Powered by Deep Web Technologies
Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Randers, Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to:Co JumpRETScreen

2

On the Notion of Semi-Randers Space  

E-Print Network [OSTI]

The two currents frameworks for indefinite Finslerian spaces-times are introduced. We discuss some of the limitations of both formalisms, in particular the notion of semi-Randers. The key point is the issue of the gauge invariance associated with gauge transformations of the 1-form appearing in the Randers function. Therefore gauge invariance spoils the {\\it space-time metric interpretation} and {\\it Lagrangian interpretation} of a Randers space. Instead, we argue in favor of a sheaf formulation of the classical dynamics.

Ricardo Gallego Torrome

2010-09-22T23:59:59.000Z

3

Modified Friedmann model in Randers-Finsler space of approximate Berwald type as a possible alternative to dark energy hypothesis  

E-Print Network [OSTI]

Gravitational field equations in Randers-Finsler space of approximate Berwald type are investigated. A modified Friedmann model is proposed. It is showed that the accelerated expanding universe is guaranteed by a constrained Randers-Finsler structure without invoking dark energy. The geodesic in Randers-Finsler space is studied. The additional term in the geodesic equation acts as repulsive force against the gravity.

Zhe Chang; Xin Li

2009-01-08T23:59:59.000Z

4

Emergent phenomenology from deterministic Cartan-Randers systems  

E-Print Network [OSTI]

We consider specific deterministic quantum models of Cartan-Randers type and show how a dualized abelian gauge symmetry, diffeomorphism invariance, the Principle of Inertia, reversibility of phenomenological dynamics, maximal acceleration and maximal propagation speed for matter arise from such models in an phenomenological description. Two particular predictions are highlighted: the first is the value of maximal acceleration is universal and has the value of order 10^{52} m/s^2. The second prediction is that gauge symmetries in phenomenological models must come dualized and containing an abelian sector.

Ricardo Gallego Torromé

2013-10-24T23:59:59.000Z

5

Weak Gravitational Field in Finsler-Randers Space and Raychaudhuri Equation  

E-Print Network [OSTI]

The linearized form of the metric of a Finsler - Randers space is studied in relation to the equations of motion, the deviation of geodesics and the generalized Raychaudhuri equation are given for a weak gravitational field. This equation is also derived in the framework of a tangent bundle. By using Cartan or Berwald-like connections we get some types "gravito - electromagnetic" curvature. In addition we investigate the conditions under which a definite Lagrangian in a Randers space leads to Einstein field equations under the presence of electromagnetic field. Finally, some applications of the weak field in a generalized Finsler spacetime for gravitational waves are given.

P. Stavrinos

2012-09-13T23:59:59.000Z

6

Visual Pipe Mapping with a Fisheye Camera Peter Hansen, Hatem Alismail, Peter Rander and Brett Browning  

E-Print Network [OSTI]

Visual Pipe Mapping with a Fisheye Camera Peter Hansen, Hatem Alismail, Peter Rander and Brett made herein are solely the responsibility of the authors. #12;Keywords: Robotics, computer vision, pipe in pipes such as those found in Liquified Natural Gas (LNG) production. A forward facing, fisheye camera

7

SOLAS Denmark Denmark can proudly boast several  

E-Print Network [OSTI]

SOLAS Denmark Denmark can proudly boast several exciting developments within their SOLAS nation Climate Research Centre where several Danish SOLAS members recently participated in a field experiment' coordinated by Ronnie Glud, University of Southern Denmark. Further to this SOLAS Denmark's scientific

Boersma, Folkert

8

Laser ion source for Columbia Universitys microbeam A.W. Bigelow a,*, G. Randers-Pehrson a  

E-Print Network [OSTI]

Laser ion source for Columbia UniversityĂ?s microbeam A.W. Bigelow a,*, G. Randers-Pehrson a , R High School, NY, USA Available online 29 August 2005 Abstract A laser ion source that will be installed for irradiation experiments with mammalian cells. Through laser ablation the laser ion source can produce heavy

Brenner, David Jonathan

9

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

10

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

22

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

23

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

24

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

25

Heat Plan DenmarkHeat Plan Denmark Anders Dyrelundy  

E-Print Network [OSTI]

the supply and the demand side · An eye-opener for the Danish politicians · Could be a model for otherHeat Plan DenmarkHeat Plan Denmark Anders Dyrelundy Market Manager for Energy and Climate Rambøll Möller · The first study in Denmark, really to integrate the energy and building sectors ­ to combine

26

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

27

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

28

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

29

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Inventories Denmark's National Inventory Report Submitted under the United Nations Framework Convention Research Institute Ministry of the Environment . Denmark Emission Inventories Denmark's National Inventory Mikkelsen #12;Data sheet Title: Denmark's National Inventory Report ­ Submitted under the United Nations

30

Tema: Emissions Inventories Titel: Denmark's National Inventory  

E-Print Network [OSTI]

Tema: Emissions Inventories Titel: Denmark's National Inventory Report - Submitted under the United;Arbejdsrapport fra DMU nr.: 127 Samfund og miljø ­ Emissions Inventories Denmark's National Inventory Report Miljøundersøgelser & Energistyrelsen Maj 2000 #12;2 Data sheet Title: Denmark's National Inventory Report ­ Submitted

31

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

32

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

33

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Inventories Denmark's National Inventory Report 2005 Submitted under the United Nations Framework Convention Research Institute Ministry of the Environment . Denmark Emission Inventories Denmark's National Inventory's National Inventory Report 2005 - Submitted under the United Nations Framework Convention on Climate Change

34

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Inventories Denmark's National Inventory Report 2006 Submitted under the United Nations Framework Convention Research Institute Ministry of the Environment Emission Inventories Denmark's National Inventory Report, Landscape and Planning #12;Data sheet Title: Denmark's National Inventory Report 2006 - Submitted under

35

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

36

Technical University of Denmark rsted DTU Automation  

E-Print Network [OSTI]

Technical University of Denmark �rsted · DTU Automation Project: SICAM - SIngle Conversion stage based SICAM using an LC-network Petar Ljusev, MSc., Ph.D. student, �rsted · DTU Automation e-mail: pl

37

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

38

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

39

Technical University of Denmark Master Thesis  

E-Print Network [OSTI]

for electricity based heat production, HPs and EBs start to appear in district heating systems around Denmark into the current highly efficient combined heat and power (CHP) system, requires new flexible measures to reduce forced heat production in periods of high wind. Heat pumps (HP) and electric immersion boilers (EB) show

40

Technical University of Denmark rsted DTU Automation  

E-Print Network [OSTI]

Technical University of Denmark �rsted · DTU Automation Project: SICAM - SIngle Conversion stage;Isolated PDM and PWM DC-AC SICAMs Petar Ljusev, MSc., Ph.D. student, �rsted · DTU Automation e-mail: pl

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Roskilde, Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType JumpJersey) Jump to:Romania:Roskilde, Denmark:

42

Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park,DellProgrammeDenair,Denmark: Energy

43

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Aerosols in Danish Environmental Research Institute Ministry of the Environment . Denmark Aerosols in Danish Air (AIDA) Mid Department Department of Atmospheric Environment Serial title and no.: NERI Technical Report No.460 Publisher

44

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

. 667, 2008 Denmark's National Inventory Report 2008 Emission Inventories 1990-2006 ­ Submitted under Inventory Report 2008 Emission Inventories 1990-2006 ­ Submitted under the United Nations Framework VKHHW Series title and no.: NERI Technical Report No. 667 Title: Denmark's National Inventory Report

45

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

. 632, 2007 Denmark's NationaI Inventory Report 2007 Emission Inventories ­ Submitted under the UnitedI Inventory Report 2007 Emission Inventories ­ Submitted under the United Nations Framework Convention.: NERI Technical Report No. 632 Title: Denmark's National Inventory Report 2007 Subtitle: Emission

46

RisR1238(EN) Extreme Winds over Denmark  

E-Print Network [OSTI]

Risø­R­1238(EN) Extreme Winds over Denmark from the NCEP/NCAR Reanalysis Helmut P. Frank Wind Laboratory, Roskilde, Denmark May 2001 #12;Abstract An extreme wind analysis of wind speed calculatedPa, and geostrophic winds at 850 hPa, 1000 hPa, and at the sea level are analyzed. At 10 m height the expected extreme

47

E-Print Network 3.0 - aureus copenhagen denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Box 358, DK-4000 Roskilde, Denmark E... -mail: ineco@iki.bas.bg d Danish Forest and Landscape Institute, Hrsholm Kongevej 11, Hrsholm, Denmark Source: Dimov, Ivan - Institute...

48

E-Print Network 3.0 - aalborg university denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: aalborg university denmark Page: << < 1 2 3 4 5 > >> 1 Curriculum Vitae Rektor Finn Kjrsdam Born 1943 in Roskilde, Denmark Summary: -75). Associate...

49

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

50

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

51

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Air Quality Research Institute Ministry of the Environment Air Quality Monitoring Programme Annual Summary for 2004 Berkowicz and Jřrgen Brandt Department: Department of Atmospheric Environment Serial title and no.: NERI

52

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark Air Quality Research Institute Ministry of the Environment Air Quality Monitoring Programme Annual Summary for 2003: Department of Atmospheric Environment Serial title and no.: NERI Technical Report No. 497 Publisher: National

53

Behavioural Ecology Field Course Mols Laboratories, Denmark 2007  

E-Print Network [OSTI]

1 REPORTS Behavioural Ecology Field Course Mols Laboratories, Denmark 2007 Teachers: Dr. Trine ................................................................................................................................... 64 Receptor based feeding preferences; An investigation of the taste perception of three classes ............................................................................................................................ 79 Taste perception in the wood ant, Formica rufa Jeppe Jensen

Hamburg,.Universität

54

E-Print Network 3.0 - aalborg denmark 25-28 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: aalborg denmark 25-28 Page: << < 1 2 3 4 5 > >> 1 Curriculum Vitae Rektor Finn Kjrsdam Born 1943 in Roskilde, Denmark Summary: Curriculum Vitae...

55

A bibliography of English imprints of Denmark through 1900  

E-Print Network [OSTI]

, and Copen hagen; but the last three volumes, although printed in Copenhagen, were published in London only. Several other books printed in English in Denmark in the second half of the century, as for example two textbooks for learning Danish compiled...

Mitchell, P. M.

1960-01-01T23:59:59.000Z

56

Ris-R-1550(EN) Nanotechnology development in Denmark  

E-Print Network [OSTI]

- rection of the nano search and technology development processes and how environ- mental issues enter in Denmark. Focus is on how environmental issues enter into the strategies and search proc- esses of Danish likely long-term perspectives of the Dan- ish nanotechnology development. The content of the report

57

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark The Danish Air;National Environmental Research Institute Ministry of the Environment The Danish Air Quality Monitoring: Department of Atmospheric Environment Serial title and no.: NERI Technical Report No. 584 Publisher: National

58

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

National Environmental Research Institute Ministry of the Environment . Denmark ExternE transport Report No. 523 #12;[Blank page] #12;National Environmental Research Institute Ministry of the Environment Departments: 1 Department of Atmospheric Environment, NERI 2 COWI Serial title and no.: NERI Technical Report

59

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

: Wind farm related mortality among avian migrants ­ a remote sensing study and model analysis Subtitle: No external finacial support. Please cite as: Desholm, M. 2006: Wind farm related mortality among avian offshore wind farm, mortality, Denmark. Layout and drawings: NERI Graphics Group, Silkeborg Front page

60

Electrolysis for Energy Storage & Grid Balancing in West Denmark  

E-Print Network [OSTI]

Electrolysis for Energy Storage & Grid Balancing in West Denmark A possible first step toward. Economic Assessment 30 6. Other Methods for Storing Energy 34 Work Method & Acknowledgements This project between the original stakeholders who were, Dansk Fjenrvarmeværkers Forening (DFF), Norsk Hydro Energy

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Using the IEA ETSAP modelling tools for Denmark  

E-Print Network [OSTI]

system 50 5.1 Supply 50 5.1.1 Fossil fuels (oil, gas, and coal) 50 5.1.2 Electricity and heat 51 5 Information Service Department Risø National Laboratory for Sustainable Energy Technical University of Denmark

62

Department of Development and Planning, Aalborg University, Denmark  

E-Print Network [OSTI]

in Engineering Education in Problem and Project-Based Learning (PBL) Environment Chunfang Zhou GroupCreativity Creativity Development in Engineering Education in Problem and Project-Based Learning (PBL) Environment of Engineering and Science, Aalborg University, Denmark #12;Group Creativity Development in Engineering Education

Kolaei, Alireza Rezania

63

Connectable solar air collectors Solar Energy Centre Denmark  

E-Print Network [OSTI]

Connectable solar air collectors Solar Energy Centre Denmark Danish Technological Institute SEC-R-22 #12;Connectable solar air collectors Søren �stergaard Jensen Miroslav Bosanac Solar Energy Centre Søren �stergaard Jensen and Miroslav Bosanac Solar Energy Centre, Danish Technological Institute

64

Connectable solar air collectors Solar Energy Centre Denmark  

E-Print Network [OSTI]

Connectable solar air collectors Solar Energy Centre Denmark Danish Technological Institute SEC-R-22 #12;Connectable solar air collectors Søren �stergaard Jensen Miroslav Bosanac Solar Energy Centre for renewable energy of the Danish Energy Agency. The project group behind the project was: Solar Energy Centre

65

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

No. 236, 2007 Danish emission inventories for road transport and other mobile sources Inventories . Denmark Research notes from NERI No. 236, 2007 Danish emission inventories for road transport and other mobile sources Inventories until year 2004 Morten Winther #12;Data sheet Series title and no.: Research

66

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

. 675, 2008 Annual Danish Emission Inventory Report to UNECE Inventories from the base year . Denmark NERI Technical Report No. 675, 2008 Annual Danish Emission Inventory Report to UNECE Inventories: Annual Danish Emission Inventory Report to UNECE Subtitle: Inventories from the base year

67

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Emission Inventory Report to UNECE Inventories from the base year of the protocols to year 2003 Research of the Environment . Denmark Annual Danish Emission Inventory Report to UNECE Inventories from the base year sheet Title: Annual Danish Emission Inventory Report to UNECE Subtitle: Inventories from the base year

68

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

and distribution in the Horns Rev offshore wind farm area Annual status report 2003 Report commissioned by Elsam of the Environment . Denmark Bird numbers and distribution in the Horns Rev offshore wind farm area Annual status reports for 2003, concerning bird studies in relation to the offshore wind farms at Nysted in the Baltic

69

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

of migratory birds during operation of Horns Rev offshore wind farm Annual status report 2004 Report of the Environment . Denmark Investigations of migratory birds during operation of Horns Rev offshore wind farm offshore wind farm 2004 Subtitle: Annual status report 2004 Authors: Thomas Kjćr Christensen & Jens Peter

70

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

and distri- butions in the Horns Rev offshore wind farm area Annual status report 2004 NERI Report Ministry of the Environment . Denmark Bird numbers and distri- butions in the Horns Rev offshore wind farm #12;Data Sheet Title: Bird numbers and distributions in the Horns Rev offshore wind farm area Subtitle

71

Bioenergy and emerging biomass conversion technologies Hanne stergrd, Ris National Laboratory, Technical University of Denmark DTU, Denmark  

E-Print Network [OSTI]

Bioenergy and emerging biomass conversion technologies Hanne �stergård, Risø National Laboratory in Denmark 8th May 2007 Background Bioenergy is an important topic to include in a foresight analysis of the world agricultural markets and Europe. In the recent Agricultural Outlook report from OECD-FAO1

72

Awardee AwardeeHeadquarters RecoveryFunding TotalValue Denmark  

Open Energy Info (EERE)

TotalValue Denmark Catalonia Spain Tech Inc Pittsburgh Pennsylvania Madrid Spain Germany Italy Belgium Czech Republic France Germany Ireland Norway United Kingdom Minnesota...

73

E-Print Network 3.0 - anholt denmark resolved Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection: Mathematics 38 Ris-R-Report Power fluctuations from large wind farms - Summary: in Denmark: Horns Rev shows that the power from the wind farm is...

74

Galileo in early modern Denmark, 1600-1650  

E-Print Network [OSTI]

The scientific revolution in the first half of the seventeenth century, pioneered by figures such as Harvey, Galileo, Gassendi, Kepler and Descartes, was disseminated to the northernmost countries in Europe with considerable delay. In this essay I examine how and when Galileo's new ideas in physics and astronomy became known in Denmark, and I compare the reception with the one in Sweden. It turns out that Galileo was almost exclusively known for his sensational use of the telescope to unravel the secrets of the heavens, meaning that he was predominantly seen as an astronomical innovator and advocate of the Copernican world system. Danish astronomy at the time was however based on Tycho Brahe's view of the universe and therefore hostile to Copernican and, by implication, Galilean cosmology. Although Galileo's telescope attracted much attention, it took about thirty years until a Danish astronomer actually used the instrument for observations. By the 1640s Galileo was generally admired for his astronomical disc...

Kragh, Helge

2014-01-01T23:59:59.000Z

75

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU  

E-Print Network [OSTI]

Comparative Microbial Genomics group Centerfor%-8531)1-803,% - or - Where Does Vibrio cholera come from? #12;Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU #12;Comparative Microbial Genomics

Ussery, David W.

76

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU Minimal genomes in bacterial Genera Dave Ussery European Conference on Synthetic Biology: Design 2007 #12;Comparative Microbial Genomics group Centerfor

Ussery, David W.

77

PROCESSES OF INSTITUTIONAL INNOVATION: REFERENCE TOOLS FOR ECO-CITIES IN FRANCE AND DENMARK  

E-Print Network [OSTI]

0 PROCESSES OF INSTITUTIONAL INNOVATION: REFERENCE TOOLS FOR ECO-CITIES IN FRANCE Frederiksberg, Denmark June 6, 2012 #12; 1 PROCESSES OF INSTITUTIONAL INNOVATION: REFERENCE TOOLS, Harty 2008). Sustainable construction represents a remarkable break with this tradition with strong

Paris-Sud XI, Université de

78

A review of "Anna of Denmark, Queen of England: A Cultural Biography." by Leeds Barroll  

E-Print Network [OSTI]

continued interest and further research in this area. Leeds Barroll. Anna of Denmark, Queen of England: A Cultural Biography. Philadelphia: University of Pennsylvania Press, 2001. 227 pp. + illus. $35.00. Review by JANE LYTTON GOOCH, UNIVERSITY... OF BRITISH COLUMBIA. Leeds Barroll?s account of the cultural and political activi- ties of Anna, Queen of England 1603-1619, reverses the usual scholarly impression of her. Up to now, the daughter of the King of Denmark has been viewed by historians as a...

Jane Lytton Gooch

2002-01-01T23:59:59.000Z

79

The Late Medieval Agrarian Crisis and Black Death plague epidemic in medieval Denmark: a paleopathological and paleodietary perspective  

E-Print Network [OSTI]

OF MEDIEVAL DENMARK.........................7 Women in Scandinavia .............................................................8 The Early Medieval Period of Denmark...................................9 The Little Ice Age and Late Medieval...............................57 4.6. Placement of the Ribe cemetery in relation to the Ribe Cathedral....59 4.7. Excavation plan of the Ribe Cemetery ..............................................58 4.8. Arm position placement used for dating of skeletons...

Yoder, Cassady J.

2009-06-02T23:59:59.000Z

80

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark Burkholderia Pan-genomics Dave Ussery Max Planck Institut fur Terrestrial Microbiology Marburg, Germany 26 May, 2008 - or - What can we learn from more than 50 sequenced genomes? #12;Comparative Microbial Genomics

Ussery, David W.

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark E. coli pangenomics - or - How to compare hundreds of E. coli genomes Fuzzy Dave Ussery UllevĂĄl Universitetssykehus Oslo, Norway Wednesday, 10 December, 2008 #12;Comparative Microbial Genomics group Centerfor

Ussery, David W.

82

Recent experiences with Energy Technology Foresight in Denmark and on Nordic Level  

E-Print Network [OSTI]

technologies: · Biomass · Solar (PV and thermal) · Wind · Fuel cells · Hydrogen · New efficient energyRecent experiences with Energy Technology Foresight in Denmark and on Nordic Level First meeting of the Energy Technology Foresight Network (EFONET) Brussels, June 16, 2005 Per Dannemand Andersen Risø National

83

Wind Turbine Shutdowns and Upgrades in Denmark: Timing Decisions and the Impact of Government Policy  

E-Print Network [OSTI]

Wind Turbine Shutdowns and Upgrades in Denmark: Timing Decisions and the Impact of Government structural econometric model of wind turbine owners' decisions about whether and when to add new turbines the underlying profit structure for wind producers and evaluate the impact of technology and government policy

Lin, C.-Y. Cynthia

84

Background Paper -Research Workshop on Expectations in Science & Technology April 29 30, 2004, Ris, Denmark  

E-Print Network [OSTI]

or less explicit on the future rather than on the present or the past. The ability to discuss aspects, Risø, Denmark Expectations in Nanotechnology and in Energy ­ Foresight in the Sea of Expectations Mads of the future and to define the understanding of the future at present is central and of strategic importance

85

Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 19952007 (the  

E-Print Network [OSTI]

1 Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 1995­2007 (the International Cancer Benchmarking Partnership): an analysis of population-based cancer registry data M P Coleman Background Cancer survival is a key measure of the effectiveness of health-care systems. Persistent regional

Maizels, Rick

86

Future Smart Energy -Fuel Cell and Hydrogen Summer School 2014, Aalborg, Denmark  

E-Print Network [OSTI]

Future Smart Energy - Fuel Cell and Hydrogen Technology Summer School 2014, Aalborg, Denmark August #12;31 Future Smart Energy - Fuel Cell and Hydrogen Technology Samuel Simon Araya Introduction to fuel cells History Why fuel cells? Fuel cell types Fuel and infrastructure Hydrogen production Hydrogen

Berning, Torsten

87

ACTA ORIENTALIA, founded in 1922, published annually under the auspices of the Oriental Societies of Denmark, Finland, Norway and Sweden,  

E-Print Network [OSTI]

of Denmark, Finland, Norway and Sweden, with support from the Nordic Publications Board for Periodicals orders may be placed with: Hermes Academic Publishing P.O.Box 2709 Solli, N-0204 Oslo, Norway Fax + 47 22

Løw, Erik

88

ACTA ORIENTALIA, founded in 1922, published annually under the auspices of the Oriental Societies of Denmark, Finland, Norway and Sweden,  

E-Print Network [OSTI]

of Denmark, Finland, Norway and Sweden, with support from the Nordic Publications Board for Periodicals: Hermes Academic Publishing P.O.Box 2709 Solli, N-0204 Oslo, Norway Fax + 47 22 43 69 95; telephone + 47

Løw, Erik

89

Cross-border transfer of climate change mitigation technologies : the case of wind energy from Denmark and Germany to India  

E-Print Network [OSTI]

This research investigated the causal factors and processes of international development and diffusion of wind energy technology by examining private sector cross-border technology transfer from Denmark and Germany to India ...

Mizuno, Emi, Ph. D. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

90

Ris National Laboratory Technical University of Denmark November 2007 Ris Energy Report 6  

E-Print Network [OSTI]

CLEaR ENERgy 58 7.8 FuSIoN ENERgy 63 7.9 gEotHERmaL ENERgy 67 7.10 HyDRo, oCEaN, WaVE aND tIDaL 69 8 INNoRisø National Laboratory · Technical University of Denmark November 2007 Risø Energy Report 6 Future options for energy technologies Edited by Hans Larsen and Leif Sønderberg Petersen Risø-R-1612(EN

91

Ris Energy Report 4 Denmark in a European market 1 Known abroad for being a country with highly efficient  

E-Print Network [OSTI]

Risø Energy Report 4 Denmark in a European market 1 4 Known abroad for being a country with highly an environment-friendly position on energy. Since the beginning of the 1990s climate change has been an important driver for Danish energy policy, and as a result the country has taken a robust approach to improving

92

Maher and Shaw Directional Aspects of Forensic Gunshot Recordings AES 39th International Conference, Hillerd, Denmark, 2010 June 1719 1  

E-Print Network [OSTI]

Maher and Shaw Directional Aspects of Forensic Gunshot Recordings AES 39th International Conference, Hillerød, Denmark, 2010 June 17­19 1 DIRECTIONALASPECTS OF FORENSIC GUNSHOT RECORDINGS ROBERT C. MAHER rob.maher@montana.edu Crime scene forensic evidence may include audio gunshot recordings obtained from

Maher, Robert C.

93

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

94

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

95

Environmental assessment of garden waste management in the Municipality of Aarhus, Denmark  

SciTech Connect (OSTI)

An environmental assessment of six scenarios for handling of garden waste in the Municipality of Aarhus (Denmark) was performed from a life cycle perspective by means of the LCA-model EASEWASTE. In the first (baseline) scenario, the current garden waste management system based on windrow composting was assessed, while in the other five scenarios alternative solutions including incineration and home composting of fractions of the garden waste were evaluated. The environmental profile (normalised to Person Equivalent, PE) of the current garden waste management in Aarhus is in the order of -6 to 8 mPE Mg{sup -1} ww for the non-toxic categories and up to 100 mPE Mg{sup -1} ww for the toxic categories. The potential impacts on non-toxic categories are much smaller than what is found for other fractions of municipal solid waste. Incineration (up to 35% of the garden waste) and home composting (up to 18% of the garden waste) seem from an environmental point of view suitable for diverting waste away from the composting facility in order to increase its capacity. In particular the incineration of woody parts of the garden waste improved the environmental profile of the garden waste management significantly.

Boldrin, Alessio, E-mail: aleb@env.dtu.dk [Department of Environmental Engineering, Technical University of Denmark, Kongens Lyngby (Denmark); Andersen, Jacob K.; Christensen, Thomas H. [Department of Environmental Engineering, Technical University of Denmark, Kongens Lyngby (Denmark)

2011-07-15T23:59:59.000Z

96

Waste collection systems for recyclables: An environmental and economic assessment for the municipality of Aarhus (Denmark)  

SciTech Connect (OSTI)

Recycling of paper and glass from household waste is an integrated part of waste management in Denmark, however, increased recycling is a legislative target. The questions are: how much more can the recycling rate be increased through improvements of collection schemes when organisational and technical limitations are respected, and what will the environmental and economic consequences be? This was investigated in a case study of a municipal waste management system. Five scenarios with alternative collection systems for recyclables (paper, glass, metal and plastic packaging) were assessed by means of a life cycle assessment and an assessment of the municipality's costs. Kerbside collection would provide the highest recycling rate, 31% compared to 25% in the baseline scenario, but bring schemes with drop-off containers would also be a reasonable solution. Collection of recyclables at recycling centres was not recommendable because the recycling rate would decrease to 20%. In general, the results showed that enhancing recycling and avoiding incineration was recommendable because the environmental performance was improved in several impact categories. The municipal costs for collection and treatment of waste were reduced with increasing recycling, mainly because the high cost for incineration was avoided. However, solutions for mitigation of air pollution caused by increased collection and transport should be sought.

Larsen, A.W., E-mail: awl@env.dtu.d [Department of Environmental Engineering, Technical University of Denmark, Miljoevej, Building 113, DK-2800 Kongens Lyngby (Denmark); Merrild, H.; Moller, J.; Christensen, T.H. [Department of Environmental Engineering, Technical University of Denmark, Miljoevej, Building 113, DK-2800 Kongens Lyngby (Denmark)

2010-05-15T23:59:59.000Z

97

A bibliography of 17th century German imprints in Denmark and the Duchies of Schleswig-Holstein  

E-Print Network [OSTI]

that lacuna seems nearly insuperable. If the task is to be accomplished, it will presumably be done piecemeal—by area and language, and in addition by special studies using the criteria of subject and genre. Several special studies are already in existence... monarchy in the sev enteenth century, that is, the area of present-day Denmark, the former Duchies of Schleswig and Holstein, as well as Norway (four, possibly five entries), Iceland (one entry), and, nominally, the provinces of Scania and Blekinge...

Mitchell, P. M.

1969-01-01T23:59:59.000Z

98

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 Ammonia Emissions from Broiler Houses in Pennsylvania  

E-Print Network [OSTI]

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 1 Ammonia Emissions from Broiler Houses in Pennsylvania During Cold of reducing ammonia (NH3) emissions are under study. Ammonia emissions during cold weather conditions from

Kentucky, University of

99

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 Ammonia Emissions from Broiler Houses in Kentucky during Winter  

E-Print Network [OSTI]

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 Ammonia Emissions from Broiler Houses in Kentucky during Winter Kenneth D a comprehensive database of ammonia emission rates (ER) from US poultry facilities. The influence of common

Kentucky, University of

100

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 AMMONIA EMISSIONS FROM LAYER HOUSES IN IOWA  

E-Print Network [OSTI]

International Symposium on Gaseous and Odour Emissions from Animal Production Facilities, Horsens, Jutland, Denmark 1-4 June, 2003 1 AMMONIA EMISSIONS FROM LAYER HOUSES IN IOWA Y. Liang1 , H. Xin2 , A. Casey10 ABSTRACT An ongoing project of monitoring ammonia (NH3) emissions from U.S. layer houses

Kentucky, University of

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Charles Nielsen; Jan Larsen; Kristian Morgen, DONG Energy, Kraftsvaerksvej 53, 7000 Fredericia, Denmark Security of supply, sustainability and the market are controlling parameters for developing the energy  

E-Print Network [OSTI]

, sustainability and the market are control parameters for developing the energy system. Bioethanol is partBioethanol Charles Nielsen; Jan Larsen; Kristian Morgen, DONG Energy, Kraftsvaerksvej 53, 7000 Fredericia, Denmark Abstract Security of supply, sustainability and the market are controlling parameters

102

Monitoring of saline tracer movement with vertically distributed self-potential measurements at the HOBE agricultural test site, Voulund, Denmark  

E-Print Network [OSTI]

The self-potential (SP) method is sensitive to water fluxes in saturated and partially saturated porous media, such as those associated with rainwater infiltration and groundwater recharge. We present a field-based study at the Voulund agricultural test site, Denmark, that is, to the best of our knowledge, the first to focus on the vertical self-potential distribution prior to and during a saline tracer test. A coupled hydrogeophysical modeling framework is used to simulate the SP response to precipitation and saline tracer infiltration. A layered hydrological model is first obtained by inverting dielectric and matric potential data. The resulting model that compares favorably with electrical resistance tomography models is subsequently used to predict the SP response. The electrokinetic contribution (caused by water fluxes in a charged porous soil) is modeled by an effective excess charge approach that considers both water saturation and pore water salinity. Our results suggest that the effective excess char...

Jougnot, Damien; Haarder, Eline B; Looms, Majken C

2015-01-01T23:59:59.000Z

103

Simultaneous immersion Mirau interferometry Oleksandra V. Lyulko, Gerhard Randers-Pehrson, and David J. Brenner  

E-Print Network [OSTI]

polarizing elements into the optics to allow simultaneous acquisition of two inter- ferograms. The system community with single-particle, single-cell mi- crobeam irradiation facilities for studying the biological ef- fects of exposure to ionizing radiation. A component of each of these microbeam irradiation

Brenner, David Jonathan

104

Curriculum Vitae for Gerhard Randers-Pehrson, PhD 1) CV prepared: March 23, 2006  

E-Print Network [OSTI]

Microfilms as document 7926535, but otherwise unpublished. 4) Postdoctoral Training: 1973-1976 Research

105

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

106

Proceedings of the Right Light 4 Conference, November 19-21, 1997, Copenhagen, Denmark. This work was supported by the U.S. General Services Administration, Pacific Rim Region, the Pacific Gas &  

E-Print Network [OSTI]

Cyclotron Road Berkeley, California, USA, 94720 Steven Blanc Pacific Gas & Electric Co. Customer Energy, Denmark. This work was supported by the U.S. General Services Administration, Pacific Rim Region, the Pacific Gas & Electric Company, and the Assistant Secretary for Energy Efficiency and Renewable Energy

107

The 10th International Equitation Science Conference is held in Denmark from August 6th 9th 2014. This book of proceedings contains abstracts of 35 oral and 57 poster presentations within the conference themes Equine  

E-Print Network [OSTI]

The 10th International Equitation Science Conference is held in Denmark from August 6th ­ 9th 2014. This book of proceedings contains abstracts of 35 oral and 57 poster presentations within the conference PROCEEDINGS 10TH INTERNATIONAL EQUITATION SCIENCE CONFERENCE 6 - 9 AUGUST 2014 AT VINGSTED HOTEL

108

Home composting as an alternative treatment option for organic household waste in Denmark: An environmental assessment using life cycle assessment-modelling  

SciTech Connect (OSTI)

An environmental assessment of the management of organic household waste (OHW) was performed from a life cycle perspective by means of the waste-life cycle assessment (LCA) model EASEWASTE. The focus was on home composting of OHW in Denmark and six different home composting units (with different input and different mixing frequencies) were modelled. In addition, incineration and landfilling was modelled as alternatives to home composting. The most important processes contributing to the environmental impact of home composting were identified as greenhouse gas (GHG) emissions (load) and the avoided emissions in relation to the substitution of fertiliser and peat when compost was used in hobby gardening (saving). The replacement of fertiliser and peat was also identified as one of the most sensible parameters, which could potentially have a significant environmental benefit. Many of the impact categories (especially human toxicity via water (HTw) and soil (HTs)) were affected by the heavy metal contents of the incoming OHW. The concentrations of heavy metals in the compost were below the threshold values for compost used on land and were thus not considered to constitute a problem. The GHG emissions were, on the other hand, dependent on the management of the composting units. The frequently mixed composting units had the highest GHG emissions. The environmental profiles of the home composting scenarios were in the order of -2 to 16 milli person equivalents (mPE) Mg{sup -1} wet waste (ww) for the non-toxic categories and -0.9 to 28 mPE Mg{sup -1} ww for the toxic categories. Home composting performed better than or as good as incineration and landfilling in several of the potential impact categories. One exception was the global warming (GW) category, in which incineration performed better due to the substitution of heat and electricity based on fossil fuels.

Andersen, J.K.; Boldrin, A.; Christensen, T.H. [Department of Environmental Engineering, Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark); Scheutz, C., E-mail: chas@env.dtu.dk [Department of Environmental Engineering, Technical University of Denmark, DK-2800 Kongens Lyngby (Denmark)

2012-01-15T23:59:59.000Z

109

Technical University of Denmark Technical University of Denmark  

E-Print Network [OSTI]

Civil Engineering · DTU Compute · DTU Electrical Engineering · DTU Energy Conversion · DTU Environment · DTU Food · DTU Fotonik · DTU Management Engineering · DTU Mechanical Engineering · DTU Nanotech · DTU · Biotechnology, biochemistry and biomedicine · Civil engineering and planning · Electro technologies · Energy

Franssen, Michael

110

Risoe Energy Conference Copenhagen, Denmark  

E-Print Network [OSTI]

Zambia Ltd (CEEEZ) Private Bag E721, Lusaka ZAMBIA Tel/Fax: +260 - 1 - 240267 Email: yamba Cane Molasses/Juice Crop Residues (Bagasse) Sugar/Solids Raw Sugar Industrial Uses Steam & Electricity%) Biomass (0%) Other/Nuclear (1.9%) Figure: SAPP Installed Electricity Capacity for 2000 (Total Energy 45 GW

111

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

112

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

113

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

114

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

115

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

116

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

117

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

118

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

119

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

120

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

122

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

123

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

124

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

125

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

126

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

127

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

128

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

129

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

130

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

131

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

132

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

133

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

134

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

135

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

136

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

137

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

138

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

139

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

140

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

142

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

143

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

144

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

145

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

146

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

147

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

148

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

149

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

150

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

151

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

152

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

153

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

154

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

155

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

156

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

157

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

158

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

159

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

160

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

162

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

163

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

164

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

165

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

166

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

167

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

168

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

169

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

170

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

171

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

172

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

173

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

174

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

175

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

176

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

177

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

178

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

179

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

180

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

182

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

183

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

184

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

185

Ris National Laboratory, Roskilde, Denmark August 1999  

E-Print Network [OSTI]

activities within development of laser diagnostics for fusion plasmas and studies of nonlinear dynamical Unit 5 2. Fusion Plasma Physics 6 2.1 Introduction 6 2.2 Laser Plasma Diagnostics 7 2.2.1 Theoretical of plasma turbulence 11 2.2.5 Phase contrast methods applied to plasma diagnostics 12 2.3 Nonlinear Dynamics

186

Environmental Radioactivity in Denmark in 1983  

E-Print Network [OSTI]

, potatoes, vegetables, (continued) INIS-Descriptors: AIR; AMERICIUM ISOTOPES; AQUATIC ECOSYSTEMS; AT was determined in precipitation, ground water and sea water. Plutonium and Americium were measured in marine

187

Technical University of Denmark rsted DTU Automation  

E-Print Network [OSTI]

the grant of Danish Energy Authority Project partner and co-sponsor: B&O ICEpower a/s J.nr.:SICAM.01 with an active capacitive voltage clamp is presented. AC-DC power supply is implemented in its simplest form-fits-all" solution that will overcome all the challenges and satisfy all of the specifications including high

188

Denmark Solar Industry DSI | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunwaysDatang Chifeng Saihanba

189

Copenhagen, Denmark: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The following text is derivedCoReturnCookson Hills ElecCopenhagen,

190

Stirling Denmark Ltd | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen, Minnesota: Energy Resources JumpStepoverGeothermalJump to:Stirling

191

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

192

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

193

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

194

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

195

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

196

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

197

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

198

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

199

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

200

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

202

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

203

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

204

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

205

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

206

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

207

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

208

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

209

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

210

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

211

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

support: Danish Environmental Protection Agency Please cite as: Illerup, J.B., Nielsen, O-K., Winther, M the fore- casts are available, i.e. the latest official forecast from the Danish Energy Authority. The emis measures. Official Danish forecasts of activity rates are used in the models for those sectors for which

212

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

: Danish Environmental Protection Agency Please cite as: Illerup, J.B, Nielsen, O-K., Winther, M, i.e. the latest official forecast from the Danish Energy Authority. The emission factors refer sce- narios together with the expected results of a few individual policy measures. Official Danish

213

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

Gyldenkærne Leif Hoffmann Erik Lyck Jytte Boll Illerup #12;'DWD VKHHW Series title and no.: NERI Technical Gyldenkærne, Leif Hoffmann, Erik Lyck, Jytte Boll Illerup Department: Department of Policy Analysis Publisher support Please cite as: Fauser, P., Thomsen, M., Nielsen, O-K., Winther, M., Gyldenkærne, S., Hoffmann, L

214

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Mette Hjorth Mikkelsen Leif Hoffmann Steen Gyldenkærne Patrik Fauser Malene Nielsen #12;'DWD VKHHW, Ole-Kenneth Nielsen, Morten Winther, Mette Hjorth Mikkelsen, Leif Hoffmann, Steen Gyldenkærne, Patrik financial support Please cite as: Illerup, J.B., Nielsen, O-K., Winther, M., Mikkelsen, M.H., Hoffmann, L

215

DVB-H in Denmark Technical and Economic aspects  

E-Print Network [OSTI]

....................................................................................................... 15 3. OVERVIEW OF MOBILE TV TECHNOLOGIES ....................................................................... 16 3.1 BROADCAST AND UNICAST TECHNOLOGIES FOR MOBILE TV ................................. 16 3......................................................................................... 18 3.3 MOBILE TV USING WIRELESS TECHNOLOGY

216

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

statistics 23 4.2 Trends 24 4.3 Results from model calculations 25 &DUERQ PRQR[LGH 5.1 Annual statistics 29

217

Technical University of Denmark A Thesis Submitted for the Degree  

E-Print Network [OSTI]

and Logging in compliance with IEC 61400-25 Using Wind Power Plant Configuration Language (WPPCL) Author: s;Abstract Vendors and customers in the wind power plant market are not capable of choos- ing each other for modeling wind power plants in the soft- ware domain. IEC 61400-25 addresses this challenge. This thesis

218

16-11-051ETSAP Modelling Issues in Denmark  

E-Print Network [OSTI]

energy use and more electricity and district heating0 100 200 300 400 500 600 700 800 900 80 '82 '84 '86 · Large share of combined heat and power · Moderate increase in household electricity demand · Larger incineration and CCGT up to 100 MW. · Small district heating systems: Gas motors below 20 MW and district

219

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

at offshore wind turbines NERI Technical Report, No. 440 #12;National Environmental Research Institute for estimating collision frequency of migrating birds at offshore wind turbines NERI Technical Report, No. 440 of a method for estimating collision frequency of migrating birds at offshore wind turbines Author: Mark

220

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

) and Quality certified (ISO 9002) Number of pages: 192 Circulation: 200 Price: DKK 100,- (incl. 25% VAT, excl 32 1 Introduction 37 1.1 Obligations 37 1.2 Environmental problems 38 1.3 Historical emission data 39

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

Reproduction permitted provided the source is explicitly acknowledged Abstract: This publication is a strategic@frontlinien.dk #12;Contents Preface 5 Acknowledgement 6 Summary and conclusions 7 Dansk resume 12 Naalisagaq

222

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

permitted provided the source is explicitly acknowledged Abstract: Liberalisation of the electricity market quickly. The liberalisation causes a consider- able change of operation practice of the engines e.g. less

223

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

'LR[LQV IURP SRZHU GLVWULFW KHDWLQJ DQG FRPELQHG KHDW DQG SRZHU SODQWV 2.1 Coal-fired plants 13 2.2 Oil for electricity and heat generation 13 2.3 Natural gas-fired plants 14 2.4 Orimulsion for electricity and heat generation 14 2.5 Municipal Solid Waste (MSW) for electricity and heat generation 14 2

224

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

: Department of Policy Analysis Publisher: National Environmental Research Institute University of Aarhus and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO2, NOX, NMVOC, CH4, CO, CO2, N2O, particulate matter, heavy metals, dioxins and PAH. A consider- able decrease

225

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

and dioxin 53 11 Uncertainty 57 11.1 Methodology 57 #12;11.1.1 Greenhouse gases 57 11.1.2 Other pollutants 58 Illerup Department: Department of Policy Analysis Serial title and no.: Research Notes from NERI No. 192- odologies and assumptions used for the inventories are described. The pollutants considered are: SO2 , NOx

226

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Illerup Department: Department of Policy Analysis Serial title and no.: Research Notes from NERI No. 229 are described. The pollutants con- sidered are SO2 , NOX , NMVOC, CH4 , CO, CO2 , N2 O, particulate matter, heavy metals, dioxins and PAH. Since 1990 the fuel consumption in stationary combustion has in- creased

227

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

. 686, 2008 Danish emission inventories for road transport and other mobile sources Inventories until NERI Technical Report No. 686, 2008 Danish emission inventories for road transport and other mobile sources Inventories until year 2006 Morten Winther #12;'DWD VKHHW Series title and no.: NERI Technical

228

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Emissions Inventory Report to UNECE Inventories 1990 - 2002 Research Notes from NERI No. 202 #12;[Blank page Inventory Report to UNECE Inventories 1990 - 2002 Research Notes from NERI No. 202 2004 Jytte Boll Illerup Title: Annual Danish Emissions Inventory Report to UNECE Subtitle: Inventories 1990 - 2002 Authors

229

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

Emissions Inventory Report to UNECE Inventories from the base year of the protocols to year 2001 NERI of the Environment Annual Danish Emissions Inventory Report to UNECE Inventories from the base year of the protocols Mette Hjort Mikkelsen #12;Data sheet Title: Annual Danish Emissions Inventory Report to UNECE Subtitle

230

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

inventories for road transport and other mobile sources Inventories until year 2002 Research Notes from NERI Danish emission inventories for road transport and other mobile sources Inventories until year 2002 Research Notes from NERI No. 201 2004 Morten Winther #12;Data sheet Title: Danish emission inventories

231

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

inventories for stationary combustion plants Inventories until year 2002 Research Notes from NERI No. 200 #12 emission inventories for stationary combustion plants Inventories until year 2002 Research Notes from NERI No. 200 2004 Malene Nielsen Jytte Boll Illerup #12;Data sheet Title: Danish emission inventories

232

Denmark, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park,DellProgrammeDenair,

233

National Environmental Research Institute University of Aarhus . Denmark  

E-Print Network [OSTI]

of Minerals and Petroleum, Nuuk, Greenland Home Rule, and the Danish Environ- mental Protection Agency GEUS discovered oil in porous volcanics in the early 1990ies. This oil was also found in the Marraat-1

234

EWIS European wind integration study (Smart Grid Project) (Denmark) | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen EnergyOpenInformation|

235

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

observations of birds in relation to collision risk at the Horns Rev offshore wind farm Annual status report to collision risk at the Horns Rev offshore wind farm Annual status report 2003 Report commissioned by Elsam offshore wind farm Authors: Thomas Kjćr Christensen, Jens Peter Hounisen, Ib Clausager & Ib Krag Petersen

236

National Environmental Research Institute Ministry of the Environment . Denmark  

E-Print Network [OSTI]

scenarios are outlined. In the basic scenario the emission in 2012 will de- crease to 9.8 mio. tonnes CO2 -eqv. and in 2017 a further reduction to 9.6 mio. tonnes of CO2 -eqv. is estimated. This corresponds to a reduction of 29% from 1990 to 2017. From 2002 to 2017 the reduction is estimated to 0.9 mio. tonnes CO2 -eqv

237

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

238

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

239

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

240

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

242

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

243

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

244

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

245

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

246

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

247

E-Print Network 3.0 - arnager limestone denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection: Multidisciplinary Databases and Resources 80 A calibrated composite section for the Late Jurassic Reuchenette Formation in northwestern Switzerland Summary:...

248

Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU  

E-Print Network [OSTI]

Comparative Microbial Genomics group Centerfor systematics - is it relevant to modern science? Istanbul, Turkey 8 August, 2008 - or - What can genomics tell us about Vibrio species? Discovering natural groups in Vibrio #12;Comparative Microbial Genomics

Ussery, David W.

249

ARCHITECTURAL QUALITY OF LOW ENERGY HOUSES. By Michael Lauring and Rob Marsh, Aalborg University, Denmark.  

E-Print Network [OSTI]

integrated design of houses with good architecture and good environmental performance. BACKGROUND: Building, as for instance in a passive house, are not combined with good architecture, there are two obvious negative in the design of examples of detached housing, terraced housing and multi storey housing with carbon dioxide

Hansen, René Rydhof

250

Ris DTU Dec.3 2009WindScanner.eu 1 Ris DTU, Technical University of Denmark  

E-Print Network [OSTI]

% to the average Danish electricity consumption · Today DK is leading worldwide regarding research and development market · By year 2020 EU's goal is to cover ~20% of the Unions electricity consumption via sustainable of wind power technology · EU Governments wish to maintain the lead Internationally on the wind power

251

APMIS 114: 12730, 2006 C 2006 The Authors Printed in Denmark . All rights reserved  

E-Print Network [OSTI]

Helicobacter pylori in vitro. APMIS 2006;114:127­30. Group IIA phospholipase A2 (PLA2-IIA) is an enzyme which has important roles in inflammation and infection. Recently, a novel human secretory PLA2 called group XIIA PLA2 (PLA2-XIIA) has been identified. Both PLA2-IIA and PLA2-XIIA are bactericidal against Gram

Gelb, Michael

252

E-Print Network 3.0 - aarhus denmark introduction Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wetlands Conference Utrecht 2004, 25-30 July Summary: wetlands for on-site treatment of wastewater Hans Brix Aarhus University, Institute of Biological Sciences... ,...

253

E-Print Network 3.0 - aarhus denmark field Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Wetlands Conference Utrecht 2004, 25-30 July Summary: wetlands for on-site treatment of wastewater Hans Brix Aarhus University, Institute of Biological Sciences... ,...

254

Geological Storage of CO2 from Power Niels Peter Christensen, Geological Survey of Denmark and  

E-Print Network [OSTI]

agreed to adopt a 20% emission reduction target by 2020 for the EU, increasing to 30% if the USA agrees to increase generating capacity. Electricity demand continues to mount by around 1.5% each year, but existing infrastructure and electricity plants are reaching the end of their useful life. It is also important that the EU

255

Technical University of Denmark Ris National Laboratory HAWC2 simulations of a floating  

E-Print Network [OSTI]

turbine for deep water Introduction The aeroelastic multi-body code for wind turbine response HAWC2 has-shore turbines the pitch motion is normally slow related to the tower motion causing a positive instantaneous gradient. For floating turbines the tower eigenfrequency is very low (

256

Ris National Laboratory Technical University of Denmark November 2007 Ris Energy Report 6  

E-Print Network [OSTI]

and conclusions The world depends heavily on fossil fuels, which cur- rently cover about 80 % of global energy fuels. Today these account for 50 % of our energy consumption, but the 2030 figure is forecast for the period up to 2025". This aims to stabilise energy consumption at its current level, and calls

257

Awardee AwardeeHeadquarters RecoveryFunding TotalValue Denmark  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio Jump to: navigation,Avanzalia Solar SL

258

Ris National Laboratory Technical University of Denmark CONDITION MONITORING OF WIND  

E-Print Network [OSTI]

Introduction This poster deals with condition monitoring of wind turbine blades based on a system stiffness and damping of an operating wind turbine blade and subsequently use changes in these parameters This poster deals with condition monitoring of wind turbine blades based on a system identification approach

259

INTERNATIONAL CONFERENCE ON ENGINEERING DESIGN, ICED11 15 -18 AUGUST 2011, TECHNICAL UNIVERSITY OF DENMARK  

E-Print Network [OSTI]

which was led in an international company dealing with hydraulic power plant machine design. It exposes organization builds and provides various ranges of Turbines/Generator on the international market in order of products since each sold turbine/generator is specific and must answer to new customer expectations

Paris-Sud XI, Université de

260

Proceedings of ASME Turbo Expo 2012 June 11-15, 2012, Copenhagen, Denmark  

E-Print Network [OSTI]

plane, x/c = 1.025. Abbreviations N Turbine nozzle guide vane. R Turbine blade. SST Shear stress Flow Turbine Research Facility (AF- TRF) having a diameter of 91.66cm. For the experimental mea- surement comparison, a reference Flat Insert is installed in the nozzle guide vane (NGV) passage. It has

Camci, Cengiz

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Proceedings of ASME Turbo Expo 2012 June 11-15, 2012, Copenhagen, Denmark  

E-Print Network [OSTI]

-68325 REDUCING THE DEMAND OF COOLANT AT THE SIDEWALL OF A HIGH PRESSURE TURBINE CASCADE BY MEANS OF SLOT WIDTH MODULATION Michael Woopen Institute of Propulsion Technology Turbine Department German Aerospace Center (DLR Turbine Department German Aerospace Center (DLR) G¨ottingen, Germany Peter-Anton Gieß Institute

262

Natural Gas Supply in Denmark -A Model of Natural Gas Transmission and the  

E-Print Network [OSTI]

, which describes the markets for electricity and district heat. Specifically on the demand side Foundation for Gas Market Liberalization . . . . . . . . . . . 14 2.5 District Heating of the markets of natural gas and electricity and the existence of an abundance of de-centralized combined heat

263

E-Print Network 3.0 - animals snekkersten denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Modelling Collection: Mathematics ; Computer Technologies and Information Sciences 71 Biogas Co-substrates for the Farm and Food Sectors Workshop Summary: , Canada Focus on...

264

E-Print Network 3.0 - addition study denmark Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 ... Source: Ecole Polytechnique, Centre de mathmatiques Collection: Mathematics 26 UPGRADING OF WASTE-TO-ENERGY PLANT IN BRESCIA, ITALY Summary: treatment options outlined...

265

EcoGrid Denmark, ForskEL (Smart Grid Project) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1 June,

266

E-Print Network 3.0 - aquifer grindsted denmark Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Center, Reston, Virginia 20192 The ... Source: Grossman, Ethan L. - Department of Geology and Geophysics, Texas A&M University Collection: Geosciences 6 Review Paper...

267

EAGE Conference & Exhibition incorporating SPE EUROPEC 2012 Copenhagen, Denmark, 4-7 June 2012  

E-Print Network [OSTI]

of equations can be transformed into an equivalent, positive semi-definite system via KACZMARZ row) any variable shared by two or more blocks is updated to be the average of its values in the different in terms of the eigen-

Gordon, Dan

268

From Propaganda to Science: Looking at the World of Academies in Early Seventeenth-century Naples  

E-Print Network [OSTI]

Bohmerland, Sweitzerland, Netherland, Denmarke, Poland,Bohmerland, Sweitzerland, Netherland, Denmarke, Poland,

Gianfrancesco, Lorenza

2012-01-01T23:59:59.000Z

269

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

270

Inside this issue: Around Campus  

E-Print Network [OSTI]

surprises along the way. Wow, we're going to be busy! As I close, I want to highlight the Jorgen Randers. Will the climate problem hurt the US? 4. Will energy be more expensive? 5. Will the young generation calmly accept

Kidd, William S. F.

271

THE RADIOLOGICAL RESEARCH ACCELERATOR FACILITY  

E-Print Network [OSTI]

: Stephen A. Marino, M.S. Chief Physicist: Gerhard Randers-Pehrson, Ph.D. Funding During this year, we were of the mutagenesis of human-hamster hybrid (AL) cells by charged particles (Exp. 43) resumed this year. Tom Hei) cells by an exact number of 4 He ion traversals (Exp. 76) continue to be investigated by Tom Hei

272

Proposed laser ion source for the Columbia University microbeam  

E-Print Network [OSTI]

Proposed laser ion source for the Columbia University microbeam Alan W. Bigelow *, G. Randers-Pehrson, D.J. Brenner Center for Radiological Research, Columbia University, New York, NY 10032, USA Abstract analyzer 1. Introduction At Columbia UniversityĂ?s Radiological Re- search Accelerator Facility (RARAF

273

The Columbia University microbeam II endstation for cell imaging and irradiation  

E-Print Network [OSTI]

The Columbia University microbeam II endstation for cell imaging and irradiation A.W. Bigelow *, G.J. Ross, G. Randers-Pehrson, D.J. Brenner Columbia University, Radiological Research Accelerator Facility The Columbia University Microbeam II has been built to provide a focused ion beam for irradiating designated

274

Laser ion source development for the Columbia University microbeam A. W. Bigelow,a)  

E-Print Network [OSTI]

Laser ion source development for the Columbia University microbeam A. W. Bigelow,a) G. Randers-Pehrson, and D. J. Brenner Center for Radiological Research, Columbia University, New York, New York 10032 accelerator at the Columbia University Radiological Research Accelerator Facility RARAF . The source has been

Bigelow, Alan W.

275

Nordisk kernesikkerhedsforskning Norrnar kjarnryggisrannsknir  

E-Print Network [OSTI]

for Sustainable Energy, Technical university of Denmark, Denmark (2) Department of Earth Science, Uppsala for Sustainable Energy, Technical university of Denmark, Denmark (2) Department of Earth Science, Uppsala University, Sweden (3) Tandem Laboratory, Uppsala University, Sweden (4) Laboratory of Radiochemistry

276

Foreword by the Hon. Ida Auken, Minister for the Environment, Denmark Procurement, Innovation and Green Growth2  

E-Print Network [OSTI]

for Sustainable Development Published by the International Institute for Sustainable Development. ISBN: 978-1-894784-60-3 International Institute for Sustainable Development TheInternationalInstituteforSustainableDevelopment projects, resulting in more rigorous research, capacity building in developing countries, better networks

277

Ecology of Freshwater Fish 2001: 10: 154167 Copyright C Munksgaard 2001 Printed in Denmark All rights reserved  

E-Print Network [OSTI]

interactions and energy flow. Wine- miller & Polis (1996) generalized that food webs provide valuable details rights reserved ISSN 0906-6691 Temporal food web variability in an upper Missouri River backwater: energy in an S. J. Fisher, M. L. Brown, upper Missouri River backwater: energy origination points and transfer D

278

Technical University of Denmark -Informatics and Mathematical Modelling Technical Report IMM-2007-02 (16 January 2007)  

E-Print Network [OSTI]

or trading of wind generation. Today, users of wind power predictions are not only provided with point integration of wind generation capacities in- duces difficulties in the management of a power system. Also deregu- lation. Increasing the value of wind generation through the improvement of prediction systems

279

International Conference on Urban Drainage, Copenhagen/Denmark, 21-26 August 2005 Pitt and Maestre 1  

E-Print Network [OSTI]

Pollutant Discharge Elimination System) MS4 (municipal separate storm sewer system) stormwater permit as part of the existing stormwater permit program, providing a scientific analysis of the data (National Pollutant Discharge Elimination System) stormwater permit program. There have been some local

Pitt, Robert E.

280

NKS Conference on Radioactive Contamination in Urban Areas Ris National Laboratory, DK-4000 Roskilde, Denmark, 7 -9 May, 2003  

E-Print Network [OSTI]

urban environments Per Hedemann-Jensen Section of Applied Health Physics, Department of Decommissioning nuclear or radiological accidents. The decision-aiding process of justification and optimisa- tion

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

2001 European Wind Energy Conference and Exhibition EWEA Bella Center, Copenhagen, Denmark, 2-6 July 2001  

E-Print Network [OSTI]

the environmental management system of Vestas Wind Systems A/S and data from subcontractors are utilised for the LCA plants. The results from that project are used as a basis for this LCA for a 2 MW offshore wind turbine. This LCA focuses on an offshore wind turbine and as a sample turbine for the assessment it has been chosen

282

Community wind power ownership schemes in Europe and their relevance to the United States  

E-Print Network [OSTI]

Roskilde, Denmark: Danish Energy Agency. Berger, J. 1997.Energy in Denmark. Danish Energy Agency for the Renewable

Bolinger, Mark

2001-01-01T23:59:59.000Z

283

1 Introduction 9 1.1 Statistical modelling and Matching problems . . . . . . . . . 9  

E-Print Network [OSTI]

in Engineering at the Technical University of Denmark (DTU), Lyngby, Denmark. Author is Sune Birch (s971739

284

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

285

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

286

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

287

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

288

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database  https://github.com/solarpermit/solarpermit/archive/devel.zip 

289

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

290

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

291

BioMed Central Page 1 of 15  

E-Print Network [OSTI]

University of Denmark Building 208, 2800 Lyngby, Denmark, 2Present address: Novozymes A/S, Novo Alle, 1B1 Universitetsparken 15, 2100 Copenhagen, Denmark Email: Thomas Schou Larsen* - thsl@novozymes.com; Anders Krogh

Batzoglou, Serafim

292

L b t t di f D kLow carbon energy system studies for Denmark Peter Meibom & Kenneth Karlsson, 2008 June 9th  

E-Print Network [OSTI]

% 6 % 5 % 6 % 6 % Cost (% of GDP) ?? . veh. - X X X X X Elec. /hybrid vehicles - X X X X X Fuel cells ­ hydrogen - NA X X X X Bio fuels X X X X X X X Heat pumps X NA X X X X Micro CHP - X - X - - Solar heating - X (X) X - - Elec. Savings

293

This dissertation is submitted to Informatics and Mathematical Modelling at the Technical University of Denmark in partial fulllment of the requirements for the  

E-Print Network [OSTI]

damper systems give rise to a relative yaw motion of the bolster with respect to the side frame: stick motion and slip motion, which leads to a discontinuity in the behaviour of the dynamical system and leads to a collapse of the state space, and consequently, change the degrees of freedom of the system

294

Abstracts of Papers and Talks from the 8Th International Waterfowl Feeding Ecology Symposium, Ribe, Denmark, 18-21 September 1989  

E-Print Network [OSTI]

Journal:  Wader Study Group Bulletin Attachment Size p00009-p00026.pdf 2.91 MB Issue:  57 Year:  1989 Pages:  9-26

295

The present thesis has been prepared at the Department of Mathematical Modelling (IMM), Technical University of Denmark and at the Develop-  

E-Print Network [OSTI]

#12;#12;Preface The present thesis has been prepared at the Department of Mathematical Modelling into the railway world with an apparently blind faith in my abilities which has given me many interesting of the present thesis is to derive a more exible contact model which can be applied on a variety of contact

296

The present thesis has been prepared at the Department of Mathematical Modelling (IMM), Technical University of Denmark and at the Develop  

E-Print Network [OSTI]

Preface The present thesis has been prepared at the Department of Mathematical Modelling (IMM me into the railway world with an apparently blind faith in my abilities which has given me many problem. The objective of the present thesis is to derive a more flexible contact model which can

297

STANDARDS FOR MEASUREMENTS AND TESTING OF WIND TURBINE POWER QUALITY Poul Srensen, Ris National Laboratory, P.O.Box 49, DK-4000 Roskilde, Denmark.  

E-Print Network [OSTI]

STANDARDS FOR MEASUREMENTS AND TESTING OF WIND TURBINE POWER QUALITY Poul Sørensen, Risø National and verification of wind turbine power quality. The work has been organised in three major activities. The first farm summation on the power quality of wind turbines with constant rotor speed. The third activity has

Heinemann, Detlev

298

Preprint of the paper submitted to CMWR XVI 2006, Copenhagen, Denmark, 19-22 June, 2006 DERIVATIVE-FREE OPTIMIZATION METHODS FOR HANDLING  

E-Print Network [OSTI]

-FREE OPTIMIZATION METHODS FOR HANDLING FIXED COSTS IN OPTIMAL GROUNDWATER REMEDIATION DESIGN T. HEMKER1 , K-integer problem formulation and use an iterative stochastic modeling technique to build surrogate functions on the benchmarking problem and point the way towards improvement and future work. 1. INTRODUCTION AND MOTIVATION

Stryk, Oskar von

299

Immigration Control in the Age of Migration  

E-Print Network [OSTI]

Czech Republic Denmark Finland France ix Germany GreeceCzech Republic, Denmark, Finland, France, Germany, Greece,Portugal Slovak Rep. Finland Malta Ireland Luxembourg Total

Wong, Tak Kei

2011-01-01T23:59:59.000Z

300

Chemical and Structural Features of Plants That Contribute to Biomass Recalcitrance  

E-Print Network [OSTI]

of cellulase (Celluclast, Novozymes, Bagsvaerd, Denmark)glucosidase (Novozyme 188, Novozymes, Bagsvaerd, Denmark) atmL) and ?-glucosidase (Novozymes 188, lot no: 037K0968,

DeMartini, Jaclyn Diana

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Use and analysis of new optimization techniques for decision theory and data mining  

E-Print Network [OSTI]

Latvia Australia N. Zealand Croatia Cyprus InsI Country 2Belgium Brazil Canada Chile Croatia Cyprus Denmark EstoniaAustria Belgium Canada Croatia Cyprus Denmark Estonia Israel

Moreno Centeno, Erick

2010-01-01T23:59:59.000Z

302

E-Print Network 3.0 - altered plasma fatty Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

National Laboratory Technical University of Denmark... , Department for Optics and Plasma Research, Frederiksborgvej 399, 4000 Roskilde, Denmark Inactivation methods... and low...

303

E-Print Network 3.0 - ae2 plasma membrane Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

National Laboratory Technical University of Denmark... , Department for Optics and Plasma Research, Frederiksborgvej 399, 4000 Roskilde, Denmark Inactivation methods... and low...

304

E-Print Network 3.0 - alcohols quarterly technical Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark, Fysikvej, Building 307, DK-2800 Lyngby, Denmark. The development... the use of biogas to create alcohol for fuel. Higher alcohols are favorable due to their high energy...

305

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada ...

306

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

307

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

308

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

309

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

310

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

311

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

312

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

313

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

314

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

315

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

316

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

317

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

318

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

319

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

320

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

322

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

323

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

324

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

325

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

326

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

327

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

328

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

329

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

330

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

332

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

333

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

334

affect foreign bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

335

allied irish bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

336

affects higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...

337

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

338

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

339

Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

340

Wind: wind power density maps at 50 m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

URANIUM IN ALKALINE ROCKS  

E-Print Network [OSTI]

Danish Atomic Energy Commission, Research Establishment, Ris^, Denmark, published by the International Atomic Energy Agency,

Murphy, M.

2011-01-01T23:59:59.000Z

342

RIS-M-2240 CLASSIFICATION SYSTEM FOR REPORTING EVENTS INVOLVING  

E-Print Network [OSTI]

Risø National Laboratory, DK 4000 Roskilde, Denmark. #12;INIS-descriptors. BEHAVIOUR; DATA ACQUISITION

343

Ris-M-2533 THE INFLUENCE OP CHEMICAL REACTIONS ON THE NOBILITY OF RADIO-  

E-Print Network [OSTI]

Roskilde, Denmark #12;INIS descriptors; ADSORPTION; C CODES; CHEMICAL REACTION KINETICS; COMPUTERIZED

344

Now we're going to talk about one of a problem that has fascinated humans since we were cave dwellers. No, not how to make a decent club to thump  

E-Print Network [OSTI]

. Eventually technology progressed to the time of Tycho Brahe, where he convinced the king of Denmark

Deutsch, Josh

345

Advisory Board Members Paul J. Crutzen (Chairman)  

E-Print Network [OSTI]

Institute, Roskilde, Denmark jbr@dmu.dk Stefan Buehler Lulea University of Technology, Kiruna, Sweden

Meskhidze, Nicholas

346

Advisory Board Members Paul J. Crutzen (Chairman)  

E-Print Network [OSTI]

Environmental Research Institute, Roskilde, Denmark jbr@dmu.dk Stefan Buehler Lulea University of Technology

Meskhidze, Nicholas

347

Advisory Board Members Paul J. Crutzen (Chairman)  

E-Print Network [OSTI]

Research Institute, Roskilde, Denmark jbr@dmu.dk Stefan Buehler Lulea University of Technology, Kiruna

Meskhidze, Nicholas

348

E-Print Network 3.0 - air speed indicators Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Puerto Rico, Mayaguez Collection: Geosciences 4 Connectable solar air collectors Solar Energy Centre Denmark Summary: ......

349

ITS-Davis Biennial Report 2008  

E-Print Network [OSTI]

architecture, explored Scotland, Germany, Denmark, and Sweden. Handy, who directs the UC Davis Sustainable

Sperling, Dan

2009-01-01T23:59:59.000Z

350

ICPIG, July 15-20, 2007, Prague, Czech Republi Inactivation of micro organisms by means of low temperature atmospheric  

E-Print Network [OSTI]

, Department for Optics and Plasma Research, Frederiksborgvej 399, 4000 Roskilde, Denmark Inactivation methods

351

Deep-probe Biosensing Using Metal-clad Waveguides Nina Skivesen, Robert Horvath, Henrik C. Pedersen.  

E-Print Network [OSTI]

. Pedersen. Department of Optics and Plasma Research, Risø National Laboratory, DK-4000 Roskilde, Denmark

352

2006-08-27 Fascinating Nonlinear Physics, ICTP Trieste Italy Jens Juul Rasmussen  

E-Print Network [OSTI]

National Laboratory, Department of Optics and Plasma Research, OPL-128, DK-4000 Roskilde, Denmark #12

353

Design Of A Dedicated ECE Diagnostic For Feedback Control Of Instabilities By ECRH  

E-Print Network [OSTI]

and Plasma Research Department, 4000 Roskilde, Denmark * Partners in the Trilateral Euregio Cluster Abstract

354

Classical kinematics and Finsler structures for nonminimal Lorentz-violating fermions  

E-Print Network [OSTI]

In the current paper the Lagrangian of a classical, relativistic point particle is obtained whose conjugate momentum satisfies the dispersion relation of a quantum wave packet underlying Lorentz violation of a particular coefficient of the nonminimal Standard-Model Extension. The properties of this Lagrangian are analyzed plus two corresponding Finsler structures are obtained. One structure describes a scaled Euclidian geometry whereas the other is neither a Riemann nor a Randers structure. The results of the article provide some initial understanding of classical Lagrangians of the nonminimal fermion sector and they prepare the ground for further future analyses.

M. Schreck

2014-05-21T23:59:59.000Z

355

Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

356

Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

357

Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

358

Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

359

Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

360

STUDENT / PARENT INFORMATION MAIL DELIVERY ON CAMPUS The information below provides the basic information you need to send and receive United States  

E-Print Network [OSTI]

West Street Address (if applicable) 522 Thurstin Ave. Bowling Green State University Bowling Green State University City, State and Zip Code Bowling Green, OH 43403-4603 Please note that BGSU has its own zip code, 43403, which is unique from the city of Bowling Green (43402). Please ensure to include

Moore, Paul A.

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Reference Buildings by Building Type: Secondary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

362

Reference Buildings by Building Type: Primary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

363

Sandia Group Medicare Advantage Plan Enrollment Form Senior Advantage Health Plan Choices (Choose One)  

E-Print Network [OSTI]

Home Phone: Cell: E-Mail Address: Permanent Residence Address: City: State: Zip Code: County: Mailing Address (only if different from your Permanent Residence Address): City: State: Zip Code: County drug coverage, including other private insurance, TRI- CARE, Federal employee health benefits coverage

Fuerschbach, Phillip

364

2011 ODU Game Development Summer Camp Registration Form Child's Name Date of Birth Sex  

E-Print Network [OSTI]

Contacts Primary Emergency Contact Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work or Cell Phone Home Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information's/Guardian's Name Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work Phone Home Phone Work Phone Address Address

365

Finance Division Employee Status Form Finance Division  

E-Print Network [OSTI]

's Date: Employee Name: Home Address: City/State: Zip/Postal Code: Work Phone Home Phone: Cell Phone Phone: Work Phone: Cell Phone: Relationship: Name (2): Address: State/Province: Zip/Postal Code: Home Phone: Work Phone: Cell Phone: Relationship: Special Notes: Department New Employee Resignation Change

Crews, Stephen

366

University of Washington Transplant Services Rev. 5/23/02  

E-Print Network [OSTI]

.: City: State: Country: Zip Code: - Home Phone: Work Phone: Ext.: Cell Phone: Home Phone: Cell phone: Work Phone: DEMOGRAPHIC INFORMATION LIVING KIDNEY DONOR FORM #12;University to you: Street Address: Apt No: City, State, Zip: Home Phone: Cell phone: Work Phone: EMPLOYER Name

Borenstein, Elhanan

367

UCR 09/2014 Washington Academic Internship Program  

E-Print Network [OSTI]

: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if different from above: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 09/2014 Do you currently receive): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship: Address: City: State

368

#~i;:~~.:(' . AQUATIC PLANT CONTROL  

E-Print Network [OSTI]

-4 EFFECTS OF WATER CHEMISTRY ON SUBMERSED AQUATIC PLANTS: A SYNTHESIS by R. Michael Smart Environmental. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City. State, and ZIP Code) 3909 Halls Ferry Road IDENTIFICATION NUMBER ORGANIZATION (If applicable) US Army Corps of Engineers Be. ADDRESS (City, Stitte

US Army Corps of Engineers

369

LES VOYAGEURS College of Agriculture Ambassadors  

E-Print Network [OSTI]

. - Uphold the policies outlined by the LSU Code of Student Conduct. - Make a commitment of time and energy area of study, questions regarding the transition into college life, campus activities, and other address City State Zip Local phone number Home phone number Home address City State Zip Country E

370

Note: The State Clearinghouse will assign identification numbers for all new projects. If a SCH number already exists for a project (e.g. Notice of Preparation or previous draft document) please fill in.  

E-Print Network [OSTI]

: City: Zip: County: Project Location: County: City/Nearest Community: Cross Streets: Zip Code: Longitude Waste Land Use Drainage/Absorption Population/Housing Balance Toxic/Hazardous Cumulative Effects For LCNG Fueling Facility California Energy Commission Donald Coe 1516 Ninth Street (916) 654

371

Reference Buildings by Building Type: Outpatient health care  

Broader source: Energy.gov [DOE]

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

372

Reference Buildings by Building Type: Hospital  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

373

Reference Buildings by Building Type: Full service restaurant  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

374

Reference Buildings by Building Type: Large office  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

375

Introduction to SAS Programming Registration Form  

E-Print Network [OSTI]

* Date of Birth Employer Job Title Work Address * Home Address City / State / Zip * City / State / Zip a certificate, you must complete at least 80% of the online quizzes and programming activities with scores of 70% or higher. Certificates of completion may take up to two weeks to process once your program has concluded

376

UPS, the UPS brandmark and the color brown are trademarks that are used with permission by the owner, United Parcel Service of America, Inc. All rights reserved. You may type directly into this form  

E-Print Network [OSTI]

UPS, the UPS brandmark and the color brown are trademarks that are used with permission VALUE Post / Zip Post / Zip UPS NEXT DAY AIR® Most deliveries made by 10:30 a.m. UPS GROUND Delivery in 1­5 business days (in-state deliveries usually arrive next day) UPS WORLDWIDE SAVERSM Int'l Service

Jones, Michelle

377

A Second-Site Noncomplementation Screen for Modifiers of Rho1 Signaling during Imaginal Disc Morpogenesis in Drosophila  

E-Print Network [OSTI]

+/+ RhoGEF2 11-3b 21 31 (239) 25 75 (61) Rho1 E3.10 +/+ RhoGEF2 11-3b 21 20 (143) 25 20 (30) Rho1 k02107b +/+ RhoGEF2 11-3b 21 80 (5) 25 100 (9) Rho1 J3.8 +/+ RhoGEF2 11-3b 21 55 (62) 25 91 (22) Rho1 E(br)246 +/+ zip E(br) 21 50 (82) 25 66 (44) Rho1 E...(br)233 +/+ zip E(br) 21 20 (102) 25 66 (29) Rho1 E3.10 +/+ zip E(br) 21 ND 25 33 (12) Rho1 k02107b +/+ zip E(br) 21 ND 25 ND Rho1 J3.8 +/+ zip E(br) 21 95 (20) 25 97 (30) a Balanced, Rho heterozygous mutant virgin females were crossed to either w 1118...

Patch, Kistie; Stewart, Shannon; Welch, Aaron; Ward, Robert

2009-10-23T23:59:59.000Z

378

Committee on the Challenges of Modern Society solar energy pilot study. First follow-up report, October 1979, pilot country: United States; co-pilot countries: Denmark and France. CCMS report No. 110  

SciTech Connect (OSTI)

During 1973 to 1978, over twenty nations participated in the NATO/CCMS Solar Energy Pilot Study, whose objective was to promote and accelerate the use of solar heating and cooling of buildings. The activities in this information exchange included (1) the regular reporting of national solar heating and cooling programs, (2) the development of a format for reporting the performance of solar heating and cooling systems, (3) the exchange of system performance reports, (4) the establishment of two specialized working groups for solar-assisted low energy dwellings and passive solar applications. At the conclusion of the pilot study in 1978, the participants formulated recommendations for continued action at the international level, as well as for action at the national level. This report describes the progress made in implementing those recommendations. In addition to detailing the steps taken to continue collaboration in various efforts initiated within the Solar Energy Pilot Study, the report contains papers on the 1979 status of the solar heating and cooling programs in seventeen CCMS countries.

None

1980-01-01T23:59:59.000Z

379

Curriculum Vitae Dr. Christopher C. Wilmers  

E-Print Network [OSTI]

, 2008 University of Aarhus, Denmark, 2007 Stanford University, Palo Alto, 2007 National Institute, NSF, Oecologia, Population Ecology, Proceedings of the Royal Society Environmental Studies Department Global Population Dynamics and Climate, Denmark, 2007 Global Climate Change and Conservation

Wilmers, Chris

380

Magnitude, geomorphologic response and climate links of lake level oscillations at Laguna Potrok Aike, Patagonian steppe (Argentina)  

E-Print Network [OSTI]

for Sustainable Energy, Technical University of Denmark (Risř DTU), DK-4000 Roskilde, Denmark d Institute Geology, Stockholm University, SE-106 91 Stockholm, Sweden a r t i c l e i n f o Article history: Received

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Nordisk kernesikkerhedsforskning Norrnar kjarnryggisrannsknir  

E-Print Network [OSTI]

National Laboratory for Sustainable Energy Technical University of Denmark January 2010 #12;Abstract and Sven P. Nielsen, Risoe National Laboratory for Sustainable Energy, Technical University of Denmark, Sweden Eila Kostiainen, Radiation and Nuclear Safety Authority, Finland Vesa Suolanen, VTT Technical

382

Pre-Service Teachers' and Students' (Mis)Conceptions About the Equal Sign  

E-Print Network [OSTI]

; Denmark, Barco, & Voran, 1976; Van de Walle, 1980 as cited in Baroody & Ginsberg, 1983). Denmark, Barco, and Voran (1976) came to a similar conclusion as Collis, who believed students were not intellectually ready to interpret the equal sign, and also...

Vela, Katherine

2012-02-14T23:59:59.000Z

383

A r c t i c Barents Sea  

E-Print Network [OSTI]

Ri Vychegda R U S S I AC A N A D A U.K.IRE. ICELAND NORWAY SWEDEN FINLAND LATVIA LITH. BELARUS UKRAINE POLAND DENMARK GERMANY EST. KAZ. JAPAN (DENMARK) Greenland (NORWAY) Svalbard (NORWAY) (NORWAY) CHINA UNITED

Martin, Jeff

384

Essays in Open Economy Monetary Policy  

E-Print Network [OSTI]

Costa Rica Cote dIvoire Croatia Jordan Denmark KazakhstanCosta Rica Cote d’Ivoire Croatia Denmark Dominican RepublicArgentina China Costa Rica Croatia Egypt India Jordan

Castro, Pedro

2012-01-01T23:59:59.000Z

385

E-Print Network 3.0 - adverse prognosis factor Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on Large-Scale Integration of Wind Power and Transmission Networks for Offshore Wind Farms, Summary: of Denmark, B. 321, DK-2800 Lyngby, Denmark, csm@imm.dtu.dk Two wind...

386

IEA Bioenergy Task 42 on Biorefineries: Co-production of fuels, chemicals, power and materials from biomass  

E-Print Network [OSTI]

(DENMARK) Leonard Boniface, Maurice Dohy, Jean-Cristophe Pouet (FRANCE) Thomas Willke (GERMANY) Patrick countries: Austria, Canada, Denmark, France, Germany, Ireland, and the Netherlands. The overview includes........................................................................16 8. Bioethanol, biodiesel and biogas: production and capacity...........................17 9

387

Ris Ris-M-GiD Title and authors)  

E-Print Network [OSTI]

-^ooo Roskilde, Denmark Telephone: (03) 35 51 01« ext. 33*»« telex: INIS Descriptors CALIBRATION DOSE

388

January 2013 Most Viewed Documents for Energy Storage, Conversion...  

Office of Scientific and Technical Information (OSTI)

(Energitjenesten, Copenhagen (Denmark)) Norwegian energy policy Utseth, Anita Energy systems and technologies for the coming century. Proceedings Soenderberg Petersen, L.;...

389

Effect of different amounts and types of calcium on colonic cell proliferation and fecal bile acids concentration  

E-Print Network [OSTI]

in Scandinavia including Finland, Sweden, and Denmark, Teppo and his colleagues showed that the incidence of colon cancer is the highest in Denmark and the lowest in Finland, where it is 50% less than that in Denmark. The gross national product per capita... shown that the population in Kuopio, Finland where people consume large amounts of milk (rich in calcium) has a fourfold lower incidence of colon cancer than the population in Copenhagen, Denmark (34). Similar results were reported in a 19-years...

C?hen Hsiao-Ch?ing

1991-01-01T23:59:59.000Z

390

Report: An Updated Annual Energy Outlook 2009 Reference Case...  

U.S. Energy Information Administration (EIA) Indexed Site

and Development - Austria, Belgium, Czech Republic, Denmark, Finland, France, Germany, Greece, Hungary," "Iceland, Ireland, Italy, Luxembourg, the Netherlands, Norway,...

391

Microsoft Word - Final Nuclear Materials Management and Safeguards...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

392

Microsoft PowerPoint - 8_Martyn_NMMSS_2013_Foreign Obligations...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, The...

393

Microsoft PowerPoint - 10_ROSE_MARTYN_UPDATED_NMMSS_2014_Foreign...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Ireland, Italy, Hungary, Latvia, Lithuania, Luxembourg, Malta, The...

394

Microsoft PowerPoint - 2A_Wednesday 5-22 830 NMMSS_2013_Presentation...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

395

Microsoft Word - Foreign Obligation Codes.docx  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

396

Microsoft PowerPoint - 2_hirsh Monday 5-20 Overview.ppt [Compatibility...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

397

E-Print Network 3.0 - andrzej sapek barbara Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Medicine ; Environmental Sciences and Ecology 2 Programme Committee Christel Baier (Germany) Summary: (Sweden) Mahesh Viswanathan (USA) Andrzej Wasowski (Denmark) Conference...

398

Microsoft PowerPoint - 6_Mitch Hembree_Monday 5-20 1115 NMMSS...  

National Nuclear Security Administration (NNSA)

Austria, Belgium, Bulgaria, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, the...

399

Biocomplexity in a highly migratory pelagic marine fish, Atlantic herring  

E-Print Network [OSTI]

, Denmark 4 Tja¨rno¨ Marine Biological Laboratory, Department of Marine Ecology, Go¨teborg University, Stro¨mstad

Ruzzante, Daniel E.

400

short communications 190 doi:10.1107/S0907444904027118 Acta Cryst. (2005). D61, 190193  

E-Print Network [OSTI]

a Department of Chemistry, University of York, England, and b Novozymes A/S, Denmark ł Current address: Argonne

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

E-Print Network 3.0 - af led lyskilder Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Birgitte Thestrup... Roskilde, Denmark Abstract Research and development within Light Emitting Diode or LED Source: Ris National Laboratory Collection: Multidisciplinary...

402

E-Print Network 3.0 - alter plasma lipid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

National Laboratory Technical University of Denmark... , Department for Optics and Plasma Research, Frederiksborgvej 399, 4000 Roskilde, ... Source: Ris National Laboratory...

403

Chip Scale Interferometry A micro fluidic platform for biochemical sensing  

E-Print Network [OSTI]

Sørensen Department of Optics and Plasma Research, Risø National Laboratory, DK-4000 Roskilde, Denmark

404

Experimental The peptides were synthesized using the stepwise  

E-Print Network [OSTI]

National Laboratory, DK-4000 Roskilde, Denmark b Department of Optics and Plasma Research, Risø National

405

Nils Tngefjord Basse E-mail: nils.basse@npb.dk  

E-Print Network [OSTI]

of the Optics and Plasma Research Department at the Risø National Laboratory in Roskilde, Denmark. My research

Basse, Nils Plesner

406

J. Fluid Mech. (2006), vol. 556, pp. 121146. c 2006 Cambridge University Press doi:10.1017/S0022112006009463 Printed in the United Kingdom  

E-Print Network [OSTI]

of Physics, DK-2800 Kgs. Lyngby, Denmark 3 Risø National Laboratory, Optics and Plasma Research Department

407

Lusus Naturae, Folklore, and DIsplay in the Nineteenth Century in the United States  

E-Print Network [OSTI]

Anderson’s Thumbelina (Tommelise) was published in Denmark in 1835 and translated into English in 1846 by Mary

Verderano Reynoso, Lena Lydia

2012-01-01T23:59:59.000Z

408

Damping Inter-Area Oscillations Using Static Synchronous Series Compensator (SSSC)  

E-Print Network [OSTI]

Department of Energy Technology Aalborg University, Denmark csu@iet.aau.dk, zch@iet.aa.dk Abstract- Static

Chen, Zhe

409

Computational analysis of temperature rise phenomena in electric induction motors  

E-Print Network [OSTI]

Computational analysis of temperature rise phenomena in electric induction motors Ying Huai Institute, University of Southern Denmark, Grundvigs Alle 150, Sonderborg, DK-6400, Denmark c Danfoss Drives A/S, Denmark Received 12 October 2002; accepted 20 December 2002 Abstract In developing electric

Melnik, Roderick

410

Heat Supply Who What Where and -Why  

E-Print Network [OSTI]

heat and power plants (CHP) and other heat technologies ...................................10 2Heat Supply in Denmark Who What Where and - Why #12;Title: Heat Supply in Denmark - Who What Where: MONTAGEbureauet Aps Printing: Kailow Graphic Cover photo: Miklos Szabo #12;HEAT SUPPLY IN DENMARK WHO WHAT WHERE

Columbia University

411

Night Wind -Deliverable D.3.2 Main Simulation Report  

E-Print Network [OSTI]

-R-1661(EN) Risø National Laboratory for Sustainable Energy Technical University of Denmark Roskilde Architecture for Wind Power Production with Energy Storage through load shifting in Refrigerated Warehouses for Sustainable Energy Technical University of Denmark P.O.Box 49 DK-4000 Roskilde Denmark Telephone +45 46774004

412

Ris National Laboratory Radiation Research Department  

E-Print Network [OSTI]

*) Risø National Laboratory DK-4000 Roskilde, Denmark Per Hedemann-Jensen Danish Decommissioning DK-4000 Laboratory DK-4000 Roskilde, Denmark Per Hedemann-Jensen Danish Decommissioning DK-4000 Roskilde, Denmark Abstract. In the event of a nuclear or radiological emergency resulting in an atmospheric re- lease

413

ANALYSIS OF POWER BALANCING WITH FUEL CELLS & HYDROGEN  

E-Print Network [OSTI]

ANALYSIS OF POWER BALANCING WITH FUEL CELLS & HYDROGEN PRODUCTION PLANTS IN DENMARK Support program;"Analysis of power balancing with fuel cells & hydrogen production plants in Denmark" ­ March 2009 ­ Project ........................................................................................................................104 #12;"Analysis of power balancing with fuel cells & hydrogen production plants in Denmark" ­ March

414

Fourth International Workshop on Large-Scale Integration of Wind Power and Transmission Networks for Offshore Wind Farms,  

E-Print Network [OSTI]

for Offshore Wind Farms, 20-21 October 2003, Billund, Denmark C. S. Nielsen, Hans F. Ravn, Camilla Schaumburg1 Fourth International Workshop on Large-Scale Integration of Wind Power and Transmission Networks of Denmark, B. 321, DK-2800 Lyngby, Denmark, csm@imm.dtu.dk Two wind power prognosis criteria and regulating

415

Driving Demand for Home Energy Improvements: Motivating residential customers to invest in comprehensive upgrades that eliminate energy waste, avoid high utility bills, and spur the economy  

E-Print Network [OSTI]

Conservation Corporation (WECC). The project‘s goal was toConservation Corporation (WECC was contracted to support theRESNET RFP RPV SMUD VCEM WECC ZIP Baltimore Neighborhood

Fuller, Merrian C.

2011-01-01T23:59:59.000Z

416

Matlab-Kinect Interface Code  

E-Print Network [OSTI]

This .zip file contains code and installation instructions for acquiring 3d arm movements in Matlab using the Microsoft Kinect 3d camera. The provided code has been validated in 32-bit and 64-bit Matlab with 32-bit and ...

Kowalski, Kevin

2012-06-01T23:59:59.000Z

417

GT Human Resources PERSONAL DATA FORM  

E-Print Network [OSTI]

GT Human Resources PERSONAL DATA FORM Page 1 Updated: 05/01/2014 Student Employee? Yes No Print clearly using black or blue ink. Personal Information Name) __________________________________________________________________________________________ (City) (State) (Zip) (County) Personal Telephone #: (_______)________-__________ GT Work Telephone

Jacobs, Laurence J.

418

E-Print Network 3.0 - approaches reveal splicing Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RNA Structures... Structures at Mammalian Splice Sites Keywords: RNA secondary structure; looping-out; long-range; alternative... splicing; SF1; HNRNPK; ZFX; ZIP7; SLC39A7; ZNF384;...

419

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' Thursday, January 15, 2015  

E-Print Network [OSTI]

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' CONFERENCE Thursday, January 15, 2015 Maneeley. Connecticut Vegetable & Small Fruit Growers' Conference (We need folks to pre-register so Maneeley's has:______________________________________ ---- Town:______________ State:_____ Zip:____________ ---- Check off: Vegetable grower ___ Fruit grower

Alpay, S. Pamir

420

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name  

E-Print Network [OSTI]

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name Remit to Address City State Zip Code SECTION 2 INSTRUCTIONS Use the link to view approved categories. Vendor Number (if known) DP Requester AP Entry Check

de Lijser, Peter

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

1A Miami, Florida Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida In addition to the ZIP file for each building type, you can directly view the...

422

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Boulder, Colorado Reference Buildings by Climate Zone and Representative City: 5B Boulder, Colorado In addition to the ZIP file for each building type, you can directly view the...

423

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Chicago, Illinois Reference Buildings by Climate Zone and Representative City: 5A Chicago, Illinois In addition to the ZIP file for each building type, you can directly view the...

424

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Phoenix, Arizona Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona In addition to the ZIP file for each building type, you can directly view the...

425

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

7 Duluth, Minnesota Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota In addition to the ZIP file for each building type, you can directly view the...

426

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Baltimore, Maryland Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland In addition to the ZIP file for each building type, you can directly view...

427

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C Seattle, Washington Reference Buildings by Climate Zone and Representative City: 4C Seattle, Washington In addition to the ZIP file for each building type, you can directly view...

428

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Atlanta, Georgia Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia In addition to the ZIP file for each building type, you can directly view the...

429

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

8 Fairbanks, Alaska Reference Buildings by Climate Zone and Representative City: 8 Fairbanks, Alaska In addition to the ZIP file for each building type, you can directly view the...

430

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Las Vegas, Nevada Reference Buildings by Climate Zone and Representative City: 3B Las Vegas, Nevada In addition to the ZIP file for each building type, you can directly view the...

431

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Houston, Texas Reference Buildings by Climate Zone and Representative City: 2A Houston, Texas In addition to the ZIP file for each building type, you can directly view the...

432

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Helena, Montana Reference Buildings by Climate Zone and Representative City: 6B Helena, Montana In addition to the ZIP file for each building type, you can directly view the...

433

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C San Francisco, California Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California In addition to the ZIP file for each building type, you can...

434

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Los Angeles, California Reference Buildings by Climate Zone and Representative City: 3B Los Angeles, California In addition to the ZIP file for each building type, you can...

435

APPLICATION FOR ADMISSION TO UNDECIDED-GRAD CLASSIFICATION For Office Use Only GRADUATE SCHOOL, WASHINGTON STATE UNIVERSITY  

E-Print Network [OSTI]

) (State) (Zip) (County if Washington) Gender M F Date of Birth Place of Birth Are you a citizen of the U State University: Fall (year) Spring (year) Summer (year) Location: Pullman Spokane Tri-Cities Vancouver

Collins, Gary S.

436

REQUEST FOR REENROLLMENT GRADUATE SCHOOL  

E-Print Network [OSTI]

-Mail Address Present address (Street) (City) (State) (Zip) (County if Washington) Telephone (Work) (Home 20 Location: Pullman Spokane Tri-Cities Vancouver Global Campus (On-line) I am stating

Collins, Gary S.

437

The Evolution of a Modular Software Network Miguel A. Fortuna  

E-Print Network [OSTI]

The Evolution of a Modular Software Network Miguel A. Fortuna , Juan A. Bonachela, and Simon A the website of this journal as a zip folder. To whom correspondence should be addressed. E-mail: fortuna

Fortuna, Miguel A.

438

U.S. DEPARTMENT OF ENERGY  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

YLARS 1 AM I'U*CHASQVO MY HOME BY ( )MORTGAGE () UND CONTRACT NAME ADDRESS CITY STATE ZIP PHONE (HOME )..... .. (CELL) (WORK). fF.ST TIME TO CALL ( 9 am to l pm) (I pm to S pm )...

439

Furman Graduate Studies Registration Form 2013 Spring Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

440

Furman Graduate Studies Registration Form 2013 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

PARENT INFORMATION FORM WWEELLCCOOMMEE PPRROOUUDD AANNTTEEAATTEERR PPAARREENNTTSS!!  

E-Print Network [OSTI]

: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status: Single Preferred Phone: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status Last Relationship to Student: Language Spoken at Home: Address: Street City State Zip Preferred Phone

Barrett, Jeffrey A.

442

Child Information: Our Little Village  

E-Print Network [OSTI]

/State/Zip Parent Information: Student ID #: _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email Insurance Information: Provider Provider Phone Policy Holder Policy

Escher, Christine

443

Schiefelbusch Hearing Clinic  

E-Print Network [OSTI]

_______ Zip_____________ E-Mail Cell Phone (____)_____________ Day Phone (____)_______________ Evening Phone to Jane Wegner by email at jwegner@ku.edu or by phone at 864-4690. Camper Information Camper Name

444

Furman Graduate Studies Registration Form 2014 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

445

UT EID# __________ Student ID #: __________ AY: 20____ -20____ School: ____________________________ Grade: ________________  

E-Print Network [OSTI]

: ___________________________________________ _________________________________________________________ CITY STATE ZIP Home Phone: ___________________ Cell#: __________________ Student Email _________________ ______________ ___________ __________ Parent(1)/Guardian Address Home Phone # Work Phone # Primary Language _________________ ______________ ___________ __________ Parent(2)/Guardian Address Home Phone # Work Phone # Primary Language In case of an emergency, contact

Texas at Austin, University of

446

Trends in template/fragment-free protein structure prediction  

E-Print Network [OSTI]

1998) Pathways to a protein folding intermediate observed instudy of all-atom protein folding and structure predic-JD, Dill KA (2007) Protein folding by zipping and assembly.

Zhou, Yaoqi; Duan, Yong; Yang, Yuedong; Faraggi, Eshel; Lei, Hongxing

2011-01-01T23:59:59.000Z

447

T-612: False Positive Detection Generic.dx!yxk in DAT 6329 |...  

Broader source: Energy.gov (indexed) [DOE]

in sdatInstaller.zip. This can be deployed via a Group Policy if you have Active Directory as described below. Addthis Related Articles V-101: McAfee VirusScan Enterprise Lets...

448

arabidopsis bzip transcription: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor Texas A&M University -...

449

University of New Hampshire Project SMART  

E-Print Network [OSTI]

University of New Hampshire Project SMART Student Application Form Summer Institute: July 2: ____________________ (Please include first, middle initial and last name) Home Address: _____________________________ City/Junior): _______ School Address: ______________________________ City, State, Zip Code: ____________________ List

New Hampshire, University of

450

Covanta Energy Corporation formerly Ogden Martin Systems of Hillsborou...  

Open Energy Info (EERE)

Inc) Place: Fairfield, New Jersey Zip: 7004 Product: Owner and operator of modern waste-to-energy facilities (over 1GW). Coordinates: 47.38522, -117.171254 Show Map...

451

NORTHERN CHAPTER OF MICHIGAN SOCIETY OF PROFESSIONAL LAND SURVEYORS SCHOLARSHIP  

E-Print Network [OSTI]

program located in the state of Michigan, and qualify for some form of financial aid which can be verified __________________________________________________________ City ______________________________________ MI Zip Code ________________ App Classification: ____Fr ______________________________________ A complete Scholarship Application must include the following: 1. A statement expressing your educational

452

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone BBGS-001WS 1.50 Total Fees ($) Fee Adjustment Instructions: 1. Complete the fee collector's name

453

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone Verification: Instructions: 1. Complete the fee collector's name, address, phone number, crab receiver permit

454

C:\\...\\mailquestionnaire. [PFP#1121010499  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

FULL NAME OF BOTTLED GAS COMPANY BOTTLED GAS LOCATION OF COMPANY (IF KNOWN): STREET, CITY, STATE, AND ZIP CODE (LPG or Propane) ACCOUNT NUMBER (IF KNOWN) TELEPHONE NUMBER (IF...

455

Nanoscience Discovery AcademyNanoscience Discovery Academy A two-week Science Academy for 9th  

E-Print Network [OSTI]

Houston area high schools Students competitively selected What Hands-on exposure to environmental science researchers using nanotechnology to tackle civilization's grand challenges ­ energy, water, environment and Street ________________________________________________________________________ City State Zip 3. E

456

USAJOBS -Search Jobs http://jobview.usajobs.gov/...t+(Postdoctoral+Research+Associate)&jbf574=AG03&q=postdoctoral+NOT+%22RA-11-032L%22&AVSDM=2011-04-12+00%3a36%3a00[6/23/2011 2:47:01 PM  

E-Print Network [OSTI]

sensing-based energy balance ET algorithms (EB-ET) - Soil and Water Assessment Tool (SWAT) - ground water: (keywords) Where: (U.S. city, state or zip code) Go to section of this Job: #12;USAJOBS - Search Jobs http

Behmer, Spencer T.

457

THE OSHER REENTRY SCHOLARSHIP AWARD The Bernard Osher Foundation Reentry scholarship targets students who did not have the  

E-Print Network [OSTI]

PHILANTHROPY: INVESTING IN YOU Venture philanthropy brings a new intensity and energy to providing scholarships in the future of students who have demonstrated the ability to balance work and competing demands with college City Zip

Huang, Jianyu

458

E-Print Network 3.0 - aus der uebung Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Information Sciences 2 Institut fur Computational Science Dept. of Computer Science, ETH Zurich Summary: . In uebung3.zip fin- den Sie das C-Programm integrateNeedleMap zur...

459

PARS II CPP Upload Template File | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

teProjectTemplate.zip More Documents & Publications Proposed Data Elements for PARS II Web Application PARS II - Integrated Project Team Meeting PARS II End-of-Month Checklist...

460

UNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION  

E-Print Network [OSTI]

program in order to reduce Federal employee's contribution to traffic congestion and air pollutionUNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION PUBLIC TRANSPORTATION BENEFIT PROGRAM): ____________ City (Residence): __________________________State: _______________ Zip Code: ________________ Air Force

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Designing libraries of chimeric proteins using SCHEMA recombination Matthew A. Smith and Frances H. Arnold*  

E-Print Network [OSTI]

1 Designing libraries of chimeric proteins using SCHEMA recombination and RASPP Matthew A. Smith toolbox. This is available from: http://cheme.che.caltech.edu/groups/fha/media/schema-tools.zip 3

Arnold, Frances H.

462

Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold*  

E-Print Network [OSTI]

1 Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold* Division downloaded and unpacked. This is available from: http://cheme.che.caltech.edu/groups/fha/media/ncr.zip 3

Arnold, Frances H.

463

2/1/2014 Using TinyWindmills To Power Portable Electronics http://www.simplygreen.co.za/articles/articles/using-tiny-windmills-to-power-portable-electronics.html 1/2  

E-Print Network [OSTI]

NEWSLETTERS ADVERTISE SEARCH Cost Of Solar Panels www.homeadvisor.com Enter Your Zip Code & Connect. Pre: Climate Impacts Could Lead To Drastic Increases In Food Prices Over Coming Decades Wind Power Growth

Chiao, Jung-Chih

464

International Oil and Gas Board International Oil and Gas Board...  

Open Energy Info (EERE)

Oil and Gas Board Address Place Zip Website Abu Dhabi Supreme Petroleum Council Abu Dhabi Supreme Petroleum Council Abu Dhabi http www abudhabi ae egovPoolPortal WAR appmanager...

465

OGS/cm:5/24/07 OFFICE OF GRADUATE STUDIES  

E-Print Network [OSTI]

Personal Data Name: Last First Middle Home Address Street Phone: City, State, Zip E-mail Date of Birth: Sex degree Location of the Institution Degrees or Certificates Dates of Attendance Subject or Field Date

Tsien, Roger Y.

466

University of Kentucky Automatic Bank Draft Donation Agreement  

E-Print Network [OSTI]

University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account for purpose of charitable donations. Donations paid by bank draft

Hayes, Jane E.

467

To the student: The top portion of this form should be completed by you and given to the recommender who has agreed to provide you with an academic recommendation to accompany your application to the University of Kentucky.  

E-Print Network [OSTI]

to the University of Kentucky _____________________________________________________________________________ ____________________________________________________________ City State Zip Code Name of High School To the recommender: The University of Kentucky appreciates your of Kentucky Office of Undergraduate Admission 100 Funkhouser Building Lexington, KY 40506-0054 Or send

Hayes, Jane E.

468

To the student: The top portion of this form should be completed by you and given to the recommender who has agreed to provide you with an academic recommendation to accompany your application to the University of Kentucky.  

E-Print Network [OSTI]

to the University of Kentucky _____________________________________________________________________________ ____________________________________________________________ City State Zip Code Name of High School To the recommender: The University of Kentucky appreciates your: University of Kentucky Office of Undergraduate Admission 100 Funkhouser Building Lexington, KY 40506

Hayes, Jane E.

469

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Albuquerque, New Mexico Reference Buildings by Climate Zone and Representative City: 4B Albuquerque, New Mexico In addition to the ZIP file for each building type, you can...

470

PART 1 OF TUTORIAL ON EXTREMES TOOLKIT (1) Installation of R software  

E-Print Network [OSTI]

PART 1 OF TUTORIAL ON EXTREMES TOOLKIT (1) Installation of R software R-2.9.2-win32.exe Use default options (2) Installation of Extremes Toolkit extRemes (R package for extreme value analysis): extRemes_1.60.zip ismev (R package used by extRemes): ismev_1.34.zip Lmoments (R package used by extRemes): Lmoments

Katz, Richard

471

Holographic Fluids with Vorticity and Analogue Gravity  

E-Print Network [OSTI]

We study holographic three-dimensional fluids with vorticity in local equilibrium and discuss their relevance to analogue gravity systems. The Fefferman-Graham expansion leads to the fluid's description in terms of a comoving and rotating Papapetrou-Randers frame. A suitable Lorentz transformation brings the fluid to the non-inertial Zermelo frame, which clarifies its interpretation as moving media for light/sound propagation. We apply our general results to the Lorentzian Kerr-AdS_4 and Taub-NUT-AdS_4 geometries that describe fluids in cyclonic and vortex flows respectively. In the latter case we associate the appearance of closed timelike curves to analogue optical horizons. In addition, we derive the classical rotational Hall viscosity of three-dimensional fluids with vorticity. Our formula remarkably resembles the corresponding result in magnetized plasmas.

Robert G. Leigh; Anastasios C. Petkou; P. Marios Petropoulos

2012-05-28T23:59:59.000Z

472

Graphene and the Zermelo Optical Metric of the BTZ Black Hole  

E-Print Network [OSTI]

It is well known that the low energy electron excitations of the curved graphene sheet $\\Sigma$ are solutions of the massless Dirac equation on a 2+1 dimensional ultra-static metric on ${\\Bbb R} \\times \\Sigma$. An externally applied electric field on the graphene sheet induces a gauge potential which could be mimicked by considering a stationary optical metric of the Zermelo form, which is conformal to the BTZ black hole when the sheet has a constant negative curvature. The Randers form of the metric can model a magnetic field, which is related by a boost to an electric one in the Zermelo frame. We also show that there is fundamental geometric obstacle to obtaining a model that extends all the way to the black hole horizon.

M. Cvetic; G. W. Gibbons

2012-05-23T23:59:59.000Z

473

A review of "Women on Stage in Stuart Drama" by Sophie Tomlinson  

E-Print Network [OSTI]

by Katherine Philips. Chap- ter One focuses on several court masques by Ben Jonson and Samuel Daniel. Aligning her argumentation with those by critics like Leeds Barroll and Stephen Orgel, Tomlinson links the power of the Anna of Denmark?s cultural... performance,? Tomlinson argues, reveals that physical embodiment can be transgressive in its own right (3): actions without words are persuasive and powerful. She ends this chapter by arguing that the court masques organized by and for Anna of Denmark...

Thompson, Ayanna

2007-01-01T23:59:59.000Z

474

The Purpose of Party Manifestos: Relating Party Function and Strategy in Party Manifestos  

E-Print Network [OSTI]

, Canada, Denmark, Finland, France, Germany, Great Britain, Greece, Iceland, Italy, Luxembourg, Netherlands, New Zealand, and Norway. Parliament and government composition database Secondly, in order to determine my independent variable, party experience... not been in government within previous two election cycles and has not been in government for the last five years, it receive a score of .00 (no). For example, using the Social Democratic Party of Denmark’s (SD) manifesto written for the November 22nd, 1966...

Groves, Jacqueline M

2013-09-24T23:59:59.000Z

475

WHO REPORT ON THE GLOBAL TOBACCO EPIDEMIC, 2013  

E-Print Network [OSTI]

Madagascar, Malta, Montenegro*, Poland, Portugal, Serbia*,Cuba, Cyprus, Denmark, Montenegro and Serbia) increased taxLuxembourg . . . I Malta Montenegro Netherlands No warnings

WHO World Health Organization

2013-01-01T23:59:59.000Z

476

Essays on Political Economy of Religion  

E-Print Network [OSTI]

Macedonia Vote percentage Montenegro Germany Year Source:Lithuania Spain-UC Ireland Spain-LC Albania MontenegroSlovakia Montenegro Czech Republic-LC Denmark Liberal

Grigoriadis, Theocharis Nikolaou

2012-01-01T23:59:59.000Z

477

accident consequences pwr: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

478

atomic power plants: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

479

atr-fugen nuclear power: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

480

accidents pwr bwr: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

Note: This page contains sample records for the topic "randers denmark zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

aagesta nuclear power: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

482

air primer pwr: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

483

atomic power plant: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

484

advanced pwr core: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

485

annular-dispersed flow pwr: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

486

alarm-p1 pwr thermohydraulics: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

487

aguirre nuclear plant: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

488

analysis pwr bwr: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Denmark December 1991 12;Abstract. A computer model of a simplified pressurized nuclear power plant a compute simulation of a simplified pressurized nuclear power plant model...

489

Nordisk kernesikkerhedsforskning Norrnar kjarnryggisrannsknir  

E-Print Network [OSTI]

. Nielsen and Kasper G. Andersson Risř National Laboratory for Sustainable Energy, DTU, Denmark July 2008, Göteborg University, Sweden Eila Kostiainen, Radiation and Nuclear Safety Authority, Finland Vesa Suolanen

490

WREF 2012: THE PAST AND FUTURE COST OF WIND ENERGY  

E-Print Network [OSTI]

WIND ENERGY by as much as 270% when comparing today’s turbinesTurbines in Denmark. Presentation to IEA Wind Task 26 (12) European Wind Energy

Wiser, Ryan

2013-01-01T23:59:59.000Z

491

E-Print Network 3.0 - annus mart min Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SYMPOSIUM 14.-16. MARTS 2005 Summary: DCAMM 10. INTERNE SYMPOSIUM 14.-16. MARTS 2005 Load Reduction Potential Using Airfoils... National Laboratory, Denmark *Speaker 12;DCAMM...

492

E-Print Network 3.0 - alar lnelaid mart Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SYMPOSIUM 14.-16. MARTS 2005 Summary: DCAMM 10. INTERNE SYMPOSIUM 14.-16. MARTS 2005 Load Reduction Potential Using Airfoils... National Laboratory, Denmark *Speaker 12;DCAMM...

493

Propagation speed of sound assessment in the layers of the guinea-pig esophagus in vitro by means of acoustic microscopy  

E-Print Network [OSTI]

Clinical Research, Skejby Hospital, Section SKS, Denmark b Center for Sensory-Motor Interaction, Aalborg:001 and in mucosa to 1584 (1566±1603) m/s p

Illinois at Urbana-Champaign, University of

494

Understanding Democratic Congruence: A Demand-Supply Perspective  

E-Print Network [OSTI]

Austria Denmark Portugal Uruguay Iceland Spain SlovakiaCyprus Italy Estonia Malta Uruguay Taiwan Hungary Greece S.Slovakia Argentina Slovenia Uruguay Mexico Croatia Brazil

Welzel, Christian; Klingemann, Hans-Dieter

2007-01-01T23:59:59.000Z

495

WREF 2012: THE PAST AND FUTURE COST OF WIND ENERGY  

E-Print Network [OSTI]

Řkonomi (The Economy of Wind Power). EUDP 33033-0196.to the Chapter on Wind Power in Energy TechnologyAgency (DEA). (1999). Wind Power in Denmark: Technologies,

Wiser, Ryan

2013-01-01T23:59:59.000Z

496

E-Print Network 3.0 - applied high energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

resources into the energy... production arising from the high percent of wind power and CHP in the Danish energy system 27. As part... in Denmark. Applied Energy ... Source:...

497

The power of the family  

E-Print Network [OSTI]

Denmark, Estonia, Spain, Finland, France, Great Britain,ties Croatia Algeria Finland Sweden Latvia Czech RepublicRep. South Africa (Union of) Finland Korea Mexico Bangladesh

Alesina, Alberto; Giuliano, Paola

2010-01-01T23:59:59.000Z

498

Cross-National Differences in Attitudes towards Homosexuality  

E-Print Network [OSTI]

third, Sweden seventh, and Finland eighth. Rounding out thecountries (Austria, Denmark, Finland, France, East Germany,Wrong at all Don’t Know Finland Always Wrong Almost Always

Smith, Tom W.

2011-01-01T23:59:59.000Z

499

August 2011 Curriculum Vita  

E-Print Network [OSTI]

Business School, Denmark 2004 Lappeenranta University of Technology, Finland 2007 University of Canterbury and Business Economics, Lappeenranta University of Technology, Finland 2003 Strategic Management Journal Best

Kammen, Daniel M.

500

Atmospheric Chemistry and Physics Advisory Board Members  

E-Print Network [OSTI]

. Buehler Lulea Univ. of Technology, Sweden sbuehler@ltu.se J. Brandt NERI Roskilde, Denmark jbr@dmu.dk C. A

Meskhidze, Nicholas