Powered by Deep Web Technologies
Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Randers, Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Randers, Denmark: Energy Resources Randers, Denmark: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2615006 Coordinates 56.46667°, 10.05° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.46667,"lon":10.05,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

Modified Friedmann model in Randers-Finsler space of approximate Berwald type as a possible alternative to dark energy hypothesis  

E-Print Network [OSTI]

Gravitational field equations in Randers-Finsler space of approximate Berwald type are investigated. A modified Friedmann model is proposed. It is showed that the accelerated expanding universe is guaranteed by a constrained Randers-Finsler structure without invoking dark energy. The geodesic in Randers-Finsler space is studied. The additional term in the geodesic equation acts as repulsive force against the gravity.

Zhe Chang; Xin Li

2009-01-08T23:59:59.000Z

3

Emergent phenomenology from deterministic Cartan-Randers systems  

E-Print Network [OSTI]

We consider specific deterministic quantum models of Cartan-Randers type and show how a dualized abelian gauge symmetry, diffeomorphism invariance, the Principle of Inertia, reversibility of phenomenological dynamics, maximal acceleration and maximal propagation speed for matter arise from such models in an phenomenological description. Two particular predictions are highlighted: the first is the value of maximal acceleration is universal and has the value of order 10^{52} m/s^2. The second prediction is that gauge symmetries in phenomenological models must come dualized and containing an abelian sector.

Ricardo Gallego Torrom

2013-10-24T23:59:59.000Z

4

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

5

Stirling Denmark Ltd | Open Energy Information  

Open Energy Info (EERE)

Stirling Denmark Ltd Stirling Denmark Ltd Jump to: navigation, search Name Stirling Denmark Ltd Place Lyngby, Denmark Zip DK 2800 Sector Biomass Product Danish manufacturer of biomass-fueled Stirling engines for power generation with zero CO2 impact. Coordinates 56.866669°, 8.31667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.866669,"lon":8.31667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

6

Laser ion source for Columbia Universitys microbeam A.W. Bigelow a,*, G. Randers-Pehrson a  

E-Print Network [OSTI]

Laser ion source for Columbia University?s microbeam A.W. Bigelow a,*, G. Randers-Pehrson a , R High School, NY, USA Available online 29 August 2005 Abstract A laser ion source that will be installed for irradiation experiments with mammalian cells. Through laser ablation the laser ion source can produce heavy

Brenner, David Jonathan

7

Denmark Solar Industry DSI | Open Energy Information  

Open Energy Info (EERE)

Industry DSI Industry DSI Jump to: navigation, search Name Denmark Solar Industry (DSI) Place Copenhagen, Denmark Zip DK-1550 Sector Solar Product Manufactures and distributes solar panels and systems. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

8

Suzlon Energy Wind A S Denmark | Open Energy Information  

Open Energy Info (EERE)

A S Denmark A S Denmark Jump to: navigation, search Name Suzlon Energy Wind A/S (Denmark) Place Aarhus, Denmark Zip Dk-8000 Sector Wind energy Product Subsidiary of Suzlon Energy specializing in the research and development of wind power solutions. The Danish subsidiary is also the head quarters for international operations. Coordinates 56.153005°, 10.204525° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.153005,"lon":10.204525,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

9

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

10

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

16

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

17

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

18

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

19

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

20

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

22

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

23

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

24

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

25

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

26

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

27

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

28

Low Enthalpy Geothermal Energy Resources in Denmark  

Science Journals Connector (OSTI)

The deep oil exploration drillings in Denmark have shown that especially the Danish Embayment contains low enthalpy geothermal resources associated with warm aquifers. The most promising reservoirs have been f...

Niels Balling; Svend Saxov

1979-01-01T23:59:59.000Z

29

Low enthalpy geothermal energy resources in Denmark  

Science Journals Connector (OSTI)

The deep oil exploration drillings in Denmark have shown that especially the Danish Embayment contains low enthalpy geothermal resources associated with warm aquifers. The most promising reservoirs have been f...

Niels Balling; Svend Saxov

30

Technical University of Denmark rsted DTU Automation  

E-Print Network [OSTI]

Technical University of Denmark ?rsted · DTU Automation Project: SICAM - SIngle Conversion stage based SICAM using an LC-network Petar Ljusev, MSc., Ph.D. student, ?rsted · DTU Automation e-mail: pl

31

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

32

Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Denmark: Energy Resources Denmark: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56,"lon":10,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

33

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark NERI Technical Environmental Research Institute Ministry of the Environment . Denmark NERI Technical Report No. 604, 2006 Fauser, Malene Nielsen Department: Department of Policy Analysis Publisher: National Environmental

34

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Burden Sharing] #12;National Environmental Research Institute Ministry of the Environment . Denmark Burden Sharing Ringius Risø National Laboratory Pia Frederiksen Katja Birr-Pedersen National Environmental Research

35

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Quality manual Environmental Research Institute Ministry of the Environment . Denmark Quality manual for the greenhouse gas.: Research Notes from NERI No. 224 Publisher: National Environmental Research Institute Ministry

36

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

37

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

38

Technical University of Denmark Master Thesis  

E-Print Network [OSTI]

for electricity based heat production, HPs and EBs start to appear in district heating systems around Denmark into the current highly efficient combined heat and power (CHP) system, requires new flexible measures to reduce forced heat production in periods of high wind. Heat pumps (HP) and electric immersion boilers (EB) show

39

Technical University of Denmark rsted DTU Automation  

E-Print Network [OSTI]

Technical University of Denmark ?rsted · DTU Automation Project: SICAM - SIngle Conversion stage;Isolated PDM and PWM DC-AC SICAMs Petar Ljusev, MSc., Ph.D. student, ?rsted · DTU Automation e-mail: pl

40

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

42

Copenhagen, Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Copenhagen, Denmark: Energy Resources Copenhagen, Denmark: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2618425 Coordinates 55.67768°, 12.57093° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67768,"lon":12.57093,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

43

Roskilde, Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Roskilde, Denmark: Energy Resources Roskilde, Denmark: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2614481 Coordinates 55.6414856°, 12.0804175° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.6414856,"lon":12.0804175,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

44

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

45

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

46

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

47

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

48

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

49

Ris-R-1550(EN) Nanotechnology development in Denmark  

E-Print Network [OSTI]

Risø-R-1550(EN) Nanotechnology development in Denmark - environmental opportunities and risk Maj Munch Andersen and Birgitte Rasmussen Title: Nanotechnology development in Denmark - environmental Products and Materials ­ Challenges from Nanotechnology, Biotechnology and ICT" (Jørgensen et al. 2006

50

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Bird numbers Commisioned by Elsam Engineering A/S 2005 #12;[Blank page] #12;National Environmental Research Institute Ministry of the Environment . Denmark Bird numbers and distri- butions in the Horns Rev offshore wind farm

51

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Investigations commissioned by Elsam Engineering A/S #12;[Blank page] #12;National Environmental Research Institute Ministry of the Environment . Denmark Investigations of migratory birds during operation of Horns Rev offshore wind farm

52

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Emission of CH4 Environmental Research Institute Ministry of the Environment . Denmark Emission of CH4 and N2O from Wastewater: National Environmental Research Institute Ministry of the Environment URL: http://www.dmu.dk Date

53

Awardee AwardeeHeadquarters RecoveryFunding TotalValue Denmark  

Open Energy Info (EERE)

Denmark Denmark Catalonia Spain Tech Inc Pittsburgh Pennsylvania Madrid Spain Germany Italy Belgium Czech Republic France Germany Ireland Norway United Kingdom Duluth Minnesota Kranj Slovenia Poland Steyr Austria Traun Austria V cklabruck Austria S nderborg Denmark Thisted Denmark United Kingdom Spain France Italy SVEZIA Switzerland Slovenia Denmark Carmona Spain Amber Kinetics Inc Fremont California American Transmission Company LLC Waukesha Wisconsin American Transmission Company LLC Waukesha Wisconsin Denmark Atlantic City Electric Co Mays Landing New Jersey Denmark Denmark Spokane Washington Baltimore Gas Electric Co Baltimore Maryland Battelle Memorial Institute Pacific Northwest Division Richland Washington Finland Italy SVEZIA Beacon Power Corporation Tyngsboro Massachusetts

54

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

55

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

56

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

57

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark The Danish Dioxin Technical Report No. 565 #12;[Tom side] #12;National Environmental Research Institute Ministry Report No. 565 Publisher: National Environmental Research Institute URL: Ministry of the Environment http

58

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Annual Danish] #12;National Environmental Research Institute Ministry of the Environment Annual Danish Emissions no. 202 Publisher: National Environmental Research Institute Ministry of the Environment URL: http

59

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark NERI Technical Report No. 602, 2006 Dioxin Air Emission Inventory 1990-2004 #12;(Blank page) #12;National Environmental of Policy Analysis. Publisher: National Environmental Research Institute Ministry of the Environment

60

Vestas Wind Systems AS | Open Energy Information  

Open Energy Info (EERE)

AS AS Jump to: navigation, search Name Vestas Wind Systems AS Place Randers, Denmark Zip DK-8900 Sector Wind energy Product Denmark-based manufacturer of large-scale wind turbines. Coordinates 56.459375°, 10.035795° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.459375,"lon":10.035795,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

EWIS European wind integration study (Smart Grid Project) (Denmark) | Open  

Open Energy Info (EERE)

Denmark) Denmark) Jump to: navigation, search Project Name EWIS European wind integration study Country Denmark Coordinates 56.26392°, 9.501785° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.26392,"lon":9.501785,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

62

Connectable solar air collectors Solar Energy Centre Denmark  

E-Print Network [OSTI]

Connectable solar air collectors Solar Energy Centre Denmark Danish Technological Institute SEC-R-22 #12;Connectable solar air collectors Søren ?stergaard Jensen Miroslav Bosanac Solar Energy Centre Søren ?stergaard Jensen and Miroslav Bosanac Solar Energy Centre, Danish Technological Institute

63

Department of Development and Planning, Aalborg University, Denmark  

E-Print Network [OSTI]

in Engineering Education in Problem and Project-Based Learning (PBL) Environment Chunfang Zhou GroupCreativity Creativity Development in Engineering Education in Problem and Project-Based Learning (PBL) Environment of Engineering and Science, Aalborg University, Denmark #12;Group Creativity Development in Engineering Education

Kolaei, Alireza Rezania

64

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark ExternE transport Report No. 523 #12;[Blank page] #12;National Environmental Research Institute Ministry of the Environment No. 523 Publisher: National Environmental Research Institute Ministry of the Environment URL: http

65

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark The Danish Air;National Environmental Research Institute Ministry of the Environment The Danish Air Quality Monitoring Environmental Research Institute Ministry of the Environment URL: http://www.dmu.dk Date of publication: June

66

Electrolysis for Energy Storage & Grid Balancing in West Denmark  

E-Print Network [OSTI]

& Solutions 16 4. Electrolysis at West Denmark's Decentral Power Stations (incl. Stationary Fuel Cells) 24 5 teknologiudvikling ved afslutningen af den billge oilies æra) 11 3. Danish Wind Carpet Behaviour, Challenges was supported and sponsored by Energistyrelsen (Danish Energy Authority), Amaliegade 44, 1256 Copenhagen K www

67

Bioenergy and emerging biomass conversion technologies Hanne stergrd, Ris National Laboratory, Technical University of Denmark DTU, Denmark  

E-Print Network [OSTI]

Bioenergy and emerging biomass conversion technologies Hanne ?stergård, Risø National Laboratory in Denmark 8th May 2007 Background Bioenergy is an important topic to include in a foresight analysis of the world agricultural markets and Europe. In the recent Agricultural Outlook report from OECD-FAO1

68

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

69

ACTA ORIENTALIA, founded in 1922, published annually under the auspices of the Oriental Societies of Denmark, Finland, Norway and Sweden,  

E-Print Network [OSTI]

of Denmark, Finland, Norway and Sweden, with support from the Nordic Publications Board for Periodicals

Løw, Erik

70

NEG Micon A S | Open Energy Information  

Open Energy Info (EERE)

NEG Micon A S NEG Micon A S Jump to: navigation, search Name NEG Micon A/S Place Randers, Denmark Zip DK-8900 Sector Wind energy Product Defunct wind turbine manufacturer that was involved in project development and maintenance, that was bought by Vestas at the end of 2003. Coordinates 56.459375°, 10.035795° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.459375,"lon":10.035795,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

71

Vestas | Open Energy Information  

Open Energy Info (EERE)

Vestas Vestas Jump to: navigation, search Logo: Vestas Name Vestas Address Alsvej 21 Place Randers, Denmark Zip 80550 Sector Wind energy Product Wind turbines Number of employees 1001-5000 Website http://www.vestas.com/ Coordinates 56.4272213°, 10.0411098° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.4272213,"lon":10.0411098,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

72

Global Renewable Energy Partners AS GREP AS | Open Energy Information  

Open Energy Info (EERE)

AS GREP AS AS GREP AS Jump to: navigation, search Name Global Renewable Energy Partners AS (GREP AS) Place Randers, Denmark Zip 8900 Sector Wind energy Product Wind project developer. Coordinates 56.459375°, 10.035795° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.459375,"lon":10.035795,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

73

E-Print Network 3.0 - aureus copenhagen denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

und Visualisierung Collection: Mathematics 46 Using satellite data for mapping offshore wind resources and wakes Summary: Energy Department, Denmark Copenhagen Offshore Wind,...

74

Awardee AwardeeHeadquarters RecoveryFunding TotalValue Denmark  

Open Energy Info (EERE)

TotalValue Denmark Catalonia Spain Tech Inc Pittsburgh Pennsylvania Madrid Spain Germany Italy Belgium Czech Republic France Germany Ireland Norway United Kingdom Minnesota...

75

Auditing RLAs Statistics Party-List Audits D'Hondt BPA Denmark Risk-Limiting Audits for Party-List Elections  

E-Print Network [OSTI]

Auditing RLAs Statistics Party-List Audits D'Hondt BPA Denmark Risk-Limiting Audits for Party of Denmark Copenhagen, Denmark 21 November 2013 #12;Auditing RLAs Statistics Party-List Audits D'Hondt BPA Statistics Party-List Audits D'Hondt BPA Denmark All vote counting methods can make mistakes · Most concerns

Stark, Philip B.

76

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU  

E-Print Network [OSTI]

Comparative Microbial Genomics group Centerfor%-8531)1-803,% - or - Where Does Vibrio cholera come from? #12;Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU #12;Comparative Microbial Genomics

Ussery, David W.

77

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU Minimal genomes in bacterial Genera Dave Ussery European Conference on Synthetic Biology: Design 2007 #12;Comparative Microbial Genomics group Centerfor

Ussery, David W.

78

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

79

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

80

'Burning for the Future'? A qualitative inquiry into the paradox of incineration as a waste management solution for "green" Denmark.  

E-Print Network [OSTI]

??Paradoxically, despite its reputation as a green leader, Denmark has the highest levels of waste and incineration per capita, as well as low levels of (more)

Husen, Betina

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 19952007 (the  

E-Print Network [OSTI]

1 Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 1995­2007 (the International Cancer Benchmarking Partnership): an analysis of population-based cancer registry data M P Coleman Background Cancer survival is a key measure of the effectiveness of health-care systems. Persistent regional

Maizels, Rick

82

Natural Gas Supply in Denmark -A Model of Natural Gas Transmission and the  

E-Print Network [OSTI]

and power generators of which most are natural gas fired, leads to the natural assumption that the future the consumption of natural gas for heat and power generation is emphasized. General results and threeNatural Gas Supply in Denmark - A Model of Natural Gas Transmission and the Liberalized Gas Market

83

Residential energy use: an international perspective on long-term trends in Denmark, Norway and Sweden  

Science Journals Connector (OSTI)

This paper examines residential energy use in the Scandinavian countries: Denmark, Norway and Sweden, over the period 19731999. The paper uses a decomposition approach to investigate differences in residential energy demand structure and end-use intensities and discusses both differences in absolute levels of energy use and differences over time. Comparisons are also made to other countries that have been analysed in the IEA energy efficiency indicator project. The analysis shows that, in contrast to Denmark and Sweden, Norway saw a growth in total residential energy use between 1973 and 1999. This can be partially explained by the fact that Norway started from a lower per capita income level in the early 1970s but has since then enjoyed a rapid income growth that drove up house area and consequently put a pressure on energy use. But the analysis also shows that Denmark and Sweden achieved significant reductions of residential energy intensities between 1973 and 1990, while the reductions in Norway were negligible. After 1990, the picture changed; there was a strong decline in residential energy intensities in Norway and a high rate of energy savings compared to most other countries analysed by the IEA, while energy savings in Denmark and Sweden more or less came to a halt.

Fridtjof Unander; Ingunn Ettestl; Mike Ting; Lee Schipper

2004-01-01T23:59:59.000Z

84

Future Smart Energy -Fuel Cell and Hydrogen Summer School 2014, Aalborg, Denmark  

E-Print Network [OSTI]

Future Smart Energy - Fuel Cell and Hydrogen Technology Summer School 2014, Aalborg, Denmark August #12;31 Future Smart Energy - Fuel Cell and Hydrogen Technology Samuel Simon Araya Introduction to fuel cells History Why fuel cells? Fuel cell types Fuel and infrastructure Hydrogen production Hydrogen

Berning, Torsten

85

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark E. coli pangenomics - or - How to compare hundreds of E. coli genomes Fuzzy Dave Ussery Ullevål Universitetssykehus Oslo, Norway Wednesday, 10 December, 2008 #12;Comparative Microbial Genomics group Centerfor

Ussery, David W.

86

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark Burkholderia Pan-genomics Dave Ussery Max Planck Institut fur Terrestrial Microbiology Marburg, Germany 26 May, 2008 - or - What can we learn from more than 50 sequenced genomes? #12;Comparative Microbial Genomics

Ussery, David W.

87

Andersen Efficient Audio Power Amplification -Challenges International Conference, Copenhagen, Denmark, 2005 September 24 1  

E-Print Network [OSTI]

Andersen Efficient Audio Power Amplification - Challenges AES 27th International Conference, Copenhagen, Denmark, 2005 September 2­4 1 EFFICIENT AUDIO POWER AMPLIFICATION - CHALLENGES MICHAEL A. E a decade efficient audio power amplification has evolved and today switch-mode audio power amplification

88

Cross-border transfer of climate change mitigation technologies : the case of wind energy from Denmark and Germany to India  

E-Print Network [OSTI]

This research investigated the causal factors and processes of international development and diffusion of wind energy technology by examining private sector cross-border technology transfer from Denmark and Germany to India ...

Mizuno, Emi, Ph. D. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

89

EcoGrid Denmark, ForskEL (Smart Grid Project) | Open Energy Information  

Open Energy Info (EERE)

Grid Project) Grid Project) Jump to: navigation, search Project Name EcoGrid Denmark, ForskEL Country Denmark Coordinates 56.26392°, 9.501785° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.26392,"lon":9.501785,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

90

The role of government in privatisation: an economic model from Denmark  

Science Journals Connector (OSTI)

As industrialised countries go through an economic conversion from public sector industries or government managed companies to privately owned companies, leaders and decision makers are seeking new models. There are very few, if any, economic models that provide a ''bridge'' or transition from the public or government to the private sector, let alone that have been successful. The issue is, nevertheless, very important today as a number of industrialised and developing countries are moving from governmentally controlled industries to the private sector. This paper focuses upon economic models. One good example is taken from Denmark. Other examples are drawn from the USA and especially the deregulation of the energy industry in California, which makes a good region to study. As a ''bell-weather'' state for other states in the USA and indeed, internationally, many governments are watching the ''great California experiment'' in deregulation of energy/power utilities. The economic model from Denmark, which is described below, has also begun to have an impact on California legislative programs being proposed but not yet implemented, for economic development. Further research and analysis will document and analyse such efforts in the future. The issue is clear: global competitiveness does not allow the USA or other countries to wait for the ideal ''open or free'' markets conditions to restructure its economy. In fact, an argument could be made that such ''free markets'' never existed in the first place and certainly will not in the future. Instead, new economic models for the privatisation of historical governmental industries must be sought that are public and private collaboration working together, rather than a choice between one or the other form of business and economic development. Other countries have had a tradition of such partnerships. Among them is Denmark, which is leading the way in many areas of economic development. This paper focuses upon one successful set of programs in Denmark: IO and IFU Funds. A description and some evaluative data provide a perspective and potential application to other industrialised as well as developing countries for the privatisation of government industries.

Woodrow W. Clark Jr.; J. Dan Jensen

2001-01-01T23:59:59.000Z

91

NKS Conference on Radioactive Contamination in Urban Areas Ris National Laboratory, DK-4000 Roskilde, Denmark, 7 -9 May, 2003  

E-Print Network [OSTI]

NKS Conference on Radioactive Contamination in Urban Areas Risø National Laboratory, DK-4000 vegetation to reduce 1 #12;NKS Conference on Radioactive Contamination in Urban Areas Risø National Roskilde, Denmark, 7 - 9 May, 2003 Radiation protection and decision-making on cleanup of contaminated

92

Maher and Shaw Directional Aspects of Forensic Gunshot Recordings AES 39th International Conference, Hillerd, Denmark, 2010 June 1719 1  

E-Print Network [OSTI]

Maher and Shaw Directional Aspects of Forensic Gunshot Recordings AES 39th International Conference, Hillerød, Denmark, 2010 June 17­19 1 DIRECTIONALASPECTS OF FORENSIC GUNSHOT RECORDINGS ROBERT C. MAHER rob.maher@montana.edu Crime scene forensic evidence may include audio gunshot recordings obtained from

Maher, Robert C.

93

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

94

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

95

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

96

SunFlake AS | Open Energy Information  

Open Energy Info (EERE)

AS Place: Copenhagen, Denmark Zip: DK-2100 Sector: Efficiency Product: Danish manufacturer of nanostructured PV cells with up to 30% efficiency. References: SunFlake AS1...

97

Advanced Offshore Solutions ApS AOS | Open Energy Information  

Open Energy Info (EERE)

Offshore Solutions ApS AOS Jump to: navigation, search Name: Advanced Offshore Solutions ApS (AOS) Place: Tranbjerg, Denmark Zip: 8310 Sector: Wind energy Product: Denmark-based...

98

Scan Energy AS | Open Energy Information  

Open Energy Info (EERE)

Scan Energy AS Jump to: navigation, search Name: Scan Energy AS Place: Dybvad, Denmark Zip: DK-9352 Sector: Solar, Wind energy Product: Denmark-based solar and wind power project...

99

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 Ammonia Emissions from Broiler Houses in Pennsylvania  

E-Print Network [OSTI]

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 1 Ammonia Emissions from Broiler Houses in Pennsylvania During Cold of reducing ammonia (NH3) emissions are under study. Ammonia emissions during cold weather conditions from

Kentucky, University of

100

Monitoring of saline tracer movement with vertically distributed self-potential measurements at the HOBE agricultural test site, Voulund, Denmark  

E-Print Network [OSTI]

The self-potential (SP) method is sensitive to water fluxes in saturated and partially saturated porous media, such as those associated with rainwater infiltration and groundwater recharge. We present a field-based study at the Voulund agricultural test site, Denmark, that is, to the best of our knowledge, the first to focus on the vertical self-potential distribution prior to and during a saline tracer test. A coupled hydrogeophysical modeling framework is used to simulate the SP response to precipitation and saline tracer infiltration. A layered hydrological model is first obtained by inverting dielectric and matric potential data. The resulting model that compares favorably with electrical resistance tomography models is subsequently used to predict the SP response. The electrokinetic contribution (caused by water fluxes in a charged porous soil) is modeled by an effective excess charge approach that considers both water saturation and pore water salinity. Our results suggest that the effective excess char...

Jougnot, Damien; Haarder, Eline B; Looms, Majken C

2015-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Differentiated long term projections of the hourly electricity consumption in local areas. The case of Denmark West  

Science Journals Connector (OSTI)

Abstract Assessing grid developments the spatial distribution of the electricity consumption is important. In Denmark the electricity grid consists of transmission and local distribution grids with different voltages that are connected via transformer stations each covering a local area with between 10.000 and 100.000 customers. Data for the hourly electricity consumption at transformer stations shows that the profile of consumption differs considerably between local areas, and this is partly due to a different weight of categories of customers in the different areas. Categories of customers have quite distinct consumption profiles and contribute quite differently to the aggregated load profile. In forecasts, demand by categories of customers is expected to develop differently implying that both the level and the profile of consumption at each transformer stations are expected to change differently. Still, in the previous planning of the transmission grid in Denmark specific local conditions have not been considered. As a first step towards differentiated local load forecasts, the paper presents a new model for long term projections of consumption in local areas and illustrates a first use of the model related to the transmission grid planning by the Danish TSO Energinet.dk. The model is a distribution system that distributes hourly consumption in an aggregated area to hourly consumption at each transformer station. Using econometrics, the model is estimated on national statistics for the hourly consumption by categories of customers and data for the hourly consumption at each transformer station for the years 20092011. Applying the model for load forecasts, a major conclusion is that different transformer stations will experience different changes both in the level - and in the hourly profile of load.

F.M. Andersen; H.V. Larsen; N. Juul; R.B. Gaardestrup

2014-01-01T23:59:59.000Z

102

Can innovative business models overcome resistance to electric vehicles? Better Place and battery electric cars in Denmark  

Science Journals Connector (OSTI)

This paper explores the geographical and policy context for an emergent business model from Better Place to deliver battery electric car mobility in Denmark. It argues that the combination of radically different technologies and a highly complex multi-agency operating environment theoretically provide the conditions and requirements for such an emergent business model. While focused on battery electric cars, renewable energy generation and smart grids, the paper has wider applicability to an understanding of the interplay between place, innovation and sustainability which suggests that diverse solutions are likely to be the characteristic solution rather than ubiquity and standardization. The paper argues, however, that the innovative business model, the deployment of electric vehicles, and the use of renewable energy systems, in this case largely based on wind power, while mutually supportive and contributing to wider policy aims with respect to the reduction of carbon emissions, may still fail in the face of entrenched practices. At the theoretical level it is concluded that theorization of business models needs a broader perspective beyond the typical value creation, value capture rubric to better understand the wider role such models have in meeting societal goals, and to understand the structural impediments to organizational and technical innovation.

Thomas Budde Christensen; Peter Wells; Liana Cipcigan

2012-01-01T23:59:59.000Z

103

E-Print Network 3.0 - af randers evalueringen Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences, Washington State University Collection: Environmental Sciences and Ecology ; Power Transmission, Distribution and Plants 98 On the Flag Curvature of Finsler Metrics of...

104

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

105

Home composting as an alternative treatment option for organic household waste in Denmark: An environmental assessment using life cycle assessment-modelling  

SciTech Connect (OSTI)

An environmental assessment of the management of organic household waste (OHW) was performed from a life cycle perspective by means of the waste-life cycle assessment (LCA) model EASEWASTE. The focus was on home composting of OHW in Denmark and six different home composting units (with different input and different mixing frequencies) were modelled. In addition, incineration and landfilling was modelled as alternatives to home composting. The most important processes contributing to the environmental impact of home composting were identified as greenhouse gas (GHG) emissions (load) and the avoided emissions in relation to the substitution of fertiliser and peat when compost was used in hobby gardening (saving). The replacement of fertiliser and peat was also identified as one of the most sensible parameters, which could potentially have a significant environmental benefit. Many of the impact categories (especially human toxicity via water (HTw) and soil (HTs)) were affected by the heavy metal contents of the incoming OHW. The concentrations of heavy metals in the compost were below the threshold values for compost used on land and were thus not considered to constitute a problem. The GHG emissions were, on the other hand, dependent on the management of the composting units. The frequently mixed composting units had the highest GHG emissions. The environmental profiles of the home composting scenarios were in the order of -2 to 16 milli person equivalents (mPE) Mg{sup -1} wet waste (ww) for the non-toxic categories and -0.9 to 28 mPE Mg{sup -1} ww for the toxic categories. Home composting performed better than or as good as incineration and landfilling in several of the potential impact categories. One exception was the global warming (GW) category, in which incineration performed better due to the substitution of heat and electricity based on fossil fuels.

Andersen, J.K.; Boldrin, A.; Christensen, T.H. [Department of Environmental Engineering, Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark); Scheutz, C., E-mail: chas@env.dtu.dk [Department of Environmental Engineering, Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark)

2012-01-15T23:59:59.000Z

106

Risoe Energy Conference Copenhagen, Denmark  

E-Print Network [OSTI]

Zambia Ltd (CEEEZ) Private Bag E721, Lusaka ZAMBIA Tel/Fax: +260 - 1 - 240267 Email: yamba Cane Molasses/Juice Crop Residues (Bagasse) Sugar/Solids Raw Sugar Industrial Uses Steam & Electricity%) Biomass (0%) Other/Nuclear (1.9%) Figure: SAPP Installed Electricity Capacity for 2000 (Total Energy 45 GW

107

Is a German Harbour Porpoise much more sensitive than a British one? Comparative analyses of mandatory measures for the protection of Harbour Porposes (Phocoena phocoena) during Offshore Wind Farm ramming in Germany, Denmark and the UK  

Science Journals Connector (OSTI)

Offshore wind farms (OWF) will soon contribute to significant growth in the renewable energy sector. At present just a few OWF have been built. As of 2012 Germany has an offshore wind capacity of little more than 200 MW whereas Denmark has already reached 875 MW and the UK soon will reach 2.000 MW. There are plans for another 114 GW in EU countries with a cumulative investment of 211 billion Euro. This expansion of offshore wind energy needs to be organized in a sustainable way. The Habitat Directive has to be considered in each European country in the same way. Currently the environmental impacts of the underwater noise on porpoises caused by jack-hammers that are mostly used to drive the pile foundations into the seabed are assessed differently amongst the forerunners of offshore wind energy like Denmark Great Britain and Germany. This paper includes an overview of the possible applied measures for avoiding damages as well as obligatory measures and the different thresholds of European countries. The analysis concludes by identifying a need for international standardization. The paper is result of research as part of the PhD thesis "Strategies for Sustainable Development of Offshore Wind Energy" of the author.

Jens Luedeke

2014-01-01T23:59:59.000Z

108

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

109

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

110

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

111

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

112

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

113

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

114

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

115

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

116

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

117

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

118

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

119

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

120

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

122

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

123

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

124

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

125

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

126

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

127

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

128

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

129

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

130

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

131

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

132

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

133

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

134

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

135

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

136

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

137

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

138

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

139

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

140

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

142

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

143

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

144

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

145

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

146

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

147

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

148

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

149

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

150

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

151

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

152

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

153

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

154

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

155

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

156

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

157

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

158

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

159

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

160

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

162

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

163

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

164

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

165

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

166

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

167

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

168

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

169

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

170

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

171

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

172

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

173

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

174

A quality OpenEI entry | OpenEI Community  

Open Energy Info (EERE)

A quality OpenEI entry A quality OpenEI entry Home > Groups > OpenEI Community Central Graham7781's picture Submitted by Graham7781(1992) Super contributor 9 February, 2010 - 11:34 imported OpenEI Here is a video highlighting 5 key characteristics of a quality OpenEI entry for Vestas, a wind company based in Randers, Denmark. These characteristics are: A form filled out completely, with good references The first sentence with the company in bold, location as a link. Good table of contents Images for style YouTube video embedded into the article. There is specific syntax required to complete some of these steps, which are highlighted in the video. More information can be found at the OpenEI Help page. You can find this video, along with all other videos at our OpenEI youtube channel.

175

A Green Energy Plan for Denmark  

Science Journals Connector (OSTI)

This note presents the main results from a research project, in the Department of Development and Planning at Aalborg University. More detailed information of the full study is given in (Lund 1996: 2) and (Lund 1...

Henrik Lund

1999-10-01T23:59:59.000Z

176

Environmental Radioactivity in Denmark in 1983  

E-Print Network [OSTI]

, potatoes, vegetables, (continued) INIS-Descriptors: AIR; AMERICIUM ISOTOPES; AQUATIC ECOSYSTEMS; AT was determined in precipitation, ground water and sea water. Plutonium and Americium were measured in marine

177

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

178

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

179

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

180

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

182

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

183

Denmark, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

70187°, -77.0530235° 70187°, -77.0530235° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.1570187,"lon":-77.0530235,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

184

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

at offshore wind turbines NERI Technical Report, No. 440 #12;National Environmental Research Institute for estimating collision frequency of migrating birds at offshore wind turbines NERI Technical Report, No. 440 of a method for estimating collision frequency of migrating birds at offshore wind turbines Author: Mark

185

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

: Danish Environmental Protection Agency Please cite as: Illerup, J.B, Nielsen, O-K., Winther, M, i.e. the latest official forecast from the Danish Energy Authority. The emission factors refer sce- narios together with the expected results of a few individual policy measures. Official Danish

186

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

, CO, CO2 , N2 O, PM, heavy metals, dioxin, PAH, green- house gas Layout: Ann-Katrine Holme Greenhouse gas emission 33 5.1 CO2 35 5.2 CH4 39 5.3 N2 O 41 6 SO2 , NOX , NMVOC and CO 43 6.1 SO2 43 6.2 NOX , NMVOC, CH4 , CO, CO2 , N2 O, particulate matter, heavy metals, diox- ins and PAH. Since 1990 the fuel

187

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

statistics 23 4.2 Trends 24 4.3 Results from model calculations 25 &DUERQ PRQR[LGH 5.1 Annual statistics 29

188

Technical University of Denmark A Thesis Submitted for the Degree  

E-Print Network [OSTI]

and Logging in compliance with IEC 61400-25 Using Wind Power Plant Configuration Language (WPPCL) Author: s;Abstract Vendors and customers in the wind power plant market are not capable of choos- ing each other for modeling wind power plants in the soft- ware domain. IEC 61400-25 addresses this challenge. This thesis

189

16-11-051ETSAP Modelling Issues in Denmark  

E-Print Network [OSTI]

energy use and more electricity and district heating0 100 200 300 400 500 600 700 800 900 80 '82 '84 '86 · Large share of combined heat and power · Moderate increase in household electricity demand · Larger incineration and CCGT up to 100 MW. · Small district heating systems: Gas motors below 20 MW and district

190

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

: Department of Policy Analysis Publisher: National Environmental Research Institute University of Aarhus and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO2, NOX, NMVOC, CH4, CO, CO2, N2O, particulate matter, heavy metals, dioxins and PAH. A consider- able decrease

191

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

and dioxin 53 11 Uncertainty 57 11.1 Methodology 57 #12;11.1.1 Greenhouse gases 57 11.1.2 Other pollutants 58 Illerup Department: Department of Policy Analysis Serial title and no.: Research Notes from NERI No. 192- odologies and assumptions used for the inventories are described. The pollutants considered are: SO2 , NOx

192

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Illerup Department: Department of Policy Analysis Serial title and no.: Research Notes from NERI No. 229 are described. The pollutants con- sidered are SO2 , NOX , NMVOC, CH4 , CO, CO2 , N2 O, particulate matter, heavy metals, dioxins and PAH. Since 1990 the fuel consumption in stationary combustion has in- creased

193

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

c-coal) 28 5.5 Transport ­ Road Transportation ­ Gasoline (1A3b-gasoline) 29 5.6 Transport ­ Road

194

Henrik Schiott Sorensen Technical University of DenmarkRoskilde,  

E-Print Network [OSTI]

index measuring technique based on light interacting with a microfluidic channel. In this method the physical variable being measured is the change in refractive index with time, which can be caused a complete decisive analysis on whole blood at near-to real-time speed with unprecedented sensitivity

195

SeWave | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » SeWave Jump to: navigation, search Name SeWave Place Denmark Zip FO-110 Product Denmark-based 50:50 JV between UK's Wavegen and Faroese electricity company SEV to to design and build a tunnelled demonstration wave power plant in the Faroes Islands. References SeWave[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This article is a stub. You can help OpenEI by expanding it. SeWave is a company located in Denmark . References ↑ "SeWave"

196

Wave Star Energy | Open Energy Information  

Open Energy Info (EERE)

Star Energy Star Energy Jump to: navigation, search Name Wave Star Energy Place Denmark Zip DK-2920 Product Denmark-based private wave device developer. References Wave Star Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: Wave Star Energy 1 10 Scale Model Test This company is involved in the following MHK Technologies: C5 WaveStar This article is a stub. You can help OpenEI by expanding it. Wave Star Energy is a company located in Denmark . References ↑ "Wave Star Energy" Retrieved from "http://en.openei.org/w/index.php?title=Wave_Star_Energy&oldid=678928" Categories: Clean Energy Organizations

197

ChoosEV | Open Energy Information  

Open Energy Info (EERE)

ChoosEV ChoosEV Jump to: navigation, search Name ChoosEV Place Copenhagen, Denmark Zip 1606 Product Denmark based company formed by Sydenergi, Seus-Nve and Sixt. The company will focus on developing simple charging stands linked to the electric grid in Denmark. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

198

Green Wind Energy formerly Solund Invest | Open Energy Information  

Open Energy Info (EERE)

Solund Invest Solund Invest Jump to: navigation, search Name Green Wind Energy (formerly Solund Invest) Place DK-3460 Birkerød, Denmark Zip DK-3460 Sector Wind energy Product Danish investment company specializing in structuring and selling wind turbine projects in Denmark and abroad to private investors. References Green Wind Energy (formerly Solund Invest)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Green Wind Energy (formerly Solund Invest) is a company located in DK-3460 Birkerød, Denmark . References ↑ "[ Green Wind Energy (formerly Solund Invest)]" Retrieved from "http://en.openei.org/w/index.php?title=Green_Wind_Energy_formerly_Solund_Invest&oldid=346065"

199

Colexon Solar Invest AS Formerly Renewagy AS | Open Energy Information  

Open Energy Info (EERE)

Invest AS Formerly Renewagy AS Invest AS Formerly Renewagy AS Jump to: navigation, search Name Colexon Solar Invest AS (Formerly Renewagy AS) Place Virum, Denmark Zip DK-2830 Sector Solar, Wind energy Product Denmark-based development and investment company that focuses on wind and solar PV project development. References Colexon Solar Invest AS (Formerly Renewagy AS)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Colexon Solar Invest AS (Formerly Renewagy AS) is a company located in Virum, Denmark . References ↑ "Colexon Solar Invest AS (Formerly Renewagy AS)" Retrieved from "http://en.openei.org/w/index.php?title=Colexon_Solar_Invest_AS_Formerly_Renewagy_AS&oldid=34

200

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

202

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

203

Danish Solar Energy PLC | Open Energy Information  

Open Energy Info (EERE)

Solar Energy PLC Solar Energy PLC Jump to: navigation, search Name Danish Solar Energy PLC Place Copenhagen - Freeport, Denmark Zip DK-2100 Sector Solar Product Copenhagen-based producer of solar cell systems including turnkey solutions design/development, consultancy, project management and manufacture of modules, electronic hardware. References Danish Solar Energy PLC[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Danish Solar Energy PLC is a company located in Copenhagen - Freeport, Denmark . References ↑ "Danish Solar Energy PLC" Retrieved from "http://en.openei.org/w/index.php?title=Danish_Solar_Energy_PLC&oldid=344064" Categories: Clean Energy Organizations

204

Danionics A S | Open Energy Information  

Open Energy Info (EERE)

Danionics A S Danionics A S Jump to: navigation, search Name Danionics A/S Place Copenhagen, Denmark Zip DK-1471 Product An international manufacturer of advanced lithium-ion polymer batteries with activities in Denmark (R&D and sales), China (manufacturing) and sales offices in a number of countries. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

205

1st Mile | Open Energy Information  

Open Energy Info (EERE)

Mile Mile Jump to: navigation, search Name 1st Mile Place Lyngby, Denmark Zip 2800 Product Denmark-based company that provides research and screening for venture capitalists. Website http://www.1stmile.dk/ Coordinates 56.866669°, 8.31667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.866669,"lon":8.31667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

206

RAcell Solar AS | Open Energy Information  

Open Energy Info (EERE)

RAcell Solar AS RAcell Solar AS Jump to: navigation, search Name RAcell Solar AS Place Copenhagen, Denmark Zip 1820 Sector Solar Product Denmark based producer of solar cells and modules; also provides turnkey system installation for PV and BIPV. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

207

LM Wind Power formerly LM Glasfiber AS | Open Energy Information  

Open Energy Info (EERE)

LM Glasfiber AS LM Glasfiber AS Jump to: navigation, search Name LM Wind Power (formerly LM Glasfiber AS) Place Kolding, Denmark Zip 6000 Sector Wind energy Product Denmark-based manufacturer of blades for large-scale wind turbines. Coordinates 55.486405°, 9.473455° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.486405,"lon":9.473455,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

208

EMD International AS formerly Energi og Milj data | Open Energy Information  

Open Energy Info (EERE)

EMD International AS formerly Energi og Milj data EMD International AS formerly Energi og Milj data Jump to: navigation, search Name EMD International AS (formerly Energi-og Miljødata) Place Aalborg Ã~, Denmark Zip 9220 Sector Biomass, Wind energy Product An independent software developer supplying companies and institutions worldwide with wind assessment/turbine siting software. Also provides software for gossil fuel and biomass projects. References EMD International AS (formerly Energi-og Miljødata)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. EMD International AS (formerly Energi-og Miljødata) is a company located in Aalborg Ã~, Denmark . References ↑ "[ EMD International AS (formerly Energi-og Miljødata)]"

209

CT Offshore | Open Energy Information  

Open Energy Info (EERE)

CT Offshore CT Offshore Place Otterup, Denmark Zip 5450 Sector Wind energy Product Denmark-based consultancy which provides assistance for project management, damage assessment and stabilization as well as other activities related to wind farms and subsea maintenance. Coordinates 55.543228°, 10.40294° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.543228,"lon":10.40294,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

210

Danish Wind Turbine Owners Association | Open Energy Information  

Open Energy Info (EERE)

Owners Association Owners Association Jump to: navigation, search Name Danish Wind Turbine Owners' Association Place Aarhus C, Denmark Zip DK-8000 Sector Wind energy Product Danish Wind Turbine Ownersâ€(tm) Association is a non-profit, independent association overseeing wind turbine ownersâ€(tm) mutual interests regarding the authorities, political decision-makers, utilities and wind turbine manufacturers. References Danish Wind Turbine Owners' Association[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Danish Wind Turbine Owners' Association is a company located in Aarhus C, Denmark . References ↑ "Danish Wind Turbine Owners' Association" Retrieved from "http://en.openei.org/w/index.php?title=Danish_Wind_Turbine_Owners_Association&oldid=344068

211

Merchant Green | Open Energy Information  

Open Energy Info (EERE)

Merchant Green Merchant Green Jump to: navigation, search Name Merchant Green Place Holstebro, Denmark Zip DK7500 Sector Renewable Energy, Wind energy Product Denmark-based market intelligence firm focused on wind and renewable energy. Coordinates 56.36254°, 8.620257° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.36254,"lon":8.620257,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

212

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

213

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

214

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

215

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

216

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

217

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

218

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

219

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

220

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

The potential for arbitrage of wind and solar surplus power in Denmark  

Science Journals Connector (OSTI)

Abstract We have recently developed a simple yet powerful method to identify key properties of electricity systems with a high share of renewables. Here, our weather-driven methodology is described and applied to model the Danish power system with combined wind and solar energy gross shares of up to 100% of the total demand. We show that in a wind only scenario, surplus energy grows rapidly beyond gross shares of about 50%, while the potential for arbitrage of surplus renewable energy, i.e. demand-side management or high-efficiency storage, is very limited in this case. A scenario with a wind-solar energy mix of 80/20, on the other hand, both decreasesthe total amount of surplus and has a significantly higher potential for arbitrage of the remaining surplus. However, beyond gross shares of about 75%, only large-scale seasonal storage of, e.g. hydrogen, enables the use of Danish surplus wind and solar energy to cover the residual Danish electricity demand in both scenarios.

Gorm B. Andresen; Rolando A. Rodriguez; Sarah Becker; Martin Greiner

2014-01-01T23:59:59.000Z

222

E-Print Network 3.0 - aquifer grindsted denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

worldwide potential: very big Deep saline aquifers 400 - 10,000 Gt (16 - 400yr) Oil and gas... Party Group Sci Tech,. Holyrood 10 Injection: buoyant, then lateral Injection Top...

223

E-Print Network 3.0 - animals snekkersten denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Modelling Collection: Mathematics ; Computer Technologies and Information Sciences 71 Biogas Co-substrates for the Farm and Food Sectors Workshop Summary: , Canada Focus on...

224

E-Print Network 3.0 - addition study denmark Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 ... Source: Ecole Polytechnique, Centre de mathmatiques Collection: Mathematics 26 UPGRADING OF WASTE-TO-ENERGY PLANT IN BRESCIA, ITALY Summary: treatment options outlined...

225

Ineson, J. R. & Surlyk, F. (eds) 2003. The Jurassic of Denmark and Greenland.:  

Science Journals Connector (OSTI)

...established'. Great stuff and a real eye opener to the personalities...surrounded by dense housing estates with their attendant vandalism...Valuing the Resource: the Sustainable Ap-proach', was introduced...in Somerset has remained a sustainable resource despite two centuries...

Simon R. A. Kelly

226

Value seeking, price sensitive, or green? Analyzing preference heterogeneity among residential energy consumers in Denmark  

Science Journals Connector (OSTI)

Abstract This study examines the heterogeneous consumer preference for electricity products in the residential electricity retailing market. Based on consumers trade-off decision making, we identified three distinct consumer segments: the value seeking consumers (53%), the price sensitive consumers (25%), and the green consumers (22%). We concluded that consumers are willing to pay extra for the increasing share of renewable energy. Consumer socio-demographic characteristics had also influence on their choices for electricity products. The findings of this study can help explain how different consumer segment can be affected by the change of electricity product attributes. Thus, it provides insightful knowledge on how to differentiate electricity products so as to satisfy specific consumer segments needs. Finally, the findings of this study have implications for energy policy makers (regulators) on consumers preference for electricity products assuming that consumers should make a choice among various products.

Yingkui Yang; Hans Stubbe Solgaard; Wolfgang Haider

2015-01-01T23:59:59.000Z

227

The new dedicated PIXE set-up at the National Environmental Research Institute, Denmark  

Science Journals Connector (OSTI)

The Niels Bohr Institute in Copenhagen was in the beginning of the 70es one of the early places for PIXE. Contributions were made to the theoretical interpretation of the PIXE spectra as well as the practical application. The home-made 4 MV van de Graaff accelerator at the Niels Bohr Institute was an excellent tool for PIXE. The accelerator which was used for many years has now found its place on a museum after more than 40 years of active service. A dedicated PIXE set-up has now been established at the National Environmental Research Institute using a new 1.7 MV Tandem Pelletron (5SDH) from NEC. The main application is elemental analysis of outdoor aerosols. The main work is unsophisticated macro analyses which do not push the equipment to its limits. This enables automated analysis of about 10 000 samples per year using very limited manpower resources. The research focuses on the contribution from various source types to the atmosphere over Europe the North Atlantic and Greenland. Source compositions and their temporal variations are studied.

Kre Kemp; Peter Waahlin

1999-01-01T23:59:59.000Z

228

E-Print Network 3.0 - aarhus denmark introduction Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wetlands Conference Utrecht 2004, 25-30 July Summary: wetlands for on-site treatment of wastewater Hans Brix Aarhus University, Institute of Biological Sciences... ,...

229

E-Print Network 3.0 - aarhus denmark field Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wetlands Conference Utrecht 2004, 25-30 July Summary: wetlands for on-site treatment of wastewater Hans Brix Aarhus University, Institute of Biological Sciences... ,...

230

Technical University of Denmark Ris National Laboratory HAWC2 simulations of a floating  

E-Print Network [OSTI]

turbine for deep water Introduction The aeroelastic multi-body code for wind turbine response HAWC2 has-shore turbines the pitch motion is normally slow related to the tower motion causing a positive instantaneous gradient. For floating turbines the tower eigenfrequency is very low (

231

A comparative multivariate analysis of household energy requirements in Australia, Brazil, Denmark, India and Japan  

Science Journals Connector (OSTI)

In this paper, we appraise sustainable household consumption from a global perspective. Using per capita energy requirements as an indicator of environmental pressure, we focus on the importance of income growth in a cross-country analysis. Our analysis is supported by a detailed within-country analysis encompassing five countries, in which we assess the importance of various socioeconomic-demographic characteristics of household energy requirements. We bring together family expenditure survey data, inputoutput tables, and energy statistics in a multivariate analysis. Instead of a uniform Kuznet's curve, we find that the effect of increasing income varies considerably across countries, even when controlling for socioeconomic and demographic variations. The latter variables show similar influences, but differing importance across countries.

Manfred Lenzen; Mette Wier; Claude Cohen; Hitoshi Hayami; Shonali Pachauri; Roberto Schaeffer

2006-01-01T23:59:59.000Z

232

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU  

E-Print Network [OSTI]

Comparative Microbial Genomics group Centerfor systematics - is it relevant to modern science? Istanbul, Turkey 8 August, 2008 - or - What can genomics tell us about Vibrio species? Discovering natural groups in Vibrio #12;Comparative Microbial Genomics

Ussery, David W.

233

Proceedings of ASME Turbo Expo 2012 June 11-15, 2012, Copenhagen, Denmark  

E-Print Network [OSTI]

MODULATION Michael Woopen Institute of Propulsion Technology Turbine Department German Aerospace Center (DLR of Propulsion Technology Turbine Department German Aerospace Center (DLR) G¨ottingen, Germany ABSTRACT Within INTRODUCTION The improvement of the overall efficiency is a major goal within the development of modern gas

234

Ris DTU Dec.3 2009WindScanner.eu 1 Ris DTU, Technical University of Denmark  

E-Print Network [OSTI]

engulfing today's and tomorrows huge on and offshore wind turbines. - a brig less RI for renewable energy IWES (onshore sites, Alpha Ventus ­ FINO 1- 3 offshore) · Norway: SINTEF (offshore technology, floatingScanner.eu Envisioned new RI European Centre for Wind Energy Research in Atmospheric Turbulent Flow "The Wind

235

EAGE Conference & Exhibition incorporating SPE EUROPEC 2012 Copenhagen, Denmark, 4-7 June 2012  

E-Print Network [OSTI]

of equations can be transformed into an equivalent, positive semi-definite system via KACZMARZ row) any variable shared by two or more blocks is updated to be the average of its values in the different in terms of the eigen-

Gordon, Dan

236

From Propaganda to Science: Looking at the World of Academies in Early Seventeenth-century Naples  

E-Print Network [OSTI]

Bohmerland, Sweitzerland, Netherland, Denmarke, Poland,Bohmerland, Sweitzerland, Netherland, Denmarke, Poland,

Gianfrancesco, Lorenza

2012-01-01T23:59:59.000Z

237

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

238

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

239

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

240

Xergi A S | Open Energy Information  

Open Energy Info (EERE)

Xergi A S Xergi A S Jump to: navigation, search Name Xergi A/S Place Aalborg, Denmark Zip DK-9200 Sector Biomass Product Turnkey solutions provider of energy and enviromental CHP plants typically utilising biogas, biomass and landfill gas. Coordinates 57.049355°, 9.91629° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":57.049355,"lon":9.91629,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

GW Energi | Open Energy Information  

Open Energy Info (EERE)

GW Energi GW Energi Jump to: navigation, search Name GW Energi Place Rødovre, Denmark Zip 2610 Sector Wind energy Product Danish wind farm investor. Coordinates 55.680531°, 12.45423° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.680531,"lon":12.45423,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

242

NordEnergie Renewables A S | Open Energy Information  

Open Energy Info (EERE)

NordEnergie Renewables A S NordEnergie Renewables A S Jump to: navigation, search Name NordEnergie Renewables A/S Place Copenhagen, Denmark Zip DK 1265 Sector Renewable Energy, Solar, Wind energy Product Copenhagen-based renewable energy project developer focused on wind and solar energy. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

243

Wave Dragon ApS | Open Energy Information  

Open Energy Info (EERE)

Dragon ApS Dragon ApS Jump to: navigation, search Name Wave Dragon ApS Place Copenhagen, Denmark Zip DK-2200 Country Albania Product Wave energy converter development company. Has patented the Wave Dragon, an offshore floating slack moored wave energy converter. Coordinates 55.6760968°, 12.5683371° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.6760968,"lon":12.5683371,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

244

AVANTI | Open Energy Information  

Open Energy Info (EERE)

AVANTI AVANTI Jump to: navigation, search Name AVANTI Place Hillerod, Denmark Zip 3400 Sector Wind energy Product AVANTI specialises in the supply of Service Lifts and safety equipment for wind turbine technicians. Coordinates 55.92882°, 12.30561° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.92882,"lon":12.30561,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

245

A2Sea A S | Open Energy Information  

Open Energy Info (EERE)

Sea A S Sea A S Jump to: navigation, search Name A2Sea A/S Place Fredericia, Denmark Zip DK-7000 Sector Wind energy Product Building and engineering contractor specialising in wind turbine transport and installation both onshore and offshore. Coordinates 55.56637°, 9.759105° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.56637,"lon":9.759105,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

246

AH Bolte A S | Open Energy Information  

Open Energy Info (EERE)

AH Bolte A S AH Bolte A S Jump to: navigation, search Name AH Bolte A/S Place Bjert, Denmark Zip DK-6091 Sector Wind energy Product Suppliers of flanges to the wind turbine industry. Coordinates 56.470699°, 8.77293° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.470699,"lon":8.77293,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

247

Aalborg Energie Technik a s | Open Energy Information  

Open Energy Info (EERE)

Aalborg Energie Technik a s Aalborg Energie Technik a s Jump to: navigation, search Name Aalborg Energie Technik a/s Place Aalborg, Denmark Zip 9220 Sector Biomass Product Designs, engineers, constructs and supplies biomass CHP plant, boilers, ranging from 10-100MW. Coordinates 57.049355°, 9.91629° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":57.049355,"lon":9.91629,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

248

Babcock Wilcox Volund A S | Open Energy Information  

Open Energy Info (EERE)

Babcock Wilcox Volund A S Babcock Wilcox Volund A S Jump to: navigation, search Name Babcock & Wilcox Volund A/S Place Esbjerg, Denmark Zip 6705 Sector Biomass Product BWV provides equipment and technologies to convert household waste and biomass into energy. Coordinates 55.46522°, 8.456905° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.46522,"lon":8.456905,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

249

European Wind Farms A S | Open Energy Information  

Open Energy Info (EERE)

S S Jump to: navigation, search Name European Wind Farms A/S Place Lyngby, Denmark Zip 2800 Sector Wind energy Product Focused on wind farm development in Europe. Coordinates 56.866669°, 8.31667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.866669,"lon":8.31667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

250

SSP Technology A S | Open Energy Information  

Open Energy Info (EERE)

SSP Technology A S SSP Technology A S Jump to: navigation, search Name SSP Technology A/S Place Broby, Denmark Zip DK-5672 Sector Wind energy Product Danish wind turbine blade manufacturer. Coordinates 55.22995°, 10.25757° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.22995,"lon":10.25757,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

251

TriWo AG | Open Energy Information  

Open Energy Info (EERE)

TriWo AG TriWo AG Jump to: navigation, search Name TriWo AG Place Trier, Denmark Zip 54290 Sector Solar Product Developer of solar photovoltaic electricity generation project in Germany. Coordinates 49.757256°, 6.636521° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.757256,"lon":6.636521,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

252

Tripod Energy | Open Energy Information  

Open Energy Info (EERE)

Tripod Energy Tripod Energy Jump to: navigation, search Name Tripod Energy Place Søborg, Denmark Zip DK-2860 Sector Services, Wind energy Product Has 24 years of experience providing consultancy services within three main areas of wind energy: -Project Preparation and Implementation -Measurements and Tests -Calculations Coordinates 59.433922°, 17.99242° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.433922,"lon":17.99242,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

253

Amminex A S | Open Energy Information  

Open Energy Info (EERE)

Amminex A S Amminex A S Jump to: navigation, search Name Amminex A/S Place Lyngby, Denmark Zip DK-2800 Sector Hydro, Hydrogen Product Developing ammonia and hydrogen storage systems. Coordinates 56.866669°, 8.31667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.866669,"lon":8.31667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

254

AAEN Consulting Engineers A S | Open Energy Information  

Open Energy Info (EERE)

AAEN Consulting Engineers A S AAEN Consulting Engineers A S Jump to: navigation, search Name AAEN Consulting Engineers A/S Place Risskov, Denmark Zip 8240 Product Danish company working with project development, planning and design withing the field of environment and energy. Coordinates 56.192451°, 10.22672° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.192451,"lon":10.22672,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

255

SPOK EMU Consult | Open Energy Information  

Open Energy Info (EERE)

SPOK EMU Consult SPOK EMU Consult Jump to: navigation, search Name SPOK/ EMU Consult Place Copenhagen, Denmark Zip 2200 Product Manager of the EC backed the Wave Dragon project. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

256

Risoe National Laboratory for Sustainable Energy | Open Energy Information  

Open Energy Info (EERE)

Laboratory for Sustainable Energy Laboratory for Sustainable Energy Jump to: navigation, search Name Risoe National Laboratory for Sustainable Energy Place Roskilde, Denmark Zip DK 4000 Product Roskilde-based, national laboratory under the Ministry of Science, Technology and Innovation focused on various areas of sustainable energy. Coordinates 55.640465°, 12.090923° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.640465,"lon":12.090923,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

257

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

258

WPD Danmark A S i G | Open Energy Information  

Open Energy Info (EERE)

Danmark A S i G Danmark A S i G Jump to: navigation, search Name WPD Danmark A/S (i.G.) Place Rødekro, Denmark Zip 6230 Sector Wind energy Product Denmark-based, subsidiary of WDP AG focused on deal structuring, project controlling, advance funding of project development costs, procuring equity, and the co-development of wind farms. Coordinates 55.069901°, 9.33499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.069901,"lon":9.33499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

259

Core Carbon Group AS CCG | Open Energy Information  

Open Energy Info (EERE)

Carbon Group AS CCG Carbon Group AS CCG Jump to: navigation, search Name Core Carbon Group AS (CCG) Place Copenhagen, Denmark Zip DK-1074 Sector Carbon Product The Core Carbon Group (formerly known as the Russian Carbon Fund) is a limited liability company incorporated in Denmark involving itself in Joint Implementation projects in Russia. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

260

The Late Medieval Agrarian Crisis and Black Death plague epidemic in medieval Denmark: a paleopathological and paleodietary perspective  

E-Print Network [OSTI]

-at-death in different sub-samples of the total sample .................................................................................70 4.3. Kruskal-Wallis H tests comparing mean age-at-death of individuals with and without the skeletal lesions in the male... .......................................191 9.2. Kruskal-Wallis H comparisons of femur length between the sexes ..192 9.3. Statistical comparisons of average femur length through time..........194 9.4. Mean male/female ratio through time...

Yoder, Cassady J.

2009-06-02T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

A bibliography of 17th century German imprints in Denmark and the Duchies of Schleswig-Holstein  

E-Print Network [OSTI]

. In the following decade the *Cf. A. Hagedorn in Mitth. des Vereins f. Hamb. Geschichte VI (1894), Heft 1, No. 9, p. 136. X number of signed items from Glckstadt rose to 62incidentally greater dran the known output of any other press in the monarchy...-Holsteinischen Universittsgesellschaft, 40). Breslau, 1932, [cited as Andreas Koch] Wiberg, S. V. Personalhistoris\\e, statistiske og gnalogiste Bidrag til en almindelig dans\\ Prceste histori ..., I-III. Odense, 1870-71. (Repr., Copen hagen 1959-60). Witt, F. Quellen und...

Mitchell, P. M.

1969-01-01T23:59:59.000Z

262

Gaussian Process Regression for Vessel Performance Monitoring Benjamin Pjedsted Pedersen, FORCE Technology, Copenhagen/Denmark, bpp@force.dk  

E-Print Network [OSTI]

of fouling has been evaluated by comparing e.g. the actual fuel consumption with a theoretical estimate basedGaussian Process Regression for Vessel Performance Monitoring Benjamin Pjedsted Pedersen, FORCE of the energy consumption on a ship. Using different data sets, from five sister container ships, the method

263

The effect of wind speed and direction and surrounding maize on hybrid ventilation in a dairy cow building in Denmark  

Science Journals Connector (OSTI)

Abstract This study evaluated the effect of wind speed and direction and surrounding maize field on the air exchange rate (ACH) and indoor air velocity in a dairy cow building with hybrid ventilation, which combined auto-controlled natural and partial mechanical pit ventilation. The standard k?? turbulence model and standard wall function were applied in CFD modeling with extension of capability to account for the aerodynamics effect of surrounding maize plant canopy in the wind domain by using user defined functions (UDF). This extended model was validated by on-site measured velocities and temperatures. A reasonably good agreement was found between simulated and measured results. The wind speed influenced ACH greatly while modeling the maize field had little effect on ACH with low wind speed. With wind speed of 3.86ms?1 in validation case, modeling the maize field reduced total ACH by 24%, ACH via bottom openings on the sidewall by 89.7% and air speed measured upwind by 71%. The results revealed that the plant canopy had the most significant effect on ACH through the opening on the sidewall. With the variation of wind direction from 0 to 90, the difference of ACH could be 60%.

L. Rong; D. Liu; E.F. Pedersen; G. Zhang

2015-01-01T23:59:59.000Z

264

Community wind power ownership schemes in Europe and their relevance to the United States  

E-Print Network [OSTI]

Roskilde, Denmark: Danish Energy Agency. Berger, J. 1997.Energy in Denmark. Danish Energy Agency for the Renewable

Bolinger, Mark

2001-01-01T23:59:59.000Z

265

Session: Poster Session + Poster Award + Scientific Award + Excellent young wind doctor award (PO.210) Track: Technical  

E-Print Network [OSTI]

-ID: 464) Hans E. Joergensen (Risø DTU, Windenergy, Denmark) Michael Courtney, Denmark (1) Torben Mikkelsen

266

Wind Energy Resource Atlas of Armenia (CD-ROM)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...

267

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

268

Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant

269

Existing Commercial Reference Buildings Constructed In or After 1980 -  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)

270

This dissertation is submitted to Informatics and Mathematical Modelling at the Technical University of Denmark in partial fulllment of the requirements for the  

E-Print Network [OSTI]

damper systems give rise to a relative yaw motion of the bolster with respect to the side frame: stick motion and slip motion, which leads to a discontinuity in the behaviour of the dynamical system and leads to a collapse of the state space, and consequently, change the degrees of freedom of the system

271

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 AMMONIA EMISSIONS FROM LAYER HOUSES IN IOWA  

E-Print Network [OSTI]

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens), hydrogen sulfide (H2S) and carbon dioxide (CO2). Among the air contaminants produced in poultry buildings al. (2003). MATERIALS AND METHODS Housing Description and Management Two types of laying hen houses

Kentucky, University of

272

L b t t di f D kLow carbon energy system studies for Denmark Peter Meibom & Kenneth Karlsson, 2008 June 9th  

E-Print Network [OSTI]

Energy Danish GHG reduction Cutting CO2 Cowi scenarios Future Danish Energy SystemDanish Energy PolicyEnerginet.dk GHG/CO2 reduction compared to 1990 GHG: -15% CO2: -60% GHG: -40%, -80 % CO2: -40%,-50 % GHG: -50: Not dealt with in study A Visionary Danish Energy P li 2025 IDA Energy Plan Danish GHG reduction scenarios

273

Lecture notes during: International Advanced PhD Course on: Climate impacts on the Baltic Sea from science to policy. 27 July-5 August, Nex, Bornholm, Denmark.  

E-Print Network [OSTI]

and governing equations 5 1.4 Physical aspect 7 1.5 Simplifications 8 1.6 Water masses and water pools 12 1 1. Introduction 1.1 Objective 3 1.2 Some illustrative model examples 4 1.3 Conservation principals.7 Strait flows 14 1.8 Intrusions and selected withdrawal 16 1.9 Turbulence 17 1.10 Water and salt balances

Omstedt, Anders

274

In Proceedings of ECSCW'99, The 6th European Conference on Computer Supported Cooperative Work, 12-16 September 1999, Copenhagen, Denmark, pp. 159-178.  

E-Print Network [OSTI]

Research 2 , USA, The Boeing Company 3 , USA gloria.mark@gmd.de, jgrudin@microsoft.com, steven.poltrock@boeing became indispensable. The Boeing Company recently shifted 100,000+ employees to a standard email platform

Mark, Gloria

275

Abstracts of Papers and Talks from the 8Th International Waterfowl Feeding Ecology Symposium, Ribe, Denmark, 18-21 September 1989  

E-Print Network [OSTI]

Journal: Wader Study Group Bulletin Attachment Size p00009-p00026.pdf 2.91 MB Issue: 57 Year: 1989 Pages: 9-26

276

Effects of boosting the supply temperature on pipe dimensions of low-energy district heating networks: A case study in Gladsaxe, Denmark  

Science Journals Connector (OSTI)

Abstract This paper presents a method for the dimensioning of the low-energy District Heating (DH) piping networks operating with a control philosophy of supplying heat in low-temperature such as 55C in supply and 25C in return regularly while the supply temperature levels are being boosted in cold winter periods. The performance of the existing radiators that were formerly sized with over-dimensions was analyzed, its results being used as input data for the performance evaluation of the piping network of the low-energy DH system operating with the control philosophy in question. The optimization method was performed under different mass flow limitations that were formed with various temperature configurations. The results showed that reduction in the mass flow rate requirement of a district is possible by increasing the supply temperature in cold periods with significant reduction in heat loss from the DH network. Sensitivity analysis was carried out in order to evaluate the area of applicability of the proposed method. Hence varied values of the original capacity and the current capacity of the existing radiators were evaluated with the design temperature values that were defined by two former radiator sizing standards.

Hakan ?. Tol; Svend Svendsen

2014-01-01T23:59:59.000Z

277

E-Print Network 3.0 - alcohols quarterly technical Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark, Fysikvej, Building 307, DK-2800 Lyngby, Denmark. The development... the use of biogas to create alcohol for fuel. Higher alcohols are favorable due to their high energy...

278

Integrating Variable Renewable Energy in Electric Power Markers...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Development countries, grid infrastructure in Denmark is aging and in need of routine upgrading. Denmark plans to take radical action to remove public objections-mainly...

279

Immigration Control in the Age of Migration  

E-Print Network [OSTI]

Czech Republic Denmark Finland France ix Germany GreeceCzech Republic, Denmark, Finland, France, Germany, Greece,Portugal Slovak Rep. Finland Malta Ireland Luxembourg Total

Wong, Tak Kei

2011-01-01T23:59:59.000Z

280

E-Print Network 3.0 - ade mabonguje poul Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

doctor award (PO.194) Track: Technical Summary: -ID: 191) Uwe Schmidt Paulsen (Ris DTU, Wind energy department, Denmark) Poul Srensen, Denmark (1) (1 Source: Ris National...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Svendborg Brakes | Open Energy Information  

Open Energy Info (EERE)

Name: Svendborg Brakes Place: Denmark Sector: Wind energy Product: Denmark-based manufacturer of braking systems for the wind industry, as well as for the oil sector....

282

Proark Energy | Open Energy Information  

Open Energy Info (EERE)

Proark Energy Proark Energy Jump to: navigation, search Name Proark Energy Place Copenhagen, Denmark Zip 1370 Sector Renewable Energy, Solar, Wind energy Product Copenhagen-based management company owned by Proark - the Danish real estate company. It controls funds that it channels into renewable energy projects around Europe, particularly into the wind and solar PV sectors respectively. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

283

Siemens PG Wind Power Division formerly Bonus Energy A S | Open Energy  

Open Energy Info (EERE)

PG Wind Power Division formerly Bonus Energy A S PG Wind Power Division formerly Bonus Energy A S Jump to: navigation, search Name Siemens PG Wind Power Division (formerly Bonus Energy A/S) Place Brande, Denmark Zip DK-7330 Sector Wind energy Product A wind turbine manufacturer whose products range from 600kW to 2.3MW. Coordinates 55.94278°, 9.12803° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.94278,"lon":9.12803,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

284

Floating Power Plant A S FPP | Open Energy Information  

Open Energy Info (EERE)

Power Plant A S FPP Power Plant A S FPP Jump to: navigation, search Name Floating Power Plant A/S (FPP) Address Stenholtsvej 27 Place Fredensborg, Denmark Zip DK-3480 Sector Wind energy Product Fredensborg-based company commercialising developments in the wave and wind energy sectors. Poseidon is the company's core development being tested at the site of an existing Dong offshore wind plant. Phone number 45 3391 9120 Website http://www.poseidonorgan.com Coordinates 55.978295°, 12.402055° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.978295,"lon":12.402055,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

285

BankInvest Technology AS | Open Energy Information  

Open Energy Info (EERE)

BankInvest Technology AS BankInvest Technology AS Jump to: navigation, search Name BankInvest Technology AS Place Copenhagen, Denmark Zip DK-2100 Product Copenhagen-based venture capital arm of BankInvest Group, that manages the BankInvest New Energy Solutions fund as well as funds in IT and biotechnology. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

286

BioPartners ApS | Open Energy Information  

Open Energy Info (EERE)

BioPartners ApS BioPartners ApS Jump to: navigation, search Name BioPartners ApS Place Tjele, Denmark Zip 8830 Sector Biomass Product Start-up company offering factual, professional and impartial advice in connection with processes that include biogas production and separation of clean fertilizers directly from degassed digester biomass. Coordinates 56.481861°, 9.62648° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.481861,"lon":9.62648,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

287

Bioener ApS formerly FLS milj a s | Open Energy Information  

Open Energy Info (EERE)

Bioener ApS formerly FLS milj a s Bioener ApS formerly FLS milj a s Jump to: navigation, search Name Bioener ApS (formerly FLS miljø a/s) Place Copenhagen, Denmark Zip 2500 Product Industrial boiler manufacturer and EPC (Engineering, Procurement and Construction) contractor focussing on straw-firing. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

288

UNEP Risoe Centre on Energy Environment and Sustainable Development URC |  

Open Energy Info (EERE)

Risoe Centre on Energy Environment and Sustainable Development URC Risoe Centre on Energy Environment and Sustainable Development URC Jump to: navigation, search Name UNEP Risoe Centre on Energy, Environment and Sustainable Development (URC) Place Roskilde, Denmark Zip DK 4000 Product UN research body that supports UNEP to assist countries (developing ones especially) in incorporating environmental aspects into energy planning and policy worldwide. Coordinates 55.640465°, 12.090923° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.640465,"lon":12.090923,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

289

Middelgrunden Wind Turbine Cooperative | Open Energy Information  

Open Energy Info (EERE)

Middelgrunden Wind Turbine Cooperative Middelgrunden Wind Turbine Cooperative Jump to: navigation, search Name Middelgrunden Wind Turbine Cooperative Place Copenhagen, Denmark Zip 2200 Sector Wind energy Product Copenhagen-based, partnership founded in May 1997 by the Working Group for Wind Turbines on Middelgrunden, with the aim to produce electricity through the establishment and management of wind turbines on the Middelgrunden shoal. Coordinates 55.67631°, 12.569355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.67631,"lon":12.569355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

290

URANIUM IN ALKALINE ROCKS  

E-Print Network [OSTI]

Danish Atomic Energy Commission, Research Establishment, Ris^, Denmark, published by the International Atomic Energy Agency,

Murphy, M.

2011-01-01T23:59:59.000Z

291

Ris-M-2533 THE INFLUENCE OP CHEMICAL REACTIONS ON THE NOBILITY OF RADIO-  

E-Print Network [OSTI]

Roskilde, Denmark #12;INIS descriptors; ADSORPTION; C CODES; CHEMICAL REACTION KINETICS; COMPUTERIZED

292

E-Print Network 3.0 - air temperature air Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Mathematics 12 Connectable solar air collectors Solar Energy Centre Denmark Summary: ......

293

E-Print Network 3.0 - air drop Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Normale Suprieure Collection: Physics 3 Connectable solar air collectors Solar Energy Centre Denmark Summary: ......

294

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

295

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

296

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

XXX VVV 000001 A A 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT WASTE COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 1 VVV XXX 03 31 2008 1 LD WASTE...

297

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

XXX XXX 000031 A M 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 4 1 31 20 -1405.00 -93.00 2 32 50...

298

Nuclear Material Transaction Report NRC 741_1  

National Nuclear Security Administration (NNSA)

1 A D 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 4 YYY XXX 1 31 20 -50397.00 -2335.00 2 31 20...

299

NRC Form 741  

National Nuclear Security Administration (NNSA)

A 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 4 YYY XXX 1 31 20 50397.00 2335.00 03 31 2008 1 FAB...

300

Nuclear Material Transaction Report NRC 741_1  

National Nuclear Security Administration (NNSA)

B 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 0 YYY XXX 04 01 2008 BASED ON SHIPPER'S VALUES Example...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

A A 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT FOREIGN COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 2 YYY RRRR 03 31 2008 1 AH31 1 EG 309 J...

302

Nuclear Material Transaction Report nrc741_1  

National Nuclear Security Administration (NNSA)

A B 1 1 1 1 COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT FOREIGN COMPANY NAME COMPANY ADDRESS CITY, STATE ZIP CODE CONTACT 2 YYY RRRR 04 05 2008 1 AH31 1 EG 309 J...

303

Generation of Nanopores during Desorption of NH3 from Mg(NH3)6Cl2  

Science Journals Connector (OSTI)

Center for Atomic-Scale Materials Physics (CAMP), Department of Physics, Building 307, Technical University of Denmark, DK-2800 Lyngby, Denmark, Amminex A/S, Kemitorvet, Building 206, DK-2800 Lyngby, Denmark, and Center for Sustainable and Green Chemistry, Department of Chemistry, Building 206, Technical University of Denmark, DK-2800 Lyngby, Denmark ... Metal ammine complexes have been known for more than a century,1 but they still turn out to have new and interesting properties. ...

Jens S. Hummelshj; Rasmus Zink Srensen; Marina Yu. Kustova; Tue Johannessen; Jens K. Nrskov; Claus Hviid Christensen

2005-12-09T23:59:59.000Z

305

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

306

Klimaschutzberatung | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Klimaschutzberatung Place: Mnchen, Germany Zip: 80469 Sector: Carbon Product: Look at Carbon Markets References:...

307

Celgard LLC | Open Energy Information  

Open Energy Info (EERE)

Carolina Zip: 28273 Product: Celgard battery separators are polypropylene andor polyethylene electrolytic membranes used in high performance battery applications. References:...

308

Eco Fuel Global | Open Energy Information  

Open Energy Info (EERE)

California Zip: 94596 Sector: Services Product: California-based environmental engineering and consulting firm. It's services include alternative fuel production,...

309

Fermilab | Press Room | Fact Sheets & Brochures | Archives |...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Economic Impacts Economic Impact FY2010 FY2009 FY2008 FY2007 Procurement Distribution Payroll by Zip Code...

310

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip

311

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

312

CSC420--Introduction to Image Understanding, Fall 2011 Assignment 1: Calibration Checkerboards  

E-Print Network [OSTI]

plane that projects to p. (c) In the Matlab code checkerShow.m, implement the above computation to hand in. Both a short written report and the completed Matlab handout code will be submitted a zip file of your Matlab solution code. The zip file must be called A1Matlab.zip, and should consist

Jepson, Allan D.

313

Committee on the Challenges of Modern Society solar energy pilot study. First follow-up report, October 1979, pilot country: United States; co-pilot countries: Denmark and France. CCMS report No. 110  

SciTech Connect (OSTI)

During 1973 to 1978, over twenty nations participated in the NATO/CCMS Solar Energy Pilot Study, whose objective was to promote and accelerate the use of solar heating and cooling of buildings. The activities in this information exchange included (1) the regular reporting of national solar heating and cooling programs, (2) the development of a format for reporting the performance of solar heating and cooling systems, (3) the exchange of system performance reports, (4) the establishment of two specialized working groups for solar-assisted low energy dwellings and passive solar applications. At the conclusion of the pilot study in 1978, the participants formulated recommendations for continued action at the international level, as well as for action at the national level. This report describes the progress made in implementing those recommendations. In addition to detailing the steps taken to continue collaboration in various efforts initiated within the Solar Energy Pilot Study, the report contains papers on the 1979 status of the solar heating and cooling programs in seventeen CCMS countries.

None

1980-01-01T23:59:59.000Z

314

Forest Vegetation Management towards environmental sustainability, N.S. Bentsen (Ed.), Proccedings from the final COST E47 Conference, Vejle, Denmark, 2009/05/57, Forest and Landscape Working Papers n 352009, 4042.  

E-Print Network [OSTI]

, the creation of biomass for the development of wood energy is not to be overlooked. The implementation cost has Papers n° 352009, 4042. Direct Seeding of Woody Plants as an Alternative to Traditional Plantations de France has financed this research program with a view to developing alternative plantation

Paris-Sud XI, Université de

315

IEA Bioenergy Task 42 on Biorefineries: Co-production of fuels, chemicals, power and materials from biomass  

E-Print Network [OSTI]

(DENMARK) Leonard Boniface, Maurice Dohy, Jean-Cristophe Pouet (FRANCE) Thomas Willke (GERMANY) Patrick countries: Austria, Canada, Denmark, France, Germany, Ireland, and the Netherlands. The overview includes........................................................................16 8. Bioethanol, biodiesel and biogas: production and capacity...........................17 9

316

Magnitude, geomorphologic response and climate links of lake level oscillations at Laguna Potrok Aike, Patagonian steppe (Argentina)  

E-Print Network [OSTI]

Aike, Patagonian steppe (Argentina) P. Kliem a,*, J.P. Buylaert b,c , A. Hahn a , C. Mayr d,e , A for Sustainable Energy, Technical University of Denmark (Risø DTU), DK-4000 Roskilde, Denmark d Institute

317

Curriculum Vitae Dr. Christopher C. Wilmers  

E-Print Network [OSTI]

, 2008 University of Aarhus, Denmark, 2007 Stanford University, Palo Alto, 2007 National Institute, NSF, Oecologia, Population Ecology, Proceedings of the Royal Society Environmental Studies Department Global Population Dynamics and Climate, Denmark, 2007 Global Climate Change and Conservation

Wilmers, Chris

318

2015 Wind Energy Systems Engineering Workshop  

Broader source: Energy.gov [DOE]

The National Renewable Energy Laboratory is partnering with the Technical University of Denmarks Department of Wind Energy to co-host the third biennial Wind Energy Systems Engineering Workshop...

319

Changes in convective properties over the solar cycle: effect on p-mode damping rates  

Science Journals Connector (OSTI)

......Grundforskningsfond, Denmark 5 Institute for Fysik og Astronomi, Aarhus Universitet, Denmark...of 1997). 2 Computational details The basic model calculations were carried out essentially...173, Workshop on Stellar Structure: Theory and Tests of Convective Energy Transport......

G. Houdek; W.J. Chaplin; T. Appourchaux; J. Christensen-Dalsgaard; W. Dppen; Y. Elsworth; D.O. Gough; G.R. Isaak; R. New; M.C. Rabello-Soares

2001-10-21T23:59:59.000Z

320

Pre-Service Teachers' and Students' (Mis)Conceptions About the Equal Sign  

E-Print Network [OSTI]

; Denmark, Barco, & Voran, 1976; Van de Walle, 1980 as cited in Baroody & Ginsberg, 1983). Denmark, Barco, and Voran (1976) came to a similar conclusion as Collis, who believed students were not intellectually ready to interpret the equal sign, and also...

Vela, Katherine

2012-02-14T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Detection of skin cancer Section for Cognitive Systems  

E-Print Network [OSTI]

, Technical University of Denmark for EOD HCI systems extraction of meaningful and actionable information.imm.dtu.dk 06/11/20093 DTU Informatics, Technical University of Denmark for EOD HCI systems extraction

322

Sustainable Films and Coatings from Hemicelluloses: A Review  

Science Journals Connector (OSTI)

Sustainable Films and Coatings from Hemicelluloses: A Review ... Ris National Laboratory for Sustainable Energy, Technical University of Denmark, P. O. Box 49, DK-4000 Roskilde, Denmark ... The integration of agro-energy crops and biorefinery manufg. ...

Natanya M. L. Hansen; David Plackett

2008-05-06T23:59:59.000Z

323

Exploiting Wind Versus Coal  

Science Journals Connector (OSTI)

...be offset with turbine mass production...of installed turbines, more than the...Denmark have wind parks offshore, where winds...of installed turbines, more than the...Denmark have wind parks offshore, where winds...

Mark Z. Jacobson; Gilbert M. Masters

2001-08-24T23:59:59.000Z

324

Effect of different amounts and types of calcium on colonic cell proliferation and fecal bile acids concentration  

E-Print Network [OSTI]

in Scandinavia including Finland, Sweden, and Denmark, Teppo and his colleagues showed that the incidence of colon cancer is the highest in Denmark and the lowest in Finland, where it is 50% less than that in Denmark. The gross national product per capita... shown that the population in Kuopio, Finland where people consume large amounts of milk (rich in calcium) has a fourfold lower incidence of colon cancer than the population in Copenhagen, Denmark (34). Similar results were reported in a 19-years...

C?hen Hsiao-Ch?ing

1991-01-01T23:59:59.000Z

325

U  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, the...

326

Report: An Updated Annual Energy Outlook 2009 Reference Case...  

U.S. Energy Information Administration (EIA) Indexed Site

and Development - Austria, Belgium, Czech Republic, Denmark, Finland, France, Germany, Greece, Hungary," "Iceland, Ireland, Italy, Luxembourg, the Netherlands, Norway,...

327

European Partnerships and Projects | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

bilateral research partnerships with countries in Europe, including Denmark, France, Germany, Iceland, Ireland, the Netherlands, Norway, Portugal, Romania, Spain, Sweden,...

328

Microsoft Word - Final Nuclear Materials Management and Safeguards...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

329

Microsoft PowerPoint - 8_Martyn_NMMSS_2013_Foreign Obligations...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, The...

330

Microsoft PowerPoint - 10_ROSE_MARTYN_UPDATED_NMMSS_2014_Foreign...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, The...

331

U  

National Nuclear Security Administration (NNSA)

states: Austria, Belgium, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, the...

332

Microsoft PowerPoint - 2A_Wednesday 5-22 830 NMMSS_2013_Presentation...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

333

Microsoft Word - Foreign Obligation Codes.docx  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

334

Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

ETDE Stakeholders Government Signatories: * Brazil * Canada * Denmark * Finland * Germany * Korea, Rep. of * Mexico * The Netherlands * Norway * Portugal * South Africa * Spain *...

335

E-Print Network 3.0 - andrzej sapek barbara Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Medicine ; Environmental Sciences and Ecology 2 Programme Committee Christel Baier (Germany) Summary: (Sweden) Mahesh Viswanathan (USA) Andrzej Wasowski (Denmark) Conference...

336

Microsoft PowerPoint - 6_Mitch Hembree_Monday 5-20 1115 NMMSS...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

337

Microsoft Word - April2005.doc  

National Nuclear Security Administration (NNSA)

states: Austria, Belgium, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, the...

338

January 2013 Most Viewed Documents for Energy Storage, Conversion...  

Office of Scientific and Technical Information (OSTI)

(Energitjenesten, Copenhagen (Denmark)) Norwegian energy policy Utseth, Anita Energy systems and technologies for the coming century. Proceedings Soenderberg Petersen, L.;...

339

Ris Ris-M-GiD Title and authors)  

E-Print Network [OSTI]

-^ooo Roskilde, Denmark Telephone: (03) 35 51 01« ext. 33*»« telex: INIS Descriptors CALIBRATION DOSE

340

AARHUS UNIVERSITY NTATORIEINVITATION TO ORIENTATION DAY  

E-Print Network [OSTI]

related to your stay in Denmark. 4 pm: Research at Aarhus University Lise Wogensen, BachDMSc, Professor

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Computational analysis of temperature rise phenomena in electric induction motors  

E-Print Network [OSTI]

Computational analysis of temperature rise phenomena in electric induction motors Ying Huai Institute, University of Southern Denmark, Grundvigs Alle 150, Sonderborg, DK-6400, Denmark c Danfoss Drives A/S, Denmark Received 12 October 2002; accepted 20 December 2002 Abstract In developing electric

Melnik, Roderick

342

Heat Supply Who What Where and -Why  

E-Print Network [OSTI]

heat and power plants (CHP) and other heat technologies ...................................10 2Heat Supply in Denmark Who What Where and - Why #12;Title: Heat Supply in Denmark - Who What Where: MONTAGEbureauet Aps Printing: Kailow Graphic Cover photo: Miklos Szabo #12;HEAT SUPPLY IN DENMARK WHO WHAT WHERE

Columbia University

343

ANALYSIS OF POWER BALANCING WITH FUEL CELLS & HYDROGEN  

E-Print Network [OSTI]

ANALYSIS OF POWER BALANCING WITH FUEL CELLS & HYDROGEN PRODUCTION PLANTS IN DENMARK Support program;"Analysis of power balancing with fuel cells & hydrogen production plants in Denmark" ­ March 2009 ­ Project ........................................................................................................................104 #12;"Analysis of power balancing with fuel cells & hydrogen production plants in Denmark" ­ March

344

Puerto Rico | OpenEI  

Open Energy Info (EERE)

Puerto Rico Puerto Rico Dataset Summary Description Source The Wave Energy Resource Assessment project is a joint venture between NREL, EPRI, and Virginia Tech. EPRI is the prime contractor, Virginia Tech is responsible for development of the models and estimating the wave resource, and NREL serves as an independent validator and also develops the final GIS-based display of the data. Source National Renewable Energy Laboratory (NREL) Date Released September 27th, 2011 (3 years ago) Date Updated October 20th, 2011 (3 years ago) Keywords EPRI GIS NREL Puerto Rico shapefile United States Virginia Tech wave energy Data application/zip icon Download Data in CSV Format (zip, 3.4 MiB) application/zip icon Download Wave Power Density Shapefile (zip, 2.5 MiB) application/zip icon Download Wave Energy Period Shapefile (zip, 2.5 MiB)

345

Transportation Energy Futures | OpenEI  

Open Energy Info (EERE)

Energy Futures Energy Futures Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

346

TEF | OpenEI  

Open Energy Info (EERE)

TEF TEF Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

347

transportation | OpenEI  

Open Energy Info (EERE)

transportation transportation Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

348

US Council for Automotive Research USCAR | Open Energy Information  

Open Energy Info (EERE)

Research USCAR Jump to: navigation, search Name: US Council for Automotive Research (USCAR) Place: Southfield, Michigan Zip: 48075 - Product: Umbrella organization of...

349

PPT Research Inc | Open Energy Information  

Open Energy Info (EERE)

PPT Research Inc Jump to: navigation, search Name: PPT Research Inc Place: Allentown, Pennsylvania Zip: 18109 Product: Has developed a closed-loop system for recycling abrasive...

350

Vertex Energy | Open Energy Information  

Open Energy Info (EERE)

Zip: 77058 Product: Vertex is comprised of several companies that together serve as a petroleum recovery company, focused on recyclereuse options for petroleum products, crudes,...

351

WeBiomass Inc | Open Energy Information  

Open Energy Info (EERE)

Zip: 05701 Region: Greater Boston Area Sector: Biomass Product: Commercial Biomass Boiler Systems Website: http:www.webiomass.com Coordinates: 43.58070919775,...

352

Indian Centre for Wind Energy Technology C WET | Open Energy...  

Open Energy Info (EERE)

WET Jump to: navigation, search Name: Indian Centre for Wind Energy Technology (C-WET) Place: Chennai, India Zip: 601 302 Sector: Wind energy Product: Government backed wind...

353

Avestor | Open Energy Information  

Open Energy Info (EERE)

Avestor Jump to: navigation, search Name: Avestor Place: Quebec, Canada Zip: J4B 727 Product: After filing bankruptcy in October 2006, Avestor's assets were acquired by the...

354

Agricultural Waste Solutions Inc AWS | Open Energy Information  

Open Energy Info (EERE)

Inc (AWS) Place: Westlake Village, California Zip: CA 91361 Product: Agricultural Waste Solutions designs small scale gasification systems. References: Agricultural Waste...

355

Multi Empreendimentos | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Multi Empreendimentos Place: Recife, Pernambuco, Brazil Zip: 50050-200 Sector: Efficiency, Renewable Energy, Services Product:...

356

Nupiaui Participacoes S A | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name: Nupiaui Participacoes S.A. Place: Luis Correia, Piaui, Brazil Zip: 64220-000 Sector: Wind energy Product: Brazil based wind project developer,...

357

Sol rios | Open Energy Information  

Open Energy Info (EERE)

rios Jump to: navigation, search Name: Solrios Place: Piranhas, Brazil Zip: 57.460.000 Sector: Buildings, Solar Product: Installs solar powered water heaters for residential,...

358

Eolica Industrial | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Eolica Industrial Place: Sao Paulo, Sao Paulo, Brazil Zip: 01020-901 Sector: Wind energy Product: Brazil based wind turbine steel towers and...

359

ABEEolica | Open Energy Information  

Open Energy Info (EERE)

ABEEolica Jump to: navigation, search Name: ABEEolica Place: Sao Paulo, Sao Paulo, Brazil Zip: 1136001 Sector: Wind energy Product: Brazil's wind energy association. References:...

360

Refinaria Alberto Pasqualini REFAP | Open Energy Information  

Open Energy Info (EERE)

search Name: Refinaria Alberto Pasqualini (REFAP) Place: Canoas, Rio Grande do Sul, Brazil Zip: 92420 - 221 Sector: Biomass Product: Brazil based biomass producer References:...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Prowind Energias Alternativas Ltda | Open Energy Information  

Open Energy Info (EERE)

Name: Prowind Energias Alternativas Ltda Place: Porto Alegre, Rio Grande do Sul, Brazil Zip: 90560-002 Sector: Wind energy Product: Brazil based wind project developer....

362

Dobreve Empreendimentos e Participacoes | Open Energy Information  

Open Energy Info (EERE)

Name: Dobreve Empreendimentos e Participacoes Place: Jaragua do Sul, Santa Catarina, Brazil Zip: 89260-500 Sector: Wind energy Product: Brazil-based wind project developer....

363

Carbotrader | Open Energy Information  

Open Energy Info (EERE)

search Name: Carbotrader Place: Sao Paulo, Sao Paulo, Brazil Zip: 13207 070 Sector: Renewable Energy, Services Product: String representation "Carbotrader is ... rading support."...

364

Gemini Solar Development Company | Open Energy Information  

Open Energy Info (EERE)

Gemini Solar Development Company Jump to: navigation, search Name: Gemini Solar Development Company Place: San Francisco, California Zip: 94105 Sector: Renewable Energy Product:...

365

Bloo Solar formerly Q1 Nanosystems | Open Energy Information  

Open Energy Info (EERE)

Solar formerly Q1 Nanosystems Jump to: navigation, search Name: Bloo Solar (formerly Q1 Nanosystems) Place: West Sacramento, California Zip: 95691 Sector: Solar Product: String...

366

SolarRoofs com | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: SolarRoofs.com Place: Carmichael, California Zip: 95608 Sector: Solar Product: California-based manufacturer of the patented Skyline solar water heating...

367

New Millennium Power | Open Energy Information  

Open Energy Info (EERE)

Millennium Power Place: Laguna Niguel, California Zip: 92677 Sector: Solar Product: Solar system installer and integrator operating in Orange County, California. References: New...

368

Accurate Solar Power | Open Energy Information  

Open Energy Info (EERE)

Accurate Solar Power Jump to: navigation, search Name: Accurate Solar Power Place: Menlo Park, California Zip: 94025 Product: US manufacturer of microinverters and smart grid...

369

California State University CSU | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: California State University (CSU) Place: Los Angeles, California Zip: 90802-4210 Sector: Solar Product: One of the largest higher education...

370

Solar Infra Inc | Open Energy Information  

Open Energy Info (EERE)

Infra Inc Jump to: navigation, search Name: Solar Infra Inc Place: Santa Clara, California Zip: 95054 Product: Manufacturer of crystalline PV modules. References: Solar Infra...

371

Nationwide Solar Funding | Open Energy Information  

Open Energy Info (EERE)

Nationwide Solar Funding Place: Palm Desert, California Zip: 92211 Sector: Solar Product: Provides funding for small (residential and business) solar projects References:...

372

Solar amp Electric Solutions | Open Energy Information  

Open Energy Info (EERE)

amp Electric Solutions Jump to: navigation, search Name: Solar & Electric Solutions Place: Santa Cruz, California Zip: 95062 Sector: Solar Product: Small solar installation firm in...

373

Advantage Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Inc Jump to: navigation, search Name: Advantage Solar Inc. Place: California Zip: 92394 Sector: Solar Product: Dealer in solar equipment and consultant in maintaining...

374

Solarese | Open Energy Information  

Open Energy Info (EERE)

Solarese Jump to: navigation, search Name: solarese Place: San Diego, California Zip: 92129 Sector: Solar Product: Installer of PV and thermal solar systems for residential and...

375

Discover Power | Open Energy Information  

Open Energy Info (EERE)

Discover Power Place: California Zip: 92109 Sector: Renewable Energy, Solar Product: Distributor of solar electric and other renewable energy products. References: Discover...

376

BrightSource Energy | Open Energy Information  

Open Energy Info (EERE)

search Name: BrightSource Energy Place: Oakland, California Zip: 94612 Sector: Solar Product: California-based company that develops, builds, owns, and operates large...

377

Aztec Solar | Open Energy Information  

Open Energy Info (EERE)

Solar Jump to: navigation, search Name: Aztec Solar Place: Rancho Cordova, California Zip: 95742 Sector: Solar Product: Installer of solar hot water and pool heating systems....

378

Sunny Hill Energy | Open Energy Information  

Open Energy Info (EERE)

Sunny Hill Energy Place: San Jose, California Zip: 95113 Sector: Solar Product: California-based solar financing and business support company that bridges residential and...

379

Scheuten Solar USA Inc | Open Energy Information  

Open Energy Info (EERE)

Scheuten Solar USA, Inc. Place: Rancho Santa Margarita, California Zip: 92688 Sector: Solar Product: Manufacturer of Solar PV systems References: Scheuten Solar USA, Inc.1 This...

380

Sequoia Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Inc Jump to: navigation, search Name: Sequoia Solar, Inc. Place: Solana Beach, California Zip: 92075 Sector: Solar Product: California-based installer of solar plants....

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Solar Depot Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Depot Inc Place: Petaluma, California Zip: 94954 Sector: Solar Product: US-based PV and solar passive system integrator and distributor. References: Solar Depot Inc1 This...

382

Perpetual Energy Systems | Open Energy Information  

Open Energy Info (EERE)

Woodland Hills, California Zip: 91367 Sector: Renewable Energy, Solar Product: String representation "Perpetual Energ ... sustainability." is too long. References: Perpetual Energy...

383

Vaillant Solar Systems | Open Energy Information  

Open Energy Info (EERE)

Vaillant Solar Systems Jump to: navigation, search Name: Vaillant Solar Systems Place: Solana Beach, California Zip: 92075 Sector: Solar Product: California-based solar company...

384

Akeena Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Akeena Solar Inc Place: Los Gatos, California Zip: CA 95032 Sector: Solar Product: Residential and commercial solar electric system installer in the US. References: Akeena Solar...

385

SJ Solar | Open Energy Information  

Open Energy Info (EERE)

SJ Solar Jump to: navigation, search Name: SJ Solar Place: San Jose, California Zip: 95131 Sector: Solar Product: Cell design firm for concentrated solar References: SJ Solar1...

386

International Solar Consulting | Open Energy Information  

Open Energy Info (EERE)

International Solar Consulting Place: Newport Beach, California Zip: 92660 Sector: Renewable Energy, Solar Product: International Solar Consulting works with large commercial and...

387

Econergy Brasil Ltda | Open Energy Information  

Open Energy Info (EERE)

Brasil Ltda Jump to: navigation, search Name: Econergy Brasil Ltda Place: Sao Paulo, Brazil Zip: 01243-020 Sector: Services Product: A consultancy firm providing technical and...

388

Abengoa Bioenergia Brasil | Open Energy Information  

Open Energy Info (EERE)

Brasil Jump to: navigation, search Name: Abengoa Bioenergia Brasil Place: Sao Paulo, Sao Paulo, Brazil Zip: 04551-060 Product: Brazilian-based ethanol producer, subsidiary of...

389

Energia Regenerativa Brasil Ltda ERB | Open Energy Information  

Open Energy Info (EERE)

Regenerativa Brasil Ltda ERB Jump to: navigation, search Name: Energia Regenerativa Brasil Ltda. (ERB) Place: Porto Alegre, Rio Grande do Sul, Brazil Zip: 91170-240 Sector: Wind...

390

Kyocera Solar do Brasil | Open Energy Information  

Open Energy Info (EERE)

Brasil Jump to: navigation, search Name: Kyocera Solar do Brasil Place: Riode Janeiro, Rio de Janeiro, Brazil Zip: 22790-200 Sector: Services, Solar Product: Brazilian based...

391

Utah State Parks and Recreation | Open Energy Information  

Open Energy Info (EERE)

Recreation Jump to: navigation, search Name: Utah State Parks and Recreation Address: 1594 W North Temple, Suite 116 Place: Salt Lake City, Utah Zip: 84116 Phone Number:...

392

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

393

Viresco Energy | Open Energy Information  

Open Energy Info (EERE)

Place: Riverside, California Zip: 92507 Product: Company developing a modified gasification process References: Viresco Energy1 This article is a stub. You can help OpenEI...

394

GLASSTECH INC | Open Energy Information  

Open Energy Info (EERE)

search Name: GLASSTECH INC Place: Perrysburg, Ohio Zip: 43551 Sector: Buildings, Efficiency, Services, Solar, Vehicles Website: http:www.glasstech.comdefau References:...

395

Nextronex Energy Systems LLC | Open Energy Information  

Open Energy Info (EERE)

Systems LLC Address: 4400 Moline Martin Rd Place: Millbury, Ohio Zip: 43447-9401 Sector: Efficiency, Renewable Energy, Services, Solar Website: http:www.nextronex.comdefau...

396

Balloon Elica | Open Energy Information  

Open Energy Info (EERE)

de Campinas, 713 Campos Elseos Place: So Paulo, So Paulo Zip: 01201-001 Sector: Efficiency, Renewable Energy, Services, Solar, Wind energy Website: http:...

397

Beijing Sevenstar Electronics Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Sevenstar Electronics Co Ltd Jump to: navigation, search Name: Beijing Sevenstar Electronics Co., Ltd Place: Beijing Municipality, China Zip: 100016 Sector: Solar Product:...

398

Sanyo North America Co | Open Energy Information  

Open Energy Info (EERE)

California Zip: CA 92154 Product: Sanyo North America Co, a subsidiary of Japanese electronics manufacture Sanyo, overseas and supports the North American market, including...

399

Colorado Energy Office | Open Energy Information  

Open Energy Info (EERE)

Office Jump to: navigation, search Name: Colorado Energy Office Address: 1580 Logan Street, Suite 100 Place: Denver, CO Zip: 80203 Website: http:www.colorado.govenergy...

400

Colorado thermal spring water geothermometry (public dataset...  

Open Energy Info (EERE)

dataset) Jump to: navigation, search OpenEI Reference LibraryAdd to library General: Colorado thermal spring water geothermometry (public dataset) Abstract The zipped Excel file...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

BLM Colorado State Office | Open Energy Information  

Open Energy Info (EERE)

Colorado State Office Abbreviation: Colorado Address: 2850 Youngfield Street Place: Lakewood, CO Zip: 80215 Phone Number: 303-239-3600 ParentHolding Organization: Bureau of Land...

402

Blendstar LLC | Open Energy Information  

Open Energy Info (EERE)

LLC Place: The Woodlands, Texas Zip: 77380 Product: Houston-based operator of ethanol blending and terminal facilities in Tennessee, Kentucky, Oklahoma, Arkansas, Alabama,...

403

Transmediair Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Place: Hillsborough, New Jersey Zip: 08844-1919 Product: New Jersey-based ethanol producer. References: Transmediair, Inc1 This article is a stub. You can help...

404

Central Indiana Ethanol LLC | Open Energy Information  

Open Energy Info (EERE)

Central Indiana Ethanol LLC Jump to: navigation, search Name: Central Indiana Ethanol LLC Place: Marion, Indiana Zip: 46952 Product: Ethanol producer developina a 151 mlpa plant in...

405

Southridge Enterprises | Open Energy Information  

Open Energy Info (EERE)

Enterprises Place: Dallas, Texas Zip: 75219 Product: Holding company for Southridge Ethanol. References: Southridge Enterprises1 This article is a stub. You can help OpenEI by...

406

Sioux River Ethanol LLC | Open Energy Information  

Open Energy Info (EERE)

Sioux River Ethanol LLC Jump to: navigation, search Name: Sioux River Ethanol LLC Place: Hudson, South Dakota Zip: 57034 Product: Farmer owned ethanol producer, Sioux River Ethanol...

407

US Ethanol Vehicle Coalition | Open Energy Information  

Open Energy Info (EERE)

Ethanol Vehicle Coalition Jump to: navigation, search Name: US Ethanol Vehicle Coalition Place: Jefferson City, Missouri Zip: 65109 Product: The National Ethanol Vehicle Coalition...

408

Ethanol Capital Management | Open Energy Information  

Open Energy Info (EERE)

Management Jump to: navigation, search Name: Ethanol Capital Management Place: Tucson, Arizona Zip: 85711 Product: Manages funds investing in Ethanol plants in the US Coordinates:...

409

Evergreen Securities formerly Ethanol Investments | Open Energy...  

Open Energy Info (EERE)

Securities formerly Ethanol Investments Jump to: navigation, search Name Evergreen Securities (formerly Ethanol Investments) Place London, England, United Kingdom Zip EC2V 5DE...

410

Dakota Ethanol | Open Energy Information  

Open Energy Info (EERE)

Dakota Ethanol Jump to: navigation, search Name: Dakota Ethanol Place: Wentworth, South Dakota Zip: 57075 Product: Farmer Coop owner of a 189m litres per year ethanol plant...

411

Trillium FiberFuels Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Place: Corvallis, Oregon Zip: 97333 Product: Oregon-based biochemical cellulosic ethanol technology developer. References: Trillium FiberFuels Inc1 This article is a stub....

412

Agri Ethanol Products LLC AEPNC | Open Energy Information  

Open Energy Info (EERE)

Agri Ethanol Products LLC AEPNC Jump to: navigation, search Name: Agri-Ethanol Products LLC (AEPNC) Place: Raleigh, North Carolina Zip: 27615 Product: Ethanol producer and project...

413

Great Plains Ethanol | Open Energy Information  

Open Energy Info (EERE)

Great Plains Ethanol Jump to: navigation, search Name: Great Plains Ethanol Place: Chancellor, South Dakota Zip: 57015 Product: Limited liability company owned by its 500 members...

414

MissionPoint Capital Partners | Open Energy Information  

Open Energy Info (EERE)

Norwalk, Connecticut Zip: CT 06854 Product: Private Investment company capitalizing on clean energy technology and increasing capacity. Coordinates: 43.83033, -90.622007...

415

Applied Intellectual Capital AIC | Open Energy Information  

Open Energy Info (EERE)

Zip: 94501-1010 Product: Applied Intellectual Capital (AIC) was founded in 1999 to fund technology development in clean energy, clean water and sustainable resources. References:...

416

Westly Group | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: Westly Group Place: Menlo Park, California Zip: 94025 Product: Clean technology-oriented venture capital firm. References: Westly Group1 This article...

417

Energex Pellet Fuel Inc | Open Energy Information  

Open Energy Info (EERE)

Energex Pellet Fuel Inc Jump to: navigation, search Name: Energex Pellet Fuel Inc. Place: Mifflintown, Pennsylvania Zip: 17059 Product: Pellets producer with a capacity of 200,000...

418

APowerCap Technologies | Open Energy Information  

Open Energy Info (EERE)

Technologies Jump to: navigation, search Name: APowerCap Technologies Place: Chaiki, Ukraine Zip: 8130 Product: APCT develops breakthrough ultracapacitor-based power modules for...

419

Sai Renewable Power Pvt Ltd SRPPL | Open Energy Information  

Open Energy Info (EERE)

Renewable Power Pvt Ltd SRPPL Jump to: navigation, search Name: Sai Renewable Power Pvt. Ltd. (SRPPL) Place: Hyderabad, Andhra Pradesh, India Zip: 500 020 Sector: Biomass Product:...

420

Astonfield Renewable Resources Ltd ARRL | Open Energy Information  

Open Energy Info (EERE)

Astonfield Renewable Resources Ltd ARRL Jump to: navigation, search Name: Astonfield Renewable Resources Ltd. (ARRL) Place: New York, New York Zip: 10017 Sector: Biomass, Solar...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Switchpower | Open Energy Information  

Open Energy Info (EERE)

Sweden Zip: 102 41 Sector: Wind energy Product: Switchpower delivers turn-key photovoltaic (PV) power systems and modern wind turbine generators to private customers,...

422

Sustainable Spaces Inc | Open Energy Information  

Open Energy Info (EERE)

Spaces Inc Jump to: navigation, search Name: Sustainable Spaces Inc. Place: San Francisco, California Zip: 94103 Sector: Carbon Product: California-based provider of energy audits...

423

California Center for Sustainable Energy CCSE | Open Energy Informatio...  

Open Energy Info (EERE)

CCSE Jump to: navigation, search Name: California Center for Sustainable Energy (CCSE) Place: San Diego, California Zip: 92123 Product: California-based technical assistance and...

424

Aeronautica Windpower LLC | Open Energy Information  

Open Energy Info (EERE)

Aeronautica Windpower LLC Jump to: navigation, search Name: Aeronautica Windpower LLC Place: Plymouth, Massachusetts Zip: 23600 Sector: Services, Wind energy Product: String...

425

Bee Cool Inc | Open Energy Information  

Open Energy Info (EERE)

North Ferrisburg, Vermont Zip: Vt 05473 Sector: Solar Product: Producer of polysilicon solar panels and solar trackers, and solar battery chargers. References: Bee Cool Inc1...

426

Shinepower | Open Energy Information  

Open Energy Info (EERE)

Place: Zhejiang Province, China Zip: 317600 Sector: Solar Product: Manufacturer in mini solar panels, solar cell modules. References: Shinepower1 This article is a stub. You...

427

Ferven Technologia | Open Energy Information  

Open Energy Info (EERE)

Madrid, Spain Zip: 28035 Sector: Solar Product: Madrid-based distributor and supplier of solar panels. References: Ferven Technologia1 This article is a stub. You can help...

428

Southwest Wind Farm Private Limited ESS ARR Group | Open Energy...  

Open Energy Info (EERE)

Private Limited ESS ARR Group Jump to: navigation, search Name: Southwest Wind Farm Private Limited (ESS ARR Group) Place: Coimbatore, Tamil Nadu, India Zip: 641402 Sector: Wind...

429

CleanTech Partners | Open Energy Information  

Open Energy Info (EERE)

Middleton, Wisconsin Zip: 53562 Product: Wisconsin-based NPO facilitating and funding energy saving technologies. Coordinates: 39.033545, -78.272579 Loading map......

430

Aerogel Composite LLC | Open Energy Information  

Open Energy Info (EERE)

Aerogel Composite LLC Jump to: navigation, search Name: Aerogel Composite LLC Place: Storrs, Connecticut Zip: 6269 Product: Developer of aerogel based composite materials for a...

431

Reference Buildings by Building Type: Strip mall | Department...  

Broader source: Energy.gov (indexed) [DOE]

Strip mall Reference Buildings by Building Type: Strip mall In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes...

432

Reference Buildings by Building Type: Large Hotel | Department...  

Broader source: Energy.gov (indexed) [DOE]

Hotel Reference Buildings by Building Type: Large Hotel In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the...

433

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

434

Cellstrom | Open Energy Information  

Open Energy Info (EERE)

Zip: 2345 Sector: Solar Product: Austria based developer of vanadium redox flow batteries for solar plants. References: Cellstrom1 This article is a stub. You can help...

435

UniBatt Ltd | Open Energy Information  

Open Energy Info (EERE)

Zip: 29500 Product: Start-up company specializing in the development of innovative batteries for mobile electronic devices such as: laptops, cellular phones, PDAs, etc....

436

Blue Sky Batteries Inc | Open Energy Information  

Open Energy Info (EERE)

Batteries Inc Jump to: navigation, search Name: Blue Sky Batteries Inc Place: Laramie, Wyoming Zip: 82072-3 Product: Nanoengineers materials for rechargeable lithium batteries....

437

Innergy Power Corporation Inc | Open Energy Information  

Open Energy Info (EERE)

Zip: 92154 Sector: Solar Product: US manufacturer of rechargeable sealed-lead batteries and solar charger for off-grid use. References: Innergy Power Corporation Inc1...

438

Millennium Ethanol LLC | Open Energy Information  

Open Energy Info (EERE)

Millennium Ethanol LLC Jump to: navigation, search Name: Millennium Ethanol, LLC Place: Marion, South Dakota Zip: 57043 Product: Millennium Ethanol is a group of more than 900...

439

Renew Energy LLC | Open Energy Information  

Open Energy Info (EERE)

Wisconsin Zip: 53549 Product: Sister company of Utica Energy, operates a 130m gallon ethanol plant in Jefferson, Wisconsin. References: Renew Energy LLC1 This article is a...

440

Kawar Energy | Open Energy Information  

Open Energy Info (EERE)

Kawar Energy Jump to: navigation, search Name: Kawar Energy Place: Amman, Jordan Zip: 11118 Sector: Services Product: Amman-based project developer, focused on bringing...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

FT Solutions LLC | Open Energy Information  

Open Energy Info (EERE)

FT Solutions LLC Jump to: navigation, search Name: FT Solutions LLC Place: South Jordan, Utah Zip: 84095 Product: JV between Headwaters Technology Innovation Group and Rentech to...

442

Millennium Energy Industries | Open Energy Information  

Open Energy Info (EERE)

Name: Millennium Energy Industries Place: Jordan Zip: 1182 Sector: Solar Product: Jordan-based solar energy firm focused in MENA region. References: Millennium Energy...

443

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

444

Embrapa Agroenergia | Open Energy Information  

Open Energy Info (EERE)

Place: Brasilia, Distrito Federal (Brasilia), Brazil Zip: 70770-901 Sector: Biofuels Product: Research and development centre for biofuels. References: Embrapa...

445

Pine Lake Corn Processors LLC | Open Energy Information  

Open Energy Info (EERE)

Processors LLC Jump to: navigation, search Name: Pine Lake Corn Processors LLC Place: Steamboat Rock, Iowa Zip: 50672 Product: Farmer owned investment and management team which...

446

Western Plains Energy LLC | Open Energy Information  

Open Energy Info (EERE)

Western Plains Energy LLC Jump to: navigation, search Name: Western Plains Energy LLC Place: Oakley, Kansas Zip: 67748 Product: Bioethanol producer using corn as feedstock...

447

DOE F 4220-10  

Energy Savers [EERE]

Project Office: Name: Telephone: ( ) 3. Contractor, Grantee or Offeror: Name: Street: City: State Zip 4. Place of Performance: (Required if different from 3) Street: City: State...

448

Gas Natural Corporacion Eolica SL | Open Energy Information  

Open Energy Info (EERE)

SL Jump to: navigation, search Name: Gas Natural Corporacion Eolica SL Place: Barcelona, Spain Zip: 8002 Sector: Wind energy Product: Barcelona headquartered wind development wing...

449

Oak Ridge Micro Energy Inc | Open Energy Information  

Open Energy Info (EERE)

Inc Jump to: navigation, search Name: Oak Ridge Micro-Energy Inc Place: Oak Ridge, Tennessee Zip: 37830 Product: Developer and producer of thin film rechargeable lithium and...

450

Beijing Sijimicoe Solar Energy | Open Energy Information  

Open Energy Info (EERE)

Sijimicoe Solar Energy Jump to: navigation, search Name: Beijing Sijimicoe Solar Energy Place: Beijing, China Zip: 102200 Sector: Solar Product: Beijing-based solar water heating...

451

Apollo Solar Energy Co Ltd ASEC | Open Energy Information  

Open Energy Info (EERE)

ASEC Jump to: navigation, search Name: Apollo Solar Energy Co Ltd (ASEC) Place: Taoyuan Hsien, Taiwan Zip: 325 Sector: Solar Product: Producer of modules for solar panels....

452

Himin Solar Energy Group | Open Energy Information  

Open Energy Info (EERE)

Himin Solar Energy Group Place: Dezhou City, Shandong Province, China Zip: 253092 Sector: Solar Product: Its products are evacuated tubes, solar water heaters, solar collectors,...

453

Sunworld Solar Energy Technology Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Sunworld Solar Energy Technology Co Ltd Jump to: navigation, search Name: Sunworld Solar Energy Technology Co Ltd Place: Shanghai, Shanghai Municipality, China Zip: RM1501 Sector:...

454

Ameco Solar | Open Energy Information  

Open Energy Info (EERE)

Place: Signal Hill, California Zip: 90755 Sector: Solar Product: Ameco is a licensed solar energy contractor operating principally in Los Angeles and Orange Counties. Ameco...

455

Rand Solar Energy Systems | Open Energy Information  

Open Energy Info (EERE)

Rand Solar Energy Systems Jump to: navigation, search Name: Rand Solar Energy Systems Place: Petach Tikva, Israel Zip: 49130 Sector: Solar Product: Israel-based manufacturer and...

456

Solar Energy Systems Inc SES | Open Energy Information  

Open Energy Info (EERE)

Solar Energy Systems, Inc (SES) Place: Brooklyn, New York Zip: 11222 Sector: Solar Product: Private company designing, building, and maintaining solar energy systems. References:...

457

Ningxia Ninghu Solar Energy Technology Co Ltd | Open Energy Informatio...  

Open Energy Info (EERE)

Ninghu Solar Energy Technology Co Ltd Jump to: navigation, search Name: Ningxia Ninghu Solar Energy Technology Co Ltd Place: Shi Zui Shan, Ningxia Autonomous Region, China Zip:...

458

California Solar Energy Industries Association | Open Energy...  

Open Energy Info (EERE)

Solar Energy Industries Association Jump to: navigation, search Name: California Solar Energy Industries Association Place: Rio Vista, California Zip: 94571 Sector: Solar Product:...

459

Sunrise Global Solar Energy | Open Energy Information  

Open Energy Info (EERE)

Sunrise Global Solar Energy Place: Taoyuan County, Taiwan Zip: 330 Sector: Solar Product: Engaged in solar monocrystalline cell design and production. References: Sunrise Global...

460

Club for Rural Electrification | Open Energy Information  

Open Energy Info (EERE)

Place: Freiburg, Germany Zip: 79114 Sector: Solar Product: An industry association of German companies in the field of solar energy for the purpose of rural electrification....

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Goldbeck Solar GmbH | Open Energy Information  

Open Energy Info (EERE)

an der Bergstrae, Germany Zip: 69493 Sector: Solar Product: A daughter company of German construction- and service company Goldbeck, Goldbeck Solar installs and maintains PV...

462

Krannich Solartechnik eK | Open Energy Information  

Open Energy Info (EERE)

der Stadt Hausen, Baden-Wrttemberg, Germany Zip: 71263 Sector: Solar Product: German consultants in small to large-scale PV project planning and consulting; also...

463

Energiebau Solarstromsysteme GmbH | Open Energy Information  

Open Energy Info (EERE)

GmbH Place: Kln, Germany Zip: 50829 Sector: Efficiency, Solar Product: A German system provider and wholesaler for solar power and energy efficiency projects....

464

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

465

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

466

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

467

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

468

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

469

E-Print Network 3.0 - affecting home blood Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FORM Summary: Security Expected Year of Graduation Home Address City State Zip Code Cell Phone ParentGuardian Name... Occupation Business Phone Home Phone Cell Phone Parent...

470

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

471

Hanford Speakers Bureau Request Form - Hanford Site  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the Hanford Speakers Bureau at 509.376.3419. REQUESTER CONTACT INFORMATION Contact Name * PhoneCell * Address * City * Zip Code * Email Address * SPEAKER REQUEST INFORMATION...

472

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

473

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

474

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

475

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

476

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

477

Universal Lighting Technologies | Open Energy Information  

Open Energy Info (EERE)

Zip: 37214-3683 Product: Universal Lighting Technologies develops, manufactures and markets energy efficient lighting technologies including HID, CFLs and ballasts....

478

Electro Energy Inc | Open Energy Information  

Open Energy Info (EERE)

search Name: Electro Energy Inc Place: Danbury, Connecticut Zip: 6810 Product: Electro Energy Inc develops, markets and manufactures electricity storage systems and solutions...

479

Carbon Markets Global Ltd | Open Energy Information  

Open Energy Info (EERE)

Markets Global Ltd Place: London, United Kingdom Zip: NW4 2HT Product: Assist project originators develop and finance clean development projects. References: Carbon Markets Global...

480

TPI Composites | Open Energy Information  

Open Energy Info (EERE)

Name: TPI Composites Place: Scottsdale, Arizona Zip: AZ 85253 Sector: Services, Wind energy Product: String representation "TPI offers a fu ... litary markets." is too long....

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Sinovel Wind Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Name: Sinovel Wind Co Ltd Place: Beijing Municipality, China Zip: 100872 Sector: Wind energy Product: Develops, manufactures and markets wind power generating equipment....

482

Vycon Inc | Open Energy Information  

Open Energy Info (EERE)

navigation, search Name: Vycon Inc Place: Cerritos, California Zip: 90703 Product: Vycon markets and manufactures flywheel energy storage systems for a wide range of applications...

483

Global Change Associates | Open Energy Information  

Open Energy Info (EERE)

New York Zip: 10025-5657 Product: Consulting firm focusing on the convergence between energy and financial markets. References: Global Change Associates1 This article is a...

484

SMA America | Open Energy Information  

Open Energy Info (EERE)

California Zip: 95945 Sector: Solar Product: Supplies the North and South American markets with the "Sunny Boy" solar inverter. References: SMA America1 This article is a...

485

Contained Energy Inc | Open Energy Information  

Open Energy Info (EERE)

Energy Inc Place: Shaker Heights, Ohio Zip: 44120 Sector: Carbon Product: Develops, manufactures, markets and sells direct carbon fuel cells with breakthrough energy density....

486

Leonardo Venablers | Open Energy Information  

Open Energy Info (EERE)

search Name: Leonardo Venablers Place: Barcelona, Spain Zip: 8003 Sector: Renewable Energy, Services Product: Headquartered in Barcelona, the company offers management and...

487

C D Technologies Inc | Open Energy Information  

Open Energy Info (EERE)

Blue Bell, Pennsylvania Zip: 19422 Product: A technology company that produces and markets systems for the power conversion and storage of electrical power, including...

488

Research Partnership to Secure Energy for America RPSEA | Open...  

Open Energy Info (EERE)

to Secure Energy for America RPSEA Jump to: navigation, search Name: Research Partnership to Secure Energy for America (RPSEA) Place: Sugar Land, TX, Texas Zip: 77478 Sector:...

489

Sky Train Corp | Open Energy Information  

Open Energy Info (EERE)

Train Corp Jump to: navigation, search Name: Sky Train Corp. Place: Palm Harbor, Florida Zip: 34684 Sector: Services Product: Sky Train Corporation is a consultant company...

490

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

491

Allopartis Biotechnologies Inc | Open Energy Information  

Open Energy Info (EERE)

Allopartis Biotechnologies, Inc. Place: San Francisco, California Zip: 94111 Sector: Biofuels Product: Allopartis is a San Francisco-based startup company that is developing...

492

Agri capital GmbH | Open Energy Information  

Open Energy Info (EERE)

Zip: 48155 Product: Muenster-based agri.capital develops and operates decentralised biogas plants. Coordinates: 33.652, -97.376364 Show Map Loading map......

493

BKN biostrom AG formerly BKN BioKraftstoff Nord AG | Open Energy...  

Open Energy Info (EERE)

Zip: 29365 Product: Investment holding company focusing on project development for biogas plants and the production of biodiesel. Coordinates: 52.766651, 10.49397 Show Map...

494

Incisa | Open Energy Information  

Open Energy Info (EERE)

Rio de janeiro, Brazil Zip: 22250-040 Sector: Efficiency Product: Design and develops biogas projects based in anaerobic digestors and energy efficiency projecs for the indutry....

495

Bison Renewable Energy LLC | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy LLC Place: Minneapolis, Minnesota Zip: 55401 Product: Developing biogas production facilities. References: Bison Renewable Energy LLC1 This article is a stub....

496

Synagro Technologies Inc | Open Energy Information  

Open Energy Info (EERE)

Zip: TX 77057 Product: Synagro, a residuals mangement company, also provides complete biogas cogeneration systems. References: Synagro Technologies Inc.1 This article is a stub....

497

BioEnergy Solutions BES | Open Energy Information  

Open Energy Info (EERE)

California Zip: 93309 Product: Bakersfield-based firm installing and operating biogas plants for farmers and food producers. References: BioEnergy Solutions (BES)1 This...

498

Archea Biogas N V | Open Energy Information  

Open Energy Info (EERE)

N V Jump to: navigation, search Name: Archea Biogas N.V. Place: Hessisch Oldendorf, Lower Saxony, Germany Zip: 31840 Product: Design, analysis, planning and construction of biogas...

499

WELtec BioPower GmbH | Open Energy Information  

Open Energy Info (EERE)

Saxony, Germany Zip: 49377 Sector: Services Product: WELtec BioPower provides turnkey biogas plants and related services. Coordinates: 52.728997, 8.286404 Show Map Loading...

500

Tecsol | Open Energy Information  

Open Energy Info (EERE)

CEDEX, France Zip: 66004 Sector: Renewable Energy, Solar Product: independent advisor to renewables energy, particularly solar, and HVAC projects. References: Tecsol1...