Powered by Deep Web Technologies
Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Springdale PA - PA 11  

Office of Legacy Management (LM)

Springdale PA - PA 11 Springdale PA - PA 11 FUSRAP Considered Sites Springdale, PA Alternate Name(s): C.H. Schnoor - Misspelling of Schnorr from historical documents Conviber, Inc. Premier Manufacturing Company Unity Railway Supply Company PA.11-1 PA.11-2 PA.11-4 PA.11-9 Location: 644 Garfield Street, Springdale, Pennsylvania PA.11-2 Historical Operations: Machined extruded uranium for the Hanford Pile Project to produce an alternate charge for the Hanford reactor and machined uranium slugs for MED contractors. PA.11-9 Eligibility Determination: Eligible PA.11-4 PA.11-5 Radiological Survey(s): Assessment Surveys, Verification Surveys PA.11-4 PA.11-6 PA.11-7 PA.11-8 Site Status: Certified - Cleanup completed - Certification Basis, Federal Register Notice Included PA.11-9


DOE - Office of Legacy Management -- Springdale PA - PA 11  

NLE Websites -- All DOE Office Websites (Extended Search)

Springdale PA - PA 11 Springdale PA - PA 11 FUSRAP Considered Sites Springdale, PA Alternate Name(s): C.H. Schnoor - Misspelling of Schnorr from historical documents Conviber, Inc. Premier Manufacturing Company Unity Railway Supply Company PA.11-1 PA.11-2 PA.11-4 PA.11-9 Location: 644 Garfield Street, Springdale, Pennsylvania PA.11-2 Historical Operations: Machined extruded uranium for the Hanford Pile Project to produce an alternate charge for the Hanford reactor and machined uranium slugs for MED contractors. PA.11-9 Eligibility Determination: Eligible PA.11-4 PA.11-5 Radiological Survey(s): Assessment Surveys, Verification Surveys PA.11-4 PA.11-6 PA.11-7 PA.11-8 Site Status: Certified - Cleanup completed - Certification Basis, Federal Register Notice Included PA.11-9


East North Central Pa  

Gasoline and Diesel Fuel Update (EIA)

East East North Central Pa cif ic Contiguous Mountain West North Central West South Central Pacific Noncontiguous East South Central Sout h At lant ic Middle Atlantic New England 35. Average Price of Natural Gas Delivered to Consumers by Census Division, 1995-1996 (Dollars per Thousand Cubic Feet) Table Census Division Residential Commercial 1995 1996 1995 1996 New England ........................................................... 9.06 9.03 6.78 6.96 Middle Atlantic ......................................................... 7.75 8.00 6.04 6.57 East North Central ................................................... 5.05 5.44 4.57 4.94 West North Central .................................................. 4.97 5.54 4.08 4.71 South Atlantic........................................................... 6.89 7.50 5.33 6.14 East South Central...................................................


Category:Pittsburgh, PA | Open Energy Information  

Open Energy Info (EERE)

Pittsburgh, PA Pittsburgh, PA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Pittsburgh, PA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Pittsburgh PA PECO Energy Co.png SVFullServiceRestauran... 65 KB SVHospital Pittsburgh PA PECO Energy Co.png SVHospital Pittsburgh ... 60 KB SVLargeHotel Pittsburgh PA PECO Energy Co.png SVLargeHotel Pittsburg... 60 KB SVLargeOffice Pittsburgh PA PECO Energy Co.png SVLargeOffice Pittsbur... 61 KB SVMediumOffice Pittsburgh PA PECO Energy Co.png SVMediumOffice Pittsbu... 63 KB SVMidriseApartment Pittsburgh PA PECO Energy Co.png SVMidriseApartment Pit... 64 KB SVOutPatient Pittsburgh PA PECO Energy Co.png SVOutPatient Pittsburg... 62 KB SVPrimarySchool Pittsburgh PA PECO Energy Co.png


Category:Philadelphia, PA | Open Energy Information  

Open Energy Info (EERE)

PA PA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Philadelphia, PA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Philadelphia PA PECO Energy Co.png SVFullServiceRestauran... 65 KB SVHospital Philadelphia PA PECO Energy Co.png SVHospital Philadelphi... 59 KB SVLargeHotel Philadelphia PA PECO Energy Co.png SVLargeHotel Philadelp... 60 KB SVLargeOffice Philadelphia PA PECO Energy Co.png SVLargeOffice Philadel... 61 KB SVMediumOffice Philadelphia PA PECO Energy Co.png SVMediumOffice Philade... 63 KB SVMidriseApartment Philadelphia PA PECO Energy Co.png SVMidriseApartment Phi... 64 KB SVOutPatient Philadelphia PA PECO Energy Co.png SVOutPatient Philadelp... 62 KB SVPrimarySchool Philadelphia PA PECO Energy Co.png


DOE - Office of Legacy Management -- Carpenter Steel Co - PA...  

Office of Legacy Management (LM)

included uranium hot rolling tests. PA.12-3 PA.12-4 Site Disposition: Eliminated - Radiation levels below criteria PA.12-1 PA.12-3 PA.12-5 Radioactive Materials Handled: Yes...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.



Office of Legacy Management (LM)

e e D"E(:pa . EFG (0744 United States Government .;,~&ljy gb' /fq Department of Eneigy memorandum JUN 4 1992 DATE: REPLY TO ATTN OF: EM-421 (W. A. Williams, 903-8149) SUBJECT: Authority Determination -- Springdale, Pennsylvania Former C. H. Schnoor & Company facility, TO: The File The attached review documents the basis for determining whether DOE has authority for taking remedial action at the former C. H. Schnoor & Company facility in Springdale, Pennsylvania, under the Formerly Utilized Sites Remedial Action Program (FUSRAP). The facility was used for the shaping of uranium by the Manhattan Engineer District (MED) during the Second World War. The following factors are significant in reaching a decision and are discussed in more detail in the attached authority review:


DOE - Office of Legacy Management -- Aliquippa - PA 07  

Office of Legacy Management (LM)

Aliquippa - PA 07 Aliquippa - PA 07 FUSRAP Considered Sites Aliquippa, PA Alternate Name(s): Cyclops Corporation, Titusville Plant Univesal Cyclops, Inc Aliquippa Forge Site Vulcan Crucible Site PA.07-2 PA.07-4 Location: 100 First Street, Aliquippa, Pennsylvania PA.07-4 Historical Operations: During the late 1940s, performed metal fabrication services under contracct with the AEC that included rolling natural uranium metal into rods. PA.07-3 PA.07-5 PA.07-6 PA.07-7 Eligibility Determination: Eligible PA.07-1 Radiological Survey(s): Assessment Surveys, Verification Surveys PA.07-8 PA.07-9 PA.07-10 PA.07-11 PA.07-12 Site Status: Certified- Certification Basis, Federal Register Notice included PA.07-4 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP



NLE Websites -- All DOE Office Websites (Extended Search)

Rats Rats Nature Bulletin No. 81 August 31, 1946 Forest Preserve District of Cook County Clayton F. Smith, President Roberts Mann, Superintendent of Conservation RATS Rats and men have been at war since the dawn of history. The "cradle of mankind" Central Asia, apparently was also the place of origin of the rat. From there, living and traveling with man, it has spread over the globe. In the United States today there are about as many rats as there are people. Cur common rat is the Norway or brown rat which arrived here from Europe before the Revolutionary War. Fiercer and more cunning, it soon exterminated the black rat and the roof rat which had migrated here with the early colonists and thrived. The black rat -- which is glossy black above, smaller and more slender -- and the roof rat, a close relative, are found now only rarely in some of the southern states, although still common in tropical America.


BatPaC - Battery Performance and Cost model - Home  

NLE Websites -- All DOE Office Websites (Extended Search)

> BatPaC Home About BatPaC Download BatPaC Contact Us BatPaC: A Lithium-Ion Battery Performance and Cost Model for Electric-Drive Vehicles The recent penetration of...


DOE - Office of Legacy Management -- Frankford Arsenal - PA 21  

Office of Legacy Management (LM)

Frankford Arsenal - PA 21 Frankford Arsenal - PA 21 FUSRAP Considered Sites Site: Frankford Arsenal (PA.21 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Pitman -Dunn Laboratories Dept. , Philadelphia , Pennsylvania PA.21-1 Evaluation Year: 1987 PA.21-2 Site Operations: Conducted research involving the use of uranium tetrachloride and metal fabrication operations with uranium metal. PA.21-2 PA.21-4 PA.21-5 Site Disposition: Eliminated - Referred to DOD PA.21-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.21-2 PA.21-3 PA.21-4 PA.21-5 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD PA.21-2


Palmco Power PA, LLC | Open Energy Information  

Open Energy Info (EERE)

PA, LLC Place New York Utility Id 56573 Utility Location Yes Ownership R Operates Generating Plant Yes References EIA Form EIA-861 Final Data File for 2010 - File1a1 LinkedIn...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NllPA DETERMINATION NllPA DETERMINATION REClPI[NT:General Molors LlC Page I 0[2 STATE: MI PROJECf TITLE: Investigation of Micra.andMacro-scale Transport Processes for Improved Fuel Cell Performance Funding Opportunity Announcement Number Proc:urement Instrument Number NEPA Control Number CID Number DE·PS36-08G098OO9 EE0000470 GF0-10-353 EE470 Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA},1 have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: B3.6 Siting, construction (or modification). operation, and decommissioning of facilities for indoor bench-scale research projects and conventional laboratory operations (fOf example, preparation of chemical standards and sample analYSIS);


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


US MidAtl PA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MidAtl PA MidAtl PA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl PA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl PA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl PA Expenditures dollars ELECTRICITY ONLY average per household * Pennsylvania households consume an average of 96 million Btu per year, 8% more than the U.S. average. Pennsylvania residents also spend 16% more than the average U.S. households for energy consumed in their homes. * Average electricity consumption in Pennsylvania homes is 10,402 kWh per year, which is lower than the national average, but 58% more than New York households and 17% more than New Jersey residents.

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US MidAtl PA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MidAtl PA MidAtl PA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US MidAtl PA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US MidAtl PA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US MidAtl PA Expenditures dollars ELECTRICITY ONLY average per household * Pennsylvania households consume an average of 96 million Btu per year, 8% more than the U.S. average. Pennsylvania residents also spend 16% more than the average U.S. households for energy consumed in their homes. * Average electricity consumption in Pennsylvania homes is 10,402 kWh per year, which is lower than the national average, but 58% more than New York households and 17% more than New Jersey residents.


PA Sangli Bundled Wind Project | Open Energy Information  

Open Energy Info (EERE)

PA Sangli Bundled Wind Project Jump to: navigation, search Name PA Sangli Bundled Wind Project Place Maharashtra, India Zip 416115 Sector Wind energy Product Ichalkaranji-based SPV...


NETL: Science Bowl Information - Southwestern PA  

NLE Websites -- All DOE Office Websites (Extended Search)

Science Bowl Information > Science Bowl Information - South West PA Science Bowl Information > Science Bowl Information - South West PA Educational Initiatives Science Bowl Information - Southwestern PA Facebook Visit us on Facebook CLICK ON IMAGE TO SEE LARGER VIEW SWPA SWPA SWPA 2012 SWPA Science Bowl Results Congratulations! North Allegheny High School and Ingomar Middle School The finals for the SWPA Science Bowl were held on March 7th. The winner of the SWPA High School Science Bowl is North Allegheny High School. The winner of the SWPA Middle School Science Bowl is Ingomar Middle School Team 2 from the North Allegheny School District. The final team results are High School: 1st - North Allegheny HS 2nd - Mt. Lebanon HS 3rd - Baldwin HS 4th - Pine-Richland HS Middle School: 1st - Ingomar MS Team 2 (North Allegheny School District)


Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area (Redirected from New York Area - NY NJ CT PA) Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026


DOE - Office of Legacy Management -- Jessop Steel Co - PA 17  

Office of Legacy Management (LM)

Jessop Steel Co - PA 17 Jessop Steel Co - PA 17 FUSRAP Considered Sites Site: JESSOP STEEL CO. (PA.17 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 500 Green Street , Washington , Pennsylvania PA.17-3 Evaluation Year: 1991 PA.17-1 Site Operations: Metal fabrication for the AEC in the early 1950s. PA.17-1 Site Disposition: Eliminated - Limited quantities of radioactive material handled on site - Potential for residual radioactive contamination is considered remote - Confirmed by radiological survey PA.17-1 PA.17-2 PA.17-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.17-1 Radiological Survey(s): Yes PA.17-3 Site Status: Eliminated from further consideration under FUSRAP


De l'utilite de l'hermeneutique des Tantra bouddhiques a propos d'un expose de l'appareit des Sept Ornements par un doxologue erudit dge lugs pa dBal mang dKon mchog rgyal mtshan (1764-1863)  

E-Print Network (OSTI)

) et son interprtation, v. P. Arnes (2002-a) : pp. 23-25 et n. 77-79. 31 Sa skya Pandita Kun dga rgyal mtshan (1182-1251), mKhas pa rnamsjug pai sgo zhes bya bai bstan bcos, (dornavant mKhas pa rnamsjug pai sgo), Mi rigs dpe skrun khang, 1981... don gsal ba sgron me, dans The Collected Works of Gu?-tha? dKon-mchog bstan- pai sgron-me, vol.1., 1971, p. 707 : sbas don ni bla mai man ngag gis ma bstan par rang dbang du dpyad pas rtogs mi nus pa zhig yin / ; pour le sens cach, v. ltude qui...

Arenes, Pierre




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Bettis Atomic Power Laboratories - PA  

Office of Legacy Management (LM)

Bettis Atomic Power Laboratories - Bettis Atomic Power Laboratories - PA 44 FUSRAP Considered Sites Site: Bettis Atomic Power Laboratories (PA.44 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Allegheny County , West Mifflin , Pennsylvania PA.44-1 Evaluation Year: Circa 1987 PA.44-2 Site Operations: Conducted activities directed toward the design, development, testing, and operational follow of nuclear reactor propulsion plants for Naval surface and submarine vessels. PA.44-1 Site Disposition: Eliminated - Active DOE facility PA.44-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Radioactive Materials Associated with Reactor Operation PA.44-3 Radiological Survey(s): None Indicated


Northeast - NY NJ CT PA Area | Open Energy Information  

Open Energy Info (EERE)

Northeast - NY NJ CT PA Area Northeast - NY NJ CT PA Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Northeast - NY NJ CT PA Area 1.1 Products and Services in the Northeast - NY NJ CT PA Area 1.2 Research and Development Institutions in the Northeast - NY NJ CT PA Area 1.3 Networking Organizations in the Northeast - NY NJ CT PA Area 1.4 Investors and Financial Organizations in the Northeast - NY NJ CT PA Area 1.5 Policy Organizations in the Northeast - NY NJ CT PA Area Clean Energy Clusters in the Northeast - NY NJ CT PA Area Products and Services in the Northeast - NY NJ CT PA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026


DOE - Office of Legacy Management -- Foote Mineral Co - PA 27  

NLE Websites -- All DOE Office Websites (Extended Search)

Foote Mineral Co - PA 27 Foote Mineral Co - PA 27 FUSRAP Considered Sites Site: Foote Mineral Co. (PA.27 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Exton , Pennsylvania PA.27-1 Evaluation Year: 1987 PA.27-1 Site Operations: Processed rare earth, principally zirconium and monazite sand was processed on a pilot-plant scale. PA.27-2 Site Disposition: Eliminated - Limited quantity of material handled - Potential for contamination considered remote PA.27-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Zirconium, Possibly Uranium PA.27-1 PA.27-2 PA.27-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Foote Mineral Co.


DOE - Office of Legacy Management -- Sharples Corp - PA 29  

NLE Websites -- All DOE Office Websites (Extended Search)

Sharples Corp - PA 29 Sharples Corp - PA 29 FUSRAP Considered Sites Site: SHARPLES CORP. (PA.29 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 201 Spring Garden Street , Philadelphia , Pennsylvania & Philadelphia , Pennsylvania PA.29-2 PA.29-1 Evaluation Year: 1986 PA.29-1 Site Operations: Producer/broker of special chemicals - major MED supplier. PA.29-2 PA.29-3 Site Disposition: Eliminated - No indication that radioactive materials were used on the site PA.29-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to SHARPLES CORP. PA.29-1 - Memorandum/Checklist; D. Levine to the File; Subject:


DOE - Office of Legacy Management -- Heppanstall Co - PA 19  

Office of Legacy Management (LM)

Heppanstall Co - PA 19 Heppanstall Co - PA 19 FUSRAP Considered Sites Site: Heppanstall Co. (PA.19 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Tippens Inc. PA.19-1 Location: 4620 Hatfield Street , Pittsburgh , Pennsylvania PA.19-4 Evaluation Year: 1987 PA.19-2 Site Operations: Forged approximately 100,000 pounds of uranium during a six month period in 1955. PA.19-1 Site Disposition: Eliminated - Potential for contamination remote. Radiological screening survey results indicate radiation levels well below DOE guidelines. Conditions at site meet applicable requirements - No further investigation of site necessary. PA.19-1 PA.19-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.19-3


DOE - Office of Legacy Management -- Beryllium Corp - PA 39  

NLE Websites -- All DOE Office Websites (Extended Search)

Beryllium Corp - PA 39 Beryllium Corp - PA 39 FUSRAP Considered Sites Site: BERYLLIUM CORP. (PA.39 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Brush Beryllium PA.39-1 Location: Reading , Pennsylvania PA.39-1 Evaluation Year: 1987 PA.39-1 Site Operations: Production of Beryllium circa late 1940s - 50s. PA.39-1 Site Disposition: Eliminated - No radioactive material handled at this site, only Beryllium PA.39-1 Radioactive Materials Handled: No PA.39-1 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to BERYLLIUM CORP. PA.39-1 - Memorandum/Checklist; D. Levine to the File; Subject:


Technical Insights for Saltstone PA Maintenance  

Science Conference Proceedings (OSTI)

The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure & Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and compatibility with existing CBP expertise and already-planned activities. Based on these criteria, the five original topics were down-selected to two: external sulfate attack and mechanistic geochemical prediction. For each of the selected topics, the CBP communicated with the PA analysts and subject matter experts at Savannah River to acquire input data specific to the Saltstone facility and related laboratory experiments. Simulations and analyses were performed for both topics using STADIUM (SIMCO 2008), LeachXS/ORCHESTRA (ECN 2007, Meeussen 2003), and other software tools. These supplemental CBP analyses produced valuable technical insights that can be used to strengthen the Saltstone PA using the ongoing PA maintenance process. This report in part summarizes key information gleaned from more comprehensive documents prepared by Sarkar et al. (2010), Samson (2010), and Sarkar (2010).

Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.




Office of Legacy Management (LM)

PA.03 PA.03 ? A' EROSPACE~CORPORATI' ON / A. Plato, S. W., Washington, D. C. ZOOZJ. Telephone: (20.2) 488.6000 7117-Oli85.cdy.X 30'Septemberl985 Mr. Arthur Whitman, NE-24 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Whitman: AUTHORITY ,REVIEW. - THE FORMER SUPERIOR,STEEL CORPORATION SITE - AECCONTRACT NO. AT(30-l)- 1412 Aer0spac.e has completed.assembly and analysis.of, available documentation,, and'.prepared the,subject review for'your consideration and. determination ifthere.is authority for. remedial action. under FUSRAP' at the former Superior SteellCorporation facility in-Carnegie, Pennsylvania. As indica,ted,in the attached~review, the Superior Steel Corporation was one of three principal contractors involved in AEC's initial fuel element


DOE - Office of Legacy Management -- Philadelphia Navy Yard - PA 08  

NLE Websites -- All DOE Office Websites (Extended Search)

Philadelphia Navy Yard - PA 08 Philadelphia Navy Yard - PA 08 FUSRAP Considered Sites Site: PHILADELPHIA NAVY YARD (PA.08) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Philadelphia , Pennsylvania PA.08-1 Evaluation Year: 1987 PA.08-1 Site Operations: Abelson's S-50 thermal diffusion pilot plant was built and operated on this facility in 1944 and large quantities of uranium hexafluoride were processed in 1945. PA.08-1 Site Disposition: Eliminated - Referred to DOD PA.08-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium oxide (hexaflouride) PA.08-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD PA.08-1


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Catalytic Co - PA 40  

NLE Websites -- All DOE Office Websites (Extended Search)

Catalytic Co - PA 40 Catalytic Co - PA 40 FUSRAP Considered Sites Site: Catalytic Co. (PA.40 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Philadelphia , Pennsylvania PA.40-1 Evaluation Year: 1991 PA.40-1 Site Operations: Prime contractor for construction of the Fernald facility. Records indicate one time shipment of a very small quantity (4 lbs) of uranium metal to this site. PA.40-1 Site Disposition: Eliminated - Construction contractor - Potential for residual contamination from the very small quantity of uranium shipped to this site is considered remote PA.40-2 Radioactive Materials Handled: None - as a construction contractor Primary Radioactive Materials Handled: Uranium Metal - Believed to be a Souvenier. PA.40-1


DOE - Office of Legacy Management -- Summerville Tube Co - PA 24  

NLE Websites -- All DOE Office Websites (Extended Search)

Summerville Tube Co - PA 24 Summerville Tube Co - PA 24 FUSRAP Considered Sites Site: SUMMERVILLE TUBE CO. (PA.24) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Bridgeport , Pennsylvania PA.24-1 Evaluation Year: 1987 PA.24-1 Site Operations: Metal fabrication research and development on uranium metal in the early 1940s - Cold drawing of tuballoy aluminum sheathing. PA.24-1 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote due to limited scope of operations and quantity of radioactive material handled PA.24-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.24-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



DOE - Office of Legacy Management -- Shippingport Atomic Power Plant - PA  

Office of Legacy Management (LM)

Shippingport Atomic Power Plant - Shippingport Atomic Power Plant - PA 13 FUSRAP Considered Sites Site: SHIPPINGPORT ATOMIC POWER PLANT (PA.13 ) Eliminated from further consideration under FUSRAP. Designated Name: Not Designated Alternate Name: Duquesne Light Company PA.13-1 Location: 25 miles west of Pittsburgh in Beaver County , Shippingport , Pennsylvania PA.13-2 Evaluation Year: circa 1987 PA.13-3 Site Operations: First commercially operated nuclear power reactor. Joint project (Federal Government an Duquesne Light Company) to demonstrate pressurized water reactor technology and to generate electricity. Plant operated by Duquesne Light Company under supervision of the Office of the DOE Deputy Assistant Secretary for Naval Reactors -- 1957 to October 1982. PA.13-2 Site Disposition: Eliminated - No Authority. DOE chartered Major Project #118, Shippingport Station Decommissioning Project completed cleanup in 1989. PA.13-1


NETL: Science Bowl Information - Southwestern PA  

NLE Websites -- All DOE Office Websites (Extended Search)

2011 SWPA Science Bowl 2011 SWPA Science Bowl CLICK ON IMAGE TO SEE LARGER VIEW SWPA West Chester East Team 1 SWPA Hempfield Team 1 SWPA State College Team 1 and SWPA Winner SWPA Norwin Team 1 Lilas Soukup,SB Coordinator NETL, The Honorable Tim Murphy, U.S. House, Dr. Charlene Newkirk, Dr. Anthony Cugini, Director, NETL Click here to watch the archived webcast of the Southwestern PA Science Bowl Finals High School Congratulations to our four division winners: View full results here Division Einstein - West Chester East Team 1 - Frances Poodry, Coach - Jon C, Captain - Ashish B - Alex C - Dan D Division Carson - Hempfield Team 1 - Thomas Harden, Coach - Jake K, Captain - Chase L - Rob R - Mike T - Priya B Division Tesla - State College Team 1 and SWPA Winner - Christoph S, Captain - Joe L - Monica M


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



NETL: 2010 SW PA Middle School Science Bowl  

NLE Websites -- All DOE Office Websites (Extended Search)

is open to middle school students (school, scouts, home school) from Southwestern Pennsylvania (SW PA). Complete eligibility requirements are located at the National...


Microsoft PowerPoint - NETL Pittsburgh, PA to Washington, DC...  

NLE Websites -- All DOE Office Websites (Extended Search)

PA. 2. Merge RIGHT via Exit 161 onto I-70 EAST toward BREEZEWOODUS-30 BALTIMOREWASHINGTON, DC (follow US-30 through Breezewood). , ( g ) 3. At FREDERICKSBURG, merge...


Privacy Act (PA) of 1974 | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

(PA) of 1974 | National Nuclear Security Administration (PA) of 1974 | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Privacy Act (PA) of 1974 Home > About Us > Our Operations > NNSA Office of General Counsel > Privacy Act (PA) of 1974 Privacy Act (PA) of 1974 The purpose of the Privacy Act of 1974 (Act), Title 5, United States Code,


Building Energy Software Tools Directory: Power Calc PaK  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Calc PaK Power Calc PaK Power Calc PaK logo Power Calc PaK is smart electrical engineering software with a proprietary database. With just 3 inputs (load kVA, load type, and number of poles), it automatically calculates, and recalculates for changes (upstream and downstream), the entire power distribution system in a building providing more than 300 outputs that are compliant with the National Electrical Code (NEC). Power Calc PaK is a patent-protected innovation (covered by U.S. Patent No. 7,636,650). One bundled calculation integrates all the outputs across all the panelboards and equipment worksheets required for the power distribution system from the branch circuit to the electrical service. A few highlights are: 3 inputs for 300 NEC-compliant outputs; ends tedious and repetitive


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


BatPaC - Battery Performance and Cost model - About BatPaC  

NLE Websites -- All DOE Office Websites (Extended Search)

About BatPaC About BatPaC The starting point for this work is based on the decades of battery design work headed by Paul Nelson at Argonne National Laboratory. These design models were based in Microsoft Office Excel® resulting in a flexible and straightforward format. The current effort builds on this previous experience by adding a manufacturing cost calculation as well as increasing the fidelity of the performance calculations all while maintaining efficient calculations (e.g. fractions of a second). The cost of a battery will change depending upon the materials chemistry, battery design, and manufacturing process. Therefore, it is necessary to account for all three areas with a bottom-up cost model. Other bottom-up cost models exist but are not generally available and have not been explicitly detailed in a public document. The motivation for our approach is based on a need for a battery performance and cost model that meets the following requirements:


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Martin-Lf Random and PA-complete Sets  

E-Print Network (OSTI)

A set A is Martin-Lof random iff the class fAg does not have \\Sigma 1 -measure 0. A set A is PA-complete if one can compute relative to A a consistent and complete extension of Peano Arithmetic. It is shown that every Martin-Lof random set either permits to solve the halting problem K or is not PA-complete. This result implies a negative answer to the question of Ambos-Spies and Kucera whether there is a Martin-Lof random set not above K which is also PA-complete.

Frank Stephan



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


PaTu Wind Farm | Open Energy Information  

Open Energy Info (EERE)

PaTu Wind Farm PaTu Wind Farm Jump to: navigation, search Name PaTu Wind Farm Facility PaTu Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Developer Oregon Trail Wind Farm Location Sherman County OR Coordinates 45.603734°, -120.618621° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.603734,"lon":-120.618621,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Palmetto Clean Energy (PaCE) Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Palmetto Clean Energy (PaCE) Program Palmetto Clean Energy (PaCE) Program Palmetto Clean Energy (PaCE) Program < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools State Government Savings Category Bioenergy Biofuels Alternative Fuel Vehicles Buying & Making Electricity Solar Home Weatherization Water Wind Program Info State South Carolina Program Type Performance-Based Incentive Rebate Amount Varies by technology and customer demand for Palmetto Clean Energy (PaCE) Provider South Carolina Energy Office '''''Note: For a limited time, generators of 6 kilowatts or less of renewable energy can now take advantage of a premium $0.10 per kilowatt hour. This premium is available on a first-come-first-serve basis to generators of solar, wind, hydro or biomass-based electricity.'''''



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SBOT 17-May-11 MINING PENNSYLVANIA NATIONAL ENERGY TECHNOLOGY LAB - PA POC Larry Sullivan Telephone (412) 386-6115 Email larry.sullivan@netl.doe.gov Support Activities for Oil and...


Microsoft PowerPoint - NETL Pittsburgh, PA to Washington, DC...  

NLE Websites -- All DOE Office Websites (Extended Search)

Washington, DC Headquarters 1. COCHRANS MILL RD. becomes BROWNSVILLE RD. 2. Stay STRAIGHT to go onto CURRY HOLLOW RDYELLOW BELT. 3 T k th PA 51 SOUTH t d CLAIRTON 3. Take the...


PA -Alternative 2009 FINAL mark revisions 91709green FINAL use...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the insulation , shall inspect the air barrier and insulation. PA304.3 Fireplaces. New wood-burning fireplaces shall have gasketed doors and outdoor combustion air. Exception:...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Vito Cedro III Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7406 vito.cedro@netl.doe.gov Jason S....


DOE - Office of Legacy Management -- Superior Steel Co - PA 03  

Office of Legacy Management (LM)

site; January 27, 1995 PA.03-4 - ORNLDOE Preliminary Survey; T.E. Myrick and C. Clark; Preliminary Site Survey Report for the Former Superior Steel Mill at Carnegie,...


PaSol Italia SpA | Open Energy Information  

Open Energy Info (EERE)

investors in order to initiate local PV module manufacturing to address the growing solar market in Italy and other parts of Europe References PaSol Italia SpA1 LinkedIn...


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


DOE - Office of Legacy Management -- Shallow Land Disposal Area - PA 45  

Office of Legacy Management (LM)

Shallow Land Disposal Area - PA 45 Shallow Land Disposal Area - PA 45 FUSRAP Considered Sites Shallow Land Disposal Area, PA Alternate Name(s): Parks Township Shallow Land Disposal Area Nuclear Materials and Equipment Corporation (NUMEC) Babcox and Wilcox Parks Facilities PA.45-1 PA.45-5 PA.45-6 Location: PA Route 66 and Kissimere Road, Parks Township, Apollo, Pennsylvania PA.45-1 Historical Operations: Fabricated nulcear fuel under an NRC license as an extension of NUMEC Apollo production facilities. PA.45-1 PA.45-5 Eligibility Determination: Eligible PA.45-6 Radiological Survey(s): None Site Status: Cleanup in progress by U.S. Army Corps of Engineers. PA.45-6 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to Shallow Land Disposal Area, PA


DOE - Office of Legacy Management -- Aluminum Co of America - PA 23  

Office of Legacy Management (LM)

PA 23 PA 23 FUSRAP Considered Sites Site: Aluminum Company of America (ALCOA) ( PA.23 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: ALCOA Research Laboratory ALCOA New Kensington Works PA.23-3 PA.23-4 Location: 600 Freeport Road and Pine and Ninth Streets , New Kensington , Pennsylvania PA.23-1 PA.23-4 Evaluation Year: Circa 1993 PA.23-1 Site Operations: Research/Development and Production activities in support of the MED uranium slug canning and other programs, 1943-1945. PA.23-5 Site Disposition: Eliminated - Based upon results of radiological surveys of the properties, potential for residual radioactive contamination is considered remote PA.23-1 PA.23-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.23-1


Microsoft PowerPoint - PA CoP.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Community of Practice Roger Seitz (Savannah River National Laboratory) David Kosson (CRESP/Vanderbilt University) Martin Letourneau (DOE EM-41) 10 March 2010 WM '10, Phoenix Arizona SRNL-MS-2010-00037-S 2 WM 10, March 10, 2010 Safety Case Concept IAEA, Nuclear Energy Agency and others Reflects use of PA as only one part of a package used to support decisions "The purpose of computing is insight, not numbers" - Richard Hamming PA PA Uncertainty/ Importance Analysis Uncertainty/ Importance Analysis Safety Case Design Design Stakeholder Stakeholder Demonstrations Demonstrations R&D R&D Monitoring Monitoring Documentation Documentation WAC WAC Uncertainties can be managed in many different ways in addition to modeling 3 WM 10, March 10, 2010 Allow Low-level Waste Disposal Facility Federal



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

County of Chester STATE: PA County of Chester STATE: PA PROJECT EECBG - Chester County (PA) Installation of Cool Roof at Coatesville District Court TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA0000013 EE0000932 GFO-O000932-003 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy. demonstrate potential energy conservation. and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


DOE - Office of Legacy Management -- Pennsylvania Ordnance Works - PA 32  

Office of Legacy Management (LM)

Ordnance Works - PA 32 Ordnance Works - PA 32 FUSRAP Considered Sites Site: Pennsylvania Ordnance Works (PA.32 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


P.A. Capdau Charter School | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

P.A. Capdau Charter School P.A. Capdau Charter School P.A. Capdau Charter School August 8, 2007 - 3:16pm Addthis Prepared Remarks for Secretary Bodman Thank you, Principal Mitchell, for your kind introduction. I am glad to be back here in New Orleans to witness the tremendous progress all of you have made after the devastating events of two years ago. I am here not only to commend your efforts but also to state my commitment and the Department of Energy's commitment to the continued rebuilding effort. With great challenges come great opportunities. While there are tangible losses to grieve over when such devastation occurs, the resilient American spirit also finds unique ways to maximize any positive impact. In this case, the chance to rebuild much of the physical infrastructure that has


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


DOE - Office of Legacy Management -- Palmerton Ore Buying Site - PA 33  

NLE Websites -- All DOE Office Websites (Extended Search)

Palmerton Ore Buying Site - PA 33 Palmerton Ore Buying Site - PA 33 FUSRAP Considered Sites Site: PALMERTON ORE BUYING SITE (PA.33) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: New Jersey Zinc Company PA.33-1 Location: Palmerton , Pennsylvania PA.33-2 Evaluation Year: 1994 PA.33-3 Site Operations: Mid-1950s - AEC leased the New Jersey Zinc Company property and established a uranium ore stockpile on the property in the vicinity of Palmerton, PA. PA.33-4 Site Disposition: Eliminated - Potential for residual contamination and resulting exposure beyond that associated with natural background radiation considered remote PA.33-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Ore PA.33-4 Radiological Survey(s): Yes PA.33-5

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Rohm and Hass Co - PA 02  

Office of Legacy Management (LM)

Rohm and Hass Co - PA 02 Rohm and Hass Co - PA 02 FUSRAP Considered Sites Site: ROHM & HASS CO. (PA.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 5000 Richmond Street , Philadelphia , Pennsylvania PA.02-1 Evaluation Year: 1985 PA.02-2 Site Operations: Research and development on uranium recovery from carbonate leach liquors in the mid-1950s. PA.02-3 Site Disposition: Eliminated - Radiation levels below criteria PA.02-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.02-3 Radiological Survey(s): Yes PA.02-4 Site Status: Eliminated from consideration under FUSRAP PA.02-5 Also see Documents Related to ROHM & HASS CO. PA.02-1 - DOE Letter; Thornton to Bjuvik; Subject: Radiological


Development of a new dynamic gas flow-control system in the pressure range of 1 Pa-133 Pa  

Science Conference Proceedings (OSTI)

A new flow-control system (FCS-705) has been developed at Korea Research Institute of Standards and Science. The system is intended for calibration of vacuum gauges in the pressure range of 1 Pa-133 Pa by comparison method. This paper describes some basic characteristics of the system including; (1) the design and construction of the system, (2) the generation of stable pressures in the chamber, (3) achieving high upstream pressure limit by installing a short duct in the by-pass pumping line, and (4) investigation of the gas flow regimes within the short duct.

Hong, S. S.; Chung, J. W. [Korea Research Institute of Standards and Science, Daejeon 305-340 (Korea, Republic of); Khan, Wakil [Pakistan Vacuum Society, street 17, Islamabad (Pakistan)




E-Print Network (OSTI)

knowledge of market conditions unavailable to its competitors. This informational trading advantage from EOL for allegations that Williams Energy Marketing & Trading Co. cornered the market for natural gas in California3-26-03 DOCKET NO. PA02-2-000 STAFF REPORT PRICE MANIPULATION IN WESTERN MARKETS FINDINGS

Laughlin, Robert B.


DOE - Office of Legacy Management -- U S Bureau of Mines - PA 36  

Office of Legacy Management (LM)

PA 36 PA 36 FUSRAP Considered Sites Site: U. S. BUREAU OF MINES (PA.36) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Bruceton , Pennsylvania PA.36-1 Evaluation Year: 1987 PA.36-2 Site Operations: Conducted studied on explosiveness of Uranium, Thorium and Beryllium. PA.36-1 PA.36-3 Site Disposition: Eliminated - Small amounts of radioactive materials used - Potential for residual radioactive contamination considered remote PA.36-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium and Thorium PA.36-2 Radiological Survey(s): Yes - health and safety monitoring during operations only PA.36-1 Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Landis Machine Tool Co - PA 34  

NLE Websites -- All DOE Office Websites (Extended Search)

Landis Machine Tool Co - PA 34 Landis Machine Tool Co - PA 34 FUSRAP Considered Sites Site: LANDIS MACHINE TOOL CO. (PA.34 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Teledyne Landis Machine PA.34-1 Location: Waynesboro , Pennsylvania PA.34-2 Evaluation Year: 1991 PA.34-1 Site Operations: Manufactured metal fabrication equipment for machining uranium metal slugs. PA.34-1 Site Disposition: Eliminated - Limited scope of activities performed quantities of radioactive materials involved suggest little or no potential for residual radioactive contamination PA.34-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.34-2 Radiological Survey(s): Yes - health and safety monitoring during operations PA.34-3


DOE - Office of Legacy Management -- Curtis-Wright Corp - PA 37  

NLE Websites -- All DOE Office Websites (Extended Search)

Curtis-Wright Corp - PA 37 Curtis-Wright Corp - PA 37 FUSRAP Considered Sites Site: Curtis-Wright Corp. ( PA.37 ) Eliminated from further consideration under FUSRAP - Referred to the Pennsylvania Department of Environmental Resources, Bureau of Radiation Protection Designated Name: Not Designated Alternate Name: Quehanna Site Quehanna Radioisotopes Pilot Plant Radiation Process Center PA.37-1 Location: Northwest Clearfield County , Quehanna , Pennsylvania PA.37-2 PA.37-3 Evaluation Year: Circa 1990 PA.37-1 Site Operations: 1955-1960 Conducted research in nucleonics, electronics, chemicals and plastics - work for AEC primarily isotope separation and heat sources for space application. Also work for U.S. Air Force. AEC licensed facility. PA.37-1 PA.37-3 Site Disposition: Eliminated - No Authority to perform remedial action. Commercial facility operated under AEC license. Cleanup by the Commonwealth of Pennsylvania under plan approved by NRC. PA.37-2


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Designation Survey - Palmerton, Pa. Ore Storage Site William Bibb  

Office of Legacy Management (LM)

Designation Survey - Palmerton, Pa. Ore Storage Site Designation Survey - Palmerton, Pa. Ore Storage Site William Bibb Oak Ridge Operations Office Based on the information furnished in Aerospace's Review of the.subject site (Attachment 1) and the ORKL/RASA (Attachment 2), it Is requested that designation survey of the Palmerton Ore Storage Pennsylvania. The survey should be detailed to and subsurface data to make up for the lack of the previous AEC surveys and in keeping with ORNL/RASA group should furnish a draft survey approval prior to conducting any survey activities. If there are any questions, please call Edward DeLaney 04 FTS 253-4716. Arthur J. Whitman / '/ Division of Facility and Site ' Deconrnissioning P,rojects Office of Nuclear Energy : 2 Attachments I bee: I E. Keller, OR, w/attachs:


Demonstration Assessment of LED Roadway Lighting: Philadelphia, PA  

Science Conference Proceedings (OSTI)

For this demonstration assessment, 10 different groups of LED luminaires were installed at three sites in Philadelphia, PA. Each of the three sites represented a different set of conditions, most importantly with regard to the incumbent HPS luminaires, which were nominally 100 W, 150 W, and 250 W. The performance of each product was evaluated based on manufacturer data, illuminance calculations, field measurements of illuminance, and the subjective impressions of both regular and expert observers.

Royer, Michael P.; Tuenge, Jason R.; Poplawski, Michael E.



DOE - Office of Legacy Management -- Westinghouse Atomic Power Div - PA 16  

Office of Legacy Management (LM)

Power Div - PA Power Div - PA 16 FUSRAP Considered Sites Site: WESTINGHOUSE ATOMIC POWER DIV. (PA.16 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Route 30 (Forrest Hills) , Pittsburgh , Pennsylvania PA.16-1 Evaluation Year: 1985 PA.16-1 Site Operations: Processed uranium metal for research and development and pilot-scale production of uranium oxide fuel elements. Prepared uranium metal for Enrico Fermi's Stagg Field experiment. PA.16-1 Site Disposition: Eliminated - Radiation levels below criteria PA.16-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium PA.16-1 Radiological Survey(s): Yes PA.16-3 Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Birdsboro Steel and Foundry Co - PA 31  

Office of Legacy Management (LM)

Birdsboro Steel and Foundry Co - PA Birdsboro Steel and Foundry Co - PA 31 FUSRAP Considered Sites Site: Birdsboro Steel and Foundry Co. (PA.31 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Birdsboro Steel Foundry & Machine Company PA.31-1 Location: Birdsboro , Pennsylvania PA.31-1 Evaluation Year: 1987 PA.31-2 Site Operations: Designed and developed metal fabrication facilities installed at the AEC Feed Materials Production Center at Fernald, Ohio; no information on metal fabrication at Birdsboro, although the site received small quantities of uranium metal - presumably for testing purposes. PA.31-2 PA.31-3 Site Disposition: Eliminated - Limited scope of activities and quantity of radioactive material used at the site suggest that the potential for residual radioactive material at the site is remote PA.31-2


DOE - Office of Legacy Management -- Bartol Research Foundation - PA 0-02  

NLE Websites -- All DOE Office Websites (Extended Search)

Bartol Research Foundation - PA Bartol Research Foundation - PA 0-02 FUSRAP Considered Sites Site: Bartol Research Foundation (PA 0-02) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: The Franklin Institute PA.0-02-1 Location: Swathmore , Pennsylvania PA.0-02-1 Evaluation Year: 1987 PA.0-02-1 Site Operations: Research organization. Possibly performed radiation monitoring and possibly supplied monitoring equipment to Monsanto Chemical Company. PA.0-02-1 Site Disposition: Eliminated - No indication that radioactive materials were used on this site PA.0-02-1 Radioactive Materials Handled: None Indicated PA.0-02-1 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Teledyne-Columbia-Summerville - PA 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Teledyne-Columbia-Summerville - PA Teledyne-Columbia-Summerville - PA 01 FUSRAP Considered Sites Site: TELEDYNE-COLUMBIA-SUMMERVILLE (PA.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Columbia Steel, Summerill Tube, Columbia-Summerill PA.01-1 Location: Pittsburgh , Pennsylvania PA.01-1 Evaluation Year: 1987 PA.01-1 Site Operations: Metal fabrication operations. No indication radioactive materials were involved. PA.01-1 Site Disposition: Eliminated - Site was not involved in the handling of radioactive materials PA.01-1 PA.01-2 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Babcock and Wilcox Co - PA 18  

Office of Legacy Management (LM)

Babcock and Wilcox Co - PA 18 Babcock and Wilcox Co - PA 18 FUSRAP Considered Sites Site: Babcock and Wilcox Co (PA 18) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Tubular Products Division PA.18-1 Location: Beaver Falls , Pennsylvania PA.18-1 Evaluation Year: 1990 PA.18-1 Site Operations: Performed development work to pierce uranium billets for extrusion to tubes. No indication that the piercing operation was conducted. PA.18-1 Site Disposition: Eliminated - No indication that the metal fabrication (piercing) operation was conducted on this site. Records indicate small radiation sources were used on the site. Potential for residual radioactive contamination considered remote due to the limited quantities of material handled on the site. PA.18-3


DOE - Office of Legacy Management -- University of Pennsylvania - PA 0-06  

Office of Legacy Management (LM)

Pennsylvania - PA Pennsylvania - PA 0-06 FUSRAP Considered Sites Site: UNIVERSITY OF PENNSYLVANIA (PA.0-06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Philadelphia , Pennsylvania PA.0-06-1 Evaluation Year: 1987 PA.0-06-1 Site Operations: Research activities involving small quantities of radioactive materials in a controlled environment. PA.0-06-1 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote PA.0-06-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Radium PA.0-06-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to UNIVERSITY OF PENNSYLVANIA


DOE - Office of Legacy Management -- Vanadium Corp of America - PA 15  

Office of Legacy Management (LM)

Vanadium Corp of America - PA 15 Vanadium Corp of America - PA 15 FUSRAP Considered Sites Site: Vanadium Corp. of America (PA.15) Eliminated from further consideration under FUSRAP. Designated Name: Not Designated Alternate Name: UMTRAP Vicinity Property No. CA-401 PA.15-5 Location: Mayer Street - Collier Township , Bridgeville , Pennsylvania PA.15-1 Evaluation Year: 1985 PA.15-2 Site Operations: Faclility used to grind pitchblende ore during the early 1940's for processing by Vitro at Canonsburg. Conducted research and developed processes for concentration of Colorado Plateau ores (uranium-vanadium) PA.15-3 Site Disposition: Eliminated - site cleaned up as a vicinity property of the Canonsburg Site in 1986 under the Uranium Mill Tailings Remedial Action Program (UMTRAP). PA.15-5


DOE - Office of Legacy Management -- University of Pittsburgh - PA 0-07  

Office of Legacy Management (LM)

Pittsburgh - PA 0-07 Pittsburgh - PA 0-07 FUSRAP Considered Sites Site: UNIVERSITY OF PITTSBURGH (PA.0-07) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Pittsburgh , Pennsylvania PA.0-07-1 Evaluation Year: 1987 PA.0-07-1 Site Operations: Research activities involving small quantities of radioactive materials in a controlled environment. PA.0-07-1 Site Disposition: Eliminated - Potential for residual radioactive contamination considered remote PA.0-07-1 Radioactive Materials Handled: Yes PA.0-07-1 Primary Radioactive Materials Handled: Not Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to UNIVERSITY OF PITTSBURGH



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PENNSYLVANIA PENNSYLVANIA NATIONAL ENERGY TECHNOLOGY LAB - PA POC Larry Sullivan Telephone (412) 386-6115 Email larry.sullivan@netl.doe.gov ADMINISTATIVE / WASTE / REMEDIATION Facilities Support Services 561210 Employment Placement Agencies 561311 Temporary Help Services 561320 Professional Employer Organizations 561330 Document Preparation Services 561410 Security Guards and Patrol Services 561612 Security Systems Services (except Locksmiths) 561621 Janitorial Services 561720 Landscaping Services 561730 Hazardous Waste Treatment and Disposal 562211 Remediation Services 562910 Materials Recovery Facilities 562920 All Other Miscellaneous Waste Management Services 562998 CONSTRUCTION Industrial Building Construction 236210 Commercial and Institutional Building Construction 236220 Power and Communication Line and Related Structures Construction

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


NETL: 2010 SW PA High School Science Bowl  

NLE Websites -- All DOE Office Websites (Extended Search)

High School Science Bowl High School Science Bowl The U.S. Department of Energy's National Energy Technology Laboratory (DOE/NETL), and the Community College of Allegheny County (CCAC), South Campus, would like to invite you to participate in one of the premier scientific events for high school students, the Southwestern Pennsylvania High School Science Bowl 2010 on February 20, 2010. This will be NETL's 19th year sponsoring the high school competition. There is a change this year in the registration process from past years, all teams who are registering to complete, must do so through the National Science Bowl website by January 7, 2010. For those who are not familiar with the Science Bowl here are some highlights: The competition is open to high school students (school, scouts, home school) from Southwestern Pennsylvania (SW PA). Complete eligibility requirements are located at the National Science Bowl website.


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Index of /images/rat/rat.seq  

NLE Websites -- All DOE Office Websites (Extended Search)

rat/rat.seq rat/rat.seq Parent Directory rat.seq.1.tif rat.seq.10.tif rat.seq.100.tif rat.seq.101.tif rat.seq.102.tif rat.seq.103.tif rat.seq.104.tif rat.seq.105.tif rat.seq.106.tif rat.seq.107.tif rat.seq.108.tif rat.seq.109.tif rat.seq.11.tif rat.seq.110.tif rat.seq.111.tif rat.seq.112.tif rat.seq.113.tif rat.seq.114.tif rat.seq.115.tif rat.seq.116.tif rat.seq.117.tif rat.seq.118.tif rat.seq.119.tif rat.seq.12.tif rat.seq.120.tif rat.seq.121.tif rat.seq.122.tif rat.seq.123.tif rat.seq.124.tif rat.seq.125.tif rat.seq.126.tif rat.seq.127.tif rat.seq.128.tif rat.seq.129.tif rat.seq.13.tif rat.seq.130.tif rat.seq.131.tif rat.seq.132.tif rat.seq.133.tif rat.seq.134.tif rat.seq.135.tif rat.seq.136.tif rat.seq.137.tif rat.seq.138.tif rat.seq.139.tif rat.seq.14.tif rat.seq.140.tif rat.seq.141.tif rat.seq.142.tif


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Microsoft PowerPoint - DOE_PA_Derivation and Application of SCULs...  

NLE Websites -- All DOE Office Websites (Extended Search)

Derivation and Application of Soil Contaminant Levels Protective of Groundwater at the Hanford Site Presented to: PA Community of Practice Technical Exchange Presented by: - Jim...


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


La premiere somme philosophique du bouddhisme tibetain. Origines litteraires, philosophiques et mythologiques des Neuf etatpes de la Voie (theg pa rim pa dgu)  

E-Print Network (OSTI)

/ 'dul ba dgongs pa gsang ba dang/ rang bzhin gsang ba'i donrnams ni/ zhes gsung te/ rtsal 'phang mtho dman gyi khyad par gyis/ so so'i blo'i rtogs tshod kyi don'di rnams kyang phyin ci ma log pa'i don rtogs pa'i man ngag gi gzhi yin pas/ de bas na man... 'en haut (tib. lha) et d'en bas (tib. klu). Cf. Stein, 1996 : 141. Les Neuf Etapes de la Voie 97 dorigine cleste et munis de capacits surhumaines, descendaient etremontaient au ciel par le moyen d'une chelle qui se trouvait sur le sommetd'une montagne...

Mestanza, Ferran



Microsoft PowerPoint - Freeze.NE PA Overview_052511.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Used Fuel Disposition Campaign Used Fuel Disposition Campaign Summary of DOE-NE PA Modeling for Storage and Disposal of Used Nuclear Fuel (UNF), High-Level Radioactive Waste (HLW), and Low-Level Waste (LLW) Geoff Freeze Sandia National Laboratories PA Community of Practice Technical Exchange May 25-26, 2011 Print Close Used Fuel Disposition 2 DOE-Nuclear Energy (NE) - PA Modeling Activities NE Advanced Modeling and Simulation (NEAMS) Waste Integrated Performance and Safety Codes (Waste IPSC) Used Fuel Disposition (UFD) Generic Performance Assessment Model (GPAM) *** Initial modeling focus in both campaigns in on UNF/HLW disposal Print Close Used Fuel Disposition 3  UFD GPAM  Short time horizon (2-3 yrs) - Simplified generic system models (i.e., PA-fidelity using GoldSim) - Current computing capabilities

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Northern Hemisphere 500-hPa Trough Merger and Fracture: A Climatology and Case Study  

Science Conference Proceedings (OSTI)

The results of an objective climatology of 500hPa trough merger (defined as the amalgamation of two initially separate vorticity maxima) and trough fracture (defined as the splitting of a single vorticity center into two separate vorticity ...

Devin B. Dean; Lance F. Bosart




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site




E-Print Network (OSTI)

a ( I V ) , N p ( I V ) , AND Pu(IV) BOROHYDRIDES Rodney H.borohydrides of Pa, Np, and Pu have been pre pared and someU(BH. ,)Pu(BHi<)ii are much more volatile

Banks, R.H.



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


State College Area High School From State College, PA Wins DOE's National  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

College Area High School From State College, PA Wins DOE's College Area High School From State College, PA Wins DOE's National Science Bowl® State College Area High School From State College, PA Wins DOE's National Science Bowl® May 1, 2006 - 10:34am Addthis WASHINGTON , DC - State College Area High School from State College, Pennsylvania, today won the Department of Energy's (DOE) National Science Bowl®. Teams representing 65 schools from across the United States competed in this "Science Jeopardy" competition, which concluded this afternoon. Members of the winning team include Jason Ma, Ylaine Gerardin, Barry Liu, Galen Lynch, Francois Greer and coach, Julie Gittings. This team won a research trip to France and $1,000 for their school's science department. The answer that clinched the championship was in response to an earth


Second Meeting, July 13, 1999 Crowne Plaza Center City Philadelphia, PA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Second Meeting, July 13, 1999 Crowne Plaza Center City Philadelphia, PA Second Meeting, July 13, 1999 Crowne Plaza Center City Philadelphia, PA The second meeting of the Transportation External Coordination Working Group (TEC/WG) DOE Transportation Protocols Topic Group took place on July 13, 1999 at the Crowne Plaza Center City in Philadelphia, PA. MORNING SESSION Ms. Williams began the meeting by stating this was the second face-to-face session of the group; several conference calls had also been held since the first meeting in Jacksonville, FL in January 1999. She indicated there were some materials available in addition to the draft protocols that had been promised; one was a comment response document containing written comments received from participants on the different protocols, and the other was a draft schedule for completion of the other protocols. She said the milestones in the schedule were


Obtaining pressures in the 10?5 Pa range with oil?sealed rotary vacuum pumps  

Science Conference Proceedings (OSTI)

Trapped oil?sealed rotary pumps are usually considered capable of ultimate pressures no lower than about 10?3 Pa. Experiments are described which confirm that most of this residual gas originates from air dissolved in the pump oil. Replacement of the air with a less soluble gas (helium) or an easily trapped gas (carbon dioxide) is shown to give a useful reduction in ultimate pressure and to reduce the oxygen partial pressure to essentially zero. Operation with completely degassed oil is shown to give ultimate pressures in the 10?5 Pa range. The design of pumps based on these principles is discussed.

B. R. F. Kendall



P-A logic: a compositional proof system for distributed programs  

Science Conference Proceedings (OSTI)

This paper describes a compositional proof system called P-A logic for establishing weak total correctness and weak divergence correctness of CSP-like distributed programs with synchronous and asynchronous communication. Each process in a network is ... Keywords: OCCAM, liveness, proof system, safety

Paritosh K. Pandya; Mathai Joseph



Improved Skill for the Anomaly Correlation of Geopotential Heights at 500 hPa  

Science Conference Proceedings (OSTI)

This paper addresses the anomaly correlation of the 500-hPa geopotential heights from a suite of global multimodels and from a model-weighted ensemble mean called the superensemble. This procedure follows a number of current studies on weather ...

T. N. Krishnamurti; K. Rajendran; T. S. V. Vijaya Kumar; Stephen Lord; Zoltan Toth; Xiaolei Zou; Steven Cocke; Jon E. Ahlquist; I. Michael Navon



SpaceTime Spectral Analysis of the Southern Hemisphere Daily 500-hPa Geopotential Height  

Science Conference Proceedings (OSTI)

In this paper the authors use the NCEPDepartment of Energy (DOE) Reanalysis 2 (NCEP2) data from 1979 to 2004 to expand the daily 500-hPa geopotential height in the Southern Hemisphere (SH, 9020S) into a double Fourier series, and analyze the ...

Cheng Sun; Jianping Li



Paper Number 15736-PA Title Reaction Kinetics of Fuel Formation for In-Situ Combustion  

E-Print Network (OSTI)

Paper Number 15736-PA Title Reaction Kinetics of Fuel Formation for In-Situ Combustion Authors Abu believed to cause fuel formation for in-situ combustion have been studied and modeled. A thin, packed bed the approach of a combustion front. Analysis of gases produced from the reaction cell revealed that pyrolysis

Abu-Khamsin, Sidqi


A generic network interface architecture for a networked processor array (NePA)  

Science Conference Proceedings (OSTI)

Recently Network-on-Chip (NoC) technique has been proposed as a promising solution for on-chip interconnection network. However, different interface specification of integrated components raises a considerable difficulty for adopting NoC techniques. ... Keywords: interconnection network, multiprocessor systemon-chip (MPSoC), network interface, network-on-chip (NoC), networked processor array (NePA)

Seung Eun Lee; Jun Ho Bahn; Yoon Seok Yang; Nader Bagherzadeh



Hugo van Dam and the dynamic adjoint function Imre Pa zsit*  

E-Print Network (OSTI)

adjoint theory in such cases does not play a role at all. 1762 I. Pa´zsit / Annals of Nuclear Energy 30 and practical and, accordingly, it dominates the applications in the theory of zero power reactor noise fluctuations in a steady subcritical reactor, i.e. the theory of zero power reactor noise, the dual possibility

Pázsit, Imre


Spectroscopic and magnetic studies of tetravalent Pa and trivalent Th compounds  

SciTech Connect

At the beginning of the actinide series, the 5f and 6d configurations are very close in energy. Consequently, both the 5f and 6d energy level splittings may be observed experimentally in Pa{sup 4+} and Th{sup 3+} compounds. The available magnetic and optical data on these systems are reviewed.

Edelstein, N.M.; Kot, W.K.



Project Plan 7930 Cell G PaR Remote Handling System Replacement  

Science Conference Proceedings (OSTI)

For over 40 years the US Department of Energy (DOE) and its predecessors have made Californium-252 ({sup 252}Cf) available for a wide range of industries including medical, nuclear fuels, mining, military and national security. The Radiochemical Engineering Development Center (REDC) located within the Oak Ridge National Laboratory (ORNL) processes irradiated production targets from the High Flux Isotope Reactor (HFIR). Operations in Building 7930, Cell G provide over 70% of the world's demand for {sup 252}Cf. Building 7930 was constructed and equipped in the mid-1960s. Current operations for {sup 252}Cf processing in Building 7930, Cell G require use of through-the-wall manipulators and the PaR Remote Handling System. Maintenance and repairs for the manipulators is readily accomplished by removal of the manipulator and relocation to a repair shop where hands-on work can be performed in glove boxes. Contamination inside cell G does not currently allow manned entry and no provisions were created for a maintenance area inside the cell. There has been no maintenance of the PaR system or upgrades, leaving operations vulnerable should the system have a catastrophic failure. The Cell G PaR system is currently being operated in a run to failure mode. As the manipulator is now 40+ years old there is significant risk in this method of operation. In 2006 an assessment was completed that resulted in recommendations for replacing the manipulator operator control and power centers which are used to control and power the PaR manipulator in Cell G. In mid-2008 the chain for the bridge drive failed and subsequent examinations indicated several damaged links (see Figure 1). To continue operations the PaR manipulator arm is being used to push and pull the bridge as a workaround. A retrieval tool was fabricated, tested and staged inside Cell G that will allow positioning of the bridge and manipulator arm for removal from the cell should the PaR system completely fail. A fully functioning and reliable Par manipulator arm is necessary for uninterrupted {sup 252}Cf operations; a fully-functioning bridge is needed for the system to function as intended.

Kinney, Kathryn A [ORNL




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


One-and two-photon photoactivation of a paGFP-fusion protein in live Drosophila embryos  

E-Print Network (OSTI)

constructed a photoactivatable Drosophila his- tone 2 A variant green fluorescent fusion protein (H2AvD- pa of multiple fluorescent loci. This report constitutes the first demon- stration of two-photon activation of pa Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Green fluorescent protein

Rieger, Bernd



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NJ1PA DETERMINATION NJ1PA DETERMINATION RECIPIENT:Abengoa Solar Inc. Page 1 of2 STATE: CO PROJECT TITLE: Reducing the Cost of Thermal Energy Storage for Parabolic Trough Power Plants Funding Opportunity Announcement Numbu Procurement Instrument Number NEPA Control Numbu ell) Number DE·PS36-08G098032 G018156 GFQ.G018156-003 G018156 Based on my review oflhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A),1 have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but nollimiled to, literature surveys. inventories. audits), data analysis (indudm9 computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply


File:USDA-CE-Production-GIFmaps-PA.pdf | Open Energy Information  

Open Energy Info (EERE)

PA.pdf PA.pdf Jump to: navigation, search File File history File usage Pennsylvania Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 419 KB, MIME type: application/pdf) Description Pennsylvania Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Pennsylvania External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:20, 27 December 2010 Thumbnail for version as of 16:20, 27 December 2010 1,650 × 1,275 (419 KB) MapBot (Talk | contribs) Automated bot upload


EIS-0357 - Gilberton Coal-to-Clean Fuels and Power Project in Giberton, PA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7 - Gilberton Coal-to-Clean Fuels and Power Project in 7 - Gilberton Coal-to-Clean Fuels and Power Project in Giberton, PA EIS-0357 - Gilberton Coal-to-Clean Fuels and Power Project in Giberton, PA Summary This Environmental Impact Statement (EIS) assesses the potential environmental impacts that would result from a proposed Department of Energy (DOE) action to provide cost-shared funding for construction and operation of facilities near Gilberton, Pennsylvania, which have been proposed by WMPI PTY, LLC, for producing electricity, steam, and liquid fuels from anthracite coal waste (culm). The project was selected by DOE under the Clean Coal Power Initiative (CCPI) to demonstrate the integration of coal waste gasification and Fischer-Tropsch (F-T) synthesis of liquid hydrocarbon fuels at commercial scale. PUBLIC COMMENT OPPORTUNITIES



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETERMINATION Nl!PA DETERMINATION RI':CIPIENT:Western Iowa Tech Community College PROJECT TITLE: Western Iowa Tech Community College Renewable Energy Economy Conidor Page 1 of2 STATE: IA Funding Opportunity Announcement Number Proeurement lnstrument Number NEPA Control Number CID Number CongressIOnally Directed DE-EEOOO3285 GF0-10-329 0 Based on my review orthe Inrormation concerning the proposed action, B5 NEPA Compliance Officer (authorb-.ed under DOE Order 451.IA), I have made the rollo wing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including. but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3M COMPANY FOR AN ADVANCE WAIVER OF PA ENT 3M COMPANY FOR AN ADVANCE WAIVER OF PA ENT RIGHTS UNDEF DOE COOPERATIVE AGREEMENT NO. DE-FC36- 01AL67621 ENTITLED "ADVANCED MEA'S FOR ENHANCED OPERATING CONDITIONS"; W(A)-04-038; CH-1205 As set out in the attached waiver petition and in subsequent discussions with DOE Patent Counsel, 3M Company (3M) has requested an advance waiver of domestic and foreign patent rights for all subject inventions made under the above-identified cooperative agreement by its employees and its subcontractors' employees, regardless of tier, except inventions made by subcontractors eligible to retain title pursuant to P.L. 96-517, as amended, and National Laboratories. Referring to item 2 of 3M's waiver petition, the purpose of this agreement encompasses the design, development and manufacturing of polymer electrolyte membrane fuel cells



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OF ENERGY OF ENERGY EERE PROJECT MANAGEMENT CENTER NJ1PA DETERMINATION Page 1 of2 RECIPIENT:ELECTRATHERM, Inc. STATE: NV PROJECT TITLE: ·Small Scale Electrical Power Generation from Heat Co-Produced in Geothermal Fluids: MiningOperation" Funding Opportunity Announcement Number PNK:urement Instrument Number N£PA Control Number em Number OE+FOAOOOO336 DE-EEOOO4435 GF0-0004435-002 G04435 Based on my review of the information c:oncerning tbe proposed action, 85 NEPA Compliance Officer (authorized under DOE Order 451.IA),1 have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Info rm ation gathering, analysis, and d issemination Information gathering (including , but not limited to, literature surveys, inventories, site visits, and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PA DEl1!RMINATION PA DEl1!RMINATION RECIPIENT:Snohomish County PUD PROJECT TITLE: Acoustic Effects of Hydrokinetic Tidal Turbines Page 1 00 STATE: WA funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA..()()()()()69 DE-EEOOO2654 GF0-10-171 0 Based on my review oflhe information concerning the proposed adion, as NEPA CompliaDce Officer (authorized under DOE Order451.1A), I have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 83.1 OnSlle and off site site characterizatIOn and environmental monitonng, Induding siting, construction (or modification). operatJon, and dismantlement or dosing (abandonment) of characterization and monitoring devices and siting, constructJon, and aSSOCIated operation of a small-scale laboratory building or renovation of a room in an existing building


File:EIA-Appalach2-OH-PA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach2-OH-PA-GAS.pdf Appalach2-OH-PA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Northern Ohio, Southwestern New York, and Western Pennsylvania By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 10.31 MB, MIME type: application/pdf) Description Appalachian Basin, Northern Ohio, Southwestern New York, and Western Pennsylvania By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Ohio, New York, Pennsylvania File history Click on a date/time to view the file as it appeared at that time.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETERMINATION Nl!PA DETERMINATION RECIPIENT :Ruby Mountain Inc for EI Paso County PROJECf TITLE : EI Paso County Geothermal Project at Fort Bliss - Phase 2-8 and Phase 3 Page 1 of2 STATE : TX Funding Opportunity Announcement Number Procuremenllnstrument Number NEPA Control Number CID Number DE-FOA-0000109 DE-EEOOO2827 GFO-O002827-OO4 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (autborlzed under DOE Order 45I.lA), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited la, literature surveys, inventories, audits). data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply


File:EIA-Appalach3-eastPA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach3-eastPA-BOE.pdf Appalach3-eastPA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Eastern Pennsylvania By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.04 MB, MIME type: application/pdf) Description Appalachian Basin, Eastern Pennsylvania By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Pennsylvania File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Romanosky Romanosky Crosscutting Research Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4721 robert.romanosky@netl.doe.gov Richard Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Shizhong Yang Principal Investigator Southern University


Rat Deterrent  

NLE Websites -- All DOE Office Websites (Extended Search)

Rat Deterrent Rat Deterrent Name: mike Location: N/A Country: N/A Date: N/A Question: my friends have a house with a basement, they have seen rats coming from cider blocks that are open at the top ,and on inspection with a mirror seem to go all the down to the foundation, i suggested maybe putting moth balls down the blocks to help out if they are coming from the botton up, they have a new baby in the house, will this hurt anyone or cause harm? thanks Replies: Moth balls are not going to hurt anyone, but they are not going to solve the problem either. Rats are serious pests that will not be deterred by moth balls and a permanent solution, sealing up access points after removing the rats, will be needed. J. Elliott Stuff the holes with steel wool. It's not poisonous, it's cheap, and rats can't chew through it.


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Recipient: County of Lancaster, PA ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Lancaster County Environmental Center Energy Efficiency Retrofits A9, All, B5.1 Waste Stream Clause Historic Preservation Clause Engineering Clause **This NEPA determination is limited to lighting upgrades, installation of a PV system; installation of a geothermal heat pump is conditioned pending further NEPA review. Lancaster County Environmental Center Renewable Energy System B5.1 Waste Stream clause Historic Preservation clause Engineering clause County Facility Energy Audits A9 None. This NEPA determination is limited to audits only.


Microsoft PowerPoint - PA CoP Status and plans.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

of Practice Status and Plans Performance Assessment Community of Practice Technical Exchange May 25, 2011 Martin J Letourneau DOE Office of Environmental Compliance 5/25/2011 Print Close 2 History and Background * Originally envisioned and established in 2008 under DOE HLW Corporate Board * Very DOE and EM oriented * Sponsored 2 technical exchange meetings (Salt Lake and Richland) * Went dormant when HLW Corporate Board was on hiatus * Corporate Board Shifted to Office of Environmental Compliance * Identified opportunity to make PA CoP broader and free- standing 5/25/2011 Print Close 3 Initial Steering Committee Meeting * Met Monday to develop path forward and work on charter - Alaa aly, Intera


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Patricia Rawls Patricia Rawls Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-5882 patricia.rawls@netl.doe.gov Sankaran Sundaresan Principal Investigator Princeton University Department of Chemical Engineering Princeton, NJ 08544 609-258-4583 sundar@princeton.edu PROJECT DURATION Start Date 10/01/2011 End Date 09/30/2014 COST Total Project Value $420,366 DOE/Non-DOE Share $300,000 / $120,366 Implementation and Refinement


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rick Dunst Rick Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 MS 922-273C Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Felicia Manciu Principal Investigator University of Texas at El Paso 500 West University Avenue El Paso, TX 79968-8900 915-747-5715 fsmanciu@utep.edu PROJECT DURATION Start Date 01/15/2009 End Date 12/15/2013 COST Total Project Value $249,546 DOE/Non-DOE Share $249,546 / $0


Mycenaean -pi and pa-ro in the light of TH Uq 434  

E-Print Network (OSTI)

for Mycenologists and specialists in the Aegean cultures, but also for scholars working on the history of the Greek language, Greek religion and institutions, and Indo-European. ISBN978-90-429-2909-8 (Peeters Leuven) ISBN978-2-7584-0186-5 (Peeters France... he demonstrates record standing flocks involved in the production of lambs and wool (KILLEN 1964); mutatis mutandis he argues for a similar function for these Pylian records. If so, the pa-ro formulae would record the herdsmen under whose care...

Thompson, Rupert John Ernest


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Effects of Pressure on Collision, Coalescence, and Breakup of Raindrops. Part I: Experiments at 50 kPa  

Science Conference Proceedings (OSTI)

Previous breakup experiments have been carried out at laboratory pressures (100 kPa). However, raindrop interactions mainly take place higher up in the atmosphere, even in the supercooled part of a cloud where drops can be initiated by shedding ...

Roland List; C. Fung; R. Nissen




E-Print Network (OSTI)

Pa (BH4 ) 4' Np (BH ) 4' AND Pu (BH ) 4 R. H. Banks, N. M.Pa(BH4 )4' Np(BH 4 )4' and Pu(BH4)4t R. H. Banks, N. M.Pa(BH )4' Np(BH )4' and Pu(BH )4 have been synthesized. U(

Banks, R.H



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PROJEC PROJEC T FAC TS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Gordon Bierwagen Principal Investigator North Dakota State University P.O. Box 6050 Department 2760 Fargo, ND 58108-6050 701-231-8294 gordon.bierwagen@ndsu.edu PARTNERS None PROJECT DURATION Start Date 12/01/2009 End Date 11/30/2011 COST Total Project Value $298,949 DOE/Non-DOE Share $298,949 / $0 PROJECT NUMBER DE-FE0002054 Government funding for this project is provided in whole or in part through the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Jose Castillo Principal Investigator San Diego State University 5500 Campanile Drive San Diego, CA 92122 619-594-7205 castillo@myth.sdsu.edu PARTNERS Sienna Geodynamics and Consulting, Inc. PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,993 DOE/Non-DOE Share $299,993 / $0 PROJECT NUMBER DE-FE0002069 Government funding for this project is provided in whole or in part through the


2013 NETL CO2 Capture Technology Meeting Sheraton Station Square, Pittsburgh, PA  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL CO2 Capture Technology Meeting NETL CO2 Capture Technology Meeting Sheraton Station Square, Pittsburgh, PA July 8 - 11, 2013 ION Novel Solvent System for CO 2 Capture FE0005799 Nathan Brown ION Engineering Presentation Outline 2  ION Advanced Solvent Background  Project Overview  Technology Fundamentals  Progress & Current Status  Plans for Future Commercialization  Acknowledgements ION Engineering Background 3 Mission Statement: Develop new solvents and processes for economic removal of CO 2 from industrial emissions. Markets:  Coal-fired flue gas  NGCC-fired flue gas  Sour gas processing 1 st & 2 nd Generation CO 2 Capture 4 Aqueous MEA Commercial Use Existing Commercial Technology Lateral Transfer of Existing Technology Aqueous MEA


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACTS Joseph Stoffa Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-0285 joseph.stoffa@netl.doe.gov Xingbo Liu Principal Investigator Dept. MechanaWest Virginia University P.O. Box 6106 Morgantown, WV 26506-6106 304-293-3339 xingbo.liu@mail.wvu.edu Shailesh D. Vora Technology Manager, Fuel Cells National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7515 shailesh.vora@netl.doe.gov PARTNERS None PROJECT DURATION Start Date End Date 08/31/2012 09/30/2015 COST Total Project Value $634,839 DOE/Non-DOE Share $499,953 / $134,886 AWARD NUMBER FE0009675 Fundamental Understanding of Oxygen Reduction and Reaction Behavior and Developing High Performance and Stable



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARTIlIENT OFI!NERGY DFPARTIlIENT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!Tl!Rl\.lINAIION RECIPIENT:NH Office of Energy and Planning PROJECf TITLE : Fonnula Grant for State Energy Program· NH Page 1 of2 STATE: NH Funding Opportunity Announ~ement Number Procurement Instrument Number NEPA Control Number CID Number DE FDA 0000643 DE-FG26-06R130472 GF()'()130472-OO1 Based on my review orlbe information concerning the proposed action, as NEPA Compliance OffICer (authorized under DOE Order 4sl.tA), I have made the foUowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for detennination: Technical advice and planning assistance to international, national, state, and local organizatioos



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PARTh1l1NT OFI!NERGY PARTh1l1NT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!TFIU.nNATION Page I of2 RECIPIENT: City of SI. Petersburg STATE: FL PROJECT TITLE: SI. Petersburg Solar Pilol Project (FL) FUnding Opportunity Announcement Number Procunml'nt Instrument Numbu NEPA Control Number CID Number DE-EEOOOO284 GF().OQ()()284-003 G0284 Based on my review ortbe information concerning the proposed action, as NEPA Compliance Officer (authorized UDder DOE Order 451.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.16 Sola r photovoltaic systems The installation, modification, operation, and removal of commercially available solar photovoltaic systems located on a building or other structure (such as rooftop, parking lot or facility, and mounted to Signage,



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

~) ~) u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPI[NT :Dehlsen Associates. LlC (DA) Page 1 of2 STATE: CA PROJECT TITLE: High Energy Density Distributed Hydrostatic Direct Drive for large Wind Turbine and MHK Device Applications Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-0000439 DE-EEOOO5139 GFO-OOOS139-001 0 Based on my review ofthe information concerning tbe proposed acrion, as NEPA Compliance Officer (authorized under DOE Order451.IA), J have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (Including, but nollimited to, literature surveys, inventories, audits), data analysis (including



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARTlIIENT OFI!NERGY DFPARTlIIENT OFI!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!Tl!RMINATION Page 1 of2 RECIPIENT: Energent Corporation STATE: CA PROJECT TITLE: Scale Resistant Heat Exchangers for Low Temperature Geothermal Binary Cycle Power Plant Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOA-0000318 DE-EE0004423 GFO-OOO4423-OO2 G04423 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order4S1.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Inf ormation Information gathering (including, but not limited to, literature surveys, inventories, site visits, and gathering, analYSiS, and audits), data analysis (including, but not limited to, computer modeling), document preparation


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Karen Kluger Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-6667 karen.kluger@netl.doe.gov Gary Mavko Principal Investigator Stanford University 397 Panama Mall Stanford, CA 94305-2215 650-723-9438 Fax: 650-723-1188 mavko@stanford.edu PROJECT DURATION Start Date 12/01/2009 End Date 06/30/2013 COST Total Project Value $385,276 DOE/Non-DOE Share $295,777/ $89,499 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Rock Physics of Geologic Carbon Sequestration/Storage



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARl'lIIENT OF ENERGY DEPARl'lIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT: Snohomish County PUD PROJECf TITLE: Acoustic Effects of Hydrokinetic Tidal Turbines Page 1 on STATE: WA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000069 DE-EEOOO2654 GFQ-0002654-OO2 0 Based on my review orlhe Information concerning the proposed action, as NEPA Compliance Officer (authori1.ed under DOE Order 4S1.1A), I have made the following determination: ex, EA, EIS APPENDIX ANO NUMBER: Description: B3.3 Field and laboratory research, inventory, and information collection activities that are directly related to the conservation of fish or wildlife resources and that involve only negligible habitat destruction or population reduction


Microsoft PowerPoint - Cheng-PA Presentation-v5.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Applications Applications of RESRAD-OFFSITE Presented At PA Community of Practice Technical Exchange Richland, WA April 14, 2010 Jing-Jy Cheng, Ph.D. Environmental Science Division Argonne National Laboratory RESRAD - A Regulatory Tool for Addressing Site Cleanup Issues 2 RESRAD, an internationally utilized model, successfully addresses the critical question "How clean is clean enough?" Supports government regulatory endeavors in cleanup * DOE (Designated by Order 5400.5) * NRC (License Termination Rule; 10 CFR 20 Subpart E; NUREG/1757) * EPA (CERCLA) * State agencies In use for about 30 years * Evaluation of more than 300 cleanup sites * Over 100 training workshops * International (e.g., IAEA) recognition RESRAD Development Philosophy : Bridging Science with Regulatory Compliance



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

... ... ~ . u.s DEPAR lENT OFl!NERG' EERE PROJECT MANAGEMENT CDITER Nl!PA Dl!Tl!Rl\llNATION Page 1 of2 RECIPIENT:Stanford University STATE: CA PROJECf TITLE: In·Situ X·Ray Analysis of Rapid Thermal Processing for Thin·FiI Solar Cells: Closing the Gap between Production and Laboratory Efficiency Funding Opportunity Announcement Number DE·FOA-0000654 Procurement Instrument Number DE·EE0005951 NEPA Control Number em Number GFQ-0005951·001 G05951 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the following determination: CX, EA, EIS APP~:NDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination 81.31 Installation or



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OFl!NERGY OFl!NERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!R}.JINATION RECIPIENT:State of Wisconsin * Office of Energy Independence PROJECf TITLE: WI Biodiesel Blending Program Page 1 of2 STATE: WI Funding Opportunity Announttmenf Number Proc:unment Instrument Numbu NEPA Control Number CID Number COP DE-EEOOO3117 GFO-l0-4t4 EE3117 Based on my nview oftbe information concerning the proposed action, as NEPA Compliance Officer (authori7.ed undu DOE Onter 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathenng (Including, but not limited to, literature surveys, inventories, audits). data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies. analytical energy supply


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Andrea Dunn Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Marte Gutierrez Principal Investigator Colorado School of Mines 1600 Illinois Street Golden, CO 80401 303-273-3468 Fax: 303-273-3602 mgutierr@mines.edu PROJECT DURATION Start Date 12/01/2009 End Date 5/31/2013 COST Total Project Value $297,505 DOE/Non-DOE Share $297,505 / $0 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Training and Research on Probabilistic Hydro-Thermo-Mechanical Modeling of Carbon Dioxide Geological Sequestration in Fractured Porous Rocks Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Il.II.': , Il.II.': , u.s. DEPARTMENT OFFNERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DFTFnIINATION RECIPIENT: FDC Enterprises, Inc. Page 1 of2 STATE: KS PROJECT TITLE: Design and Demonstration of an Advanced Agricultural Feedstock Supply System for lignocellulosic Bioenergy Production Funding Opportunity AonOUDCtment Number DE-FOA-0000060 Pnxunmtol Instrument Number EEOOO1033 NEPA Control Number em Number GF()..10-532 0 Based on my review oflbe information concerning the propostd action, 85 NEPA Compliance Officer (authorized under DOE Order 4Sl.IA). I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits). data analysis (including

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FNT OF ENERGY FNT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT:Oregon Department of Energy PROJECf TITLE: Farm Power Tillamook, LLC Page I of2 STATE: OR Funding Opportunity Announcement Number DE-FOA-0000052 Procurement Instrument Number NEPA Control Number ell> Number DE-EEOOOO140 GFO-OOO0140-OO5 EE140 Based on my review oftbe information concerning the proposed aetion, as NEPA Compliance Officer (autborized under DOE Order 451.1A), I have made the following determination: ex, EA, EI S APP~:NDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

FACTS FACTS Carbon Storage - ARRA - GSRA CONTACTS Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Robert Noll Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7597 robert.noll@netl.doe.gov Joseph Labuz Principal Investigator University of Minnesota 500 Pillsbury Drive SE Room 122 CivE 0851 Minneapolis, MN 55455 612-625-9060 jlabuz@umn.edu PARTNERS None PROJECT DURATION Start Date End Date 12/01/2009 11/30/2012 COST Total Project Value $299,568 DOE/Non-DOE Share $299,568 / $0 PROJECT NUMBER DE-FE0002020 Government funding for this project is provided in whole or in part through the



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

u~\ u~\ u.s. DEPAR TMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT:Hawaii Natural Energy Institute STATE : HI PROJECf TITLE: Hawaii Hydrogen Power Park - Technology Validation of a Hydrogen Fueling System Funding Opportunity Announcement Number n/a Procurement Instrument Number DE·FC51-02R021399 NEPA Control Number GFO-R021399-002 Page 1 of2 em Number 21399 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description; 85.1 Adions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Office of Legacy Management (LM)

8 MILES NORTH OF PHlLADEl.PHlA 8 MILES NORTH OF PHlLADEl.PHlA HATBORO, PA. August 27, 1948 ! ! Frank Giaccio' Commission / I This follows my letter of August ZOth, in which I promised to advise you of our thoughts concerning beryllium, after I had completed a series of con- tacts with both.Government and private,grou?s and had an opportunity to evaluate the possibilities of using our process from the point of view of industrial research. By this, I meanthe possibility of the research leading into substantial production of parts. I believe I mentioned some of the contacts to you when I was in your office, and that we still had more to make. It is my opinion now that as far as beryllium is concerned, I cannot visualize the possibility of large production runs of parts; because it is



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Recipient. County of Berks, PA ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Replacement of Steam and Condensation Lines at North Campus B5.1 Waste Stream, Engineering, and Historical Preservation clauses. The new boiler cannot result in a net increase in air emissions. Additional Comments: Based on my review of information conveyed to me and in my possession (or attached) concerning the proposed action, as NEPA Compliance Officer (as authorized under DOE Order 451.1B), I have determined that the proposed action fits within the specified class of actions, other applicable regulatory requirements are met, and the proposed action is hereby categorically excluded from further



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PARTMENT OF ENERGY PARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETERMINATION RECIPIENT:WA Dept of Commerce Page 1 of3 STATE: WA PROJECT TITLE: SEP ARRA · WSU Anaerobic Digester - Nutrient Recovery Technology - Vander Haak Dairy Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number EEOOOO139 GF0-0000139-040 0 Based on my review of the Information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visils, and audits), data analysis (including


Oxidation of zirconium alloys in 2.5 kPa water vapor for tritium readiness.  

DOE Green Energy (OSTI)

A more reactive liner material is needed for use as liner and cruciform material in tritium producing burnable absorber rods (TPBAR) in commercial light water nuclear reactors (CLWR). The function of these components is to convert any water that is released from the Li-6 enriched lithium aluminate breeder material to oxide and hydrogen that can be gettered, thus minimizing the permeation of tritium into the reactor coolant. Fourteen zirconium alloys were exposed to 2.5 kPa water vapor in a helium stream at 300 C over a period of up to 35 days. Experimental alloys with aluminum, yttrium, vanadium, titanium, and scandium, some of which also included ternaries with nickel, were included along with a high nitrogen impurity alloy and the commercial alloy Zircaloy-2. They displayed a reactivity range of almost 500, with Zircaloy-2 being the least reactive.

Mills, Bernice E.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N1!PA Dl!1'ElU.llNATION N1!PA Dl!1'ElU.llNATION RECIPIENT:City of Perth Amboy PROJECT TITLE : Municipal Complex Solar Power Project Page 1 of2 STATE: NJ Funding Opportunity Announl::ement Number Procurement Instrument Number NEPA Control Number elD Number Congressionally Directed Project DE· EEOOO3172 GF0-0003172..Q01 EE3172 Based on my review of the information concerning the proposed action, as N[PA Compliance Officer (authoro.ed under DOE Order451.1A),1 have made tbe following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Adions to oonserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentratIOns of potentially harmful substances. These actions may involve financial and technical


BsTan gnyis gling pa (1480-1535) et la Revelation du Yang tig ye shes mthong grol  

E-Print Network (OSTI)

enseignements et de ri-chesses se trouve Gos sngon ! Si tu (veux) te rendre l-bas, je te guiderai !Cest une injonction de Guru Padma ! 10 4 Le personnage dont il est question dans cette stance est O rgyan m... certainement lui prfrer laleon du bKa thang gser phreng de Sangs rgyas gling pa qui propose la lecture (p.630) stag thab. On verra plus bas comment interprter isolment stag (pour stagshar) et thab (pour thab).6 O rgyan gling pa, op. cit., p. 571 : de...

Achard, Jean-Luc




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



A Diagnostic Study of an Explosively Developing Extratropical Cyclone and an Associated 500-hPa Trough Merger  

Science Conference Proceedings (OSTI)

This paper presents a diagnosis of an explosively developing cyclone (1.3 Ber) that occurred in conjunction with a 500-hPa synoptic-scale trough merger over the eastern United States in November 1999. The explosive development occurred in ...

Jennifer L. S. Strahl; Phillip J. Smith



Contributions to 2^nd TeV Particle Astrophysics Conference (TeV PA II) Madison Wisconsin - 28-31 August 2006  

E-Print Network (OSTI)

This collection of proceedings to the TeV PA II Conference presents some of the latest results of the IceCube Collaboration.

IceCube Collaboration; A. Achterberg



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Geochemical data package for the Hanford immobilized low-activity tank waste performance assessment (ILAW PA)  

Science Conference Proceedings (OSTI)

Lockheed Martin Hanford Company (LMHC) is designing and assessing the performance of disposal facilities to receive radioactive wastes that are stored in single- and double-shell tanks at the Hanford Site. The preferred method of disposing of the portion that is classified as low-activity waste is to vitrify the liquid/slurry and place the solid product in near-surface, shallow-land burial facilities. The LMHC project to assess the performance of these disposal facilities is the Hanford Immobilized Low-Activity Tank Waste (ILAW) Performance Assessment (PA) activity. The goal of this project is to provide a reasonable expectation that the disposal of the waste is protective of the general public, groundwater resources, air resources, surface-water resources, and inadvertent intruders. Achieving this goal will require prediction of contaminant migration from the facilities. This migration is expected to occur primarily via the movement of water through the facilities, and the consequent transport of dissolved contaminants in the porewater of the vadose zone. Pacific Northwest National Laboratory assists LMHC in their performance assessment activities. One of the PNNL tasks is to provide estimates of the geochemical properties of the materials comprising the disposal facility, the disturbed region around the facility, and the physically undisturbed sediments below the facility (including the vadose zone sediments and the aquifer sediments in the upper unconfined aquifer). The geochemical properties are expressed as parameters that quantify the adsorption of contaminants and the solubility constraints that might apply for those contaminants that may exceed solubility constraints. The common parameters used to quantify adsorption and solubility are the distribution coefficient (K{sub d}) and the thermodynamic solubility product (K{sub sp}), respectively. In this data package, the authors approximate the solubility of contaminants using a more simplified construct, called the solution concentration limit, a constant value. In future geochemical data packages, they will determine whether a more rigorous measure of solubility is necessary or warranted based on the dose predictions emanating from the ILAW 2001 PA and reviewers' comments. The K{sub d}s and solution concentration limits for each contaminant are direct inputs to subsurface flow and transport codes used to predict the performance of the ILAW system. In addition to the best-estimate K{sub d}s, a reasonable conservative value and a range are provided. They assume that K{sub d} values are log normally distributed over the cited ranges. Currently, they do not give estimates for the range in solubility limits or their uncertainty. However, they supply different values for both the K{sub d}s and solution concentration limits for different spatial zones in the ILAW system and supply time-varying K{sub d}s for the concrete zone, should the final repository design include concrete vaults or cement amendments to buffer the system pH.

DI Kaplan; RJ Serne



New Regimes of Stringy (Holographic) Pomeron and High Multiplicity pp and pA Collisions  

E-Print Network (OSTI)

Holographic AdS/QCD models of the Pomeron unite a string-based description of hadronic reactions of the pre-QCD era with the perturbative BFKL approach. The specific version we will use due to Stoffers and Zahed, is based on a semiclassical quantization of a "tube" (closed string exchange or open string virtual pair production) in its Euclidean formulation using the scalar Polyakov action. This model has a number of phenomenologically successful results. In this work we point out that the periodicity of a coordinate around the tube allows the introduction of a Matsubara time and therefore an effective temperature on the string. We observe that in the LHC setting this temperature is approaching the Hagedorn temperature of the QCD strings. We therefore conclude, based on studies of the stringy thermodynamics of pure gauge theories, that there should exist two new regimes of the Pomeron: the "near-critical" and the "post-critical" ones. In the former one, string excitations should create a high entropy "string ball" at mid-rapidity, with high energy and entropy but small pressure/free energy. Amusingly, we find that this ball is dual to a certain black hole. Furthermore, as the intrinsic temperature of the string narrows on the Hagedorn temperature or T/TH-1=O(1/Nc), or even higher ones, the stringy ball develops repulsive interactions, a pressure, and becomes a post-critical explosive "QGP ball". We speculate that the high multiplicity trigger in pp and pA selects events with such a "string ball" cluster. The hydrodynamical flow resulting from this scenario is discussed elsewhere.

Edward Shuryak; Ismail Zahed




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DEl'ER}.fiNATION RECIPIENT:Cortiand County Business Development Corporation PROJE(.T TITLE : Energy Independent Agri-Business Outreach Page I of2 STATE: NY Funding Opportunity Announcement Number DE-EOOO3110 Procurement Instrument Number EEOOO3110 NEPA Control Number em Number GFO-10-573 0 Based on my review orlbe information concerning the proposed action, as N[PA Compliance Officer (autborized under DOE Order 4SI.IA),1 have made tbe follol'iing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul nollimiled 10, literature surveys. inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETlffiMINATION Nl!PA DETlffiMINATION R[CIPIENT:New York State Energy Research and Development Authority PROJECf TITLE: Program Year 2012 Formula Grants - State Energy Program Page 1 of3 STATE: NY Funding Opportunity Announcement Numbel" Procurement Instrument Number NEPA Control Number CID Number DE-FOA-Q000643 R130772 GF0-0130772-OO1 Based on my review orlbe information concerning the proposed action, as NEPA Compliance Omen (authorized under DOE Order 451.1A), I hne made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: All Technical advice and assistance to organization, A9 Information gathering, analysis, and dissemination Rational for determination: Technical advice and planning aSSistance to international, national, slate, and local organizations.


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Comparison of 700-hPa NCEP-R1 and AMIP-R2 Wind Patterns over the Continental United States Using Cluster Analysis  

Science Conference Proceedings (OSTI)

Clustering techniques are adapted to facilitate the comparison of gridded 700-hPa wind flow patterns spanning the continental United States. A recent decade (198594) of wind component data has been extracted from two widely used reanalysis ...

Ellen J. Cooter; Jenise Swall; Robert Gilliam



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DE1'l!RlInNATION DE1'l!RlInNATION Page I of2 RECIPIENT:West Chester University of Pennsylvania STATE: PA PROJECT TITLE: Design and Implementation of Geothermal Energy Systems at West Chester University Funding Opportunity Announcement Number 70.10 Procurement Instrument Number DE-EEOOO3217 NEPA Control Number GFO-1Q-484 cm Number o Based on my review oflhe informallon concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTII'IENT OF ENERGY DEPARTII'IENT OF ENERGY EERE PROJECT MA'PA DETEIU.fiNATION RECIPIENT:ldaho Office of Energy Resources PROJECT TITLE : Program Year 2012 State Energy Program Formula Grants Page 1 of2 STATE: fD Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CIO Number DE-FOA0000643 DE-EEOOO3681 GFD-0003681-OO3 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 1. IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination A11 Technical advice and assistance to organizations Rational for determination: Information gathering (induding, but not limited to, literature surveys, inventories, site visits, and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DI!PARTlIIENT OFI!NFRGY DI!PARTlIIENT OFI!NFRGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!TIIU.fiNATION REClPI[NT:The Regents of the University of Califomia; University of California Berkley Page I of2 STATE: CA PROJEcr TITLE: Advanced Manufacturing MedicaVBiosciences Pipeline for Economic Development {AM2PED)is a regional medical and biosciences manufacturing initiative targeting the 180/880 corridor in the SF East Bay. Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number JlAC2102AM DE-EE0006026 GF().()()()6()26-001 G06026 Based on my TCview ortbe information concerning the proposed aclion, as NEPA Compliance Officer (authoru.ed under DOE Order 451.1A), I have made tbe following detel"mination: ex, EA, [IS APPENDIX AND NUMBER:



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

.**.* : .**.* : , U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!Rl\lINATION RECIPIENT :DOE Solar Energy Technology Program PROJECf TITLE: Solar Energy Evolution and Diffusion Studies (SE EDS) Page 1 of2 STATE: DC Funding Opportunity Annouoc:emenf Number Procurement Instrument Number NEPA Control Number em Number OE-FOA-OOOO740 GFO-FOA0740-001 Based on my review orehe information concerning the proposed aetion, as NEPA Compliance Officer (authorized under DOE Order 4Sl.IA), I have made tbe following determination: ex, EA, EIS APPENDlX AND NUMBER: Description: A91nformation gatheri ng, analYSiS, and d isseminatio n Information gathering (including, but nollimiled 10, literature surveys, Inventories, site visits, and audits), data analysis (including, but not limited 10, computer modeling), document preparation



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARThIENT OFENYRGY DFPARThIENT OFENYRGY EERE PROJECT MANAGEMENT CENTER Nl'PA DETFlUllNATION RECIPIENT:State of louisiana-Louisiana Department of Natural Resources PROJECf TITLE: ARRA EECBG-Slale of louisiana Pointe Coupe Parish Page 1 of3 STATE : LA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Numbu DE-FOA-OOOOO13 DE-EEOOOO735 GF0-0000735-OO5 0 Based on my review of the informafion concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Adions to conserve energy. demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OFENl!RGY OFENl!RGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!lU.nNATION RECIPIENT:Atargis Energy Inc. PROJECT TITLE : Cycloidal Wave Energy Converter Page lof2 STATE: CO Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE·FOA-OOOO293 DE-EEOOO3635 GFQ-000363S-001 0 Based on my review of tbe information concerning tbe proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA). I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies. analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Richland county Richland county U.S. DEPARTMENT OFI!NFRGY EERE PROJECT MANAGEMENT CENTER Nl!PA DI!TI!RMINATION PROJECT TITLE: Irmo Char1ing Cross Sidewalk Project Page 1 of2 STATE: SC Funding Opportunity AnnouDcement Num~r Procurement Instrument Number NEPA Control Number CID Number EEOOOO95O GF().()()()()95()3 0 Based on my review ofthe information concerning tbe proposed action, as NEPA Compliance Officer (authom.ed under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation , and promote energy-efficJency that do not increase the indoor ooncentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MANAGEMENT CENTER MANAGEMENT CENTER NJ!PA DETEJU,llNATION RECIPIENT :Ocean Renewable Power Company, LlC Page I of2 STATE: AK PROJECf TITLE: Acoustic Monitoring of Beluga Whale Interactions withCook Inlet Tidal Energy Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO69 DE-EE0002657 GFO-O002657-002 G02657 Based on my review oftbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B3.3 Research related to Field and laboratory research, inventory, and information collection activities that are directly conservation of fish, wildlife, related to the conservation of fish and wildlife resources or to the protection of cultural



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARThIFNT OF ENERGY DFPARThIFNT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DETFID.llNATION RECIPIENT:Mercedes·Benz Research & Development, North America PROJECT TITLE : Light· Duty Fuel Cell Electric Vehicle Validation Data Page I of2 STATE : CA Funding Opportunity Announcemcnt Number DE·FOA·0000625 Procurement Instrument Number DE-EEOOO5971 NEPA Control Number CID Number GFO"'()005971...{)()1 G05971 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI. IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Rational for detennination: Information gathering (including, but not limited to, literature surveys. inventories, site visits, and



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DIiPARTMENT OF ENFR Y DIiPARTMENT OF ENFR Y EERE PROJECT MANAGEMENT C NTER NIiPA DETERMINATION RECIPIENT:Califomia Energy Commission PROJE('T TITLE: SEP Annual Formula Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procurement Instrument umber NEPA Control Number em Number DE-FOA-0000643 DE-EE-0003941 GFO-O003941-OO1 Based on my review of the information concerning the proposed action, as NEP Compliance Officer (authorized under DOE Order 451.lA), I have made the (ollowlng determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including , bul nol limiled 10, lite alure surveys, inventories, site visits, and audits), data analysis (including , but nol limiled 10. co puler modeling), document preparation


Exchanges of Energy, Water and Carbon Dioxide Xuhui Lee (Yale University) and Edward Pa:on (NCAR)  

NLE Websites -- All DOE Office Websites (Extended Search)

Influences of the Boundary Layer Flow on Vegeta8on-Air Influences of the Boundary Layer Flow on Vegeta8on-Air Exchanges of Energy, Water and Carbon Dioxide Xuhui Lee (Yale University) and Edward Pa:on (NCAR) * Summarize your projects and its scienFfic objecFves for the next 3-5 years The objecFve of this project is to establish a mechanisFc understanding of the interplay between flow heterogeneity in the atmospheric boundary layer (ABL), land surface heterogeneity, and vegetaFon-air exchange of energy, water and CO 2 . The project will invesFgate mechanisms by which mesoscale moFons in the ABL influence vegetaFon-air exchange. It will also quanFfy the influence of heterogeneity on predicFons by 1D column models used in regional and global scale climate models. It is hypothesized that two important ABL processes entrainment and flow



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

*** *** ~ , RECI P I [NT :Riverheath u.s. DEP.-\RTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!RMINATION Page 1 of2 STATE: WI PROJECT TITLE: RiverHeath: Neighborhood loop Geothermal Exchange System: Technology Demonstration Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOO116 DE-EEOOO3005 GFO-OO03005-OO2 G03005 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4Sl.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may Involve financial and technical


Dictyostelium transcriptional responses to Pseudomonas aeruginosa: common and specific effects from PAO1 and PA14 strains  

E-Print Network (OSTI)

,15 DDB0167879 IWS1 C-terminus 0,70 0,69 DDB0205969 snd1, tudor domain-containing protein 0,66 0,79 DDB0188840 TFIIAL, "transcription_factor_IIA" -0,79 -0,55 DDB0167865 ddx52, DEAD/DEAH box helicase -0,55 -0,55 DDB0184074 ddx6, DEAD/DEAH box helicase 0... ,62 0,66 DDB0184228 DEAD/DEAH box helicase -0,63 -0,60 Table 2: Genes differentially expressed upon infection with PAO1 and PA14 versus Klebsiella (Continued)Page 9 of 15 (page number not for citation purposes) DDB0206136 myb domain-containing protein 0...

Carilla-Latorre, Sergio; Calvo-Garrido, Javier; Bloomfield, Gareth; Skelton, Jason; Kay, Robert R; Ivens, Alasdair; Martinez, Jose L; Escalante, Ricardo



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Exceptional Service in the National Interest SNL/WIPP Records Center File Code: WIPP:  

E-Print Network (OSTI)

Exceptional Service in the National Interest SNL/WIPP Records Center File Code: WIPP:'s) Waste Isolation Pilot Plant (WIPP). The DOE is emplacing MgO in the WIPP to serve as the engineered in the WIPP divided by the total amount required to consume all CO2 that would be produced by microbial

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Northern Wintertime Divergence Extrema at 200 hPa and MSLP Cyclones as Simulated in the AMIP Integration by the ECMWF General Circulation Model  

Science Conference Proceedings (OSTI)

Divergence and convergence centers at 200 hPa and mean sea level pressure (MSLP) cyclones are located every 6 hours for a 10-year GCM simulation for the boreal winters from 1980 to 1988. The simulation used the observed monthly mean SST for the ...

James S. Boyle



Interannual Variations of East Asian Trough Axis at 500 hPa and its Association with the East Asian Winter Monsoon Pathway  

Science Conference Proceedings (OSTI)

Interannual variations of the East Asian trough (EAT) axis at 500 hPa are studied with the European Centre for Medium-Range Weather Forecasts 40-yr reanalysis data. The associated circulation pattern and pathway of the East Asian winter monsoon (...

Lin Wang; Wen Chen; Wen Zhou; Ronghui Huang



By Terry Engelder and Gary G. Lash UNIVERSITY PARK, PA.The shale gas rush is on. Excitement over natural gas production from a  

E-Print Network (OSTI)

By Terry Engelder and Gary G. Lash UNIVERSITY PARK, PA.­The shale gas rush is on. Excitement over natural gas production from a number of Devonian-Mississippian black shales such as the Barnett by the Eastern Gas Shales Project (EGSP), a U.S. Department of Energy-sponsored investigation of gas potential

Engelder, Terry


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nl!PA DETl!la.llNATION Nl!PA DETl!la.llNATION RECIPIENT:lmpact Technologies llC PROJECf TITLE : Deep Geothermal Drilling using Millimeter Wave Technology Page 1 of2 STATE: OK Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOS22 DE-EEOOO5504 GFO-OOO5504-OO1 G05504 Based on my review or lhe infonnation concerning the proposed action, as NEPA Compliance OtrlCCf (authorized unde r DOE OTdu451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (induding. but not limited to. literature surveys, inventories, site visits, and audits), data analysis (induding. but not limited 10, computer modeling), document preparation (induding. bul nollimited to, conceptual design,


Structure and Function of PA4872 from Pseudomonas aeruginosa, a Novel Class of Oxaloacetate Decarboxylase from the PEP Mutase/Isocitrate Lyase Superfamily  

SciTech Connect

Pseudomonas aeruginosa PA4872 was identified by sequence analysis as a structurally and functionally novel member of the PEP mutase/isocitrate lyase superfamily and therefore targeted for investigation. Substrate screens ruled out overlap with known catalytic functions of superfamily members. The crystal structure of PA4872 in complex with oxalate (a stable analogue of the shared family R-oxyanion carboxylate intermediate/transition state) and Mg{sup 2+} was determined at 1.9 {angstrom} resolution. As with other PEP mutase/isocitrate lyase superfamily members, the protein assembles into a dimer of dimers with each subunit adopting an {alpha}/{beta} barrel fold and two subunits swapping their barrel's C-terminal {alpha}-helices. Mg2+ and oxalate bind in the same manner as observed with other superfamily members. The active site gating loop, known to play a catalytic role in the PEP mutase and lyase branches of the superfamily, adopts an open conformation. The N{sup {epsilon}} of His235, an invariant residue in the PA4872 sequence family, is oriented toward a C(2) oxygen of oxalate analogous to the C(3) of a pyruvyl moiety. Deuterium exchange into {alpha}-oxocarboxylate-containing compounds was confirmed by {sup 1}H NMR spectroscopy. Having ruled out known activities, the involvement of a pyruvate enolate intermediate suggested a decarboxylase activity of an {alpha}-oxocarboxylate substrate. Enzymatic assays led to the discovery that PA4872 decarboxylates oxaloacetate (k{sub cat}) = 7500 s{sup -1} and K{sub m} = 2.2 mM) and 3-methyloxaloacetate (k{sub cat}) = 250 s{sup -1} and K{sub m} = 0.63 mM). Genome context of the fourteen sequence family members indicates that the enzyme is used by select group of Gram-negative bacteria to maintain cellular concentrations of bicarbonate and pyruvate; however the decarboxylation activity cannot be attributed to a pathway common to the various bacterial species.

Narayanan, Buvaneswari C.; Niu, Weiling; Han, Ying; Zou, Jiwen; Mariano, Patrick S.; Dunaway-Mariano, Debra; Herzberg, Osnat (UNM); (UMBI)



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



La Liste Des Tantras Du rNying Ma'i Rgyud 'bum Selon L'edition Et Ablie Par Kun Mkhyen 'Jigs Med Gling Pa  

E-Print Network (OSTI)

gro bai rgyud lnga) qui sontcommuns lAnuyoga24 et dont la liste concerne les nos. 229, 224, 169, 166 etun Ri bo brtsegs pai rgyud qui est non-identifi dans la liste de Jigs med glingpa),xvi. le Recueillement Concentr (Ting dzin rtse gcig, non... on pourrait leur en trouver une, ainsi quon la fait dans cette prsentation. Il faudrait galement appliquer ce schma celui des clas- sification complexes du Klong sde en Abme blanc (klong dkar po), noir (klong nag po), diapr (klong khra bo) et infini...

Achard, Jean-Luc



Offering Songs, Festive Songs, Processional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Ta po sam ten gyam pa, 'Dream about Tibet'  

E-Print Network (OSTI)

last updated on Monday, 4 April 2011 Accession Form for Individual Recordings: Collection / Collector Name mGar glu / Katey Blumenthal Tape No. / Track / Item No. 06_14_2010_Ta po sam ten gyam pa.WAV Length of track 00:03:53 Title of track Ta po... ) Date of recording 06/14/2010 Place of recording Lo Monthang, Mustang, Nepal Name(s), age, sex, place of birth of performer(s) Tashi Tsering, unknown age, Male, Lo Monthang, Mustang, Nepal. Language of recording Logay Performer(s)s first / native...

Blumenthal, Katey


Offering Songs, Festive Songs, Processional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Da lulo chig dag pa nai ki nai glu yakshung  

E-Print Network (OSTI)

last updated on Monday, 4 April 2011 Accession Form for Individual Recordings: Collection / Collector Name khro glu / Katey Blumenthal Tape No. / Track / Item No. 06_07_2010_Da lulo chig dag pa nai ki nai glu yakshung.MP3 Length of track 00... (festive song) Medium (i.e. reel to reel, web-based file, DVD) Digital Recording Related tracks (include description/relationship if appropriate) Name of recorder (if different from collector) Date of recording 06/07/2010 Place of recording Lo...

Blumenthal, Katey


Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



The Metabolism of Americium in the Rat  

E-Print Network (OSTI)

A. J. Barber, J. G Hamilton, Metabolism of Plutonium inRats, Plutonium Project Record of the National Nuclearin the Rat (CH 3606) Plutonium Project Record of the

Scott, K.G.



Physical characteristics of LWRs and SCLWRs loaded by ({sup 233}U-Th-{sup 238}U) oxide fuel with small additions of {sup 231}Pa  

SciTech Connect

The paper investigates the possibility and attractiveness of using (U-Th) fuel in light-water reactors (LWRs) and in light-water reactors with super-critical coolant parameters (SCLWRs). It is proposed to dilute {sup 233}U with {sup 238}U to enhance the proliferation resistance of this fissionable isotope. If is noteworthy that she idea was put forward for the first time by she well known American physicist and participant of the Manhattan Project Dr. T. Taylor. Various fuel compositions are analyzed and compared on fuel breeding, achievable values of fuel burn-up and cross-sections of parasitic neutron absorption. It is also demonstrated that small {sup 231}Pa additions (several percent) into the fuel allows: to increase fuel burn-up, to achieve more negative temperature reactivity coefficient of coolant and to enhance nonproliferation of the fuel. (authors)

Kulikov, E.G.; Shmelev, A.N.; Apse, V.A. [Moscow Engineering Physics Institute - State University, Kashirskoe shosse, 31, Moscow (Russian Federation); Kulikov, G.G. [International Science and Technology Center, Krasnoproletarskaya ul., 32-34, P.0. Box 20, Moscow (Russian Federation)




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PARThlENT OF ENERGY PARThlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER Nl!PA Dl1TImfiNATION RECIPIENT: BeIi Geospace, Inc Page 1 of2 STATE: TX PROJECT TITLE: Geothermal Technology Advancement for Rapid Development of Resources in the U.S. Funding OpportunUy Announcement Number Procurement Instrument Number NEPA Control Number em Number DE·FQA'()()()()S22 OE-EEOOO5515 GF0-0005515-001 G05515 Bued on my review oftbe information concerning the proposro action, as NEPA Compliance Officer (authorized under DOE Ordtr 4SI.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : A9 Information gathering, analysis, and dissemination Information gathering (induding, but not limited to, literature surveys, inventories, site visits. and audits), data analysis


EERE PROJECT MANAGEMENT CENTER N1!PA DEl'l!R1.llNAl'ION R[CIPIENT:State of Louisiana-louisiana Department of Natural Resources  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENTER CENTER N1!PA DEl'l!R1.llNAl'ION R[CIPIENT:State of Louisiana-louisiana Department of Natural Resources PROJECf TITLE: ARRA EECBG - State of Louisiana St. James Parish Page 1 of2 STATE: LA Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO13 DE-EEOOOO735 GF0-0000735-004 0 Based on my review or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I bave made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potentia! energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENl!RGY ENl!RGY EERE PROJECT MANAGEMENT CENTER Nl!PA DETl!R1.llNATION RECIPIENT: Magma Energy (U.S .) Corp. Page 1 of3 STATE: NV PROJECf TITLE: Recovery Act: A 3D·3C Reflection Seismic Survey and Data Integration to Identify the Seismic Response of Fractures and Permeable Zones over a Known Geothermal Resource: Soda lake , Churchill Co" NV Funding Opportunity Announcement Number PrO(u.-ement Instrument Number NEPA Control Number em Number 0000109 DE-EEOOO2832 GFO-OOO2832·003 0 Based on my review oftbe informatioD concerning the proposed action, as NEPA Compliance Officer (authori7.ed under DOE Order 451.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathenng (including , but nollimiled 10, literature surveys, inventories, audits), data analYSIS (including

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ENVIRONMENTAL COALITION ON NUCLEAR POWER Phone/Fax: 814-237-3900 433 Orlando Avenue, State College, PA 16803 e-mail: johnsrud@csrlink  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

COALITION ON NUCLEAR POWER Phone/Fax: 814-237-3900 433 COALITION ON NUCLEAR POWER Phone/Fax: 814-237-3900 433 Orlando Avenue, State College, PA 16803 e-mail: johnsrud@csrlink.net January 29, 1998 U.S. Department of Energy Office of General Counsel CC-52 RE: 62 FR 68272 1000 Independence Avenue SW Price-Anderson Act Washington, D.C. 20585 Dear Madam or Sir: We have just been notified of the December 31, 1997, Federal Register Notice of opportunity for public comment on the Price-Anderson Act (PAA). Please accept for the Department's record in this matter the following comments submitted by the Pennsylvania-based Environmental Coalition on Nuclear Power (ECNP), a not-for-profit public-interest citizens' organization that has been actively involved in a broad range of nuclear energy and radioactive waste issues since


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




Science Conference Proceedings (OSTI)

... Synovate provides services to many companies, including General Motors, Fidelity Investments, American Express, ExxonMobil, Proctor & Gamble ...




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Pour servir a la numerisation des manuscrits tibetains de Dunhuang conserves a la Bibliotheque Nationale : II. Un fichier de Marcelle Lalou  

E-Print Network (OSTI)

'i mdo. 129, INV. 116 (quinzimedes textes mentionns la suite du texte 5). = Otani 810 ? rnam par mi rtog par 'jug pa zhes bya ba'igzungs. ! Avikalpapravesha.- rnam par snang mdzad chos kyi rje. 257, INV. 2 (dbut du texte 2).- rnam spyan drang ba smon... texte 4).- mi rtog pa'i bsam gtan la 'jug pa dam pa'i chos kyi mdo sde (las). 068,INV. 829 (dbut du texte, qui donne "myi rtog pa" et non "mi rtog pa".- moksa'i bshas pa rdzogs sho //. 0618, INV. 910 (fin du f. 22, l'orthographede la fiche est...

Chayet, Anne




SciTech Connect

In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Pa{alpha} image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M{sub Sun} yr{sup -1}, was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are {approx}7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

Komugi, S. [Joint ALMA Observatory, Alonso de Cordova 3107, Vitacura, Santiago 763-0355 (Chile); Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabe, T.; Yoshii, Y. [Institute of Astronomy, University of Tokyo, Osawa 2-21-1, Mitaka, Tokyo 181-0015 (Japan); Takagi, T. [Institute of Space and Astronautical Science, JAXA, 3-31-1 Yoshinodai, Sagamihara, Kanagawa 229-8510 (Japan); Iono, D.; Kaneko, H.; Ueda, J. [Nobeyama Radio Observatory, National Astronomical Observatory, 462-2 Nobeyama, Minamimaki, Minamisaku, Nagano 384-1305 (Japan); Saitoh, T. R., E-mail: skomugi@alma.cl [Interactive Research Center of Science, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro 152-0033 (Japan)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Gene therapy in alcoholic rats  

NLE Websites -- All DOE Office Websites (Extended Search)

70 70 Sept. 9, 2001 Gene Therapy Reduces Drinking in "Alcoholic" Rats UPTON, NY - Scientists at the U.S. Department of Energy's Brookhaven National Laboratory have shown that increasing the level of a brain protein important for transmitting pleasure signals can turn rats that prefer alcohol into light drinkers, and those with no preference into near teetotalers. The findings, published in the first September 2001 issue of the Journal of Neurochemistry (Vol. 78, No. 5), may have implications for the prevention and treatment of alcoholism in humans. "This is a preliminary study, but when you see a rat that chooses to drink 80 to 90 percent of its daily fluid as alcohol, and then three days later it's down to 20 percent, that's a dramatic drop in alcohol intake - a very clear change in behavior," said Panayotis Thanos, the lead researcher. "This gives us great hope that we can refine this treatment for future clinical use."


Tibetan Texts: dMigs-pa-brtag-pa; dMigs-pa-brtag-pahi-hgrel-pa; dMigs-pa-brtag-pahi-hgrel-bshad  

E-Print Network (OSTI)

~~ .~~.:..\\t ~.~",.Q.,~", " 01~' -" ""' ~""' -.,.rtI' .!"oo~""" ...", q+j::"~' ~~ :J"..q~r'ra,,::'t:4"',"?f:a~'fl:::J':.\\l=-;Q~~"~ ~='~I:';C\\ ~~"~;:'S~'~~rs ::J'iJ'~'~5~':J'~='~="~1 ::" 1 ~ ~=:~;:':;;J... ~~ '~=" ~~'.:fs:,'..CJj "l'~ ~r:.J~'~''C!~'~ ~i'r;.:I-l J.t='~C!l~~t:'~~=l1~:P::~~~;'=-irC\\i"'~~1 i~ :r. e;-~ 'f,e:' ~ ~ "'" ...",.., ~ ~ . @l~ ~t:'tJ::~ ",,'~ "'. S ~'?l'~~~' c.rti ~ ;1 C:,~ .~ 1- .t; 6t 't: ,r. ''-i'll':: 1:' f:' ':r~'=~"1...

Namgyal Institute of Tibetology



A Handlist of the Bonpo Kangyur and Tengyur  

E-Print Network (OSTI)

??????????????????????????? Dus gsum mi nub bstan pa'i rgyal mtshan kun tu bzang po nam mkha' rgyal po thugs rje chen po 'khor ba kun grol gyi rgyud. Note: This is a gter ma of Bde-chen gling-pa. 117 28. ??????????????????????????????????????????????????????????? ??... ??????????????????????????? rDzogs chen bsgrags pa skor gsum las, sTeng lha yul du bsgrags pa'i skor. 324 175. ???????????????????????????????? ?????????????? ??????????????????????????????? rDzogs chen bsgrags pa skor gsum las, Bar mi yul dang, 'Og klu yul du bsgrags...

Keutzer, Kurt



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


National Aeronautics and Space Administration Desert RATS  

E-Print Network (OSTI)

. This helps the D-RATS team determine the system requirements necessary for exploring distant locations while exploration methods, equipment and tools developed in laboratory settings in a real world environment developing the technical skills required of the next generation of explorers. Desert RATS is one of a suite


Other Participants 1992 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

, Sparks , NV Gateway High School , Monroeville , PA Grant High School, Portland , OR Hanford High School , Richland , WA Harrison High School , Farmington Hills , MI Henry M....


Notice of Intent to Prepare an Environmental Impact Statement for the Gilberton Coal-to-Clean Fuels and Power Project, Gilberton, PA (DOE/EIS-0357) (April 10, 2003)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

08 08 Federal Register / Vol. 68, No. 69 / Thursday, April 10, 2003 / Notices DEPARTMENT OF ENERGY Notice of Intent To Prepare an Environmental Impact Statement for the Gilberton Coal-to-Clean Fuels and Power Project, Gilberton, PA AGENCY: Department of Energy. ACTION: Notice of intent. SUMMARY: The U.S. Department of Energy (DOE) announces its intent to prepare an Environmental Impact Statement (EIS) pursuant to the National Environmental Policy Act (NEPA), the Council on Environmental Quality (CEQ) NEPA regulations (40 CFR parts 1500-1508), and the DOE NEPA regulations (10 CFR part 1021), to assess the potential environmental impacts of a proposed project by WMPI PTY, LLC, to design, construct, and operate a demonstration plant near Gilberton, Schuylkill County, Pennsylvania. The


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Blythe Solar Power Project PA/FEIS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BLYTHE SOLAR POWER PROJECT BLYTHE SOLAR POWER PROJECT Volume 1 of 2 August 2010 DOI Control #: FES 10-41 Publication Index #: BLM/CA/ES-2010-015+1793 NEPA Tracking # DOI-BLM-CA-060-0010-0013-EIS United States Department of the Interior Bureau of Land Management 120 1 Bird Center Drive Palm Springs, CA 92262 Phone (760) 833-7100 IFax (760) 833-7199 http://www.blm.gov/ca/palmsprings/ In reply refer to: CACA 048811 August 20, 20 I0 Dear Reader: Enclosed is the Proposed Resource Management Plan-AmendmentlFinal Environmental Impact Statement (PAlFEIS) for the California Desert Conservation Area (CDCA) Plan and Blythe Solar Power Project (BSPP). The Bureau of Land Management (BLM) prepared the PAIFEIS in consultation with cooperating agencies, taking into account public comments received during the National Environmental


Genesis Solar Energy Project PA/FEIS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GENESIS SOLAR ENERGY PROJECT GENESIS SOLAR ENERGY PROJECT Volume 1 of 3 August 2010 DOI Control #: FES 10-42 Publication Index #: BLM/CA/ES-2010-016+1793 NEPA Tracking # DOI-BLM-CA-060-0010-0015-EIS ,,..--......- _...._--- United States Department of the Interior Bureau of Land Management 1201 Bird Center Drive Palm Springs, CA 92262 Phone (760) 833·7100 IFax (760) 833-7199 http://www.blm.gov/calpalmsprings/ In reply refer to: CACA 048880 August 27, 20 I0 Dear Reader: Enclosed is the Proposed Resource Management Plan-Amendment/Final Environmental Impact Statement (PAIFEIS) for the California Desert Conservation Area (COCA) Plan and Genesis Solar Energy Project (GSEP). The Bureau of Land Management (BLM) prepared the PAiFEIS in consultation with cooperating agencies, taking into account public comments received during the National


Microsoft Word - PA Report 2013.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 1-December 30, 2012 October 1-December 30, 2012 February 12, 2013 Page 5 2.2 90-DAY LOOK AHEAD  Provide an annual assessment of the LM/LMS Environmental Management System in February. Three processes will be examined to evaluate implementation of the EMS elements.  Revise the Quality Assurance Manual, incorporating DOE Order 414.1D in March. A major change to the DOE directive is the requirements to choose a national standard as a basis of the QA Program. Stoller has chosen ISO 14001, Environmental Management System, because the standard focuses on environmental stewardship. 2.3 MAJOR CONCERNS The 2012 Health and Safety goal of more timely completion of corrective actions did not reach the 80 percent target for this quarter. A renewed focus on corrective action completion was


NETL: Science Bowl Information - South Western PA  

NLE Websites -- All DOE Office Websites (Extended Search)

CLICK ON IMAGE TO SEE LARGER VIEW SWPA Marshall Team 1 and SWPA Winner SWPA Wendover SWPA Carson Team 1 SWPA Suncrest Team 1 Lilas Soukup,SB Coordinator NETL, The Honorable Tim Murphy, U.S. House, Dr. Charlene Newkirk, Dr. Anthony Cugini, Director, NETL Middle School Congratulations to our four division winners: View full results here Division Einstein - Suncrest Team 1 - Christina Maloney, Coach - Aishwarya V, Captain - Bryce A - Luka B - David S - Roark S Division Carson - Wendover - Denise McGill, Coach - Adam G, Captain - Julia H - Kristina M - Josh M - Katrina P Division Tesla - Carson Team 1 - Cris Rufflol, Coach - Kevin D, Captain - Massil A - Pranav C - Rohan Y Division Westinghouse - Marshall Team 1 and SWPA Winner - Daniel Williams, Coach - Songela C, Captain - Marisa D


225 Shunk Hall University Park, PA 16802  

E-Print Network (OSTI)

of experience: Leadership of a contracted work crew consisting of 15 laborers Troubleshooting daily process

Demirel, Melik C.

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NETL: Science Bowl Information - South Western PA  

NLE Websites -- All DOE Office Websites (Extended Search)

CLICK ON IMAGE TO SEE LARGER VIEW National Champs - State College - enjoying the Eiffel Tower in Paris. National Champs - State College - enjoying the Eiffel Tower in Paris....


NETL: 2009 SW PA Science Bowl Information  

NLE Websites -- All DOE Office Websites (Extended Search)

second in the National Competition and traveled to France to visit Europe's largest nuclear power plant. 2009 Southwestern Pennsylvania Science Bowl Information Center DATE:...


NETL: Science Bowl Information - Southwestern PA  

NLE Websites -- All DOE Office Websites (Extended Search)

SWPA Science Bowl-High School Preliminary Results Congratulations to the four high school divisional winners who competed Saturday February 25, 2012 in 12 competitive matches....


NETL: Science Bowl Information - South Western PA  

NLE Websites -- All DOE Office Websites (Extended Search)

SWPA Science Bowl-Middle School Preliminary Results Congratulations to the four middle school divisional winners who competed Saturday March 3, 2012 in 5 competitive rounds. These...


Arco chimie focuses on PA at FOS  

Science Conference Proceedings (OSTI)

Arco Chimie France (Fos-sur-Mer), at a recent meeting at its southern France manufacturing site, emphasized that future strategy is strongly focused on its propylene oxide (PO) and derivatives activities. The F2.5 billion ($466 million)-Fe billion/year operation manufactures 200,000 m.t./year of PO, about 70% for captive use and the balance for the merchant market; 550,000 m.t./year of methyl tert butyl ether (MTBE); 97,000 m.t./year of polyols; and 70,000 m.t./year of propylene glycols. There has been talk of Arco modifying its Fos MTBE plant to make it flexible for ethyl tert-butyl ether (ETBE) output; the parent company already operates an MTBE/ETBE pilot unit at Corpus Christi, TX. But Arco Chimie notes there is insufficient bioethanol feedstock availability to convert all production to ETBE. The company would also require investment in new storage capacity for ethanol and ETBE. However, France's biofuels program is not yet clearly defined, and it is politically sensitive because it depends heavily on government subsidies offered to farmers. That, says Arco, makes it impossible to have an accurate idea of how much ethanol will be available.

Jackson, D.



Pittsburgh, PA 15217 Members, County Council  

E-Print Network (OSTI)

Members, My name is Roger Dannenberg. I've lived in Pittsburgh since 1979, and I have been a member never be detected by testing. It might be detected by a complete inspection of the software programs, has recommended that electronic voting systems enable voters to inspect a paper record to verify

Eckhardt, Dave


2011 International Pittsburgh Coal Conference Pittsburgh, PA  

E-Print Network (OSTI)

injection line is equipped with a flow meter and pressure transducer as well as a pneumatic control valve to below the water table and hence are not directly connected with the vadose zone, while well W-3 has of the latter's well screen and shutting off its connectivity with soil vadose zone gas. Formal sampling

Mohaghegh, Shahab


La Roca Blanca de Lhang lhang - Un santuario en Nyag rong  

E-Print Network (OSTI)

de Rag dmar, debido a la progresiva influencia a lo largo de los siglos de la emigracin de poblacin mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag... mi nyag pa shar dang lho phyogs su phos mthus mi nyag log skad da ltaang lus yod pa de sa gnas dir rag dmar go zer ba ni brag dmar go zer ba yin/ La Roca Blanca de Lhang lhang 15 masculina(dbon brgyud) 9 . Muchos de estos centros religiosos...

Aguillar, Oriol



Sub-threshold spinal cord stimulation facilitates spontaneous motor activity in spinal rats  

E-Print Network (OSTI)

facilitates spontaneous motor activity in spinal rats.facilitates spontaneous motor activity in spinal rats Paragtreadmill (electrical enabling motor control, eEmc) after a



What Connects Rat Tails to Cancer and Heart Disease?  

NLE Websites -- All DOE Office Websites (Extended Search)

What Connects Rat Tails to Cancer and Heart Disease? Collagen is the main (and most abundant) protein in all mammalian connective tissues, including those of the heart, lungs,...


The First Four Themes of Klong chen pa's Tshig don bcu gcig pa  

E-Print Network (OSTI)

as Buddha-Body, its nature as light, and its compassion as Awareness. 5. The way taken by Pristine Cognition gives an outline of the forma- tion of the body. It is argued that one has to learn first about the definite characteristics of the body... in order to understand the light-channels (od rtsa) which are based on the body and which constitute the way taken by Pristine Cognition (ye shes). 6. The doors by means of which Pristine Cognition arises explains the place where Pristine Cognition...

Scheidegger, Daniel



Modification of radiation damage in rat spinal cord by mitotane  

SciTech Connect

Modification of the paralytic response in rats after 6-MV photon irradiation of the spinal cord with either single or split exposures (two equal fractions given in a 24-hour period) by mitotane was investigated. Mitotane was administered as a suspension in physiologic saline (300 mg/kg/day) for either 5 days prior to or 5 days after irradiation. For rats receiving split doses of 6-MV photons, either the last two doses of mitotane were given 2 hours prior to each radiation fraction or mitotane was begun 2 hours after the second fraction and continued for 5 days. The data to 6 months after irradiation indicate that, in rats given mitotane for 5 days prior to single-dose photon irradiation, the paralytic response (as defined by the dose needed to produce paralysis in 50% of the irradiated groups of rats) was enhanced by a dose-enhancement factor (DEF) of 1.40. The DEF in the group of rats given mitotane after single doses of 6-MV photons was 1.15. In the split-dose irradiation experiments, the DEF for the groups of rats given mitotane prior to each radiation fraction was 1.36; while the DEF for the group of rats receiving mitotane beginning after the second fraction was 1.18. These data indicate that mitotane can potentiate the effects of 6-MV photon irradiation to the central nervous system, with mitotane administered prior to irradiation being the most effective sequence.

Glicksman, A.S.; Bliven, S.F.; Leith, J.T.



On the history and identification of two of the Thirteen Later Translations of the Dzogchen Mind Series  

E-Print Network (OSTI)

skad du/ byang chub kyi sems sgom pa don grub pa zhes bya ba/ dpal kun tu bzang po bde ba chen po la phyag 'tshal [lo]/ thug rje rgya mtsho (l. 5) sems can kun la khyab/ lha dang klu yang bden pa'i bka' nyan te/ dkon mchog gsum ni nam yang bskur mi... ni bstan du med/ sems dang chos ni ci yang ma yin pas/ sgom (l. 7) pa'i tshe na ci yang mi bsgom mo/ rnam par rtog pa'i mtshan ma ci byung yang/ rtog pa de nyid chos nyid yin shes na/ chos kyi dbyings ni gzhan du bsgom mi dgos/ de la gnyen pos bcos...

Liljenberg, Karen



SGang steng Catalogue  

E-Print Network (OSTI)

byaba/ 184-187 (274b-282a) Revue d'Etudes Tibtaines18 Colophon : // rgyud kyi rgyal po mi nub rgyal mtshan rje btsan dam pardo rje od phro bai rgyud rdzogs so//. 24. rDo rje sems dpa' nam mkha' che rgyas pa'i yi ge med pa'i rgyud/187-190 (282a-284b... cing theg pa mtha dag gi don bkod pa/ byang chubkyi sems bsam gtan nges pai rgyal po/ rje btsan dam pa rdzogs so//. 26. Mi 'gyur ba'i thig le tig / 189-191 (285a-287a)Colophon : /byang chub kyi sems mi gyur bai thig le tig rdzogs so//. 27. Srog gi...

Cathy Cantwell; Mayer, Rob; Kowalewski, Michael; Achard, Jean-Luc



"Department of Energy Information Protection Task Force - SSN Reduction Project PA 09-Baseline Inventory",,,,,,,,,,,,,"1. Not Cost Effective","2. No Resources Available","3. Legally Required to Collect and/or Maintain","4. Other - Explain in Column ""R"""  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Energy Information Protection Task Force - SSN Reduction Project PA 09-Baseline Inventory",,,,,,,,,,,,,"1. Not Cost Effective","2. No Resources Available","3. Legally Required to Collect and/or Maintain","4. Other - Explain in Column ""R""" Department of Energy Information Protection Task Force - SSN Reduction Project PA 09-Baseline Inventory",,,,,,,,,,,,,"1. Not Cost Effective","2. No Resources Available","3. Legally Required to Collect and/or Maintain","4. Other - Explain in Column ""R""" "DOE Privacy Website: http://management.energy.gov/FOIA/privacy.htm",,,,,,,,,,,,,"Yes","No","N/A" ,"1. Departmental Element","2. System Name/ Major Application Name","3. Location","4. Name of System Owner/ Information or Data Owner","5. Contact Information","6. Does the system collect or maintain Social Security numbers?","7. Source of Legal Requirement/Authority to Collect or Maintain Social Security Numbers?","8. Does the system have a Privacy Impact Assessment (PIA)?","9. Does the system have a System of Records Notice (SORN)? If yes, provide the name of the System of Records Notice.","10. Does the system collect or maintain other forms of PII?","Comments"


Quantitation of products from riboflavin in rat urine  

SciTech Connect

When (2-/sup 14/C) riboflavin is injected i.p. into rats, the excreted vitamin in urine and feces has been shown to be the intact vitamin with trace amounts of lumichrome and lumiflavin. Recent findings with /sup 14/C-riboflavin fed to rats indicated higher levels of riboflavin catabolites in urine, e.g., 7- and 8-carboxylumichromes. The authors have determined catabolites in urine from male rats fed 0, 2, and 6 ..mu..g riboflavin/g diet/day for six weeks. Two rats from each group were placed weekly in metabolic cages, and urine was collected for 24 hours. On the fourth week, a third animal from each group received an i.p. injection of /sup 14/C-riboflavin and the urine was collected for 48 hours. Urine samples were extracted with phenol for flavin components and with chloroform for derivatives of lumichrome and lumiflavin. Riboflavin was the predominant flavin excreted by all diet groups with trace amounts of coenzymes and 7- and 8-hydroxymethylriboflavin. Riboflavin accounted for 85% of all the radioactivity recovered from the deficient and sufficient rats and 90% in rats fed excess. Lumichrome-type compounds including carboxylumichromes accounted for only a few % of recovered radioactivity. Thus, these components are primarily a product of intestinal microfloral degradation rather than significant tissue catabolites of riboflavin.

Chastain, J.L.; McCormick, D.B.



The effect of dietary Cu and diabetes on indices of Cu nutriture in the rat  

SciTech Connect

The uptake-retention of 67Cu is affected by dietary Cu and diabetes. Consequently, the functional activities of select enzymes and tissue Cu status were assessed. STZ-diabetic and control rats were fed Cu suppl. or def. diets. Rats were gavaged with 28 {mu}Ci 67Cu, and killed 8, 16, 24, 32, 64, or 128 h later. Diabetic rats were hyperphagic, hyperglycemic and hypoinsulinemic; with no effect of diet. Plasma ceruloplasmin activity (Cp) was lower in Cu def. rats; diabetic rats tended to have higher Cp than controls. Cu def. rats had low Cu levels in liver, kidney and plasma. Cu suppl. diabetic rats had higher liver and kidney Cu compared to Cu def. diabetic rats. Gel chromatography of liver showed that with time, there was a transfer of 67Cu from low to higher MW ligands. In nondiabetic rats, more 67Cu was associated with the higher MW ligands. The converse was observed for diabetic rats. There was no effect of diabetes on liver 67Cu localization. Diabetic rats had higher metallothionein (MT) concentrations in liver and kidney compared to controls Cu deficiency lowered MT values in both diabetic and control rats. CuZn SOD Cu activity was lowered with Cu def. and diabetes, while Mn SOD activity was similar among groups. Plasma lipid peroxide levels were lower in diabetic rats than controls. The results show that Cu metabolism is affected in diabetes, and the changes are functionally significant.

Rucker, R.B.; Uriu-Hare, J.Y.; Tinker, D.; Keen, C.L. (Univ. of California, Davis (United States))



The sGang steng-b rNying ma'i rGyud manuscript from Bhutan  

E-Print Network (OSTI)

first folios, itsimply gives the volume identification and pagination in gold ink. 6 Volumes Ka, Pa, Ra, Ha to Ki, Gi, Ci, Chi, Nyi, Thi, Ni, Pi, Bi, and Mi 7 This is unlike the Rig 'dzin edition, where...

Cathy Cantwell; Mayer, Rob



The Buddhist princess and the woolly turban: non-Buddhist others in a 15th century biography  

E-Print Network (OSTI)

rnams la di ni bdag gis kun tu mi bzod kyis/ rdo ba dang phongs la rab tu bskrod cig ces bsgoo/khor rnams kyis kyang le lo ma yin par de bzhin du bgyis pa las/ bya gag gi phreng pa zhig pa bzhin du gyur nas rnga dang bshang la sogs pa rnams ni gzhi... dbus su ci nang bgyid par zhus nas/ de dang dei las la jug pa na rgyal bai dbang mos rang gi lhai de nyid dran par byes te blta stangs kyi gzir bas gshen rabs kyi rgyal mtshan chang ba yon mchod khor dang bcas pa thams cad la shing tu mi zad pa...

Diemberger, Hildegard



Antidotal effectiveness of activated charcoal in rats  

SciTech Connect

This study was designed to investigate the relative adsorption of radiolabeled /sup 14/C-sodium pentobarbital by three types of activated charcoal. Factors affection adsorption of the drug by SuperChar, United States Pharmacopeia (USP), and Darco G-60 activated charcoals with surface areas of 2800-3500 m2/g, 1000 m/sup 2//g, and 650 m/sup 2//g, respectively, were studied both in vitro and in vivo. For in vitro experiments, the drug was dissolved in water of 70% sorbitol (w/v), and the maximum binding capacity and dissociation constants for each of the charcoals were calculated. Rank order of maximum binding capacity was directly proportional to charcoal surface area in both water and sorbitol, while the dissociation constants for the charcoals in water were not different. For in vivo experiments, absorption of orally administered sodium pentobarbital (40 mg/kg) was studied in rats with and without activated charcoal administration. The results of this research suggest that: (1) SuperChar given in water possesses the greatest antidotal efficacy, (2) sorbitol induced catharsis does not reduce oral absorption of sodium pentobarbital, and (3) sorbitol enhances the antidotal efficacy of USP charcoal.

Curd-Sneed, C.D.


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Atrial natriuretic polypeptide-like material in rat lung  

SciTech Connect

Atrial natriuretic polypeptide-like immunoreactive material (ANP-IR) was found in rat lung by radioimmunoassay, with the concentration ranging from 0.6-1.2 pmol/g of tissue in each lobe. PAP-immunohistochemical study demonstrated that specific staining of granules for ..cap alpha..-human ANP are mainly located in the muscular layer of the pulmonary vein. Fractionation of lung extract by gel filtration and reserve phase HPLC revealed the presence of multiple forms of ANP-IR, which possibly possessed molecular structure partially different from rat ANP, atriopeptin I and III. Intravenous injection of lung extract induced potent diuresis and natriuresis in rats. These responses could be abolished when the lung extract was preincubated with antiserum for ..cap alpha..-human ANP. Specific binding sites for /sup 125/I-labeled rat ANP were also found in lung membrane preparation by radioreceptor assay. Incubation of synthetic atriopeptin III (10/sup -9/ to 10/sup -6/M) with lung tissue induced 1-28 fold increase in lung cGMP content. The results suggest that ANP-IR and its receptors existing in rat lung may be involved in the regulation of pulmonary function and have a synergic effect with ANP of cardiac origin in the control of water-electrolytes balance.

Chang, J.K.; Chang, D.; Xie, C.W.; Song, D.L.; Li, X.R.; Zhang, S.X.; Wang, T.L.; Tang, J.



Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

. Moscou : Nauka. Zhang Yisun 1993. Bod rgya tshig mdzod chen mo, Pkin : Mi rigs dpe skrun khang LA ROCA BLANCA DE LHANG LHANG Un santuario en Nyag rong Oriol Aguilar En Tbet, el Pas de las Nieves, en el centro de... mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag dmar, en Rag dmar8. Tambin facilita los nombres de los diversos centros religiosos desde tiempos...

Achard, Jean-Luc



Regulation of atrial natriuretic peptide receptors in the rat brain  

SciTech Connect

We have studied the localization, kinetics, and regulation of receptors for the circulating form of the atrial natriuretic peptide (ANP; 99-126) in the rat brain. Quantitative autoradiographic techniques and a /sup 125/I-labeled ligand, /sup 125/I-ANP (99-126), were employed. After in vitro autoradiography, quantification was achieved by computerized microdensitometry followed by comparison with /sup 125/I-standards. ANP receptors were discretely localized in the rat brain, with the highest concentrations in circumventricular organs, the choroid plexus, and selected hypothalamic nuclei involved in the production of the antidiuretic hormone vasopressin and in blood-pressure control. Spontaneously (genetic) hypertensive rats showed much lower numbers of ANP receptors than normotensive controls in the subfornical organ, the area postrema, the nucleus of the solitary tract, and the choroid plexus. These changes are in contrast to those observed for receptors of angiotensin II, another circulating peptide with actions opposite to those of ANP. Under conditions of acute dehydration after water deprivation, as well as under conditions of chronic dehydration such as those present in homozygous Brattleboro rats, there was an up-regulation of ANP receptors in the subfornical organ. Our results indicate that in the brain, circumventricular organs contain ANP receptors which could respond to variations in the concentration of circulating ANP. In addition, brain areas inside the blood-brain barrier contain ANP receptors probably related to the endogenous, central ANP system. The localization of ANP receptors and the alterations in their regulation present in genetically hypertensive rats and after dehydration indicate that brain ANP receptors are probably related to fluid regulation, including the secretion of vasopressin, and to cardiovascular function.

Saavedra, J.M.




E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.



The influence of dietary Cu and diabetes on tissue sup 67 Cu retention kinetics in rats  

SciTech Connect

Compared to controls, diabetes results in higher plasma, liver and kidney Cu concentrations. Since alterations in Cu metabolism may be associated with diabetic pathology, the authors investigated how Cu metabolism is affected by diabetes and dietary Cu intake. Nondiabetic and STZ diabetic rats were fed Cu suppl. or Cu def. diets for 5 wks. Rats were intubated with 28 {mu}Ci {sup 67}Cu and killed after 8, 16, 24, 32, 64, or 128 h. There were marked effects of both diet and diabetes on {sup 67}Cu metabolism. Independent of diabetes, deficient rats had a higher % of retained {sup 67}Cu, in liver, plasma, RBC, muscle, spleen, brain, lung, uterus, and intestine than adequate Cu rats. Independent of dietary Cu, diabetic rats had a lower % of retained {sup 67}Cu in liver, plasma, RBC, muscle, spleen, lung, bone, pancreas, skin, uterus and heart than controls. Differential effects were noted for kidney; adequate Cu diabetic rats had a higher % of retained {sup 67}Cu than all other groups. Marked effects of both diet and diabetes were evident when tissue Cu turnover was examined. Compared to Cu suppl. rats, Cu def. rats had a slower turnover of {sup 67}Cu, in liver, plasma, intestine, pancreas, eye, brain, muscle, spleen, lung and heart. Diabetic rats had a slower turnover of {sup 67}Cu than nondiabetic rats in liver, plasma, intestine, pancreas, eye, kidney, RBC and uterus. The data imply that a focus on Cu metabolism with regard to cellular Cu trafficking and pathology may be warranted.

Uriu-Hare, J.Y.; Rucker, R.B.; Keen, C.L. (Univ. of California, Davis (United States))



Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Engine Technology Background The mission of the U.S. Department of Energy's National Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Testing of Rapid PSA for CO 2 Capture Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Research &...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

including lignite and sub-bituminous coal, make up about half of U.S. coal production and reserves. They have lower energy and sulfur contents than bituminous coal, but higher...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Institute Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...


Microsoft Word - CX_PA-Sappho-LLIP-L0254.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 30, 2009 November 30, 2009 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Curtis Michael Electrical Engineer - TFOD-OLYMPIA Proposed Action: Port Angeles-Sappho #1 Line Tap Budget Information: Work Order # 00004866, Task # 04 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B4.6: "Additions or modifications to electric power transmission facilities that would not affect the environment beyond the previously developed facility area..." Location: Port Angeles, Clallam County, Washington Proposed by: Bonneville Power Administration (BPA) and Clallam County Public Utility District (PUD) Description of the Proposed Action: BPA proposes to install a new tap and associated disconnect structures on BPA's Port Angeles-Sappho #1 115-kV transmission line to provide a


OpenPA: Open Portable Atomics | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

(Open Portable Atomics) is an open source library intended to provide a consistent C API for performing atomic operations on a variety of platforms. The main goal of the...


DMigs-pa-brtag-pahi-hgrel-bshad (Alambana Pariksha Tika)  

E-Print Network (OSTI)

. ," -- -' ..... ~", ~~ Q~'~ ~'Q'qF' F;" l::::'::J' '~'::1'1:\\ 'Y~~ .~~.:..\\t ~.~",.Q.,~", " 01~' -" ""' ~""' -.,.rtI' .!"oo~""" ...", q+j::"~' ~~ :J"..q~r'ra,,::'t:4"',"?f:a~'fl:::J':.\\l=-;Q~~"~ ~='~I:';C\\ ~~"~;:'S~'~~rs ::J'iJ'~'~5~':J'~='~="~1 ::" 1... ~' )"~.:: ~~:.;.II ~~ :'C:'~5~l"r~s.:'fI~ '.r~.J.t.~~.~ I ~~ '~=" ~~'.:fs:,'..CJj "l'~ ~r:.J~'~''C!~'~ ~i'r;.:I-l J.t='~C!l~~t:'~~=l1~:P::~~~;'=-irC\\i"'~~1 i~ :r. e;-~ 'f,e:' ~ ~ "'" ...",.., ~ ~ . @l~ ~t:'tJ::~ ",,'~ "'. S ~'?l'~~~' c.rti ~ ;1 C...

Namgyal Institute of Tibetology


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of filter elements to remove ash from the syngas prior to it being utilized in a gas turbine or fuel cell. The elements are arranged in columns called "candles" and contained...



NLE Websites -- All DOE Office Websites (Extended Search)

improvements in generator efficiency and appliance efficiency ratings, development of energy-efficient manufacturing or industrial practices, and small-scale conservation and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Facilities Description Scientists at NETL's laboratories use the Geoscience Analysis, Interpretation, and Assessments (GAIA) Computational Facilities for...



E-Print Network (OSTI)

. ENVIRONMENT Paper is from the ultimate renewable resource: trees; and sustainably managed forests are carbon commodity. The biggest market for exports of wastepaper from New Zealand is China closely followed production is 99% from sustainable and renewable plantations. The wood used for newsprint is either low value

Hickman, Mark


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Pyroelectric Ceramic Temperature Sensors for Energy System Applications Background There is an increasing need to monitor processing parameters such as...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

CO 2 -Binding Organic Liquids Gas Capture with Polarity-Swing-Assisted Regeneration Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and are also stringent in order to avoid poisoning catalysts utilized in making liquids from fuel gas, electrodes in fuel cells, and selective catalytic reduction...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

The TMS Foundation. The TMS Foundation was established in 1993, to develop and fund programs that will fully prepare future generations of professionals for...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

TMS Foundation Activities. Through the generous support of TMS members, friends, and corporate contributors, The TMS Foundation is currently funding these...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

The TMS Foundation Bylaws. The TMS Foundation was established in 1993, to develop and fund programs that will fully prepare future generations of...


P.A. Capdau Charter School | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and, of course, our school buildings, like the one we are in today. DOE's "EnergySmart Schools" Program helps reduce schools' energy use and expenses, and provides a better...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

TMS ENERGY INITIATIVES ... minorities, or project your green persona to make your corporate mark through customized events, scholarships and amenities.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

modeling, laboratory experiments, and industry input to develop physics-based methods, models, and tools to support the development and deployment of advanced...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of clean energy systems. Accomplishments The AVESTAR team successfully deployed 3-D virtual IGCC immersive training systems at NETL and West Virginia University that allow...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent...


NETL: Science Bowl Information - South Western PA - 2010 New...  

NLE Websites -- All DOE Office Websites (Extended Search)

CLICK ON IMAGE TO SEE LARGER VIEW National Champs - State College - enjoying the Eiffel Tower in Paris. National Champs - State College - enjoying the Eiffel Tower in Paris. 2010...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

volatilization from interconnect alloys using solution conductivity. Schematic of a SOFC highlighting potential degradation mechanisms. The GEGR project assists the SOFCs...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

project phases focused on cell and stack research and development with emphasis on SOFC performance enhancement (power density, fuel utilization, and degradation), cost...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

chemical state of pulse laser deposited thin-film cathodes were measured. * A symmetric SOFC cell for ultra-small angle X-ray scattering studies was designed and constructed. The...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

coatingscale durability through thermal cycling. * Drew the interest of a major SOFC manufacturer and specialty SOFC metals producer. Benefits nGimat's SBIR project...

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

assists the SOFCs program in meeting its cost and performance targets by ensuring that SOFC seals can achieve reliable operation over an extended operating life. The program...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

methods developed in this ONR program can now be applied to the testing of a Delphi Gen 4 SOFC stack in the DOE research program. Benefits This NUWC project assists the SOFCs...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

region or matching oxygen vacancy concen- trations. * Demonstrated that periodic reverse SOFC operation serves to prolong SOFC lifetimes. * Demonstrated elemental surface valence...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Unique Low Thermal Conductivity Thermal Barrier Coating (TBC) Architectures-UES Background Gas turbine engines used in integrated gasification combined cycle power plants require...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

a novel catalyzed wall heat exchanger, and a network of heat exchangers to support thermal self-sufficiency. * Completed test stand modifications at UTC Power to support...


Privacy Act (PA) of 1974 | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

unwarranted invasions of their privacy stemming from federal agencies' collection, maintenance, use, and disclosure of personal information about them. Therefore, unlike the...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

diverse number of systems and chemical processes ranging from catalysts developments for Fischer-Tropsch synthesis applications, nanoscience, development of dense membrane systems...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and unknown samples. Analyses are used to characterize the fundamental properties of unconventional natural gas and oil reservoirs, ultra-deepwater and frontier-region...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the plant. Calera's process reduces carbon dioxide and pollutant emissions by using waste streams to make useable products. In the Sub-phase 2a, Calera completed the detailed...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

WGS National Carbon Capture Center - Water-Gas Shift Tests to Reduce Steam Use Background In cooperation with Southern Company Services, the U.S. Department of Energy (DOE)...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

* Conduct bench-scale testing of the complete ICES incorporating the selected particle growth method with the optimized capture duct and diffuser systems to enable the...


Membranes Obtained from PA6/HDPE Blends Via Precipitation by ...  

Science Conference Proceedings (OSTI)

The results showed the characteristic pores for microfiltration process. .... of Transparent Conductive Films of Magnesium Hydroxide Based Compounds.


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

First Name:*. Middle Initial: Last Name:*. Title/Position: Employer: Address 1:*. Address 2: City:*. State/Province:*. Zip/Postal Code:*. Country: Telephone: Fax:.


Confirmatory Survey Report for the Quehanna Decommissioning Project, Karthaus, PA  

Science Conference Proceedings (OSTI)

The survey activities consisted of visual inspections and radiological surveys including beta and gamma surface scans and surface beta activity measurements.

W. C. Adams



Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

can contribute to the reduction of overall greenhouse gas emissions from fossil power plants. One area of research is the development and characterization of multiple...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Archer Daniels Midland Company: CO 2 Capture from Biofuels Production and Storage into the Mt. Simon Sandstone Background Carbon dioxide (CO 2 ) emissions from industrial...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Transport Membrane (ITM) Oxygen Technology for Integration in IGCC and Other Advanced Power Generation Systems Background Oxygen is among the top five chemicals produced worldwide...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

materials requirements for all fossil energy systems, including materials for advanced power generation technologies, such as coal gasification, heat engines, such as turbines,...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Aerodynamics and Heat Transfer Studies of Parameters Specific to the IGCC- Requirements: High Mass Flow Endwall Contouring, Leading Edge Filleting and Blade Tip Ejection under...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Effects of Hot Streak and Phantom Cooling on Heat Transfer in a Cooled Turbine Stage Including Particulate Deposition-The Ohio State University Background Sophisticated...

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BatPaC - Battery Performance and Cost model - Contacts  

NLE Websites -- All DOE Office Websites (Extended Search)

Argonne National Laboratory Chemical Sciences & Engineering DOE Logo CSE Home About CSE Research Facilities People Publications Awards News & Highlights Events Search Argonne ......


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

FutureGen 2.0 Background The combustion of fossil fuels for electricity generation is one of the largest contributors to carbon dioxide (CO 2 ) emissions in the United States and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

(3) improving efficiency of storage operations; and (4) developing Best Practices Manuals. Deploying these technologies in commercial-scale applications will require a...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

main bulk phases, the Nb solid solution, and Nb silicides will be developed. Formation energies of the undoped and doped Nb-Si-Cr will be calculated and compared. Interfacial...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Technology (Georgia Tech) will obtain data and develop models of the turbulent burning rate of HHC fuels at realistic conditions and in inhomo- geneous conditions such as...


Recipient: County of Lancaster, PA ENERGY EFFICIENCY AND CONSERVATION...  

NLE Websites -- All DOE Office Websites (Extended Search)

Server Virtualization A9, B5.1 None. LED Traffic Signal Upgrades B5.1 Waste Stream Clause Energy Audit & Energy Master Planning for Public & Not-for- Profit Facilities A9, All,...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. After only eight years from the time of...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. Only eight years after construction and...


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

capture technologies developed by the DOE program may also be applied to natural gas power plants after addressing the R&D challenges associated with the relatively low...


Herausgeber: Paderborn Institute for Scientific Computation (PaSCo)  

E-Print Network (OSTI)

sources. One of related works is an energy-harvesting WSN for a railway monitoring system [6]. In [7.032mW (indoor) to 37mW (direct sunlight) when energy is harvested from solar or 5mW (piezoelectric

Noé, Reinhold


The Minerals, Metals and Materials Society, Warrendale, PA - TMS  

Science Conference Proceedings (OSTI)

TMS on LinkedIN LinkedIN TMS on Facebook Facebook TMS on Flickr Flickr TMS YouTube Channel YouTube Email Page...


P.O. Box 1002 Millersville, Pa. 17551-0302  

E-Print Network (OSTI)

Gramoxone Inteon® Syngenta 22 D 2L Firestorm® Chemtura 22 D 3L Paraquat Concentrate® Solera Source Dynamics

Hardy, Christopher R.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

correspond to reflected-shock temperature (1180 K) and pressure (13.06 atm) for a stoichiometric H 2 -O 2 mixture in argon. Comparison with chemical kinetics mechanisms is good...


The Minerals, Metals and Materials Society, Warrendale, PA  

Science Conference Proceedings (OSTI)

TMS ENERGY INITIATIVES KNOWLEDGE RESOURCE CENTER ... Corporate, Hydro Aluminium Rolled Products Wagstaff Inc. Foundation Founders


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

oil recovery (EOR) application. The industrial source of CO 2 will be a petroleum-coke-to-chemicals (methanol and other by-products) gasification plant being developed by...


Sequence analysis of the rat Brca1 homolog and its promoter region  

Science Conference Proceedings (OSTI)

dog, and human to help identify the important functional domains ... regions among the rat, mouse, and human genes. .... resulted in Taq polymerase errors.


Effect of Low Dose Radiation on Antioxidant Levels in Rat Brain  

NLE Websites -- All DOE Office Websites (Extended Search)

Low Dose Radiation on Antioxidant Levels in Rat Brain Mohan Doss Fox Chase Cancer Center Abstract Background: Parkinsons disease (PD) is characterized by progressive...


PyRAT - python radiography analysis tool (u)  

SciTech Connect

PyRAT is a radiography analysis tool used to reconstruction images of unknown 1-0 objects. The tool is written in Python and developed for use on LINUX and Windows platforms. The tool is capable of performing nonlinear inversions of the images with minimal manual interaction in the optimization process. The tool utilizes the NOMAD mixed variable optimization tool to perform the optimization.

Temple, Brian A [Los Alamos National Laboratory; Buescher, Kevin L [Los Alamos National Laboratory; Armstrong, Jerawan C [Los Alamos National Laboratory



Extraction of erythropoietin from normal kidneys. [Rats, dogs  

SciTech Connect

Significant amounts of active erythropoietin were extracted from the kidneys of normal rats, cattle, dogs, and rabbits by homogenization of the organs in 0.1 M phosphate buffer. The mean erythropoietin activities of the extracts, as determined by the starved-rat assay, were 0.26 U/g beef kidney, 0.41 U/g dog kidney, and 0.11 U/g rat kidney. The dog kidney extracts had a mean activity of 0.35 U/g, as measured by stimulation of hemoglobin synthesis in cultured bone marrow cells (in vitro assay) and produced a dose-dependent stimulation of /sup 59/Fe incorporation into circulating red cells when assayed in polycythemic mice. Extracts of rabbit kidney cortices had a mean activity of 2.12 U/g, as measured by stimulation of hemoglobin synthesis in cultured bone marrow cells. When the dog kidney homogenate was fractionated on DEAE-cellulose, all of the erythropoietin activity was adsorbed to the exchanger in the presence of 0.01 M acetate buffer, pH 4.5, and was completely eluted by 0.1 M Na/sub 2/HPO/sub 4/-0.5 M NaCl, pH 8. An antibody made aganist human urinary erythropoietin completely inactivated the erythropoietic factor in the dog kidney extract. Serum from a donor dog had no erythropoietin activity when assayed in the starved rat, suggesting that the factor in the extracts is intracellular erythropoietin rather than that contained in plasma trapped in the renal vasculature. The complete inactivation of the erythropoietic factor in these kidney homogenates by antierythropoietin and its behavior on DEAE-cellulose indicate that this factor is structurally similar to native plasma erythropoietin. The extracts are completely active without being incubated in the presence of serum.

Sherwood, J.B.; Goldwasser, E.



Relaxation Time Constants and Apparent Diffusion Coefficients of Rat Retina at 7 Tesla  

E-Print Network (OSTI)

Relaxation Time Constants and Apparent Diffusion Coefficients of Rat Retina at 7 Tesla Govind Nair* and ADC of the rat eyes were measured at 50 3 50 3 800 lm at 7 Tesla. Profiles of T1, T2, T2* and ADC

Duong, Timothy Q.

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

Summary.-Urine of normal rats, pregnant animals and animals bearing chemically induced hepatoma was tested with antisera to foetoproteins by the double immunodiffusion technique. Antigens were not detected in the urine of normal rats. Alpha-foetoprotein was demonstrated in the urine of pregnant rats and hepatomabearing animals. THREE specific embryonic proteins have been described in the rat. One antigen, the lipoprotein esterase, is present in the serum of the adult animal in minute amounts. The other two constituents, alpha-foetoprotein and alpha-M-foetoprotein, formerly termed LA antigen and alpha-2-glycoprotein, normally occur in the serum of the foetus, neonate and pregnant rat (Stanislawski-Birencwajg, 1967). Alpha-M-foetoprotein also appears in the serum of rats with acute toxic liver injury and following a variety of experimental procedures (van Gool and Ladiges, 1969; Heim and Lane, 1964). On the other hand, both foetoproteins are detected in the serum of rats with chemically induced hepatoma (Stanislawski-Birencwajg, Uriel and Grabar,. 1967). Since the alpha-foetoprotein (AFP) is present in the amniotic fluid, to which foetal urine contributes substantially (Pitkin, Reynolds and Burchell, 1968; Vernier and Smith, 1968), it is surprising that urinary excretion in the adult has received little attention (Masseyeff, 1972). In the rat, urinary excretion of non-plasma proteins, i.e. tissue antigens emanating from the accessory sex glands, kidneys, liver and testes, has been reported from

E. Okon; E. Rosenmann; T. Dishont; J. H. Boss



Norepinephrine uptake by rat jejunum: Modulation by angiotensin II  

SciTech Connect

Angiotensin II (ANG II) is believed to stimulate sodium and water absorption from the small intestine by enhancing sympathetic nerve transmission. This study is designed to determine whether ANG II can enhance sympathetic neurotransmission within the small intestine by inhibition norepinephrine (NE) uptake. Intracellular NE accumulation by rat jejunum was concentration dependent and resolved into high- and low-affinity components. The high-affinity component (uptake 1) exhibited a Michaelis constant (K{sub m}) of 1.72 {mu}M and a maximum velocity (V{sub max}) of 1.19 nmol {center dot} g{sup {minus}1} {center dot} 10 min{sup {minus}1}. The low-affinity component (uptake 2) exhibited a K{sub m} of 111.1 {mu}M and a V{sub max} of 37.1 nmol {center dot} g{sup {minus}1} {center dot} 10 min{sup {minus}1}. Cocaine, an inhibitor of neuronal uptake, inhibited the intracellular accumulation of label by 80%. Treatment of animals with 6-hydroxydopamine, which depletes norepinephrine from sympathetic terminals, also attenuated NE uptake by 60%. Thus accumulation within sympathetic nerves constitutes the major form of ({sup 3}H)NE uptake into rat jejunum. ANG II inhibited intracellular ({sup 3}H)NE uptake in a concentration-dependent manner. At a dose of 1 mM, ANG II inhibited intracellular ({sup 3}H)NE accumulation by 60%. Cocaine failed to potentiate the inhibition of ({sup 3}H)NE uptake produced by ANG II. Thus ANG II appears to prevent ({sup 3}H)NE accumulation within rat jejunum by inhibiting neuronal uptake.

Suvannapura, A.; Levens, N.R. (CIBA-GEIGY Corp., Summit, NJ (USA))



Effect of co-exposure and cadmium in rats  

Science Conference Proceedings (OSTI)

Metabolism and toxicity of heavy metals may be influenced by certain factors such as protein malnutrition, essential element deficiency or alcoholism. Ethanol has been found to enhance the absorption of lead in body and alcoholics have been reported to be more susceptible to lead intoxication. As alcoholism may be common among industry workers and a significant section of population, who may be exposed to cadmium, it was considered of interest to investigate the influence of ethanol-cadmium co-exposure on cadmium sensitive hepatic, renal and serum enzymes, tissue accumulation of cadmium, essential trace element status and cadmium induced hepatic metallothione in synthesis in rats.

Tandon, S.K.; Tewari, P.C.



A highly sensitive radioreceptor assay for atrial natriuretic peptide in rat plasma  

SciTech Connect

To enable serial measurements of plasma atrial natriuretic peptide (ANP) concentrations in the rat, a microradioreceptor assay (RRA) for this hormone was developed. Glomerular microsomes bearing ANP receptors were used to bind ANP. The smallest quantity of ANP detectable by this method was 0.2 fmol/sample. By contrast, a radioimmunoassay for ANP was sensitive to 2.4 fmol/sample. The intra- and interassay coefficients of variation for the RRA were 4.1 and 11.6%, respectively. Recovery of 10, 20, 50, and 100 pM synthetic ANP added to unextracted rat plasma was essentially 100%. Biologically inactive, synthetic amino- and carboxy-terminal ANP fragments added to rat plasma were not detected. Plasma ANP was stable when measured four consecutive times at 90-min intervals in 10 fasting rats. In a separate group of rats, fasting plasma ANP levels averaged 34 {plus minus} 3 and rose to 57 {plus minus} 5 pM in the postprandial state, whereas levels in fasting time controls remained constant. It is concluded that the RRA for ANP described here detects ANP in microliter quantities of unextracted rat plasma. Thus serial measurements of ANP concentrations can be undertaken in rats without inducing major changes in the volume status.

Ballermann, B.J. (Brigham and Women's Hospital, Boston, MA (USA) Harvard Medical School, Boston, MA (USA))



A mode of action for induction of thyroid gland tumors by Pyrethrins in the rat  

Science Conference Proceedings (OSTI)

Prolonged treatment with high doses of Pyrethrins results in thyroid gland tumors in the rat. To elucidate the mode of action for tumor formation, the effect of Pyrethrins on rat thyroid gland, thyroid hormone levels and hepatic thyroxine UDPglucuronosyltransferase activity was investigated. Male Sprague-Dawley CD rats were fed diets containing 0 (control) and 8000 ppm Pyrethrins and female rats diets containing 0, 100, 3000 and 8000 ppm Pyrethrins for periods of 7, 14 and 42 days and for 42 days followed by 42 days of reversal. As a positive control, rats were also fed diets containing 1200-1558 ppm sodium Phenobarbital (NaPB) for 7 and 14 days. The treatment of male rats with 8000 ppm Pyrethrins, female rats with 3000 and 8000 ppm Pyrethrins and both sexes with NaPB resulted in increased thyroid gland weights, which were associated with follicular cell hypertrophy. Thyroid follicular cell replicative DNA synthesis was increased by treatment with Pyrethrins and NaPB for 7 and/or 14 days. Treatment with Pyrethrins and NaPB increased hepatic microsomal thyroxine UDPglucuronosyltransferase activity and serum thyroid stimulating hormone levels (TSH), but reduced serum levels of either thyroxine (T{sub 4}) and/or triiodothyronine (T{sub 3}). The effects of Pyrethrins in female rats were dose-dependent, with 100 ppm being a no-effect level, and on cessation of treatment were essentially reversible in both sexes. The concordance between the effects of Pyrethrins and NaPB suggests that the mode of action for Pyrethrins-induced rat thyroid gland tumors is similar to that of some other non-genotoxic inducers of hepatic xenobiotic metabolism.

Finch, John M. [Inveresk Research, Tranent EH33 2NE, Scotland (United Kingdom); Osimitz, Thomas G. [Science Strategies LLC, Charlottesville, VA 22902 (United States)]. E-mail: perseus1@worldnet.att.net; Gabriel, Karl L. [ConTox Ltd, Fort Washington, PA 19034-0368 (United States); Martin, Tom [Inveresk Research, Tranent EH33 2NE, Scotland (United Kingdom); Henderson, Wendy J. [Inveresk Research, Tranent EH33 2NE, Scotland (United Kingdom); Capen, Charles C. [The Ohio State University, Columbus, OH 43082 (United States); Butler, William H. [Glebe Cottage, Big Common Lane, Bletchingley, Surrey RH14QE, England (United Kingdom); Lake, Brian G. [BIBRA International Ltd, Woodmansterne Road, Carshalton, Surrey SM5 4DS, England (United Kingdom); Centre for Toxicology, School of Biomedical and Molecular Sciences, University of Surrey, Guildford, Surrey GU2 7XH, England (United Kingdom)



Exercise training modulates apoptotic signaling in the aging rat heart  

E-Print Network (OSTI)

Aging is characterized by a progressive decline in cardiac function. A critical contributor to the age-related impairment in heart function is the loss of cardiac myocytes through ??apoptosis??, or programmed cell death. A dramatic increase in the rate of apoptosis has been reported with aging in the rat left ventricle. In contrast, exercise training not only improves cardiac function, but also reduces the risk of heart disease. However, the ability of exercise training to modulate apoptotic signaling and apoptosis in the aging heart remains unknown. Therefore, the purpose of this study was to determine the effects of exercise training on apoptotic signaling and apoptosis in the aging heart. We hypothesized that (1) aging would increase pro-apoptotic signaling and apoptosis in the rat left ventricle, and (2) exercise training would ameliorate upregulation of Bcl-2 family-driven apoptosis in the heart. Four and 25 month old Fischer-344 rats were assigned to four groups: young control (YC), young trained (YT), old control (OC), and old trained (OT). Exercise training groups ran on a treadmill for 60 min/day at 15 m/min (15? incline), 5 d/wk for 12 wk. Protein expression of Bax, Bcl-2, caspase-9, and cleaved caspase-3 was measured using Western immunoblot analysis. Apoptosis (DNA fragmentation) was assessed using a cell death detection ELISA. Bax levels in OC were dramatically higher (+176.0%) compared to YC. In contrast, exercise training resulted in a significant decrease (-53.4%) in Bax in OT compared to OC. Bcl-2 levels in OC were lower (-26.3%) compared to YC. Conversely, exercise training significantly increased Bcl-2 levels by 117.8% in OT compared to OC. Caspase-9 levels were higher (+98.7%) in OC than YC, while exercise training significantly reduced caspase-9 levels in YT (-52.6%) and OT (-76.9%), respectively. Aging resulted in a dramatic increase (+122.8%) in cleaved caspase-3 levels and a significant decrease (-32.9%) with exercise training. Finally, apoptosis (DNA fragmentation) significantly increased (+163.8%) with aging and decreased (-43.9%) with exercise training. These novel data indicate that aging increases pro-apoptotic signaling and apoptosis in the left ventricle, while exercise training is effective in diminishing pro-apoptotic signaling and apoptosis in the aging heart.

Kwak, Hyo Bum



Advances in Conjugated Linoleic Acid Research, Vol 2Chapter 13 CLA and Bone Modeling in Rats  

Science Conference Proceedings (OSTI)

Advances in Conjugated Linoleic Acid Research, Vol 2 Chapter 13 CLA and Bone Modeling in Rats Health Nutrition Biochemistry eChapters Health - Nutrition - Biochemistry AOCS Press Downloadable pdf of Chapter 13 C


Particulate oil shale inhalation and pulmonary inflammatory response in rats  

SciTech Connect

This experiment detrimetal that long-term inhalation of shale dusts by rats elicits a limited inflammatory response in the lung less profound than that observed in animals exposed to equivalent levels of quartz alone. This observation suggests that organic and inorganic constituents of shale may provide a protective effect. The implications for fibrogenic disease are two-fold: (1) inhalation of oil shale dusts appeared to be less detriemtal than the inhalation of quartz along, and (2) there was no apparent synergistic action of quartz and the complex of organic materials present in shale. Animals exposed to shale dusts failed to develop any significant lung lesions, while all of the animals exposed to quartz developed granulomas and some frank fibrosis.

Wilson, J.S.; Holland, L.M.; Halleck, M.S.; Martinez, E.; Saunders, G.



Ultrastructural changes in rat hepatocytes following acute methyl mercury intoxication  

SciTech Connect

Male rats were given daily subcutaneous injections of methylmercuric chloride (CH/sub 3/HgCl) at a dosage of 10 mg/kg body weight for 4 days. The earliest ultrastructural changes consisted of dilatation of the rough endoplasmic reticulum, wavy transformation of the mitochondrial membranes and occasional accumulation of liposomes. Focal areas of cytoplasmic degradation were observed 1 day after the initial administration of mercury. An increased number of lysosomes as well as swelling and floccular degeneration of the mitochondria were frequently observed at 2 days. Sequestration of cytoplasmic organelles within the hepatocytes, extrusion of degenerated hepatic organelles and cytoplasmic debris into the sinusoid could be observed 24 hours after the initial mercury administration and became a frequent finding after 4 days of intoxication. (auth)

Desnoyers, P.A.; Chang, L.W.



Endotoxin suppresses surfactant synthesis in cultured rat lung cells  

Science Conference Proceedings (OSTI)

Pulmonary complications secondary to postburn sepsis are a major cause of death in burned patients. Using an in vitro organotypic culture system, we examined the effect of E. coli endotoxin (LPS) on lung cell surfactant synthesis. Our results showed that E. coli endotoxin (1.0, 2.5, 10 micrograms LPS/ml) was capable of suppressing the incorporation of /sup 3/H-choline into de novo synthesized surfactant, lamellar bodies (LB), and common myelin figures (CMF) at 50%, 68%, and 64%, respectively. In a similar study, we were able to show that LPS also inhibited /sup 3/H-palmitate incorporation by cultured lung cells. LPS-induced suppression of surfactant synthesis was reversed by hydrocortisone. Our results suggest that LPS may play a significant role in reducing surfactant synthesis by rat lung cells, and thus contribute to the pathogenesis of sepsis-related respiratory distress syndrome (RDS) in burn injury.

Li, J.J.; Sanders, R.L.; McAdam, K.P.; Gelfand, J.A.; Burke, J.F.



Cocaine hypophagia and hyperlocomotion in rats before and after exposure to a high-fat diet  

E-Print Network (OSTI)

Relatively few studies have examined the effects of psychostimulants in obese subjects. Using the dietary obese rat model, the present experiments determined the reductions in food intake (hypophagia) and increases in locomotion (hyperlocomotion) induced by cocaine in diet-induced obese prone (DIO-prone) rats and diet resistant prone (DR-prone) rats as well as diet-induced obese (DIO) rats and diet resistant (DR) rats. In Experiment 1, thirty-six male Sprague-Dawley rats were given intra-peritoneal (i.p.) injections of cocaine (0, 10, 20, and 30 mg/kg) immediately prior to placement into locomotor chambers outfitted with a food source and a water source for a 60-minute test period. In Experiment 2, the same rats were exposed to a high-fat diet, and were subsequently divided into groups according to the extent of the weight gain (high weight gainers ? DIO group, low weight gainers ? DR group, and residual weight gainers ? MIX group). The rats were retested for reactivity to cocaine using conditions similar to those in Experiment 1. Rats injected with cocaine prior to high-fat exposure (Experiment 1) showed a dose dependent suppression of food intake, as well as a dose dependent increase in locomotor activity, with DR-prone rats exhibiting an enhanced degree of cocaine-induced hypophagia, as well as cocaine-induced hyperlocomotion as compared to the other groups. In Experiment 2, DIO rats exhibited a suppression of food intake after injection of 10 mg/kg cocaine, as well as an increase in locomotor activity that was significantly greater than noted in the other groups. When the results of Experiment 1 were analyzed as a function of prospective body weight gain (as opposed to placement into distinct groups), reactivity to cocaine decreased as body weight gain increased. In contrast, after high-fat exposure and weight gain, increased body weight gain was associated with an increased magnitude of suppression in food intake after cocaine administration. Similar patterns of differential cocaine sensitivity were observed for cocaine hyperlocomotion in Experiment 2. These studies indicate that although the propensity to develop obesity is associated with a diminished cocaine response, cocaine reactivity is enhanced after the induction of obesity.

Ho, Dao Hong



Biomethylation of inorganic arsenic by the rat and some laboratory animals  

SciTech Connect

This article concerns the distribution (in the liver, kidney and blood) and excretion (in the urine, feces and bile) of arsenic metabolites such as dimethylated, monomethylated and inorganic arsenic in rats following a single oral and intravenous (iv) administration of arsenic acid. This paper also describes studies on the species difference in the arsenic methylation between the rats and some other laboratory animals as mice, hamsters, rabbits and cats.

Odanaka, Y.; Matano, O.; Goto, S.



Automated whole-genome multiple alignment of rat, mouse, and human  

SciTech Connect

We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: <7% of the rat contigs are aligned to multiple places in human and 97% of all alignments with human sequence > 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna



Age-related changes in receptor-mediated phosphoinositide hydrolysis in various regions of rat brain  

SciTech Connect

The effects of age on cholinergic markers and receptor-stimulated phosphoinositide hydrolysis was examined in the frontal cortex and striatum of male Fischer-344 rats. Choline acetyltransferase activity was decreased 27% in the striatum of aged rats compared to young controls. Muscarinic receptor density as measured by ({sup 3}H)-quinuclidinyl benzilate binding showed a similar 26% decrease in the striatum of aged rats. Phosphoinositide hydrolysis was measured by the release of inositol phosphate (IP) from tissue slices prelabeled with ({sup 3}H)myoinositol in response to carbachol, norepinephrine, and quisqualate. In the cortex, stimulated IP release was significantly greater in slices from aged rats compared to young rats for all three agonists. In contrast, stimulated IP release was significantly decreased in striatal slices from aged rats compared to young for all three agonists. These data indicate a differential effect of age on agonist-stimulated phosphoinositide hydrolysis in the cortex and striatum. The decreased responsiveness in the latter area may result from the age-related loss of postsynaptic receptors.

Mundy, W.; Tandon, P.; Tilson, H. (Research Triangle Park, NC (United States)); Ali, S. (National Center for Toxicological Research, Jefferson, AR (United States))



Autoradiographic localization and characterization of angiotensin II binding sites in the spleen of rats and mice  

SciTech Connect

Specific binding sites for angiotensin II (Ang II) were localized in the red pulp of the spleen of rats and mice by quantitative autoradiography using /sup 125/I-Sar1-Ang II as a ligand. In the rat, the binding was saturable and specific, and the rank order for Ang II derivatives as competitors of /sup 125/I-Sar1-Ang II binding correlates well with their affinity for Ang II receptors in other tissues. Kinetic analysis in the rat spleen revealed a single class of binding sites with a KD of 1.11 nM and a Bmax value of 81.6 fmol/mg protein. Ang II binding sites were also localized on isolated rat spleen cells with similar affinity but with much lower Bmax, 9.75 fmol/mg protein. Ang II receptors were not detected in thymus sections from rats or mice, or on isolated rat thymocytes. The binding sites described here might represent a functional Ang II receptor with a role in the regulation of splenic volume and blood flow and in the modulation of the lymphocyte function.

Castren, E.; Kurihara, M.; Saavedra, J.M.



Establishing a rodent (Fischer 344 rat) model of mild cognitive impairment in aging  

E-Print Network (OSTI)

Mild Cognitive Impairment is characterized by age-related decline in a variety of cognitive domains, including reference and working memory and olfactory function. Importantly, declining age-related mnemonic abilities is not inevitable; learning and memory deficits emerge in some people by middle-age while others remain largely cognitively-intact even at advanced chronological ages. The goal of this thesis is to establish a Fischer 344 (F344) rat model with some features of human cognitive aging which can then be utilized to undercover the neurobiological underpinnings of age-related cognitive deficits. Young (6 mo), middle-aged (11 mo), and aged (22 mo) F344 rats were behaviorally characterized in a well-established reference memory version of the Morris water maze task. Indeed, age-related impairments did occur across the lifespan. Moreover, the reference memory protocol used here was sufficiently sensitive to detect a difference in individual abilities among aged F344 rats such that approximately half of the rats performed on par with young while the other half performed outside this range, demonstrating impairment. These data mimic individual differences in declarative memory among aged humans. Subsequently, subsets of rats initially characterized on the reference memory version of the water maze were tested on either a spatial working memory water maze task or an olfactory discrimination task. Despite detecting an age-related delay-dependent decline in spatial working memory, this impairment was not correlated with spatial reference memory. In contrast, a strong and significant relationship was observed among aged rats in the odor discrimination task such that aged rats with the worst spatial reference memory were also the most impaired in their ability to discriminate odors for a food reward. Importantly, this subset of cognitively-impaired rats was not impaired on digging media discrimination problems with identical task demands, nor were they anosmic. These data are among the first to demonstrate a cross-domain cognitive deficit in a rodent model of human aging. Together, the current study both confirms the use of the naturalistic F344 rat model for the study of cognitive deficits within the context of aging and provides the most comprehensive cognitive profile of this rat population to date.

LaSarge, Candi Lynn



General Considerations in the Corrosion of Structures  

Science Conference Proceedings (OSTI)

Table 1   Corrosion rates of carbon steel calibrating specimens at various locations...Vancouver Island BC, Canada Rural marine 13 0.5 Detroit, MI Industrial 14.5 0.57 Fort Amidor Pier, Panama, CZ Marine 14.5 0.57 Morenci, MI Urban 19.5 0.77 Potter County, PA Rural 20 0.8 Waterbury, CT Industrial 22.8 0.89 State College, PA Rural 23 0.9 Montreal, Que. Canada Urban 23 0.9 Durham, NH Rural...


Carbon Steels  

Science Conference Proceedings (OSTI)

Table 1   Corrosion rates of carbon steel at various locations...Vancouver Island, BC, Canada Rural marine 13 0.5 Detroit, MI Industrial 14.5 0.57 Fort Amidor Pier, CZ Marine 14.5 0.57 Morenci, MI Urban 19.5 0.77 Potter County, PA Rural 20 0.8 Waterbury, CT Industrial 22.8 0.89 State College, PA Rural 23 0.9 Montreal, QC, Canada Urban 23 0.9 Durham, NH Rural 28 1.1...


A nineteenth-century Bonpo pilgrim in Western Tibet and Nepal: Episodes from the life of dKar ru grub dbang bsTan 'dzin rin chen  

E-Print Network (OSTI)

in the valley named Khra zhu, in the east of the savage borderland of Hor (in Khams).2 His father was She tsu wer ma of the B?iu ldong dmar clan, and his mother Dang ra g.yu mi of the rGyal rmog sog po clan. His actual birth took place at sunrise... held the title of head proctor (khrims chen), named Rad sla wer ma. The censure he received ostensibly 3 Kha ba che phyir nor yod gro mi thub / gzhon pa rgyab khur thub tshad gro dgos pai / nor...

Ramble, Charles



Tagore au Tibet  

E-Print Network (OSTI)

modernit loccidentale.50 Quoi quil en soit, 47 Tagore 2002b : 99.48 Gru gzings 2001 : 152 (Brtsams chos nang gi mi sna gtso bo Rgya gar chos lugs pa Kar la ni rgyalgces kyi snying stobs shugs drag... cing / rang gshis brtan zhing brling bai na gzhon zhig yin / Slobchen mthar phyin ma thag Rgya gar rgyal gces pai mthun tshogs kyi dbu bzhugs su bsdad pas / mirigs bcings grol gyi ched du dbyin jii mi ser spel mkhan mthar skrod gtong ba khur du...

Robin, Francoise


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Lamps in the Leaping Over  

E-Print Network (OSTI)

dusgser gyi nya mo khor lo bskor bai rgyud chen po: /rang byung lhun grub bras bu n/ /gdod naslhun grub rang char bas/ /byung ba lnga la rag ma pas/ /sku gsung thugs la rten mi cha/ /gsalbyed rig pai sgron ma yi s/ /gter khyim phung po gsal byed... / /longs sku dang nisprul pai sku/ /chu shel sgron mai dpes mtshon kyang/da lta rang la byung ma srid/ /khyung sgoma chag phur mi nus/.14 See TTT 54, p. 504, eigthth chapter of the Byang chub kyi sems rin chen khor lo: /sems nyid rigpai sgron ma yis...

Scheidegger, Daniel



Le Corps d'Arc-en-ciel ('ja' lus) de Shardza Rinpoche illustrant la perfection de la Voie rDzogs chen  

E-Print Network (OSTI)

celui-ci in Bon chos kyi rnam par dbye ba mdor bsdus, p. 89-112. 28 sPrul sku Blo ldan snying po (1360-1385), Mi shig rdo rje (qui est, supposment, lincarnation immdiate de sPrul sku Blo ldan), Sangs rgyas gling pa (1705-1735), et Kun grol grags... . Rappelons cependant que, comme toutes choses, lenseignement du Buddha est considr comme un phno- mne impermanent (bon mi rtag pa) et donc vou la destruction. La prsence ou prnnit de lenseignement est lun des lments clefs entrant dans les...

Achard, Jean-Luc



Contribution aux nombrables de la tradition Bon po : l'Appendive de bsTan 'dzin Rin chen rgyal mtshan a la Sphere de Cristal des Dieux et des Demons de Shar rdza rin po che  

E-Print Network (OSTI)

lettre Ha) ; 2. lessence fminine manifeste sous la forme du a shad etlocalise lextrmit infrieure du canal central ; et 3. le thig le indestructi-ble (mi shig pai thig le) localise dans le cur et exprime en fonction duneEssence vide (ngo bo... familiarisation avec les principes de lapratique, lors de la fusion des essences conscutive au Brasier et lEcoulement (bar dzag)44, il entre alors dans des expriences contemplativesde Dlice (bde ba), de Clart (gsal ba) et de Non-discursivit (mi rtog pa...

Achard, Jean-Luc



Veil of Kashmir  

E-Print Network (OSTI)

is considerably strengthened when we see that Zhangzhungpas words opening verse 28, gang yang grang dang tsha ba dang // bkres dang skon pa mi sems shing, find a parallel (more in meaning and grammatical structure than in wording) in the Sad?prarudita story... (Tsong-kha-pa 2000: 1): gang yang lus dang srog la mi lta bai brtson grus... (Assiduity without any consideration whatsoever for body and life...). In the following verse, number 29, we find a still louder echo of a phrase from Tsongkhapas k?vya...

Martin, Dan



Tuvinian images of demons from Tibet  

E-Print Network (OSTI)

causing deseases see Tucci and Heissig (1970): 193, 195. As such demons the gdon are also briefly characterized by Tseng (2005): 51. For further general remarks on the gdon see Clifford (1984): 148-55. In a text composed by Mi pham rnam rgyal in 1908... . Ri dvags rgyal (Ri dvags rgyal po) deer (ri dvags) (Fig. 3) 3. sKem byed (sKem byed pa) young man (gzhon nu) (Fig. 2) 4. brJed byed (brJed byed pa) fox (wa) (Fig. 4) 5. Khu tshur can raven (bya rog) (Fig. 5) 6. Ma mo human being (mi...

Schwieger, Peter



In vitro dermal absorption of pyrethroid pesticides in human and rat skin  

SciTech Connect

Dermal exposure to pyrethroid pesticides can occur during manufacture and application. This study examined the in vitro dermal absorption of pyrethroids using rat and human skin. Dermatomed skin from adult male Long Evans rats or human cadavers was mounted in flow-through diffusion cells, and radiolabeled bifenthrin, deltamethrin or cis-permethrin was applied in acetone to the skin. Fractions of receptor fluid were collected every 4 h. At 24 h, the skins were washed with soap and water to remove unabsorbed chemical. The skin was then solubilized. Two additional experiments were performed after washing the skin; the first was tape-stripping the skin and the second was the collection of receptor fluid for an additional 24 h. Receptor fluid, skin washes, tape strips and skin were analyzed for radioactivity. For rat skin, the wash removed 53-71% of the dose and 26-43% remained in the skin. The cumulative percentage of the dose at 24 h in the receptor fluid ranged from 1 to 5%. For human skin, the wash removed 71-83% of the dose and 14-25% remained in the skin. The cumulative percentage of the dose at 24 h in the receptor fluid was 1-2%. Tape-stripping removed 50-56% and 79-95% of the dose in rat and human skin, respectively, after the wash. From 24-48 h, 1-3% and about 1% of the dose diffused into the receptor fluid of rat and human skin, respectively. The pyrethroids bifenthrin, deltamethrin and cis-permethrin penetrated rat and human skin following dermal application in vitro. However, a skin wash removed 50% or more of the dose from rat and human skin. Rat skin was more permeable to the pyrethroids than human skin. Of the dose in skin, 50% or more was removed by tape-stripping, suggesting that permeation of pyrethroids into viable tissue could be impeded. The percentage of the dose absorbed into the receptor fluid was considerably less than the dose in rat and human skin. Therefore, consideration of the skin type used and fractions analyzed are important when using in vitro dermal absorption data for risk assessment.

Hughes, Michael F., E-mail: hughes.michaelf@epa.go [Integrated Systems Toxicology Division, National Health and Environmental Effects Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Edwards, Brenda C. [Integrated Systems Toxicology Division, National Health and Environmental Effects Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)



Extracellular calcium sensing in rat aortic vascular smooth muscle cells  

Science Conference Proceedings (OSTI)

Extracellular calcium (Ca2+o) can act as a first messenger in many cell types through a G protein-coupled receptor, calcium-sensing receptor (CaR). It is still debated whether the CaR is expressed in vascular smooth muscle cells (VSMCs). Here, we report the expression of CaR mRNA and protein in rat aortic VSMCs and show that Ca2+o stimulates proliferation of the cells. The effects of Ca2+o were attenuated by pre-treatment with MAPK kinase 1 (MEK1) inhibitor, as well as an allosteric modulator, NPS 2390. Furthermore, stimulation of the VSMCs with Ca2+o-induced phosphorylation of ERK1/2, but surprisingly did not cause inositol phosphate accumulation. We were not able to conclusively state that the CaR mediates Ca2+o-induced cell proliferation. Rather, an additional calcium-sensing mechanism may exist. Our findings may be of importance with regard to atherosclerosis, an inflammatory disease characterized by abnormal proliferation of VSMCs and high local levels of calcium.

Smajilovic, Sanela [Laboratory of Molecular Cardiology, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet (Denmark); Danish National Research Foundation Centre for Cardiac Arrhythmia (DARC), Copenhagen (Denmark); Hansen, Jakob Lerche [Laboratory of Molecular and Cellular Cardiology, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet (Denmark); Danish National Research Foundation Centre for Cardiac Arrhythmia (DARC), Copenhagen (Denmark); Christoffersen, Tue E.H. [Laboratory of Molecular Cardiology, Department of Cardiology, Copenhagen University Hospital, Rigshospitalet (Denmark); Danish National Research Foundation Centre for Cardiac Arrhythmia (DARC), Copenhagen (Denmark)] (and others)



Automated whole-genome multiple alignment of rat, mouse, and human  

Science Conference Proceedings (OSTI)

We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna



Endogenous N-nitroso compounds, and their precursors, present in bacon, do not initiate or promote aberrant crypt foci in the colon of rats  

E-Print Network (OSTI)

groups of 10 rats, whose diets contained 7, 14 or 28 fat. Tested meats were bacon, pork, chicken and beef by the number of aberrant crypt foci (ACF) in the colon of rats, 45 days after the start of a high-fat bacon similar. Rats fed a diet based on beef, pork or chicken meat had less fecal NOC than controls (most p

Paris-Sud XI, Université de


Modulation of Intestinal Micrornas by a Chemoprotective Diet  

E-Print Network (OSTI)

We have hypothesized that dietary modulation of intestinal miRNA expression may contribute to the chemoprotective effects of nutritional bioactives (fish oil and pectin). Using a rat colon carcinogen model, we determined miRNAs-let-7d, miR-15b, miR-107, miR-191 and miR-324-5p were modulated by fish oil + pectin. We also demonstrated that BACE1 and PTEN are targets of miR-107 and miR-21, respectively. To further elucidate the biological effects of diet and carcinogen on miRNAs, we integrated global miRNAs, total and polysomal gene expression datasets obtained from the above mentioned study and used four computational approaches. We demonstrated that polysomal profiling is tightly related to microRNA changes when compared with total mRNA profiling. In addition, diet and carcinogen exposure modulated a number of microRNAs and complementary gene expression analyses showed that oncogenic PTK2B, PDE4B, and TCF4 were suppressed by the chemoprotective diet at both the mRNA and protein levels. To determine the function of select diet and colon carcinogen modulated miRNAs and to validate their targets, we carried out a series of loss and gain of function experiments along with luciferase reporter assays. We verified that PDE4B and TCF4 are direct targets of miR-26b and miR-203, respectively. PTK2B was determined to be an indirect target of miR-19b. In addition, microRNA physiological function was assessed by examining effects on apoptosis and cell proliferation. To better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we investigated the chemoprotective effects of dietary agents on miRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creERT2 knock in mice injected with AOM. We demonstrated that based on relative expression of miR-125a-5p, miR-190b and miR-191 in stem cells vs. daughter cells and differentiated cells, these miRNAs may be stem cell specific miRNAs. We also identified miR-21 to be significantly reduced in stem cells compared to differentiated cells and selectively modulated by these dietary agents in stem cells. In summary, our results indicate for the first time that fish oil plus pectin protect against colon tumorigenesis in part by modulating a subset of miRNAs and their target genes (mRNAs) implicated in the regulation of the colon stem cell niche and tumor development.

Shah, Manasvi 1984-



Genome sequence of the brown Norway rat yields insights into mammalian evolution  

SciTech Connect

The laboratory rat (Rattus norvegicus) is an indispensable tool in experimental medicine and drug development, having made inestimable contributions to human health. We report here the genome sequence of the Brown Norway (BN) rat strain. The sequence represents a high-quality 'draft' covering over 90 percent of the genome. The BN rat sequence is the third complete mammalian genome to be deciphered, and three-way comparisons with the human and mouse genomes resolve details of mammalian evolution. This first comprehensive analysis includes genes and proteins and their relation to human disease, repeated sequences, comparative genome-wide studies of mammalian orthologous chromosomal regions and rearrangement breakpoints, reconstruction of ancestral karyotypes and the events leading to existing species, rates of variation, and lineage-specific and lineage-independent evolutionary events such as expansion of gene families, orthology relations and protein evolution.

Gibbs, Richard A.; Weinstock, George M.; Metzker, Michael L.; Muzny, Donna M.; Sodergren, Erica J.; Scherer, Steven; Scott, Graham; Steffen, David; Worley, Kim C.; Burch, Paula E.; Okwuonu, Geoffrey; Hines, Sandra; Lewis, Lora; DeRamo, Christine; Delgado, Oliver; Dugan-Rocha, Shannon; Miner, George; Morgan, Margaret; Hawes, Alicia; Gill, Rachel; Holt, Robert A.; Adams, Mark D.; Amanatides, Peter G.; Baden-Tillson, Holly; Barnstead, Mary; Chin, Soo; Evans, Cheryl A.; Ferriera, Steven; Fosler, Carl; Glodek, Anna; Gu, Zhiping; Jennings, Don; Kraft, Cheryl L.; Nguyen, Trixie; Pfannkoch, Cynthia M.; Sitter, Cynthia; Sutton, Granger G.; Venter, J. Craig; Woodage, Trevor; Smith, Douglas; Lee, Hong-Maei; Gustafson, Erik; Cahill, Patrick; Kana, Arnold; Doucette-Stamm, Lynn; Weinstock, Keith; Fechtel, Kim; Weiss, Robert B.; Dunn, Diane M.; Green, Eric D.; Blakesley, Robert W.; Bouffard, Gerard G.; de Jong, Pieter J.; Osoegawa, Kazutoyo; Zhu, Baoli; Marra, Marco; Schein, Jacqueline; Bosdet, Ian; Fjell, Chris; Jones, Steven; Krzywinski, Martin; Mathewson, Carrie; Siddiqui, Asim; Wye, Natasja; McPherson, John; Zhao, Shaying; Fraser, Claire M.; Shetty, Jyoti; Shatsman, Sofiya; Geer, Keita; Chen, Yixin; Abramzon, Sofyia; Nierman, William C.; Havlak, Paul H.; Chen, Rui; Durbin, K. James; Egan, Amy; Ren, Yanru; Song, Xing-Zhi; Li, Bingshan; Liu, Yue; Qin, Xiang; Cawley, Simon; Cooney, A.J.; D'Souza, Lisa M.; Martin, Kirt; Wu, Jia Qian; Gonzalez-Garay, Manuel L.; Jackson, Andrew R.; Kalafus, Kenneth J.; McLeod, Michael P.; Milosavljevic, Aleksandar; Virk, Davinder; Volkov, Andrei; Wheeler, David A.; Zhang, Zhengdong; Bailey, Jeffrey A.; Eichler, Evan E.; Tuzun, Eray; Birney, Ewan; Mongin, Emmanuel; Ureta-Vidal, Abel; Woodwark, Cara; Zdobnov, Evgeny; Bork, Peer; Suyama, Mikita; Torrents, David; Alexandersson, Marina; Trask, Barbara J.; Young, Janet M.; et al.



Environmental Lighting Has a Selective Influence on Ethanol Intake in Rats  

E-Print Network (OSTI)

rats. PHYSIOL BEHAV 66(2) 323328, 1999.The effect of lighting condition on levels of absolute ethanol intake were systematically examined in the present study. Wistar rats were exposed to one of three lighting conditions: constant light, constant dark, and a standard 12?12 light/dark cycle. The animals were acclimatized to lighting conditions for 2 weeks prior to ethanol (EtOH) acquisition with water and food available ad lib. EtOH was then presented in increasing concentrations from 2 % (v/v; 95 % with tap water) to 10 % on alternate days in free choice with water. Immediately following the acquisition phase, a maintenance period was initiated that began with everyday presentations of 10 % EtOH solution in free choice with water. After 10 days, lighting conditions for the constant light and dark groups were switched to normal lighting (12/12 light/ dark). EtOH and water intake were recorded for an additional 10 days. Rats exposed to constant light during EtOH acquisition and maintenance consumed less EtOH during the maintenance period than rats exposed to normal lighting conditions. When lighting conditions were switched to a normal cycle, water consumption increased significantly but EtOH intake did not change. Rats living in constant dark during EtOH acquisition and maintenance consumed less EtOH during the acquisition period when compared with rats living in normal lighting conditions. Unlike animals trained under constant lighting, switching to normal lighting conditions had no effect on EtOH or water intake. There were no differences in water consumption levels among the groups during acquisition and maintenance, suggesting a specificity of the effects of lighting condition on EtOH intake. The present study, therefore, has attempted to show that an environmental variable such as lighting may exert

F. L. W. Goodwin; S. Amir; Z. Amit




SciTech Connect

Association of a distinctive taste stimulus with exposure to x rays results in a conditioned aversion toward the stimulus in rats, mice, and cats. This is manifested by a progressive reduction in the amount of flavored fluid consumed during a series of x-ray exposures and subsequently by the acquired value of the flavored fluid to act as a con- ditioned stiraulus for aversive behavior in the absence of radiation. Saccharin-flavored water was effective as a conditioned stimulus for rats and mice, and chocolateflavored milk was effective for cats. Some implications of these observations for the study of behavior are discussed. (auth)

Kimeldorf, D.J.; Garcia, J.; Rubadeau, D.O.



Dietary quercetin exacerbates the development of estrogen-induced breast tumors in female ACI rats  

Science Conference Proceedings (OSTI)

Phytoestrogens are plant compounds that structurally mimic the endogenous estrogen 17{beta}-estradiol (E{sub 2}). Despite intense investigation, the net effect of phytoestrogen exposure on the breast remains unclear. The objective of the current study was to examine the effects of quercetin on E{sub 2}-induced breast cancer in vivo. Female ACI rats were given quercetin (2.5 g/kg food) for 8 months. Animals were monitored weekly for palpable tumors, and at the end of the experiment, rats were euthanized, breast tumor and different tissues excised so that they could be examined for histopathologic changes, estrogen metabolic activity and oxidant stress. Quercetin alone did not induce mammary tumors in female ACI rats. However, in rats implanted with E{sub 2} pellets, co-exposure to quercetin did not protect rats from E{sub 2}-induced breast tumor development with 100% of the animals developing breast tumors within 8 months of treatment. No changes in serum quercetin levels were observed in quercetin and quercetin + E{sub 2}-treated groups at the end of the experiment. Tumor latency was significantly decreased among rats from the quercetin + E{sub 2} group relative to those in the E{sub 2} group. Catechol-O-methyltransferase (COMT) activity was significantly downregulated in quercetin-exposed mammary tissue. Analysis of 8-isoprostane F{sub 2{alpha}} (8-iso-PGF{sub 2{alpha}}) levels as a marker of oxidant stress showed that quercetin did not decrease E{sub 2}-induced oxidant stress. These results indicate that quercetin (2.5 g/kg food) does not confer protection against breast cancer, does not inhibit E{sub 2}-induced oxidant stress and may exacerbate breast carcinogenesis in E{sub 2}-treated ACI rats. Inhibition of COMT activity by quercetin may expose breast cells chronically to E{sub 2} and catechol estrogens. This would permit longer exposure times to the carcinogenic metabolites of E{sub 2} and chronic exposure to oxidant stress as a result of metabolic redox cycling to estrogen metabolites, and thus quercetin may exacerbate E{sub 2}-induced breast tumors in female ACI rats.

Singh, Bhupendra [Division of Pharmacology and Toxicology, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States); Mense, Sarah M. [Department of Environmental Health Sciences, Columbia University, New York, NY 10032 (United States); Bhat, Nimee K. [Division of Pharmacology and Toxicology, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States); Putty, Sandeep; Guthiel, William A. [Division of Pharmaceutical Sciences, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States); Remotti, Fabrizio [Department of Pathology, Columbia University, New York, NY 10032 (United States); Bhat, Hari K., E-mail: bhath@umkc.ed [Division of Pharmacology and Toxicology, School of Pharmacy, University of Missouri-Kansas City, Kansas City, MO 64108 (United States)



Mutations of the Apc gene in experimental colorectal carcinogenesis induced by azoxymethane in F344 rats  

E-Print Network (OSTI)

Summary We investigated in the rat the role of the Apc gene, which is mutated in familial adenomatous polyposis and sporadic colon cancer in the process leading from normal colonic mucosa to aberrant crypt foci (ACF) and finally to adenomas and adenocarcinomas. We analysed mutations in exon 15 of the rat Apc gene using in vitro synthesized protein assay in 66 ACF and in 28 colon tumours induced by azoxymethane. No Apc mutations were found in ACF, whereas five mutations were found in the tumours. The data suggest that mutations of the Apc gene are associated with the transition from ACF to adenoma and adenocarcinoma and not from normal mucosa to ACF.

G Caderni; M Bazzicalupo; C Briani; A Giannini; M Fazi; P Dolaral



Metabolism and disposition of 1-bromopropane in rats and mice following inhalation or intravenous administration  

SciTech Connect

Workplace exposure to 1-bromopropane (1-BrP) can potentially occur during its use in spray adhesives, fats, waxes, and resins. 1-BrP may be used to replace ozone depleting solvents, resulting in an increase in its annual production in the US, which currently exceeds 1 million pounds. The potential for human exposure to 1-BrP and the reports of adverse effects associated with potential occupational exposure to high levels of 1-BrP have increased the need for the development of biomarkers of exposure and an improved understanding of 1-BrP metabolism and disposition. In this study, the factors influencing the disposition and biotransformation of 1-BrP were examined in male F344 rats and B6C3F1 mice following inhalation exposure (800 ppm) or intravenous administration (5, 20, and 100 mg/kg). [1,2,3-{sup 13}C]1-BrP and [1-{sup 14}C]1-BrP were administered to enable characterization of urinary metabolites using NMR spectroscopy, LC-MS/MS, and HPLC coupled radiochromatography. Exhaled breath volatile organic chemicals (VOC), exhaled CO{sub 2}, urine, feces, and tissues were collected for up to 48 h post-administration for determination of radioactivity distribution. Rats and mice exhaled a majority of the administered dose as either VOC (40-72%) or {sup 14}CO{sub 2} (10-30%). For rats, but not mice, the percentage of the dose exhaled as VOC increased between the mid ({approx} 50%) and high ({approx} 71%) dose groups; while the percentage of the dose exhaled as {sup 14}CO{sub 2} decreased (19 to 10%). The molar ratio of exhaled {sup 14}CO{sub 2} to total released bromide, which decreased as dose increased, demonstrated that the proportion of 1-BrP metabolized via oxidation relative to pathways dependent on glutathione conjugation is inversely proportional to dose in the rat. [{sup 14}C]1-BrP equivalents were recovered in urine (13-17%, rats; 14-23% mice), feces (< 2%), or retained in the tissues and carcass (< 6%) of rats and mice administered i.v. 5 to 100 mg/kg [{sup 14}C]1-BrP. Metabolites characterized in urine of rats and mice include N-acetyl-S-propylcysteine, N-acetyl-3-(propylsulfinyl)alanine, N-acetyl-S-(2-hydroxypropyl)cysteine, 1-bromo-2-hydroxypropane-O-glucuronide, N-acetyl-S-(2-oxopropyl)cysteine, and N-acetyl-3-[(2-oxopropyl)sulfinyl]alanine. These metabolites may be formed following oxidation of 1-bromopropane to 1-bromo-2-propanol and bromoacetone and following subsequent glutathione conjugation with either of these compounds. Rats pretreated with 1-aminobenzotriazole (ABT), a potent inhibitor of P450 excreted less in urine ({down_arrow}30%), exhaled as {sup 14}CO2 ({down_arrow}80%), or retained in liver ({down_arrow}90%), with a concomitant increase in radioactivity expired as VOC ({up_arrow}52%). Following ABT pretreatment, rat urinary metabolites were reduced in number from 10 to 1, N-acetyl-S-propylcysteine, which accounted for > 90% of the total urinary radioactivity in ABT pretreated rats. Together, these data demonstrate a role for cytochrome P450 and glutathione in the dose-dependent metabolism and disposition of 1-BrP in the rat.

Garner, C.E. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States)]. E-mail: cegarner@rti.org; Sumner, S.C.J. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Davis, J.G. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Burgess, J.P. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Yueh, Y. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Demeter, J. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Zhan, Q. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Valentine, J. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Jeffcoat, A.R. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States); Burka, L.T. [National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Mathews, J.M. [Department of Drug Metabolism and Disposition, RTI International, Research Triangle Park, NC 27709 (United States)



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks



SciTech Connect

The reaction of the thyroid gland of white male rats to x irradiation (800 r) depends upon the age and individual reactivity of the animal. In young rats the irradiation provokes marked changes in the thyroid gland, which in some instances are expressed by an insignificant rise of the activity (in the first hours and days after irradiation) followed by its decrease (from the 5th to 30th day). In other cases a drop of the activity is seen already in the first hours. In all rats of this group the thyroid gland reverts tu normal towards the second month. In adult rats (5- 7-month-old) the above dose of irradiation provokes less pronounced changes in the structure of the gland, as compared to young rats. Towards the l8th day after irradiation the structure of the thyroid gland normalizes. Irradiation (800 r) of old rats does not cause noticeable changes in the histological picture of the thyroid gland. In young rats with a severe course of radiation sickness, sacrificed in the agonal state on the 9th-l3th day following irradiation, there is a sharp drop of the thyroid gland activity. (auth)

Loskutova, E.A.



Hyperamplification of centrosomes and asynchronous nuclear division induced by N-nitrosodimethylamine in rats  

Science Conference Proceedings (OSTI)

Mechanisms of hepatocyte multinucleation was investigated in rats exposed to N-nitrosodimethylamine (NDMA). By using immunohistochemical reaction to ?-tubulin it was established that the number of cells containing three and more centrosomes increased ... Keywords: asynchronous DNA synthesis, centrosomes, cytochrome P4502E1, multinucleated hepatocytes, multipolar mitosis, oxidative stress

Bauyrzhan Umbayev; Tamara Shalakhmetova; William Au



Pulmonary toxicity, distribution, and clearance of intratracheally instilled silicon nanowires in rats  

Science Conference Proceedings (OSTI)

Silicon nanowires (SiNWs) are being manufactured for use as sensors and transistors for circuit applications. The goal was to assess pulmonary toxicity and fate of Si NWusing an in vivo experimental model. Male Sprague-Dawley rats were intratracheally ...

Jenny R. Roberts; Robert R. Mercer; Rebecca S. Chapman; Guy M. Cohen; Sarunya Bangsaruntip; Diane Schwegler-Berry; James F. Scabilloni; Vincent Castranova; James M. Antonini; Stephen S. Leonard



Increased angiotensin II receptors in brain nuclei of DOCA-salt hypertensive rats  

SciTech Connect

We analyzed angiotensin II (ANG II) receptors by in vitro autoradiography in selective brain nuclei of control, salt-treated (1% NaCl in drinking water), deoxycorticosterone acetate (DOCA)-treated (DOCA pivalate, 25 mg/kg sc weekly), and DOCA-salt-treated (DOCA + salt treatments) uninephrectomized male Wistar-Kyoto rats. After 4 wk of treatment, only the DOCA-salt group developed hypertension. ANG II binding increased in median preoptic nucleus and subfornical organ of salt- and DOCA-treated rats. DOCA-treated rats also showed increased ANG II binding in paraventricular nucleus. DOCA-salt-treated rats showed higher ANG II binding in nucleus of the solitary tract and area postrema, as well as in the areas mentioned before. Although salt and/or DOCA treatments alone increased ANG II receptors in some brain nuclei, after combined DOCA-salt treatment there was significantly higher ANG II binding in all areas, except the median preoptic nucleus. These results suggest that increased ANG II receptors in selected brain areas may play a role in the pathophysiology of mineralocorticoid-salt experimental hypertension.

Gutkind, J.S.; Kurihara, M.; Saavedra, J.M.



Evaluation of deltamethrin kinetics and dosimetry in the maturing rat using a PBPK model  

Science Conference Proceedings (OSTI)

Immature rats are more susceptible than adults to the acute neurotoxicity of pyrethroid insecticides like deltamethrin (DLM). A companion kinetics study (Kim et al., in press) revealed that blood and brain levels of the neuroactive parent compound were inversely related to age in rats 10, 21, 40 and 90 days old. The objective of the current study was to modify a physiologically based pharmacokinetic (PBPK) model of DLM disposition in the adult male Sprague-Dawley rat (Mirfazaelian et al., 2006), so blood and target organ dosimetry could be accurately predicted during maturation. Age-specific organ weights and age-dependent changes in the oxidative and hydrolytic clearance of DLM were modeled with a generalized Michaelis-Menten model for growth and the summary equations incorporated into the PBPK model. The model's simulations compared favorably with empirical DLM time-courses in plasma, blood, brain and fat for the four age-groups evaluated (10, 21, 40 and 90 days old). PND 10 pups' area under the 24-h brain concentration time curve (AUC{sub 0-24h}) was 3.8-fold higher than that of the PND 90 adults. Our maturing rat PBPK model allows for updating with age- and chemical-dependent parameters, so pyrethroid dosimetry can be forecast in young and aged individuals. Hence, this model provides a methodology for risk assessors to consider age-specific adjustments to oral Reference Doses on the basis of PK differences.

Tornero-Velez, Rogelio, E-mail: tornero-velez.rogelio@epa.go [National Exposure Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States); Mirfazaelian, Ahmad, E-mail: amirfazaelian@gmail.co [Department of Chemical Injuries, Baghiatallah University of Medical Sciences, Tehran (Iran, Islamic Republic of); Kim, Kyu-Bong, E-mail: kimkb@rx.uga.ed [Department of Pharmaceutical Engineering, College of Engineering, Inje University, Obang-dong, Gimhae, Gyungnam 621-749 (Korea, Republic of); Anand, Sathanandam S., E-mail: satheesh.s.anand@usa.dupont.co [Dupont Haskell Global Centers for Health and Environmental Sciences, 1090 Elkton Road, Newark, DE 19714 (United States); Kim, Hyo J., E-mail: hyokimm@yahoo.co.k [Department of Pharmaceutical and Biomedical Sciences, College of Pharmacy, University of Georgia, Athens, GA 30602-2352 (United States); Haines, Wendy T., E-mail: toxicology@unc.ed [Curriculum in Toxicology, University of North Carolina, Chapel Hill, CB 7270, NC 27599-7270 (United States); Bruckner, James V., E-mail: bruckner@rx.uga.ed [Department of Pharmaceutical and Biomedical Sciences, College of Pharmacy, University of Georgia, Athens, GA 30602-2352 (United States); Fisher, Jeffrey W., E-mail: jwfisher@uga.ed [Department of Environmental Health, College of Public Health, University of Georgia, Athens, GA 30602 (United States)



A Glucose BioFuel Cell Implanted in Rats Philippe Cinquin1  

E-Print Network (OSTI)

A Glucose BioFuel Cell Implanted in Rats Philippe Cinquin1 *, Chantal Gondran2 , Fabien Giroud2 powerful ones, Glucose BioFuel Cells (GBFCs), are based on enzymes electrically wired by redox mediators applications. Citation: Cinquin P, Gondran C, Giroud F, Mazabrard S, Pellissier A, et al. (2010) A Glucose BioFuel

Paris-Sud XI, Université de


The effect of methylsulfonylmethane on the experimental colitis in the rat  

Science Conference Proceedings (OSTI)

Methylsulfonylmethane (MSM), naturally occurring in green plants, fruits and vegetables, has been shown to exert anti-inflammatory and antioxidant effects. MSM is an organosulfur compound and a normal oxidative metabolite of dimethyl sulfoxide. This study was carried out to investigate the effect of MSM in a rat model of experimental colitis. Colitis was induced by intracolonic instillation of 1 ml of 5% of acetic acid. Rats were treated with MSM (400 mg/kg/day, orally) for 4 days. Animals were euthanized and distal colon evaluated histologically and biochemically. Tissue samples were used to measurement of malondialdehyde (MDA), myeloperoxidase (MPO), catalase (CAT), glutathione (GSH) and proinflammatory cytokine (TNF-{alpha} and IL-1{beta}) levels. Results showed that MSM decreased macroscopic and microscopic colonic damage scores caused by administration of acetic acid. MSM treatment also significantly reduced colonic levels of MDA, MPO and IL-1{beta}, while increased the levels of GSH and CAT compared with acetic acid-induced colitis group. It seems that MSM as a natural product may have a protective effect in an experimental ulcerative colitis. - Research Highlights: > Methylsulfonylmethane occurs naturally in some green plants, fruits and vegetables. > Methylsulfonylmethane (MSM) has anti-inflammatory and antioxidant effects. > We evaluated the effects of MSM in a rat model of experimental ulcerative colitis. > MSM has protective effect against acetic acid-induced colitis in rat.

Amirshahrokhi, K., E-mail: k.amirshahrokhi@arums.ac.ir [Department of Pharmacology, School of Medicine, Ardabil University of Medical Sciences, P.O. Box 56197, Ardabil (Iran, Islamic Republic of); Bohlooli, S. [Department of Pharmacology, School of Medicine, Ardabil University of Medical Sciences, P.O. Box 56197, Ardabil (Iran, Islamic Republic of); Chinifroush, M.M. [Department of Pathology, School of Medicine, Ardabil University of Medical Sciences, Ardabil (Iran, Islamic Republic of)



Inhalation developmental toxicology studies: Teratology study of acetone in mice and rats: Final report  

SciTech Connect

Acetone, an aliphatic ketone, is a ubiquitous industrial solvent and chemical intermediate; consequently, the opportunity for human exposure is high. The potential for acetone to cause developmental toxicity was assessed in Sprague-Dawley rats exposed to 0, 440, 2200, or 11000 ppm, and in Swiss (CD-1) mice exposed to 0, 440, 2200, and 6600 ppm acetone vapors, 6 h/day, 7 days/week. Each of the four treatment groups consisted of 10 virgin females (for comparison), and approx.32 positively mated rats or mice. Positively mated mice were exposed on days 6-17 of gestation (dg), and rats on 6-19 dg. The day of plug or sperm detection was designated as 0 dg. Body weights were obtained throughout the study period, and uterine and fetal body weights were obtained at sacrifice (rats, 20 dg; mice, 18 dg). Implants were enumerated and their status recorded. Live fetuses were sexed and examined for gross, visceral, skeletal, and soft-tissue craniofacial defects. 46 refs., 6 figs., 27 tabs.

Mast, T.J.; Evanoff, J.J.; Rommereim, R.L.; Stoney, K.H.; Weigel, R.J.; Westerberg, R.B.



Le'u gsum pa _'phags pa shA ri'i bu dang 'phags pa mo'u 'gal gyi bu gnyis khyim nas khyim med par rab tu byung ba'i lo rgyus  

E-Print Network (OSTI)

{ ~ f:! ~ !":1 ~ LI :- [j' , Ll ~ . ~ y- . ~ , ~ ~ :-.... ~ ci19 Ll "to t{ ~ !":1 [( ~ ~ t6' ~ ~ ~ !O f:! ET y- LI 4! to I.ltf fit> iJ ~~ !O LI , Ll ~ c!fJI ~ Ier- I~ Ll fi1 6~ t6' @ ~? rn . Ll y- ~ ~ ~ @ ~ ~ !f6"- i... Ll ~ !O IF" u:-fT- P 17""- v-- W v-- LI iJ c~ ~ LI I~ t{ [j' 1!":1 ' iJ 4! ~ /:Zl ~ 1>:'"" .... ~ ~ "-I 6fT ~ i7~' LI t{ fl W ffii?'~ ~ t{ LI !":1 W {~ t~ ~ ,W- fT iLl 6f:! lr I :-::= (!Ii' rn t'}f ~ ,:.". rn r.::l LI . II:[) ~ Ll...

Lepcha, Samten Gyatso



Prenatal PCBs disrupt early neuroendocrine development of the rat hypothalamus  

SciTech Connect

Neonatal exposure to endocrine disrupting chemicals (EDCs) such as polychlorinated biphenyls (PCBs) can interfere with hormone-sensitive developmental processes, including brain sexual differentiation. We hypothesized that disruption of these processes by gestational PCB exposure would be detectable as early as the day after birth (postnatal day (P) 1) through alterations in hypothalamic gene and protein expression. Pregnant Sprague-Dawley rats were injected twice, once each on gestational days 16 and 18, with one of the following: DMSO vehicle; the industrial PCB mixture Aroclor 1221 (A1221); a reconstituted mixture of the three most prevalent congeners found in humans, PCB138, PCB153, and PCB180; or estradiol benzoate (EB). On P1, litter composition, anogenital distance (AGD), and body weight were assessed. Pups were euthanized for immunohistochemistry of estrogen receptor {alpha} (ER{alpha}) or TUNEL labeling of apoptotic cells or quantitative PCR of 48 selected genes in the preoptic area (POA). We found that treatment with EB or A1221 had a sex-specific effect on developmental apoptosis in the neonatal anteroventral periventricular nucleus (AVPV), a sexually dimorphic hypothalamic region involved in the regulation of reproductive neuroendocrine function. In this region, exposed females had increased numbers of apoptotic nuclei, whereas there was no effect of treatment in males. For ER{alpha}, EB treatment increased immunoreactive cell numbers and density in the medial preoptic nucleus (MPN) of both males and females, while A1221 and the PCB mixture had no effect. PCR analysis of gene expression in the POA identified nine genes that were significantly altered by prenatal EDC exposure, in a manner that varied by sex and treatment. These genes included brain-derived neurotrophic factor, GABA{sub B} receptors-1 and -2, IGF-1, kisspeptin receptor, NMDA receptor subunits NR2b and NR2c, prodynorphin, and TGF{alpha}. Collectively, these results suggest that the disrupted sexual differentiation of the POA by prenatal EDC exposures is already evident as early as the day after birth, effects that may change the trajectory of postnatal development and compromise adult reproductive function.

Dickerson, Sarah M.; Cunningham, Stephanie L. [Center for Molecular and Cellular Toxicology, Division of Pharmacology and Toxicology, University of Texas at Austin, Austin, TX 78712 (United States); Gore, Andrea C., E-mail: andrea.gore@mail.utexas.edu [Center for Molecular and Cellular Toxicology, Division of Pharmacology and Toxicology, University of Texas at Austin, Austin, TX 78712 (United States); Institute for Neuroscience, University of Texas at Austin, Austin, TX 78712 (United States); Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712 (United States)



miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Studies on Pentoxifylline and Tocopherol Combination for Radiation-Induced Heart Disease in Rats  

SciTech Connect

Purpose: To investigate whether the application of pentoxifylline (PTX) and tocopherol l (Vit. E) could modify the development of radiation-induced heart disease and downregulate the expression of transforming growth factor (TGF)-{beta}1mRNA in rats. Methods and Materials: A total of 120 Sprague-Dawley rats were separated into four groups: control group, irradiated group, experimental group 1, and experiment group 2. Supplementation was started 3 days before irradiation; in experimental group 1, injection of PTX (15 mg/kg/d) and Vit. E (5.5 mg/kg/d) continued till the 12th week postirradiation, whereas in experimental group 2 it was continued until the 24th week postirradiation. All rats were administrated a single dose of 20 Gy irradiation to the heart except the control group. Histopathologic evaluation was performed at various time points (Days 1, 2, 4, 8, and 12 and 24th week) up to 24 weeks after irradiation. Changes of levels of TGF-{beta}1 mRNA expression were also investigated at the same time points using competitive polymerase chain reaction. Results: Compared with the irradiated group, levels of TGF-{beta}1 mRNA of the rat hearts were relatively low in the two experimental groups on the 12th week postirradiation. In experimental group 1, there was a rebound expression of TGF-{beta}1 mRNA on the 24th week postirradiation, whereas that of the experimental group 2 remained low (p < 0.05). The proportions of collagen fibers of the two experimental groups were lower than that of irradiated group (p < 0.05). A rebound could be observed in the experimental group 1. Conclusion: PTX and Vit. E downregulated the expression of TGF-{beta}1 mRNA. The irradiated rat hearts showed a marked pathologic response to the drugs. The withdrawal of drugs in the 12th week postirradiation could cause rebound effects of the development of fibrosis.

Liu Hui [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Radiotherapy, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Xiong Mai [Department of Cardiac Surgery, the First Affiliated Hospital, Sun Yat-sen University, Guangzhou, Guangdong (China); Xia Yunfei; Cui Nianji; Lu Rubiao [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Radiotherapy, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Deng Ling [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Pathology, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Lin Yuehao [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Clinical Laboratory, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Rong Tiehua [State Key Laboratory of Oncology in South China, Guangzhou, Guangdong (China); Department of Thoracic Surgery, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China)], E-mail: esophagus2003@yahoo.com.cn



Effect of synthetic ANP on renal and loop of Henle functions in the young rat  

SciTech Connect

The present studies were undertaken to determine, by recollection micropuncture, the effect of a synthetic atrial natriuretic peptide (ANP) on the absolute and fractional deliveries of water and sodium to the juxtamedullary end-descending limb. Two groups of young female Munich-Wistar rats were studied: 1) control received the vehicle only; and 2) ANP received a prime followed by the constant infusion of a synthetic rat atrial peptide (28 amino acids). With the infusion of ANP, clearance of p-( UC)aminohippurate (( UC(PAH) and glomerular filtration rate (GFR) fell significantly. Despite this fall in GFR and renal plasma flow, ANP produced a 2-fold increase in urine volume and a 10-fold increase in sodium excretion. Absolute and fractional sodium deliveries to the end-descending limb increased by approx.30% in the ANP group, whereas mean juxtamedullary single-nephron glomerular filtration rate (SNGFR) remained stable. In three additional rats prepared for micropuncture of the superficial end-accessible proximal tubule, ANP reduced cortical SNGFR by approx.15%. By contrast, GFR did not decline in response to ANP in larger rats, when treated identically. The authors conclude that 1) in young rats ANP can produce a natriuresis in the absence of a rise in GFR; 2) the fall in GFR observed following ANP is due presumably to the immaturity of the animals used in these studies; and 3) ANP produces a rise in absolute and fractional water and sodium deliveries to the end-descending limb that cannot be attributed to a change in SNGFR. The relatively small rise in fractional sodium delivery to the end-descending limb, most probably due to inhibition of sodium and water reabsorption in the juxtamedullary proximal tubule and/or thin descending limb, accounts for only a smallproportion of sodium excretion in the final urine.

Roy, D.R.


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Different Sets of Channels in the Instructions Series of Rdzogs chen  

E-Print Network (OSTI)

snang srid snod bcud 'khor 'das thams cad rig pa'i rang snang du shar ba la /thabs ma 'gags par snang ba yab la /shes rab mi 'dzin par stong pa yum dang gnyis med du sbyar bas /gang snang rig pa'i grogs su rang shar te /: Thus, method, i... : /khyad par ka ti shel sbugs can //dar kar snal ma phra la 'khril //'di bzi'i nang na 'od dang zer //thig le thig phran ye shes rlung //rgyu bas ye shes snang ba ston //'od rtsa'i rang Revue dEtudes Tibtaines 32 where they serve as usual as carriers...

Scheidegger, Daniel




SciTech Connect

A ration containing 35% beef irradiated with 2.79 megarad fed to 12 male Sprague-Dawley rats caused the death of 9 rats because of hemorrhage. The mean reciprocal of the prothrombin time was 0.068 plus or minus 0.018 sec/sup -/. When 3 male cats and 3 male dogs were fed a ration containing irradiated bsef for 40 weeks, all gained weight and the prothrombin time of the blood remained normal. The amount of vitamin K in the ration was calculated to be 6 mu g/100 g of ration solids, which was adequate to prevent prolonged prothrombin times of the blood of cats and dogs, although it was inadequate for rats. Irradintion of beef with 2.8 megarad was previously shown to cause a 50--85% loss in vitamin K content. Rats fed a ration containing nonirradiated beef survived and there was no prolonged prothrombin time of the blood. (H.H.D.)

Reber, E.F.; Malhotra, Om.P.



Decreased angiotensin II binding affinity and binding capacity in the anterior pituitary gland of adult spontaneously hypertensive rats  

SciTech Connect

Angiotensin II (ANG) binding sites were quantified in single pituitary glands from 4-week-old and 14-week-old male spontaneously hypertensive rats (SHR) and age-matched male normotensive Wistar-Kyoto (WKY) control rats after incubation with /sup 125/I-(Sar/sup 1/)-ANG, autoradiography with computerized densitometry, and comparison to /sup 125/I-standards. The maximum binding capacity (B/sub max/) decreased while the dissociation constant (K/sub d/) for ANG increased in 14-week-old SHR when compared to age-matched WKY control rats. Conversely, no difference between rat strains was found in 4-week-old animals. Our results suggest that pituitary ANG binding sites may play a role in the pathophysiology of established genetic hypertension.

Gutkind, J.S.; Castren, E.; Saavedra, J.M.



Critical period window for spectral tuning defined in the primary auditory cortex (A1) in the rat  

E-Print Network (OSTI)

Repair Critical Period Window for Spectral Tuning Defined inregulation of the CP window is tied to sensory experience,of the critical period window for the rat primary auditory

de Villers-Sidani, Etienne; Chang, Edward F; Bao, Shaowen; Merzenich, Michael M



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Tracking the Sun II: The Installed Cost of Photovoltaics in the U.S. from 1998-2008  

E-Print Network (OSTI)

kW >100 kW ?10 kW PA SDF Solar PV Grant Program 10-100 kW >Renewable DG Program CT CCEF Solar PV Program MA MD MI MTCProgram MW No. Systems SDF Solar PV Grant Program MW No.

Barbose, Galen L



Theoretical study of 3-D molecular similarity and ligand binding modes of orthologous human and rat D2 dopamine receptors  

Science Conference Proceedings (OSTI)

The D"2 dopamine receptor (D"2DR) is an important target for the treatment of some central nervous system disorders, such as Parkinson disease, schizophrenia and drug-dependence. In this work, we built 3-D models of the long form of human and rat D"2DRs ... Keywords: 7TM receptor, D2 dopamine receptor ligands, Drug development, Molecular modeling, Parkinson's disease, Rat striatum

Marvin A. Soriano-Ursa; Jorge O. Ocampo-Lpez; Karina Ocampo-Mendoza; Jos G. Trujillo-Ferrara; Jos Correa-Basurto



Les bKa'brgyad - Sources canoniques et tradition de Nyangral Nyima 'od zer  

E-Print Network (OSTI)

la Pense, li la famille du bouddha Ak?obhya (Thugs Mi bskyod pa'i rigs) nomm dPal Heruka snying rje rol pa'i rgyud (?r?-heruka-karu??kr??ita-tantra), tabli par l'?c?rya H??- kara12 , venu de l'Inde de l'est, prs de Zahor (Est du Bengale) (r... mi tra, Pra chen ha ti, Rum bu ghu ya dhe ba, Dha na sang tri, Shan ting ghar ba. 21 'Ju mi pham (s.d., vol. 21 : 15) mentionne galement cette neuvime cassette, dont les autres gter ston qui ont dcouvert des cycles de bKa' brgyad ne parlent pas...

Sampel, Tenzin



A Cytogenetic Footprint for Mammary Carcinomas Induced by PhIP in Rats  

SciTech Connect

PhIP (2-amino-1-methyl-6-phenylimidazo [4,5-b] pyridine), a mutagen/carcinogen belonging to the class of heterocyclic amines (HCAs) found in cooked meats, is a mammary gland carcinogen in rats and has been implicated in the etiology of certain human cancers including breast cancer. To gain insight into the genomic alterations associated with PhIP-induced mammary gland carcinogenesis, we used comparative genomic hybridization (CGH) to examine chromosomal abnormalities in rat mammary carcinomas induced by PhIP, and for comparison, by DMBA (7,12-dimethylbenz[a]anthracene), a potent experimental mammary carcinogen. There was a consistent and characteristic pattern of chromosome-region loss in PhIP-induced carcinomas that clearly distinguished them from carcinomas induced by DMBA.

Christian, A T



Dynamic uptake of radioactive substance in rat salivary gland following /sup 3/H-melatonin administration  

SciTech Connect

Dynamics of radioactive accumulation in rat greater salivary gland following systemic administration of /sup 3/H-melatonin was studied to determine a possible action of the hormone in the gland. Progressive decline of /sup 3/H-melatonin concentrations was found in the serum, lung, skeletal muscle, liver, kidney, and salivary gland during 60 min following the administration. On the contrary, there was a progressive accumulation of radioactive substance other than /sup 3/H-melatonin in the salivary gland but not in other tissues mentioned. The radioactivity was also progressively and preferentially localized in the nuclear fraction of the gland cells. These results suggest a possible direct action of melatonin derivative in rat salivary gland.

Withyachumnarnkul, B.; Wongprapairot, P.; Trakulrungsi, W.




E-Print Network (OSTI)

Abstract The present study assessed the efficacy of the cannabinoid CBi receptor antagonist, SR-141716, in reducing voluntary ethanol intake in selectively bred Sardinian alcohol-preferring (sP) rats. Ethanol (10%, v/v) and food were available in daily 4h scheduled access periods; water was present 24 h/day. The acute administration of a 2.5 and a 5 mg/kg dose of SR-141716 selectively reduced ethanol intake, whereas a 10 mg/kg dose of SR-141716 reduced to a similar extent both ethanol and food intake. These results suggest that the cannabinoid CBi receptor is involved in the mediation of the ethanolreinforcing effects in sP rats.

unknown authors



Development of a multi-electrode array for spinal cord epidural stimulation to facilitate stepping and standing after a complete spinal cord injury in adult rats  

E-Print Network (OSTI)

segments via ascending projections from the sacral segmentsof hindlimb nerve projections to the rat spinal cord: a663. Nelson S, Mendell L: Projection of single knee flexor



X-ray intravital microscopy for functional imaging in rat hearts using synchrotron radiation coronary microangiography  

SciTech Connect

An X-ray intravital microscopy technique was developed to enable in vivo visualization of the coronary, cerebral, and pulmonary arteries in rats without exposure of organs and with spatial resolution in the micrometer range and temporal resolution in the millisecond range. We have refined the system continually in terms of the spatial resolution and exposure time. X-rays transmitted through an object are detected by an X-ray direct-conversion type detector, which incorporates an X-ray SATICON pickup tube. The spatial resolution has been improved to 6 {mu}m, yielding sharp images of small arteries. The exposure time has been shortened to around 2 ms using a new rotating-disk X-ray shutter, enabling imaging of beating rat hearts. Quantitative evaluations of the X-ray intravital microscopy technique were extracted from measurements of the smallest-detectable vessel size and detection of the vessel function. The smallest-diameter vessel viewed for measurements is determined primarily by the concentration of iodinated contrast material. The iodine concentration depends on the injection technique. We used ex vivo rat hearts under Langendorff perfusion for accurate evaluation. After the contrast agent is injected into the origin of the aorta in an isolated perfused rat heart, the contrast agent is delivered directly into the coronary arteries with minimum dilution. The vascular internal diameter response of coronary arterial circulation is analyzed to evaluate the vessel function. Small blood vessels of more than about 50 {mu}m diameters were visualized clearly at heart rates of around 300 beats/min. Vasodilation compared to the control was observed quantitatively using drug manipulation. Furthermore, the apparent increase in the number of small vessels with diameters of less than about 50 {mu}m was observed after the vasoactive agents increased the diameters of invisible small blood vessels to visible sizes. This technique is expected to offer the potential for direct investigation of mechanisms of vascular dysfunctions.

Umetani, K. [Japan Synchrotron Radiation Research Institute, SPring-8, Sayo-cho, Sayo-gun, Hyogo 679-5198 (Japan); Fukushima, K. [National Cerebral and Cardiovascular Center Hospital, Fujishirodai, Suita-shi, Osaka 565-8565 (Japan)



Cross-linking of atrial natriuretic peptide to binding sites in rat olfactory bulb membranes  

SciTech Connect

Binding sites for /sup 125/I-atrial natriuretic peptide (ANP)2 in rat olfactory bulb membranes have been studied using pharmacological and biochemical methods. Various unlabeled ANP-related peptides were tested for the ability to inhibit the binding of the radioligand in membrane binding assays. ANP(92-126) and ANP(99-126) were the most potent inhibitors tested, both exhibiting an IC50 value of 0.40 nM. ANP(103-126) and ANP(103-123) were 3 and 70 times less potent, respectively. ANP(111-126) was unable to inhibit the binding of the radioligand at a concentration of 1 microM. Several peptides unrelated to ANP were unable to inhibit the binding of the radioligand to rat olfactory bulb membranes. Membranes labeled with /sup 125/I-ANP were incubated with cross-linking agents and subjected to SDS-PAGE followed by autoradiography. A band possessing an apparent molecular mass of 116 kDa was identified. The labeling of this band was progressively decreased by increasing concentrations of unlabeled ANP(99-126) (IC50 = 0.6 nM) and by several other ANP-related peptides at nanomolar concentrations. For comparison purposes, ANP binding sites in rat aorta membranes were labeled with /sup 125/I-ANP and cross-linked using identical techniques. Three bands possessing molecular masses of 120, 72, and 62 kDa were identified. These results indicate that the ANP binding site in rat olfactory bulb membranes displays pharmacological and biochemical properties similar to peripheral ANP receptors.

Wildey, G.M.; Glembotski, C.C.


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Lipidomic changes in rat liver after long-term exposure to ethanol  

Science Conference Proceedings (OSTI)

Alcoholic liver disease (ALD) is a serious health problem with significant morbidity and mortality. In this study we examined the progression of ALD along with lipidomic changes in rats fed ethanol for 2 and 3 months to understand the mechanism, and identify possible biomarkers. Male Fischer 344 rats were fed 5% ethanol or caloric equivalent of maltose-dextrin in a Lieber-DeCarli diet. Animals were killed at the end of 2 and 3 months and plasma and livers were collected. Portions of the liver were fixed for histological and immunohistological studies. Plasma and the liver lipids were extracted and analyzed by nuclear magnetic resonance (NMR) spectroscopy. A time dependent fatty infiltration was observed in the livers of ethanol-fed rats. Mild inflammation and oxidative stress were observed in some ethanol-fed rats at 3 months. The multivariate and principal component analysis of proton and phosphorus NMR spectroscopy data of extracted lipids from the plasma and livers showed segregation of ethanol-fed groups from the pair-fed controls. Significant hepatic lipids that were increased by ethanol exposure included fatty acids and triglycerides, whereas phosphatidylcholine (PC) decreased. However, both free fatty acids and PC decreased in the plasma. In liver lipids unsaturation of fatty acyl chains increased, contrary to plasma, where it decreased. Our studies confirm that over-accumulation of lipids in ethanol-induced liver steatosis accompanied by mild inflammation on long duration of ethanol exposure. Identified metabolic profile using NMR lipidomics could be further explored to establish biomarker signatures representing the etiopathogenesis, progression and/or severity of ALD. - Highlights: > Long term exposure to ethanol was studied. > A nuclear magnetic resonance (NMR) spectroscopy based lipidomic approach was used. > We examined the clustering pattern of the NMR data with principal component analysis. > NMR data were compared with histology and immunohistochemistry data. > Biochemical parameters were compared with the observed NMR lipid data.

Fernando, Harshica; Bhopale, Kamlesh K. [Department of Pathology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Kondraganti, Shakuntala [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Kaphalia, Bhupendra S. [Department of Pathology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Shakeel Ansari, G.A., E-mail: sansari@utmb.edu [Department of Pathology, University of Texas Medical Branch, Galveston, TX, 77555 (United States); Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX, 77555 (United States)



The effects of ethanol on strychnine sensitive glycine receptors in the rat basolateral amygdala  

E-Print Network (OSTI)

The major relationship between ethanol and the behavioral response to environmental stressors indicates that ethanol functions to reduce the effects of stress. The most classical presentation of the anxiety-reduction hypothesis of alcoholism, presented by Cogner (1956), theorized that alcoholism was induced by the anxiolytic effects of ethanol, which in turn reinforced intake of ethanol. If this holds true, then it is reasonable to hypothesize that the CNS effects of ethanol may be dominant in the area of the brain that controls or influences anxiety. Given the known role of the amygdala in fear and anxiety-induced responses, we hypothesized that the anxiety reducing effects of ethanol would be observed within the amygdala and may be measured as alterations of neuronal excitability. The first aim of this thesis was to establish an animal model of alcoholism in the laboratory. This was done by introducing a nutritionally complete ethanol containing liquid diet. We compared two liquid diet formularies, one prepared in-house and one commercially prepared. The second aim enlisted a behavioral experiment to test our hypothesis of alterations of the anxiety response in the chronically ethanol treated rats. We utilized the light/dark box apparatus to measure the anxiolytic and anxiogenic effects of chronic ethanol ingestion and withdrawal. In these tests we found that both the ethanol and control rats displayed a slightly greater interest in exploring the dark side of the box, while the ethanol withdrawal rats spent a significant percent of their total time on the light side. The third aim was to use whole-cell patch clamp electrophysiology to study the cellular effects of ethanol on the rat basolateral amygdala neurons. Initially we were able to demonstrate that the acutely isolated BLA neurons contained strychnine-sensitive glycine receptors. However, we found no significant alteration in the glycine-, GABA-, or NMDA-mediated response within these neurons with chronic ethanol exposure or withdrawal.

Botting, Shaleen Kaye



The correlation dimension of rat hearts in an experimentally controlled environment  

Science Conference Proceedings (OSTI)

The electric response of several isolated rat hearts in a controlled environment was studied experimentally. The correlation dimension D 2 was estimated and was found to be between 4 and 6.5 when the response was nearly periodic. The variation of D 2 with the concentration of calcium was studied and a general trend of its increase with increasing concentration was found. Two types of ventricular fibrillation (VF) were observed

Guy Dori; Shmuel Fishman; S. A. Ben-Haim



Characterization of angiotensin-binding sites in the bovine adrenal and the rat brain  

SciTech Connect

The first study was designed to determine whether systemically administered MSG affects neurons in the CVOs that are potentially important in mediating angiotensin-dependent responses. Rats were pretreated with MSG and the receptors for angiotensin II were assayed by radioligand binding in brain homogenates from the septum anteroventral third ventricular region (AV3V) and the thalamus/hypothalamus region using {sup 125}I-angiotensin II as the radioligand. The results of this experiment indicate that systematically administered MSG in the rat significantly reduced the number (Bmax) of Ang II receptors in a tissue sample which contained both extra blood-brain barrier organs as well as tissue within the blood-brain barrier with no change in the affinity (Kd) of the binding sites. The second chapter reports the successful solubilization of bovine adrenal {sup 125}I Ang II and {sup 125}I Sar{sup 1},Ile{sup 8}-Ang II binding sites with the detergent CHAPS. The results of our studies indicate the presence of two angiotensin binding sites. The one site is specific for naturally occurring angiotensins as well as sarcosine-1 substituted angiotensin analogues. The other site which can be optimally stabilized be re-addition of 0.3% CHAPS into the incubation assay binds sarcosine-1 substituted angiotensins exclusively. Hydrophobic interaction chromatography experiments suggest that these sites, possibly, represent distinct proteins. The third chapter discusses the successful solubilization and partial characterization of the rat brain angiotensin receptor.

Rogulja, I.



Deux noms tangoutes dans une legende tibetaine  

E-Print Network (OSTI)

I me sicle, et donc antrieure dau moins quatre cent ans aux textes tibtains eux-mmes. Deuximement, le nom dune montagne est mentionn, accompagn lui aussi dune glose en tibtain : de nas rgyal-rabs drug na Mi-nyag Rgyal-rgod byung / de... i dus su / si noi zhwa / Bod-skad du bsgyur na / sems nag-poi ri zhes pa la skyes pai mis rgyal- poi blon-po byas nas rgyal-po gsod par gyur zhes pa Six gnrations aprs lui, Rgyal-rgod du Mi-nyag apparut. A cette poque, on disait quun homme...

Jacques, Guillaume



Le mode d'emergence du Reel - L'avenement des manifestations de la base (gzhi snang) selon les conceptions de la Grande Perfection  

E-Print Network (OSTI)

/ gzhi ka dag chen pozhes bya ste/ ngo bo rang bzhin thugs rje rnam pa gsum du gnas so/ ngo bo de mi gyur bai ye shesma gags par gsal ba gzhon nu bum pai skui gnas lugs zhes byao/ rang bzhin od lngai snang bama gags so/ thugs rjei snang ba ni... ) rayonnante de lumire (od du gsal ba). Voir inter alia Mi pham, rDo rjesnying po, p. 358.17 Klong chen pa, Theg mchog mdzod, I, p. 295. Ici, la Compassion na pas ici expressment decaractre thique ; voir ce sujet Chgyel Namkhai Norbu & Adriano Clemente...

Achard, Jean-Luc



Evidence for selective expression of angiotensin II receptors on atretic follicles in the rat ovary: an autoradiographic study  

SciTech Connect

Ovarian angiotensin II (Ang II) receptors display a cyclical pattern of variation during the rat estrous cycle. Ang II receptors, estimated by the specific binding of the Ang II receptor antagonist (/sup 125/I)iodo-(Sar1,Ile8) Ang II to ovarian membranes, were lowest at estrus (binding site density (Bmax) = 35 +/- 2 fmol/mg; binding site affinity (KD) = 2.0 +/- 0.2 nM) and highest at diestrus I (Bmax = 59 +/- 3 fmol/mg; KD = 1.6 +/- 0.1 nM). We have previously shown that Ang II receptors in the rat ovary predominantly exist on the granulosa cell layer of a subpopulation of follicles. Our present studies show that the Ang II receptor-containing follicles in the rat ovary are mainly atretic (approximately 80%) or show signs of early atresia (approximately 15%) during all stages of the estrous cycle. A small number of Ang II receptor-containing follicles were healthy (approximately 5%). In contrast to the Ang II receptor-containing follicles, the FSH receptor-containing follicles were predominantly healthy (greater than 90%). Follicles which contained both Ang II receptors and FSH receptors were mainly early atretic. Since Ang II receptor-containing follicles in the rat ovary were mainly atretic these studies suggest that in the rat Ang II may be a major factor in regulating the function of atretic ovarian follicles.

Daud, A.I.; Bumpus, F.M.; Husain, A.



Comparative in vitro cytotoxicity of nickel oxides and nickel-copper oxides to rat, mouse, and dog pulmonary alveolar macrophages  

SciTech Connect

Metal oxides containing either Ni alone (NiO's) or both Ni and Cu (Ni-CuO's) are encountered during Ni refining. Six NiO compounds calcined at temperatures ranging from < 650 to 1045/sup 0/ and four Ni-CuO's containing from 6.9 to 28% Cu and 44 to 69% Ni were screened for their in vitro cytotoxicity to alveolar macrophages (AM). NiO's were less toxic to rat AM than were the Ni-CuO compounds. The toxicity of the Ni-CuO compounds increased with increasing Cu content and decreasing Ni content of the molecules, indicating that the toxicity was due to the Cu content of the molecules. AM obtained from beagle dogs, F344/N rats, and B6C3F/sub 1/ mice displayed the following species sensitivities: dog > rat approx. = mouse, with dog AM being most sensitive. The observed differences in species sensitivities correlated with differences in the phagocytic abilities of dog, rat, and mouse AM, with the ranking of phagocytic abilities of the AM in decreasing order of ability being dog > rat > mouse.

Benson, J.M.; Henderson, R.F.; Pickrell, J.A.



Localization of atrial natriuretic peptide mRNA and immunoreactivity in the rat heart and human atrial appendage  

SciTech Connect

The localization of mRNA encoding preproatrial natriuretic peptide was investigated in tissue sections and cultures of rat heart and in sections of human right atrial appendage using the technique of in situ hybridization with /sup 32/P- and /sup 35/S-labeled RNA probes. Rat atrial natriuretic peptide (ANP) transcripts were demonstrated in numerous atrial myocytes and, to a lesser extent, in ventricular myocytes in both tissue sections and newborn rat heart cultures. These findings are consistent with those obtained by RNA blot analysis of rat heart total RNA, indicating that a single prepro-ANP transcript of approx. 900 nucleotides was present in the ventricles as well as the atria. Using a /sup 35/S-labeled RNA probe for human ANP mRNA, ANP transcripts were also localized to the majority of myocytes in the human right atrial appendage. Only background levels of autoradiographic labeling were obtained when RNA probes identical to the coding sequence of rat or human ANP mRNA were used. A close correlation was found between the distribution of ANP immunoreactivity and prepro-ANP mRNA in these preparations. These results provide unequivocal evidence for the expression of the ANP gene in the rat ventricles, as well as the atria, because myocytes in these tissues have been established as the sites of both ANP localization and precursor biosynthesis. The combined use of cardiac cultures and in situ hybridization may be of value in future studies investigating the regulation of ANP synthesis in cardiac myocytes.

Hamid, Q.; Wharton, J.; Terenghi, G.; Hassall, C.J.S.; Aimi, J.; Taylor, K.M.; Nakazato, H.; Dixon, J.E.; Burnstock, G.; Polak, J.M.



Charcterization of atrial natriuretic peptide receptors (ANP-R) in rat kidney and lung tissues  

SciTech Connect

The ability of several rat ANP analogues to compete with SVI-ANP(1-28) for binding to plasma membranes of rat kidney cortex (RKPM) and rat lung (RLPM) was examined. Their ability to compete on RKPM was: ANP(1-28)>pro-ANP>ANP(5-28)>ANP(5-27), ANP(5-25) being inactive. Conversely, the potency of the analogues on RLPM was: ANP(5-28)>ANP(5-27)>ANP(1-28)>ANP-(5-25), pro-ANP being unable to compete. The stimulation of particulate guanylate cyclase by these peptides paralleled their ability to compete. Truncation of the C-terminal therefore decreases the binding of the peptide to RKPM. In contrast, the N-terminal seems to be important for interaction with ANP-R on RLPM. ANP-R were photolabeled with SVI-iodo-azidosalicylyl-ANP(1-28) (ASA-ANP) or azidobenzoyl- SVI-ANP(1-28) (AB-ANP) in which the C-terminal tyrosine is iodinated. In ASA-ANP, the iodine is located on the benzene ring. ASA-ANP identified a protein of approx.140 kDa in RKPM. AB-ANP recognized an additional protein of approx.120 kDa. The bulkier N-terminal of the ASA-ANP seems to hinder the binding of the analogue to the approx.120-kDa protein. In RLPM only the approx.120-kDa protein was detected by AB-ANP. The approx.140-kDa receptor may be unique to the kidney. ANF-R in RKPM and RLPM respectively, appear to interact with different domains of ANP suggesting the existence of two forms of the ANP-R.

Tallerico-Melnyk, T.; Yu, H.; Flynn, T.G.; Yip, C.C.



Reversal of docosahexaenoic acid deficiency in the rat brain, retina, liver, and serum  

E-Print Network (OSTI)

Abstract The loss of docosahexaenoic acid (DHA) from the retina or brain has been associated with a loss in nervoussystem function in experimental animals, as well as in human infants fed vegetable oil-based formulas. The reversibility of the loss of DHA and the compensation by an increase in the n-6 docosapentaenoic acid (DPAn-6) was studied in young adult rats. Long-Evans rats were subjected to a very low level of n-3 fatty acids through two generations. The F2 generation, n-3-deficient animals at 7 weeks of age were provided a repletion diet containing both ?-linolenate and DHA. A separate group of F2 generation rats had been maintained on an n-3-adequate diet of the same composition. Tissues from the brain, retina, liver, and serum were collected on weeks 0, 1, 2, 4, and 8 from both groups of animals. The concentrations of DHA, DPAn-6, and other fatty acids were determined and the rate of recovery and length of time needed to complete DHA recovery were determined for each tissue. The DHA level in the brain at 1 and 2 weeks after diet reversal was only partially recovered, rising to approximately 20 % and 35%, respectively, of the n-3-adequate group level. Full recovery was not obtained until 8 weeks after initiation of the repletion diet. Although the initial rate of retinal DHA accretion was greater than that of brain DHA, the half-time for DHA recovery was only marginally greater. On the other hand, the levels of DHA in the serum and liver were approximately 90 % and 100 % replaced, respectively, within 2 weeks of diet reversal. A consideration of the total amounts and time courses of DHA repleted in the nervous system compared with the liver and circulation suggests that transport-related processes may limit the rate of DHA repletion in the retina and brain.Moriguchi, T., J.

Toru Moriguchi; James Loewke; Megan Garrison; Janice Nicklay Catalan; Norman Salem



Effects of cadmium on the renal and skeletal muscle microcirculation in rats  

SciTech Connect

The effects of cadmium on the arteriolar diameters of the kidney and skeletal muscle were quantified, because of the hypertensive effect of cacmium. The effect of cacmium on the constrictor response of the renal arterioles to angiotensin II (Ang II) were also assessed. In vivo preparations of the rat hydronephrotic kidney and cremaster muscle were used for direct visualization of the microvessels with intravital television microscopy. Hydronephrosis was induced in twenty-seven male Wistar-Kyoto rats (150-180 g) by unilateral ureter ligation. The hydronephrotic kidney, with intact cortical circulation and innervation, was exteriorized in a specially designed bath for microcirculation observation 6-8 weeks following the ureter ligation. The cremaster muscle experiments were conducted in another thirty-seven male WKY rats (120-180 g). Disparate effects of cadmium were observed in these two microcirculation beds. Topical cadmium (1.35 [mu]M-0.45 mM) increased the diameters of the pre- and postglomerular vessels in the hydronephrotic kidney maximally by 15-26%. Cadmium (0.27 mM) inhibited the Ang II response of the arterioles non-competitively. However, intraperitoneally injected cadmium (2 mg/kg), which significantly increased the mean arterial pressure, did not dilate the arterioles nor alter the Ang II response. On the other hand, cadmium (13.5 [mu]M-0.72 mM) constricted the larger arterioles in the cremaster muscle (60-160 [mu]m) concentration-dependently, but not small arterioles (15-30 [mu]m). In summary, topical cadmium dilates renal arterioles and decreases their reactivity to Ang II, but constricts the larger cremaster arterioles. The disparate effects of cadmium suggest different Ca[sup 2+] utilization mechanisms in different vascular beds. The construction of the cremaster arterioles may contribute to cadmium-induced hypertension by increasing peripheral resistance.

Zhang Chong.



Impaired mitochondrial respiration and protein nitration in the rat hippocampus after acute inhalation of combustion smoke  

SciTech Connect

Survivors of massive inhalation of combustion smoke endure critical injuries, including lasting neurological complications. We have previously reported that acute inhalation of combustion smoke disrupts the nitric oxide homeostasis in the rat brain. In this study, we extend our findings and report that a 30-minute exposure of awake rats to ambient wood combustion smoke induces protein nitration in the rat hippocampus and that mitochondrial proteins are a sensitive nitration target in this setting. Mitochondria are central to energy metabolism and cellular signaling and are critical to proper cell function. Here, analyses of the mitochondrial proteome showed elevated protein nitration in the course of a 24-hour recovery following exposure to smoke. Mass spectrometry identification of several significantly nitrated mitochondrial proteins revealed diverse functions and involvement in central aspects of mitochondrial physiology. The nitrated proteins include the ubiquitous mitochondrial creatine kinase, F1-ATP synthase {alpha} subunit, dihydrolipoamide dehydrogenase (E3), succinate dehydrogenase Fp subunit, and voltage-dependent anion channel (VDAC1) protein. Furthermore, acute exposure to combustion smoke significantly compromised the respiratory capacity of hippocampal mitochondria. Importantly, elevated protein nitration and reduced mitochondrial respiration in the hippocampus persisted beyond the time required for restoration of normal oxygen and carboxyhemoglobin blood levels after the cessation of exposure to smoke. Thus, the time frame for intensification of the various smoke-induced effects differs between blood and brain tissues. Taken together, our findings suggest that nitration of essential mitochondrial proteins may contribute to the reduction in mitochondrial respiratory capacity and underlie, in part, the brain pathophysiology after acute inhalation of combustion smoke.

Lee, Heung M.; Reed, Jason; Greeley, George H. [Department of Surgery, University of Texas Medical Branch (United States); Englander, Ella W. [Department of Surgery, University of Texas Medical Branch (United States); Shriners Hospitals for Children, Galveston, TX (United States)], E-mail: elenglan@utmb.edu



RatBot: anti-enumeration peer-to-peer botnets  

SciTech Connect

Botnets have emerged as one of the most severe cyber threats in recent years. To obtain high resilience against a single point of failure, the new generation of botnets have adopted the peer-to-peer (P2P) structure. One critical question regarding these P2P botnets is: how big are they indeed? To address this question, researchers have proposed both actively crawling and passively monitoring methods to enumerate existing P2P botnets. In this work, we go further to explore the potential strategies that botnets may have to obfuscate their true sizes. Towards this end, this paper introduces RatBot, a P2P botnet that applies some statistical techniques to defeat existing P2P botnet enumeration methods. The key ideas of RatBot are two-fold: (1) there exist a fraction of bots that are indistinguishable from their fake identities, which are spoofing IP addresses they use to hide themselves; (2) we use a heavy-tailed distribution to generate the number of fake identities for each of these bots so that the sum of observed fake identities converges only slowly and thus has high variation. We use large-scale high-fidelity simulation to quantify the estimation errors under diverse settings, and the results show that a naive enumeration technique can overestimate the sizes of P2P botnets by one order of magnitude. We believe that our work reveals new challenges of accurately estimating the sizes of P2P botnets, and hope that it will raise the awareness of security practitioners with these challenges. We further suggest a few countermeasures that can potentially defeat RatBot's anti-enumeration scheme.

Yan, Guanhua [Los Alamos National Laboratory; Eidenbenz, Stephan [Los Alamos National Laboratory; Chen, Songqing [GEORGE MASON UNIV.




E-Print Network (OSTI)

Abstract Aims: Intermittent presentations of the ethanol sipper have been reported to induce more ethanol drinking in rats than when the ethanol sipper was continuously available during the session. This intermittent sipper effect was observed in a social drinking situation, in which subjects experienced intermittent opportunities to interact briefly with a conspecific rat. The objective of this study was to evaluate the effects of the intermittent sipper procedure in situations providing for intermittent presentations of food, and, in addition, in situations that do not provide for intermittent presentations of another rewarding event. Methods: Four groups of male Long-Evans hooded rats, arranged in a 2 2 factorial design with two levels of Sipper Procedure (Intermittent vs Continuous) and two levels of Food procedure (Food vs No Food), were trained in drinking chambers. During each daily session, Intermittent Sipper groups received access to the ethanol sipper during each of 25 trials of 10 s each, while Continuous Sipper groups had access to the ethanol sipper during the entire session ( 30 min). During each session, Food groups received 25 presentations of food pellets while No Food groups received no food pellets. Ethanol concentrations in the sipper [3, 4, 6, 8, and 10 % (vol./vol.)] increased across sessions. Results: More rapid escalation of ethanol intake was observed in the Intermittent Sipper groups than in the Continuous Sipper groups, and this effect was observed in both the Food and No Food conditions (Ps ethanol sipper, yet induced more ethanol drinking than Continuous Sipper procedures. The intermittent sipper effect is not dependent on presentations of food. Implications for scheduleinduced polydipsia and Pavlovian autoshaping are discussed.

Arthur Tomie; William C. Miller; Erik Dranoff; Larissa A. Pohorecky



Altered cardiovascular reactivity and osmoregulation during hyperosmotic stress in adult rats developmentally exposed to polybrominated diphenyl ethers (PBDEs)  

Science Conference Proceedings (OSTI)

Polybrominated diphenyl ethers (PBDEs) and the structurally similar chemicals polychlorinated biphenyls (PCBs) disrupt the function of multiple endocrine systems. PCBs and PBDEs disrupt the secretion of vasopressin (VP) from the hypothalamus during osmotic activation. Since the peripheral and central vasopressinergic axes are critical for osmotic and cardiovascular regulation, we examined whether perinatal PBDE exposure could impact these functions during physiological activation. Rats were perinatally dosed with a commercial PBDE mixture, DE-71. Dams were given 0 (corn oil control), 1.7 (low dose) or 30.6 mg/kg/day (high dose) in corn oil from gestational day (GD) 6 through postnatal day (PND) 21 by oral gavage. In the male offspring exposed to high dose PBDE plasma thyroxine and triiodothyronine levels were reduced at PND 21 and recovered to control levels by PND 60 when thyroid stimulating hormone levels were elevated. At 14-18 months of age, cardiovascular responses were measured in four groups of rats: Normal (Oil, normosmotic condition), Hyper (Oil, hyperosmotic stress), Hyper PBDE low (1.7 mg/kg/day DE-71 perinatally, hyperosmotic stress), and Hyper PBDE high (30.6 mg/kg/day DE-71 perinatally, hyperosmotic stress). Systolic blood pressure (BP), diastolic BP, and heart rate (HR) were determined using tail cuff sphygmomanometry and normalized to pretreatment values (baseline) measured under basal conditions. Hyperosmotic treatment yielded significant changes in systolic BP in PBDE exposed rats only. Hyper PBDE low and high dose rats showed 36.1 and 64.7% greater systolic BP responses at 3 h post hyperosmotic injection relative to pretreatment baseline, respectively. No treatment effects were measured for diastolic BP and HR. Hyper and Hyper PBDE rats showed increased mean plasma osmolality values by 45 min after injection relative to normosmotic controls. In contrast to Hyper rats, Hyper PBDE (high) rats showed a further increase in mean plasma osmolality at 3 h (358.3 {+-} 12.4 mOsm/L) relative to 45 min post hyperosmotic injection (325.1 {+-} 11.4 mOsm/L). Impaired osmoregulation in PBDE-treated animals could not be attributed to decreased levels of plasma vasopressin. Our findings suggest that developmental exposure to PBDEs may disrupt cardiovascular reactivity and osmoregulatory responses to physiological activation in late adulthood. - Highlights: > We examined whether PBDE exposure could impact osmotic and cardiovascular regulation. > Hyperosmotic treatment yielded significant changes in systolic BP in PBDE exposed rats only. > PBDEs may disrupt cardiovascular and osmoregulatory responses to physiological activation.

Shah, Ashini [Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States); Coburn, Cary G. [Environmental Toxicology Graduate Program, University of California, Riverside, 92521 (United States); Watson-Siriboe, Abena; Whitley, Rebecca; Shahidzadeh, Anoush; Gillard, Elizabeth R.; Nichol, Robert [Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States); Leon-Olea, Martha [Neuromorfologia Funcional, Direccion de Investigaciones en Neurociencias, Instituto Nacional de Psiquiatria Ramon de la Fuente Muniz, Mexico City (Mexico); Gaertner, Mark [Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States); Kodavanti, Prasada Rao S. [Neurotoxicology Branch, NHEERL/ORD, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Curras-Collazo, Margarita C., E-mail: margarita.curras@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, 92521 (United States); Department of Cell Biology and Neuroscience, University of California, Riverside, 92521 (United States)




E-Print Network (OSTI)

ABSTRACT: The extracts of bark, leaves and stem of A. indica, fruits of P. longum, berries of E. officinalis and seeds of G. indicum were prepared using different solvents. Three different combinations of these extracts were tried on the female albino rats for their effect on the estrous cycle. The combination consisting of alcoholic extracts of leaves and stem of A. indica, fruits of P. longum, berries of E. officinalis and seeds of G. indicum has exhibited considerable effect on estrous cycle by prolongation of diestrous phase.

C. K. Kokate; M. Krishna; Reddy; N. Chari



Therapeutic efficacy of dimercaptosuccinic acid and thiamine/ascorbic acid on lead intoxication in rats  

SciTech Connect

Thiamine, folic acid, pyridoxine and ascorbic acid either individually or in combination have been proven to be effective in reducing the toxic manifestations of lead and in enhancing the antidotal efficacy of CaNa{sub 2}EDTA. In a recent report from the authors' laboratory, it was observed that given combination of thiamine and ascorbic acid with thiol chelators improved the ability of the animals to excrete lead thereby reducing body lead burden. In view of the beneficial effect of these two vitamins, it was considered of interest to evaluate their potential to modify the prophylactic action of DMS in lead intoxication in rat after repeated administration.

Tandon, S.K.; Flora, S.J.S. (Industrial Toxicology Research Centre, Lucknow (India))



Exercise training regulation of extracellular matrix and remodeling in the aging rat heart  

E-Print Network (OSTI)

Aging is characterized by a progressive impairment of cardiac structure and function. The cardiac remodeling involves loss of cardiac myocytes, reactive hypertrophy of the remaining cells, and increased extracellular matrix (ECM) and fibrosis in the aging heart. In contrast, exercise training not only improves cardiac function, but also reduces the risk of heart disease. However, the ability of exercise training to modulate ECM and remodeling in the aging heart remains unknown. Therefore, the purpose of this study was to determine the effects of exercise training on ECM remodeling in the aging heart. We hypothesized that (1) exercise training would attenuate age-related changes in left ventricle morphology including extramyocyte space and collagen contents, and (2) exercise training would ameliorate age-induced changes in ECM-related factors including MMPs, TIMPs, TNF-?, TGF-?1, and ?-SMA in the heart. Three and 31 month old Fischer 344 Brown Norway F1 hybrid rats were assigned to four groups: young sedentary (YS), young exercise-trained (YE), old sedentary (OS), and old exercise-trained (OE). Exercise training groups walked briskly on a treadmill for 45 min/day (12 incline) at 20m/min (young) or 10 m/min (old), 5 d/wk for 12 wk. We found that endurance exercise training might ameliorate the ageinduced increase in extramyocyte space and collagen contents of the left ventricle. Exercise training might protect against age-induced fibrosis by increasing MMP-2, MMP-14 in the soluble fraction and MMP-1, MMP-3, MMP-14 in the insoluble fraction of old rat hearts. Conversely, exercise training might reduce the fibrosis by decreasing TIMP-1 in the soluble fraction of old rat hearts. Further, exercise training reduced potential upstream pro-fibrotic mediators including TNF-? and TGF-?1 in the aging rat hearts. These results are the first to demonstrate that exercise training has a protective effect against age-induced extracellular collagen matrix remodeling in the aging heart, associated with increased MMP-1, -2, -3, -14 and decreased TIMP-1, TNF-?, and TGF- ?1.

Kwak, Hyo Bum



An integrated functional genomic study of acute phenobarbital exposure in the rat  

E-Print Network (OSTI)

in drinking water following exposure for three years [8]. Isenberg et al. reported that in F344 rats, exposure to 500 ppm PB in the diet for 1-2 weeks produces an increase in relative liver weight which is reversible on returning the animals to control diet... ) in PB treated animals compared to controls (table 1) at all time points for 500 and 1000 ppm. Body weight was significantly increased in the 500 and 1000 ppm groups at day 14 (p intake for the 500...

Waterman, Claire L; Currie, Richard A; Cottrell, Lisa A; Dow, Jacky; Wright, Jayne; Waterfield, Catherine J; Griffin, Julian L


Note: This page contains sample records for the topic "rat mi pa" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reactive Transport Models with Reactive Transport Models with Geomechanics to Mitigate Risks of CO2 Utilization and Storage Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

a Prototype Commercial a Prototype Commercial Gasifier Sensor Background Integrated gasification combined cycle (IGCC) technology has the potential to improve the efficiency and environmental performance of fossil fuel based electric power production. During the IGCC process, coal and/or biomass is gasified at high temperature and pressure to form synthesis gas (syngas), a mixture of hydrogen, carbon monoxide, carbon dioxide, and small amounts of contaminants such as hydrogen sulfide. The syngas can be used to produce power, chemicals, and/or fuels. The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) Gasification Technologies Program is focused on enhancing the performance of gasification systems, thus enabling U.S. industry to improve the competitiveness of