National Library of Energy BETA

Sample records for readiness level trl

  1. Development of Technology Readiness Level (TRL) Metrics and Risk Measures

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.; Anderson, K. K.; Sivaramakrishnan, Chandrika; Lansing, Carina

    2012-10-01

    This is an internal project milestone report to document the CCSI Element 7 team's progress on developing Technology Readiness Level (TRL) metrics and risk measures. In this report, we provide a brief overview of the current technology readiness assessment research, document the development of technology readiness levels (TRLs) specific to carbon capture technologies, describe the risk measures and uncertainty quantification approaches used in our research, and conclude by discussing the next steps that the CCSI Task 7 team aims to accomplish.

  2. CCSI Technology Readiness Levels Likelihood Model (TRL-LM) User’s Guide

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.; Sivaramakrishnan, Chandrika; Lansing, Carina

    2013-03-26

    This is the manual for the Carbon Capture Simulation Initiative (CCSI) Technology Readiness Level Likelihood model based on PNNL velo.

  3. An Analysis of TRL-Based Cost and Schedule Models

    E-Print Network [OSTI]

    Kenley, C. Robert

    2012-04-30

    The GAO's, NASA's, and the DoD's adoption of the technology readiness level (TRL) scale to improve technology management has led to the emergence of many TRL-based models that are used to monitor technology maturation, ...

  4. TRL Computer System User’s Guide

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.

    2014-01-31

    We have developed a wiki-based graphical user-interface system that implements our technology readiness level (TRL) uncertainty models. This document contains the instructions for using this wiki-based system.

  5. Modeling and simulation technology readiness levels.

    SciTech Connect (OSTI)

    Clay, Robert L.; Shneider, Max S.; Marburger, S. J.; Trucano, Timothy Guy

    2006-01-01

    This report summarizes the results of an effort to establish a framework for assigning and communicating technology readiness levels (TRLs) for the modeling and simulation (ModSim) capabilities at Sandia National Laboratories. This effort was undertaken as a special assignment for the Weapon Simulation and Computing (WSC) program office led by Art Hale, and lasted from January to September 2006. This report summarizes the results, conclusions, and recommendations, and is intended to help guide the program office in their decisions about the future direction of this work. The work was broken out into several distinct phases, starting with establishing the scope and definition of the assignment. These are characterized in a set of key assertions provided in the body of this report. Fundamentally, the assignment involved establishing an intellectual framework for TRL assignments to Sandia's modeling and simulation capabilities, including the development and testing of a process to conduct the assignments. To that end, we proposed a methodology for both assigning and understanding the TRLs, and outlined some of the restrictions that need to be placed on this process and the expected use of the result. One of the first assumptions we overturned was the notion of a ''static'' TRL--rather we concluded that problem context was essential in any TRL assignment, and that leads to dynamic results (i.e., a ModSim tool's readiness level depends on how it is used, and by whom). While we leveraged the classic TRL results from NASA, DoD, and Sandia's NW program, we came up with a substantially revised version of the TRL definitions, maintaining consistency with the classic level definitions and the Predictive Capability Maturity Model (PCMM) approach. In fact, we substantially leveraged the foundation the PCMM team provided, and augmented that as needed. Given the modeling and simulation TRL definitions and our proposed assignment methodology, we conducted four ''field trials'' to examine how this would work in practice. The results varied substantially, but did indicate that establishing the capability dependencies and making the TRL assignments was manageable and not particularly time consuming. The key differences arose in perceptions of how this information might be used, and what value it would have (opinions ranged from negative to positive value). The use cases and field trial results are included in this report. Taken together, the results suggest that we can make reasonably reliable TRL assignments, but that using those without the context of the information that led to those results (i.e., examining the measures suggested by the PCMM table, and extended for ModSim TRL purposes) produces an oversimplified result--that is, you cannot really boil things down to just a scalar value without losing critical information.

  6. Technology Readiness Levels for Advanced Nuclear Fuels and Materials Development

    SciTech Connect (OSTI)

    Jon Carmack

    2014-01-01

    The Technology Readiness Level (TRL) process is used to quantitatively assess the maturity of a given technology. The TRL process has been developed and successfully used by the Department of Defense (DOD) for development and deployment of new technology and systems for defense applications. In addition, NASA has also successfully used the TRL process to develop and deploy new systems for space applications. Advanced nuclear fuels and materials development is a critical technology needed for closing the nuclear fuel cycle. Because the deployment of a new nuclear fuel forms requires a lengthy and expensive research, development, and demonstration program, applying the TRL concept to the advanced fuel development program is very useful as a management and tracking tool. This report provides definition of the technology readiness level assessment process as defined for use in assessing nuclear fuel technology development for the Advanced Fuel Campaign (AFC).

  7. Early Market TRL/MRL Analysis

    SciTech Connect (OSTI)

    Ronnebro, Ewa; Stetson, Ned

    2013-12-01

    he focus of this report is TRL/MRL analysis of hydrogen storage; it documents the methodology and results of an effort to identify hydrogen storage technologies’ technical and manufacturing readiness for early market motive and non-motive applications and to provide a path forward toward commercialization. Motive applications include materials handling equipment (MHE) and ground support equipment (GSE), such as forklifts, tow tractors, and specialty vehicles such as golf carts, lawn mowers and wheel chairs. Non-motive applications are portable, stationary or auxiliary power units (APUs) and include portable laptops, backup power, remote sensor power, and auxiliary power for recreational vehicles, hotels, hospitals, etc. Hydrogen storage technologies assessed include metal hydrides, chemical hydrides, sorbents, gaseous storage, and liquid storage. The assessments are based on a combination of Technology Readiness Level (TRL) and Manufacturing Readiness Level (MRL) designations that enable evaluation of hydrogen storage technologies at varying levels of development. The manufacturing status could be established from eight risk elements: Technical Maturity, Design, Materials, Cost & Funding, Process Capability, Personnel, Facilities and Manufacturing Planning. This approach provides a logical methodology and roadmap to enable the identification of hydrogen storage technologies, their advantages/disadvantages, gaps and R&D needs on an unbiased and transparent scale that is easily communicated to interagency partners. This technology readiness assessment (TRA) report documents the process used to conduct the TRA/MRA (technology and manufacturing readiness assessment), reports the TRL and MRL for each assessed technology and provides recommendations based on the findings. To investigate the state of the art and needs to mature the technologies, PNNL prepared a questionnaire to assign TRL and MRL for each hydrogen storage technology. The questionnaire was sent to identified hydrogen storage technology developers and manufacturers who were asked to perform a self-assessment. We included both domestic and international organizations including U.S. national laboratories, U.S. companies, European companies and Japanese companies. PNNL collected the data and performed an analysis to deduce the level of maturity and to provide program recommendations.

  8. September 4-5, 2008/ARR TRL Assessment of Fusion Power Plant

    E-Print Network [OSTI]

    Raffray, A. René

    September 4-5, 2008/ARR 1 TRL Assessment of Fusion Power Plant Subsystems A. René Raffray of tritium throughout the entire plant, including breeding and recovery. 12. Power Extraction: Understand how the readiness level of the blanket subsystem for a fusion power plant (DEMO and beyond) · In order to develop

  9. TECHNOLOGY READINESS LEVELS A White Paper

    E-Print Network [OSTI]

    Rhoads, James

    028 TECHNOLOGY READINESS LEVELS A White Paper April 6, 1995 John C. Mankins Advanced Concepts Office Office of Space Access and Technology NASA Introduction Technology Readiness Levels (TRLs) are a systematic metric/measurement system that supports assessments of the maturity of a particular technology

  10. Technology and Manufacturing Readiness of Early Market Motive and Non-Motive Hydrogen Storage Technologies for Fuel Cell Applications

    SciTech Connect (OSTI)

    Ronnebro, Ewa

    2012-06-16

    PNNL’s objective in this report is to provide DOE with a technology and manufacturing readiness assessment to identify hydrogen storage technologies’ maturity levels for early market motive and non-motive applications and to provide a path forward toward commercialization. PNNL’s Technology Readiness Assessment (TRA) is based on a combination of Technology Readiness Level (TRL) and Manufacturing Readiness Level (MRL) designations that enable evaluation of hydrogen storage technologies in varying levels of development. This approach provides a logical methodology and roadmap to enable the identification of hydrogen storage technologies, their advantages/disadvantages, gaps and R&D needs on an unbiased and transparent scale that is easily communicated to interagency partners. The TRA report documents the process used to conduct the TRA, reports the TRL and MRL for each assessed technology and provides recommendations based on the findings.

  11. Scientific Solutions (TRL 5 6 Component) - Underwater Active...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Solutions (TRL 5 6 Component) - Underwater Active Acoustic Monitoring Network for Marine and Hydrokinetic Energy Scientific Solutions (TRL 5 6 Component) - Underwater Active...

  12. EVALUATION OF SUPPLEMENTAL PRE-TREATMENT DEVELOPMENT REQUIREMENTS TO MEET TRL 6 ROTARY MICROFILTRATION

    SciTech Connect (OSTI)

    HUBER HJ

    2011-10-03

    In spring 2011, the Technology Maturation Plan (TMP) for the Supplemental Treatment Project (RPP-PLAN-49827, Rev. 0), Technology Maturation Plan for the Treatment Project (T4S01) was developed. This plan contains all identified actions required to reach technical maturity for a field-deployable waste feed pretreatment system. The supplemental pretreatment system has a filtration and a Cs-removal component. Subsequent to issuance of the TMP, rotary microfiltration (RMF) has been identified as the prime filtration technology for this application. The prime Cs-removal technology is small column ion exchange (ScIX) using spherical resorcinol formaldehyde (sRF) as the exchange resin. During fiscal year 2011 (FY2011) some of the tasks identified in the TMP have been completed. As of September 2011, the conceptual design package has been submitted to DOE as part of the critical decision (CD-1) process. This document describes the remaining tasks identified in the TMP to reach technical maturity and evaluates the validity of the proposed tests to fill the gaps as previously identified in the TMP. The potential vulnerabilities are presented and the completed list of criteria for the DOE guide DOE G 413.3-4 different technology readiness levels are added in an attachment. This evaluation has been conducted from a technology development perspective - all programmatic and manufacturing aspects were excluded from this exercise. Compliance with the DOE G 413.3-4 programmatic and manufacturing requirements will be addressed directly by the Treatment Project during the course of engineering design. The results of this evaluation show that completion of the proposed development tasks in the TMP are sufficient to reach TRL 6 from a technological point of view. The tasks involve actual waste tests using the current baseline configuration (2nd generation disks, 40 psi differential pressure, 30 C feed temperature) and three different simulants - the PEP, an AP-Farm and an S-saltcake. Based on FY2011 dollars used in the TMP, these tests will have ROM costs of $950K and require up to 10 months to complete. Completion of the simulant testing will satisfy the TRL 5 and TRL 6 criteria that are related to system testing with materials that represent the full range of properties in a relevant environment.

  13. NGNP – Creating Validated TRL and TDRMs for Critical Systems, Subsystems, and Components

    SciTech Connect (OSTI)

    John W. Collins; John M. Beck; Emmanuel O. Opare; Layne F. Pincock

    2008-09-01

    This report introduces two draft Next Generation Nuclear Plant (NGNP) Technology Development Roadmaps (TDRMs) and documents the methods used to create them. As such, this report depicts the development of the hardware needed to successfully operate the NGNP and identifies this hardware by the area of the plant it supports and by system, subsystem, and component (SSC). Several options exist for which technologies are selected to fulfill the functions of the NGNP. These options are represented by differing SSCs and are grouped into reference designs. Each SSC associated with each reference design is evaluated, rated, and assigned a technology readiness level (TRL). A rollup of the TRLs allows for comparison of the various reference designs. A TDRM then documents the tasks needed to obtain information in key discriminating criteria to support technology down selection and the tasks and test required to sufficiently mature the technology and reduce the likelihood of technological failure upon installation. This report presents the path forward, methods, and tools used to understand the requirements, manage the uncertainty, and mitigate the risk for the NGNP project. The key tool, TDRMs, is the means to facilitate NGNP risk-informed decision making, technology down selection, and technology qualification and maturation while serving to coordinate engineering, research and development, and licensing efforts.

  14. Whitestone Power & Communications (TRL 1 2 3 System) - Whitestone...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Poncelet RISEC Project 32poncwpcselvaggio.ppt More Documents & Publications Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE Water Power...

  15. Turner Hunt Ocean Renewable (TRL 4 System) - THOR's Power Method...

    Energy Savers [EERE]

    More Documents & Publications CX-004722: Categorical Exclusion Determination Vortex Hydro Energy (TRL 5 6 System) - Advanced Integration of Power Take-Off in VIVACE Ocean...

  16. Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine Project Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine Project Dehlsen (TRL 5 6 System) -...

  17. An evaluation of fusion energy R&D gaps using Technology Readiness Levels

    E-Print Network [OSTI]

    An evaluation of fusion energy R&D gaps using Technology Readiness Levels M. S. Tillack for prioritization. #12;The topic of fusion energy R&D gaps is receiving increased attention page 2 of 16 In EU&D needs that is widely recognized and utilized outside of the fusion community. Initial efforts

  18. AN EVALUATION OF FUSION ENERGY R&D GAPS USING TECHNOLOGY READINESS LEVELS M. S. Tillack1

    E-Print Network [OSTI]

    Raffray, A. René

    in the science and technology, or "laboratory" environment almost invariably leads to cost and schedule overAN EVALUATION OF FUSION ENERGY R&D GAPS USING TECHNOLOGY READINESS LEVELS M. S. Tillack1 , A. D and remaining R&D needs, we adopted a methodology called "Technology Readiness Levels". We defined

  19. Snohomish PUD No 1 (TRL 7 8 System) - Puget Sound Pilot Tidal...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Documents & Publications Ocean Renewable Power Co (ORPC) (TRL 7 8 System) - TidGen (TM) Power System Commercialization Project Vortex Hydro Energy (TRL 5 6 System) - Advanced...

  20. Northwest Energy Innovations (TRL 5 6 System)- WETNZ MtiMode Wave Energy Converter Advancement Project

    Broader source: Energy.gov [DOE]

    Northwest Energy Innovations (TRL 5 6 System) - WETNZ MtiMode Wave Energy Converter Advancement Project

  1. Preliminary Technology Maturation Plan for Immobilization of High-Level Waste in Glass Ceramics

    SciTech Connect (OSTI)

    Vienna, John D.; Crum, Jarrod V.; Sevigny, Gary J.; Smith, G L.

    2012-09-30

    A technology maturation plan (TMP) was developed for immobilization of high-level waste (HLW) raffinate in a glass ceramics waste form using a cold-crucible induction melter (CCIM). The TMP was prepared by the following process: 1) define the reference process and boundaries of the technology being matured, 2) evaluate the technology elements and identify the critical technology elements (CTE), 3) identify the technology readiness level (TRL) of each of the CTE’s using the DOE G 413.3-4, 4) describe the development and demonstration activities required to advance the TRLs to 4 and 6 in order, and 5) prepare a preliminary plan to conduct the development and demonstration. Results of the technology readiness assessment identified five CTE’s and found relatively low TRL’s for each of them: • Mixing, sampling, and analysis of waste slurry and melter feed: TRL-1 • Feeding, melting, and pouring: TRL-1 • Glass ceramic formulation: TRL-1 • Canister cooling and crystallization: TRL-1 • Canister decontamination: TRL-4 Although the TRL’s are low for most of these CTE’s (TRL-1), the effort required to advance them to higher values. The activities required to advance the TRL’s are listed below: • Complete this TMP • Perform a preliminary engineering study • Characterize, estimate, and simulate waste to be treated • Laboratory scale glass ceramic testing • Melter and off-gas testing with simulants • Test the mixing, sampling, and analyses • Canister testing • Decontamination system testing • Issue a requirements document • Issue a risk management document • Complete preliminary design • Integrated pilot testing • Issue a waste compliance plan A preliminary schedule and budget were developed to complete these activities as summarized in the following table (assuming 2012 dollars). TRL Budget Year MSA FMP GCF CCC CD Overall $M 2012 1 1 1 1 4 1 0.3 2013 2 2 1 1 4 1 1.3 2014 2 3 1 1 4 1 1.8 2015 2 3 2 2 4 2 2.6 2016 2 3 2 2 4 2 4.9 2017 2 3 3 2 4 2 9.8 2018 3 3 3 3 4 3 7.9 2019 3 3 3 3 4 3 5.1 2020 3 3 3 3 4 3 14.6 2021 3 3 3 3 4 3 7.3 2022 3 3 3 3 4 3 8.8 2023 4 4 4 4 4 4 9.1 2024 5 5 5 5 5 5 6.9 2025 6 6 6 6 6 6 6.9 CCC = canister cooling and crystallization; FMP = feeding, melting, and pouring; GCF = glass ceramic formulation; MSA = mixing, sampling, and analyses. This TMP is intended to guide the development of the glass ceramics waste form and process to the point where it is ready for industrialization.

  2. Savannah River Site Tank 48H Waste Treatment Project Technology Readiness Assessment

    SciTech Connect (OSTI)

    Harmon, H.D.; Young, J.K.; Berkowitz, J.B.; DeVine, Jr.J.C.; Sutter, H.G.

    2008-07-01

    One of U.S. Department of Energy's (DOE) primary missions at Savannah River Site (SRS) is to retrieve and treat the high level waste (HLW) remaining in SRS tanks and close the F and H tank farms. At present, a significant impediment to timely completion of this mission is the presence of significant organic chemical contamination in Tank 48H. Tank 48H is a 1.3 million gallon tank with full secondary containment, located and interconnected within the SRS tank system. However, the tank has been isolated from the system and unavailable for use since 1983, because its contents - approximately 250,000 gallons of salt solution containing Cs-137 and other radioisotopes - are contaminated with nearly 22,000 Kg of tetraphenylborate, a material which can release benzene vapor to the tank head space in potentially flammable concentrations. An important element of the DOE SRS mission is to remove, process, and dispose of the contents of Tank 48H, both to eliminate the hazard it presents to the SRS H-Tank Farm and to return Tank 48H to service. Tank 48H must be returned to service to support operation of the Salt Waste Processing Facility, to free up HLW tank space, and to allow orderly tank closures per Federal Facility Agreement commitments. The Washington Savannah River Company (WSRC), the SRS prime contractor, has evaluated alternatives and selected two processes, Wet Air Oxidation (WAO) and Fluidized Steam Bed Reforming (FBSR) as candidates for Tank 48H processing. Over the past year, WSRC has been testing and evaluating these two processes, and DOE is nearing a final technology selection in late 2007. In parallel with WSRC's ongoing work, DOE convened a team of independent qualified experts to conduct a Technology Readiness Assessment (TRA). The purpose of the TRA was to determine the maturity level of the Tank 48H treatment technology candidates - WAO and FBSR. The methodology used for this TRA is based on detailed guidance for conducting TRAs contained in the Department of Defense (DoD), Technology Readiness Assessment Desk-book. The TRA consists of three parts: - Determination of the Critical Technology Elements (CTEs) for each of the candidate processes. - Evaluation of the Technology Readiness Levels (TRLs) of each CTE for each process. - Defining of the technology testing or engineering work necessary to bring immature technologies to the appropriate maturity levels. The TRA methodology assigns a TRL to a technology based on the lowest TRL assigned to any CTE of that technology. Based on the assessment, the overall TRL for WAO was 2 and the TRL for FBSR was 3. WAO was limited by the current lack of definition for the off-gas treatment system (TRL of 2). The FBSR Product Handling had little or no test work and therefore received the lowest score (TRL of 3) for the FBSR CTEs. In summary, both FBSR and WAO appear to be viable technologies for treatment of Tank 48H legacy waste. FBSR has a higher degree of maturity than WAO, but additional technology development will be required for both technologies. However, the Assessment Team believes that sufficient information is available for DOE to select the preferred or primary technology. Limited testing of the backup technology should be conducted as a risk mitigation strategy. (authors)

  3. SAVANNAH RIVER SITE TANK 48H WASTE TREATMENT PROJECT TECHNOLOGY READINESS ASSESSMENT

    SciTech Connect (OSTI)

    Harmon, Harry D.; Young, Joan K.; Berkowitz, Joan B.; Devine, John C.; Sutter, Herbert G.

    2008-10-25

    ABSTRACT One of U.S. Department of Energy’s (DOE) primary missions at Savannah River Site (SRS) is to retrieve and treat the high level waste (HLW) remaining in SRS tanks and close the F&H tank farms. At present, a significant impediment to timely completion of this mission is the presence of significant organic chemical contamination in Tank 48H. Tank 48H is a 1.3 million gallon tank with full secondary containment, located and interconnected within the SRS tank system. However, the tank has been isolated from the system and unavailable for use since 1983, because its contents – approximately 250,000 gallons of salt solution containing Cs-137 and other radioisotopes – are contaminated with nearly 22,000 Kg of tetraphenylborate, a material which can release benzene vapor to the tank head space in potentially flammable concentrations. An important element of the DOE SRS mission is to remove, process, and dispose of the contents of Tank 48H, both to eliminate the hazard it presents to the SRS H-Tank Farm and to return Tank 48H to service. Tank 48H must be returned to service to support operation of the Salt Waste Processing Facility, to free up HLW tank space, and to allow orderly tank closures per Federal Facility Agreement commitments. The Washington Savannah River Company (WSRC), the SRS prime contractor, has evaluated alternatives and selected two processes, Wet Air Oxidation (WAO) and Fluidized Steam Bed Reforming (FBSR) as candidates for Tank 48H processing. Over the past year, WSRC has been testing and evaluating these two processes, and DOE is nearing a final technology selection in late 2007. In parallel with WSRC’s ongoing work, DOE convened a team of independent qualified experts to conduct a Technology Readiness Assessment (TRA). The purpose of the TRA was to determine the maturity level of the Tank 48H treatment technology candidates – WAO and FBSR. The methodology used for this TRA is based on detailed guidance for conducting TRAs contained in the Department of Defense (DoD), Technology Readiness Assessment Deskbook. The TRA consists of three parts: • Determination of the Critical Technology Elements (CTEs) for each of the candidate processes. • Evaluation of the Technology Readiness Levels (TRLs) of each CTE for each process. • Defining of the technology testing or engineering work necessary to bring immature technologies to the appropriate maturity levels. The TRA methodology assigns a TRL to a technology based on the lowest TRL assigned to any CTE of that technology. Based on the assessment, the overall TRL for WAO was 2 and the TRL for FBSR was 3. WAO was limited by the current lack of definition for the off-gas treatment system (TRL of 2). The FBSR Product Handling had little or no test work and therefore received the lowest score (TRL of 3) for the FBSR CTEs. In summary, both FBSR and WAO appear to be viable technologies for treatment of Tank 48H legacy waste. FBSR has a higher degree of maturity than WAO, but additional technology development will be required for both technologies. However, the Assessment Team believes that sufficient information is available for DOE to select the preferred or primary technology. Limited testing of the backup technology should be conducted as a risk mitigation strategy.

  4. SAVANNAH RIVER SITE TANK 48H WASTE TREATMENT PROJECT TECHNOLOGY READINESS ASSESSMENT

    SciTech Connect (OSTI)

    Harmon, Harry D.; Young, Joan K.; Berkowitz, Joan B.; Devine, John C.; Sutter, Herbert G.

    2008-03-18

    One of U.S. Department of Energy's (DOE) primary missions at Savannah River Site (SRS) is to retrieve and treat the high level waste (HLW) remaining in SRS tanks and close the F&H tank farms. At present, a significant impediment to timely completion of this mission is the presence of significant organic chemical contamination in Tank 48H. Tank 48H is a 1.3 million gallon tank with full secondary containment, located and interconnected within the SRS tank system. However, the tank has been isolated from the system and unavailable for use since 1983, because its contents - approximately 250,000 gallons of salt solution containing Cs-137 and other radioisotopes - are contaminated with nearly 22,000 Kg of tetraphenylborate, a material which can release benzene vapor to the tank head space in potentially flammable concentrations. An important element of the DOE SRS mission is to remove, process, and dispose of the contents of Tank 48H, both to eliminate the hazard it presents to the SRS H-Tank Farm and to return Tank 48H to service. Tank 48H must be returned to service to support operation of the Salt Waste Processing Facility, to free up HLW tank space, and to allow orderly tank closures per Federal Facility Agreement commitments. The Washington Savannah River Company (WSRC), the SRS prime contractor, has evaluated alternatives and selected two processes, Wet Air Oxidation (WAO) and Fluidized Steam Bed Reforming (FBSR) as candidates for Tank 48H processing. Over the past year, WSRC has been testing and evaluating these two processes, and DOE is nearing a final technology selection in late 2007. In parallel with WSRC's ongoing work, DOE convened a team of independent qualified experts to conduct a Technology Readiness Assessment (TRA). The purpose of the TRA was to determine the maturity level of the Tank 48H treatment technology candidates - WAO and FBSR. The methodology used for this TRA is based on detailed guidance for conducting TRAs contained in the Department of Defense (DoD), Technology Readiness Assessment Deskbook. The TRA consists of three parts: (1) Determination of the Critical Technology Elements (CTEs) for each of the candidate processes. (2) Evaluation of the Technology Readiness Levels (TRLs) of each CTE for each process. (3) Defining of the technology testing or engineering work necessary to bring immature technologies to the appropriate maturity levels. The TRA methodology assigns a TRL to a technology based on the lowest TRL assigned to any CTE of that technology. Based on the assessment, the overall TRL for WAO was 2 and the TRL for FBSR was 3. WAO was limited by the current lack of definition for the off-gas treatment system (TRL of 2). The FBSR Product Handling had little or no test work and therefore received the lowest score (TRL of 3) for the FBSR CTEs. In summary, both FBSR and WAO appear to be viable technologies for treatment of Tank 48H legacy waste. FBSR has a higher degree of maturity than WAO, but additional technology development will be required for both technologies. However, the Assessment Team believes that sufficient information is available for DOE to select the preferred or primary technology. Limited testing of the backup technology should be conducted as a risk mitigation strategy.

  5. Ocean Power Technologies (TRL 5 6 System) - PB500, 500 kW Utility...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    technologiesinchart.ppt More Documents & Publications Advanced, High Power, Next Scale, Wave Energy Conversion Device Ocean Power Technologies (TRL 7 8 System) - Reedsport PB150...

  6. STANDARD OPERATING PROCEDURE FOR TUBE "A2-WetOxBond" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "A2-WetOxBond" furnace in TRL. INTRODUCTION Tube "A2-Wet. Three Eurotherm temperature controllers provide a 20 inch long, flat profile in the Center Zone resistant gloves to handle those parts PROCEDURE. 1) "ENGAGE" the machine in CORAL for TRL tube "A2-WetOxBond"machine

  7. STANDARD OPERATING PROCEDURE FOR TUBE "B3-DryOx" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "B3-DryOx" furnace in TRL. INTRODUCTION Tube "B3-Dry profile in the Center Zone; they are arranged in a master/slave configuration and the temperature profile to handle those parts PROCEDURE. 1) "ENGAGE" the machine in CORAL for TRL tube "B3-DryOx"machine, before you

  8. STANDARD OPERATING PROCEDURE FOR TUBE "A1-GateOx" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "A1-GateOx" furnace in TRL. INTRODUCTION Tube "A1-Gate. Three Eurotherm temperature controllers provide a 20 inch long, flat profile in the Center Zone the special heat resistant gloves to handle those parts PROCEDURE. 1) "ENGAGE" the machine in CORAL for TRL

  9. STANDARD OPERATING PROCEDURE FOR TUBE "B1-Au" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "B1-Au" furnace in TRL. INTRODUCTION Tube "B1-Au. Three Eurotherm temperature controllers provide a 20 inch long, flat profile in the Center Zone PROCEDURE. 1) "ENGAGE" the machine in CORAL for TRL tube "B1-Au"machine, before you start. Tube B1-Au

  10. STANDARD OPERATING PROCEDURE FOR TUBE "B2-Ox-Alloy" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "B2-Ox-Alloy" furnace in TRL. INTRODUCTION Tube "B2-Ox. Three Eurotherm temperature controllers provide a 20 inch long, flat profile in the Center Zone PROCEDURE. 1) "ENGAGE" the machine in CORAL for TRL tube "B2-Ox-Alloy"machine, before you start. Tube B2

  11. Ocean Renewable Power Co (ORPC) (TRL 7 8 System)- TidGen (TM) Power System Commercialization Project

    Broader source: Energy.gov [DOE]

    Ocean Renewable Power Co (ORPC) (TRL 7 8 System) - TidGen (TM) Power System Commercialization Project

  12. Bayer Material Science (TRL 1 2 3 System)- River Devices to Recover Energy with Advanced Materials(River DREAM)

    Broader source: Energy.gov [DOE]

    Bayer Material Science (TRL 1 2 3 System) - River Devices to Recover Energy with Advanced Materials(River DREAM)

  13. Princeton Power Systems (TRL 5 6 Component)- Marine High-Voltage Power Conditioning and Transmission System with Integrated Energy Storage

    Broader source: Energy.gov [DOE]

    Princeton Power Systems (TRL 5 6 Component) - Marine High-Voltage Power Conditioning and Transmission System with Integrated Energy Storage

  14. Free Flow Energy (TRL 1 2 3 Component) - Design and Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Free Flow Energy (TRL 1 2 3 Component) - Design and Development of a Cross-Platform Submersible Generator Optimized for the Conditions of Current Energy Conversion Free Flow Energy...

  15. Characterization, minimization and disposal of radioactive, hazardous, and mixed wastes during cleanup and rransition of the Tritium Research Laboratory (TRL) at Sandia National Laboratories/California (SNL/CA)

    SciTech Connect (OSTI)

    Garcia, T.B.; Gorman, T.P.

    1996-12-01

    This document provides an outline of waste handling practices used during the Sandia National Laboratory/California (SNL/CA), Tritium Research Laboratory (TRL) Cleanup and Transition project. Here we provide background information concerning the history of the TRL and the types of operations that generated the waste. Listed are applicable SNL/CA site-wide and TRL local waste handling related procedures. We describe personnel training practices and outline methods of handling and disposal of compactible and non-compactible low level waste, solidified waste water, hazardous wastes and mixed wastes. Waste minimization, reapplication and recycling practices are discussed. Finally, we provide a description of the process followed to remove the highly contaminated decontamination systems. This document is intended as both a historical record and as a reference to other facilities who may be involved in similar work.

  16. New Developments in the Technology Readiness Assessment Process in US DOE-EM - 13247

    SciTech Connect (OSTI)

    Krahn, Steven; Sutter, Herbert; Johnson, Hoyt

    2013-07-01

    A Technology Readiness Assessment (TRA) is a systematic, metric-based process and accompanying report that evaluates the maturity of the technologies used in systems; it is designed to measure technology maturity using the Technology Readiness Level (TRL) scale pioneered by the National Aeronautics and Space Administration (NASA) in the 1980's. More recently, DoD has adopted and provided systematic guidance for performing TRAs and determining TRLs. In 2007 the GAO recommended that the DOE adopt the NASA/DoD methodology for evaluating technology maturity. Earlier, in 2006-2007, DOE-EM had conducted pilot TRAs on a number of projects at Hanford and Savannah River. In March 2008, DOE-EM issued a process guide, which established TRAs as an integral part of DOE-EM's Project Management Critical Decision Process. Since the development of its detailed TRA guidance in 2008, DOE-EM has continued to accumulate experience in the conduct of TRAs and the process for evaluating technology maturity. DOE has developed guidance on TRAs applicable department-wide. DOE-EM's experience with the TRA process, the evaluations that led to recently developed proposed revisions to the DOE-EM TRA/TMP Guide; the content of the proposed changes that incorporate the above lessons learned and insights are described. (authors)

  17. System Verification Through Reliability, Availability, Maintainability (RAM) Analysis & Technology Readiness Levels (TRLs)

    SciTech Connect (OSTI)

    Emmanuel Ohene Opare, Jr.; Charles V. Park

    2011-06-01

    The Next Generation Nuclear Plant (NGNP) Project, managed by the Idaho National Laboratory (INL), is authored by the Energy Policy Act of 2005, to research, develop, design, construct, and operate a prototype fourth generation nuclear reactor to meet the needs of the 21st Century. A section in this document proposes that the NGNP will provide heat for process heat applications. As with all large projects developing and deploying new technologies, the NGNP is expected to meet high performance and availability targets relative to current state of the art systems and technology. One requirement for the NGNP is to provide heat for the generation of hydrogen for large scale productions and this process heat application is required to be at least 90% or more available relative to other technologies currently on the market. To reach this goal, a RAM Roadmap was developed highlighting the actions to be taken to ensure that various milestones in system development and maturation concurrently meet required availability requirements. Integral to the RAM Roadmap was the use of a RAM analytical/simulation tool which was used to estimate the availability of the system when deployed based on current design configuration and the maturation level of the system.

  18. STANDARD OPERATING PROCEDURE FOR TUBE "A4-Polyiamide" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "A4-Polyiamide" furnace in TRL. INTRODUCTION Tube "A4. Three Eurotherm temperature controllers provide a 20 inch long, flat profile in the Center Zone. Use the special heat resistant gloves to handle those parts PROCEDURE. 1) "ENGAGE" the machine

  19. STANDARD OPERATING PROCEDURE FOR TUBE "A3-Sinter" furnace in TRL.

    E-Print Network [OSTI]

    Reif, Rafael

    STANDARD OPERATING PROCEDURE FOR TUBE "A3-Sinter" furnace in TRL. INTRODUCTION Tube "A3-Sinter which is a mixture of Hydrogen and Nitrogen. The tube is a CMOS machine. The system is operated in manual mode. Three Eurotherm temperature controllers provide a 20 inch long, flat profile in the Center

  20. Zero Energy Ready Home | Department of Energy

    Office of Environmental Management (EM)

    Home Zero Energy Ready Home Look for the Label Look for the Label The DOE Zero Energy Ready Home label is a symbol of excellence. Learn what's behind this new level of performance....

  1. Summary - Savannah River Site Tank 48H Waste Treatment Project

    Office of Environmental Management (EM)

    and t ess Level (TRL) on Process: stem (TRL3) atment System RA reports, please v govPagesExternal nology Readiness A ng a systematic, me er SiteSRS H Waste Treatm nt of...

  2. US Synthetic Corp (TRL 4 Component)- The Development of Open, Water Lubricated Polycrystalline Diamond Thrust Bearings for use in Marine Hydrokinetic (MHK) Energy Machines

    Broader source: Energy.gov [DOE]

    US Synthetic Corp (TRL 4 Component) - The Development of Open, Water Lubricated Polycrystalline Diamond Thrust Bearings for use in Marine Hydrokinetic (MHK) Energy Machines

  3. Readiness Review Training- Member

    Office of Energy Efficiency and Renewable Energy (EERE)

    Slides used for November 10, 2010 Readiness Review Member Training at the Idaho National Laboratory. Course provides tools and tips to be an effective readiness review team member.

  4. Ready, set...go!

    SciTech Connect (OSTI)

    Alexandre, Melanie

    2010-06-16

    The objectives of this paper are: (1) Discuss organizational readiness for changes in an ergonomics program or intervention; (2) Assessing organizational readiness; (3) Benefits and challenges of change; and (4) Case studies of ergonomic programs that were 'not ready' and 'ready'.

  5. Readiness Review RM

    Office of Environmental Management (EM)

    the progress of tasks needed to attain operational readiness, conducting practice drills and evolutions, maintaining and reviewing evidence files, reviewing corrective...

  6. Technology Readiness Assessment Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-09-15

    The Guide assists individuals and teams involved in conducting Technology Readiness Assessments (TRAs) and developing Technology Maturation Plans (TMPs) for the DOE capital asset projects subject to DOE O 413.3B. Supersedes DOE G 413.3-4.

  7. Emergency Readiness Assurance Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1992-02-27

    To establish the requirements of the Emergency Readiness Assurance Program with a goal of assurting that the Department of Energy (DOE) Emergency Management System (EMS) is ready to respond promptly, efficiently, and effectively to any emergency involving DOE facilities or requiring DOE assistance. Cancels DOE O 5500.10 dated 4-30-91. Chg 1 dated 2-27-92. Change 1 canceled by DOE O 151.1 of 9-25-95.

  8. Readiness Review Training- Team Leader

    Office of Energy Efficiency and Renewable Energy (EERE)

    Slides used for November 10, 2010 Readiness Review Team Leader Training at the Idaho National Laboratory. Course provides tools and tips to be an effective readiness review team leader.

  9. Technology Readiness and the Smart Grid

    SciTech Connect (OSTI)

    Kirkham, Harold; Marinovici, Maria C.

    2013-02-27

    Technology Readiness Levels (TRLs) originated as a way for the National Aeronautics and Space Administration (NASA) to monitor the development of systems being readied for space. The technique has found wide application as part of the more general topic of system engineering. In this paper, we consider the applicability of TRLs to systems being readied for the smart grid. We find that there are many useful parallels, and much to be gained by this application. However, TRLs were designed for a developer who was also a user. That is not usually the case for smart grid developments. We consider the matter from the point of view of the company responsible for implementation, typically a utility, and we find that there is a need for connecting the many standards in the industry. That connection is explored, and some new considerations are introduced.

  10. Ready, set, go . . . well maybe

    SciTech Connect (OSTI)

    Alexandre, Melanie M; Bartolome, Terri-Lynn C

    2011-02-28

    The agenda for this presentation is: (1) understand organizational readiness for changes; (2) review benefits and challenges of change; (3) share case studies of ergonomic programs that were 'not ready' and some that were 'ready'; and (4) provide some ideas for facilitating change.

  11. DOE Zero Energy Ready Home Solar Hot Water-Ready Checklist

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Zero Energy Ready Home Solar Hot Water-Ready Checklist (Encouraged) DOE Zero Energy Ready Home National Program encourages, but does not require, consideration of this checklist....

  12. Ready, set, go . . . well maybe

    E-Print Network [OSTI]

    Alexandre, Melanie M

    2011-01-01

    at the 2011 Applied Ergonomics Conference By Melaniesustainable? Case study of ergonomics program that was ‘ notwas not! Case study of ergonomics program that was ‘ready

  13. ARM - Ingest Readiness Form

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Comments? WeDatastreamstps DocumentationAtlanticENAField ParticipantsFieldFormsIngest Readiness Form Ingest Ingest

  14. Richmond Electric Vehicle Initiative Electric Vehicle Readiness...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Richmond Electric Vehicle Initiative Electric Vehicle Readiness Plan Richmond Electric Vehicle Initiative Electric Vehicle Readiness Plan The REVi plan addresses the electric...

  15. AMO Requests Technical Topics Suitable for a Manufacturing Innovation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Institute April 17, 2014 - 12:23pm Addthis The Advanced Manufacturing Office (AMO) seeks information on mid-Technology Readiness Level (TRL) research and development (R&D) needs,...

  16. Webinar: Ventilation and Filtration Strategies with Indoor airPLUS and Zero Energy Ready Homes

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy Zero Energy Ready Home (ZERH) Program represents a whole new level of home performance, with rigorous requirements that ensure outstanding levels of energy savings,...

  17. DOE Zero Energy Ready Home: Durable Energy Builders, Houston...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOE Zero Energy Ready Home: Durable Energy Builders, Houston, Texas DOE Zero Energy Ready Home: Durable Energy Builders, Houston, Texas This DOE Zero Energy Ready Home features...

  18. Implementation plan for WRAP Module 1 operational readiness review

    SciTech Connect (OSTI)

    Irons, L.G.

    1994-11-04

    The Waste Receiving and Processing Module 1 (WRAP 1) will be used to receive, sample, treat, and ship contact-handled (CH) transuranic (TRU), low-level waste (LLW), and low-level mixed waste (LLMW) to storage and disposal sites both on the Hanford site and off-site. The primary mission of WRAP 1 is to characterize and certify CH waste in 55-gallon and 85-gallon drums; and its secondary function is to certify CH waste standard waste boxes (SWB) and boxes of similar size for disposal. The WRAP 1 will provide the capability for examination (including x-ray, visual, and contents sampling), limited treatment, repackaging, and certification of CH suspect-TRU waste in 55-gallon drums retrieved from storage, as well as newly generated CH LLW and CH TRU waste drums. The WRAP 1 will also provide examination (X-ray and visual only) and certification of CH LLW and CH TRU waste in small boxes. The decision to perform an Operational Readiness Review (ORR) was made in accordance with WHC-CM-5-34, Solid Waste Disposal Operations Administration, Section 1.4, Operational Readiness Activities. The ORR will ensure plant and equipment readiness, management and personnel readiness, and management programs readiness for the initial startup of the facility. This implementation plan is provided for defining the conduct of the WHC ORR.

  19. Mission and Readiness Assessment for Fusion Nuclear Facilities

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory 20th ANS Topical Meeting on the Technology of Fusion Energy Nashville, TN U.S.A. 28 August 2012 #12;Background and Motivation 2 · Increased attention to DEMO planning") ­ ReNeW 2009 ­ Technology Readiness Levels application (Tillack, et al., FS&T 2009) ­ FNS Pathways

  20. Early Childhood Education and School Readiness: Conceptual

    E-Print Network [OSTI]

    Rau, Don C.

    Early Childhood Education and School Readiness: Conceptual Models, Constructs, and Measures and Evaluation. #12;Early Childhood Education and School Readiness Workshop, June 17-18, 2002 TABLE OF CONTENTS .................................................................................................................................................13 Language and Early Literacy

  1. Weather Ready Nation: A Vital Conversation on

    E-Print Network [OSTI]

    Weather Ready Nation: A Vital Conversation on Tornadoes and Severe Weather A Community Report March;WeatherReady Nation: A Vital Conversation on Tornadoes and Severe Weather Report from the December 2011

  2. EM Performs Tenth Technology Readiness Assessment

    Broader source: Energy.gov [DOE]

    WASHINGTON, D.C. – EM recently completed its tenth Technology Readiness Assessment (TRA) since piloting the TRA process in 2006.

  3. Solar Ready: An Overview of Implementation Practices

    SciTech Connect (OSTI)

    Watson, A.; Guidice, L.; Lisell, L.; Doris, L.; Busche, S.

    2012-01-01

    This report explores three mechanisms for encouraging solar ready building design and construction: solar ready legislation, certification programs for solar ready design and construction, and stakeholder education. These methods are not mutually exclusive, and all, if implemented well, could contribute to more solar ready construction. Solar ready itself does not reduce energy use or create clean energy. Nevertheless, solar ready building practices are needed to reach the full potential of solar deployment. Without forethought on incorporating solar into design, buildings may be incompatible with solar due to roof structure or excessive shading. In these cases, retrofitting the roof or removing shading elements is cost prohibitive. Furthermore, higher up-front costs due to structural adaptations and production losses caused by less than optimal roof orientation, roof equipment, or shading will lengthen payback periods, making solar more expensive. With millions of new buildings constructed each year in the United States, solar ready can remove installation barriers and increase the potential for widespread solar adoption. There are many approaches to promoting solar ready, including solar ready legislation, certification programs, and education of stakeholders. Federal, state, and local governments have the potential to implement programs that encourage solar ready and in turn reduce barriers to solar deployment. With the guidance in this document and the examples of jurisdictions and organizations already working to promote solar ready building practices, federal, state, and local governments can guide the market toward solar ready implementation.

  4. HIA 2015 DOE Zero Energy Ready Home Case Study: Greenhill Contracting...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Green Acres 20, 26, 28 New Paltz, NY DOE ZERO ENERGY READY HOME(tm) The U.S. Department of Energy invites home builders across the country to meet the extraordinary levels of...

  5. Mission and Readiness Assessment for Fusion Nuclear Facilities

    SciTech Connect (OSTI)

    G.H. Neilson, et. al.

    2012-12-12

    Magnetic fusion development toward DEMO will most likely require a number of fusion nuclear facilities (FNF), intermediate between ITER and DEMO, to test and validate plasma and nuclear technologies and to advance the level of system integration. The FNF mission space is wide, ranging from basic materials research to net electricity demonstration, so there is correspondingly a choice among machine options, scope, and risk in planning such a step. Readiness requirements to proceed with a DEMO are examined, and two FNF options are assessed in terms of the contributions they would make to closing DEMO readiness gaps, and their readiness to themselves proceed with engineering design about ten years from now. An advanced tokamak (AT) pilot plant with superconducting coils and a mission to demonstrate net electricity generation would go a long way toward DEMO. As a next step, however, a pilot plant would entail greater risk than a copper-coil FNSF-AT with its more focussed mission and technology requirements. The stellarator path to DEMO is briefly discussed. Regardless of the choice of FNF option, an accompanying science and technology development program, also aimed at DEMO readiness, is absolutely essential.

  6. Technology Readiness Assessments | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    August 1, 2013 Technology Readiness Assessment (TRA)Technology Maturation Plan (TMP) Process Guide This document is a guide for those involved in conducting TRAs and developing...

  7. Internship Checklist Ready Reference C-3

    E-Print Network [OSTI]

    Internship Checklist Ready Reference C-3 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  8. Cover Letter Formula Ready Reference F-3

    E-Print Network [OSTI]

    Cover Letter Formula Ready Reference F-3 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  9. Letter of Refusal Ready Reference F-8

    E-Print Network [OSTI]

    Letter of Refusal Ready Reference F-8 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology Career

  10. Sample Withdrawal Letter Ready Reference F-11

    E-Print Network [OSTI]

    Sample Withdrawal Letter Ready Reference F-11 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  11. Sample Application Letter Ready Reference F-5

    E-Print Network [OSTI]

    Sample Application Letter Ready Reference F-5 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  12. Sample Networking Letter Ready Reference F-6

    E-Print Network [OSTI]

    Sample Networking Letter Ready Reference F-6 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  13. Sample Acceptance Letter Ready Reference F-10

    E-Print Network [OSTI]

    Sample Acceptance Letter Ready Reference F-10 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  14. Job Search Steps Ready Reference D-1

    E-Print Network [OSTI]

    Job Search Steps Ready Reference D-1 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  15. Preparing A Vita Ready Reference E-13

    E-Print Network [OSTI]

    Preparing A Vita Ready Reference E-13 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office

  16. Hydrogen Infrastructure Market Readiness: Opportunities and Potential...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Opportunities and Potential for Near-term Cost Reductions. Proceedings of the Hydrogen Infrastructure Market Readiness Workshop and Summary of Feedback Provided through the...

  17. Community Readiness Assessments | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Community Readiness Assessments, Call Slides and Discussion Summary, December 5, 2013. Call Slides and Discussion Summary More Documents & Publications Focus Series: Program Finds...

  18. Organizational Readiness in Specialty Mental Health Care

    E-Print Network [OSTI]

    Hamilton, Alison B.; Cohen, Amy N.; Young, Alexander S.

    2010-01-01

    readiness for change (ORC) measure, and key stake- holders43 clinical staff completed the ORC, and 38 key stakeholdersdeviations (SDs) of the ORC scores are also illuminating in

  19. ORISE: Asset Readiness Management System (ARMS)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Asset Readiness Management System (ARMS) Database tracks emergency response exercises and equipment to help DOE asses emergency preparedness Developed by the Oak Ridge Institute...

  20. Building a Weather-Ready Nation noaa.gov/wrn Weather-Ready Nation &

    E-Print Network [OSTI]

    Building a Weather-Ready Nation noaa.gov/wrn Welcome Weather-Ready Nation & America's PrepareAthon! Webinar April 1, 2015 "Whole Community Approach to Building National Resilience " #12;Building a Weather-Ready Nation A word from... noaa.gov/wrn Dr. Kathryn Sullivan NOAA Administrator #12;Building a Weather

  1. ZERH Webinar: Selling Zero Energy Ready Homes Made Easy: Tools...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ZERH Webinar: Selling Zero Energy Ready Homes Made Easy: Tools and Resources that Work ZERH Webinar: Selling Zero Energy Ready Homes Made Easy: Tools and Resources that Work...

  2. Designing and Building Houses that are Solar Ready | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    after initial construction is completed can save time and money by following new house Solar Ready design guidelines. Solar Ready houses are designed and built with integrated...

  3. DOE Zero Energy Ready Home National Program Requirements (Rev...

    Broader source: Energy.gov (indexed) [DOE]

    4) DOE Zero Energy Ready Home National Program Requirements Rev04.pdf More Documents & Publications DOE Zero Energy Ready Home National Program Requirements (Rev. 05) California...

  4. DOE Zero Energy Ready Home Case Study: Greenhill Contracting...

    Energy Savers [EERE]

    Zero Energy Ready Home Case Study: Greenhill Contracting, Green Acres 20, 26, 28, New Paltz, NY DOE Zero Energy Ready Home Case Study: Greenhill Contracting, Green Acres 20,...

  5. Energy -- and Water -- Efficiency in the DOE Zero Energy Ready...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy -- and Water -- Efficiency in the DOE Zero Energy Ready Home Program Webinar (Text Version) Energy -- and Water -- Efficiency in the DOE Zero Energy Ready Home Program...

  6. Preliminary Technology Readiness Assessment (TRA) for the Calcine...

    Office of Environmental Management (EM)

    Preliminary Technology Readiness Assessment (TRA) for the Calcine Disposition Project Volume 1 (CDP) Preliminary Technology Readiness Assessment (TRA) for the Calcine Disposition...

  7. DOE Zero Energy Ready Home Case Study: Mandalay Homes, Prescott...

    Energy Savers [EERE]

    Homes, Prescott Valley, AZ DOE Zero Energy Ready Home Case Study: Mandalay Homes, Phoenix, AZ, Affordable DOE Zero Energy Ready Home Case Study: Mandalay Homes, Prescott...

  8. Advancing Technology Readiness: Wave Energy Testing and Demonstration...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advancing Technology Readiness: Wave Energy Testing and Demonstration Advancing Technology Readiness: Wave Energy Testing and Demonstration March 6, 2014 - 1:23pm Addthis Northwest...

  9. Energy Department Emergency Response Team Ready to Respond to...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Emergency Response Team Ready to Respond to Hurricane Irene Energy Department Emergency Response Team Ready to Respond to Hurricane Irene August 26, 2011 - 12:15pm Addthis...

  10. Roundtable on Sustainable Biofuels Certification Readiness Study

    E-Print Network [OSTI]

    Roundtable on Sustainable Biofuels Certification Readiness Study: Hawai`i Biofuel Projects Prepared 12.1 Deliverable Bioenergy Analyses Prepared by Hawai`i Biofuel Foundation And NCSI Americas Inc agency thereof. #12;1 RSB Certification Readiness Study: Hawaii Biofuel Projects Prepared For Hawaii

  11. Lightning Arrestor Connectors Production Readiness

    SciTech Connect (OSTI)

    Marten, Steve; Linder, Kim; Emmons, Jim; Gomez, Antonio; Hasam, Dawud; Maurer, Michelle

    2008-10-20

    The Lightning Arrestor Connector (LAC), part “M”, presented opportunities to improve the processes used to fabricate LACs. The A## LACs were the first production LACs produced at the KCP, after the product was transferred from Pinnellas. The new LAC relied on the lessons learned from the A## LACs; however, additional improvements were needed to meet the required budget, yield, and schedule requirements. Improvement projects completed since 2001 include Hermetic Connector Sealing Improvement, Contact Assembly molding Improvement, development of a second vendor for LAC shells, general process improvement, tooling improvement, reduction of the LAC production cycle time, and documention of the LAC granule fabrication process. This report summarizes the accomplishments achieved in improving the LAC Production Readiness.

  12. Salary Negotiation Ready ReferenceH-3

    E-Print Network [OSTI]

    Salary Negotiation Ready ReferenceH-3 College of Engineering, Architecture & Technology Career" salary on the top end of your range. Although this range may appear high because it is created from

  13. Writing Career Objectives Ready Reference E-5

    E-Print Network [OSTI]

    Writing Career Objectives Ready Reference E-5 College of Engineering, Architecture & Technology in pharmaceutical research" #12;Oklahoma State University College of Engineering, Architecture & Technology Career your practical skills. Examples: -"A position in a large, high tech organization requiring network

  14. Superconducting Partnership with Readiness Review Update

    E-Print Network [OSTI]

    1 Superconducting Partnership with Industry: Readiness Review Update Mike Gouge, ORNL Steve Ashworth, LANL Paul Bakke, DOE-Golden DOE 2004 Superconductivity Peer Review July 27-29, 2004 #12;2 SPI

  15. Modeling Renewable Energy Readiness: The UAE Context

    E-Print Network [OSTI]

    Choucri, Nazli

    Modeling technology policy is becoming an increasingly important capability to steer states and societies toward sustainability. This paper presents a simulation-modeling approach to evaluate renewable energy readiness, ...

  16. Zero Energy Ready Home | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    2-story, 1,650-ft2 cabin built by a custom home builder for his own family meets Passive House Standards with 5.5-in. ZERH Events ZERH Webinar: Selling Zero Energy Ready Homes...

  17. IsYour Network Cloud Ready? Network EnableYour Cloud With MPLSVPNs

    E-Print Network [OSTI]

    Greenberg, Albert

    -enabled cloud that is highly-secure and reliable. It is critical for enterprises to evaluate a network, but the high level of shared infrastructure creates concerns about security risks.As a result, the public cloudIsYour Network Cloud Ready? Network EnableYour Cloud With MPLSVPNs A FROST & SULLIVAN EXECUTIVE

  18. DOE Zero Energy Ready Home Newsletter February 2015 | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Zero Energy Ready Home Newsletter February 2015 DOE Zero Energy Ready Home Newsletter February 2015 Table of Contents A note from Sam Rashkin: "If you don't tell your story, you...

  19. ZERH Webinar: Sales and Value Recognition of Zero Energy Ready...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ZERH Webinar: Sales and Value Recognition of Zero Energy Ready Homes ZERH Webinar: Sales and Value Recognition of Zero Energy Ready Homes December 18, 2014 12:00PM to 1:15PM EST...

  20. Solar Ready Vets: Preparing Our Veterans to Join the Growing...

    Office of Environmental Management (EM)

    Solar Ready Vets: Preparing Our Veterans to Join the Growing Solar Workforce Solar Ready Vets: Preparing Our Veterans to Join the Growing Solar Workforce April 6, 2015 - 2:27pm...

  1. An assessment of the value of retail ready packaging

    E-Print Network [OSTI]

    Jackson, Kathleen Anne

    2008-01-01

    Use of retail-ready packaging reduces the costs of replenishing store shelves by eliminating the labor of removing packaging materials and stocking individual items on shelves. While reducing costs for retailers, retail-ready ...

  2. University of Michigan Gets Offshore Wind Ready for Winter on...

    Office of Environmental Management (EM)

    University of Michigan Gets Offshore Wind Ready for Winter on Lake Michigan University of Michigan Gets Offshore Wind Ready for Winter on Lake Michigan April 16, 2013 - 12:00am...

  3. Building America Top Innovations 2013 Profile - Zero Energy-Ready...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Building America Top Innovations 2013 Profile - Zero Energy-Ready Single-Family Homes Building America Top Innovations 2013 Profile - Zero Energy-Ready Single-Family Homes Many...

  4. Building America Top Innovations 2013 Profile - Zero Energy-Ready...

    Energy Savers [EERE]

    Top Innovations 2013 Profile - Zero Energy-Ready Single-Family Homes Building America Top Innovations 2013 Profile - Zero Energy-Ready Single-Family Homes Many Building America...

  5. DOE Zero Energy Ready Home Case Study: Green Extreme Homes &...

    Energy Savers [EERE]

    Green Extreme Homes & Carl Franklin Homes, Garland, TX DOE Zero Energy Ready Home Case Study: Green Extreme Homes & Carl Franklin Homes, Garland, TX DOE Zero Energy Ready Home Case...

  6. Building America Zero Energy Ready Home Case Study: Imery Group...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Zero Energy Ready Home Case Study: Imery Group, Proud Green Home, Serenbe GA Building America Zero Energy Ready Home Case Study: Imery Group, Proud Green Home, Serenbe GA Case...

  7. Energy Efficiency First, Zero Energy Ready Homes, and Solar PV...

    Office of Environmental Management (EM)

    Energy Efficiency First, Zero Energy Ready Homes, and Solar PV Updates Energy Efficiency First, Zero Energy Ready Homes, and Solar PV Updates April 29, 2015 11:00AM to 12:30PM MDT...

  8. DOE Zero Energy Ready Home Partner Central | Department of Energy

    Office of Environmental Management (EM)

    Central DOE Zero Energy Ready Home Partner Central The DOE Zero Energy Ready Home label is the symbol of excellence for new homes. Join the ranks of leading edge builders who...

  9. ENERGY STAR Webinar: Zero Energy Ready Home Program

    Broader source: Energy.gov [DOE]

    Once a home is as good as ENERGY STAR, the modest added “lift” to bring a home up to DOE’s Zero Energy Ready specs unleashes a wave of powerful value messages.  DOE Zero Energy Ready Homes live...

  10. NHI Component Technical Readiness Evaluation System

    SciTech Connect (OSTI)

    Steven R. Sherman; Dane F. Wilson; Steven J. Pawel

    2007-09-01

    A decision process for evaluating the technical readiness or maturity of components (i.e., heat exchangers, chemical reactors, valves, etc.) for use by the U.S. DOE Nuclear Hydrogen Initiative is described. This system is used by the DOE NHI to assess individual components in relation to their readiness for pilot-scale and larger-scale deployment and to drive the research and development work needed to attain technical maturity. A description of the evaluation system is provided, and examples are given to illustrate how it is used to assist in component R&D decisions.

  11. Fast Track Troubleshooting Using the SMART BoardTM 600 Series Interactive Whiteboard's Ready Light

    E-Print Network [OSTI]

    Matrajt, Graciela

    Fast Track Troubleshooting Using the SMART BoardTM 600 Series Interactive Whiteboard's Ready Light Start Is the Ready light on? Is the Ready light red or alternating red/green? Is the Ready light flashing green? Is the Ready light solid green? Is the Ready light amber? No Yes No No No Go to Flowchart 2

  12. Building a Weather-Ready Nation Fall Weather Safety

    E-Print Network [OSTI]

    Building a Weather-Ready Nation Fall Weather Safety www.weather.gov/safety Wildfire ­ Drought ­ Hurricanes ­ Wind ­ Early Season Winter ­ Flood #12;Building a Weather-Ready Nation Wildfire Safety smoking materials. weather.gov/wildfire www.weather.gov/safety #12;Building a Weather-Ready Nation

  13. Professional References Ready Reference E-11

    E-Print Network [OSTI]

    Professional References Ready Reference E-11 College of Engineering, Architecture & Technology College of Engineering, Architecture & Technology Career Services Office ATRC 109E Stillwater, OK 74078 requested to do so. Create a separate sheet entitled "References." Print it on the same high quality papers

  14. The Behavioral Interview Ready Reference G-7

    E-Print Network [OSTI]

    The Behavioral Interview Ready Reference G-7 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology in technical and high tech industries within the last 10 years. Behavioral interviews are designed to focus

  15. Questioning Yourself Ready Reference B-2

    E-Print Network [OSTI]

    Questioning Yourself Ready Reference B-2 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career Services Office set my own hours? Do I thrive in a high-stress atmosphere, or would I prefer something a bit more

  16. Roundtable on Sustainable Biofuels Certification Readiness Study

    E-Print Network [OSTI]

    Roundtable on Sustainable Biofuels Certification Readiness Study: Hawai`i Biofuel Projects Prepared 12.1 Deliverable (item 2) Bioenergy Analyses Prepared by Hawai`i Biofuel Foundation And NCSI Americas: Hawaii Biofuel Projects Prepared For Hawaii Natural Energy Institute School of Ocean Earth Sciences

  17. Human Resources Organizational Readiness Project: An Overview

    E-Print Network [OSTI]

    Finzi, Adrien

    and easily interface with SAP software Managed by a special Human Resources project team Will be undertaken in close coordination with the BUworks program team HR Organizational Readiness Project BUworks / SAP of SAP Enhanced data security within the new system Current job "system" is 30 years old ­ it must

  18. CRAD, Facility Safety- Readiness Review Program

    Office of Energy Efficiency and Renewable Energy (EERE)

    A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) that can be used for assessment of a contractor's Readiness Review Program.

  19. Property:Technology Readiness Level | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report Url Jump

  20. Marine and Hydrokinetic Technology Readiness Level | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios TowardsInformationMarietta, Georgia:Marine MammalMarine

  1. NGNP Infrastructure Readiness Assessment: Consolidation Report

    SciTech Connect (OSTI)

    Brian K Castle

    2011-02-01

    The Next Generation Nuclear Plant (NGNP) project supports the development, demonstration, and deployment of high temperature gas-cooled reactors (HTGRs). The NGNP project is being reviewed by the Nuclear Energy Advisory Council (NEAC) to provide input to the DOE, who will make a recommendation to the Secretary of Energy, whether or not to continue with Phase 2 of the NGNP project. The NEAC review will be based on, in part, the infrastructure readiness assessment, which is an assessment of industry's current ability to provide specified components for the FOAK NGNP, meet quality assurance requirements, transport components, have the necessary workforce in place, and have the necessary construction capabilities. AREVA and Westinghouse were contracted to perform independent assessments of industry's capabilities because of their experience with nuclear supply chains, which is a result of their experiences with the EPR and AP-1000 reactors. Both vendors produced infrastructure readiness assessment reports that identified key components and categorized these components into three groups based on their ability to be deployed in the FOAK plant. The NGNP project has several programs that are developing key components and capabilities. For these components, the NGNP project have provided input to properly assess the infrastructure readiness for these components.

  2. An Approach to Technology Risk Management Ricardo Valerdi

    E-Print Network [OSTI]

    de Weck, Olivier L.

    in parametric cost estimation models. Introduction The rapid change of Information Technology has madeAn Approach to Technology Risk Management Ricardo Valerdi USC Center for Software Engineering 941 W Symposium MIT, Cambridge, MA, March 29-31, 2004 ABSTRACT NASA's Technology Readiness Levels (TRL) approach

  3. Technology Readiness Assessment (TRA)/Technology Maturation Plan...

    Energy Savers [EERE]

    (TRA)Technology Maturation Plan (TMP) Process Guide Technology Readiness Assessment (TRA)Technology Maturation Plan (TMP) Process Guide This document is a guide for those...

  4. Marketing and Sales Solutions for Zero Energy Ready Homes Webinar...

    Broader source: Energy.gov (indexed) [DOE]

    Below is the text version of the webinar, Marketing and Sales Solutions for Zero Energy Ready Homes, presented in June 2014. Lindsay Parker: ... the Department of Energy Zero...

  5. DOE Zero Energy Ready Home Second Production Builder Round Table

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Solidify the Zero Energy Ready definition DOE will continue participating in the Net-Zero Energy coalition to secure a definition with all stakeholders. Expand DOE Challenge...

  6. Ten Steps for Career Success Ready Reference A-4

    E-Print Network [OSTI]

    Ten Steps for Career Success Ready Reference A-4 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career

  7. Sample Letter of Inquiry Ready Reference F-4

    E-Print Network [OSTI]

    Sample Letter of Inquiry Ready Reference F-4 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of Engineering, Architecture & Technology Career

  8. First Impressions on Job Interviews Ready Reference G-2

    E-Print Network [OSTI]

    & Technology Career Services Oklahoma State University College of Engineering, Architecture & TechnologyFirst Impressions on Job Interviews Ready Reference G-2 College of Engineering, Architecture

  9. Sample Status Inquiry Letter Ready Reference F-9

    E-Print Network [OSTI]

    Sample Status Inquiry Letter Ready Reference F-9 College of Engineering, Architecture & Technology Career Services Oklahoma State University College of College of Engineering, Architecture & Technology

  10. DOE Zero Energy Ready Home Webinar: Building Energy Optimization...

    Energy Savers [EERE]

    Webinar: Building Energy Optimization (BEopt) Software DOE Zero Energy Ready Home Webinar: Building Energy Optimization (BEopt) Software This webinar was presented on May 15, 2014...

  11. Smart-Grid Ready PV Inverter with Utility Communication

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    standards, operations center visibility and management, and optimized coordination of smart PV inverters with existing distribution control devices. Smart-Grid Ready PV Inverter...

  12. Smart-Grid Ready PV Inverters with Utility Communication

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    INTEGRATION Smart-Grid Ready PV Inverters with Utility Communication Electric Power Research Institute Brian Seal, Tom Key, Aminul Huque, Lindsey Rogers Technical Contact Brian...

  13. Module Embedded Microninverter Smart Grid Ready Residential Solar...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    including VoltVAR support Module Embedded Microninverter Smart Grid Ready Residential Solar Electric System RUI ZHOU GE GLOBAL RESEARCH Develop and demonstrate power electronics...

  14. DOE Zero Energy Ready Home: Lighting Efficiency Webinar (Text...

    Broader source: Energy.gov (indexed) [DOE]

    webinar, DOE Zero Energy Ready Home: Lighting Efficiency, presented in May 2015. Alex Krowka: Presentation cover slide: ... join us today for this session on LED lighting design...

  15. Readiness Review Training- Development of Criteria And Review Approach Documents

    Broader source: Energy.gov [DOE]

    Slides used for November 8-9, 2010 Readiness Review Training - Development of Criteria And Review Approach Documents at the Idaho National Laboratory.

  16. DOE Zero Energy Ready Home National Program Requirements (Rev...

    Broader source: Energy.gov (indexed) [DOE]

    5), May, 11, 2015. DOE Zero Energy Ready Home National Program Requirements Rev05 - Final.pdf More Documents & Publications California DOE ZERH Program Requiremets DOE Zero Energy...

  17. DOE ZERO ENERGY READY HOME UPDATE NEWSLETTER APRIL 2015 | Department...

    Broader source: Energy.gov (indexed) [DOE]

    Awards: Lasting Legacies ZERH Update July 2015.pdf More Documents & Publications DOE ZERO ENERGY READY HOME UPDATE NEWSLETTER MAY 2015 Building America Building Science Translator...

  18. DOE Zero Energy Ready Home Case Study: Transformation Inc., Production...

    Energy Savers [EERE]

    spray foam on basement walls, triple-pane windows, and one mini-split ductless heat pump. BAZeroEnergyReadyTransformationProduction062414.pdf More Documents &...

  19. Accelerating the Electrification of U.S. Drive Trains: Ready...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Trains: Ready and Affordable Technology Solutions for Domestically Manufactured Advanced Batteries 2010 DOE Vehicle Technologies and Hydrogen Programs Annual Merit Review and Peer...

  20. Accelerating the Electrification of U.S. Drive Trains: Ready...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ready and Affordable Technology Solutions for Domestically Manufactured Advanced Batteries Larry Atkins Exide Technologies June 7, 2010 Project ID ARRAVT004 This...

  1. ZERH Webinar: Selling Zero Energy Ready Homes Made Easy: Tools...

    Broader source: Energy.gov (indexed) [DOE]

    been watching closely, the Zero Energy Ready Home now has an impressive array of tools that can help builder partners effectively communicate the value of their certified...

  2. DOE Zero Energy Ready Home Resources | Department of Energy

    Office of Environmental Management (EM)

    look up their case studies in the Building America Program Publication and Product Library, or search the Building America Solution Center. DOE Zero Energy Ready Home Sales and...

  3. Independent Oversight Review of the NNSA Production Office Readiness...

    Energy Savers [EERE]

    Independent Oversight Review of the NNSA Production Office Readiness Review Program February 2014 Office of Safety and Emergency Management Evaluations Office of Enforcement and...

  4. Using ReadyTalk Teleconference Service (Audio and Web) Summary: Learn how to sign up for ReadyTalk teleconference service and how to set up a

    E-Print Network [OSTI]

    Alvarez-Cohen, Lisa

    Using ReadyTalk Teleconference Service (Audio and Web) Summary: Learn how to sign up for Ready guides. Services tab: #12; Brief descriptions of ReadyTalk's services. Note that prices on the Web siteTalk teleconference service and how to set up a conference call using ReadyTalk. Note: UC has signed a system

  5. Community Readiness Assessments | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p aDepartment ofCommercial Grade DedicationaOfficeto theifReadiness

  6. Readiness Review RM | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuildingBudget ||Department ofRequest7ofPlanEO-05-01:NationalReadiness

  7. ORISE: Asset Readiness Management System (ARMS)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesseworkSURVEY UNIVERSE The 2014 surveyNuclearHowAsset Readiness Management

  8. Capture-ready power plants : options, technologies and economics

    E-Print Network [OSTI]

    Bohm, Mark (Mark C.)

    2006-01-01

    A plant can be considered to be capture-ready if, at some point in the future it can be retrofitted for carbon capture and sequestration and still be economical to operate. The concept of capture-ready is not a specific ...

  9. Building a Weather-Ready Nation Winter Weather Safety

    E-Print Network [OSTI]

    Building a Weather-Ready Nation Winter Weather Safety NOAA/NWS Winter Weather Safety Seasonal Campaign www.weather.gov #12;Building a Weather-Ready Nation Winter Weather Hazards Winter Weather Safety www.weather.gov · Snow/Ice · Blizzards · Flooding · Cold Temperatures #12;Building a Weather

  10. Using ISMS Principles and Functions in Developing an ARRA Readiness Review Process

    Broader source: Energy.gov [DOE]

    Presenter: Linda K. Rogers, Assessments & Readiness Programs Manager, Bechtel Jacobs Company, LLC Track 8-8

  11. Are Batteries Ready for Plug-in Hybrid Buyers?

    E-Print Network [OSTI]

    Axsen, Jonn; Kurani, Kenneth S; Burke, Andy

    2009-01-01

    higher power density batteries have reduced energy density,2008 UCD-ITS-WP-09-02 Are batteries ready for plug-in hybridprograms mischaracterize the batteries needed to start

  12. Are Batteries Ready for Plug-in Hybrid Buyers?

    E-Print Network [OSTI]

    Axsen, Jonn; Burke, Andy; Kurani, Kenneth S

    2010-01-01

    237–253. Burke, A. , 2007. Batteries and ultracapacitors forresults with lithium-ion batteries. In: Proceedings (CD)locate/tranpol Are batteries ready for plug-in hybrid

  13. Are batteries ready for plug-in hybrid buyers?

    E-Print Network [OSTI]

    Axsen, Jonn; Kurani, Kenneth S.; Burke, Andrew

    2008-01-01

    higher power density batteries have reduced energy density,2008 UCD-ITS-WP-09-02 Are batteries ready for plug-in hybridprograms mischaracterize the batteries needed to start

  14. DOE Zero Energy Ready Home Webinar: Ducts in Conditioned Space

    Broader source: Energy.gov [DOE]

    DOE Challenge Home is a blueprint for zero energy ready homes.  When we make that statement – it’s impossible to justify huge thermal losses from ducts in unconditioned spaces.  That’s why one of...

  15. DOE Challenge Home (Now Zero Energy Ready Home) - Building America...

    Broader source: Energy.gov (indexed) [DOE]

    a much more rigorous set of guidelines that establish a national definition for Zero Net-Energy Ready performance. Read about this Top Innovation. See an example of a DOE...

  16. DOE Zero Energy Ready Home Ducts in Conditioned Space Webinar...

    Broader source: Energy.gov (indexed) [DOE]

    is design strategies for locating the ductwork within the conditioned envelope of the building. And this is sort of a must-have for zero energy ready homes, because if these homes...

  17. DOE Zero Energy Ready Home Case Study, Caldwell and Johnson,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Exeter, RI, Custom Home Case study of a DOE Zero Energy Ready Home in Exeter, Rhode Island, that scored HERS 43 without PV. This 2,000 ft2 custom home has a spray- foamed...

  18. DOE Zero Energy Ready Home Case Study: Weiss Building & Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Ready Home in Downers Grove, IL, that scored HERS 35 without PV. This 3,600-square-foot custom home has advanced framed walls with R-23 dense-packed fiberglass plus R-13...

  19. DOE Zero Energy Ready Home Case Study: Weiss Building & Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    a sealed attic with open-cell spray foam, a pier foundation, and 95% efficient gas furnace. BAZeroEnergyReadyWeissCustom062414.pdf More Documents & Publications DOE Zero...

  20. Smart Grid Ready PV Inverters with Utility Communication

    Office of Energy Efficiency and Renewable Energy (EERE)

    Electric Power Research Institute (EPRI) will develop, implement, and demonstrate smart-grid ready inverters with grid support functionality and required communication links to capture the full...

  1. SRS Tank 48H Waste Treatment Project Technology Readiness Assessment

    Office of Environmental Management (EM)

    Savannah River Site Tank 48H Waste Treatment Project Technology Readiness Assessment Harry D. Harmon Joan B. Berkowitz John C. DeVine, Jr. Herbert G. Sutter Joan K. Young...

  2. DOE Zero Energy Ready Home Case Study: Evolutionary Home Builders...

    Energy Savers [EERE]

    vented attic with R-100 blown cellulose; wo air-to-air heat pumps SEER 14.1; HSPF 9.6; heat pump water heater. DOE Zero Energy Ready Home Case Study: Evolutionary Home Builders,...

  3. DOE Zero Energy Ready Home Case Study: Sunroc Builders, Bates...

    Office of Environmental Management (EM)

    8.25" SIP roof; uninsulated slab foundation; fresh air intake; SEER 16 ducted air source heat pump. DOE Zero Energy Ready Home Case Study: Sunroc Builders, Lakeland, FL More...

  4. DOE Zero Energy Ready Home Case Study: Manatee County Habitat...

    Energy Savers [EERE]

    has R-23 ICF walls, a spray-foamed sealed attic, solar hot water, and a ducted mini-split heat pump. BAZeroEnergyReadyManateeHabitatForHumanity062414.pdf More Documents &...

  5. DOE Zero Energy Ready Home Case Study: Charles Thomas Homes,...

    Energy Savers [EERE]

    under slab; a vented attic with R-100 blown cellulose; 95% AFUE furnace, 14 SEER AC, ERV; heat pump water heater. DOE Zero Energy Ready Home Case Study: Charles Thomas Homes,...

  6. DOE Zero Energy Ready Home Case Study: High Performance Homes...

    Energy Savers [EERE]

    R-15 unfaced batt on walls, sealed attic with R-49 ocsf under roof deck; ground source heat pump COP 4.4. DOE Zero Energy Ready Home Case Study: High Performance Homes,...

  7. DOE Zero Energy Ready Home Case Study: Amaris Homes, Fishers...

    Energy Savers [EERE]

    and around slab, a vented attic with with 2" ccsf plus R-15 blown cellulose, a central heat pump and HRV. DOE Zero Energy Ready Home Case Study: Amaris Homes, Vadnais Heights,...

  8. DOE Zero Energy Ready Home Case Study: Glastonbury Housesmith...

    Energy Savers [EERE]

    unvented attic with 5" ccsf and 6.5" blown fiberglass under the roof deck; ground source heat pump COP 4.4. DOE Zero Energy Ready Home Case Study: Glastonbury Housesmith, South...

  9. DOE Zero Energy Ready Home Case Study: Heirloom Design Build...

    Energy Savers [EERE]

    rigid foam under slab; sealed attic with R-28 ocsf under roof deck; 22.8 SEER; 12.5 HSPF heat pump. DOE Zero Energy Ready Home Case Study: Heirloom Design Build, Atlanta, GA More...

  10. DOE Zero Energy Ready Home Case Study: Addison Homes, Cobbler...

    Energy Savers [EERE]

    on inside with 2 inches poly iso, a vented attic with R-38 blown fiberglass, a central heat pump with fresh air intake. DOE Zero Energy Ready Home Case Study: Addison Homes,...

  11. EV Community Readiness projects: New York City and Lower Hudson...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    EV Community Readiness projects: New York City and Lower Hudson Valley Clean Communities, Inc. (NY, MA, PA); NYSERDA (ME, NH, VT, MA, RI, CT, NY, NJ, PA, DE, MD, DC) EV Community...

  12. DOE Zero Energy Ready Home Case Study: Preferred Builders, Old...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    R-13 closed-cell spray foam under the slab and on basement walls, an ERV, and a gas boiler for forced air and radiant floor heat. BAZeroEnergyReadyPreferredBuilders062414.pdf...

  13. DOE Zero Energy Ready Home Efficient Hot Water Distribution I...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    I -- What's At Stake Webinar (Text Version) DOE Zero Energy Ready Home Efficient Hot Water Distribution I -- What's At Stake Webinar (Text Version) Below is the text version of the...

  14. DOE Zero Energy Ready Home Case Study: Cobblestone Homes, Midland...

    Energy Savers [EERE]

    Case study of a DOE Zero Energy Ready home in Midland, MI, that scored HERS 49 without PV or HERS 44 with 1.4 kW of PV. The custom home served as a prototype and energy...

  15. DOE Zero Energy Ready Home Case Study: Sterling Brook Custom...

    Energy Savers [EERE]

    Zero Energy Ready home in Double Oak, TX, north of Dallas, that scored a HERS 44 without PV. The 3,752-ft2 two-story home served as an energy-efficient model home for the custom...

  16. DOE Zero Energy Ready Home Case Study: Southern Energy Homes...

    Energy Savers [EERE]

    Energy Ready Home standard. This manufactured home achieved a HERS score of 57 without PV. The home has been set up for side-by-side testing with an identical manufactured home...

  17. DOE Zero Energy Ready Home Case Study: Brookside Development...

    Broader source: Energy.gov (indexed) [DOE]

    of a DOE Zero Energy Ready home in Derby, CT, that achieves a HERS score of 45 without PV or HERS 26 with PV. The production home is one of a development of 7 two-story,...

  18. DOE Zero Energy Ready Home Case Study, Caldwell and Johnson,...

    Energy Savers [EERE]

    of a DOE Zero Energy Ready Home in Exeter, Rhode Island, that scored HERS 43 without PV. This 2,000 ft2 custom home has a spray- foamed attic and walls, plus rigid foam...

  19. Nuclear Energy Readiness Indicator Index (NERI): A benchmarking tool for assessing nuclear capacity in developing countries

    SciTech Connect (OSTI)

    Saum-Manning,L.

    2008-07-13

    Declining natural resources, rising oil prices, looming climate change and the introduction of nuclear energy partnerships, such as GNEP, have reinvigorated global interest in nuclear energy. The convergence of such issues has prompted countries to move ahead quickly to deal with the challenges that lie ahead. However, developing countries, in particular, often lack the domestic infrastructure and public support needed to implement a nuclear energy program in a safe, secure, and nonproliferation-conscious environment. How might countries become ready for nuclear energy? What is needed is a framework for assessing a country's readiness for nuclear energy. This paper suggests that a Nuclear Energy Readiness Indicator (NERI) Index might serve as a meaningful basis for assessing a country's status in terms of progress toward nuclear energy utilization under appropriate conditions. The NERI Index is a benchmarking tool that measures a country's level of 'readiness' for nonproliferation-conscious nuclear energy development. NERI first identifies 8 key indicators that have been recognized by the International Atomic Energy Agency as key nonproliferation and security milestones to achieve prior to establishing a nuclear energy program. It then measures a country's progress in each of these areas on a 1-5 point scale. In doing so NERI illuminates gaps or underdeveloped areas in a country's nuclear infrastructure with a view to enable stakeholders to prioritize the allocation of resources toward programs and policies supporting international nonproliferation goals through responsible nuclear energy development. On a preliminary basis, the indicators selected include: (1) demonstrated need; (2) expressed political support; (3) participation in nonproliferation and nuclear security treaties, international terrorism conventions, and export and border control arrangements; (4) national nuclear-related legal and regulatory mechanisms; (5) nuclear infrastructure; (6) the utilization of IAEA technical assistance; (7) participation in regional arrangements; and (8) public support for nuclear power. In this paper, the Index aggregates the indicators and evaluates and compares the level of readiness in seven countries that have recently expressed various degrees of interest in establishing a nuclear energy program. The NERI Index could be a valuable tool to be utilized by: (1) country officials who are considering nuclear power; (2) the international community, desiring reassurance of a country's capacity for the peaceful, safe, and secure use of nuclear energy; (3) foreign governments/NGO's, seeking to prioritize and direct resources toward developing countries; and (4) private stakeholders interested in nuclear infrastructure investment opportunities.

  20. LWRS ATR Irradiation Testing Readiness Status

    SciTech Connect (OSTI)

    Kristine Barrett

    2012-09-01

    The Light Water Reactor Sustainability (LWRS) Program was established by the U.S. Department of Energy Office of Nuclear Energy (DOE-NE) to develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of the current reactors. The LWRS Program is divided into four R&D Pathways: (1) Materials Aging and Degradation; (2) Advanced Light Water Reactor Nuclear Fuels; (3) Advanced Instrumentation, Information and Control Systems; and (4) Risk-Informed Safety Margin Characterization. This report describes an irradiation testing readiness analysis in preparation of LWRS experiments for irradiation testing at the Idaho National Laboratory (INL) Advanced Test Reactor (ATR) under Pathway (2). The focus of the Advanced LWR Nuclear Fuels Pathway is to improve the scientific knowledge basis for understanding and predicting fundamental performance of advanced nuclear fuel and cladding in nuclear power plants during both nominal and off-nominal conditions. This information will be applied in the design and development of high-performance, high burn-up fuels with improved safety, cladding integrity, and improved nuclear fuel cycle economics

  1. A Qualitative Readiness-Requirements Assessment Model for Enterprise Big-Data Infrastructure Investment

    SciTech Connect (OSTI)

    Olama, Mohammed M [ORNL] [ORNL; McNair, Wade [ORNL] [ORNL; Sukumar, Sreenivas R [ORNL] [ORNL; Nutaro, James J [ORNL] [ORNL

    2014-01-01

    In the last three decades, there has been an exponential growth in the area of information technology providing the information processing needs of data-driven businesses in government, science, and private industry in the form of capturing, staging, integrating, conveying, analyzing, and transferring data that will help knowledge workers and decision makers make sound business decisions. Data integration across enterprise warehouses is one of the most challenging steps in the big data analytics strategy. Several levels of data integration have been identified across enterprise warehouses: data accessibility, common data platform, and consolidated data model. Each level of integration has its own set of complexities that requires a certain amount of time, budget, and resources to implement. Such levels of integration are designed to address the technical challenges inherent in consolidating the disparate data sources. In this paper, we present a methodology based on industry best practices to measure the readiness of an organization and its data sets against the different levels of data integration. We introduce a new Integration Level Model (ILM) tool, which is used for quantifying an organization and data system s readiness to share data at a certain level of data integration. It is based largely on the established and accepted framework provided in the Data Management Association (DAMA-DMBOK). It comprises several key data management functions and supporting activities, together with several environmental elements that describe and apply to each function. The proposed model scores the maturity of a system s data governance processes and provides a pragmatic methodology for evaluating integration risks. The higher the computed scores, the better managed the source data system and the greater the likelihood that the data system can be brought in at a higher level of integration.

  2. DOE ZERH Webinar: Updates to the DOE Zero Energy Ready Home Specs- Rev05

    Broader source: Energy.gov [DOE]

    TitleUpdates to the DOE Zero Energy Ready Home Specs - Rev05DescriptionIn the year since DOE last updated the DOE Zero Energy Ready Home specs, we've continued to track our partner feedback and...

  3. Order Module--DOE O 425.1D, VERIFICATION OF READINESS TO START...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    5.1D, VERIFICATION OF READINESS TO START UP OR RESTART NUCLEAR FACILITIES Order Module--DOE O 425.1D, VERIFICATION OF READINESS TO START UP OR RESTART NUCLEAR FACILITIES "The...

  4. Computer vs. Video Game System: Ready to Rumble in the #EnergyFaceoff...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Computer vs. Video Game System: Ready to Rumble in the EnergyFaceoff Jungle Computer vs. Video Game System: Ready to Rumble in the EnergyFaceoff Jungle November 4, 2014 - 10:20am...

  5. DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Danbury, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury, CT Case study of a DOE Zero...

  6. DOE Zero Energy Ready Home Case Study: Carl Franklin Homes, L...

    Energy Savers [EERE]

    Zero Energy Ready Home Case Study: Carl Franklin Homes, L.C.Green Extreme Homes, CDC, McKinley Project, Garland TX DOE Zero Energy Ready Home Case Study: Carl Franklin Homes,...

  7. DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury...

    Energy Savers [EERE]

    BPC Green Builders, Danbury, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Danbury, CT Case...

  8. What to Expect When Readying to Move Spent Nuclear Fuel from...

    Energy Savers [EERE]

    What to Expect When Readying to Move Spent Nuclear Fuel from Commercial Nuclear Power Plants What to Expect When Readying to Move Spent Nuclear Fuel from Commercial Nuclear Power...

  9. EMERGENCY READINESS ASSURANCE PLAN (ERAP) FOR FISCAL YEAR (FY) 2014

    SciTech Connect (OSTI)

    Bush, Shane

    2014-09-01

    This Emergency Readiness Assurance Plan (ERAP) for Fiscal Year (FY) 2014 in accordance with DOE O 151.1C, “Comprehensive Emergency Management System.” The ERAP documents the readiness of the INL Emergency Management Program using emergency response planning and preparedness activities as the basis. It describes emergency response planning and preparedness activities, and where applicable, summarizes and/or provides supporting information in tabular form for easy access to data. The ERAP also provides budget, personnel, and planning forecasts for FY-15. Specifically, the ERAP assures the Department of Energy Idaho Operations Office that stated emergency capabilities at INL are sufficient to implement PLN-114, “INL Emergency Plan/RCRA Contingency Plan.

  10. DOE Zero Energy Ready Home Case Study: Shore Road Project- Old Greenwich, Connecticut

    Broader source: Energy.gov [DOE]

    This case study describes the builder Murphy Brothers' first DOE Zero Energy Ready Home in Old Greenwich, CT.

  11. Text-Alternative Version: ENERGY STAR® for SSL: Getting Ready for September 30

    Office of Energy Efficiency and Renewable Energy (EERE)

    Below is the text-alternative version of the ENERGY STAR® for SSL: Getting Ready for September 30 webcast.

  12. Capture-Ready Power Plants -Options, Technologies and Economics Mark C. Bohm

    E-Print Network [OSTI]

    1 Capture-Ready Power Plants - Options, Technologies and Economics by Mark C. Bohm Bachelor and Policy Program #12;2 #12;3 Capture-ready Power Plants ­ Options, Technologies and Costs by Mark C. Bohm of a plant. Power plant owners and policymakers are interested in capture-ready plants because they may offer

  13. APPLYING CACHING TO TWO-LEVEL ADAPTIVE BRANCH PREDICTION

    E-Print Network [OSTI]

    Vintan, Lucian N.

    - 1 - APPLYING CACHING TO TWO-LEVEL ADAPTIVE BRANCH PREDICTION EGAN, C., STEVEN, G. B., SHIM, W of the Camera-ready paper. #12;- 2 - APPLYING CACHING TO TWO-LEVEL ADAPTIVE BRANCH PREDICTION ABSTRACT During the 1990s Two-level Adaptive Branch Predictors were developed to meet the requirement for accurate branch

  14. Creating a Professional Portfolio Ready ReferenceE-12

    E-Print Network [OSTI]

    Creating a Professional Portfolio Ready ReferenceE-12 College of Engineering, Architecture & Technology Career Services Portfolios aren't just for artists anymore. Long regarded as an essential job effort and time. The Low and High Tech Alternatives You may design a high tech or low tech portfolio

  15. Researching a Company Online Ready Reference D-13

    E-Print Network [OSTI]

    Researching a Company Online Ready Reference D-13 College of Engineering, Architecture & Technology information on over 50,000 public and private companies (www.hoovers.com). · CorpTech Database of High and private high-tech organizations (www.corptech.com). · Companies Online from Dun & Bradstreet and Lycos

  16. FEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 83

    E-Print Network [OSTI]

    Tullos, Desiree

    - rupted--electricity, telephone, natural gas, gasoline pumps, cash registers, ATM machines, and internetFEDERAL EMERGENCY MANAGEMENT AGENCY ARE YOU READY? 83 National Security Emergencies I n addition to the natural and tech- nological hazards described in this publication, Americans face threats posed by hostile

  17. TECHNICAL POLLUTION PREVENTION GUIDE FOR READY-MIXED CONCRETE OPERATIONS

    E-Print Network [OSTI]

    #12;TECHNICAL POLLUTION PREVENTION GUIDE FOR READY-MIXED CONCRETE OPERATIONS IN THE LOWER FRASER BASIN DOE FRAP 1997-13 Prepared for: Environment Canada Environmental Protection Fraser Pollution Action Plan through its Fraser Pollution Abatement Office. Environment Canada is not responsible

  18. U.S. Department of Energy Technology Readiness Assessment Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2009-10-12

    This Guide assists individuals and teams involved in conducting Technology Readiness Assessments and developing Technology Maturation Plans for the DOE capital acquisition asset projects subject to DOE O 413.3A, Program and Project Management for the Acquisition of Capital Assets, dated 7-28-06. Canceled by DOE G 413.3-4A. Does not cancel other directives.

  19. Ready to eat breakfast cereals from food-grade sorghums 

    E-Print Network [OSTI]

    Cruz y Celis Ehlinger, Laura Penelope

    1993-01-01

    Two food-grade sorghum hybrids, ATx63 I *Tx436 (non waxy), and B.BON 34, (waxy), were micronized and evaluated for their potential use in ready to eat breakfast cereals (RTE-BC). Whole and decorticated grains were exposed to infra-red burners...

  20. IBM Watson Group Recruiting Event Ready to Work with Watson?

    E-Print Network [OSTI]

    IBM Watson Group Recruiting Event Ready to Work with Watson? Attend this session to learn about Watson opportunities INTERESTED YET? IBM is leading the real-world success of cognitive systems. Together and resources of IBM. Gates & Hillman 6115 LOCATION February, 18 2014 DATE 4PM - 7PM TIME WHO SHOULD ATTEND? 4

  1. Richard C. Ready Department of Agricultural Economics and Economics

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Richard C. Ready Department of Agricultural Economics and Economics Montana State University, University of Wisconsin, Madison: Agricultural Economics Major Field: Environmental and Resource Economics 2. M.A. - 1985, University of Wisconsin, Madison: Agricultural Economics 3. B.S - 1981, Cornell

  2. Operational Readiness Review: Savannah River Replacement Tritium Facility

    SciTech Connect (OSTI)

    Not Available

    1993-02-01

    The Operational Readiness Review (ORR) is one of several activities to be completed prior to introducing tritium into the Replacement Tritium Facility (RTF) at the Savannah River Site (SRS). The Secretary of Energy will rely in part on the results of this ORR in deciding whether the startup criteria for RTF have been met. The RTF is a new underground facility built to safely service the remaining nuclear weapons stockpile. At RTF, tritium will be unloaded from old components, purified and enriched, and loaded into new or reclaimed reservoirs. The RTF will replace an aging facility at SRS that has processed tritium for more than 35 years. RTF has completed construction and is undergoing facility startup testing. The final stages of this testing will require the introduction of limited amounts of tritium. The US Department of Energy (DOE) ORR was conducted January 19 to February 4, 1993, in accordance with an ORR review plan which was developed considering previous readiness reviews. The plan also considered the Defense Nuclear Facilities Safety Board (DNFSB) Recommendations 90-4 and 92-6, and the judgements of experienced senior experts. The review covered three major areas: (1) Plant and Equipment Readiness, (2) Personnel Readiness, and (3) Management Systems. The ORR Team was comprised of approximately 30 members consisting of a Team Leader, Senior Safety Experts, and Technical Experts. The ORR objectives and criteria were based on DOE Orders, industry standards, Institute of Nuclear Power Operations guidelines, recommendations of external oversight groups, and experience of the team members.

  3. Energy Flow: A Multimodal `Ready' Indication For Electric Vehicles

    E-Print Network [OSTI]

    ]. The limited range of EVs implicates a new importance of information about stored energy, estimated rangeEnergy Flow: A Multimodal `Ready' Indication For Electric Vehicles Abstract The lack of sound compared to a conventional car with a combustion engine. Most EVs provide a visual feedback about

  4. Verification of Readiness to Start Up or Restart Nuclear Facilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2010-04-16

    The order establishes requirements for verifying readiness for startup of new Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations, and for restart of existing Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations that have been shut down. Adm Chg 1, dated 4-2-13, supersedes DOE O 425.1D.

  5. Verification of Readiness to Start Up or Restart Nuclear Facilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2010-04-16

    The order establishes requirements for verifying readiness for startup of new Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations, and for restart of existing Hazard Category 1, 2, and 3 nuclear facilities, activities, and operations that have been shut down. Cancels DOE O 425.1C. Adm Chg 1, dated 4-2-13.

  6. NOAA's National Weather Service Building a Weather-Ready Nation

    E-Print Network [OSTI]

    NOAA's National Weather Service Building a Weather-Ready Nation For more information, please visit: www.noaa.gov and www.nws.noaa.gov NOAA's National Weather Service (NWS) is the Nation's official source for weather and water data, forecasts, and warnings. From information accessed on your smartphone

  7. DOE Zero Energy Ready Home Case Study: Greenhill Contracting...

    Broader source: Energy.gov (indexed) [DOE]

    a DOE Zero Energy Ready home in New Paltz, NY, that achieved a HERS score of 37 without PV or 7 with 7.5-kW PV. The two-story 2,288-ft2 home is one of 9 certified homes. All of...

  8. DOE Zero Energy Ready Home Case Study: John Hubert Associates...

    Broader source: Energy.gov (indexed) [DOE]

    of a DOE Zero Energy Ready home in North Cape May, NJ, that scored a HERS 46 without PV or HERS 9 with 6.5 kW of PV. The two-story, 1,871-ft2 home has advanced-framed...

  9. Key Facts About Hurricane Readiness Preparing for a Hurricane

    E-Print Network [OSTI]

    HURRICANES Key Facts About Hurricane Readiness Preparing for a Hurricane If you are under a hurricane watch or warning, here are some basic steps to take to prepare for the storm: · Learn about your. · Identify potential home hazards and know how to secure or protect them before the hurricane strikes

  10. DOE Zero Energy Ready Home Case Study: Southern Energy Homes — First DOE Zero Energy Ready Manufactured Home, Russellville, AL

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This home is the first manufactured home built to the DOE Zero Energy Ready Home standard and won an Affordable Builder award in the 2014 Housing Innovations Awards. This manufactured home achieved a HERS score of 57 without photovoltaics and includes superior insulation and air sealing.

  11. Microgrid-Ready Solar PV; NREL (National Renewable Energy Laboratory)

    SciTech Connect (OSTI)

    2015-07-01

    Designing new solar projects to be 'microgrid-ready' enables the U.S. DoD, other federal agencies, and the private sector to plan future microgrid initiatives to utilize solar PV as a generating resource. This fact sheet provides background information with suggested language for several up-front considerations that can be added to a solar project procurement or request for proposal (RFP) that will help ensure that PV systems are built for future microgrid connection.

  12. Rough and Ready Biomass Facility | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: EnergyRocklinRohmRoshniRotokawa Geothermaland Ready

  13. Taking the Challenge at Singer Village--A Cold Climate Zero Energy Ready Home

    SciTech Connect (OSTI)

    Puttagunta, S.; Gaakye, O.

    2014-10-01

    After progressively incorporating ENERGY STAR(R) for Homes Versions 1, 2, and 3 into its standard practices over the years, this builder, Brookside Development, was seeking to build an even more sustainable product that would further increase energy efficiency, while also addressing indoor air quality, water conservation, renewable-ready, and resiliency. These objectives align with the framework of the DOE Challenge Home program, which 'builds upon the comprehensive building science requirements of ENERGY STAR for Homes Version 3, along with proven Building America innovations and best practices. Other special attribute programs are incorporated to help builders reach unparalleled levels of performance with homes designed to last hundreds of years.' CARB partnered with Brookside Development on the design optimization and construction of the first home in a small development of seven planned new homes being built on the old Singer Estate in Derby, CT.

  14. Taking the Challenge at Singer Village — A Cold Climate Zero Energy Ready Home

    SciTech Connect (OSTI)

    Puttagunta, S.; Faakye, O.

    2014-10-01

    After progressively incorporating ENERGY STAR® for Homes Versions 1, 2, and 3 into its standard practices over the years, this builder, Brookside Development, was seeking to build an even more sustainable product that would further increase energy efficiency, while also addressing indoor air quality, water conservation, renewable-ready, and resiliency. These objectives align with the framework of the DOE Challenge Home program, which "builds upon the comprehensive building science requirements of ENERGY STAR for Homes Version 3, along with proven Building America innovations and best practices. Other special attribute programs are incorporated to help builders reach unparalleled levels of performance with homes designed to last hundreds of years." Consortium for Advanced Residential Buildings (CARB) partnered with Brookside Development on the design optimization and construction of the first home in a small development of seven planned new homes being built on the old Singer Estate in Derby, CT.

  15. 324 Building B-Cell Pressurized Water Reactor Spent Fuel Packaging & Shipment RL Readiness Assessment Final Report [SEC 1 Thru 3

    SciTech Connect (OSTI)

    HUMPHREYS, D C

    2002-08-01

    A parallel readiness assessment (RA) was conducted by independent Fluor Hanford (FH) and U. S. Department of Energy, Richland Operations Office (RL) team to verify that an adequate state of readiness had been achieved for activities associated with the packaging and shipping of pressurized water reactor fuel assemblies from B-Cell in the 324 Building to the interim storage area at the Canister Storage Building in the 200 Area. The RL review was conducted in parallel with the FH review in accordance with the Joint RL/FH Implementation Plan (Appendix B). The RL RA Team members were assigned a FH RA Team counterpart for the review. With this one-on-one approach, the RL RA Team was able to assess the FH Team's performance, competence, and adherence to the implementation plan and evaluate the level of facility readiness. The RL RA Team agrees with the FH determination that startup of the 324 Building B-Cell pressurized water reactor spent nuclear fuel packaging and shipping operations can safely proceed, pending completion of the identified pre-start items in the FH final report (see Appendix A), completion of the manageable list of open items included in the facility's declaration of readiness, and execution of the startup plan to operations.

  16. DOE Zero Energy Ready Home Low Load High Efficiency HVAC Webinar (Text Version)

    Broader source: Energy.gov [DOE]

    Below is the text version of the DOE Zero Energy Ready Home webinar, Low Load High Efficiency HVAC, presented in May 2014.

  17. How do I Apply for Graduate School...? Ready Reference D-18

    E-Print Network [OSTI]

    & Technology Career Services Oklahoma State University College of Engineering, Architecture & TechnologyHow do I Apply for Graduate School...? Ready Reference D-18 College of Engineering, Architecture

  18. Zero Energy-Ready Single-Family Homes - Building America Top...

    Broader source: Energy.gov (indexed) [DOE]

    program, the Challenge Home (now Zero Energy Ready Home) program. This Top Innovation highlights Building America research teams who have worked directly with builders to...

  19. Marketing and Sales Solutions for Zero Energy Ready Homes Webinar (Text Version)

    Broader source: Energy.gov [DOE]

    Below is the text version of the webinar, Marketing and Sales Solutions for Zero Energy Ready Homes, presented in June 2014.

  20. HIA 2015 DOE Zero Energy Ready Home Case Study: Hammer and Hand...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    eerebuildingszero-energy-ready-home PNNL-SA-113527, September 2015 One minisplit heat pump provides all of the heating and cooling the highly efficient home needs. While...

  1. DOE ZERH Webinar: Updates to the DOE Zero Energy Ready Home Specs...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    presented in May 2015. Watch the presentation. Lindsay Parker: Presentation cover slide: Hi, everyone. Welcome to the Department of Energy Zero Energy Ready Home Technical Training...

  2. El Salvador-Climate Finance Readiness Programme | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to:of theClimate Finance Readiness Programme Jump to:

  3. Ghana-REDD Readiness Requires Radical Reform | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New Pages RecentPlant <Silver Peak AreaForestREDD Readiness

  4. EECBG Success Story: LEDs Ready for Takeoff at Louisiana Airport |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|Department of EnergyDepartment ofDepartment of Energy LEDs Ready

  5. Zero Energy Ready Home Update Newsletter | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowingFuelWeatherize »EvePlantEnergy YuccaZero Energy Ready

  6. DOE Zero Energy Ready Home Resources | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electricLaboratory | DepartmentDOE Zero Energy Ready Home provides

  7. Hispanic Preschoolers' School Readiness: A Study Examining the Impact of Cultural, Social-Emotional, and Sociodemographic Factors 

    E-Print Network [OSTI]

    Avila Brizuela, Leonor

    2012-02-14

    of the literature by examining factors that impact school readiness among Hispanic preschoolers. The goal of this study was to determine the extent to which cultural variables can predict school readiness and social-emotional competence, above and beyond...

  8. Building America Top Innovations 2013 Profile – Zero Energy-Ready Single-Family Homes

    SciTech Connect (OSTI)

    none,

    2013-09-01

    Building homes that are zero energy-ready is a goal of the U.S. Department of Energy’s Building America program and one embodied in Building America’s premier home certification program, the Challenge Home program. This case study describes several examples of successful zero energy-ready home projects completed by Building America teams and partner builders.

  9. Weed Management Costs, Weed Best Management Practices, and The Roundup Ready Weed Management Program

    E-Print Network [OSTI]

    Mitchell, Paul D.

    Weed Management Costs, Weed Best Management Practices, and The Roundup Ready® Weed Management-commercial purposes by any means, provide that this copyright notice appears on all such copies. #12;1 Weed Management Costs, Weed Best Management Practices, and The Roundup Ready® Weed Management Program T.M. Hurley

  10. CLAS12 Software Readiness Review Jerry Gilfoyle (for the CLAS12 Software Group)

    E-Print Network [OSTI]

    Gilfoyle, Jerry

    CLAS12 Software Readiness Review Jerry Gilfoyle (for the CLAS12 Software Group) Physics Department, University of Richmond, Virginia Outline: 1. Introduction 2. Software Framework 3. Management 4. Requirements by a factor of ten over CLAS6 (L = 1035 cm-2s-1). Software Goal: Ready to analyze data at turn on (October

  11. Financing Capture Ready Coal-Fired Power Plants in China by Issuing Capture Options

    E-Print Network [OSTI]

    Aickelin, Uwe

    Financing Capture Ready Coal-Fired Power Plants in China by Issuing Capture Options Xi Liang, Jia Li, Jon Gibbons and David Reiner December 2007 EPRG 0728 & CWPE 0761 #12;FINANCING CAPTURE READY COAL supercritical pulverized coal power plant in China, using a cash flow model with Monte-Carlo simulations

  12. `Capture ready' regulation of fossil fuel power plants Betting the UK's carbon emissions on promises of future technology

    E-Print Network [OSTI]

    Haszeldine, Stuart

    power stations licensed in 2009 have had to set off land adjacent to the power plant as a capture ready`Capture ready' regulation of fossil fuel power plants ­ Betting the UK's carbon emissions interest in investing in new fossil fuelled power plants. The question is whether capture ready policy can

  13. Social Media: Weather-Ready Wednesday Please help the NWS spread these important safety messages on social media! Everyone is

    E-Print Network [OSTI]

    Social Media: Weather-Ready Wednesday #WRW Please help the NWS spread these important safety build a WeatherReady Nation. WeatherReady Wednesday is a National Weather Service initiative to help spread weather safety messages each week. Each week you can pick a different topic to share. It can

  14. 2010 Manufacturing Readiness Assessment Update to the 2008 Report for Fuel Cell Stacks and Systems for the Backup Power and Materials Handling Equipment Markets

    SciTech Connect (OSTI)

    Wheeler, D.; Ulsh, M.

    2012-08-01

    In 2008, the National Renewable Energy Laboratory (NREL), under contract to the US Department of Energy (DOE), conducted a manufacturing readiness assessment (MRA) of fuel cell systems and fuel cell stacks for back-up power and material handling applications (MHE). To facilitate the MRA, manufacturing readiness levels (MRL) were defined that were based on the Technology Readiness Levels previously established by the US Department of Energy (DOE). NREL assessed the extensive existing hierarchy of MRLs developed by Department of Defense (DoD) and other Federal entities, and developed a MRL scale adapted to the needs of the Fuel Cell Technologies Program (FCTP) and to the status of the fuel cell industry. The MRL ranking of a fuel cell manufacturing facility increases as the manufacturing capability transitions from laboratory prototype development through Low Rate Initial Production to Full Rate Production. DOE can use MRLs to address the economic and institutional risks associated with a ramp-up in polymer electrolyte membrane (PEM) fuel cell production. In 2010, NREL updated this assessment, including additional manufacturers, an assessment of market developments since the original report, and a comparison of MRLs between 2008 and 2010.

  15. Carbon Characterization Laboratory Readiness to Receive Irradiated Graphite Samples

    SciTech Connect (OSTI)

    Karen A. Moore

    2011-05-01

    The Carbon Characterization Laboratory (CCL) is located in Labs C19 and C20 of the Idaho National Laboratory Research Center. The CCL was established under the Next Generation Nuclear Plant Project to support graphite and ceramic composite research and development activities. The research conducted in this laboratory will support the Advanced Graphite Creep experiments—a major series of material irradiation experiments within the Next Generation Nuclear Plant Graphite program. The CCL is designed to characterize and test low activated irradiated materials such as high purity graphite, carbon-carbon composites, silicon-carbide composite, and ceramic materials. The laboratory is fully capable of characterizing material properties for both irradiated and nonirradiated materials. Major infrastructural modifications were undertaken to support this new radiological facility at Idaho National Laboratory. Facility modifications are complete, equipment has been installed, radiological controls and operating procedures have been established and work management documents have been created to place the CCL in readiness to receive irradiated graphite samples.

  16. DOE ZERH Webinar: Updates to the DOE Zero Energy Ready Home Specs-- Revision 05

    Broader source: Energy.gov [DOE]

    In the year since DOE last updated the DOE Zero Energy Ready Home specs, we've continued to track our partner feedback and other industry issues. This brings us to the release of Revision 05, which changes the solar hot water ready provisions to "recommended", incorporates a phase-in period for the new ENERGY STAR window specs, and spells out how the program works in states where the 2012 IECC is in place. This one-hour webinar will cover the key changes in the DOE Zero Energy Ready Homes specs and explain their significance to our builder, rater, and designer partners.

  17. Operational readiness review for the Waste Experimental Reduction Facility. Final report

    SciTech Connect (OSTI)

    Not Available

    1993-11-01

    An Operational Readiness Review (ORR) at the Idaho National Engineering Laboratory`s (INEL`s) Waste Experimental Reduction Facility (WERF) was conducted by EG&G Idaho, Inc., to verify the readiness of WERF to resume operations following a shutdown and modification period of more than two years. It is the conclusion of the ORR Team that, pending satisfactory resolution of all pre-startup findings, WERF has achieved readiness to resume unrestricted operations within the approved safety basis. ORR appraisal forms are included in this report.

  18. U.S. Department of Energy Zero Energy Ready Home? LENDER PARTNER...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    U.S. Department of Energy Zero Energy Ready Home(tm) LENDER PARTNER AGREEMENT This agreement is administered by the U.S. Department of Energy (DOE) in support of DOE Zero Energy...

  19. DOE Zero Energy Ready Home Case Study: Shore Road Project - Old...

    Energy Savers [EERE]

    ventilator. The house has a dual-fuel heat pump, an instantaneous condensing water heater, and 4.5-kW solar shingles. DOE Zero Energy Ready Home: Murphy Brothers Contracting,...

  20. Financing Capture Ready Coal-Fired Power Plants in China by Issuing Capture Options

    E-Print Network [OSTI]

    Liang, Xi; Reiner, David; Gibbons, Jon; Li, Jia

    investors diversify risk, and offer global warming investors an alternative investment opportunity. As a detailed case study, we assess the value of a Capture Option and Capture Ready plant for a 600 MW supercritical pulverized coal power plant in China...

  1. DOE Zero Energy Ready Home Case Study: New Town Builders, Denver...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ready Home in Denver, CO, that scored HERS 41 without PV, HERS 3 with PV. This 3,560-square-foot production home has R-36 double-stud walls, a vented attic with R-50 blown...

  2. DOE Zero Energy Ready Home Case Study: Ferguson Design and Constructio...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Zero Energy Ready Home in Long Island, NY, that scored HERS 43 without PV. This 5,088-square-foot custom home has R-25 double-stud walls, a vaulted roof with R-40 blown cellulose,...

  3. Influence of Agricultural Dual Credit on Student College Readiness Self-Efficacy 

    E-Print Network [OSTI]

    Neely, Alanna L.

    2013-07-12

    The purpose of this correlational and descriptive study was to examine the influence of an agricultural dual credit course curriculum on student self-efficacy of college readiness as students matriculate to post-secondary education. To evaluate...

  4. DOE Zero Energy Ready Home Case Study: StreetScape Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    foam, R-49 open-cell spray-foam sealed attic, an HRV, and a tankless water heater for hydro coil furnace with high-velocity, small-diameter ducts. BAZeroEnergyReadyStreetScape...

  5. DOE Zero Energy Ready Home Case Study: StreetScape Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    open-cell spray-foam sealed attic, an HRV, and a tankless water heater for hydro coil furnace with high-velocity, small-diameter ducts. BAZeroEnergyReadyStreetScape062414.pdf...

  6. Application of the cumulative risk model in predicting school readiness in Head Start children 

    E-Print Network [OSTI]

    Rodriguez-Escobar, Olga Lydia

    2009-05-15

    This study investigates the degree to which the cumulative risk index predicted school readiness in a Head Start population. In general, the reviewed studies indicated the cumulative risk model was efficacious in predicting adverse developmental...

  7. DOE Zero Energy Ready Home Case Study: BPC Green Builders, Taft...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Taft School, Watertown, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Taft School, Watertown, CT Case study of a DOE 2015 Housing Innovation Award winning custom...

  8. HIA 2015 DOE Zero Energy Ready Home Case Study: Carl Franklin...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Franklin Homes, L.C. Green Extreme Homes, CDC McKinley Project Garland, TX DOE ZERO ENERGY READY HOME(tm) The U.S. Department of Energy invites home builders across the country to...

  9. DOE Tour of Zero: The First DOE Zero Energy Ready Retrofit by...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    by Green Extreme Homes and Carl Franklin Homes DOE Tour of Zero: The First DOE Zero Energy Ready Retrofit by Green Extreme Homes and Carl Franklin Homes Addthis 1 of 11 Green...

  10. DOE Zero Energy Ready Home Case Study: BPC Green Builders, Custom...

    Energy Savers [EERE]

    Study: BPC Green Builders, Custom Home, New Fairfield, CT DOE Zero Energy Ready Home Case Study: BPC Green Builders, Custom Home, New Fairfield, CT Case study of a DOE Zero Energy...

  11. DOE Zero Energy Ready Home Case Study: Amerisips Homes — Miller-Bloch Residence, Johns Island, SC

    SciTech Connect (OSTI)

    none,

    2014-09-01

    For this DOE Zero Energy Ready Home that won a Custom Builder award in the 2014 Housing Innovation Awards, the builder uses structural insulated panels to construct the entire building shell, including the roof, walls, and floor of the home.

  12. DOE ZERH Webinar: Technical Resources for Marketing and Selling Zero Energy Ready Homes

    Broader source: Energy.gov [DOE]

    Plan review… energy modeling… field inspections… certification…done!  Right?  If only it were that simple to successfully transition to Zero Energy Ready Homes.  The reality is that there’s a lot...

  13. DOE Zero Energy Ready Home Case Study: Palo Duro Homes, Via del...

    Energy Savers [EERE]

    and R-5rigid foam at slab edge; vented attic with R-75 blown fiberglass; ducted minisplit heat pump 16.5 SEER, 9.5 HSPF. DOE Zero Energy Ready Home Case Study: Palo Duro Homes,...

  14. DOE Zero Energy Ready Home Case Study: Hammer and Hand, Pumpkin...

    Energy Savers [EERE]

    with R-29 rigid EPS foam under slab; vented attic with R-86 blown cellulose; minisplit heat pump; ducted with HRV; 15.5 SEER; 10 HSPF. DOE Zero Energy Ready Home Case Study:...

  15. DOE Zero Energy Ready Home Case Study: Habitat for Humanity South...

    Energy Savers [EERE]

    on interior walls; R-20 ocsf in roof of sealed attic, uninsulated slab, 15 SEER 8.0 HSPF heat pump walls for heating and cooling, heat pump water heater. DOE Zero Energy Ready...

  16. DOE Zero Ready Home Case Study: Green Extreme Homes & Carl Franklin...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    certifi ed to the high performance requirements of the U.S. Department of Energy's Zero Energy Ready Home program, thanks to a successful collaboration between the non-profi t...

  17. User readiness to interact with information systems - a human activity perspective 

    E-Print Network [OSTI]

    Sun, Jun

    2006-10-30

    This study focuses on how and why people become ready to interact with certain information systems (IS) based on their previous experiences with the same and/or similar systems. User-system interaction can be regarded as ...

  18. Envisioning a Bright Future for New Braunfels Children: A Community-Based Approach to School Readiness 

    E-Print Network [OSTI]

    Fanomezantsoa, Herilala; Hopkins, Elizabeth; Tooley, Kathryn

    2015-05-20

    Consulting Capstone Group (MCCG) mission was to provide the McKenna Foundation with informed recommendations regarding school readiness, so that they could effectively serve and advance the well-being of the New Braunfels community....

  19. DOE Zero Energy Ready Home Going Green and Building Strong: Building...

    Broader source: Energy.gov (indexed) [DOE]

    require participation in the FORTIFIED Home program for certification under the DOE Zero Energy Ready Home program, we do strongly encourage it, and we think that there's a lot of...

  20. DOE Zero Energy Ready Home Case Study: Clifton View Homes, Marine...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Marine Drive and Port Hadlcok, Coupeville and Port Hadlock WA DOE Zero Energy Ready Home Case Study: Clifton View Homes, Marine Drive and Port Hadlcok, Coupeville and Port Hadlock...

  1. DOE Zero Energy Ready Home Case Study: e2 Homes, Winter Park...

    Energy Savers [EERE]

    study of a DOE Zero Energy Ready Home in Winter Park, FL, that scored HERS 57 without PV or HERS -7 with PV. This 4,305-square-foot custom home has autoclaved aerated concrete...

  2. Development of a culturally appropriate process for assessing distance learning readiness in Latin America 

    E-Print Network [OSTI]

    Villalobos Peñ alosa, Patricia

    2009-05-15

    The purpose of this study was to develop an instrument for assessing distance learning readiness of institutions in Latin America for international projects of food and agriculture with higher education institutions in the ...

  3. Variance analysis in the quality control of ready mixed concrete in a major structure 

    E-Print Network [OSTI]

    Valle Aguilar, Jorge Luis

    1984-01-01

    of strength variations in concrete Fly ash in ready mixed concrete Statistical Inference Hypothesis testing . Analysis of variance Duality control charts Linear regression and correlation Page 10 12 15 17 18 19 20 22 24 24 24 26 27 CHAPTER... Comparison of variances (o') for different ready mixed plants Comparison of means (X) and variances (o'). Comparison of means (7J) and variances (o') for various mix designs, f'c = 3000 psi Comparison of means (X) and variances (o') for mix designs...

  4. Vehicle Technologies Office: AVTA- Evaluating Military Bases and Fleet Readiness for Electric Vehicles

    Broader source: Energy.gov [DOE]

    The Vehicle Technologies Office's Advanced Vehicle Testing Activity carries out testing on a wide range of advanced vehicles and technologies on dynamometers, closed test tracks, and on-the-road. Through the AVTA, Idaho National Laboratory also does fleet and other analysis to evaluate readiness for plug-in electric vehicles and other advanced technology vehicles. The following reports describe analysis studies Idaho National Laboratory conducted for the military to evaluate readiness for plug-in electric vehicles.

  5. Readiness review plan for the in situ vitrification demonstration of Seepage Pit 1 in Waste Area Grouping 7

    SciTech Connect (OSTI)

    NONE

    1995-05-01

    A treatability study is planned that encompasses the application of in situ vitrification (ISV) to at least two segments of the Oak Ridge National Laboratory Seepage Pit I during the third quarter of fiscal year 1995. Before the treatability study can be initiated, the proposed activity must be subjected to an Operational Readiness Review (ORR). ORR is a structured methodology of determining readiness to proceed as outlined in Martin Marietta Energy Systems, Inc. (Energy Systems), Environmental Restoration Waste Management Procedure ER/C-P1610, which provides Energy Systems organizations assurance that the work to be performed is consistent with management`s expectations and that the subject activity is ready to proceed safely. The readiness review plan provides details of the review plan overview and the scope of work to be performed. The plan also identifies individuals and position responsibilities for implementing the activity. The management appointed Readiness Review Board (RRB) has been identified. A Field Readiness Review Team (FRT), a management appointed multidisciplinary group, has been established (1) to evaluate the ISV treatability study, (2) to identify and assemble supporting objective evidences of the readiness to proceed, and (3) to assist the team leader in presenting the evidences to the RRB. A major component of RRB is the formulation of readiness review criteria months before the operation. A comprehensive readiness review tree (a positive logic tree) is included, which identifies the activities required for the development of the readiness criteria. The readiness review tree serves as a tool to prevent the omission of an item that could affect system performance. All deficiencies identified in the review will be determined as prestart findings and must be resolved before the project is permitted to proceed. The final approval of the readiness to proceed will be the decision of RRB.

  6. Are Wireless Sensors and Controls Ready for the Building Automation Industry? Selected Case Studies and Technology Development Activities

    SciTech Connect (OSTI)

    Kintner-Meyer, Michael CW; Brambley, Michael R.

    2006-09-13

    This paper discusses whether or not today’s wireless sensors are ready for building controls and energy efficiency monitoring applications.

  7. Management assessment of tank waste remediation system contractor readiness to proceed with phase 1B privatization

    SciTech Connect (OSTI)

    Honeyman, J.O.

    1998-01-09

    This Management Assessment of Tank Waste Remediation System (TWRS) Contractor Readiness to Proceed With Phase 1B Privatization documents the processes used to determine readiness to proceed with tank waste treatment technologies from private industry, now known as TWRS privatization. An overall systems approach was applied to develop action plans to support the retrieval and disposal mission of the TWRS Project. The systems and infrastructure required to support the mission are known. Required systems are either in place or plans have been developed to ensure they exist when needed. Since October 1996 a robust system engineering approach to establishing integrated Technical Baselines, work breakdown structures, tank farms organizational structure and configurations, work scope, and costs has become part of the culture within the TWRS Project. An analysis of the programmatic, management, and technical activities necessary to declare readiness to proceed with execution of the mission demonstrates that the system, personnel, and hardware will be on-line and ready to support the private contractors. The systems approach included defining the retrieval and disposal mission requirements and evaluating the readiness of the Project Hanford Management Contract (PHMC) team to support initiation of waste processing by the private contractors in June 2002 and to receive immobilized waste shortly thereafter. The Phase 1 feed delivery requirements from the private contractor Requests for Proposal were reviewed. Transfer piping routes were mapped, existing systems were evaluated, and upgrade requirements were defined.

  8. Management assessment of tank waste remediation system contractor readiness to proceed with phase 1B privatization

    SciTech Connect (OSTI)

    Certa, P.J.

    1998-01-07

    Readiness to Proceed With Phase 1B Privatization documents the processes used to determine readiness to proceed with tank waste treatment technologies from private industry, now known as TWRS privatization. An overall systems approach was applied to develop action plans to support the retrieval and disposal mission of the TWRS Project. The systems and infrastructure required to support the mission are known. Required systems are either in place or plans have been developed to ensure they exist when needed. Since October 1996 a robust system engineering approach to establishing integrated Technical Baselines, work breakdown structures, tank farms organizational structure and configurations, work scope, and costs has become part of the culture within the TWRS Project. An analysis of the programmatic, management, and technical activities necessary to declare readiness to proceed with execution of the mission demonstrates that the system, personnel, and hardware will be on line and ready to support the private contractors. The systems approach included defining the retrieval and disposal mission requirements and evaluating the readiness of the Project Hanford Management Contract (PHMC) team to support initiation of waste processing by the private contractors in June 2002 and to receive immobilized waste shortly thereafter. The Phase 1 feed delivery requirements from the private contractor Requests for Proposal were reviewed. Transfer piping routes were mapped, existing systems were evaluated, and upgrade requirements were defined.

  9. Summary - WTP Analytical Lab, BOF and LAW Waste Vitrification...

    Office of Environmental Management (EM)

    and L ms were CTEs: ng System (TR ion analysis sy P-MS (TRL5) RA reports, please v govPagesExternal nology Readiness A ng a systematic, me ent PlantWTP nt of Energy and Imm...

  10. TRL Acid and Solvent Wet Processing Rules and Guidelines

    E-Print Network [OSTI]

    Reif, Rafael

    guards, Trionic gloves (atop the standard gowning vinyl cleanroom gloves cleanroom gloves and safety glasses are required. MSDS sheets for all chemicals

  11. Scientific Solutions (TRL 5 6 Component) - Underwater Active Acoustic

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy BillsNo. 195 -RobSSL INDepartment ofJuneScenario AnalysisSchool7,Monitoring

  12. The purpose of NOAA's Weather-Ready Nation initiative is first and foremost to save lives and

    E-Print Network [OSTI]

    The purpose of NOAA's Weather-Ready Nation initiative is first and foremost to save lives public. The Weather-Ready Nation initiative will help America meet the challenges that come with increased extreme weather events by more actively engaging the public on preparedness and resiliency. What

  13. Readiness assessment plan for the Radioactive Mixed Waste Land Disposal Facility (Trench 31)

    SciTech Connect (OSTI)

    Irons, L.G.

    1994-11-22

    This document provides the Readiness Assessment Plan (RAP) for the Project W-025 (Radioactive Mixed Waste Land Disposal Facility) Readiness Assessment (RA). The RAP documents prerequisites to be met by the operating organization prior to the RA. The RAP is to be implemented by the RA Team identified in the RAP. The RA Team is to verify the facility`s compliance with criteria identified in the RAP. The criteria are based upon the {open_quotes}Core Requirements{close_quotes} listed in DOE Order 5480.31, {open_quotes}Startup and Restart of Nuclear Facilities{close_quotes}.

  14. DOE Zero Energy Ready Home Case Study: Green Extreme Homes & Carl Franklin Homes — First DOE Zero Energy Ready Home Retrofit, Garland, TX

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This builder was honored with an Affordable Builder award in the 2014 Housing Innovation Awards, for the first retrofit home certified to the DOE Zero Energy Ready home requirements.The 60-year-old, three-bedroom ranch home is expected to save its homeowner more than $1,000 a year in utility bills compared to a home built to the current 2009 International Energy Conservation Code.

  15. DOE Zero Energy Ready Home Case Study: Boulder ZED Design Build - Boulder, Colorado

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready Home in Boulder, Colorado, that scored HERS 38 without PV and 0 with PV. This 2,504 ft2 custom home has advanced framed walls, superior insulation a ground-source heat pump, ERV, and triple-pane windows.

  16. Questions to Ask During Employer Research Ready ReferenceD-14

    E-Print Network [OSTI]

    & Technology Career Services Oklahoma State University College of Engineering, Architecture & TechnologyQuestions to Ask During Employer Research Ready ReferenceD-14 College of Engineering, Architecture the organization offer its employees? · How high is the employee turnover rate for the organization? · What

  17. Original Article Human readiness to throw: the sizeweight illusion is not an illusion when

    E-Print Network [OSTI]

    Indiana University

    are equivalent. Thus, the illusion is functional, not a misperception: optimal objects for throwing are picked that the illusion is a perceptual bias that reflects readiness to acquire fully functional throwing ability food. The ability to throw objects long distance is known to have been of central importance

  18. Capture-Ready Coal Plants -Options, Technologies and Economics Mark C. Bohm1

    E-Print Network [OSTI]

    1 Capture-Ready Coal Plants - Options, Technologies and Economics Mark C. Bohm1 , Howard J. Herzog1 be employed during the initial design and construction of a both pulverized coal and integrated gasification the Internet in the summer of 2006 [7]. Introduction Interest in the construction of coal-fired power

  19. Phase 5 storage (Project W-112) Central Waste Complex operational readiness review, final report

    SciTech Connect (OSTI)

    Wight, R.H.

    1997-05-30

    This document is the final report for the RFSH conducted, Contractor Operational Readiness Review (ORR) for the Central Waste Complex (CWC) Project W-112 and Interim Safety Basis implementation. As appendices, all findings, observations, lines of inquiry and the implementation plan are included.

  20. MEASURING READINESS FOR CAREER-DECISION MAKING WITH THE CAREER THOUGHTS INVENTORY IN FINLAND

    E-Print Network [OSTI]

    McQuade, D. Tyler

    1 MEASURING READINESS FOR CAREER-DECISION MAKING WITH THE CAREER THOUGHTS INVENTORY IN FINLAND University of Applied Sciences, Jyväskylä, Finland. James Sampson, Ph.D., is Associate Dean, College of Educational Research Methodology, the Institute for Educational Research, University of Jyväskylä, Finland

  1. Focus Sheet | Hazardous Waste Checklist How to be ready for state hazardous waste

    E-Print Network [OSTI]

    Wilcock, William

    storage cabinet. Avoid accumulating a lot of waste ­ keep areas clear. EPO ­ Hazardous Waste Checklist 07Focus Sheet | Hazardous Waste Checklist How to be ready for state hazardous waste inspectors. See a hazardous waste inspection. ons, rrosive. n hemicals? ical waste. Waste-like chemicals have als Are you

  2. Physics and Astronomy Department San Francisco State University Physics Readiness Exam

    E-Print Network [OSTI]

    Golterman, Maarten

    Physics and Astronomy Department San Francisco State University Physics Readiness Exam Math Qualification Test for Introductory Physics ­ Physics 111 or Physics 220 In addition to meeting course prerequisites, students wishing to enroll in Physics 111 or Physics 220 must demonstrate adequate competence

  3. DOE Zero Energy Ready Home Case Study: Promethean Homes — Gross-Shepard Residence, Charlottesville, VA

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This is the first DOE Zero Energy Ready Home for this builder, who earned a Custom Builder honor in the 2014 Housing Innovation Awards. The home included rigid mineral wool board insulation over house wrap and plywood on the 2x6 advanced framed walls, achieving HERS 33 without PV.

  4. DOE Zero Energy Ready Home Case Study: Mandalay Homes — Pronghorn Ranch, Prescott Valley, AZ

    SciTech Connect (OSTI)

    none,

    2014-09-01

    The builder has certified 20 homes to DOE Zero Energy Ready Home program and plans are underway for 50 more. Winner of a Production Builder prize in the 2014 Housing Innovation Awards, the homes achieved a HERS score of 48 without photovoltaics (PV) or HERS 25 with 3.5 kW PV included.

  5. DOE Zero Energy Ready Home Case Study: Cobblestone Homes — 2014 Model Home, Midland, MI

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This builder's first DOE Zero Energy Ready Home won a Custom Builder award in the 2014 Housing Innovation Awards, scored HERS 49 without PV or HERS 44 with 1.4 kW of PV, and served as a prototype and energy efficiency demonstration model while performance testing was conducted.

  6. Exploring Factors of Readiness to Learn about Infant Feeding in Mothers of NICU Infants

    E-Print Network [OSTI]

    Hadsell, Christine Ann

    2013-08-31

    Abstract Teaching the postpartum mother who has an infant in the Neonatal Intensive Care Unit (NICU) about infant feeding may be delayed if the nurse does not determine readiness to learn (RTL) and confidence to feed (CTF) and/or makes assumptions...

  7. Ohio-Kentucky-Indiana Regional Council of Governments Go Solar Ready – Solar Map

    Broader source: Energy.gov [DOE]

    The Ohio-Kentucky-Indiana Regional Council of Governments Go Solar Ready Map provides general information about the estimated annual solar energy potential on building rooftops in the OKI region. The intention of this tool is to provide the user a general understanding of the solar energy available on rooftops in the OKI tristate region.

  8. Is RPL Ready for Actuation? A Comparative Evaluation in a Smart City Scenario

    E-Print Network [OSTI]

    Picco, Gian Pietro

    Is RPL Ready for Actuation? A Comparative Evaluation in a Smart City Scenario Timofei Istomin1 of a large-scale infrastructure for smart city applications, which directly informs our evaluation, where we infrastructure of 860+ IEEE 802.15.4 nodes, for monitoring and control of public lighting and other "smart city

  9. CLAS12 Software Readiness Review -Replay Jerry Gilfoyle (for the CLAS12 Software Group)

    E-Print Network [OSTI]

    Gilfoyle, Jerry

    CLAS12 Software Readiness Review - Replay Jerry Gilfoyle (for the CLAS12 Software Group) Physics Department, University of Richmond, Virginia Outline: 0. History 1. Introduction 2. Software Framework 3 spectrometer based on CLAS6. Luminosity increases by a factor of ten over CLAS6 (L = 1035 cm-2s-1). Software

  10. DOE Zero Energy Ready Home Case Study: Brookside Development — Singer Village, Derby, CT

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This DOE Zero Energy Ready Home is one of a development of seven two-story homes that garnered a Production Builder award in the 2014 Housing Innovation Awards. Exceptional construction quality allowed the home to achieve a HERS score of 45 without photovoltaic, or HERS 26 with a 7-kW photovoltaic system included.

  11. DOE Zero Energy Ready Home Case Study: M Street Homes — Smartlux on Greenpark, Houston, TX

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This builder certified its first DOE Zero Energy Ready Home and won a Production Builder honor in the 2014 Housing Innovation Awards. It is the first home in the world to use a tri-generation system to supply electricity, heating, and cooling on site.

  12. Personal Internet Presence: Job Seeker Self-Audit Ready Reference D-17

    E-Print Network [OSTI]

    Personal Internet Presence: Job Seeker Self-Audit Ready Reference D-17 College of Engineering Internet Presence Job Seeker Self-Audit to evaluate your e-image on a regular basis. Personal Internet your resume been posted on the internet by your academic department? Yes No I don't know Do you belong

  13. Team leader`s preparation guide for Operational Readiness Reviews (ORR)

    SciTech Connect (OSTI)

    Not Available

    1994-09-01

    This document provides instructions, explanations, and examples for the performance of all phases of an Operational Readiness Review (ORR). Details pertinent to the team leader, team members, and review coordinator are outlined. Sample forms and correspondence are included in appendices. Although this document is for use by DOE ORR team leaders, it can be used by contractor ORR team leaders also.

  14. VALUE OF A WEATHER-READY NATION LAST REVISED 10/13/2011

    E-Print Network [OSTI]

    1 VALUE OF A WEATHER-READY NATION LAST REVISED 10/13/2011 NOAA activities support science, service value of our work as it relates to the National Weather Service (NWS). Here we provide data on: What and by product or service type. If you find data about weather that may be useful in your work

  15. DOE Zero Energy Ready Home Case Study: Clifton View Homes — Kaltenbach Residence, Clinton, WA

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This home on Whidbey Island won a Custom Builder award in the 2014 Housing Innovation Awards. The DOE Zero Energy Ready Home scores HERS 37 without PV or HERS -13 with 10 kW PV, enough to power the home and an electric car.

  16. DOE Zero Energy Ready Home Case Study: AquaZephyr, Ithaca, NY...

    Energy Savers [EERE]

    study of a DOE Zero Energy Ready home in Ithaca, NY, that achieves a HERS 56 without PV or HERS 15 with 4-kW of PV. The two-story, 1,664-ft2 home is one of 17 single-family and...

  17. DOE Zero Energy Ready Home Case Study: One Sky Homes, San Jose...

    Broader source: Energy.gov (indexed) [DOE]

    Ready home in San Jose, CA, that achieved a HERS 69 on the California HERS score without PV, or HERS -1 with 6.4 kW of PV. The custom home has 2x6 advanced framed walls dense...

  18. DOE Zero Energy Ready Home Case Study: KB Home, Lancaster, CA...

    Energy Savers [EERE]

    study of a DOE Zero Energy Ready home in Lancaster, CA, that achieved a HERS 43 without PV 43 or HERS 0 with 6.9-kW PV. The two-story, 2,537ft2 home serves as a model for the...

  19. DOE Zero Energy Ready Home: Near Zero Maine Home II, Vassalboro...

    Energy Savers [EERE]

    study of a DOE Zero Energy Ready home in Vassalboro, Maine, that scored HERS 35 without PV and HERS 11 with PV. This 1,200 ft2 home has 10.5-inch-thick double-walls with 3 layers...

  20. The ATLAS Trigger System: Ready for Run-2

    E-Print Network [OSTI]

    Maeda, Junpei; The ATLAS collaboration

    2015-01-01

    The ATLAS trigger has been successfully collecting collision data during the first run of the LHC between 2009-2013 at a centre-of-mass energy between 900 GeV and 8 TeV. The trigger system consists of a hardware Level-1 (L1) and a software based high-level trigger (HLT) that reduces the event rate from the design bunch-crossing rate of 40 MHz to an average recording rate of a few hundred Hz. During the next data-taking period starting in 2015 (Run-2) the LHC will operate at a centre-of-mass energy of about 13 TeV resulting in roughly five times higher trigger rates. We will briefly review the ATLAS trigger system upgrades that were implemented during the shutdown, allowing us to cope with the increased trigger rates while maintaining or even improving our efficiency to select relevant physics processes. This includes changes to the L1 calorimeter and muon trigger system, the introduction of a new L1 topological trigger module and the merging of the previously two-level HLT system into a single event filter fa...

  1. The ATLAS Trigger System - Ready for Run-2

    E-Print Network [OSTI]

    Backes, Moritz; The ATLAS collaboration

    2015-01-01

    The ATLAS trigger has been successfully collecting collision data during the first run of the LHC between 2009-2013 at a centre-of-mass energy between 900 GeV and 8 TeV. The trigger system consists of a hardware based Level-1 (L1) and a software based high-level trigger (HLT) that reduces the event rate from the design bunch-crossing rate of 40 MHz to an average recording rate of a few hundred Hz. During the course of the ongoing Run-2 data-taking campaign at 13 TeV centre-of-mass energy the trigger rates will be approximately 5 times higher compared to Run-1. In these proceedings we briefly review the ATLAS trigger system upgrades that were implemented during the shutdown, allowing us to cope with the increased trigger rates while maintaining or even improving our efficiency to select relevant physics processes. This includes changes to the L1 calorimeter and muon trigger system, the introduction of a new L1 topological trigger subsystem and the merging of the previously two-level HLT system into a single ev...

  2. DOE Zero Energy Ready Home Case Study: Caldwell and Johnson — Church Community and Housing Corporation, Charlestown, RI

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This DOE Zero Energy Ready Home garnered an Affordable Builder award in the 2014 Housing Innovation Awards, for its highly insulated construction, minisplit heat pump and water heater, and triple pane windows.

  3. DOE handbook: Guide to good practices for operational readiness reviews (ORR) team leader`s guide

    SciTech Connect (OSTI)

    1994-09-01

    This guidance section provides instructions, explanations and examples for the performance of all phases of an Operational Readiness Review (ORR). Details pertinent to the Team Leader (TL), Team Members (TM) and Review Coordinator (RC) are outlined. An appendix contains sample forms and correspondence which are typically used to initiate and perform the ORR. Although this document was written specifically for use by DOE ORR Team Leaders, its use may also be beneficial to contractor ORR Team Leaders. The handbook is also useful for Team Leaders of Readiness Assessments conducted in accordance with requirements of DOE O 425.1. Lessons learned, which are promulgated with this handbook, will benefit any line manager, particularly those preparing a facility or process for startup or restart.

  4. DOE Zero Energy Ready Home Case Study: Leganza Residence - Greenbank, Washington

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready Home in Greenbank, Washington that scored HERS 37 without PV and a -5 with PV. This 1,955 ft2 custom home has 6.5-inch structural insulated panel (SIPs) walls, a 10.25-inch SIPS roof, an R-20 insulated slab, a 2-ton ground source heat pump, radiant floor heat, 7.1 kWh PV, and triple-pane windows.

  5. The ATLAS Trigger System: Ready for Run 2

    E-Print Network [OSTI]

    Czodrowski, Patrick; The ATLAS collaboration

    2015-01-01

    The ATLAS trigger system has been used successfully for data collection in the 2009-2013 Run 1 operation cycle of the CERN Large Hadron Collider (LHC) at center-of-mass energies of up to 8 TeV. With the restart of the LHC for the new Run 2 data-taking period at 13 TeV, the trigger rates are expected to rise by approximately a factor of 5. This presentation gave a brief overview of the upgrades to the ATLAS trigger system that have been implemented during the LHC shutdown period in order to deal with the increased trigger rates while efficiently selecting the physics processes of interest. These upgrades include changes to the L1 calorimeter trigger, the introduction of a new L1 topological trigger module, improvements in the L1 muon system, and the merging of the previously two-level HLT system into a single processing farm.

  6. Hydrogen Production via a Commercially Ready Inorganic membrane Reactor

    SciTech Connect (OSTI)

    Paul K.T. Liu

    2005-08-23

    Single stage low-temperature-shift water-gas-shift (WGS-LTS) via a membrane reactor (MR) process was studied through both mathematical simulation and experimental verification in this quarter. Our proposed MR yields a reactor size that is 10 to >55% smaller than the comparable conventional reactor for a CO conversion of 80 to 90%. In addition, the CO contaminant level in the hydrogen produced via MR ranges from 1,000 to 4,000 ppm vs 40,000 to >70,000 ppm via the conventional reactor. The advantages of the reduced WGS reactor size and the reduced CO contaminant level provide an excellent opportunity for intensification of the hydrogen production process by the proposed MR. To prepare for the field test planned in Yr III, a significant number (i.e., 98) of full-scale membrane tubes have been produced with an on-spec ratio of >76% during this first production trial. In addition, an innovative full-scale membrane module has been designed, which can potentially deliver >20 to 30 m{sup 2}/module making it suitable for large-scale applications, such as power generation. Finally, we have verified our membrane performance and stability in a refinery pilot testing facility on a hydrocracker purge gas. No change in membrane performance was noted over the >100 hrs of testing conducted in the presence of >30% H{sub 2}S, >5,000 ppm NH{sub 3} (estimated), and heavy hydrocarbons on the order of 25%. The high stability of these membranes opens the door for the use of our membrane in the WGS environment with significantly reduced pretreatment burden.

  7. Dimensionality and Measurement Invariance of a SchoolReadiness Screener by Gender and Parent EducationLevels

    E-Print Network [OSTI]

    Furlong, Michael James

    2015-01-01

    school. Sociology of Education, 61, 147 –159. Retrieved fromThe flat world and education: How America’s commitment toParent involvement in education as a moderator of family and

  8. UTILITY ADVANCED TURBINE SYSTEMS(ATS) TECHNOLOGY READINESS TESTING

    SciTech Connect (OSTI)

    Kenneth A. Yackly

    2001-06-01

    The following paper provides an overview of GE's H System{trademark} technology, and specifically, the design, development, and test activities associated with the DOE Advanced Turbine Systems (ATS) program. There was intensive effort expended in bringing this revolutionary advanced technology program to commercial reality. In addition to describing the magnitude of performance improvement possible through use of H System{trademark} technology, this paper discusses the technological milestones during the development of the first 9H (50Hz) and 7H (60 Hz) gas turbines. To illustrate the methodical product development strategy used by GE, this paper discusses several technologies that were essential to the introduction of the H System{trademark}. Also included are analyses of the series of comprehensive tests of materials, components and subsystems that necessarily preceded full scale field testing of the H System{trademark}. This paper validates one of the basic premises with which GE started the H System{trademark} development program: exhaustive and elaborate testing programs minimized risk at every step of this process, and increase the probability of success when the H System{trademark} is introduced into commercial service. In 1995, GE, the world leader in gas turbine technology for over half a century, in conjunction with the DOE National Energy Technology Laboratory's ATS program, introduced its new generation of gas turbines. This H System{trademark} technology is the first gas turbine ever to achieve the milestone of 60% fuel efficiency. Because fuel represents the largest individual expense of running a power plant, an efficiency increase of even a single percentage point can substantially reduce operating costs over the life of a typical gas-fired, combined-cycle plant in the 400 to 500 megawatt range. The H System{trademark} is not simply a state-of-the-art gas turbine. It is an advanced, integrated, combined-cycle system in which every component is optimized for the highest level of performance. The unique feature of an H-technology combined-cycle system is the integrated heat transfer system, which combines both the steam plant reheat process and gas turbine bucket and nozzle cooling. This feature allows the power generator to operate at a higher firing temperature than current technology units, thereby resulting in dramatic improvements in fuel-efficiency. The end result is the generation of electricity at the lowest, most competitive price possible. Also, despite the higher firing temperature of the H System{trademark}, the combustion temperature is kept at levels that minimize emission production. GE has more than 3.6 million fired hours of experience in operating advanced technology gas turbines, more than three times the fired hours of competitors' units combined. The H System{trademark} design incorporates lessons learned from this experience with knowledge gleaned from operating GE aircraft engines. In addition, the 9H gas turbine is the first ever designed using ''Design for Six Sigma'' methodology, which maximizes reliability and availability throughout the entire design process. Both the 7H and 9H gas turbines will achieve the reliability levels of our F-class technology machines. GE has tested its H System{trademark} gas turbine more thoroughly than any previously introduced into commercial service. The H System{trademark} gas turbine has undergone extensive design validation and component testing. Full-speed, no-load testing of the 9H was achieved in May 1998 and pre-shipment testing was completed in November 1999. The 9H will also undergo approximately a half-year of extensive demonstration and characterization testing at the launch site. Testing of the 7H began in December 1999, and full speed, no-load testing was completed in February 2000. The 7H gas turbine will also be subjected to extensive demonstration and characterization testing at the launch site.

  9. DOE Zero Energy Ready Home Case Study: The Imery Group — Proud Green Home, Serenbe, GA

    SciTech Connect (OSTI)

    none,

    2014-09-01

    The first certified Zero Energy Ready Home in Georgia was honored in the Custom Builder category of the 2014 Housing Innovation Awards. The 2,811-ft2, two-story custom home has 2x6 advanced framed walls filled with R-20 of open-cell spray foam, plus an R-6.6 insulated coated OSB sheathing. Also included is electronic monitoring equipment that tracks the PV, solar thermal water heater, ERV, mini-split heat pump with three indoor heads, solar water heater, and LED and CFL lighting.

  10. Data Center Energy Efficiency and Renewable Energy Site Assessment: Anderson Readiness Center; Salem, Oregon

    SciTech Connect (OSTI)

    Metzger, I.; Van Geet, O.

    2014-06-01

    This report summarizes the results from the data center energy efficiency and renewable energy site assessment conducted for the Oregon Army National Guard in Salem, Oregon. A team led by NREL conducted the assessment of the Anderson Readiness Center data centers March 18-20, 2014 as part of ongoing efforts to reduce energy use and incorporate renewable energy technologies where feasible. Although the data centers in this facility account for less than 5% of the total square footage, they are estimated to be responsible for 70% of the annual electricity consumption.

  11. DOE Zero Energy Ready Home Case Study: Healthy Efficient Homes - Spirit Lake, Iowa

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready Home in Spirit Lake, Iowa, that scored HERS 41 without PV and HERS 28 with PV. This 3,048 ft2 custom home has advanced framed walls filled with 1.5 inches closed-cell spray foam, a vented attic with spray foam-sealed top plates and blown fiberglass over the ceiling deck. R-23 basement walls are ICF plus two 2-inch layers of EPS. The house also has a mini-split heat pump, fresh air fan intake, and a solar hot water heater.

  12. DOE Zero Energy Ready Home Case Study: Durable Energy Builders - Houston, Texas

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready Home in Houston, Texas, that scored HERS 39 without PV and HERS 29 with PV. This 5,947 ft2 custom home has 11.5-inch ICF walls. The attic is insulated along the roof line with 5 to 7 inches of open-cell spray foam. Most of the home's drinking water is supplied by a 11,500-gallon rainwater cistern. Hurricane strapping connects the roof to the walls. The triple-pane windows are impact resistant. The foundation is a raised slab.

  13. DOE Zero Energy Ready Home Case Study: Near Zero Maine Home II - Vassalboro, Maine

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready home in Vassalboro, Maine, that scored HERS 35 without PV and HERS 11 with PV. This 1,200 ft2 home has 10.5-inch-thick double-walls with 3 layers of mineral wool batt insulation, an R-20 insulated slab, R-70 cellulose in the attic, extensive air sealing, a mini-split heat pump, an heat recovery ventilator, solar water heating, LED lighting, 3.9 kWh PV, and triple-pane windows.

  14. DOE Zero Energy Ready Home Case Study: Shore Road Project - Old Greenwich, Connecticut

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready Home in Old Greenwich, CT, that scored HERS 40 without PV and HERS 27 with PV. This 4,100 ft2 custom home has 13-inch ICF basement walls and 11-inch ICF above-grade walls with a closed-cell spray foam-insulated roof deck, and a continuously running ERV. The house has a dual-fuel heat pump, an instantaneous condensing water heater, and 4.5-kW solar shingles.

  15. AVTA: Reports on Plug-in Electric Vehicle Readiness at 3 DOD Facilities

    Broader source: Energy.gov [DOE]

    The Vehicle Technologies Office's Advanced Vehicle Testing Activity carries out testing on a wide range of advanced vehicles and technologies on dynamometers, closed test tracks, and on-the-road. These results provide benchmark data that researchers can use to develop technology models and guide future research and development. The following reports analyze data and survey results on readiness for the use of plug-in electric vehicles on the Naval Air Station Jacksonville, Naval Station Mayport, and Joint Base Lewis McChord, as informed by the AVTA's testing on plug-in electric vehicle charging equipment. This research was conducted by Idaho National Laboratory.

  16. Ohio-Kentucky-Indiana Regional Council of Governments Solar Ready Construction Guidelines

    Broader source: Energy.gov [DOE]

    These voluntary guidelines are developed for the local governments of the OKI region to provide guidance for residential developers, home builders, and architects in the design and construction of new residential buildings. These guidelines are intended to guide a developer, architect, or other interested party through the components of building design required to prepare a building for future solar installation. These guidelines include best practices for solar-ready building design to minimize the costs of future solar installation while maximizing potential system efficiency and apply to site selection, building design, and building construction.

  17. DOE Zero Energy Ready Home Case Study: Montlake Modern - Seattle, Washington

    SciTech Connect (OSTI)

    none,

    2014-11-01

    This case study describes a DOE Zero Energy Ready Home in Seattle, WA, that scored HERS 42 without PV and a -1 with PV. This 3,192 ft2 custom home has 6-inch SIP walls, a 12-inch SIP roof, an R-28 ICF-insulated foundation slab edge with R-20 rigid foam under the slab; an air-to-water heat pump plus radiant floor heat; 100% LED lighting; filtered-fan-powered fresh air intake; triple-pane windows, 9.7 kWh PV for electric car charging station.

  18. OTM and UTARI personnel will perform Technology

    E-Print Network [OSTI]

    Huang, Haiying

    to interested 3 rd party, who develops & commercializes the technology; Licensee pays patent costs; UTAOTM and UTARI personnel will perform Technology Readiness (TRL) & Manufacturing Readiness (MRL to the Office of Technology Management via the OTM webpage OTM and UTARI personnel will review the IPD and meet

  19. The Navy must be ready to fight and win today, while building the ability to prevail into the future. Education is our asymmetric advantage in developing

    E-Print Network [OSTI]

    CONCLUSION The Navy must be ready to fight and win today, while building the ability to prevail. Be Ready. #12;INTRODUCTION Sailors and naval officers­our warfighting force­ constitute the Navy's most prized and valuable resource. Education is our Navy's strategic investment to enhance effectiveness

  20. Use of Residual Solids from Pulp and Paper Mills for Enhancing Strength and Durability of Ready-Mixed Concrete

    SciTech Connect (OSTI)

    Tarun R. Naik; Yoon-moon Chun; Rudolph N. Kraus

    2003-09-18

    This research was conducted to establish mixture proportioning and production technologies for ready-mixed concrete containing pulp and paper mill residual solids and to study technical, economical, and performance benefits of using the residual solids in the concrete. Fibrous residuals generated from pulp and paper mills were used, and concrete mixture proportions and productions technologies were first optimized under controlled laboratory conditions. Based on the mixture proportions established in the laboratory, prototype field concrete mixtures were manufactured at a ready-mixed concrete plant. Afterward, a field construction demonstration was held to demonstrate the production and placement of structural-grade cold-weather-resistant concrete containing residual solids.

  1. Readiness Assurance

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal GasAdministration Medal01 Sandia4) August 20123/%2A en NNSA

  2. Are PHP Applications Ready for Hack? Laleh Eshkevari, Fabien Dos Santos, James R. Cordy, and Giuliano Antoniol

    E-Print Network [OSTI]

    Cordy, James R.

    Are PHP Applications Ready for Hack? Laleh Eshkevari, Fabien Dos Santos, James R. Cordy be more difficult to understand and the source of many bugs. Hack, a new PHP variant endorsed by Facebook the constraints of Hack's static typing. We report evidence that dynamic typing is actually a relatively uncommon

  3. ScratchJr: Computer programming in early childhood education as a pathway to academic readiness and success

    E-Print Network [OSTI]

    Resnick, Mitchel

    1 ScratchJr: Computer programming in early childhood education as a pathway to academic readiness specifically for early childhood education (K-2). This is an educational segment where there are few powerful project will build on the PI's research on technologies in early childhood education, and on the work

  4. DOE Zero Energy Ready Home Case Study: New Town Builders — The ArtiZEN Plan, Denver, CO

    SciTech Connect (OSTI)

    none,

    2014-09-01

    The Grand Winner in the Production Builder category of the 2014 Housing Innovation Awards, this builder plans to convert all of its product lines to DOE Zero Energy Ready Home construction by the end of 2015. This home achieves HERS 38 without photovoltaics (PV) and HERS -3 with 8.0 kW of PV.

  5. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  6. POST HOC STUDY OF A STATE SELECTION PROCESS TO PREDICT STATE READINESS TO PARTICIPATE IN SCHOOLWIDE INCLUSIVE SCHOOL REFORM

    E-Print Network [OSTI]

    Mitchiner, Melinda Sue

    2014-12-31

    by the national center for selecting state partners was predictive of state readiness to participate in schoolwide inclusive school reform, and to assess utility of the process for use by other national centers. The state selection process used by the national...

  7. Getting Ready for the Challenges for the Air Traffic Management for Unmanned Aerial Systems (UAS) C.W. Johnson,

    E-Print Network [OSTI]

    Johnson, Chris

    as EUROCONTROL's Spec-0102 on the Use of Military Unmanned Aerial Vehicles as Operational Air Traffic Outside-1- Getting Ready for the Challenges for the Air Traffic Management for Unmanned Aerial Systems's 08-01: Unmanned Aircraft Systems Operations in the U. S. National Airspace System, as well

  8. DOE Zero Energy Ready Home Case Study: One Sky Homes — Cottle Zero Net Energy Home, San Jose, CA

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This builder took home the Grand Winner prize in the Custom Builder category in the 2014 Housing Innovation Awards for its high performance building science approach. The builder used insulated concrete form blocks to create the insulated crawlspace foundation for its first DOE Zero Energy Ready Home, the first net zero energy new home certified in the state of California.

  9. DOE Zero Energy Ready Home Case Study: Amaris Custom Homes, St. Paul, Minnesota

    SciTech Connect (OSTI)

    2015-06-01

    For this project, Amaris worked with U.S. Department of Energy (DOE) team, NorthernSTAR Building America Partnership, to develop the first Zero Energy Ready Home (ZERH) in Minnesota's cold climate using reasonable, cost-effective, and replicable construction materials and practices. The result is a passive solar, super-efficient 3542-ft2 walkout ranch-style home with all the creature comforts. Along with meeting ZERH standards, Amaris also achieved certifications for Leadership in Energy & Environmental Design for Homes v4, MN Green Path Emerald, and a Builders Association of the Twin Cities Reggie Award of Excellence. The home achieves a HERS score of 41 without photovoltaics; with PV, the home achieves a HERS score of 5.

  10. Hydrogen Infrastructure Market Readiness: Opportunities and Potential for Near-term Cost Reductions; Proceedings of the Hydrogen Infrastructure Market Readiness Workshop and Summary of Feedback Provided through the Hydrogen Station Cost Calculator

    SciTech Connect (OSTI)

    Melaina, M. W.; Steward, D.; Penev, M.; McQueen, S.; Jaffe, S.; Talon, C.

    2012-08-01

    Recent progress with fuel cell electric vehicles (FCEVs) has focused attention on hydrogen infrastructure as a critical commercialization barrier. With major automakers focused on 2015 as a target timeframe for global FCEV commercialization, the window of opportunity is short for establishing a sufficient network of hydrogen stations to support large-volume vehicle deployments. This report describes expert feedback on the market readiness of hydrogen infrastructure technology from two activities.

  11. Tool Helps Utilities Assess Readiness for Electric Vehicle Charging (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2011-10-01

    NREL research helps answer a fundamental question regarding electric vehicles: Is the grid ready to handle them? Environmental, economic and security concerns regarding oil consumption make electrifying the transportation sector a high national priority. NREL's Center for Transportation Technologies & Systems (CTTS) has developed a framework for utilities to evaluate the plug-in vehicle (PEV) readiness of distribution transformers. Combining a wealth of vehicle performance statistics with load data from partner utilities including the Hawaiian Electric Company and Xcel Energy, NREL analyzed the thermal loading characteristics of distribution transformers due to vehicle charging. After running millions of simulations replicating varying climates and conditions, NREL is now able to predict aging rates for transformers when PEVs are added to existing building loads. With the NREL tool, users define simulation parameters by inputting vehicle trip and weather data; transformer load profiles and ratings; PEV penetration, charging rates and battery sizes; utility rates; the number of houses on each transformer; and public charging availability. Transformer load profiles, drive cycles, and ambient temperature data are then run through the thermal model to produce a one-year timeseries of the hotspot temperature. Annual temperature durations are calculated to help determine the annual aging rate. Annual aging rate results are grouped by independent variables. The most useful measure is transformer mileage, a measure of how many electrically-driven miles must be supplied by the transformer. Once the spectrum analysis has been conducted for an area or utility, the outputs can be used to help determine if more detailed evaluation is necessary, or if transformer replacement is required. In the majority of scenarios, transformers have enough excess capacity to charge PEVs. Only in extreme cases does vehicle charging have negative long-term impact on transformers. In those cases, upgrades to larger transformers would be recommended. NREL analysis also showed opportunity for newly-installed smart grids to offset distribution demands by time-shifting the charging loads. Most importantly, the model demonstrated synergies between PEVs and distributed renewables, not only providing clean renewable energy for vehicles, but also reducing demand on the entire distribution infrastructure by supplying loads at the point of consumption.

  12. DOE Zero Energy Ready Home Case Study: John Hubert Associates — EXIT-0 House, North Cape May, NJ

    SciTech Connect (OSTI)

    none,

    2014-09-01

    This house is the first DOE Zero Energy Ready Home for this builder and won a Custom Builder award in the 2014 Housing Innovation Awards. The 1,871-ft2 home features advanced-framed above-grade walls with R-21 fiberglass batt plus an R-3.6-insulated coated OSB sheathing, R-18 rigid-foam-insulated crawlspace walls, solar water heating, a high-efficiency heat pump, an HRV, and mostly LED lighting.

  13. Analyses of Value-added for Case-ready Beef, with Special Emphasis on Texas. 

    E-Print Network [OSTI]

    Dietrich, R.A.; Farris, D.E.; Ward, J.B

    1992-01-01

    hundredweight cost advantages over other alternative packaging/ distribu tion systems (Table 35): (1) $1.00 over tray-ready, (2) $3.00 over central overwrap, (3) Almost $7.00 over central frozen, (4) Almost $9.00 over boxed beef (the pre- dominant 1988....48 165.48 Fixed 0.84 1.10 1.00 1.18 1.18 1.18 0.93 Labor 2.86 5.53 9.73 9.76 9.76 9.76 16.06 Package 2.24 2.60 5.21 10.10 18.43 10.10 10.10 Distribution 2.75 2.75 5.35 2.75 3.72 2.27 4.20 Other 2.86 10.03 10.34 10.34 11.34 16.04 11 .78 Sub-Total 177...

  14. National high-level waste systems analysis plan

    SciTech Connect (OSTI)

    Kristofferson, K.; Oholleran, T.P.; Powell, R.H.; Thiel, E.C.

    1995-05-01

    This document details the development of modeling capabilities that can provide a system-wide view of all US Department of Energy (DOE) high-level waste (HLW) treatment and storage systems. This model can assess the impact of budget constraints on storage and treatment system schedules and throughput. These impacts can then be assessed against existing and pending milestones to determine the impact to the overall HLW system. A nation-wide view of waste treatment availability will help project the time required to prepare HLW for disposal. The impacts of the availability of various treatment systems and throughput can be compared to repository readiness to determine the prudent application of resources or the need to renegotiate milestones.

  15. New Whole-House Solutions Case Study: EcoVillage: A Net Zero Energy Ready Community, Ithaca, New York

    SciTech Connect (OSTI)

    2015-04-01

    The Consortium for Advanced Residential Buildings is working with the EcoVillage co-housing community and builder AquaZephyr in Ithaca, New York, on their third neighborhood called the Third Residential EcoVillage Experience (TREE). This community-scale project consists of 40 housing units—15 apartments, and 25 single family residences that range in size from 1,250 ft2–1,664 ft2 and cost from $80,000 to $235,000. The community is pursing DOE Zero Energy Ready Home (ZERH), US Green Building Council Leadership in Energy and Environmental Design (LEED) Gold, and ENERGY STAR certifications for the entire project.

  16. Distributing leadership to teachers through a District Level Math Council

    E-Print Network [OSTI]

    Robertson, Melavel Odviar

    2008-01-01

    courses, Math 7, Introduction to High School Algebra, andnew math courses to enhance student readiness for Algebra,math achievement and in particular, in year two, to Algebra

  17. SIMULTANEOUS PRODUCTION OF HIGH-PURITY HYDROGEN AND SEQUESTRATION-READY CO2 FROM SYNGAS

    SciTech Connect (OSTI)

    Linda Denton; Hana Lorethova; Tomasz Wiltowski; Court Moorefield; Parag Kulkarni; Vladimir Zamansky; Ravi Kumar

    2003-12-01

    This final report summarizes the progress made on the program ''Simultaneous Production of High-Purity Hydrogen and Sequestration-Ready CO{sub 2} from Syngas (contract number DE-FG26-99FT40682)'', during October 2000 through September of 2003. GE Energy and Environmental Research (GE-EER) and Southern Illinois University (SIU) at Carbondale conducted the research work for this program. This program addresses improved methods to efficiently produce simultaneous streams of high-purity hydrogen and separated carbon dioxide from synthesis gas (syngas). The syngas may be produced through either gasification of coal or reforming of natural gas. The process of production of H{sub 2} and separated CO{sub 2} utilizes a dual-bed reactor and regenerator system. The reactor produces hydrogen and the regenerator produces separated CO{sub 2}. The dual-bed system can be operated under either a circulating fluidized-bed configuration or a cyclic fixed-bed configuration. Both configurations were evaluated in this project. The experimental effort was divided into lab-scale work at SIU and bench-scale work at GE-EER. Tests in a lab-scale fluidized bed system demonstrated the process for the conversion of syngas to high purity H{sub 2} and separated CO{sub 2}. The lab-scale system generated up to 95% H{sub 2} (on a dry basis). Extensive thermodynamic analysis of chemical reactions between the syngas and the fluidized solids determined an optimum range of temperature and pressure operation, where the extent of the undesirable reactions is minimum. The cycling of the process between hydrogen generation and oxygen regeneration has been demonstrated. The fluidized solids did not regenerate completely and the hydrogen purity in the reuse cycle dropped to 70% from 95% (on a dry basis). Changes in morphology and particle size may be the most dominant factor affecting the efficiency of the repeated cycling between hydrogen production and oxygen regeneration. The concept of simultaneous production of hydrogen and separated stream of CO{sub 2} was proved using a fixed bed 2 reactor system at GE-EER. This bench-scale cyclic fixed-bed reactor system designed to reform natural gas to syngas has been fabricated in another coordinated DOE project. This system was modified to reform natural gas to syngas and then convert syngas to H{sub 2} and separated CO{sub 2}. The system produced 85% hydrogen (dry basis).

  18. White Paper for U.S. Army Rapid Equipping Force: Waste Heat Recovery with Thermoelectric and Lithium-Ion Hybrid Power System

    SciTech Connect (OSTI)

    Farmer, J C

    2007-11-26

    By harvesting waste heat from engine exhaust and storing it in light-weight high-capacity modules, it is believed that the need for energy transport by convoys can be lowered significantly. By storing this power during operation, substantial electrical power can be provided during long periods of silent operation, while the engines are not operating. It is proposed to investigate the potential of installing efficient thermoelectric generators on the exhaust systems of trucks and other vehicles to generate electrical power from the waste heat contained in the exhaust and to store that power in advanced power packs comprised of polymer-gel lithium ion batteries. Efficient inexpensive methods for production of the thermoelectric generator are also proposed. The technology that exists at LLNL, as well as that which exists at industrial partners, all have high technology readiness level (TRL). Work is needed for integration and deployment.

  19. Demonstration of high contrast with an obscured aperture with the WFIRST-AFTA shaped pupil coronagraph

    E-Print Network [OSTI]

    Cady, Eric; An, Xin; Balasubramanian, Kunjithapatham; Diaz, Rosemary; Kasdin, N Jeremy; Kern, Brian; Kuhnert, Andreas; Nemati, Bijan; Poberezhskiy, Ilya; Riggs, A J Eldorado; Zimmer, Robert; Zimmerman, Neil

    2015-01-01

    The coronagraph instrument on the WFIRST-AFTA mission study has two coronagraphic architectures, shaped pupil and hybrid Lyot, which may be interchanged for use in different observing scenarios. Each architecture relies on newly-developed mask components to function in the presence of the AFTA aperture, and so both must be matured to a high technology readiness level (TRL) in advance of the mission. A series of milestones were set to track the development of the technologies required for the instrument; in this paper, we report on completion of WFIRST-AFTA Coronagraph Milestone 2---a narrowband $10^{-8}$ contrast test with static aberrations for the shaped pupil---and the plans for the upcoming broadband Coronagraph Milestone 5.

  20. Process improvement to the inspection readiness plan in chemical weapons convention challenge inspections. Master`s thesis

    SciTech Connect (OSTI)

    Triplett, W.M.

    1997-09-01

    This thesis identified current Information Technology initiatives to help improve the Navy`s Inspection Readiness Plan for Chemical Warfare Convention (CWC) Challenge Inspection. The CWC is an intensive inspection. The Challenge Inspection allows for a team of international inspectors to inspect a naval facility suspected of violating the CWC on very short notice. This thesis begins with a review of the CWC Challenge Inspection timeline. It then describes the Navy`s Inspection Readiness Plan for CWC Challenge Inspections as well as the Navy Tiger Team that is sent to naval facilities to assist the Commanding Officer and base personnel during inspections. One of the initiatives evaluated by this analysis is the use of videoconferencing. To ascertain the feasibility of using videoconferencing in the CWC Challenge Inspection process, this thesis reviews the current videoconferencing systems and standards, and the results of a questionnaire that was sent to various naval commands. This thesis concludes with recommendations for inclusion of videoconferencing and various other Information Technology initiatives in the CWC Challenge Inspection process.

  1. Recommendations for Tritium Science and Technology Research and Development in Support of the Tritium Readiness Campaign, TTP-7-084

    SciTech Connect (OSTI)

    Senor, David J.

    2013-10-30

    Between 2006 and 2012 the Tritium Readiness Campaign Development and Testing Program produced significant advances in the understanding of in-reactor TPBAR performance. Incorporating these data into existing TPBAR performance models has improved permeation predictions, and the discrepancy between predicted and observed tritium permeation in the WBN1 coolant has been decreased by about 30%. However, important differences between predicted and observed permeation still remain, and there are significant knowledge gaps that hinder the ability to reliably predict other aspects of TPBAR performance such as tritium distribution, component integrity, and performance margins. Based on recommendations from recent Tritium Readiness Campaign workshops and reviews coupled with technical and programmatic priorities, high-priority activities were identified to address knowledge gaps in the near- (3-5 year), middle- (5-10 year), and long-term (10+ year) time horizons. It is important to note that there are many aspects to a well-integrated research and development program. The intent is not to focus exclusively on one aspect or another, but to approach the program in a holistic fashion. Thus, in addition to small-scale tritium science studies, ex-reactor tritium technology experiments such as TMED, and large-scale in-reactor tritium technology experiments such as TMIST, a well-rounded research and development program must also include continued analysis of WBN1 performance data and post-irradiation examination of TPBARs and lead use assemblies to evaluate model improvements and compare separate-effects and integral component behavior.

  2. The Enterprise Level Roadmap

    E-Print Network [OSTI]

    Lean Advancement Initiative

    2000-01-01

    The Enterprise Level Roadmap is part of a Transition-To-Lean Guide, a three volume set of materials designed to help a user navigate through the Roadmap at increasingly deeper levels of detail.

  3. Snohomish PUD No 1 (TRL 7 8 System) - Puget Sound Pilot Tidal Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy BillsNo.Hydrogen4Energy Smooth Brome Monitoring at RockyProject |

  4. Measuring the maturity of a technology : guidance on assigning a TRL.

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(JournalspectroscopyReport) | SciTechelement method inBook: Measuring

  5. Measuring the maturity of a technology : guidance on assigning a TRL.

    Office of Scientific and Technical Information (OSTI)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfate Reducing(JournalspectroscopyReport) | SciTechelement method inBook: Measuring(Technical Report)

  6. Dehlsen (TRL 5 6 System) - Aquantis C-Plane Ocean Current Turbine Project |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 20153Daniel BoffDepartment ofCondition | Department

  7. Free Flow Energy (TRL 1 2 3 Component) - Design and Development of a

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015ExecutiveFluorescent LampFort Collins,47328 Vol.

  8. Whitestone Power & Communications (TRL 1 2 3 System) - Whitestone Poncelet

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematics And Statistics » USAJobs SearchAMERICA'S FUTURE.ProjectsLeaders | Department ofRISEC Project |

  9. Hanford low-level vitrification melter testing -- Master list of data submittals

    SciTech Connect (OSTI)

    Hendrickson, D.W.

    1995-03-15

    The Westinghouse Hanford Company (WHC) is conducting a two-phased effort to evaluate melter system technologies for vitrification of liquid low-level radioactive waste (LLW) streams. The evaluation effort includes demonstration testing of selected glass melter technologies and technical reports regarding the applicability of the glass melter technologies to the vitrification of Hanford LLW tank waste. The scope of this document is to identify and list vendor document submittals in technology demonstration support of the Hanford Low-Level Waste Vitrification melter testing program. The scope of this document is limited to those documents responsive to the Statement of Work, accepted and issued by the LLW Vitrification Program. The purpose of such a list is to maintain configuration control of vendor supplied data and to enable ready access to, and application of, vendor supplied data in the evaluation of melter technologies for the vitrification of Hanford low-level tank wastes.

  10. Development of the Write Process for Pipeline-Ready Heavy Oil

    SciTech Connect (OSTI)

    Lee Brecher; Charles Mones; Frank Guffey

    2009-03-07

    Work completed under this program advances the goal of demonstrating Western Research Institute's (WRI's) WRITE{trademark} process for upgrading heavy oil at field scale. MEG Energy Corporation (MEG) located in Calgary, Alberta, Canada supported efforts at WRI to develop the WRITE{trademark} process as an oil sands, field-upgrading technology through this Task 51 Jointly Sponsored Research project. The project consisted of 6 tasks: (1) optimization of the distillate recovery unit (DRU), (2) demonstration and design of a continuous coker, (3) conceptual design and cost estimate for a commercial facility, (4) design of a WRITE{trademark} pilot plant, (5) hydrotreating studies, and (6) establish a petroleum analysis laboratory. WRITE{trademark} is a heavy oil and bitumen upgrading process that produces residuum-free, pipeline ready oil from heavy material with undiluted density and viscosity that exceed prevailing pipeline specifications. WRITE{trademark} uses two processing stages to achieve low and high temperature conversion of heavy oil or bitumen. The first stage DRU operates at mild thermal cracking conditions, yielding a light overhead product and a heavy residuum or bottoms material. These bottoms flow to the second stage continuous coker that operates at severe pyrolysis conditions, yielding light pyrolyzate and coke. The combined pyrolyzate and mildly cracked overhead streams form WRITE{trademark}'s synthetic crude oil (SCO) production. The main objectives of this project were to (1) complete testing and analysis at bench scale with the DRU and continuous coker reactors and provide results to MEG for process evaluation and scale-up determinations and (2) complete a technical and economic assessment of WRITE{trademark} technology to determine its viability. The DRU test program was completed and a processing envelope developed. These results were used for process assessment and for scaleup. Tests in the continuous coker were intended to determine the throughput capability of the coker so a scaled design could be developed that maximized feed rate for a given size of reactor. These tests were only partially successful because of equipment problems. A redesigned coker, which addressed the problems, has been build but not operated. A preliminary economic analysis conducted by MEG and an their engineering consultant concluded that the WRITE{trademark} process is a technically feasible method for upgrading bitumen and that it produces SCO that meets pipeline specifications for density. When compared to delayed coking, the industry benchmark for thermal upgrading of bitumen, WRITE{trademark} produced more SCO, less coke, less CO{sub 2} per barrel of bitumen fed, and had lower capital and operating costs. On the other hand, WRITE{trademark}'s lower processing severity yielded crude with higher density and a different product distribution for naphtha, light gas oil and vacuum oil that, taken together, might reduce the value of the SCO. These issues plus the completion of more detailed process evaluation and economics need to be resolved before WRITE{trademark} is deployed as a field-scale pilot.

  11. A PUBLICATION OF THE TEXAS TRANSPORTATION INSTITUTE MEMBER OF THE TEXAS A&M UNIVERSITY SYSTEM VOL. 41 NO. 3 2005 Is Texas ready for

    E-Print Network [OSTI]

    . 41 NO. 3 2005 Is Texas ready for high-speed rail? PAGE 2 Pecos facility open for business PAGE 6 Hall background research to determine the feasibility of high- speed rail in Texas. TTI is serving as a resource agency providing expertise and analytical capabilities to the Texas High- speed Rail and Transportation

  12. In 2006, the Alliance of Coastal Technology (ACT) evaluated the performance of five commercial-ready, in situ turbidity sensors at

    E-Print Network [OSTI]

    Boss, Emmanuel S.

    ABSTRACT In 2006, the Alliance of Coastal Technology (ACT) evaluated the performance of five commercial-ready, in situ turbidity sensors at eight test sites located throughout North America (Fig. 1, and a freshwater lake (Fig. 1) . The sensors used in this study consisted of: A backscatter Turbidity Probe ( =660

  13. Apple Harvest Time! Determining when apples are ready to be harvested can be tricky. You need to know the variety of the apple and its approximate harvest

    E-Print Network [OSTI]

    New Hampshire, University of

    Apple Harvest Time! Determining when apples are ready to be harvested can be tricky. You need to know the variety of the apple and its approximate harvest date. These dates vary each year with fluctuations in blooming rates, degree days and rainfall. If you're growing your own apples, perhaps the best

  14. Math 115 Self-Assessment Test is designed to assist you to determine how ready you are to take Math 115 (Pre-Calculus) at UNBC.

    E-Print Network [OSTI]

    Northern British Columbia, University of

    Math/Stats Math 115 Self-Assessment Test is designed to assist you to determine how ready you are to take Math 115 (Pre-Calculus) at UNBC. Contents 1. About Math 115 2. How to take the Self Assessment Test 3. The Test 4. Scoring the Test, and What to do Next 1. About Math 115 (Pre-Calculus) at UNBC

  15. Reducing Extreme Weather Impacts: Building a Weather-Ready Nation For more than 140 years, the National Weather Service (NWS) has provided weather, water, and climate

    E-Print Network [OSTI]

    Reducing Extreme Weather Impacts: Building a Weather-Ready Nation For more than 140 years, the National Weather Service (NWS) has provided weather, water, and climate information to protect lives also been a year of extreme weather events. The impact of these events, both on lives and the economy

  16. Liquid level detector

    DOE Patents [OSTI]

    Grasso, A.P.

    1984-02-21

    A liquid level detector for low pressure boilers. A boiler tank, from which vapor, such as steam, normally exits via a main vent, is provided with a vertical side tube connected to the tank at the desired low liquid level. When the liquid level falls to the level of the side tube vapor escapes therethrough causing heating of a temperature sensitive device located in the side tube, which, for example, may activate a liquid supply means for adding liquid to the boiler tank. High liquid level in the boiler tank blocks entry of vapor into the side tube, allowing the temperature sensitive device to cool, for example, to ambient temperature.

  17. Liquid level detector

    DOE Patents [OSTI]

    Grasso, Albert P. (Vernon, CT)

    1986-01-01

    A liquid level detector for low pressure boilers. A boiler tank, from which apor, such as steam, normally exits via a main vent, is provided with a vertical side tube connected to the tank at the desired low liquid level. When the liquid level falls to the level of the side tube vapor escapes therethrough causing heating of a temperature sensitive device located in the side tube, which, for example, may activate a liquid supply means for adding liquid to the boiler tank. High liquid level in the boiler tank blocks entry of vapor into the side tube, allowing the temperature sensitive device to cool, for example, to ambient temperature.

  18. Mathematics from High School to Community College: Preparation, Articulation, and College Un-readiness

    E-Print Network [OSTI]

    Jaffe, Louise

    2012-01-01

    10 Pre Algebra or Gen Math Algebra 1 Algebra 1 GeometryEd Algebra RSP Below Algebra Math 6 Below Alg: Acceleratedre-routing occurs in Pre-Algebra Math 84 3-levels below Math

  19. Timing is everything : along the fossil fuel transition pathway.

    SciTech Connect (OSTI)

    Kobos, Peter Holmes; Walker, La Tonya Nicole; Malczynski, Leonard A.

    2013-10-01

    People save for retirement throughout their career because it is virtually impossible to save all you'll need in retirement the year before you retire. Similarly, without installing incremental amounts of clean fossil, renewable or transformative energy technologies throughout the coming decades, a radical and immediate change will be near impossible the year before a policy goal is set to be in place. Therefore, our research question is,To meet our desired technical and policy goals, what are the factors that affect the rate we must install technology to achieve these goals in the coming decades?' Existing models do not include full regulatory constraints due to their often complex, and inflexible approaches to solve foroptimal' engineering instead ofrobust' and multidisciplinary solutions. This project outlines the theory and then develops an applied software tool to model the laboratory-to-market transition using the traditional technology readiness level (TRL) framework, but develops subsequent and a novel regulatory readiness level (RRL) and market readiness level (MRL). This tool uses the ideally-suited system dynamics framework to incorporate feedbacks and time delays. Future energy-economic-environment models, regardless of their programming platform, may adapt this software model component framework ormodule' to further vet the likelihood of new or innovative technology moving through the laboratory, regulatory and market space. The prototype analytical framework and tool, called the Technology, Regulatory and Market Readiness Level simulation model (TRMsim) illustrates the interaction between technology research, application, policy and market dynamics as they relate to a new or innovative technology moving from the theoretical stage to full market deployment. The initial results that illustrate the model's capabilities indicate for a hypothetical technology, that increasing the key driver behind each of the TRL, RRL and MRL components individually decreases the time required for the technology to progress through each component by 63, 68 and 64%, respectively. Therefore, under the current working assumptions, to decrease the time it may take for a technology to move from the conceptual stage to full scale market adoption one might consider expending additional effort to secure regulatory approval and reducing the uncertainty of the technology's demand in the marketplace.

  20. New Whole-House Solutions Case Study: Zero Energy Ready Home Multifamily Project: Mutual Housing at Spring Lake

    SciTech Connect (OSTI)

    D. Springer and A. German

    2015-09-01

    Building cost effective, high performance homes that provide superior comfort, health, and durability is the goal of the Department of Energy's (DOE's) Zero Energy Ready Homes (ZERH) program. This case study describes the development of a 62-unit multifamily community constructed by nonprofit developer Mutual Housing at the Spring Lake subdivision in Woodland, California. The Spring Lake project is expected to be the first ZERH-certified multifamily project nationwide. Building America team Alliance for Residential Building Innovation worked with Mutual Housing throughout the project. An objective of this project was to gain a highly visible foothold for residential buildings built to the DOE ZERH specification that can be used to encourage participation by other California builders.

  1. GaN-Ready Aluminum Nitride Substrates for Cost-Effective, Very Low Dislocation Density III-Nitride LED's

    SciTech Connect (OSTI)

    Sandra Schujman; Leo Schowalter

    2010-10-15

    The objective of this project was to develop and then demonstrate the efficacy of a costeffective approach for a low defect density substrate on which AlInGaN LEDs can be fabricated. The efficacy of this “GaN-ready” substrate would then be tested by growing high efficiency, long lifetime InxGa1-xN blue LEDs. The approach used to meet the project objectives was to start with low dislocation density AlN single-crystal substrates and grow graded AlxGa1-xN layers on top. Pseudomorphic AlxGa1-xN epitaxial layers grown on bulk AlN substrates were used to fabricate light emitting diodes and demonstrate better device performance as a result of the low defect density in these layers when benched marked against state-of-the-art LEDs fabricated on sapphire substrates. The pseudomorphic LEDs showed excellent output powers compared to similar wavelength devices grown on sapphire substrates, with lifetimes exceeding 10,000 hours (which was the longest time that could reliably be estimated). In addition, high internal quantum efficiencies were demonstrated at high driving current densities even though the external quantum efficiencies were low due to poor photon extraction. Unfortunately, these pseudomorphic LEDs require high Al content so they emit in the ultraviolet. Sapphire based LEDs typically have threading dislocation densities (TDD) > 108 cm-2 while the pseudomorphic LEDs have TDD ? 105 cm-2. The resulting TDD, when grading the AlxGa1-xN layer all the way to pure GaN to produce a “GaN-ready” substrate, has varied between the mid 108 down to the 106 cm-2. These inconsistencies are not well understood. Finally, an approach to improve the LED structures on AlN substrates for light extraction efficiency was developed by thinning and roughening the substrate.

  2. Tiltmeter leveling mechanism

    DOE Patents [OSTI]

    Hunter, Steven L. (Livermore, CA); Boro, Carl O. (Milpitas, CA); Farris, Alvis (late of Byron, CA)

    2002-01-01

    A tiltmeter device having a pair of orthogonally disposed tilt sensors that are levelable within an inner housing containing the sensors. An outer housing can be rotated to level at least one of the sensor pair while the inner housing can be rotated to level the other sensor of the pair. The sensors are typically rotated up to about plus or minus 100 degrees. The device is effective for measuring tilts in a wide range of angles of inclination of wells and can be employed to level a platform containing a third sensor.

  3. Precision liquid level sensor

    DOE Patents [OSTI]

    Field, Michael E. (Albuquerque, NM); Sullivan, William H. (Albuquerque, NM)

    1985-01-01

    A precision liquid level sensor utilizes a balanced R. F. bridge, each arm including an air dielectric line. Changes in liquid level along one air dielectric line imbalance the bridge and create a voltage which is directly measurable across the bridge.

  4. Precision liquid level sensor

    DOE Patents [OSTI]

    Field, M.E.; Sullivan, W.H.

    1985-01-29

    A precision liquid level sensor utilizes a balanced R. F. bridge, each arm including an air dielectric line. Changes in liquid level along one air dielectric line imbalance the bridge and create a voltage which is directly measurable across the bridge. 2 figs.

  5. The readiness of ATLAS Trigger-DAQ system for the second LHC run

    E-Print Network [OSTI]

    Rammensee, Michael; The ATLAS collaboration

    2015-01-01

    After its first shutdown, LHC will provide pp collisions with increased luminosity and energy. In the ATLAS experiment, the Trigger and Data Acquisition (TDAQ) system has been upgraded to deal with the increased event rates. The updated system is radically different from the previous implementation, both in terms of architecture and expected performance. The main architecture has been reshaped in order to profit from the technological progress and to maximize the flexibility and efficiency of the data selection process. The trigger system in ATLAS consists of a hardware Level-1 (L1) and a software based high-level trigger (HLT) that reduces the event rate from the design bunch-crossing rate of 40 MHz to an average recording rate of a few hundred Hz. The pre-existing two-level software filtering, known as L2 and the Event Filter, are now merged into a single process, performing incremental data collection and analysis. This design has many advantages, among which are: the radical simplification of the architec...

  6. FUEL-FLEXIBLE GASIFICATION-COMBUSTION TECHNOLOGY FOR PRODUCTION OF H2 AND SEQUESTRATION-READY CO2

    SciTech Connect (OSTI)

    George Rizeq; Janice West; Arnaldo Frydman; Vladimir Zamansky; Linda Denton; Hana Loreth; Tomasz Wiltowski

    2001-07-01

    It is expected that in the 21st century the Nation will continue to rely on fossil fuels for electricity, transportation, and chemicals. It will be necessary to improve both the thermodynamic efficiency and environmental impact performance of fossil fuel utilization. General Electric Energy and Environmental Research Corporation (GE EER) has developed an innovative fuel-flexible Advanced Gasification-Combustion (AGC) concept to produce H{sub 2} and sequestration-ready CO{sub 2} from solid fuels. The AGC module offers potential for reduced cost and increased energy efficiency relative to conventional gasification and combustion systems. GE EER was awarded a Vision-21 program from U.S. DOE NETL to develop the AGC technology. Work on this three-year program started on October 1, 2000. The project team includes GE EER, California Energy Commission, Southern Illinois University at Carbondale, and T. R. Miles, Technical Consultants, Inc. In the AGC technology, coal/opportunity fuels and air are simultaneously converted into separate streams of (1) pure hydrogen that can be utilized in fuel cells, (2) sequestration-ready CO{sub 2}, and (3) high temperature/pressure oxygen-depleted air to produce electricity in a gas turbine. The process produces near-zero emissions and, based on preliminary modeling work in the first quarter of this program, has an estimated process efficiency of approximately 67% based on electrical and H{sub 2} energy outputs relative to the higher heating value of coal. The three-year R&D program will determine the operating conditions that maximize separation of CO{sub 2} and pollutants from the vent gas, while simultaneously maximizing coal conversion efficiency and hydrogen production. The program integrates lab-, bench- and pilot-scale studies to demonstrate the AGC concept. This is the third quarterly technical progress report for the Vision-21 AGC program supported by U.S. DOE NETL (Contract: DE-FC26-00FT40974). This report summarizes program accomplishments for the period starting April 1, 2001 and ending June 30, 2001. The report includes an introduction summarizing the AGC concept, main program tasks, objectives of this program, and provides a summary of program activities covering program management and progress in first year tasks including lab- and bench-scale design, facilities preparation, and engineering studies.

  7. DOE Zero Energy Ready Home Case Study: Mandalay Homes, Phoenix, Arizona

    SciTech Connect (OSTI)

    none,

    2013-09-01

    This builder built fourteen homes in the Gordon Estates subdivision that achieved Challenge Home certification with HERS 38–58 on an affordable budget for homeowners. Every Mandalay home in the development also met the National Green Building Standard gold level. The Gordon Estates subdivision is also serving as a showcase of energy efficiency, and Mandalay is hosting education workshops for realtors, state and local officials, other builders, students, potential homeowners, and the public. The builder won a 2013 Housing Innovation Award in the affordable builder category.

  8. Guidelines for Participating in the DOE Zero Energy Ready Home | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nA Guide to Tapping STD-1128-2013levelGUIDE TO| Department ofEnergyof

  9. HIA 2015 DOE Zero Energy Ready Home Case Study: BPC Green Builders, Taft School, Watertown, CT

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nA Guide to Tapping STD-1128-2013levelGUIDE TO|GustaveUpdate andTaft School

  10. Ultrasonic liquid level detector

    DOE Patents [OSTI]

    Kotz, Dennis M. (North Augusta, SC); Hinz, William R. (Augusta, GA)

    2010-09-28

    An ultrasonic liquid level detector for use within a shielded container, the detector being tubular in shape with a chamber at its lower end into which liquid from in the container may enter and exit, the chamber having an ultrasonic transmitter and receiver in its top wall and a reflector plate or target as its bottom wall whereby when liquid fills the chamber a complete medium is then present through which an ultrasonic wave may be transmitted and reflected from the target thus signaling that the liquid is at chamber level.

  11. Reevaluation Of Vitrified High-Level Waste Form Criteria For Potential Cost Savings At The Defense Waste Processing Facility

    SciTech Connect (OSTI)

    Ray, J. W.; Marra, S. L.; Herman, C. C.

    2013-01-09

    At the Savannah River Site (SRS) the Defense Waste Processing Facility (DWPF) has been immobilizing SRS's radioactive high level waste (HLW) sludge into a durable borosilicate glass since 1996. Currently the DWPF has poured over 3,500 canisters, all of which are compliant with the U. S. Department of Energy's (DOE) Waste Acceptance Product Specifications for Vitrified High-Level Waste Forms (WAPS) and therefore ready to be shipped to a federal geologic repository for permanent disposal. Due to DOE petitioning to withdraw the Yucca Mountain License Application (LA) from the Nuclear Regulatory Commission (NRC) in 2010 and thus no clear disposal path for SRS canistered waste forms, there are opportunities for cost savings with future canister production at DWPF and other DOE producer sites by reevaluating high-level waste form requirements and compliance strategies and reducing/eliminating those that will not negatively impact the quality of the canistered waste form.

  12. Reevaluation of Vitrified High-Level Waste Form Criteria for Potential Cost Savings at the Defense Waste Processing Facility - 13598

    SciTech Connect (OSTI)

    Ray, J.W. [Savannah River Remediation (United States)] [Savannah River Remediation (United States); Marra, S.L.; Herman, C.C. [Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808 (United States)] [Savannah River National Laboratory, Savannah River Site, Aiken, SC 29808 (United States)

    2013-07-01

    At the Savannah River Site (SRS) the Defense Waste Processing Facility (DWPF) has been immobilizing SRS's radioactive high level waste (HLW) sludge into a durable borosilicate glass since 1996. Currently the DWPF has poured over 3,500 canisters, all of which are compliant with the U. S. Department of Energy's (DOE) Waste Acceptance Product Specifications for Vitrified High-Level Waste Forms (WAPS) and therefore ready to be shipped to a federal geologic repository for permanent disposal. Due to DOE petitioning to withdraw the Yucca Mountain License Application (LA) from the Nuclear Regulatory Commission (NRC) in 2010 and thus no clear disposal path for SRS canistered waste forms, there are opportunities for cost savings with future canister production at DWPF and other DOE producer sites by reevaluating high-level waste form requirements and compliance strategies and reducing/eliminating those that will not negatively impact the quality of the canistered waste form. (authors)

  13. Catalog of documents produced by the Greater-Than-Class C Low-Level Waste Management Program

    SciTech Connect (OSTI)

    Winberg, M.R.

    1995-03-01

    This catalog provides a ready reference for documents prepared by the Greater-Than-Class C Low-Level Waste (GTCC LLW) Management Program. The GTCC LLW Management Program is part of the National Low-Level Waste Management Program (NLLWMP). The NLLWMP is sponsored by the US Department of Energy (DOE) and is responsible for assisting the DOE in meeting its obligations under Public Law 99-240, The Low-Level Radioactive Waste Policy Amendments Act of 1985. This law assigns DOE the responsibility of ensuring the safe disposal of GTCC LLW in a facility licensed by the Nuclear Regulatory Commission (NRC). The NLLWMP is managed at the Idaho National Engineering Laboratory (INEL).

  14. LEVEL 01 FLOOR LEVEL 1 / GROUND FLOOR / SUPPORT SERVICES BUILDING

    E-Print Network [OSTI]

    Lennard, William N.

    LEVEL 01 FLOOR LEVEL 1 / GROUND FLOOR / SUPPORT SERVICES BUILDING 05/02/2012ACCESSIBILITY WESTERN FLOOR PLAN SUPPORT SERVICES BUILDING Level 2 Lower building Rm.2350 1393 WESTERN ROAD N6G -1G9 UPDATE DRAWN #12;LEVEL 02 FLOOR LEVEL 2 / SECOND FLOOR / SUPPORT SERVICES BUILDING 05/02/2012ACCESSIBILITY

  15. Risk-Based Comparison of Carbon Capture Technologies

    SciTech Connect (OSTI)

    Engel, David W.; Dalton, Angela C.; Dale, Crystal; Jones, Edward

    2013-05-01

    In this paper, we describe an integrated probabilistic risk assessment methodological framework and a decision-support tool suite for implementing systematic comparisons of competing carbon capture technologies. Culminating from a collaborative effort among national laboratories under the Carbon Capture Simulation Initiative (CCSI), the risk assessment framework and the decision-support tool suite encapsulate three interconnected probabilistic modeling and simulation components. The technology readiness level (TRL) assessment component identifies specific scientific and engineering targets required by each readiness level and applies probabilistic estimation techniques to calculate the likelihood of graded as well as nonlinear advancement in technology maturity. The technical risk assessment component focuses on identifying and quantifying risk contributors, especially stochastic distributions for significant risk contributors, performing scenario-based risk analysis, and integrating with carbon capture process model simulations and optimization. The financial risk component estimates the long-term return on investment based on energy retail pricing, production cost, operating and power replacement cost, plan construction and retrofit expenses, and potential tax relief, expressed probabilistically as the net present value distributions over various forecast horizons.

  16. Fuel-Flexible Gasification-Combustion Technology for Production of H2 and Sequestration-Ready CO2

    SciTech Connect (OSTI)

    George Rizeq; Parag Kulkarni; Wei Wei; Arnaldo Frydman; Thomas McNulty; Roger Shisler

    2005-11-01

    It is expected that in the 21st century the Nation will continue to rely on fossil fuels for electricity, transportation, and chemicals. It will be necessary to improve both the process efficiency and environmental impact performance of fossil fuel utilization. GE Global Research is developing an innovative fuel-flexible Unmixed Fuel Processor (UFP) technology to produce H{sub 2}, power, and sequestration-ready CO{sub 2} from coal and other solid fuels. The UFP module offers the potential for reduced cost, increased process efficiency relative to conventional gasification and combustion systems, and near-zero pollutant emissions including NO{sub x}. GE was awarded a contract from U.S. DOE NETL to develop the UFP technology. Work on the Phase I program started in October 2000, and work on the Phase II effort started in April 2005. In the UFP technology, coal and air are simultaneously converted into separate streams of (1) high-purity hydrogen that can be utilized in fuel cells or turbines, (2) sequestration-ready CO{sub 2}, and (3) high temperature/pressure vitiated air to produce electricity in a gas turbine. The process produces near-zero emissions with an estimated efficiency higher than IGCC with conventional CO2 separation. The Phase I R&D program established the feasibility of the integrated UFP technology through lab-, bench- and pilot-scale testing and investigated operating conditions that maximize separation of CO{sub 2} and pollutants from the vent gas, while simultaneously maximizing coal conversion efficiency and hydrogen production. The Phase I effort integrated experimental testing, modeling and preliminary economic studies to demonstrate the UFP technology. The Phase II effort will focus on three high-risk areas: economics, sorbent attrition and lifetime, and product gas quality for turbines. The economic analysis will include estimating the capital cost as well as the costs of hydrogen and electricity for a full-scale UFP plant. These costs will be benchmarked with IGCC polygen costs for plants of similar size. Sorbent attrition and lifetime will be addressed via bench-scale experiments that monitor sorbent performance over time and by assessing materials interactions at operating conditions. The product gas from the third reactor (high-temperature vitiated air) will be evaluated to assess the concentration of particulates, pollutants and other impurities relative to the specifications required for gas turbine feed streams. This is the eighteenth quarterly technical progress report for the UFP program, which is supported by U.S. DOE NETL (Contract No. DE-FC26-00FT40974) and GE. This report summarizes program accomplishments for the Phase II period starting July 01, 2005 and ending September 30, 2005. The report includes an introduction summarizing the UFP technology, main program tasks, and program objectives; it also provides a summary of program activities and accomplishments covering progress in tasks including process modeling, scale-up and economic analysis.

  17. Tank waste remediation system retrieval and disposal mission readiness-to-proceed responses to internal independent assessment

    SciTech Connect (OSTI)

    Schaus, P.S.

    1998-01-06

    The US Department of Energy (DOE) is planning to make critical decisions during fiscal year (FY) 1998 regarding privatization contracts for the treatment of Hanford tank waste. Specifically, DOE, Richland Operations Office (RL), will make decisions related to proceeding with Phase 1 Privatization. In support of these decisions, the management and integration (M+I) contractor must be able to meet the requirements to support the Phase 1 privatization contractors. As part of the assessment of the Tank Waste Retrieval (TWR) Readiness-To-Proceed (RTP), an independent review of their process and products was required by the RL letter of August 8, 1997. The Independent Review Team reviewed the adequacy of the planning that has been done by the M+I contractor to validate that, if the plans are carried out, there is reasonable assurance of success. Overall, the RTP Independent Review Team concluded that, if the planning by the M+I contractor team is carried out with adequate funding, there is reasonable assurance that the M+I contractor will be able to deliver waste to the privatization contractor for the duration of Phase 1. This conclusion was based on addressing the recommendations contained in the Independent Review Team`s Final Report and in the individual Criteria and Review Approach (CRA) forms completed during the assessment. The purpose of this report is to formally document the independent assessment and the RTP team responses to the Independent Review Team recommendations. It also provides closure logics for selected recommendations from a Lockheed Martin Hanford Corporation (LMHC) internal assessment of the Technical Basis Review (TBR) packages. This report contains the RTP recommendation closure process (Section 2.0); the closure tables (Section 3.0) which provide traceability between each review team recommendation and its corresponding Project Hanford Management Contract closure logic; and two attachments that formally document the Independent Review Team Final Report and the Internal Assessment Final Report.

  18. Technical Readiness and Gaps Analysis of Commercial Optical Materials and Measurement Systems for Advanced Small Modular Reactors

    SciTech Connect (OSTI)

    Anheier, Norman C.; Suter, Jonathan D.; Qiao, Hong; Andersen, Eric S.; Berglin, Eric J.; Bliss, Mary; Cannon, Bret D.; Devanathan, Ramaswami; Mendoza, Albert; Sheen, David M.

    2013-08-06

    This report intends to support Department of Energy’s Office of Nuclear Energy (DOE-NE) Nuclear Energy Research and Development Roadmap and industry stakeholders by evaluating optical-based instrumentation and control (I&C) concepts for advanced small modular reactor (AdvSMR) applications. These advanced designs will require innovative thinking in terms of engineering approaches, materials integration, and I&C concepts to realize their eventual viability and deployability. The primary goals of this report include: 1. Establish preliminary I&C needs, performance requirements, and possible gaps for AdvSMR designs based on best available published design data. 2. Document commercial off-the-shelf (COTS) optical sensors, components, and materials in terms of their technical readiness to support essential AdvSMR in-vessel I&C systems. 3. Identify technology gaps by comparing the in-vessel monitoring requirements and environmental constraints to COTS optical sensor and materials performance specifications. 4. Outline a future research, development, and demonstration (RD&D) program plan that addresses these gaps and develops optical-based I&C systems that enhance the viability of future AdvSMR designs. The development of clean, affordable, safe, and proliferation-resistant nuclear power is a key goal that is documented in the Nuclear Energy Research and Development Roadmap. This roadmap outlines RD&D activities intended to overcome technical, economic, and other barriers, which currently limit advances in nuclear energy. These activities will ensure that nuclear energy remains a viable component to this nation’s energy security.

  19. DECREASE Final Technical Report: Development of a Commercial Ready Enzyme Application System for Ethanol

    SciTech Connect (OSTI)

    Teter, Sarah A

    2012-04-18

    Conversion of biomass to sugars plays a central in reducing our dependence on petroleum, as it allows production of a wide range of biobased fuels and chemicals, through fermentation of those sugars. The DECREASE project delivers an effective enzyme cocktail for this conversion, enabling reduced costs for producing advanced biofuels such as cellulosic ethanol. Benefits to the public contributed by growth of the advanced biofuels industry include job creation, economic growth, and energy security. The DECREASE primary project objective was to develop a two-fold improved enzyme cocktail, relative to an advanced cocktail (CZP00005) that had been developed previously (from 2000- 2007). While the final milestone was delivery of all enzyme components as an experimental mixture, a secondary objective was to deploy an improved cocktail within 3 years following the close of the project. In February 2012, Novozymes launched Cellic CTec3, a multi-enzyme cocktail derived in part from components developed under DECREASE. The externally validated performance of CTec3 and an additional component under project benchmarking conditions indicated a 1.8-fold dose reduction in enzyme dose required for 90% conversion (based on all available glucose and xylose sources) of NREL dilute acid pretreated PCS, relative to the starting advanced enzyme cocktail. While the ability to achieve 90% conversion is impressive, targeting such high levels of biomass digestion is likely not the most cost effective strategy. Novozymes techno economic modeling showed that for NREL's dilute acid pretreated corn stover (PCS), 80% target conversion enables a lower total production cost for cellulosic ethanol than for 90% conversion, and this was also found to be the case when cost assumptions were based on the NREL 2002 Design Report. A 1.8X dose-reduction was observed for 80% conversion in the small scale (50 g) DECREASE benchmark assay for CTec3 and an additional component. An upscaled experiment (in 0.5 kg kettle reactors) was performed to compare the starting enzyme mixture CZP00005 with CTec3 alone; these results indicated a 1.9X dose- reduction for 80% conversion. The CTec3 composition does not include the best available enzyme components from the DECREASE effort. While these components are not yet available in a commercial product, experimental mixtures were assayed in a smaller scale assay using DECREASE PCS, at high solids loadings (21.5% TS). The results indicated that the newer mixtures required 2.9X-less enzyme for 90% conversion, and 3.2X-less enzyme for 80% conversion, relative to the starting enzyme cocktail. In conclusion, CTec3 delivers a 1.8-1.9X dose reduction on NREL PCS at high solids loadings, and the next generation enzyme from Novozymes will continue to show dramatically improved biochemical performance. CTec3 allows reduced costs today, and the experimental cocktails point to continued biotechnological improvements that will further drive down costs for biorefineries of tomorrow.

  20. Liquid level detector

    DOE Patents [OSTI]

    Tshishiku, Eugene M. (Augusta, GA)

    2011-08-09

    A liquid level detector for conductive liquids for vertical installation in a tank, the detector having a probe positioned within a sheath and insulated therefrom by a seal so that the tip of the probe extends proximate to but not below the lower end of the sheath, the lower end terminating in a rim that is provided with notches, said lower end being tapered, the taper and notches preventing debris collection and bubble formation, said lower end when contacting liquid as it rises will form an airtight cavity defined by the liquid, the interior sheath wall, and the seal, the compression of air in the cavity preventing liquid from further entry into the sheath and contact with the seal. As a result, the liquid cannot deposit a film to form an electrical bridge across the seal.

  1. Technology Readiness Assessment Report

    Office of Environmental Management (EM)

    of management decisions by identifying key technologies that have been demonstrated to work or by highlighting immature or unproven technologies that might result in increased...

  2. Ready, set...go!

    E-Print Network [OSTI]

    Alexandre, Melanie

    2010-01-01

    any proof participatory ergonomics works? • What does thefor changes in an ergonomics program or intervention •of change • Changes in ergonomics program or intervention

  3. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    CoalTek, Inc., project will demonstrate the use of a microwave process that combines coal and biomass to produce a suitable single-stream feedstock pellet for co-gasification....

  4. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (Fuels) Advanced H 2 Membranes 2 11 13 Coal-Biomass to Liquids 1 15 16 Solid Oxide Fuel Cells Anode Electrolyte Cathode (AEC) Development 10 10 Atmospheric Pressure Systems...

  5. Ready to Fire 2 

    E-Print Network [OSTI]

    Unknown

    2011-09-05

    powder feed for fabrication. A simple and economic option for laboratory scale powder production is the Rotating Electrode Process (REP), which produces microsphere shaped powder by melting the tip of a rotating bar with an electric arc. In order to fully...

  6. Construction Readiness RM

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (BillionProvedTravel TravelChallenges |1-01Concentrating Solar PowerBlogExperience |Construction

  7. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable LandmimicDECEMBER 2014 CARBONASSESSMENT

  8. TECHNOLOGY READINESS ASSESSMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable LandmimicDECEMBER 2014

  9. Level-1 Milestone 350 Definitions v1

    SciTech Connect (OSTI)

    Quinn, T

    2006-11-17

    This milestone is the direct result of work that started seven years ago with the planning for a 100-teraFLOP platform and will be satisfied when 100 teraFLOPS is placed in operation and readied for Stockpile Stewardship Program simulations. The end product of this milestone will be a production-level, high-performance computing system, code named Purple, designed to be used to solve the most demanding stockpile stewardship problems, that is, the large-scale application problems at the edge of our understanding of weapon physics. This fully functional 100 teraFLOPS system must be able to serve a diverse scientific and engineering workload. It must also have a robust code development and production environment, both of which facilitate the workload requirements. This multi-year effort includes major activities in contract management, facilities, infrastructure, system software, and user environment and support. Led by LLNL, the trilabs defined the statement of work for a 100-teraFLOP system that resulted in a contract with IBM known as the Purple contract. LLNL worked with IBM throughout the contract period to resolve issues and collaborated with the Program to resolve contractual issues to ensure delivery of a platform that best serves the Program for a reasonable cost. The Purple system represents a substantial increase in the classified compute resources at LLNL for NNSA. The center computer environment must be designed to accept the Purple system and to scale with the increase of compute resources to achieve required end-to-end services. Networking, archival storage, visualization servers, global file systems, and system software will all be enhanced to support Purple's size and architecture. IBM and LLNL are sharing responsibility for Purple's system software. LLNL is responsible for the scheduler, resource manager, and some code development tools. Through the Purple contract, IBM is responsible for the remainder of the system software including the operating system, parallel file system, and runtime environment. LLNL, LANL, and SNL share responsibility for the Purple user environment. Since LLNL is the host for Purple, LLNL has the greatest responsibility. LLNL will provide customer support for Purple to the tri-labs and as such has the lead for user documentation, negotiating the Purple usage model, mapping of the ASC computational environment requirements to the Purple environment, and demonstrating those requirements have been met. In addition, LLNL will demonstrate important capabilities of the computing environment including full functionality of visualization tools, file transport between Purple and remote site file systems, and the build environment for principle ASC codes. LANL and SNL are responsible for delivering unique capabilities in support of their users, porting important applications and libraries, and demonstrating remote capabilities. The key capabilities that LANL and SNL will test are user authorization and authentication, data transfer, file system, data management, and visualization. SNL and LANL should port and run in production mode a few key applications on a substantial number of Purple nodes.

  10. Technical/Support Job Level Technical/Support Level I Technical/Support Level II Technical/Support Level III

    E-Print Network [OSTI]

    Technical/Support Job Level Technical/Support Level I Technical/Support Level II Technical supervision Problem Solving Refers to procedures, technical aids, co-workers, or supervisors to solve routine are varied and non-routine Uses knowledge of standardized rules, procedures, and operations to resolve

  11. Taking Risk Assessment and Management to the Next Level: Program-Level Risk Analysis to Enable Solid Decision-Making on Priorities and Funding

    SciTech Connect (OSTI)

    Nelson, J. G.; Morton, R. L.; Castillo, C.; Dyer, G.; Johnson, N.; McSwain, J. T.

    2011-02-01

    A multi-level (facility and programmatic) risk assessment was conducted for the facilities in the Nevada National Security Site (NNSS) Readiness in Technical Base and Facilities (RTBF) Program and results were included in a new Risk Management Plan (RMP), which was incorporated into the fiscal year (FY) 2010 Integrated Plans. Risks, risk events, probability, consequence(s), and mitigation strategies were identified and captured, for most scope areas (i.e., risk categories) during the facilitated risk workshops. Risk mitigations (i.e., efforts in addition to existing controls) were identified during the facilitated risk workshops when the risk event was identified. Risk mitigation strategies fell into two broad categories: threats or opportunities. Improvement projects were identified and linked to specific risks they mitigate, making the connection of risk reduction through investments for the annual Site Execution Plan. Due to the amount of that was collected, analysis to be performed, and reports to be generated, a Risk Assessment/ Management Tool (RAMtool) database was developed to analyze the risks in real-time, at multiple levels, which reinforced the site-level risk management process and procedures. The RAMtool database was developed and designed to assist in the capturing and analysis of the key elements of risk: probability, consequence, and impact. The RAMtool calculates the facility-level and programmatic-level risk factors to enable a side-by-side comparison to see where the facility manager and program manager should focus their risk reduction efforts and funding. This enables them to make solid decisions on priorities and funding to maximize the risk reduction. A more active risk management process was developed where risks and opportunities are actively managed, monitored, and controlled by each facility more aggressively and frequently. risk owners have the responsibility and accountability to manage their assigned risk in real-time, using the RAMtool database.

  12. The Path to Fusion Energy for Concepts Currently at the Concept Exploration Level

    E-Print Network [OSTI]

    Target Fusion (MTF) Non-toroidal concepts ­­ generally in early exploratory stage · Flow Z-pinch ("ZAP needed? Advanced diagnostics Theory and simulation Support from base program, technology program BPX Non-nuclear technology No DEMO yes May not be ready for first DEMO; Ready for Advanced Power Plant DEMO following tokamak

  13. Specified assurance level sampling procedure

    SciTech Connect (OSTI)

    Willner, O.

    1980-11-01

    In the nuclear industry design specifications for certain quality characteristics require that the final product be inspected by a sampling plan which can demonstrate product conformance to stated assurance levels. The Specified Assurance Level (SAL) Sampling Procedure has been developed to permit the direct selection of attribute sampling plans which can meet commonly used assurance levels. The SAL procedure contains sampling plans which yield the minimum sample size at stated assurance levels. The SAL procedure also provides sampling plans with acceptance numbers ranging from 0 to 10, thus, making available to the user a wide choice of plans all designed to comply with a stated assurance level.

  14. An American company thinks it can have a commercial reactor ready and working within a decade ONE of the clichs of nuclear-power research is that a commercial fusion reactor is only 30 years away, and always1

    E-Print Network [OSTI]

    South Bohemia, University of

    of the clichés of nuclear-power research is that a commercial fusion reactor is only 30 years away, and always1An American company thinks it can have a commercial reactor ready and working within a decade ONE that Lockheed Martin,2 a big American engineering and defence company, has a new design for a fusion reactor

  15. Low-level radioactive waste management: transitioning to off-site disposal at Los Alamos National Laboratory

    SciTech Connect (OSTI)

    Dorries, Alison M

    2010-11-09

    Facing the closure of nearly all on-site management and disposal capability for low-level radioactive waste (LLW), Los Alamos National Laboratory (LANL) is making ready to ship the majority of LLW off-site. In order to ship off-site, waste must meet the Treatment, Storage, and Disposal Facility's (TSDF) Waste Acceptance Criteria (WAC). In preparation, LANL's waste management organization must ensure LANL waste generators characterize and package waste compliantly and waste characterization documentation is complete and accurate. Key challenges that must be addressed to successfully make the shift to off-site disposal of LLW include improving the detail, accuracy, and quality of process knowledge (PK) and acceptable knowledge (AK) documentation, training waste generators and waste management staff on the higher standard of data quality and expectations, improved WAC compliance for off-site facilities, and enhanced quality assurance throughout the process. Certification of LANL generators will allow direct off-site shipping of LLW from their facilities.

  16. Interior Light Level Measurements Appendix F -Interior Light Level Measurements

    E-Print Network [OSTI]

    Appendix F ­ Interior Light Level Measurements #12;F.1 Appendix F - Interior Light Level. A potential concern is that a lower VT glazing may increase electric lighting use to compensate for lost qualify and quantify a representative loss of daylighting, and therefore electric lighting use

  17. Service Level Agreement/Specification

    E-Print Network [OSTI]

    Flynn, E. Victor

    Service Level Agreement/Specification For Maintenance and Associated Risk Management Services Team c. Contract Labour 4. REACTIVE MAINTENANCE 5. ESTATE DATA REQUIREMENTS 6. ESTATE EMERGENCY. RISK MANAGEMENT a. General b. Scope of Service c. Statement of Intent Service Level Agreement 2007 Vers

  18. ALIGNMENT, LEVELING AND DEPLOYMENT CONSTRAINTS

    E-Print Network [OSTI]

    Rathbun, Julie A.

    Thermoelectric Generator (RTG) Crew Deployment Description Passive Seismic Experiment (PSE) Crew Deployment Description Leveling and Alignment Solar Wind Spectrometer (SWS) Crew Deployment Description Leveling to deplo~nent. Design of ALSEP allows deployment when sun angle is from 5 to 45 degrees. 2 #12;CENTRAL

  19. Spray Calciner/In-Can Melter high-level waste solidification technical manual

    SciTech Connect (OSTI)

    Larson, D.E. (ed.)

    1980-09-01

    This technical manual summarizes process and equipment technology developed at Pacific Northwest Laboratory over the last 20 years for vitrification of high-level liquid waste by the Spray Calciner/In-Can Melter process. Pacific Northwest Laboratory experience includes process development and demonstration in laboratory-, pilot-, and full-scale equipment using nonradioactive synthetic wastes. Also, laboratory- and pilot-scale process demonstrations have been conducted using actual high-level radioactive wastes. In the course of process development, more than 26 tonnes of borosilicate glass have been produced in 75 canisters. Four of these canisters contained radioactive waste glass. The associated process and glass chemistry is discussed. Technology areas described include calciner feed treatment and techniques, calcination, vitrification, off-gas treatment, glass containment (the canister), and waste glass chemistry. Areas of optimization and site-specific development that would be needed to adapt this base technology for specific plant application are indicated. A conceptual Spray Calciner/In-Can Melter system design and analyses are provided in the manual to assist prospective users in evaluating the process for plant application, to provide equipment design information, and to supply information for safety analyses and environmental reports. The base (generic) technology for the Spray Calciner/In-Can Melter process has been developed to a point at which it is ready for plant application.

  20. Research Library Service Level Agreement

    E-Print Network [OSTI]

    Wechsler, Risa H.

    Research Library Service Level Agreement 2015-2016 Contents THE SLAC RESEARCH LIBRARY PURPOSE.................................................................................................3 DESCRIPTION OF SLAC RESEARCH LIBRARY COLLECTIONS AND SERVICES......4 Electronic Resources Access.......................................................................................9 APPENDIX: SLAC RESEARCH LIBRARY RULES...................................................10 #12

  1. Low Level Heat Recovery Technology 

    E-Print Network [OSTI]

    O'Brien, W. J.

    1982-01-01

    With today's high fuel prices, energy conservation projects to utilize low level waste heat have become more attractive. Exxon Chemical Company Central Engineering has been developing guidelines and assessing the potential for application of low...

  2. Low-Level Waste Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-07-09

    The guide provides criteria for determining which DOE radioactive wastes are to be managed as low-level waste in accordance with DOE M 435.1-1, Chapter IV.

  3. High-Level Waste Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-07-09

    The guide provides the criteria for determining which DOE radioactive wastes are to be managed as high-level waste in accordance with DOE M 435.1-1.

  4. Level indicator for pressure vessels

    DOE Patents [OSTI]

    Not Available

    1982-04-28

    A liquid-level monitor for tracking the level of a coal slurry in a high-pressure vessel including a toroidal-shaped float with magnetically permeable bands thereon disposed within the vessel, two pairs of magnetic-field generators and detectors disposed outside the vessel adjacent the top and bottom thereof and magnetically coupled to the magnetically permeable bands on the float, and signal-processing circuitry for combining signals from the top and bottom detectors for generating a monotonically increasing analog control signal which is a function of liquid level. The control signal may be utilized to operate high-pressure control valves associated with processes in which the high-pressure vessel is used.

  5. High pressure liquid level monitor

    DOE Patents [OSTI]

    Bean, Vern E. (Frederick, MD); Long, Frederick G. (Ijamsville, MD)

    1984-01-01

    A liquid level monitor for tracking the level of a coal slurry in a high-pressure vessel including a toroidal-shaped float with magnetically permeable bands thereon disposed within the vessel, two pairs of magnetic field generators and detectors disposed outside the vessel adjacent the top and bottom thereof and magnetically coupled to the magnetically permeable bands on the float, and signal processing circuitry for combining signals from the top and bottom detectors for generating a monotonically increasing analog control signal which is a function of liquid level. The control signal may be utilized to operate high-pressure control valves associated with processes in which the high-pressure vessel is used.

  6. ECE Teaching Staff, Level 4,

    E-Print Network [OSTI]

    Hickman, Mark

    ECE Teaching Staff, Level 4, Von Haast Building ECE Labs Electrical & Computer Engineering #12;ELEC Electronics Lab & Randy Hampton Control Lab Machines Lab & Ken Smart Mech. Workshop & Dave Healy Power Building Student Workshop The Shed Café Kim Rutter 441 & Philipp Hof Yonghe Liu Seminar Room 457 Von Haast

  7. Superconductivity for Large Scale Wind Turbines

    SciTech Connect (OSTI)

    R. Fair; W. Stautner; M. Douglass; R. Rajput-Ghoshal; M. Moscinski; P. Riley; D. Wagner; J. Kim; S. Hou; F. Lopez; K. Haran; J. Bray; T. Laskaris; J. Rochford; R. Duckworth

    2012-10-12

    A conceptual design has been completed for a 10MW superconducting direct drive wind turbine generator employing low temperature superconductors for the field winding. Key technology building blocks from the GE Wind and GE Healthcare businesses have been transferred across to the design of this concept machine. Wherever possible, conventional technology and production techniques have been used in order to support the case for commercialization of such a machine. Appendices A and B provide further details of the layout of the machine and the complete specification table for the concept design. Phase 1 of the program has allowed us to understand the trade-offs between the various sub-systems of such a generator and its integration with a wind turbine. A Failure Modes and Effects Analysis (FMEA) and a Technology Readiness Level (TRL) analysis have been completed resulting in the identification of high risk components within the design. The design has been analyzed from a commercial and economic point of view and Cost of Energy (COE) calculations have been carried out with the potential to reduce COE by up to 18% when compared with a permanent magnet direct drive 5MW baseline machine, resulting in a potential COE of 0.075 $/kWh. Finally, a top-level commercialization plan has been proposed to enable this technology to be transitioned to full volume production. The main body of this report will present the design processes employed and the main findings and conclusions.

  8. Near Surface Leakage Monitoring for the Verification and Accounting of Geologic Carbon Sequestration Using a Field Ready {sup 14}C Isotopic Analyzer

    SciTech Connect (OSTI)

    Marino, Bruno

    2014-04-14

    Results for the development of a field ready multi-isotopic analyzer for {sup 12}CO{sub 2}, {sup 13}CO{sub 2} and {sup 14}CO{sub 2} and applications for carbon capture and storage (CCS) containment performance are described. A design goal of the field platform was to provide isotopic data with a high data rate, a standardized reference baseline and acceptable precision (e.g., ~ ±50 per mil D{sup 14}CO{sub 2}) for detection and quantification of fossil-fuel CO{sub 2} CCS leakage scenarios. The instrument platform was not designed to replace high precision accelerator mass spectrometry. An additional goal was to combine project scale isotopic data and associated fluxes with unique financial instruments linking CCS containment performance to a publicly traded security providing project revenue to stakeholders. While the primary goals of the project were attained additional work is needed for the instrument platform and deployment within a full scale CCS site that was not available during the project timeframe.

  9. Effect of Sea Level Rise

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|DepartmentStatementofApril 25,EVthe next generationEffect of Sea Level

  10. Company Level Imports Explanatory Notes

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1 Table 1.101Company Level Imports Explanatory Notes

  11. Runtime deadlock analysis for system level design

    E-Print Network [OSTI]

    Cheung, Eric; Chen, Xi; Hsieh, Harry; Davare, Abhijit; Sangiovanni-Vincentelli, Alberto; Watanabe, Yosinori

    2009-01-01

    workshop on high level design validation and test, Nov. 2001Metropolis, and two real world design examples, which aredetection · System-level design · SystemC · Metropolis E.

  12. CHARACTERIZATION OF AN ACTIVELY COOLED METAL FOIL THERMAL RADIATION SHIELD

    SciTech Connect (OSTI)

    Feller, J. R.; Salerno, L. J.; Kashani, A.; Helvensteijn, B. P. M.

    2010-04-09

    Zero boil-off (ZBO) or reduced boil-off (RBO) systems that involve active cooling of large cryogenic propellant tanks will most likely be required for future space exploration missions. For liquid oxygen or methane, such systems could be implemented using existing high technology readiness level (TRL) cryocoolers. However, for liquid hydrogen temperatures (approx20 K) no such coolers exist. In order to partially circumvent this technology gap, the concept of broad area cooling (BAC) has been developed, whereby a low mass thermal radiation shield could be maintained at temperatures around 100 K by steady circulation of cold pressurized gas through a network of narrow tubes. By this method it is possible to dramatically reduce the radiative heat leak to the 20 K tank. A series of experiments, designed to investigate the heat transfer capabilities of BAC systems, have been conducted at NASA Ames Research Center (ARC). Results of the final experiment in this series, investigating heat transfer from a metal foil film to a distributed cooling line, are presented here.

  13. The LHC Low Level RF

    E-Print Network [OSTI]

    Baudrenghien, Philippe; Molendijk, John Cornelis; Olsen, Ragnar; Rohlev, Anton; Rossi, Vittorio; Stellfeld, Donat; Valuch, Daniel; Wehrle, Urs

    2006-01-01

    The LHC RF consists of eight 400 MHz superconducting cavities per ring, with each cavity independently powered by a 300 kW klystron, via a circulator. The challenge for the Low Level is to cope with very high beam current (more than 1 A RF component) and achieve excellent beam lifetime (emittance growth time in excess of 25 hours). Each cavity has an associated Cavity Controller rack consisting of two VME crates which implement high gain RF Feedback, a Tuner Loop with a new algorithm, a Klystron Ripple Loop and a Conditioning system. In addition each ring has a Beam Control system (four VME crates) which includes a Frequency Program, Phase Loop, Radial Loop and Synchronization Loop. A Longitudinal Damper (dipole and quadrupole mode) acting via the 400 MHz cavities is included to reduce emittance blow-up due to filamentation from phase and energy errors at injection. Finally an RF Synchronization system implements the bunch into bucket transfer from the SPS into each LHC ring. When fully installed in 2007, the...

  14. ORISE: Training and Technology Support

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    activities throughout the VHA and enables multi-level participation and collaboration. Asset Readiness Management System (ARMS) The ARMS system provides readiness information on...

  15. Operational Readiness Team: OPERATIONAL READINESS REVIEW PLAN FOR THE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeeding access toOctober 1996Technologies /JuneOperating Oakoak ridge 12 ......

  16. Manufacturing Readiness Assessment for Fuel Cell Stacks and Systems for the Back-up Power and Material Handling Equipment Emerging Markets (Revised)

    SciTech Connect (OSTI)

    Wheeler, D.; Ulsh, M.

    2010-02-01

    This report details NREL's activity to address the need to understand the current status and associated risk levels of the polymer electrolyte membrane (PEM) fuel cell industry.

  17. Solar Ready Buildings Planning Guide

    SciTech Connect (OSTI)

    Lisell, L.; Tetreault, T.; Watson, A.

    2009-12-01

    This guide offers a checklist for building design and construction to enable installation of solar photovoltaic and heating systems at some time after the building is constructed.

  18. Emergency Readiness Assurance Plans (ERAPs)

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-08-21

    This volume describes the assessments and documentation that would ensure that stated response capabilities are sufficient to implement emergency plans. Canceled by DOE G 151.1-3.

  19. Ready, set, go . . . well maybe

    E-Print Network [OSTI]

    Alexandre, Melanie M

    2011-01-01

    achievement. Journal of Change Management 2004 4(3):193-215.The hard side of change management. Harvard Business Revieware the management and employees to change? • Who are the ‘

  20. NERSC application readiness case studies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a critical need in materials design for more efficient and cost-effective solar light-harvesting and energy conversion. GW calculations within BerkeleyGW occur across two...

  1. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    an air-source heat pump in Climate Zones 1-6 when the Rated Home is modeled with a ground-source heat pump, electric strip or baseboard heat; and the Target Home shall be...

  2. TECHNOLOGY READINESS ASSESSMENT-OVERVIEW

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Combustion 2 2 Advanced Concepts 0 Gasification Systems Feed Systems 2 2 4 Gasifier Optimization and Plant Supporting Systems 2 3 1 6 Syngas Processing 2 2 3 4 11 Advanced...

  3. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Standards. 2. A size modification factor is next calculated using the following equation: Size Modification Factor CFA Benchmark Home CFA Home To Be Built 0.25 , but...

  4. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Rating Standards 2. A size modification factor is next calculated using the following equation for homes rated using RESNET accredited HERS software: Size Modification Factor ...

  5. NERSC application readiness case studies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    BerkeleyGW occur across two executables. The first depends heavily on dense linear algebra and FFT math libraries, while the second depends on custom code that expresses large...

  6. NERSC application readiness case studies

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    within BerkeleyGW occur across two executables. The first depends heavily on dense linear algebra and FFT math libraries, while the second depends on custom code that expresses...

  7. Planning and Conducting Readiness Reviews

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills andOrder 422.1,an R7-Compatible Cumulative

  8. TECHNOLOGY READINESS ASSESSMENT-OVERVIEW

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable LandmimicDECEMBER 2014ASSESSMENT-OVERVIEW

  9. Readiness Review | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners * Impacts on GlobalRachel2RateCaseElementsOxide FuelRead

  10. Application Readiness Across DOE Labs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of raregovAboutRecovery ActTools to someone by AllocationAnnualAppliancesHome

  11. DOE Zero Energy Ready Home

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department8, 2015 GATEWAY Takes 9. TechnologyDOEPart

  12. Getting Ready for Adaptive RTSs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Low LETUseful Links Useful Links:Getthe Next

  13. Glass blowing on a wafer level

    E-Print Network [OSTI]

    Eklund, E. Jesper; Shkel, Andrei M.

    2007-01-01

    Wafer-Level Micro-Glass-Blowing UCI Of?ce of Technology176, 2005. [3] ——, Glass Blowing on a Wafer Scale (Expandedmodels. EKLUND AND SHKEL: GLASS BLOWING ON A WAFER LEVEL [5

  14. High Level Waste System Plan Revision 9

    SciTech Connect (OSTI)

    Davis, N.R.; Wells, M.N.; Choi, A.S.; Paul, P.; Wise, F.E.

    1998-04-01

    Revision 9 of the High Level Waste System Plan documents the current operating strategy of the HLW System at SRS to receive, store, treat, and dispose of high-level waste.

  15. An indicator energy of two close levels

    E-Print Network [OSTI]

    Alexander V. Shamanin

    2013-09-17

    In this paper, we introduce a concept of an indicator energy of two close levels in the perturbation.

  16. Short Papers___________________________________________________________________________________________________ Mining Multiple-Level Association

    E-Print Network [OSTI]

    Wu, Xindong

    ___________________________________________________________________________________________________ Mining Multiple-Level Association Rules in Large Databases Jiawei Han, Member, IEEE Computer Society for efficient mining of multiple-level association rules from large transaction databases based on the Apriori. Index TermsÐData mining, knowledge discovery in databases, association rules, multiple-level association

  17. Hurricane jeanne Preliminary Water Levels Report

    E-Print Network [OSTI]

    Hurricane jeanne Preliminary Water Levels Report Tide Gauges within the Path of Hurricane Jeanne-OPS Hurricane JEANNE Preliminary Report #12;SUMMARY CO-OPS Tide Gauge Data for Hurricane Jeanne NOAA's Center://tidesonline.nos.noaa.gov). Storm surge is the observed water level minus the predicted water level referred to MLLW. Hurricane

  18. Global Warming and Caspian Sea Level Fluctuations

    E-Print Network [OSTI]

    Ardakanian, Reza

    2013-01-01

    Coastal regions have a high social, economical and environmental importance. Due to this importance the sea level fluctuations can have many bad consequences. In this research the correlation between the increasing trend of temperature in coastal stations due to Global Warming and the Caspian Sea level has been established. The Caspian Sea level data has been received from the Jason-1 satellite. It was resulted that the monthly correlation between the temperature and sea level is high and also positive and almost the same for all the stations. But the yearly correlation was negative. It means that the sea level has decreased by the increase in temperature.

  19. Service Levels and Associated Cleaning Areas Service Level 0 -No Service will be provided.

    E-Print Network [OSTI]

    Escher, Christine

    Level 0 ­ Includes all rooms/areas categorized as: Hazardous Material, mechanical, storage, issue, stockService Levels and Associated Cleaning Areas Service Level 0 - No Service will be provided. Service Level 1- Includes all rooms/areas categorized as: offices, copy, file, mail, hallways, vestibules

  20. Chinese and Japanese Word Segmentation Using Word-Level and Character-Level Information

    E-Print Network [OSTI]

    Chinese and Japanese Word Segmentation Using Word-Level and Character-Level Information Tetsuji and Japanese word segmentation. Word-level information is useful for analysis of known words, while character-level informa- tion is useful for analysis of unknown words, and the method utilizes both these two types

  1. Operating Experience Level 3: Radiologically Contaminated Respirators...

    Energy Savers [EERE]

    Experience Level 3 provides information on a safety concern related to radiological contamination of launderedreconditioned respirators and parts that have been certified as...

  2. Action and Inaction Levels in Pest Management. 

    E-Print Network [OSTI]

    Sterling, Winfield

    1984-01-01

    to this problem be to use the term "action level" as a replacement term "economic threshold" and the term "inac level" for the critical natural enemy densities (134). terms are more fitting because economic and factors are both important in pest manage dec... component of level model. If the plant has reserves of n sufficient time remaining during the growing replace damaged fruit , then a higher action level be set. The effect of leaf damage as related phenological stage of cotton plant growth is ill...

  3. Low-level waste program technical strategy

    SciTech Connect (OSTI)

    Bledsoe, K.W.

    1994-10-01

    The Low-Level Waste Technical Strategy document describes the mechanisms which the Low-Level Waste Program Office plans to implement to achieve its mission. The mission is to manage the receipt, immobilization, packaging, storage/disposal and RCRA closure (of the site) of the low-level Hanford waste (pretreated tank wastes) in an environmentally sound, safe and cost-effective manner. The primary objective of the TWRS Low-level waste Program office is to vitrify the LLW fraction of the tank waste and dispose of it onsite.

  4. Division of Research FACULTY-LEVEL RESEARCH

    E-Print Network [OSTI]

    Fernandez, Eduardo

    1 Division of Research SUBJECT: FACULTY-LEVEL RESEARCH APPOINTMENTS Effective Date: 02/01/13 Policy Number 10.1.3 Supersedes: 08/01/08 Page Of 1 3 Responsible Authority: Vice President for Research I. BACKGROUND Faculty-level research appointments, identified by the titles of Research Assistant Professor

  5. Seminar -4. letnik Landau Levels in Graphene

    E-Print Network [OSTI]

    Ramsak, Anton

    Seminar - 4. letnik Landau Levels in Graphene Author: Zala Lenarcic Mentor: prof. Anton Ramsak Ljubljana, December 2010 Abstract In this seminar I present graphene, a new material with promising to graphene's unusual energy dispersion. I will derive Landau levels for standard electrons, for electrons

  6. IT Services' Service Level Agreement TECHNICAL SUPPORT

    E-Print Network [OSTI]

    Hamburger, Peter

    IT Services' Service Level Agreement TECHNICAL SUPPORT and HARDWARE/SOFTWARE/NETWORK MAINTENANCE This service level agreement (SLA) describes the computer services provided by Walb Union Operations into the university services card system's database by Union Operations. Walb Union Operations creates university

  7. An Integrated Low Level Heat Recovery System 

    E-Print Network [OSTI]

    Sierra, A. V., Jr.

    1981-01-01

    A large amount of low level thermal energy is lost to air or water in a typical petroleum refinery. This paper discusses a complex integrated low level heat recovery system that is being engineered for installation in a large petroleum refinery...

  8. Hurricane IVAN Preliminary Water Levels Report

    E-Print Network [OSTI]

    Hurricane IVAN Preliminary Water Levels Report *For the purpose of timely release, data contained and Services #12;CO-OPS Water Level Data for Hurricane IVAN NOAA's Center for Operational Oceanographic and in the Gulf of Mexico. During the hurricane season (June through November) CO-OPS personnel actively maintain

  9. Set # Name Size (Towne) Forward Reverse Probe Author Date Citation 1 TRL11, IRL11 ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 44264432

    E-Print Network [OSTI]

    ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 4426­4432 UL54 / Polymerase 2 UL75 T A P R I M B 218 ACCCGTTACGTGACGGTCAA TTGTCGGCGTTTTCTCCAAA Allen 1995 JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1995, p. 725­728 3 UL75 T A P O I M B 268 TACAACAAACCGATTGCCGC

  10. Level shift operators for open quantum systems

    E-Print Network [OSTI]

    Marco Merkli

    2006-01-07

    Level shift operators describe the second order displacement of eigenvalues under perturbation. They play a central role in resonance theory and ergodic theory of open quantum systems at positive temperatures. We exhibit intrinsic properties of level shift operators, properties which stem from the structure of open quantum systems at positive temperatures and which are common to all such systems. They determine the geometry of resonances bifurcating from eigenvalues of positive temperature Hamiltonians and they relate the Gibbs state, the kernel of level shift operators, and zero energy resonances. We show that degeneracy of energy levels of the small part of the open quantum system causes the Fermi Golden Rule Condition to be violated and we analyze ergodic properties of such systems.

  11. Low Level Radiation SEAB Ltr. to Moniz

    Office of Environmental Management (EM)

    on how DOE should pursue research on the question of a 'linear' or 'threshold' low-level radiation exposure model. Should DOE continue its efforts on this subject or...

  12. Making Use of Low-Level Heat 

    E-Print Network [OSTI]

    Plaster, W. E.

    1979-01-01

    Immense amounts of energy are being thrown away every day in petroleum refineries, chemical plants, and throughout all types of industrial operations. Much of this energy is at temperature levels below 350OF and is typically rejected...

  13. Variable Speed Pumping for Level Control 

    E-Print Network [OSTI]

    Vasel, M.

    1982-01-01

    analysis, and a brief discussion of variable frequency drive design considerations. Energy savings figures are based upon actual electricity costs at the plant involved. Process duty cycle and energy requirement levels were verified by a wattmeter...

  14. Tank farms compacted low-level waste

    SciTech Connect (OSTI)

    Hetzer, D.C.

    1997-08-01

    This report describes the process of Low-Level Waste (LLW) volume reduction by compaction. Also included is the data used for characterization of LLW destined for compaction. Scaling factors (ratios) are formed based on data contained in this report.

  15. Tank farms compacted low level waste

    SciTech Connect (OSTI)

    Waters, M.S., Westinghouse Hanford

    1996-07-01

    This report describes the process of Low Level Waste (LLW) volume reduction by compaction. Also included is the data used for characterization of LLW destined for compaction. Scaling factors (ratios) are formed based on data contained in this report.

  16. Low-level waste forum meeting reports

    SciTech Connect (OSTI)

    Sternwheeler, W.D.E.

    1992-12-31

    This paper provides highlights from the 1992 winter meeting of the Low Level Radioactive Wastes Forum. Topics of discussion included: legal information; state and compact reports; freedom of information requests; and storage.

  17. Level-2 Calorimeter Trigger Upgrade at CDF

    SciTech Connect (OSTI)

    Flanagan, G.U.; /Purdue U.

    2007-04-01

    The CDF Run II Level-2 calorimeter trigger is implemented in hardware and is based on an algorithm used in Run I. This system insured good performance at low luminosity obtained during the Tevatron Run II. However, as the Tevatron instantaneous luminosity increases, the limitations of the current system due to the algorithm start to become clear. In this paper, we will present an upgrade of the Level-2 calorimeter trigger system at CDF. The upgrade is based on the Pulsar board, a general purpose VME board developed at CDF and used for upgrading both the Level-2 tracking and the Level-2 global decision crate. This paper will describe the design, hardware and software implementation, as well as the advantages of this approach over the existing system.

  18. LEVEL SET REGULARIZATION IN POSITRON EMISSION TOMOGRAPHY 1 Level Set Method for Positron Emission

    E-Print Network [OSTI]

    Ferguson, Thomas S.

    LEVEL SET REGULARIZATION IN POSITRON EMISSION TOMOGRAPHY 1 Level Set Method for Positron Emission for integrated Petroleum Research). #12;LEVEL SET REGULARIZATION IN POSITRON EMISSION TOMOGRAPHY 2 Abstract In positron emission tomography (PET) a radioactive compound is injected into the body to promote a tissue

  19. Exploiting level sensitive latches in wire pipelining 

    E-Print Network [OSTI]

    Seth, Vikram

    2005-02-17

    margin for setup time and clock skew, i.e. in the interval of [T -Tp,T -Tsetup-Tskew], as shown by the yellow shaded interval in Figure 3 for positive level sensitive latches. Here Tp is the duration of positive clock signal level... occupy certain region and disallow repeater or synchronous element insertions. In this scenario, the timing flexibility of latches can facilitate further TCLK TP Tn Tsetup 8 improvement on latency compared with flip-flop based wire...

  20. Features, Events, and Processes: system Level

    SciTech Connect (OSTI)

    D. McGregor

    2004-10-15

    The purpose of this analysis report is to evaluate and document the inclusion or exclusion of the system-level features, events, and processes (FEPs) with respect to modeling used to support the total system performance assessment for the license application (TSPA-LA). A screening decision, either Included or Excluded, is given for each FEP along with the technical basis for screening decisions. This information is required by the U.S. Nuclear Regulatory Commission (NRC) at 10 CFR 63.113 (d, e, and f) (DIRS 156605). The system-level FEPs addressed in this report typically are overarching in nature, rather than being focused on a particular process or subsystem. As a result, they are best dealt with at the system level rather than addressed within supporting process-level or subsystem-level analyses and models reports. The system-level FEPs also tend to be directly addressed by regulations, guidance documents, or assumptions listed in the regulations; or are addressed in background information used in development of the regulations. For included FEPs, this analysis summarizes the implementation of the FEP in the TSPA-LA (i.e., how the FEP is included). For excluded FEPs, this analysis provides the technical basis for exclusion from the TSPA-LA (i.e., why the FEP is excluded). The initial version of this report (Revision 00) was developed to support the total system performance assessment for site recommendation (TSPA-SR). This revision addresses the license application (LA) FEP List (DIRS 170760).

  1. Seasonal sand level changes on southern california beaches

    E-Print Network [OSTI]

    Yates, Marissa L.

    2009-01-01

    2.3 Sand level measurements . . . . . .2.4 Sand level changes . . . . . . . . . . 2.5 Wave4.3.2 Sand level observations . . . . . . . . . . . . . .

  2. Seasonal Sand Level Changes on Southern California Beaches

    E-Print Network [OSTI]

    Yates, Marissa L

    2009-01-01

    2.3 Sand level measurements . . . . . .2.4 Sand level changes . . . . . . . . . . 2.5 Wave4.3.2 Sand level observations . . . . . . . . . . . . . .

  3. Torsional ultrasonic wave based level measurement system

    DOE Patents [OSTI]

    Holcomb, David E. (Oak Ridge, TN); Kisner, Roger A. (Knoxville, TN)

    2012-07-10

    A level measurement system suitable for use in a high temperature and pressure environment to measure the level of coolant fluid within the environment, the system including a volume of coolant fluid located in a coolant region of the high temperature and pressure environment and having a level therein; an ultrasonic waveguide blade that is positioned within the desired coolant region of the high temperature and pressure environment; a magnetostrictive electrical assembly located within the high temperature and pressure environment and configured to operate in the environment and cooperate with the waveguide blade to launch and receive ultrasonic waves; and an external signal processing system located outside of the high temperature and pressure environment and configured for communicating with the electrical assembly located within the high temperature and pressure environment.

  4. Statistical approach to nuclear level density

    SciTech Connect (OSTI)

    Sen'kov, R. A.; Horoi, M.; Zelevinsky, V. G.

    2014-10-15

    We discuss the level density in a finite many-body system with strong interaction between the constituents. Our primary object of applications is the atomic nucleus but the same techniques can be applied to other mesoscopic systems. We calculate and compare nuclear level densities for given quantum numbers obtained by different methods, such as nuclear shell model (the most successful microscopic approach), our main instrument - moments method (statistical approach), and Fermi-gas model; the calculation with the moments method can use any shell-model Hamiltonian excluding the spurious states of the center-of-mass motion. Our goal is to investigate statistical properties of nuclear level density, define its phenomenological parameters, and offer an affordable and reliable way of calculation.

  5. Fault-tolerant three-level inverter

    DOE Patents [OSTI]

    Edwards, John; Xu, Longya; Bhargava, Brij B.

    2006-12-05

    A method for driving a neutral point clamped three-level inverter is provided. In one exemplary embodiment, DC current is received at a neutral point-clamped three-level inverter. The inverter has a plurality of nodes including first, second and third output nodes. The inverter also has a plurality of switches. Faults are checked for in the inverter and predetermined switches are automatically activated responsive to a detected fault such that three-phase electrical power is provided at the output nodes.

  6. Closed-field capacitive liquid level sensor

    DOE Patents [OSTI]

    Kronberg, J.W.

    1995-01-01

    A liquid level sensor based on a closed field circuit comprises a ring oscillator using a symmetrical array of plate units that creates a displacement current. The displacement current varies as a function of the proximity of a liquid to the plate units. The ring oscillator circuit produces an output signal with a frequency inversely proportional to the presence of a liquid. A continuous liquid level sensing device and a two point sensing device are both proposed sensing arrangements. A second set of plates may be located inside of the probe housing relative to the sensing plate units. The second set of plates prevent any interference between the sensing plate units.

  7. Conceptual Evaluation for the Installation of Treatment Capability for Mixed Low Level Waste at the Nevada National Security Site

    SciTech Connect (OSTI)

    NSTec Environmental Management

    2010-11-24

    National Security Technologies, LLC, initiated an evaluation of treatment technologies that they would manage and operate as part of the mixed low-level waste (MLLW) disposal facilities at the Nevada National Security Site (NNSS). The NNSS Disposal Facility has been receiving radioactive waste from the U.S. Department of Energy (DOE) complex since the 1960s, and since 2005 the NNSS Disposal Facility has been receiving radioactive and MLLW for disposal only. In accordance with the Resource Conservation and Recovery Act (RCRA), all mixed waste must meet land disposal restrictions (LDRs) prior to disposal. Compliance with LDRs is attained through treatment of the waste to mitigate the characteristics of the listed waste hazard. Presently, most generators utilize commercial capacity for waste treatment prior to shipment to the NNSS Disposal Facility. The objectives of this evaluation are to provide a conceptual study of waste treatment needs (i.e., demand), identify potential waste treatment technologies to meet demand, and analyze implementation considerations for initiating MLLW treatment capacity at the NNSS Disposal Facility. A review of DOE complex waste generation forecast data indicates that current and future Departmental demand for mixed waste treatment capacity will remain steady and strong. Analysis and screening of over 30 treatment technologies narrowed the field of treatment technologies to four: • Macroencapsulation • Stabilization/microencapsulation • Sort and segregation • Bench-scale mercury amalgamation The analysis of treatment technologies also considered existing permits, current the NNSS Disposal Facility infrastructure such as utilities and procedures, and past experiences such as green-light and red-light lessons learned. A schedule duration estimate has been developed for permitting, design, and construction of onsite treatment capability at the NNSS Disposal Facility. Treatment capability can be ready in 20 months.

  8. High-level radioactive wastes. Supplement 1

    SciTech Connect (OSTI)

    McLaren, L.H.

    1984-09-01

    This bibliography contains information on high-level radioactive wastes included in the Department of Energy's Energy Data Base from August 1982 through December 1983. These citations are to research reports, journal articles, books, patents, theses, and conference papers from worldwide sources. Five indexes, each preceded by a brief description, are provided: Corporate Author, Personal Author, Subject, Contract Number, and Report Number. 1452 citations.

  9. Expectations of two-level telegraph noise

    E-Print Network [OSTI]

    Jesse Fern

    2006-11-02

    We find expectation values of functions of time integrated two-level telegraph noise. Expectation values of this noise are evaluated under simple control pulses. Both the Gaussian limit and $1/f$ noise are considered. We apply the results to a specific superconducting quantum computing example, which illustrates the use of this technique for calculating error probabilities.

  10. The Science of Level Design Kenneth Hullett

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    elements and gameplay. The next step is to validate this theory with a series of experiments that test]: Human factors, K.8.0 [Personal Computing]: Games General Terms Design, Human Factors Keywords level propose to conduct a series of experiments. A combination of qualitative and quantitative assessments

  11. Methodology for Prototyping Increased Levels of Automation

    E-Print Network [OSTI]

    Valasek, John

    Methodology for Prototyping Increased Levels of Automation for Spacecraft Rendezvous Functions of automation than previous NASA vehicles, due to program requirements for automation, including Automated Ren authority between humans and computers (i.e. automation) as a prime driver for cost, safety, and mission

  12. Complexity Management in System-level Design

    E-Print Network [OSTI]

    California at Berkeley, University of

    , and work with a range of constraints and optimization criteria. This design process is quite complex1 of 22 Complexity Management in System-level Design Asawaree Kalavade Edward A. Lee Keywords design space exploration, hardware-software codesign, design methodology management, design flow

  13. Low-level waste forum meeting reports

    SciTech Connect (OSTI)

    NONE

    1993-12-31

    This paper provides the results of the winter meeting of the Low Level Radioactive Waste Forum. Discussions were held on the following topics: new developments in states and compacts; adjudicatory hearings; information exchange on siting processes, storage surcharge rebates; disposal after 1992; interregional access agreements; and future tracking and management issues.

  14. Low-level waste forum meeting reports

    SciTech Connect (OSTI)

    NONE

    1991-12-31

    This report contains highlights from the 1991 fall meeting of the Low Level Radioactive Waste Forum. Topics included legal updates; US NRC updates; US EPA updates; mixed waste issues; financial assistance for waste disposal facilities; and a legislative and policy report.

  15. BIOSAFETY LEVELS AND RISK ASSESSMENT POLICY

    E-Print Network [OSTI]

    Jia, Songtao

    BIOSAFETY LEVELS AND RISK ASSESSMENT POLICY Procedure: 2.2 Created: 3/7/2014 Version: 1.0 A risk assessment to account for the characteristics of the agent being used, the procedures of infection, a risk assessment is required in all cases to initially establish the appropriate biocontainment

  16. County Level Wind Erosion Estimation Using National

    E-Print Network [OSTI]

    , Fuller (1987), Rao (2003). 11 #12;Model searching for Wind Erosion In NRI, wind erosion WEQCounty Level Wind Erosion Estimation Using National Resources Inventory Survey Taps Maiti. · Approx. 3 points/PSU; 800,000 points in 1997 NRI 4 #12;· Data on Urban land, small water etc

  17. Low-level waste forum meeting reports

    SciTech Connect (OSTI)

    NONE

    1995-12-31

    This paper provides highlights from the 1995 summer meeting of the Low Level radioactive Waste Forum. Topics included: new developments in state and compacts; federal waste management; DOE plans for Greater-Than-Class C waste management; mixed wastes; commercial mixed waste management; international export of rad wastes for disposal; scintillation cocktails; license termination; pending legislation; federal radiation protection standards.

  18. PAIRWISE BLENDING OF HIGH LEVEL WASTE (HLW)

    SciTech Connect (OSTI)

    CERTA, P.J.

    2006-02-22

    The primary objective of this study is to demonstrate a mission scenario that uses pairwise and incidental blending of high level waste (HLW) to reduce the total mass of HLW glass. Secondary objectives include understanding how recent refinements to the tank waste inventory and solubility assumptions affect the mass of HLW glass and how logistical constraints may affect the efficacy of HLW blending.

  19. Combining Unit-level Symbolic Execution and System-level Concrete Execution for Testing NASA

    E-Print Network [OSTI]

    Pasareanu, Corina

    Combining Unit-level Symbolic Execution and System-level Concrete Execution for Testing NASA Software Corina S. Pasareanu, Peter C. Mehlitz, David H. Bushnell, Karen Gundy-Burlet, Michael Lowry NASA.h.bushnell, karen.gundy-burlet, michael.r.lowry}@nasa.gov Suzette Person Department of Computer Science

  20. INTRODUCTION Fish routinely exhibit a level of agility that far surpasses the level

    E-Print Network [OSTI]

    Mittal, Rajat

    4043 INTRODUCTION Fish routinely exhibit a level of agility that far surpasses the level that human-engineered underwater vehicles have been able to achieve (Bandyopadhyay, 2002). Fish such as sunfish, perch and goldfish in both quiescent and turbulent flows (Lauder et al., 2006). There are many reasons why fish are more

  1. Relative Sea-Level Chanhes in Iceland 25 3. Relative Sea-Level Changes in Iceland

    E-Print Network [OSTI]

    Ingólfsson, Ólafur

    Relative Sea-Level Chanhes in Iceland 25 3. Relative Sea-Level Changes in Iceland: new Aspects of the Weichselian Deglaciation of Iceland Hreggviður Norðdahl1 and Halldór G. Pétursson2 1 University of Iceland, Science Institute, Dunhagi 3, IS-107 Reykjavik 2 Icelandic Institute of Natural History, IS-600 Akureyri 3

  2. HighHigh--LevelSynthesisforLevelSynthesisfor LowPowerLowPower

    E-Print Network [OSTI]

    Mohanty, Saraju P.

    ;4 DesignQualityMeasuresDesignQualityMeasures ·Area ·Performance ·Power ·Testability1 HighHigh--LevelSynthesisforLevelSynthesisfor LowPowerLowPower SarajuP.Mohanty smohanty.Dynamicpowerdissipationdetails 3.Howtoreducedynamicpower? 4.EffectofFrequencyonEnergy/Power 5.Fewlow-powerresearchworks #12

  3. Low-level waste feed staging plan

    SciTech Connect (OSTI)

    Certa, P.J.; Grams, W.H.; McConville, C.M.; L. W. Shelton, L.W.; Slaathaug, E.J., Westinghouse Hanford

    1996-08-12

    The `Preliminary Low-Level Waste Feed Staging Plan` was updated to reflect the latest requirement in the Tank Waste Remediation Privatization Request for Proposals (RFP) and amendments. The updated plan develops the sequence and transfer schedule for retrieval of DST supernate by the management and integration contractor and delivery of the staged supernate to the private low-activity waste contractors for treatment. Two DSTs are allocated as intermediate staging tanks. A transfer system conflict analysis provides part of the basis for determining transfer system upgrade requirements to support both low-activity and high-level waste feed delivery. The intermediate staging tank architecture and retrieval system equipment are provided as a planning basis until design requirements documents are prepared. The actions needed to successfully implement the plan are identified. These include resolution of safety issues and changes to the feed envelope limits, minimum order quantities, and desired batch sizes.

  4. High-Level Waste Melter Study Report

    SciTech Connect (OSTI)

    Perez, Joseph M.; Bickford, Dennis F.; Day, Delbert E.; Kim, Dong-Sang; Lambert, Steven L.; Marra, Sharon L.; Peeler, David K.; Strachan, Denis M.; Triplett, Mark B.; Vienna, John D.; Wittman, Richard S.

    2001-07-13

    At the Hanford Site in Richland, Washington, the path to site cleanup involves vitrification of the majority of the wastes that currently reside in large underground tanks. A Joule-heated glass melter is the equipment of choice for vitrifying the high-level fraction of these wastes. Even though this technology has general national and international acceptance, opportunities may exist to improve or change the technology to reduce the enormous cost of accomplishing the mission of site cleanup. Consequently, the U.S. Department of Energy requested the staff of the Tanks Focus Area to review immobilization technologies, waste forms, and modifications to requirements for solidification of the high-level waste fraction at Hanford to determine what aspects could affect cost reductions with reasonable long-term risk. The results of this study are summarized in this report.

  5. Electronic multi-purpose material level sensor

    DOE Patents [OSTI]

    McEwan, T.E.

    1997-03-11

    The present electronic multi-purpose material level sensor is based on time domain reflectometry (TDR) of very short electrical pulses. Pulses are propagated along a transmission line that is partially immersed in a liquid, powder, or other substance such as grain in a silo. The time difference of the reflections at the start of the transmission line and the air/liquid interface are used to determine levels to better than 0.01 inch. The sensor is essentially independent of circuit element and temperature variations, and can be mass produced at an extremely low price. The transmission line may be a Goubau line, microstrip, coaxial cable, twin lead, CPS or CPW, and may typically be a strip placed along the inside wall of a tank. The reflected pulses also contain information about strata within the liquid such as sludge-build-up at the bottom of an oil tank. 9 figs.

  6. Electronic multi-purpose material level sensor

    DOE Patents [OSTI]

    McEwan, Thomas E. (Livermore, CA)

    1997-01-01

    The present electronic multi-purpose material level sensor is based on time domain reflectometry (TDR) of very short electrical pulses. Pulses are propagated along a transmission line that is partially immersed in a liquid, powder, or other substance such as grain in a silo. The time difference of the reflections at the start of the transmission line and the air/liquid interface are used to determine levels to better than 0.01 inch. The sensor is essentially independent of circuit element and temperature variations, and can be mass produced at an extremely low price. The transmission line may be a Goubau line, microstrip, coaxial cable, twin lead, CPS or CPW, and may typically be a strip placed along the inside wall of a tank. The reflected pulses also contain information about strata within the liquid such as sludge-build-up at the bottom of an oil tank.

  7. Review of APR+ Level 2 PSA

    SciTech Connect (OSTI)

    Lehner, J.R.; Mubayi, V.; Pratt, W. T.

    2012-02-17

    Brookhaven National Laboratory (BNL) assisted the Korea Institute of Nuclear Safety (KINS) in reviewing the Level 2 Probabilistic Safety Assessment (PSA) of the APR+ Advanced Pressurized Water Reactor (PWR) prepared by the Korea Hydro & Nuclear Power Co., Ltd (KHNP) and KEPCO Engineering & Construction Co., Inc. (KEPCO-E&C). The work described in this report involves a review of the APR+ Level 2 PSA submittal [Ref. 1]. The PSA and, therefore, the review is limited to consideration of accidents initiated by internal events. As part of the review process, the review team also developed three sets of Requests for Additional Information (RAIs). These RAIs were provided to KHNP and KEPCO-E&C for their evaluation and response. This final detailed report documents the review findings for each technical element of the PSA and includes consideration of all of the RAIs made by the reviewers as well as the associated responses. This final report was preceded by an interim report [Ref. 2] that focused on identifying important issues regarding the PSA. In addition, a final meeting on the project was held at BNL on November 21-22, 2011, where BNL and KINS reviewers discussed their preliminary review findings with KHNP and KEPCO-E&C staffs. Additional information obtained during this final meeting was also used to inform the review findings of this final report. The review focused not only on the robustness of the APR+ design to withstand severe accidents, but also on the capability and acceptability of the Level 2 PSA in terms of level of detail and completeness. The Korean nuclear regulatory authorities will decide whether the PSA is acceptable and the BNL review team is providing its comments for KINS consideration. Section 2.0 provides the basis for the BNL review. Section 3.0 presents the review of each technical element of the PSA. Conclusions and a summary are presented in Section 4.0. Section 5.0 contains the references.

  8. Circuit level modeling of inductive elements

    SciTech Connect (OSTI)

    Muyshondt, G.P.; Portnoy, W.M.

    1989-01-01

    Design and analysis of spacecraft power systems have been difficult to perform because of the lack of circuit level models for nonlinear inductive elements. This paper reviews some of the models which have been proposed, their limitations, and applications. An improved saturation dependent model will be described. The model has been implemented in SPICE and with a commercial circuit program and demonstrated to be satisfactory in both implementations. 3 refs., 9 figs.

  9. Novel Supercritical Carbon Dioxide Power Cycle Utilizing Pressured Oxy-combustion in Conjunction with Cryogenic Compression

    SciTech Connect (OSTI)

    Brun, Klaus; McClung, Aaron; Davis, John

    2014-03-31

    The team of Southwest Research Institute® (SwRI) and Thar Energy LLC (Thar) applied technology engineering and economic analysis to evaluate two advanced oxy-combustion power cycles, the Cryogenic Pressurized Oxy-combustion Cycle (CPOC), and the Supercritical Oxy-combustion Cycle. This assessment evaluated the performance and economic cost of the two proposed cycles with carbon capture, and included a technology gap analysis of the proposed technologies to determine the technology readiness level of the cycle and the cycle components. The results of the engineering and economic analysis and the technology gap analysis were used to identify the next steps along the technology development roadmap for the selected cycle. The project objectives, as outlined in the FOA, were 90% CO{sub 2} removal at no more than a 35% increase in cost of electricity (COE) as compared to a Supercritical Pulverized Coal Plant without CO{sub 2} capture. The supercritical oxy-combustion power cycle with 99% carbon capture achieves a COE of $121/MWe. This revised COE represents a 21% reduction in cost as compared to supercritical steam with 90% carbon capture ($137/MWe). However, this represents a 49% increase in the COE over supercritical steam without carbon capture ($80.95/MWe), exceeding the 35% target. The supercritical oxy-combustion cycle with 99% carbon capture achieved a 37.9% HHV plant efficiency (39.3% LHV plant efficiency), when coupling a supercritical oxy-combustion thermal loop to an indirect supercritical CO{sub 2} (sCO{sub 2}) power block. In this configuration, the power block achieved 48% thermal efficiency for turbine inlet conditions of 650°C and 290 atm. Power block efficiencies near 60% are feasible with higher turbine inlet temperatures, however a design tradeoff to limit firing temperature to 650°C was made in order to use austenitic stainless steels for the high temperature pressure vessels and piping and to minimize the need for advanced turbomachinery features such as blade cooling. The overall technical readiness of the supercritical oxy-combustion cycle is TRL 2, Technology Concept, due to the maturity level of the supercritical oxy-combustor for solid fuels, and several critical supporting components, as identified in the Technical Gap Analysis. The supercritical oxycombustor for solid fuels operating at pressures near 100 atm is a unique component of the supercritical oxy-combustion cycle. In addition to the low TRL supercritical oxy-combustor, secondary systems were identified that would require adaptation for use with the supercritical oxycombustion cycle. These secondary systems include the high pressure pulverized coal feed, high temperature cyclone, removal of post-combustion particulates from the high pressure cyclone underflow stream, and micro-channel heat exchangers tolerant of particulate loading. Bench scale testing was utilized to measure coal combustion properties at elevated pressures in a CO{sub 2} environment. This testing included coal slurry preparation, visualization of coal injection into a high pressure fluid, and modification of existing test equipment to facilitate the combustion properties testing. Additional bench scale testing evaluated the effectiveness of a rotary atomizer for injecting a coal-water slurry into a fluid with similar densities, as opposed to the typical application where the high density fluid is injected into a low density fluid. The swirl type supercritical oxy-combustor was developed from initial concept to an advanced design stage through numerical simulation using FLUENT and Chemkin to model the flow through the combustor and provide initial assessment of the coal combustion reactions in the flow path. This effort enabled the initial combustor mechanical layout, initial pressure vessel design, and the conceptual layout of a pilot scale test loop. A pilot scale demonstration of the supercritical oxy-combustion cycle is proposed as the next step in the technology development. This demonstration would advance the supercritical oxy-combustion cycle and the supercritical

  10. Condition Based Monitoring of Gas Turbine Combustion Components

    SciTech Connect (OSTI)

    Ulerich, Nancy; Kidane, Getnet; Spiegelberg, Christine; Tevs, Nikolai

    2012-09-30

    The objective of this program is to develop sensors that allow condition based monitoring of critical combustion parts of gas turbines. Siemens teamed with innovative, small companies that were developing sensor concepts that could monitor wearing and cracking of hot turbine parts. A magnetic crack monitoring sensor concept developed by JENTEK Sensors, Inc. was evaluated in laboratory tests. Designs for engine application were evaluated. The inability to develop a robust lead wire to transmit the signal long distances resulted in a discontinuation of this concept. An optical wear sensor concept proposed by K Sciences GP, LLC was tested in proof-of concept testing. The sensor concept depended, however, on optical fiber tips wearing with the loaded part. The fiber tip wear resulted in too much optical input variability; the sensor could not provide adequate stability for measurement. Siemens developed an alternative optical wear sensor approach that used a commercial PHILTEC, Inc. optical gap sensor with an optical spacer to remove fibers from the wearing surface. The gap sensor measured the length of the wearing spacer to follow loaded part wear. This optical wear sensor was developed to a Technology Readiness Level (TRL) of 5. It was validated in lab tests and installed on a floating transition seal in an F-Class gas turbine. Laboratory tests indicate that the concept can measure wear on loaded parts at temperatures up to 800{degrees}C with uncertainty of < 0.3 mm. Testing in an F-Class engine installation showed that the optical spacer wore with the wearing part. The electro-optics box located outside the engine enclosure survived the engine enclosure environment. The fiber optic cable and the optical spacer, however, both degraded after about 100 operating hours, impacting the signal analysis.

  11. Lid design for low level waste container

    DOE Patents [OSTI]

    Holbrook, R.H.; Keener, W.E.

    1995-02-28

    A container for low level waste includes a shell and a lid. The lid has a frame to which a planar member is welded. The lid frame includes a rectangular outer portion made of square metal tubing, a longitudinal beam extending between axial ends of the rectangular outer portion, and a transverse beam extending between opposite lateral sides of the rectangular outer portion. Two pairs of diagonal braces extend between the longitudinal beam and the four corners of the rectangular outer portion of the frame. 6 figs.

  12. Simulation levels of detail for plant motion 

    E-Print Network [OSTI]

    Beaudoin, Jacob Michael

    2013-02-22

    that motion interactive [PCOI, DCFOI, EMF03]. A comparison of our method with some of these other methods is provided in section 7. 1. SLODs have come into prominence only in the last few years [Ber97, CF97]. They have sometimes taken other names ? Endo et... al. refer to them as levels of motion detail, or LOmDs [EMF03]. There have been a wide variety of applications for SLODs. These include rigid body dynamics and motion [CIF99, DO01, CAF01], simple collision detection and response [CH97, ODG*03...

  13. EM Corporate Performance Metrics, Complex Level

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (BillionProvedTravel TravelChallengesOhio andTechnologiesLandEnergy BeginsComplex Level July,

  14. EM Corporate Performance Metrics, Site Level

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (BillionProvedTravel TravelChallengesOhio andTechnologiesLandEnergy BeginsComplex Level July,Site

  15. ARM - Sea Level and Climate Change

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Comments?govInstrumentsnoaacrnBarrow, Alaska OutreachCalendarPressExtended Facility SGPScienceScienceLevel and

  16. ARM - Sea Surface and Sea Level

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Comments?govInstrumentsnoaacrnBarrow, Alaska OutreachCalendarPressExtended Facility SGPScienceScienceLevel

  17. ARM - Lesson Plans: Past Sea Level Data

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Comments?govInstrumentsnoaacrnBarrow, Alaska Outreach Home Room News PublicationsClimatePast Sea Level Data

  18. Property:DIA/Level | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceIIInformationEnergyReportNumberCoolingTowerWaterUseWinterGrossCurrentLevel Jump

  19. Hight-Level Waste & Facilities Disposition

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D. Title:Highlights LANS invests inHigh-Level Waste

  20. AVTA Voltec AC Level 1 and Level 2 Charging Systems Testing Results

    Broader source: Energy.gov [DOE]

    The Vehicle Technologies Office's Advanced Vehicle Testing Activity carries out testing on a wide range of advanced vehicles and technologies on dynamometers, closed test tracks, and on-the-road. These results provide benchmark data that researchers can use to develop technology models and guide future research and development. The following report describes results from testing done on the Voltec Level 1 and Level 2 charging systems for plug-in electric vehicles. This research was conducted by Idaho National Laboratory.