inspections as well as the Navy Tiger Team that is sent to naval facilities to assist the Commanding Officer and base personnel during inspections. One of the initiatives evaluated by this analysis is the use of videoconferencing. To ascertain the feasibility of using videoconferencing in the CWC Challenge Inspection process, this thesis reviews the current videoconferencing systems and standards, and the results of a questionnaire that was sent to various naval commands. This thesis concludes with recommendations for inclusion of videoconferencing and various other Information Technology initiatives in the CWC Challenge Inspection process.

  6. Recommendations for Tritium Science and Technology Research and Development in Support of the Tritium Readiness Campaign, TTP-7-084

    SciTech Connect (OSTI)

    Senor, David J.

    2013-10-30T23:59:59.000Z

    Between 2006 and 2012 the Tritium Readiness Campaign Development and Testing Program produced significant advances in the understanding of in-reactor TPBAR performance. Incorporating these data into existing TPBAR performance models has improved permeation predictions, and the discrepancy between predicted and observed tritium permeation in the WBN1 coolant has been decreased by about 30%. However, important differences between predicted and observed permeation still remain, and there are significant knowledge gaps that hinder the ability to reliably predict other aspects of TPBAR performance such as tritium distribution, component integrity, and performance margins. Based on recommendations from recent Tritium Readiness Campaign workshops and reviews coupled with technical and programmatic priorities, high-priority activities were identified to address knowledge gaps in the near- (3-5 year), middle- (5-10 year), and long-term (10+ year) time horizons. It is important to note that there are many aspects to a well-integrated research and development program. The intent is not to focus exclusively on one aspect or another, but to approach the program in a holistic fashion. Thus, in addition to small-scale tritium science studies, ex-reactor tritium technology experiments such as TMED, and large-scale in-reactor tritium technology experiments such as TMIST, a well-rounded research and development program must also include continued analysis of WBN1 performance data and post-irradiation examination of TPBARs and lead use assemblies to evaluate model improvements and compare separate-effects and integral component behavior.

  7. DOE Zero Ready Home Case Study: M Street Homes, Smartlux on Greenpark...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    airPLUS and WaterSense requirements, and meets 2012 International Energy Conservation Code insulation levels. Although M Street was founded in 2009, its past president Bob...

  8. Development of the Write Process for Pipeline-Ready Heavy Oil

    SciTech Connect (OSTI)

    Lee Brecher; Charles Mones; Frank Guffey

    2009-03-07T23:59:59.000Z

    Work completed under this program advances the goal of demonstrating Western Research Institute's (WRI's) WRITE{trademark} process for upgrading heavy oil at field scale. MEG Energy Corporation (MEG) located in Calgary, Alberta, Canada supported efforts at WRI to develop the WRITE{trademark} process as an oil sands, field-upgrading technology through this Task 51 Jointly Sponsored Research project. The project consisted of 6 tasks: (1) optimization of the distillate recovery unit (DRU), (2) demonstration and design of a continuous coker, (3) conceptual design and cost estimate for a commercial facility, (4) design of a WRITE{trademark} pilot plant, (5) hydrotreating studies, and (6) establish a petroleum analysis laboratory. WRITE{trademark} is a heavy oil and bitumen upgrading process that produces residuum-free, pipeline ready oil from heavy material with undiluted density and viscosity that exceed prevailing pipeline specifications. WRITE{trademark} uses two processing stages to achieve low and high temperature conversion of heavy oil or bitumen. The first stage DRU operates at mild thermal cracking conditions, yielding a light overhead product and a heavy residuum or bottoms material. These bottoms flow to the second stage continuous coker that operates at severe pyrolysis conditions, yielding light pyrolyzate and coke. The combined pyrolyzate and mildly cracked overhead streams form WRITE{trademark}'s synthetic crude oil (SCO) production. The main objectives of this project were to (1) complete testing and analysis at bench scale with the DRU and continuous coker reactors and provide results to MEG for process evaluation and scale-up determinations and (2) complete a technical and economic assessment of WRITE{trademark} technology to determine its viability. The DRU test program was completed and a processing envelope developed. These results were used for process assessment and for scaleup. Tests in the continuous coker were intended to determine the throughput capability of the coker so a scaled design could be developed that maximized feed rate for a given size of reactor. These tests were only partially successful because of equipment problems. A redesigned coker, which addressed the problems, has been build but not operated. A preliminary economic analysis conducted by MEG and an their engineering consultant concluded that the WRITE{trademark} process is a technically feasible method for upgrading bitumen and that it produces SCO that meets pipeline specifications for density. When compared to delayed coking, the industry benchmark for thermal upgrading of bitumen, WRITE{trademark} produced more SCO, less coke, less CO{sub 2} per barrel of bitumen fed, and had lower capital and operating costs. On the other hand, WRITE{trademark}'s lower processing severity yielded crude with higher density and a different product distribution for naphtha, light gas oil and vacuum oil that, taken together, might reduce the value of the SCO. These issues plus the completion of more detailed process evaluation and economics need to be resolved before WRITE{trademark} is deployed as a field-scale pilot.

  9. Variance analysis in the quality control of ready mixed concrete in a major structure

    E-Print Network [OSTI]

    Valle Aguilar, Jorge Luis

    1984-01-01T23:59:59.000Z

    the same quality of concrete. 5. The use of different types of lightweight aggregates with and without fly ash did not seem to affect variability in the 3000 psi (20. 7 Npa) strength level. 6. Lower compressive strength results observed during... Plot of 28-day strengths versus 7-day strengths The 7500 Psi Strength Level General 40 42 Compressive strength versus water-cement ratio Compressive strength versus slump Variance analysis for the 7500 psi strength variations . 42 43 46 Oua1...

  10. White Paper for U.S. Army Rapid Equipping Force: Waste Heat Recovery with Thermoelectric and Lithium-Ion Hybrid Power System

    SciTech Connect (OSTI)

    Farmer, J C

    2007-11-26T23:59:59.000Z

    By harvesting waste heat from engine exhaust and storing it in light-weight high-capacity modules, it is believed that the need for energy transport by convoys can be lowered significantly. By storing this power during operation, substantial electrical power can be provided during long periods of silent operation, while the engines are not operating. It is proposed to investigate the potential of installing efficient thermoelectric generators on the exhaust systems of trucks and other vehicles to generate electrical power from the waste heat contained in the exhaust and to store that power in advanced power packs comprised of polymer-gel lithium ion batteries. Efficient inexpensive methods for production of the thermoelectric generator are also proposed. The technology that exists at LLNL, as well as that which exists at industrial partners, all have high technology readiness level (TRL). Work is needed for integration and deployment.

  11. GaN-Ready Aluminum Nitride Substrates for Cost-Effective, Very Low Dislocation Density III-Nitride LED's

    SciTech Connect (OSTI)

    Sandra Schujman; Leo Schowalter

    2010-10-15T23:59:59.000Z

    The objective of this project was to develop and then demonstrate the efficacy of a costeffective approach for a low defect density substrate on which AlInGaN LEDs can be fabricated. The efficacy of this “GaN-ready” substrate would then be tested by growing high efficiency, long lifetime InxGa1-xN blue LEDs. The approach used to meet the project objectives was to start with low dislocation density AlN single-crystal substrates and grow graded AlxGa1-xN layers on top. Pseudomorphic AlxGa1-xN epitaxial layers grown on bulk AlN substrates were used to fabricate light emitting diodes and demonstrate better device performance as a result of the low defect density in these layers when benched marked against state-of-the-art LEDs fabricated on sapphire substrates. The pseudomorphic LEDs showed excellent output powers compared to similar wavelength devices grown on sapphire substrates, with lifetimes exceeding 10,000 hours (which was the longest time that could reliably be estimated). In addition, high internal quantum efficiencies were demonstrated at high driving current densities even though the external quantum efficiencies were low due to poor photon extraction. Unfortunately, these pseudomorphic LEDs require high Al content so they emit in the ultraviolet. Sapphire based LEDs typically have threading dislocation densities (TDD) > 108 cm-2 while the pseudomorphic LEDs have TDD ? 105 cm-2. The resulting TDD, when grading the AlxGa1-xN layer all the way to pure GaN to produce a “GaN-ready” substrate, has varied between the mid 108 down to the 106 cm-2. These inconsistencies are not well understood. Finally, an approach to improve the LED structures on AlN substrates for light extraction efficiency was developed by thinning and roughening the substrate.

  12. Implementation plan for the Waste Experimental Reduction Facility Restart Operational Readiness Review

    SciTech Connect (OSTI)

    Not Available

    1993-03-01T23:59:59.000Z

    The primary technical objective for the WERF Restart Project is to assess, upgrade where necessary, and implement management, documentation, safety, and operation control systems that enable the resumption and continued operation of waste treatment and storage operations in a manner that is compliant with all environment, safety, and quality requirements of the US Department of Energy and Federal and State regulatory agencies. Specific processes that will be resumed at WERF include compaction of low-level compatible waste; size reduction of LLW, metallic and wood waste; incineration of combustible LLW and MLLW; and solidification of low-level and mixed low-level incinerator bottom ash, baghouse fly ash, and compatible sludges and debris. WERF will also provide for the operation of the WWSB which includes storage of MLLW in accordance with Resource Conservation and Recovery Act requirements.

  13. Zia_Gold_Level_Award_News_Release_4-29-13

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron SpinPrincetonUsingWhatY-12Zero Energy Ready Home ZeroThe Role of New

  14. Free Flow Energy (TRL 1 2 3 Component) - Design and Development of a

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport inEnergy0.pdf Flash2010-60.pdf2 DOE March, 2015

  15. Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine Project |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny:Revised Finding of No53197 This workDayton:| DepartmentCondition | Department

  16. The readiness of ATLAS Trigger-DAQ system for the second LHC run

    E-Print Network [OSTI]

    Rammensee, Michael; The ATLAS collaboration

    2015-01-01T23:59:59.000Z

    After its first shutdown, LHC will provide pp collisions with increased luminosity and energy. In the ATLAS experiment, the Trigger and Data Acquisition (TDAQ) system has been upgraded to deal with the increased event rates. The updated system is radically different from the previous implementation, both in terms of architecture and expected performance. The main architecture has been reshaped in order to profit from the technological progress and to maximize the flexibility and efficiency of the data selection process. The trigger system in ATLAS consists of a hardware Level-1 (L1) and a software based high-level trigger (HLT) that reduces the event rate from the design bunch-crossing rate of 40 MHz to an average recording rate of a few hundred Hz. The pre-existing two-level software filtering, known as L2 and the Event Filter, are now merged into a single process, performing incremental data collection and analysis. This design has many advantages, among which are: the radical simplification of the architec...

  17. Timing is everything : along the fossil fuel transition pathway.

    SciTech Connect (OSTI)

    Kobos, Peter Holmes; Walker, La Tonya Nicole; Malczynski, Leonard A.

    2013-10-01T23:59:59.000Z

    People save for retirement throughout their career because it is virtually impossible to save all you'll need in retirement the year before you retire. Similarly, without installing incremental amounts of clean fossil, renewable or transformative energy technologies throughout the coming decades, a radical and immediate change will be near impossible the year before a policy goal is set to be in place. Therefore, our research question is,To meet our desired technical and policy goals, what are the factors that affect the rate we must install technology to achieve these goals in the coming decades?' Existing models do not include full regulatory constraints due to their often complex, and inflexible approaches to solve foroptimal' engineering instead ofrobust' and multidisciplinary solutions. This project outlines the theory and then develops an applied software tool to model the laboratory-to-market transition using the traditional technology readiness level (TRL) framework, but develops subsequent and a novel regulatory readiness level (RRL) and market readiness level (MRL). This tool uses the ideally-suited system dynamics framework to incorporate feedbacks and time delays. Future energy-economic-environment models, regardless of their programming platform, may adapt this software model component framework ormodule' to further vet the likelihood of new or innovative technology moving through the laboratory, regulatory and market space. The prototype analytical framework and tool, called the Technology, Regulatory and Market Readiness Level simulation model (TRMsim) illustrates the interaction between technology research, application, policy and market dynamics as they relate to a new or innovative technology moving from the theoretical stage to full market deployment. The initial results that illustrate the model's capabilities indicate for a hypothetical technology, that increasing the key driver behind each of the TRL, RRL and MRL components individually decreases the time required for the technology to progress through each component by 63, 68 and 64%, respectively. Therefore, under the current working assumptions, to decrease the time it may take for a technology to move from the conceptual stage to full scale market adoption one might consider expending additional effort to secure regulatory approval and reducing the uncertainty of the technology's demand in the marketplace.

  18. FUEL-FLEXIBLE GASIFICATION-COMBUSTION TECHNOLOGY FOR PRODUCTION OF H2 AND SEQUESTRATION-READY CO2

    SciTech Connect (OSTI)

    George Rizeq; Janice West; Arnaldo Frydman; Raul Subia; Vladimir Zamansky; Hana Loreth; Lubor Stonawski; Tomasz Wiltowski; Edwin Hippo; Shashi Lalvani

    2003-01-01T23:59:59.000Z

    It is expected that in the 21st century the Nation will continue to rely on fossil fuels for electricity, transportation, and chemicals. It will be necessary to improve both the process efficiency and environmental impact performance of fossil fuel utilization. GE Energy and Environmental Research Corporation (GE EER) has developed an innovative fuel-flexible Unmixed Fuel Processor (UFP) technology to produce H{sub 2}, power, and sequestration-ready CO{sub 2} from coal and other solid fuels. The UFP module offers the potential for reduced cost, increased process efficiency relative to conventional gasification and combustion systems, and near-zero pollutant emissions including NO{sub x}. GE EER was awarded a Vision 21 program from U.S. DOE NETL to develop the UFP technology. Work on this Phase I program started on October 1, 2000. The project team includes GE EER, California Energy Commission, Southern Illinois University at Carbondale, and T. R. Miles, Technical Consultants, Inc. In the UFP technology, coal/opportunity fuels and air are simultaneously converted into separate streams of (1) pure hydrogen that can be utilized in fuel cells, (2) sequestration-ready CO{sub 2}, and (3) high temperature/pressure oxygen-depleted air to produce electricity in a gas turbine. The process produces near-zero emissions and, based on process modeling work, has an estimated process efficiency of 68%, based on electrical and H{sub 2} energy outputs relative to the higher heating value of coal, and an estimated equivalent electrical efficiency of 60%. The Phase I R&D program will determine the operating conditions that maximize separation of CO{sub 2} and pollutants from the vent gas, while simultaneously maximizing coal conversion efficiency and hydrogen production. The program integrates lab-, bench- and pilot-scale studies to demonstrate the UFP technology. This is the ninth quarterly technical progress report for the Vision 21 UFP program supported by U.S. DOE NETL (Contract No. DE-FC26-00FT40974). This report summarizes program accomplishments for the period starting October 1, 2002 and ending December 31, 2002. The report includes an introduction summarizing the UFP technology, main program tasks, and program objectives; it also provides a summary of program activities and accomplishments covering progress in tasks including lab- and bench-scale experimental testing, pilot-scale design and assembly, and program management.

  19. FUEL-FLEXIBLE GASIFICATION-COMBUSTION TECHNOLOGY FOR PRODUCTION OF H2 AND SEQUESTRATION-READY CO2

    SciTech Connect (OSTI)

    George Rizeq; Janice West; Arnaldo Frydman; Vladimir Zamansky; Linda Denton; Hana Loreth; Tomasz Wiltowski

    2001-07-01T23:59:59.000Z

    It is expected that in the 21st century the Nation will continue to rely on fossil fuels for electricity, transportation, and chemicals. It will be necessary to improve both the thermodynamic efficiency and environmental impact performance of fossil fuel utilization. General Electric Energy and Environmental Research Corporation (GE EER) has developed an innovative fuel-flexible Advanced Gasification-Combustion (AGC) concept to produce H{sub 2} and sequestration-ready CO{sub 2} from solid fuels. The AGC module offers potential for reduced cost and increased energy efficiency relative to conventional gasification and combustion systems. GE EER was awarded a Vision-21 program from U.S. DOE NETL to develop the AGC technology. Work on this three-year program started on October 1, 2000. The project team includes GE EER, California Energy Commission, Southern Illinois University at Carbondale, and T. R. Miles, Technical Consultants, Inc. In the AGC technology, coal/opportunity fuels and air are simultaneously converted into separate streams of (1) pure hydrogen that can be utilized in fuel cells, (2) sequestration-ready CO{sub 2}, and (3) high temperature/pressure oxygen-depleted air to produce electricity in a gas turbine. The process produces near-zero emissions and, based on preliminary modeling work in the first quarter of this program, has an estimated process efficiency of approximately 67% based on electrical and H{sub 2} energy outputs relative to the higher heating value of coal. The three-year R&D program will determine the operating conditions that maximize separation of CO{sub 2} and pollutants from the vent gas, while simultaneously maximizing coal conversion efficiency and hydrogen production. The program integrates lab-, bench- and pilot-scale studies to demonstrate the AGC concept. This is the third quarterly technical progress report for the Vision-21 AGC program supported by U.S. DOE NETL (Contract: DE-FC26-00FT40974). This report summarizes program accomplishments for the period starting April 1, 2001 and ending June 30, 2001. The report includes an introduction summarizing the AGC concept, main program tasks, objectives of this program, and provides a summary of program activities covering program management and progress in first year tasks including lab- and bench-scale design, facilities preparation, and engineering studies.

  20. Building America Zero Energy Ready Home Case Study: Imery Group, Proud

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. Department ofJune 2,The BigSiding RetrofitforCamberly Homes - SilverGreen Home,

  1. University of Michigan Gets Offshore Wind Ready for Winter on Lake Michigan

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group current C3E AmbassadorsUS-EU-Japan-JapanHighlyFrom left toBack row: Isaac|

  2. What to Expect When Readying to Move Spent Nuclear Fuel from Commercial

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA group currentBradley Nickell DirectorThe&ManagementEfficiency |A N E N

  3. Director's CD-3b Readiness Review of the MINERvA Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMFormsGasRelease Date: Contact: Shelley

  4. Focus Series: Program Finds Community "Readiness" Is the Key to More

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy Chinaof EnergyImpactOnSTATEMENT8.pdf MoreRevised

  5. Computer vs. Video Game System: Ready to Rumble in the #EnergyFaceoff

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613PortsmouthBartlesville EnergyDepartment.Attachment FY2011-40(10 CFR Parts 1021Jungle |

  6. Order Module--DOE O 425.1D, VERIFICATION OF READINESS TO START UP OR

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaeferAprilOverviewEfficiencyof EnergyOokie MaState and"To ensure

  7. Getting Ready to Set the Thermostat Low-And Keep it There! | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To: CongestionDevelopment of a downhole wireline toolDepartmentGetErinof

  8. Guidelines for Correctly Using the DOE Zero Energy Ready Home Name and Logo

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To: CongestionDevelopment ofofthePerformance Requirements of Section 543|

  9. Houston Smart Grid System Almost Ready for Launch | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To:Department ofOral Testimony of Secretary Samuel W.Housing

  10. Preliminary Technology Readiness Assessment (TRA) for the Calcine Disposition Project Volume 2 (CDP)

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSAR - T enAmountCammie CroftPRELIMINARY TECHNOLOGY

  11. Accelerating the Electrification of U.S. Drive Trains: Ready and Affordable

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartmentDepartment of2 of 5) ALARAManager(Decemberenergy

  12. Subscribe to the DOE Zero Energy Ready Home News | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssues DOE's NuclearSpurringSteamDepartment ofStudy:SubmitResidential

  13. Kick-Off Meeting Smart Grid Ready Inverters DOE Project DE-EE0005337

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12electron beamJoin2015JustKateKent5 B O N N E V I LPV Grid

  14. L1:PAC.P6.04 Westinghouse Test Stand Technical Readiness Review

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12electron beamJoin2015JustKateKent5 BC W S

  15. DOE ZERO ENERGY READY HOME UPDATE NEWSLETTER MAY 2015 | Department of

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable Energy Delivering

  16. DOE Zero Energy Ready Home Case Study, Nexus EnergyHomes, Frederick, MD,

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable Energy

  17. DOE Zero Energy Ready Home Case Study: Brookside Development, Derby, CT |

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable EnergyDepartment of

  18. DOE Zero Energy Ready Home Case Study: Southern Energy Homes, Russellville,

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable EnergyDepartment ofAL |

  19. DOE Zero Energy Ready Home Case Study: Sterling Brook Custom Homes, Double

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRUJuly 29, 2013SavannahRenewable EnergyDepartment ofAL

  20. DOE Tour of Zero: The First DOE Zero Energy Ready Manufactured Home by

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 Russian NuclearandJunetrack graphics workDepartment of13

  1. DOE Tour of Zero: The First DOE Zero Energy Ready Retrofit by Green Extreme

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 Russian NuclearandJunetrack graphics workDepartment of13Homes and Carl Franklin

  2. The Ohio State University Readies for its Encore at the Solar Decathlon |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23,EnergyChicopeeTechnology Performance AprilPractice andGoldconvened the

  3. OLCF Selects Application Readiness Projects to Prepare for Next-generation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated CodesTransparencyDOE Project TapsDOERecoveryNuclearLifeMealsOFermilabSummit

  4. Marine & Hydrokinetic Technology Readiness Initiative TIDAL ENERGY SYSTEM FOR ON-SHORE POWER GENERATION

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem Not Found Item Not Found TheHot electron dynamics in807 DE899 06 Revision 0U7114-

  5. 15 Blog Posts to Get You Ready for Winter Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China 2015ofDepartment ofCBFO-13-3322 2013of Energy July 1, Activities ReportAllison

  6. The Readiness of the Department's Federal Radiological Monitoring and Assessment Center

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergyIssuesEnergy SolarRadioactive Liquid Waste Treatment FacilityThe

  7. Ready, Set . . . Get Prepped for Monday's Launch of the 'America's Next

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014, an OHASeptember 2010In addition to 1National BroadbandDepartmentTop

  8. DOE Zero Energy Ready Home Case Study: Sterling Brook Custom Homes, Double

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy China U.S. DepartmentEnergyBoilersPlant |AddressingNM, Production |Humanity,Oak, TX |

  9. CdTe portfolio offers commercial ready high efficiency solar - Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .Fornl ProjectDeterminatIonCathodeOpen

  10. UPF site readiness subproject completed on time and under budget | Y-12

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening aTurbulence may bedieselsummer gasoline price0 UPCNational

  11. A Guide to the Lessons Learned from the Clean Cities Community Electric Vehicle Readiness Projects

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del(ANL-IN-03-032) -Less isNFebruaryOctober 2, AlgeriaQ1 Q2you aA DeepAGlobalDioxide

  12. Microsoft Word - 2009-014655 - 2010 SGSR Appendix A 2 2 2012 print ready

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember 5-6,Energy,IntroductionNeil400 NorthPUBLIC Metrics

  13. Microsoft Word - 2009-014655 - 2010 SGSR Appendix B 2 2 2012 print ready

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember 5-6,Energy,IntroductionNeil400 NorthPUBLIC Metrics

  14. Microsoft Word - 2009-014655 - SGSR FINAL VERSION 2 2 2012 print ready

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember 5-6,Energy,IntroductionNeil400 NorthPUBLIC

  15. Microsoft Word - Final SA-Nov 2012 Camera Ready.doc

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently Asked Questions forCheneyNovember S.Fluor-B&W (08-93) United States5-SA-05 November

  16. Review of the Sodium Bearing Waste Treatment Project - Integrated Waste Treatment Unit Federal Operational Readiness Review

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergy SmallImplementing the NationalReverseNational LaboratorySavannah

  17. Alternative Fuels Data Center: Plug-In Electric Vehicle Readiness Scorecard

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWP RelatedCellulaseFuels andConversionsAssumptions andPlug-In

  18. Sandia Energy - Fuel-Cell-Powered Mobile Lights Tested, Proven, Ready for

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's PossibleRadiationImplementing Nonlinear757 (1)Tara46Energy StorageFirst-Ever AsianCommercial

  19. Getting ready for the Northern New Mexico RoboRAVE on March 7

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8,Dist.NewofGeothermal Heat Pump Basics Acrobat X orGettingNorthern New

  20. Savannah River Site Salt Waste Processing Facility Technology Readiness Assessment Report

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic2 OPAM615_CostNSARDevelopmentalEfficiency | DepartmentSavannahDecommissioning

  1. Microsoft Word - ESnet SRS SC12 paper camera ready.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your1 SECTION A. Project Title:404 2.1big-data science

  2. Fuel-Flexible Gasification-Combustion Technology for Production of H2 and Sequestration-Ready CO2

    SciTech Connect (OSTI)

    George Rizeq; Janice West; Raul Subia; Arnaldo Frydman; Parag Kulkarni; Jennifer Schwerman; Valadimir Zamansky; John Reinker; Kanchan Mondal; Lubor Stonawski; Hana Loreth; Krzysztof Piotrowski; Tomasz Szymanski; Tomasz Wiltowski; Edwin Hippo

    2005-02-28T23:59:59.000Z

    GE Global Research is developing an innovative energy technology for coal gasification with high efficiency and near-zero pollution. This Unmixed Fuel Processor (UFP) technology simultaneously converts coal, steam and air into three separate streams of hydrogen-rich gas, sequestration-ready CO{sub 2}, and high-temperature, high-pressure vitiated air to produce electricity in gas turbines. This is the draft final report for the first stage of the DOE-funded Vision 21 program. The UFP technology development program encompassed lab-, bench- and pilot-scale studies to demonstrate the UFP concept. Modeling and economic assessments were also key parts of this program. The chemical and mechanical feasibility were established via lab and bench-scale testing, and a pilot plant was designed, constructed and operated, demonstrating the major UFP features. Experimental and preliminary modeling results showed that 80% H{sub 2} purity could be achieved, and that a UFP-based energy plant is projected to meet DOE efficiency targets. Future work will include additional pilot plant testing to optimize performance and reduce environmental, operability and combined cycle integration risks. Results obtained to date have confirmed that this technology has the potential to economically meet future efficiency and environmental performance goals.

  3. Technical Readiness and Gaps Analysis of Commercial Optical Materials and Measurement Systems for Advanced Small Modular Reactors

    SciTech Connect (OSTI)

    Anheier, Norman C.; Suter, Jonathan D.; Qiao, Hong (Amy); Andersen, Eric S.; Berglin, Eric J.; Bliss, Mary; Cannon, Bret D.; Devanathan, Ramaswami; Mendoza, Albert; Sheen, David M.

    2013-08-06T23:59:59.000Z

    This report intends to support Department of Energy’s Office of Nuclear Energy (DOE-NE) Nuclear Energy Research and Development Roadmap and industry stakeholders by evaluating optical-based instrumentation and control (I&C) concepts for advanced small modular reactor (AdvSMR) applications. These advanced designs will require innovative thinking in terms of engineering approaches, materials integration, and I&C concepts to realize their eventual viability and deployability. The primary goals of this report include: 1. Establish preliminary I&C needs, performance requirements, and possible gaps for AdvSMR designs based on best available published design data. 2. Document commercial off-the-shelf (COTS) optical sensors, components, and materials in terms of their technical readiness to support essential AdvSMR in-vessel I&C systems. 3. Identify technology gaps by comparing the in-vessel monitoring requirements and environmental constraints to COTS optical sensor and materials performance specifications. 4. Outline a future research, development, and demonstration (RD&D) program plan that addresses these gaps and develops optical-based I&C systems that enhance the viability of future AdvSMR designs. The development of clean, affordable, safe, and proliferation-resistant nuclear power is a key goal that is documented in the Nuclear Energy Research and Development Roadmap. This roadmap outlines RD&D activities intended to overcome technical, economic, and other barriers, which currently limit advances in nuclear energy. These activities will ensure that nuclear energy remains a viable component to this nation’s energy security.

  4. DECREASE Final Technical Report: Development of a Commercial Ready Enzyme Application System for Ethanol

    SciTech Connect (OSTI)

    Teter, Sarah A

    2012-04-18T23:59:59.000Z

    Conversion of biomass to sugars plays a central in reducing our dependence on petroleum, as it allows production of a wide range of biobased fuels and chemicals, through fermentation of those sugars. The DECREASE project delivers an effective enzyme cocktail for this conversion, enabling reduced costs for producing advanced biofuels such as cellulosic ethanol. Benefits to the public contributed by growth of the advanced biofuels industry include job creation, economic growth, and energy security. The DECREASE primary project objective was to develop a two-fold improved enzyme cocktail, relative to an advanced cocktail (CZP00005) that had been developed previously (from 2000- 2007). While the final milestone was delivery of all enzyme components as an experimental mixture, a secondary objective was to deploy an improved cocktail within 3 years following the close of the project. In February 2012, Novozymes launched Cellic CTec3, a multi-enzyme cocktail derived in part from components developed under DECREASE. The externally validated performance of CTec3 and an additional component under project benchmarking conditions indicated a 1.8-fold dose reduction in enzyme dose required for 90% conversion (based on all available glucose and xylose sources) of NREL dilute acid pretreated PCS, relative to the starting advanced enzyme cocktail. While the ability to achieve 90% conversion is impressive, targeting such high levels of biomass digestion is likely not the most cost effective strategy. Novozymes techno economic modeling showed that for NREL's dilute acid pretreated corn stover (PCS), 80% target conversion enables a lower total production cost for cellulosic ethanol than for 90% conversion, and this was also found to be the case when cost assumptions were based on the NREL 2002 Design Report. A 1.8X dose-reduction was observed for 80% conversion in the small scale (50 g) DECREASE benchmark assay for CTec3 and an additional component. An upscaled experiment (in 0.5 kg kettle reactors) was performed to compare the starting enzyme mixture CZP00005 with CTec3 alone; these results indicated a 1.9X dose- reduction for 80% conversion. The CTec3 composition does not include the best available enzyme components from the DECREASE effort. While these components are not yet available in a commercial product, experimental mixtures were assayed in a smaller scale assay using DECREASE PCS, at high solids loadings (21.5% TS). The results indicated that the newer mixtures required 2.9X-less enzyme for 90% conversion, and 3.2X-less enzyme for 80% conversion, relative to the starting enzyme cocktail. In conclusion, CTec3 delivers a 1.8-1.9X dose reduction on NREL PCS at high solids loadings, and the next generation enzyme from Novozymes will continue to show dramatically improved biochemical performance. CTec3 allows reduced costs today, and the experimental cocktails point to continued biotechnological improvements that will further drive down costs for biorefineries of tomorrow.

  5. Tiltmeter leveling mechanism

    DOE Patents [OSTI]

    Hunter, Steven L. (Livermore, CA); Boro, Carl O. (Milpitas, CA); Farris, Alvis (late of Byron, CA)

    2002-01-01T23:59:59.000Z

    A tiltmeter device having a pair of orthogonally disposed tilt sensors that are levelable within an inner housing containing the sensors. An outer housing can be rotated to level at least one of the sensor pair while the inner housing can be rotated to level the other sensor of the pair. The sensors are typically rotated up to about plus or minus 100 degrees. The device is effective for measuring tilts in a wide range of angles of inclination of wells and can be employed to level a platform containing a third sensor.

  6. Risk-Based Comparison of Carbon Capture Technologies

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.; Dale, Crystal; Jones, Edward

    2013-05-01T23:59:59.000Z

    In this paper, we describe an integrated probabilistic risk assessment methodological framework and a decision-support tool suite for implementing systematic comparisons of competing carbon capture technologies. Culminating from a collaborative effort among national laboratories under the Carbon Capture Simulation Initiative (CCSI), the risk assessment framework and the decision-support tool suite encapsulate three interconnected probabilistic modeling and simulation components. The technology readiness level (TRL) assessment component identifies specific scientific and engineering targets required by each readiness level and applies probabilistic estimation techniques to calculate the likelihood of graded as well as nonlinear advancement in technology maturity. The technical risk assessment component focuses on identifying and quantifying risk contributors, especially stochastic distributions for significant risk contributors, performing scenario-based risk analysis, and integrating with carbon capture process model simulations and optimization. The financial risk component estimates the long-term return on investment based on energy retail pricing, production cost, operating and power replacement cost, plan construction and retrofit expenses, and potential tax relief, expressed probabilistically as the net present value distributions over various forecast horizons.

  7. Company Level Imports Archives

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal Stocks at CommercialDecadeReservesYear21Company Level Imports Company Level

  8. Improved freezing level retrieval

    E-Print Network [OSTI]

    Hong, Sungwook

    2002-01-01T23:59:59.000Z

    TRMM Microwave Imager(TMI)-based passive microwave retrieval techniques result in biased estimates of the freezing level and rainfall over the east Pacific in the Inter Tropical Convergence Zone (ITCZ). Passive microwave rainfall estimates...

  9. Sea level change

    SciTech Connect (OSTI)

    Meier, M.F. [Univ. of Colorado, Boulder, CO (United States)

    1996-12-31T23:59:59.000Z

    The IPCC (Intergovernmental Panel on Climate Change) 1995 Scientific Assessment, Chapter 7. Sea Level Change, presents a modest revision of the similar chapter in the 1990 Assessment. Principal conclusions on observed sea-level change and the principal terms in the sea-level equation (ocean thermal expansion, glaciers, ice sheets, and land hydrology), including our knowledge of the present-day (defined as the 20th Century) components of sea-level rise, and projections of these for the future, are presented here. Some of the interesting glaciological problems which are involved in these studies are discussed in more detail. The emphasis here is on trends over decades to a century, not on shorter variations nor on those of the geologic past. Unfortunately, some of the IPCC projections had not been agreed at the time of writing of this paper, and these projections will not be given here. 15 refs., 2 figs.

  10. Ready, set...go!

    E-Print Network [OSTI]

    Alexandre, Melanie

    2010-01-01T23:59:59.000Z

    any proof participatory ergonomics works? • What does thefor changes in an ergonomics program or intervention •of change • Changes in ergonomics program or intervention

  11. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (Fuels) Advanced H 2 Membranes 2 11 13 Coal-Biomass to Liquids 1 15 16 Solid Oxide Fuel Cells Anode Electrolyte Cathode (AEC) Development 10 10 Atmospheric Pressure Systems...

  12. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Systems Advanced Combustion Turbines Supercritical CO 2 Power Cycles Feed Systems Gasi er Optimization and Plant Supporting Systems Syngas Processing Oxy-Combustion Chemical...

  13. Catalog of documents produced by the Greater-Than-Class C Low-Level Waste Management Program

    SciTech Connect (OSTI)

    Winberg, M.R.

    1995-03-01T23:59:59.000Z

    This catalog provides a ready reference for documents prepared by the Greater-Than-Class C Low-Level Waste (GTCC LLW) Management Program. The GTCC LLW Management Program is part of the National Low-Level Waste Management Program (NLLWMP). The NLLWMP is sponsored by the US Department of Energy (DOE) and is responsible for assisting the DOE in meeting its obligations under Public Law 99-240, The Low-Level Radioactive Waste Policy Amendments Act of 1985. This law assigns DOE the responsibility of ensuring the safe disposal of GTCC LLW in a facility licensed by the Nuclear Regulatory Commission (NRC). The NLLWMP is managed at the Idaho National Engineering Laboratory (INEL).

  14. Reevaluation of Vitrified High-Level Waste Form Criteria for Potential Cost Savings at the Defense Waste Processing Facility - 13598

    SciTech Connect (OSTI)

    Ray, J.W. [Savannah River Remediation (United States)] [Savannah River Remediation (United States); Marra, S.L.; Herman, C.C. [Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808 (United States)] [Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808 (United States)

    2013-07-01T23:59:59.000Z

    At the Savannah River Site (SRS) the Defense Waste Processing Facility (DWPF) has been immobilizing SRS's radioactive high level waste (HLW) sludge into a durable borosilicate glass since 1996. Currently the DWPF has poured over 3,500 canisters, all of which are compliant with the U. S. Department of Energy's (DOE) Waste Acceptance Product Specifications for Vitrified High-Level Waste Forms (WAPS) and therefore ready to be shipped to a federal geologic repository for permanent disposal. Due to DOE petitioning to withdraw the Yucca Mountain License Application (LA) from the Nuclear Regulatory Commission (NRC) in 2010 and thus no clear disposal path for SRS canistered waste forms, there are opportunities for cost savings with future canister production at DWPF and other DOE producer sites by reevaluating high-level waste form requirements and compliance strategies and reducing/eliminating those that will not negatively impact the quality of the canistered waste form. (authors)

  15. Ultrasonic liquid level detector

    DOE Patents [OSTI]

    Kotz, Dennis M. (North Augusta, SC); Hinz, William R. (Augusta, GA)

    2010-09-28T23:59:59.000Z

    An ultrasonic liquid level detector for use within a shielded container, the detector being tubular in shape with a chamber at its lower end into which liquid from in the container may enter and exit, the chamber having an ultrasonic transmitter and receiver in its top wall and a reflector plate or target as its bottom wall whereby when liquid fills the chamber a complete medium is then present through which an ultrasonic wave may be transmitted and reflected from the target thus signaling that the liquid is at chamber level.

  16. DATE SUBMITTED: GRADE LEVEL:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration would likeConstitution4Customer-Comments Sign InFutureSUBMITTED: GRADE LEVEL:

  17. Level: National Data;

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40Coal StocksProved Reserves (Billion Cubic Feet)Wellhead0 Capability to.5 First

  18. Company Level Imports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting theCommercialization and Innovation2010 2010 EIA-28 Financial

  19. Level Diagram Format Choice

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn12electron 9 5Let us count the ways. We've13, 2009 InFormWhich

  20. Tables of Energy Levels

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del SolStrengthening a solidSynthesis of 2D Alloys &8-5070P3. U.S.7.

  1. Liquid level detector

    DOE Patents [OSTI]

    Tshishiku, Eugene M. (Augusta, GA)

    2011-08-09T23:59:59.000Z

    A liquid level detector for conductive liquids for vertical installation in a tank, the detector having a probe positioned within a sheath and insulated therefrom by a seal so that the tip of the probe extends proximate to but not below the lower end of the sheath, the lower end terminating in a rim that is provided with notches, said lower end being tapered, the taper and notches preventing debris collection and bubble formation, said lower end when contacting liquid as it rises will form an airtight cavity defined by the liquid, the interior sheath wall, and the seal, the compression of air in the cavity preventing liquid from further entry into the sheath and contact with the seal. As a result, the liquid cannot deposit a film to form an electrical bridge across the seal.

  2. Pinning down energy levels | EMSL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    levels Pinning down energy levels Released: September 12, 2014 Scientists discover the energy differences behind green fluorescent protein's glow The research begins with (a)...

  3. Level-1 Milestone 350 Definitions v1

    SciTech Connect (OSTI)

    Quinn, T

    2006-11-17T23:59:59.000Z

    This milestone is the direct result of work that started seven years ago with the planning for a 100-teraFLOP platform and will be satisfied when 100 teraFLOPS is placed in operation and readied for Stockpile Stewardship Program simulations. The end product of this milestone will be a production-level, high-performance computing system, code named Purple, designed to be used to solve the most demanding stockpile stewardship problems, that is, the large-scale application problems at the edge of our understanding of weapon physics. This fully functional 100 teraFLOPS system must be able to serve a diverse scientific and engineering workload. It must also have a robust code development and production environment, both of which facilitate the workload requirements. This multi-year effort includes major activities in contract management, facilities, infrastructure, system software, and user environment and support. Led by LLNL, the trilabs defined the statement of work for a 100-teraFLOP system that resulted in a contract with IBM known as the Purple contract. LLNL worked with IBM throughout the contract period to resolve issues and collaborated with the Program to resolve contractual issues to ensure delivery of a platform that best serves the Program for a reasonable cost. The Purple system represents a substantial increase in the classified compute resources at LLNL for NNSA. The center computer environment must be designed to accept the Purple system and to scale with the increase of compute resources to achieve required end-to-end services. Networking, archival storage, visualization servers, global file systems, and system software will all be enhanced to support Purple's size and architecture. IBM and LLNL are sharing responsibility for Purple's system software. LLNL is responsible for the scheduler, resource manager, and some code development tools. Through the Purple contract, IBM is responsible for the remainder of the system software including the operating system, parallel file system, and runtime environment. LLNL, LANL, and SNL share responsibility for the Purple user environment. Since LLNL is the host for Purple, LLNL has the greatest responsibility. LLNL will provide customer support for Purple to the tri-labs and as such has the lead for user documentation, negotiating the Purple usage model, mapping of the ASC computational environment requirements to the Purple environment, and demonstrating those requirements have been met. In addition, LLNL will demonstrate important capabilities of the computing environment including full functionality of visualization tools, file transport between Purple and remote site file systems, and the build environment for principle ASC codes. LANL and SNL are responsible for delivering unique capabilities in support of their users, porting important applications and libraries, and demonstrating remote capabilities. The key capabilities that LANL and SNL will test are user authorization and authentication, data transfer, file system, data management, and visualization. SNL and LANL should port and run in production mode a few key applications on a substantial number of Purple nodes.

  4. The Path to Fusion Energy for Concepts Currently at the Concept Exploration Level

    E-Print Network [OSTI]

    Target Fusion (MTF) Non-toroidal concepts ­­ generally in early exploratory stage · Flow Z-pinch ("ZAP needed? Advanced diagnostics Theory and simulation Support from base program, technology program BPX Non-nuclear technology No DEMO yes May not be ready for first DEMO; Ready for Advanced Power Plant DEMO following tokamak

  5. DOE Order Self Study Modules - DOE O 425.1D, Verification of Readiness to Startup or Restart Nuclear Facilities

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,Office of Policy, OAPM |TRU WasteAdministrator |20.1C Briefing DOEUpdateGO

  6. Review of the Sodium Bearing Waste Treatment Project - Integrated Waste Treatment Uinit Contractor Operational Readiness Review, June 2012

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergy SmallImplementing the NationalReverseNational LaboratorySavannah

  7. Taking Risk Assessment and Management to the Next Level: Program-Level Risk Analysis to Enable Solid Decision-Making on Priorities and Funding

    SciTech Connect (OSTI)

    Nelson, J. G.; Morton, R. L.; Castillo, C.; Dyer, G.; Johnson, N.; McSwain, J. T.

    2011-02-01T23:59:59.000Z

    A multi-level (facility and programmatic) risk assessment was conducted for the facilities in the Nevada National Security Site (NNSS) Readiness in Technical Base and Facilities (RTBF) Program and results were included in a new Risk Management Plan (RMP), which was incorporated into the fiscal year (FY) 2010 Integrated Plans. Risks, risk events, probability, consequence(s), and mitigation strategies were identified and captured, for most scope areas (i.e., risk categories) during the facilitated risk workshops. Risk mitigations (i.e., efforts in addition to existing controls) were identified during the facilitated risk workshops when the risk event was identified. Risk mitigation strategies fell into two broad categories: threats or opportunities. Improvement projects were identified and linked to specific risks they mitigate, making the connection of risk reduction through investments for the annual Site Execution Plan. Due to the amount of that was collected, analysis to be performed, and reports to be generated, a Risk Assessment/ Management Tool (RAMtool) database was developed to analyze the risks in real-time, at multiple levels, which reinforced the site-level risk management process and procedures. The RAMtool database was developed and designed to assist in the capturing and analysis of the key elements of risk: probability, consequence, and impact. The RAMtool calculates the facility-level and programmatic-level risk factors to enable a side-by-side comparison to see where the facility manager and program manager should focus their risk reduction efforts and funding. This enables them to make solid decisions on priorities and funding to maximize the risk reduction. A more active risk management process was developed where risks and opportunities are actively managed, monitored, and controlled by each facility more aggressively and frequently. risk owners have the responsibility and accountability to manage their assigned risk in real-time, using the RAMtool database.

  8. Sea Level Rise Media Release

    E-Print Network [OSTI]

    Hu, Aixue

    Sea Level Rise Media Release Coverage Report 07/06/2009 Melting Ice Could Lead to Massive Waves 06/11/2009 Rising sea levels could see U.S. Atlantic coast cities make hard choices; Where to let Baltimore Chronicle & Sentinel, The 06/08/2009 Rapid rise in sea levels on East Coast predicted Pittsburgh

  9. Near Surface Leakage Monitoring for the Verification and Accounting of Geologic Carbon Sequestration Using a Field Ready {sup 14}C Isotopic Analyzer

    SciTech Connect (OSTI)

    Marino, Bruno

    2014-04-14T23:59:59.000Z

    Results for the development of a field ready multi-isotopic analyzer for {sup 12}CO{sub 2}, {sup 13}CO{sub 2} and {sup 14}CO{sub 2} and applications for carbon capture and storage (CCS) containment performance are described. A design goal of the field platform was to provide isotopic data with a high data rate, a standardized reference baseline and acceptable precision (e.g., ~ ±50 per mil D{sup 14}CO{sub 2}) for detection and quantification of fossil-fuel CO{sub 2} CCS leakage scenarios. The instrument platform was not designed to replace high precision accelerator mass spectrometry. An additional goal was to combine project scale isotopic data and associated fluxes with unique financial instruments linking CCS containment performance to a publicly traded security providing project revenue to stakeholders. While the primary goals of the project were attained additional work is needed for the instrument platform and deployment within a full scale CCS site that was not available during the project timeframe.

  10. Low-level radioactive waste management: transitioning to off-site disposal at Los Alamos National Laboratory

    SciTech Connect (OSTI)

    Dorries, Alison M [Los Alamos National Laboratory

    2010-11-09T23:59:59.000Z

    Facing the closure of nearly all on-site management and disposal capability for low-level radioactive waste (LLW), Los Alamos National Laboratory (LANL) is making ready to ship the majority of LLW off-site. In order to ship off-site, waste must meet the Treatment, Storage, and Disposal Facility's (TSDF) Waste Acceptance Criteria (WAC). In preparation, LANL's waste management organization must ensure LANL waste generators characterize and package waste compliantly and waste characterization documentation is complete and accurate. Key challenges that must be addressed to successfully make the shift to off-site disposal of LLW include improving the detail, accuracy, and quality of process knowledge (PK) and acceptable knowledge (AK) documentation, training waste generators and waste management staff on the higher standard of data quality and expectations, improved WAC compliance for off-site facilities, and enhanced quality assurance throughout the process. Certification of LANL generators will allow direct off-site shipping of LLW from their facilities.

  11. Specified assurance level sampling procedure

    SciTech Connect (OSTI)

    Willner, O.

    1980-11-01T23:59:59.000Z

    In the nuclear industry design specifications for certain quality characteristics require that the final product be inspected by a sampling plan which can demonstrate product conformance to stated assurance levels. The Specified Assurance Level (SAL) Sampling Procedure has been developed to permit the direct selection of attribute sampling plans which can meet commonly used assurance levels. The SAL procedure contains sampling plans which yield the minimum sample size at stated assurance levels. The SAL procedure also provides sampling plans with acceptance numbers ranging from 0 to 10, thus, making available to the user a wide choice of plans all designed to comply with a stated assurance level.

  12. Advanced industrial gas turbine technology readiness demonstration program. Phase II. Final report: compressor rig fabrication assembly and test

    SciTech Connect (OSTI)

    Schweitzer, J. K.; Smith, J. D.

    1981-03-01T23:59:59.000Z

    The results of a component technology demonstration program to fabricate, assemble and test an advanced axial/centrifugal compressor are presented. This work was conducted to demonstrate the utilization of advanced aircraft gas turbine cooling and high pressure compressor technology to improve the performance and reliability of future industrial gas turbines. Specific objectives of the compressor component testing were to demonstrate 18:1 pressure ratio on a single spool at 90% polytropic efficiency with 80% fewer airfoils as compared to current industrial gas turbine compressors. The compressor design configuration utilizes low aspect ratio/highly-loaded axial compressor blading combined with a centrifugal backend stage to achieve the 18:1 design pressure ratio in only 7 stages and 281 axial compressor airfoils. Initial testing of the compressor test rig was conducted with a vaneless centrifugal stage diffuser to allow documentation of the axial compressor performance. Peak design speed axial compressor performance demonstrated was 91.8% polytropic efficiency at 6.5:1 pressure ratio. Subsequent documentation of the combined axial/centrifugal performance with a centrifugal stage pipe diffuser resulted in the demonstration of 91.5% polytropic efficiency and 14% stall margin at the 18:1 overall compressor design pressure ratio. The demonstrated performance not only exceeded the contract performance goals, but also represents the highest known demonstrated compressor performance in this pressure ratio and flow class. The performance demonstrated is particularly significant in that it was accomplished at airfoil loading levels approximately 15% higher than that of current production engine compressor designs. The test results provide conclusive verification of the advanced low aspect ratio axial compressor and centrifugal stage technologies utilized.

  13. Interior Light Level Measurements Appendix F -Interior Light Level Measurements

    E-Print Network [OSTI]

    Appendix F ­ Interior Light Level Measurements #12;F.1 Appendix F - Interior Light Level. A potential concern is that a lower VT glazing may increase electric lighting use to compensate for lost qualify and quantify a representative loss of daylighting, and therefore electric lighting use

  14. ALIGNMENT, LEVELING AND DEPLOYMENT CONSTRAINTS

    E-Print Network [OSTI]

    Rathbun, Julie A.

    Thermoelectric Generator (RTG) Crew Deployment Description Passive Seismic Experiment (PSE) Crew Deployment and Alignment Central Station Antenna Crew Deployment Description Leveling, Alignment, and Pointing Radioisotope

  15. Spray Calciner/In-Can Melter high-level waste solidification technical manual

    SciTech Connect (OSTI)

    Larson, D.E. (ed.)

    1980-09-01T23:59:59.000Z

    This technical manual summarizes process and equipment technology developed at Pacific Northwest Laboratory over the last 20 years for vitrification of high-level liquid waste by the Spray Calciner/In-Can Melter process. Pacific Northwest Laboratory experience includes process development and demonstration in laboratory-, pilot-, and full-scale equipment using nonradioactive synthetic wastes. Also, laboratory- and pilot-scale process demonstrations have been conducted using actual high-level radioactive wastes. In the course of process development, more than 26 tonnes of borosilicate glass have been produced in 75 canisters. Four of these canisters contained radioactive waste glass. The associated process and glass chemistry is discussed. Technology areas described include calciner feed treatment and techniques, calcination, vitrification, off-gas treatment, glass containment (the canister), and waste glass chemistry. Areas of optimization and site-specific development that would be needed to adapt this base technology for specific plant application are indicated. A conceptual Spray Calciner/In-Can Melter system design and analyses are provided in the manual to assist prospective users in evaluating the process for plant application, to provide equipment design information, and to supply information for safety analyses and environmental reports. The base (generic) technology for the Spray Calciner/In-Can Melter process has been developed to a point at which it is ready for plant application.

  16. Evaluations of average level spacings

    SciTech Connect (OSTI)

    Liou, H.I.

    1980-01-01T23:59:59.000Z

    The average level spacing for highly excited nuclei is a key parameter in cross section formulas based on statistical nuclear models, and also plays an important role in determining many physics quantities. Various methods to evaluate average level spacings are reviewed. Because of the finite experimental resolution, to detect a complete sequence of levels without mixing other parities is extremely difficult, if not totally impossible. Most methods derive the average level spacings by applying a fit, with different degrees of generality, to the truncated Porter-Thomas distribution for reduced neutron widths. A method that tests both distributions of level widths and positions is discussed extensivey with an example of /sup 168/Er data. 19 figures, 2 tables.

  17. Superconductivity for Large Scale Wind Turbines

    SciTech Connect (OSTI)

    R. Fair; W. Stautner; M. Douglass; R. Rajput-Ghoshal; M. Moscinski; P. Riley; D. Wagner; J. Kim; S. Hou; F. Lopez; K. Haran; J. Bray; T. Laskaris; J. Rochford; R. Duckworth

    2012-10-12T23:59:59.000Z

    A conceptual design has been completed for a 10MW superconducting direct drive wind turbine generator employing low temperature superconductors for the field winding. Key technology building blocks from the GE Wind and GE Healthcare businesses have been transferred across to the design of this concept machine. Wherever possible, conventional technology and production techniques have been used in order to support the case for commercialization of such a machine. Appendices A and B provide further details of the layout of the machine and the complete specification table for the concept design. Phase 1 of the program has allowed us to understand the trade-offs between the various sub-systems of such a generator and its integration with a wind turbine. A Failure Modes and Effects Analysis (FMEA) and a Technology Readiness Level (TRL) analysis have been completed resulting in the identification of high risk components within the design. The design has been analyzed from a commercial and economic point of view and Cost of Energy (COE) calculations have been carried out with the potential to reduce COE by up to 18% when compared with a permanent magnet direct drive 5MW baseline machine, resulting in a potential COE of 0.075 $/kWh. Finally, a top-level commercialization plan has been proposed to enable this technology to be transitioned to full volume production. The main body of this report will present the design processes employed and the main findings and conclusions.

  18. Transmutation Fuel Campaign Description and Status

    SciTech Connect (OSTI)

    Jon Carmack; Kemal O. Pasamehmetoglu

    2008-01-01T23:59:59.000Z

    This report contains a technical summary package in response to a Level 2 milestone in the transmutation fuel campaign (TFC) management work-package calling for input to the Secretarial decision. At present, the form of the Secretarial decision package is not fully defined, and it is not clear exactly what will be required from the TFC as a final input. However, it is anticipated that a series oftechnical and programmatic documents will need to be provided in support of a wider encompassing document on GNEP technology development activities. The TFC technical leadership team provides this report as initial input to the secretarial decision package which is being developed by the Technical Integration Office (TIO) in support of Secretarial decision. This report contains a summary of the TFC execution plan with a work breakdown structure, highlevel schedule, major milestones, and summary description of critical activities in support of campaign objectives. Supporting documents referenced in this report but provided under separate cover include: • An updated review of the state-of-the art for transmutation fuel development activities considering national as well as international fuel research and development testing activities. • A definition of the Technology Readiness Level (TRL) used to systematically define and execute the transmutation fuel development activities.

  19. Levelling of microprofiles in electrodeposition

    SciTech Connect (OSTI)

    Jordan, K.G.

    1990-12-01T23:59:59.000Z

    This dissertation addresses current distribution phenomena in the smoothing of advancing and receding microprofiles during electrodeposition in the following areas: levelling in the presence of inhibitors, levelling in the presence of corrosive agents, and levelling caused by periodic current reversal. These phenomena are relevant to many commercial electrodeposition processes. Theoretical analysis of moving boundaries in electrodeposition is addressed, focusing on the levelling of microscopic surface contours. The literature relevant to the solution of current distribution problems is reviewed. Convection of inhibitors to the depth of trenches is evaluated using the finite element method, and characterized as a function of Reynolds number, notch angle, and depth. Secondary flows are shown to noticeably enhance transport into microscopic trenches only at high Peclet numbers, i.e. at very high flow velocities. The boundary element method (BEM) is used to analyze levelling caused by inhibitors consumed at the transport limiting rate during electrodeposition. It is predicted that (1) better levelling performance can be obtained if the microscopic surface waviness is oriented perpendicular to the convective flow, and (2) for surface roughness oriented parallel to the flow, there is an optimum boundary layer thickness, or flux of additive, which results in superior levelling performance. Profilometry and photomicrography is applied to obtain the current distribution, current efficiency and levelling performance on novel microprofiled electrodes for two orientations with respect to the fluid flow during nickel electrodeposition in the presence of coumarin. Slightly better levelling occurs in flows transverse to grooves, and the deposit thickness increases in the flow direction. It is concluded that coumarin acts by simultaneously lowering the current efficiency, and blocking metal deposition. 331 refs., 86 figs., 8 tabs.

  20. High-Level Waste Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-07-09T23:59:59.000Z

    The guide provides the criteria for determining which DOE radioactive wastes are to be managed as high-level waste in accordance with DOE M 435.1-1.

  1. Low-Level Waste Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-07-09T23:59:59.000Z

    The guide provides criteria for determining which DOE radioactive wastes are to be managed as low-level waste in accordance with DOE M 435.1-1, Chapter IV.

  2. Low Level Heat Recovery Technology

    E-Print Network [OSTI]

    O'Brien, W. J.

    1982-01-01T23:59:59.000Z

    level heat recovery technology. This paper discusses heat distribution systems, latest developments in absorption refrigeration and organic Rankine cycles, and pressure, minimization possibilities. The relative merits and economics of the various...

  3. Community Readiness Project Helps State Get Ready for Electric...

    Office of Environmental Management (EM)

    analysis and statewide strategy to prepare Oregon for the large-scale use of plug-in hybrid and all-electric vehicles. The strategy will include public outreach and planning...

  4. Community Readiness Project Helps State Get Ready for Electric Vehicles

    Office of Energy Efficiency and Renewable Energy (EERE)

    Oregon is planning for the large-scale deployment of hybrid and all-electric vehicles to reach the state's goal of 30,000 plug-in vehicles by 2015.

  5. DOE Zero Energy Ready Home Consolidated Renewable Energy Ready

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    are met: 1. Location, based on zip code has at least 5 kWhm 2 day average daily solar radiation based on annual solar insolation using PVWatts online tool: http:...

  6. Promoting system-level learning from project-level lessons

    SciTech Connect (OSTI)

    Jong, Amos A. de, E-mail: amosdejong@gmail.com [Innovation Management, Utrecht (Netherlands); Runhaar, Hens A.C., E-mail: h.a.c.runhaar@uu.nl [Section of Environmental Governance, Utrecht University, Utrecht (Netherlands); Runhaar, Piety R., E-mail: piety.runhaar@wur.nl [Organisational Psychology and Human Resource Development, University of Twente, Enschede (Netherlands); Kolhoff, Arend J., E-mail: Akolhoff@eia.nl [The Netherlands Commission for Environmental Assessment, Utrecht (Netherlands); Driessen, Peter P.J., E-mail: p.driessen@geo.uu.nl [Department of Innovation and Environment Sciences, Utrecht University, Utrecht (Netherlands)

    2012-02-15T23:59:59.000Z

    A growing number of low and middle income nations (LMCs) have adopted some sort of system for environmental impact assessment (EIA). However, generally many of these EIA systems are characterised by a low performance in terms of timely information dissemination, monitoring and enforcement after licencing. Donor actors (such as the World Bank) have attempted to contribute to a higher performance of EIA systems in LMCs by intervening at two levels: the project level (e.g. by providing scoping advice or EIS quality review) and the system level (e.g. by advising on EIA legislation or by capacity building). The aims of these interventions are environmental protection in concrete cases and enforcing the institutionalisation of environmental protection, respectively. Learning by actors involved is an important condition for realising these aims. A relatively underexplored form of learning concerns learning at EIA system-level via project level donor interventions. This 'indirect' learning potentially results in system changes that better fit the specific context(s) and hence contribute to higher performances. Our exploratory research in Ghana and the Maldives shows that thus far, 'indirect' learning only occurs incidentally and that donors play a modest role in promoting it. Barriers to indirect learning are related to the institutional context rather than to individual characteristics. Moreover, 'indirect' learning seems to flourish best in large projects where donors achieved a position of influence that they can use to evoke reflection upon system malfunctions. In order to enhance learning at all levels donors should thereby present the outcomes of the intervention elaborately (i.e. discuss the outcomes with a large audience), include practical suggestions about post-EIS activities such as monitoring procedures and enforcement options and stimulate the use of their advisory reports to generate organisational memory and ensure a better information dissemination.

  7. High Level Waste Management Division High. Level Waste System Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC) EnvironmentalGyroSolé(tm) Harmonicbet WhenHiggs Boson May| ArgonneHigh Level

  8. Space elevator systems level analysis

    SciTech Connect (OSTI)

    Laubscher, B. E. (Bryan E.)

    2004-01-01T23:59:59.000Z

    The Space Elevator (SE) represents a major paradigm shift in space access. It involves new, untried technologies in most of its subsystems. Thus the successful construction of the SE requires a significant amount of development, This in turn implies a high level of risk for the SE. This paper will present a systems level analysis of the SE by subdividing its components into their subsystems to determine their level of technological maturity. such a high-risk endeavor is to follow a disciplined approach to the challenges. A systems level analysis informs this process and is the guide to where resources should be applied in the development processes. It is an efficient path that, if followed, minimizes the overall risk of the system's development. systems level analysis is that the overall system is divided naturally into its subsystems, and those subsystems are further subdivided as appropriate for the analysis. By dealing with the complex system in layers, the parameter space of decisions is kept manageable. Moreover, A rational way to manage One key aspect of a resources are not expended capriciously; rather, resources are put toward the biggest challenges and most promising solutions. This overall graded approach is a proven road to success. The analysis includes topics such as nanotube technology, deployment scenario, power beaming technology, ground-based hardware and operations, ribbon maintenance and repair and climber technology.

  9. Official Certificate List Level(s)* Academic Administrative

    E-Print Network [OSTI]

    Risk, Uncertainty and Decision Analysis EGRU335 Certificate in Engineering Thermal Energy Systems EGRU International Certificate ALSU198 Certificate for Biology in Engineering for Engineering Majors EGRU135 Level IESG310 Certificate in Engineering for Energy Sustainability EGRU340 Certificate in Engineering

  10. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    not required. b. Location, based on zip code, has at least 5 kWhm 2 day average daily solar radiation based on annual solar insolation using this online tool: http:...

  11. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    a PV system b. Location, based on zip code, has at least 5 kWhm 2 day average daily solar radiation based on annual solar insolation using this online tool: http:...

  12. Solar Ready Buildings Planning Guide

    SciTech Connect (OSTI)

    Lisell, L.; Tetreault, T.; Watson, A.

    2009-12-01T23:59:59.000Z

    This guide offers a checklist for building design and construction to enable installation of solar photovoltaic and heating systems at some time after the building is constructed.

  13. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    IECC Zones 4 Marine 5,6,7,8) AFUE 80% 90% 94% SEER 18 15 13 HSPF 8.2 9 10 24 Geothermal Heat Pump ENERGY STAR EER and COP Criteria ASHRAE 62.2 Whole-House Mechanical Ventilation...

  14. Forensic Statistics: Ready for consumption?

    E-Print Network [OSTI]

    Gill, Richard D.

    in de rechtszaal. Stator. http://www.kennislink.nl/web/show?id=111865 #12;Everyday statistics · Intensive two-way interaction between statistician and subject-matter expert (client) Cyclic process of re

  15. Emergency Readiness Assurance Plans (ERAPs)

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-08-21T23:59:59.000Z

    This volume describes the assessments and documentation that would ensure that stated response capabilities are sufficient to implement emergency plans. Canceled by DOE G 151.1-3.

  16. TECHNOLOGY READINESS ASSESSMENT-OVERVIEW

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Combustion 2 2 Advanced Concepts 0 Gasification Systems Feed Systems 2 2 4 Gasifier Optimization and Plant Supporting Systems 2 3 1 6 Syngas Processing 2 2 3 4 11 Advanced...

  17. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials | DepartmentEnergy Will

  18. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials | DepartmentEnergy WillCalifornia Program

  19. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials | DepartmentEnergy WillCalifornia

  20. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: Theof"WaveInteractionsMaterials | DepartmentEnergy WillCalifornia5) May

  1. High pressure liquid level monitor

    DOE Patents [OSTI]

    Bean, Vern E. (Frederick, MD); Long, Frederick G. (Ijamsville, MD)

    1984-01-01T23:59:59.000Z

    A liquid level monitor for tracking the level of a coal slurry in a high-pressure vessel including a toroidal-shaped float with magnetically permeable bands thereon disposed within the vessel, two pairs of magnetic field generators and detectors disposed outside the vessel adjacent the top and bottom thereof and magnetically coupled to the magnetically permeable bands on the float, and signal processing circuitry for combining signals from the top and bottom detectors for generating a monotonically increasing analog control signal which is a function of liquid level. The control signal may be utilized to operate high-pressure control valves associated with processes in which the high-pressure vessel is used.

  2. Level indicator for pressure vessels

    DOE Patents [OSTI]

    Not Available

    1982-04-28T23:59:59.000Z

    A liquid-level monitor for tracking the level of a coal slurry in a high-pressure vessel including a toroidal-shaped float with magnetically permeable bands thereon disposed within the vessel, two pairs of magnetic-field generators and detectors disposed outside the vessel adjacent the top and bottom thereof and magnetically coupled to the magnetically permeable bands on the float, and signal-processing circuitry for combining signals from the top and bottom detectors for generating a monotonically increasing analog control signal which is a function of liquid level. The control signal may be utilized to operate high-pressure control valves associated with processes in which the high-pressure vessel is used.

  3. Simulation of leveling in electrodeposition

    SciTech Connect (OSTI)

    Dukovic, J.O.; Tobias, C.W. (Materials and Chemical Sciences Div., Lawrence Berkeley Lab. and Dept. of Chemical Engineering, Univ. of California, Berkeley, CA (US))

    1990-12-01T23:59:59.000Z

    This paper reports on a model of current distribution and electrode shape change for electrodeposition in the presence of diffusion-controlled leveling agents that have been developed. The system is treated as a special case of secondary current distribution, with the surface overpotential taken to depend on both the current density and the transport-limited flux of the leveling agent, according to an empirical relation adapted from polarization data measured at different conditions of agitation. The spatial variation of the leveling-agent flux is determined from a concentration field problem based on the assumption of a stagnant diffusion layer. The solution is obtained by the boundary element method, with a flexible moving-boundary algorithm for simulating the advancement of the electrode profile. To illustrate the model's performance, the evolution of a groove profile during deposition of nickel from a Watts-type bath containing coumarin is predicted and compared with measurements reported in the literature.

  4. The CMS High Level Trigger

    E-Print Network [OSTI]

    Adam, W; Deldicque, C; Ero, J; Frühwirth, R; Jeitler, Manfred; Kastner, K; Köstner, S; Neumeister, N; Porth, M; Padrta P; Rohringer, H; Sakulinb, H; Strauss, J; Taurok, A; Walzel, G; Wulz, C E; Lowette, S; Van De Vyver, B; De Lentdecker, G; Vanlaer, P; Delaere, C; Lemaître, V; Ninane, A; van der Aa, O; Damgov, J; Karimäki, V; Kinnunen, R; Lampen, T; Lassila-Perini, K M; Lehti, S; Nysten, J; Tuominiemi, J; Busson, P; Todorov, T; Schwering, G; Gras, P; Daskalakis, G; Sfyrla, A; Barone, M; Geralis, T; Markou, C; Zachariadou, K; Hidas, P; Banerjee, S; Mazumdara, K; Abbrescia, M; Colaleoa, A; D'Amato, N; De Filippis, N; Giordano, D; Loddo, F; Maggi, M; Silvestris, L; Zito, G; Arcelli, S; Bonacorsi, D; Capiluppi, P; Dallavalle, G M; Fanfani, A; Grandi, C; Marcellini, S; Montanari, A; Odorici, F; Travaglini, R; Costa, S; Tricomi, A; Ciulli, a V; Magini, N; Ranieri, R; Berti, L; Biasotto, M; Gulminia, M; Maron, G; Toniolo, N; Zangrando, L; Bellato, M; Gasparini, U; Lacaprara, S; Parenti, A; Ronchese, P; Vanini, S; Zotto, S; Ventura P L; Perugia; Benedetti, D; Biasini, M; Fano, L; Servoli, L; Bagliesi, a G; Boccali, T; Dutta, S; Gennai, S; Giassi, A; Palla, F; Segneri, G; Starodumov, A; Tenchini, R; Meridiani, P; Organtini, G; Amapane, a N; Bertolino, F; Cirio, R; Kim, J Y; Lim, I T; Pac, Y; Joo, K; Kim, S B; Suwon; Choi, Y I; Yu, I T; Cho, K; Chung, J; Ham, S W; Kim, D H; Kim, G N; Kim, W; CKim, J; Oh, S K; Park, H; Ro, S R; Son, D C; Suh, J S; Aftab, Z; Hoorani, H; Osmana, A; Bunkowski, K; Cwiok, M; Dominik, Wojciech; Doroba, K; Kazana, M; Królikowski, J; Kudla, I; Pietrusinski, M; Pozniak, Krzysztof T; Zabolotny, W M; Zalipska, J; Zych, P; Goscilo, L; Górski, M; Wrochna, G; Zalewski, P; Alemany-Fernandez, R; Almeida, C; Almeida, N; Da Silva, J C; Santos, M; Teixeira, I; Teixeira, J P; Varelaa, J; Vaz-Cardoso, N; Konoplyanikov, V F; Urkinbaev, A R; Toropin, A; Gavrilov, V; Kolosov, V; Krokhotin, A; Oulianov, A; Stepanov, N; Kodolova, O L; Vardanyan, I; Ilic, J; Skoro, G P; Albajar, C; De Troconiz, J F; Calderón, A; López-Virto, M A; Marco, R; Martínez-Rivero, C; Matorras, F; Vila, I; Cucciarelli, S; Konecki, M; Ashby, S; Barney, D; Bartalini, P; Benetta, R; Brigljevic, V; Bruno, G; Cano, E; Cittolin, S; Della Negra, M; de Roeck, A; Favre, P; Frey, A; Funk, W; Futyan, D; Gigi, D; Glege, F; Gutleber, J; Hansen, M; Innocente, V; Jacobs, C; Jank, W; Kozlovszky, Miklos; Larsen, H; Lenzi, M; Magrans, I; Mannelli, M; Meijers, F; Meschi, E; Mirabito, L; Murray, S J; Oh, A; Orsini, L; Palomares-Espiga, C; Pollet, L; Rácz, A; Reynaud, S; Samyn, D; Scharff-Hansen, P; Schwick, C; Sguazzoni, G; Sinanis, N; Sphicas, P; Spiropulu, M; Strandlie, A; Taylor, B G; Van Vulpen, I; Wellisch, J P; Winkler, M; Villigen; Kotlinski, D; Zurich; Prokofiev, K; Speer, T; Dumanoglu, I; Bristol; Bailey, S; Brooke, J J; Cussans, D; Heath, G P; Machin, D; Nash, S J; Newbold, D; Didcot; Coughlan, A; Halsall, R; Haynes, W J; Tomalin, I R; Marinelli, N; Nikitenko, A; Rutherford, S; Seeza, C; Sharif, O; Antchev, G; Hazen, E; Rohlf, J; Wu, S; Breedon, R; Cox, P T; Murray, P; Tripathi, M; Cousins, R; Erhan, S; Hauser, J; Kreuzer, P; Lindgren, M; Mumford, J; Schlein, P E; Shi, Y; Tannenbaum, B; Valuev, V; Von der Mey, M; Andreevaa, I; Clare, R; Villa, S; Bhattacharya, S; Branson, J G; Fisk, I; Letts, J; Mojaver, M; Paar, H P; Trepagnier, E; Litvine, V; Shevchenko, S; Singh, S; Wilkinson, R; Aziz, S; Bowden, M; Elias, J E; Graham, G; Green, D; Litmaath, M; Los, S; O'Dell, V; Ratnikova, N; Suzuki, I; Wenzel, H; Acosta, D; Bourilkov, D; Korytov, A; Madorsky, A; Mitselmakher, G; Rodríguez, J L; Scurlock, B; Abdullin, S; Baden, D; Eno, S; Grassi, T; Kunori, S; Pavlon, S; Sumorok, K; Tether, S; Cremaldi, L M; Sanders, D; Summers, D; Osborne, I; Taylor, L; Tuura, L; Fisher,W C; Mans6, J; Stickland, D P; Tully, C; Wildish, T; Wynhoff, S; Padley, B P; Chumney, P; Dasu, S; Smith, W H; CMS Trigger Data Acquisition Group

    2006-01-01T23:59:59.000Z

    At the Large Hadron Collider at CERN the proton bunches cross at a rate of 40MHz. At the Compact Muon Solenoid experiment the original collision rate is reduced by a factor of O (1000) using a Level-1 hardware trigger. A subsequent factor of O(1000) data reduction is obtained by a software-implemented High Level Trigger (HLT) selection that is executed on a multi-processor farm. In this review we present in detail prototype CMS HLT physics selection algorithms, expected trigger rates and trigger performance in terms of both physics efficiency and timing.

  5. Company Level Imports Explanatory Notes

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for On-Highway4,1,50022,3,,,,6,1,9,1,50022,3,,,,6,1,Decade Year-0E (2001)gasoline prices4Consumption TheX I A OCompany Level

  6. High temperature liquid level sensor

    DOE Patents [OSTI]

    Tokarz, Richard D. (West Richland, WA)

    1983-01-01T23:59:59.000Z

    A length of metal sheathed metal oxide cable is perforated to permit liquid access to the insulation about a pair of conductors spaced close to one another. Changes in resistance across the conductors will be a function of liquid level, since the wetted insulation will have greater electrical conductivity than that of the dry insulation above the liquid elevation.

  7. Texas Rangeland Monitoring: Level Three

    E-Print Network [OSTI]

    Hanselka, C. Wayne; Hart, Charles R.; McGinty, Allan

    2006-10-09T23:59:59.000Z

    L-5455 10/06 Texas Rangeland Monitoring: Level Three C. Wayne Hanselka, Charles R. Hart and Allan McGinty* Monitoring is an essential tool in rangeland management. Monitoring is the way to determine whether goals are being achieved with current...

  8. Idaho High-Level Waste & Facilities Disposition, Final Environmental Impact Statement

    SciTech Connect (OSTI)

    N /A

    2002-10-11T23:59:59.000Z

    This EIS analyzes the potential environmental consequences of alternatives for managing high-level waste (HLW) calcine, mixed transuranic waste/sodium bearing waste (SBW) and newly generated liquid waste at the Idaho National Engineering and Environmental Laboratory (INEEL) in liquid and solid forms. This EIS also analyzes alternatives for the final disposition of HLW management facilities at the INEEL after their missions are completed. After considering comments on the Draft EIS (DOE/EIS-0287D), as well as information on available treatment technologies, DOE and the State of Idaho have identified separate preferred alternatives for waste treatment. DOE's preferred alternative for waste treatment is performance based with the focus on placing the wastes in forms suitable for disposal. Technologies available to meet the performance objectives may be chosen from the action alternatives analyzed in this EIS. The State of Idaho's Preferred Alternative for treating mixed transuranic waste/SBW and calcine is vitrification, with or without calcine separations. Under both the DOE and State of Idaho preferred alternatives, newly generated liquid waste would be segregated after 2005, stored or treated directly and disposed of as low-level, mixed low-level, or transuranic waste depending on its characteristics. The objective of each preferred alternative is to enable compliance with the legal requirement to have INEEL HLW road ready by a target date of 2035. Both DOE and the State of Idaho have identified the same preferred alternative for facilities disposition, which is to use performance-based closure methods for existing facilities and to design new facilities consistent with clean closure methods.

  9. Manufacturing Readiness Assessment for Fuel Cell Stacks and Systems for the Back-up Power and Material Handling Equipment Emerging Markets (Revised)

    SciTech Connect (OSTI)

    Wheeler, D.; Ulsh, M.

    2010-02-01T23:59:59.000Z

    This report details NREL's activity to address the need to understand the current status and associated risk levels of the polymer electrolyte membrane (PEM) fuel cell industry.

  10. Energy Level Diagrams A=10

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the following

  11. Energy Level Diagrams A=11

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the

  12. Energy Level Diagrams A=12

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the2

  13. Energy Level Diagrams A=13

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the23

  14. Energy Level Diagrams A=14

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the234

  15. Energy Level Diagrams A=15

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the2345

  16. Energy Level Diagrams A=16

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the23456

  17. Energy Level Diagrams A=17

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the234567

  18. Energy Level Diagrams A=18

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the2345678

  19. Energy Level Diagrams A=19

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in the234567819

  20. Energy Level Diagrams A=20

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in

  1. Energy Level Diagrams A=4

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4 Available in

  2. Energy Level Diagrams A=5

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4 Available

  3. Energy Level Diagrams A=6

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4 Available6

  4. Energy Level Diagrams A=7

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4 Available67

  5. Energy Level Diagrams A=8

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4 Available678

  6. Energy Level Diagrams A=9

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8, 2000Consumption Survey (CBECS) Data 210 Available in4

  7. Mid-Level Ethanol Blends

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaeferApril 1,(EAC)TABLE OF CONTENTS 1of:Microsoft WordREMARKSMicrosoft

  8. Effect of Sea Level Rise

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy Chinaof EnergyImpactOn July 2, 2014 in theGroup Report |ofM A NNRELU.S.-JapanWear

  9. Continental margin architecture : sea level and climate

    E-Print Network [OSTI]

    Hill, Jenna Catherine

    2007-01-01T23:59:59.000Z

    J. , 2006. Rapid sea-level rise and Holocene climate in theJ. , 2006. Rapid sea-level rise and Holocene climate in theby deceleration of sea-level rise. Science, 265: 228-231.

  10. Fluorescent optical liquid level sensor

    DOE Patents [OSTI]

    Weiss, Jonathan D. (Albuquerque, NM)

    2001-01-01T23:59:59.000Z

    A liquid level sensor comprising a transparent waveguide containing fluorescent material that is excited by light of a first wavelength and emits at a second, longer wavelength. The upper end of the waveguide is connected to a light source at the first wavelength through a beveled portion of the waveguide such that the input light is totally internally reflected within the waveguide above an air/liquid interface in a tank but is transmitted into the liquid below this interface. Light is emitted from the fluorescent material only in those portions of the waveguide that are above the air/liquid interface, to be collected at the upper end of the waveguide by a detector that is sensitive only to the second wavelength. As the interface moves down in the tank, the signal strength from the detector will increase.

  11. Exam Preparation Identifying Levels of Learning

    E-Print Network [OSTI]

    , proposed a six-level model of learning, with each level requiring a different type of cognitive processingSee over Exam Preparation Identifying Levels of Learning When you are preparing for an exam, understand, apply, analyze, evaluate, and create. Understanding these levels and the types of exam questions

  12. Lecture course on Sea level variations

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    level rise from tide gauges "viewpoint of the solid Earth" "A tide staff" Rate is ~ 20 cm/century 7 Level rise between 1993 and 2010 by satellite ALTIMETRY Sea level is rising (by altimetry) "viewpoint of space" 1993-2010 8Friday, November 11, 2011 #12;Sea level will be rising (IPCC scenarios) Figure 11

  13. High Level Waste System Plan Revision 9

    SciTech Connect (OSTI)

    Davis, N.R.; Wells, M.N.; Choi, A.S.; Paul, P.; Wise, F.E.

    1998-04-01T23:59:59.000Z

    Revision 9 of the High Level Waste System Plan documents the current operating strategy of the HLW System at SRS to receive, store, treat, and dispose of high-level waste.

  14. Low Level Radioactive Waste Authority (Michigan)

    Broader source: Energy.gov [DOE]

    Federal laws passed in 1980 and 1985 made each state responsible for the low-level radioactive waste produced within its borders. Act 204 of 1987 created the Low-Level Radioactive Waste Authority ...

  15. Action and Inaction Levels in Pest Management.

    E-Print Network [OSTI]

    Sterling, Winfield

    1984-01-01T23:59:59.000Z

    1984 Action and Inaction Levels in Pest Management Winfield Sterling Department of Entomology Texas A&M University and The Texas Agricultural Experiment Station College Station, Texas 77843 Contents Introduction... of pests does the maintenance of pests below economic (112). The term inaction level for the density of enemies sufficient to maintain the pests below level is suggested (29). McDaniel & Sterling an example of an inaction level. They a ratio of one...

  16. CHARACTERIZING UNCERTAIN SEA LEVEL RISE PROJECTIONS TO

    E-Print Network [OSTI]

    identifies scenarios where a decision to invest in near-term response to extreme sea level rise passes a cost. Keywords: Sea level rise, robust decision-making, climate change adaptation, cost-benefit analysis PleaseCHARACTERIZING UNCERTAIN SEA LEVEL RISE PROJECTIONS TO SUPPORT INVESTMENT DECISIONS

  17. Updating Maryland's Sea-level Rise

    E-Print Network [OSTI]

    Ezer,Tal

    Updating Maryland's Sea-level Rise Projections Scientific and Technical Working Group Maryland Climate Change Commission June 26, 2013 #12;Sea-level Rise Expert Group Donald F. Boesch* , University-author of the National Assessment Scenarios report Author of paper(s) on recent sea-level rise ~ Author contributing

  18. Level Set Implementations on Unstructured Point Cloud

    E-Print Network [OSTI]

    Duncan, James S.

    Level Set Implementations on Unstructured Point Cloud by HO, Hon Pong A Thesis Submitted;Level Set Implementations on Unstructured Point Cloud by HO, Hon Pong This is to certify that I have implementations on unstructured point cloud 15 3.1 Level set initialization

  19. Set # Name Size (Towne) Forward Reverse Probe Author Date Citation 1 TRL11, IRL11 ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 44264432

    E-Print Network [OSTI]

    ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 4426­4432 UL54 / Polymerase 2 UL75 T A P R I M B 218 ACCCGTTACGTGACGGTCAA TTGTCGGCGTTTTCTCCAAA Allen 1995 JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1995, p. 725­728 3 UL75 T A P O I M B 268 TACAACAAACCGATTGCCGC

  20. Global Warming and Caspian Sea Level Fluctuations

    E-Print Network [OSTI]

    Ardakanian, Reza

    2013-01-01T23:59:59.000Z

    Coastal regions have a high social, economical and environmental importance. Due to this importance the sea level fluctuations can have many bad consequences. In this research the correlation between the increasing trend of temperature in coastal stations due to Global Warming and the Caspian Sea level has been established. The Caspian Sea level data has been received from the Jason-1 satellite. It was resulted that the monthly correlation between the temperature and sea level is high and also positive and almost the same for all the stations. But the yearly correlation was negative. It means that the sea level has decreased by the increase in temperature.