Powered by Deep Web Technologies
Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Research of Rou Pu Tuan.  

E-Print Network (OSTI)

??Speaking to the erotological fiction, people would often refer to Rou Pu Tuan. Besides Jin Ping Mei, Rou Pu Tuan is also frequently mentioned by (more)

Lin, Sin-ying



Queen Anne's County- Solar Zoning  

Energy.gov (U.S. Department of Energy (DOE))

Queen Anne's County zoning code allows for ground mounted solar arrays in areas zoned as "open space," "agricultural," and "countryside" districts.



E-Print Network (OSTI)

articles (Robins 1983; 1993: esp. 21 - 55; 2002, 2003).1977; Arnold 1996: 27 - 35, esp. fig. 25). The divine was-fig. 7; Lacovara 1997a: esp. 36 - 38; Lacovara 1997b). In

Roth, Silke



Models and Symmetry Breaking for `Peaceable Armies of Queens'  

E-Print Network (OSTI)

to address in implementation. We added constraints so that a square being unattacked by a white queen problem on a chess-board, requiring equal numbers of black and white queens to be placed on the board so that the white queens cannot attack the black queens. We show how the symmetry of the problem can

Smith, Barbara M.


DOE Solar Decathlon: Team Ontario: Queen's University, Carleton University,  

NLE Websites -- All DOE Office Websites (Extended Search)

Team Ontario: Queen's University, Carleton University, and Algonquin Team Ontario: Queen's University, Carleton University, and Algonquin College Team website: ontariosd.ca Photo of members of the Queen's University, Carleton University, and Algonquin College Solar Decathlon 2013 team on the deck of their partially constructed house. Several members are laughing and throwing snowballs. Enlarge image The Queen's University, Carleton University, and Algonquin College Solar Decathlon 2013 team (Courtesy of the Queen's University, Carleton University, and Algonquin College Solar Decathlon 2013 team) he Queen's University, Carleton University, and Algonquin College audiovisual presentation Jury Feedback Architecture Contest Market Appeal Contest Engineering Contest Communications Contest Team Deliverables Project Manual Construction Drawings


Desert Queen Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Desert Queen Geothermal Area Desert Queen Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Desert Queen Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (4) 9 Exploration Activities (1) 10 References Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Northwest Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant



E-Print Network (OSTI)

: classify all knots, in order to understand matter. Then Bohr came along, and discovered the atom ... Knots Speaker: Ami Mamolo, Queen's University Title: What does it mean to understand "actual infinity"? Abstract: The $T^2$ Statistic and applications to time series. Monday, March 22 Algebraic Geometry Seminar Time: 3

Offin, Dan


Desert Queen Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Desert Queen Geothermal Project Desert Queen Geothermal Project Project Location Information Coordinates 39.877777777778°, -118.34722222222° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.877777777778,"lon":-118.34722222222,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


8020Info Inc. Queen's Learning Commons Page 1 of 64 For the Use of Queen's Learning Commons ONLY 2011, 8020Info Inc. All rights reserved.  

E-Print Network (OSTI)

© 8020Info Inc. Queen's Learning Commons Page 1 of 64 For the Use of Queen's Learning Commons ONLY 2011, 8020Info Inc. All rights reserved. help@8020info.com ­ http://www.8020info.com The survey;© 8020Info Inc. Queen's Learning Commons Page 2 of 64 For the Use of Queen's Learning Commons ONLY

Ellis, Randy


Origin And Characterization Of Geothermal Waters At Desert Queen, Nevada |  

Open Energy Info (EERE)

Origin And Characterization Of Geothermal Waters At Desert Queen, Nevada Origin And Characterization Of Geothermal Waters At Desert Queen, Nevada Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Paper: Origin And Characterization Of Geothermal Waters At Desert Queen, Nevada Details Activities (1) Areas (1) Regions (0) Abstract: The Desert Queen geothermal system, which is in close proximity to two locations where geothermal energy is currently being harnessed, may host an additional reservoir. A _18O vs _D plot indicates that Desert Queen waters likely originate from the Humboldt River, and reflects Humboldt River water that is clearly evaporated. Temperatures of the reservoir at depth are estimated to be between 92-141°C and were calculated using the _18O(SO4-H2O) geothermometer. It is unclear whether these temperatures


The composition and diagenesis of the Queen Formation (Guadalupian, Permian) at Virey and Moose Queen fields, Midland County, Texas  

E-Print Network (OSTI)

The Permian Basin of West Texas and Eastern New Mexico has been a center of oil and gas exploration since the early 1940s. Hydrocarbon profusion is focused in the shelfal areas of the Permian Basil with one of the most prolific clastic reservoirs being the Queen Formation. The Queen Formation is part of the Artesia Group, a sequence of interbedded shelf carbonates. evaporates, and classics. The first purpose of this thesis is to characterize the facies and petrography of the Queen Formation and its sandstone reservoirs at the Moose and Virey Queen fields. The second purpose is to investigate the depositional and diagenetic processes that control the formation, size and quality of the sandstone reservoirs and non-reservoirs. The Queen Formation at the Moose and Virey Queen Gelds generally consist of feldspathic litharenites to litharenites in a complex sequence of interbreed very fine-grained sandstones, coarse grained milestones, anhydritic very fine-grained sandstones, halitic very fine-grained sandstones. Based upon grain size measurements and petrographic analyses, these sandstones can be classified as well sorted sandflat, saline sandflat, and intertidal sandstones from a fluvial depositional system represented by a sequence of coarsening and finning upward cycles.The primary porosity of all of the sandstones of the Queen Formation was reduced by the precipitation of authigenic clay, the infiltration of mud and the formation of soil structures, and the precipitation of authigenic cements such as halite and anhydrite. Reservoirs were formed in the sandflat facies by the dissolution of cements and labile grains, creating enhanced secondary porosity. This project is just one part of a regional study of the Queen Formation in the Permian Basil which can be added to the extensive database on the Queen sandstones in order to obtain a more accurate delineation of the processes responsible for the deposition of the Queen Formation.

Voncannon, Jennifer Catherine



Queens County, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Queens County, New York: Energy Resources Queens County, New York: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.7644444°, -73.8233333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.7644444,"lon":-73.8233333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geothermometry At Desert Queen Area (Garchar & Arehart, 2008) | Open Energy  

Open Energy Info (EERE)

Queen Area (Garchar & Arehart, 2008) Queen Area (Garchar & Arehart, 2008) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Desert Queen Area (Garchar & Arehart, 2008) Exploration Activity Details Location Desert Queen Area Exploration Technique Geothermometry Activity Date Usefulness not indicated DOE-funding Unknown Notes Temperatures of the reservoir at depth are estimated to be between 92-141 degrees C and were calculated using the δ18O(SO4-H2O) geothermometer. It is unclear whether these temperatures reflect waters from the outflow zone of the Desert Peak geothermal system, or waters from a different reservoir at Desert Queen. Quartz, chalcedony, amorphous silica, Na-K-Ca, and δ18O(SO4-H2O) geothermometer calculations were performed.


Developing Synoptic Analogs for Extreme Mass Balance Conditions on Queen Elizabeth Island Ice Caps  

Science Conference Proceedings (OSTI)

Detailed synoptic and climate analyses were undertaken for summer seasons during which extreme mass balance conditions were recorded on glaciers in the Queen Elizabeth Islands in high Arctic Canada. Three types of mass balance extremes were ...

Bea Taylor Alt



Manitoba Court of Queen's Bench Rule 20A: history of the law regarding civil money judgment and mortgage enforcement.  

E-Print Network (OSTI)

??This Master of Laws thesis provides an analysis of Manitoba Court of Queen's Bench civil money judgment cases, sampled quantitatively for 1995 and 2004, to (more)

Effler, Barry Curtis



DOE - Office of Legacy Management -- Queen City Barrel Co - OH 41  

Office of Legacy Management (LM)

Queen City Barrel Co - OH 41 Queen City Barrel Co - OH 41 FUSRAP Considered Sites Site: QUEEN CITY BARREL CO. (OH.41) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Cincinnati , Ohio OH.41-1 Evaluation Year: 1987 OH.41-1 Site Operations: Cleaned and reconditioned 30- and 55-gallon drums. OH.41-2 OH.41-3 Site Disposition: Eliminated - Based upon limited scope of operations, potential for residual radioactive contamination from MED or AEC operations considered remote OH.41-1 Radioactive Materials Handled: Yes OH.41-2 Primary Radioactive Materials Handled: Radium Bearing Material OH.41-2 OH.41-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see


H2A Delivery: GH2 and LH2 Forecourt Land Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

GH2 and LH2 Forecourt GH2 and LH2 Forecourt GH2 and LH2 Forecourt Land Areas Land Areas Hydrogen Delivery Analysis Meeting May 8-9, 2007 Columbia, Maryland TIAX LLC Matthew Hooks 1601 S. D Anza Blvd. hooks.matthew@TIAXLLC.com Cupertino CA, 95014 Tel. 408-517-1550 Reference: D0348 © 2007 TIAX LLC General Assumptions ƒ Forecourt stations with fewer than 6 hydrogen dispensers will have both hydrogen and gasoline dispensers on-site (6 total) ƒ Forecourt area (not including convenience store) will be allocated based on relative number of hydrogen/gasoline dispensers ƒ All stations with more than 6 hydrogen dispensers will only dispense hydrogen ƒ 100% of forecourt area (not including convenience store) will be allocated to hydrogen delivery ƒ Area allocated to hydrogen storage will be in excess of the


Sedimentation of shelf sandstones in Queen Formation, McFarland and Means fields, central basin platform of Permian basin  

SciTech Connect

The Queen Formation is a sequence of carbonates, evaporites, and sandstones of Permian (Guadalupian) age that is found across the subsurface of the Central Basin platform of the Permian basin. The formation is a major hydrocarbon reservoir in this region, and its primary reservoir facies are porous shelf sandstones and dolomites. Cores and well logs from McFarland and Means fields (on the northwest margin of the Central Basin platform) were examined to determine the sedimentary history of the shelf sandstones.

Malicse, A.; Mazzullo, J.; Holley, C.; Mazzullo, S.J.



Sulimar Queen environmental restoration project closure package Sandia environmental stewardship exemplar.  

SciTech Connect

In March 2008, Sandia National Laboratories (Sandia), in partnership with the Bureau of Land Management, Roswell Field Office, completed its responsibilities to plug and abandon wells and restore the surface conditions for the Sulimar Queens Unit, a 2,500 acre oil field, in Chaves County, Southeast New Mexico. Sandia assumed this liability in an agreement to obtain property to create a field laboratory to perform extensive testing and experimentation on enhanced oil recovery techniques for shallow oil fields. In addition to plugging and abandoning 28 wells, the project included the removal of surface structures and surface reclamation of disturbed lands associated with all plugged and abandoned wells, access roads, and other auxiliary facilities within unit boundaries. A contracting strategy was implemented to mitigate risk and reduce cost. As the unit is an important wildlife habitat for prairie chickens, sand dune lizards, and mule deer, the criteria for the restoration and construction process were designed to protect and enhance the wildlife habitat. Lessons learned from this project include: (1) extreme caution should be exercised when entering agreements that include future liabilities, (2) partnering with the regulator has huge benefits, and (3) working with industry experts, who were familiar with the work, and subcontractors, who provided the network to complete the project cost effectively.

Tillman, Jack B.



Queens University, Carleton University, and Algonquin College Solar Decathlon 2011 Construction Drawings  

NLE Websites -- All DOE Office Websites (Extended Search)


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


4-Hydroxy-PCB106 acts as a direct thyroid hormone receptor agonist in rat GH3 cells  

E-Print Network (OSTI)

Polychlorinated biphenyls (PCBs) may interfere with thyroid hormone (TH) action by interacting directly with the TH receptor (TR). We found that the hydroxylated PCB metabolite, 4-OH-CB106, bound to the human TR?1 and significantly elevated endogenous growth hormone (GH) expression in GH3 cells in a manner similar to that of T3 itself. This effect was also observed using a consensus TH response element (TRE) in a luciferase expression system, and was blocked by a single base-pair substitution in this TRE. In addition, we found that 4-OH-CB106 did not alter the ability of TR?1 to physically interact with the TRE in the GH promoter, or with SRC1 or NCoR. These effects were directly parallel to effects of T3, indicating that 4-OH-CB106 exerts a direct agonistic effect on the TR?1.

Seo-hee You A; Kelly J. Gauger A; Ruby Bansal B; R. Thomas Zoeller A



Sequence stratigraphic controls of hydrocarbon reservoir architecture - case study of Late Permian (Guadalupian) Queen Formation, Means Field, Andrews County, Texas.  

E-Print Network (OSTI)

The late Permian Queen Formation (115 m thick) is a succession of mixed clastics, carbonates and evaporites deposited in the northeastern margin of Central Basin Platform of the Permian Basin, west Texas, USA. Depositional facies, stacking patterns of cyclic facies associations and statistical correlation of rock property variations define geologic controls on reservoir rock properties. Textural, compositional, petrophysical and diagenetic variations within lithofacies exhibit systematic changes with stratigraphic position, which can be related to base level changes that were controlled by high-frequency, low-amplitude, sea level fluctuations during a greenhouse period. Ten lithofacies record variations in clastic input, shallow marine carbonate production, and evaporate precipitation in sabhkas and salinas. Four different types of lithofacies associations define: (1) transgressive deltaic deposits; (2) upward-shallowing evaporite and carbonate tidal-flat deposits; (3) transgressive beach ridge and sand flat deposits; and (4) upward-shallowing evaporite salina-sabhka deposits. Stacking patterns of lithofacies associations define sixteen depositional cycles that can be grouped into eight cycle sets. Cycle sets in turn are grouped to define two high-frequency sequences. Sequence 1 progresses from fluvial to carbonate tidal flat cycles. Sequence 2 consists of salina-dominated upward-shoaling cycles. Lateral continuity of cycles indicates restricted sedimentation on low-accommodation inner platform areas updip of prograding highstand platform-margin carbonate buildups, and a long-term trend of accommodation decrease. The Queen Formation contains two reservoir types; (1) siliciclastic reservoirs capped by evaporites and (2) layer-cake carbonate reservoirs. Of the four reservoir zones identified, R11 in lowstand fluvial-deltaic deposits has relatively little cement and the best reservoir characters.

Ryu, Changsu



Facies, depositional environments, and reservoir properties of the Shattuck sandstone, Mesa Queen Field and surrounding areas, southeastern New Mexico  

E-Print Network (OSTI)

The Shattuck Sandstone Member of the Guadalupian age Queen Formation was deposited in back-reef environments on a carbonate platform of the Northwest Shelf (Permian Basin, New Mexico, USA) during a lowstand of sea level. At Mesa Queen Field, the Shattuck Sandstone is a sheet-like sand body that averages 30 ft (9.1 m) in thickness. The Shattuck Sandstone includes deposits of four major siliciclastic environments: (1) fluvial sandflats, (2) eolian sand sheets, (3) inland sabkhas, and (4) marine-reworked eolian sands. Fluvial sandflat deposits are further subdivided into sheetflood, wadi plain, and river-mouth deposits. Dolomites, evaporites, and siliciclastics that formed in adjacent coastal sabkha and lagoonal environments bound the Shattuck Sandstone from above and below. The Shattuck Sandstone is moderately- to well-sorted, very fine-grained subarkose, with a mean grain size of 98 ?m (3.55?). Eolian sand sheet, wadi plain, and marine-reworked eolian facies comprise the productive reservoir intervals. Reservoir quality reflects intragranular and intergranular secondary porosity formed by partial dissolution of labile feldspar grains, and pore-filling anhydrite and dolomite cements. Vertical successions and regional facies patterns support previous interpretations that these deposits formed during a sea-level lowstand and early stages of the subsequent transgression. Facies patterns across the shelf indicate fluvial sandflats prograded over coastal and continental sabkhas, and eolian sand deposition became more common during sea-level fall and lowstand. During subsequent transgression, eolian sediments in the upper portion of the Shattuck Sandstone were reworked as coastal and lagoon environments became reestablished on the inner carbonate platform.

Haight, Jared



Lithologic characteristics, depositional environments and geometries of reservoir and nonreservoir facies in the Queen Formation (Guadalupian, Permian) of Moose and Virey Fields, Midland County, Texas  

E-Print Network (OSTI)

The Queen Formation is a member of the Artesia Group, which is a sequence of intermingling carbonates, classics and evaporates that were deposited during Guadalupian (Permian) time across the Northwest Shelf, Central Basin Platform, and Midland Basin of the Permian Basin, west Texas and southeastern New Mexico. In Moose and Virey Fields, the Queen is the main producing formation and consists entirely of intercepted back-reef shelf elastics and evaporates which were deposited in a variety of continental desert and marginal marine settings. The Queen desert was a broad and generally low-relief surface transected by warm temperatures, semi-arid climate, scarce vegetation, and alternating periods of dryness and intense storm-induced flashflooding. Sedimentation within the Queen desert took place in six separate depositional environments. The elastics of Moose and Virey Fields were deposited in proximal fluvial sandflat and fluvial-dominated sabra environments, and along the edge of a shallow hypersaline lagoon. The anhydrides (formerly gypsum) were precipitated subaqueously on the floor of and in the subsurface beneath a broad and shallow, hypersaline lagoon which was characterized by poor circulation and restriction from the normal marine environment. Some halides formed subaqueously in a large, but very shallow, isolated inland saliva situated in the topographic lows of the desert sabkha. Other halides formed in an ephemeral and sometimes desiccated salt-pan environment which was subjected to alternating 'wet' and 'dry' conditions. It is believed that the progression of depositional environments across the study area was in part controlled by fourth- and fifth-order relative sea level fluctuations during a major third-order marine regression. Two large subsurface structural collapse features with at least 200 feet of vertical relief are located in the central portions of Moose and Virey Fields. The collapse of the Queen Formation in these areas was induced by the post-depositional and post-burial dissolution of the halides primarily of the underlying Grayburg Formation, and to a lesser extent of the Queen Formation. It apparently occurred as a series of minor collapse events which first began in Post-oueen Guadalupian time, during deposition of the lower Seven Rivers Formation, and finally ended in the Ochoan during deposition of the Rustler Anhydrite.

Aller, Gregory Shane



***Department of Economics, Queens University  

E-Print Network (OSTI)

This paper represents the views of the author and does not necessarily reflect the opinions of Statistics Canada. This paper outlines the structure of payroll taxes and documents evidence on the level, growth and role of each component over the last three decades for Canada and for each province. Levied by both the federal and provincial governments, payroll taxes in Canada include four major components: i) unemployment insurance (UI) premiums; ii) Canada/Quebec Pension Plan (C/QPP) contributions; iii) workers compensation (WC) premiums; and iv) the provincial health/post-secondary education (H/E) tax levied by Quebec, Manitoba, Ontario and Newfoundland. While the UI and C/QPP components are levied on both employers and employees, the WC and H/E components are levied on employers only. Our main findings are 1) payroll taxes have increased substantially over the last three decades in Canada as a whole and in every province; 2) the structure, level, growth and role of each component of payroll taxes vary remarkably from one province to another; 3) the expansion of the UI component in recent years has been the largest contributor to the rise in payroll taxes across every province in the country; and 4) despite significant growth in recent years, payroll taxes are still much lower in Canada than in most other western industrialized countries. JEL classification: E62--- Taxation; H25--- Business Taxes Key words: supplementary labour income, employer payroll taxes, employee payroll taxes, effective payroll tax rates- 5-

Zhengxi Lin; Garnett Picot; Charles Beach




U.S. Energy Information Administration (EIA) Indexed Site




E-Print Network (OSTI)

of first place. Bob Brenn 130# 1st Mike Tanascu 147* 1st Tom Centner 157# Ron Miltenberger 177# 1st John

Johnson Jr.,, Ray



E-Print Network (OSTI)

,wherethe frozen-influx 1LosAlamosNational Laboratory, LosAlamos,New Mex- ico. 2Institute for PlasmaResearch and M. A. Shay, In- stitute for Plasma Research, University of Maryland, College Park, MD 20742. (drake


Reasons for decision in the matter of Imperial Oil Resources Limited and Boston Gas Company application pursuant to Part VI of the National Energy Board Act for a license to export natural gas: GH-1-99  

Science Conference Proceedings (OSTI)

This document provides the Reasons for Decision in the matter of Hearing Order GH-1-99, heard in Halifax, NS on May 4 and 5, 1999. The proceeding concerns an application for a gas export license from Imperial Oil Resources Ltd. (IORL) and Boston Gas for a proposed export for sale to Boston Gas for the period 1 Nov 1999 to 31 Mar 2007. The natural gas will be produced from the Sable Offshore Energy Project and replace IORL's Alberta natural gas supplies sold to Boston Gas. The document includes a discussion of the market-based procedure used by the Board to assess the merits of an application to obtain a gas export license.

Not Available



February 28 Sickening Queens: Class and Ethnic  

E-Print Network (OSTI)

in the Making: A DIY Zine-Making Workshop Facilitator: Jamie Schlote, The Women's Center March 7 17th Annual


(!)"0 12#)1"043)57698@ 0A BC15A 3 DFE"GH0 1BCG93)5PI4QQ@ AR 3"0A S)GT'(!6UDFIWVXXX Ya`Fb"cd ecfhgi p qrsaqttt7uvwyxvws aFa  

E-Print Network (OSTI)

DFE"GH0 1BCG93¢)§5PI4Q¢Q¢@ AR ¦3"0A S)§G¦T'(!6UDFIWV§X¢X¢X Ya`Fb"cd e§c¢fhg§i p q¢r§saq§t¢t¢t7u¦v§wyx§¢v§w¦s aFa¢§¢ § 1 DYNAMIC PARTIAL PREFETCH RANKING IN HYPERMEDIA NEIGHBORHOOD JAVED I. KHAN Media ¢¡ £¢¤¦¥§¥§¨© §£¢§¥ !" ¥¢¡#§$"© £§$¢%§&'£§ ¥¢¡ ¥¢§¤¦¥ £ (!)"0 1¢2#)§1"043¢)§57698¢@ 0A BC1§5A 3

Khan, Javed I.


Gateway to the Future the campaign for queens college  

E-Print Network (OSTI)

Caucasian JQ348670 JQ348815 JQ348423 127 DNA/ allozymes 41.7167 46.6 Katekh Azerbaijan B. verrucosissimus348646 JQ348791 JQ348422 130 DNA/ allozymes 38.45 48.73 Sim Azerbaijan B. eichwaldi Caspian JQ348681 JQ348826 JQ348546 131 DNA/ allozymes 38.65 48.8 Avrora Azerbaijan B. eichwaldi Caspian ZISP.7185 JQ348680

Johnson Jr.,, Ray


King and Queen County, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

County, Virginia: Energy Resources County, Virginia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 37.7298568°, -76.8951551° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7298568,"lon":-76.8951551,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Queen Creek, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Arizona: Energy Resources Arizona: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.2486638°, -111.6342993° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.2486638,"lon":-111.6342993,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Queen Valley, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

2986656°, -111.2895709° 2986656°, -111.2895709° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.2986656,"lon":-111.2895709,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Queen Anne's County, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Anne's County, Maryland: Energy Resources Anne's County, Maryland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.0263572°, -76.1319953° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.0263572,"lon":-76.1319953,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


QUEEN MARY, UNIVERSITY OF LONDON MTH 4106 Introduction to Statistics  

E-Print Network (OSTI)

density function of 2X + Y . 4 The probability that a light bulb will fail in a year is 0.75, and light bulbs fail independently. If 192 bulbs are installed, what is the probability that the number which fail

Bailey, R. A.


Queens University, Carleton University, and Algonquin Colleges...  

NLE Websites -- All DOE Office Websites (Extended Search)

system design? X B. EFFICIENCY 1 Relative to conventional systems, how much energy will the systems save over the course of an entire year? X 2 Do the HVAC and lighting...


Queens University, Carleton University, and Algonquin Colleges...  

NLE Websites -- All DOE Office Websites (Extended Search)

61-80 81-90 91-100 A FINAL WEBSITE 1 Was the site submitted by the deadline? X 2 Is the design appealing (graphics, photos, colors, and typography)? X 3 Is the information...


Queens University, Carleton University, and Algonquin Colleges...  

NLE Websites -- All DOE Office Websites (Extended Search)

ONTARIO POINTS APPROACH EQUALS EXCEEDS ECLIPSES 0-60% 61-80% 81-90% 91-100% A. LIVABILITY 1 Is the operation of the house's lighting, entertainment, and other controls intuitive? X...

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

csdp50.zip to expand the zip archive. 2. First, determine whether you'll find the BLAS and LAPACK library rou-. tines needed by CSDP. Many manufacturers...


Preserving the Queen (City's) crown jewel : historic preservation in Cincinnati's Over-the-Rhine  

E-Print Network (OSTI)

Over-the-Rhine is a nationally significant historic district in Cincinnati, Ohio, and one of the City's greatest assets. Despite its tremendous character and potential, for years the district has languished through ...

Rieman-Klingler, Daniel G. (Daniel Glenn)



Sustainability at the project level : the case of Willets Point, Queens  

E-Print Network (OSTI)

Citywide sustainability planning creates a vision of how environmental concerns will shape urban development, but the way these plans are incorporated into individual development projects plays a large role in determining ...

Watson, Siobhan (Siobhan Therese)



Excess Specific Heat in Evaporated Amorphous Silicon D. R. Queen,1,* X. Liu,2  

E-Print Network (OSTI)

] and molecular dynamics simulations [38] both associate an increase in the vibrational density of states in a. Revaz, B. L. Zink, and F. Hellman, Thermochim. Acta 432, 158 (2005). [23] X. Liu and H. V. Lo

Hellman, Frances


The museum as agent of participatory planning : the Queens Museum of Art engages an immigrant neighborhood  

E-Print Network (OSTI)

In neighborhoods facing demographic shifts, like changes in ethnicity, class and language, resident participation in state-sponsored planning processes can be difficult due to unfamiliarity, mistrust or cultural misalignment ...

Garz, Jessica Beth



Queens of the Dancehall and Rudegyals: Rasta Women and Reggae-Dancehall in Brazil  

E-Print Network (OSTI)

and Reggae-Dancehall in Brazil Seeing a female behind a mic(interviewed in southeast Brazil, including MCs, musicians,in the sound system culture in Brazil is an example the

McFarlane, Marisa



Queens University, Carleton University, and Algonquin College Solar Decathlon 2011 Menu and Recipes  

NLE Websites -- All DOE Office Websites (Extended Search)

D.O.E. Solar Decathlon 2013 Table of Contents | Page 2 D.O.E. Solar Decathlon 2013 Table of Contents | Page 2 ECHO by TEAM ONTARIO Dinner Party Menus and Recipes TABLE OF CONTENTS Dinner Party Menu.............................................................................................................................3 Dinner 1 ..................................................................................................................................................... 3 Dinner 2 ..................................................................................................................................................... 3 Recipes ..............................................................................................................................................4 Stuffed Peppers ......................................................................................................................................... 4


bersicht ber die Durchfhrung der Fachpraktika Master Gym Bachelor BEU / Master GH / R  

E-Print Network (OSTI)

) WiSe od. SoSe 2) WiSe 1) 4) WiSe od. SoSe 2) Chemie SoSe SoSe 5) ______ SoSe 5) _____ _____ _____ _____ Deutsch WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. So

Kallenrode, May-Britt


Reading contamination : an environmental education center at the Wells G&H Superfund Site  

E-Print Network (OSTI)

This thesis proposes and architectural and programmatic methodology which makes legible the processes and consequences of site contamination. This methodology is chiefly demonstrated through a plan for the site which emerges ...

Berry, Rebecca Lynn, 1973-



Using synthetic biology to screen for functional diversity of GH1 enzymes  

DOE Green Energy (OSTI)

Advances in next-generation sequencing technologies have enabled single genomes as well as complex environmental samples (metagenomes) to be comprehensively sequenced on a routine basis. Bioinformatics analysis of the resulting sequencing data reveals a continually expanding catalogue of predicted proteins ( 14 million as of April 2011), 75 percent of which are associated with functional annotation (COG, Pfam, Enzyme, Kegg, etc). These predicted proteins cover the full spectrum of known pathways and functional activities, including many novel biocatalysts that are expected to significantly contribute to the development of clean technologies including biomass degradation, lipid transformation for biodiesel generation, intermediates for polymer production, carbon capture, and bioremediation.

Deutsch, Sam; Datta, Supratim; Hamilton, Matthew; Friedland, Greg; D'Haeseleer, Patrik; Chen, Jan-Fang; Chivian, Dylan; Egan, Rob; Sale, Kenneth; Simmons, Blake; Rubin, Eddy



ATLAS I: A Singlechip ATM switch for NOWs Manolis G.H. Katevenis Panagiota Vatsolaki  

E-Print Network (OSTI)

; these are handled in either of two ways. Some networks allow packets/cells to be dropped, and use end latency, and and (ii) they drop cells when (even short­term) congestion happens. In this paper, we present­ pressure (credit­based) flow control which never drops ATM cells. The architecture of ATLAS I has been

Markatos, Evangelos P.


Finding Statistics & Data at Queen's Sept/08 STATISTICS Facts & figures in tables, charts, time series, graphs, etc.  

E-Print Network (OSTI)

Statistics Handbook ­ statistics on oil, gas, electricity, as well as energy trade and the economy & U.S. trade in goods with over 200 countries Tuition and Living Accommodation Cost at Canadian DegreeGranting Universities ­ how much are you paying? World Trade Database ­ Canadian imports/exports

Graham, Nick


58-25 Queens Blvd., Woodside, NY 11377 T: (718) 204-7077; (800) 627-1244  

E-Print Network (OSTI)

of Christendom ­ the tomb where Christ was buried and was resurrected. Exit via the Damascus Gate and continue beverages. · Laundry and other items of a personal nature. · Personal, trip cancellation, accident Tax/Customs Fees/Security Charge. · Optional insurance coverage is available for Baggage, Accident

Marsh, David


ATLAS I: A Single-chip ATM switch for NOWs Manolis G.H. Katevenis Panagiota Vatsolaki  

E-Print Network (OSTI)

ows these are handled in either of two ways. Some networks allow packets/cells to be dropped, and use latency, and and (ii) they drop cells when (even short-term) congestion happens. In this paper, we present- pressure (credit-based) ow control which never drops ATM cells. The architecture of ATLAS I has been fully

Markatos, Evangelos P.


Queens University, Carleton University, and Algonquin Colleges U.S. Department of Energy Solar Decathlon 2013 Architecture Jury Feedback  

NLE Websites -- All DOE Office Websites (Extended Search)

DESIGN & IMPLEMENTATION DESIGN & IMPLEMENTATION 1 Was the team effective in its use of architectural elements including, but not limited to: Scale and proportion of room and façade features x Indoor/outdoor connections x Composition x Linking of various home elements x 2 Did the team create a holistic design that will be comfortable for occupants and compatible with the surrounding environment? x 3 Lighting Are the lighted spaces rich and varied? x Do they have adequate light for tasks? x Do they have good color rendition? x Do the luminaires properly distribute light? x Is the admission of direct and diffuse sunlight effectively controlled? x 4 Will the overall architectural design offer a sense of inspiration and delight to Solar Decathlon visitors? x B. DOCUMENTATION 1 Did the drawings, construction specifications, and


Development of New Electrolytes for IT-SOFCs for Energy Applications Supervised by Dr Isaac Abrahams, Prof. Martin Dove (Queen Mary University of London) and  

E-Print Network (OSTI)

Development of New Electrolytes for IT-SOFCs for Energy Applications Supervised by Dr Isaac technology behind solid oxide fuel cells (SOFCs) give them huge potential in this respect, provided that key temperatures is therefore a key SOFC research target. As part of this research, characterisation

Chittka, Lars


Queen's Sustainability Advisory Committee (QSAC) Minutes of the meeting held on September 23, 2010 from 10:00 a.m. to 11:30 a.m.  

E-Print Network (OSTI)

are encouraged to have a final look at the framework before its release II. Solar PV · An RFI was released campus rooftops (roughly 75% of available rooftop space) and an 80 acre tract of land at the biology practices and possible financial models to support solar PV deployment · Using the information from the RFI

Graham, Nick


Offering Songs, Festive Songs, Processional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Gyalmo Kusum, 'Queen Kusum'  

E-Print Network (OSTI)

in this intermarriage. Primarily a collection of folk and religious offering songs sung by a specialised class of folk singers (Emeda) in Lo. Most of these songs are sung by Tashi Tsering, the last remaining Emeda singer in Lo. In many of these songs, he accompanies...

Blumenthal, Katey


)1024365')7 85'9) #&(@"A&B )DC'56B4E56"FB G(H) CI95PQ)  

E-Print Network (OSTI)

byexaminationalone.For admis- ADMISSION, REGISTRATIONANDENROLLMENTI slon of nonresident applicants by this method

Paris-Sud XI, Université de


M k D d Mark Daymond  

Science Conference Proceedings (OSTI)

... Research reactors; Reflector vessel walls Queen's University, Kingston, Canada Department of Mechanical and Materials Engineering Nuclear ...


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DrummoyneOval LyonsRoad,Drummoyne  

E-Print Network (OSTI)

Annandale Leichhardt Petersham NewtownStanmore Kingsford Queens Park Edgecliff Woollahra Redfern Waterloo

Green, Donna


Department of Materials Research in Progress  

E-Print Network (OSTI)

Todorov Queen's University, Belfast Mr Shunichiro Ueno Coal Ash Limited, UK RESEARCH FELLOWS Dr Heiko



E-Print Network (OSTI)

[T] Field map calculated from coil current densiUes using Icool grid rou length =5-7 m- B=20-1.5 & 2.5 T Target SC Magnets Field Map 0 5 10 15 20 25 Z/25/13 6 Tracking 1E5 muons through decay channel -10 cells (50 m) Transmission

McDonald, Kirk



E-Print Network (OSTI)

[T] Field map calculated from coil current densiUes using Icool grid rou Transmission: Constant 1.5 Solenoid Field %67 Field map from realisUc coils taper length =7 m- B=20-1.5 T Target SC Magnets Field Map 0 5 10 15 20 25 Z [m

McDonald, Kirk


Lithium fluoride (LiF) crystal for parametric X-ray (PXR) production  

E-Print Network (OSTI)

'' is associated with electrons moving through a condensed medium at relativistic speeds [1]. These photons is assumed to be parallel with the crystal surface for simplicity. Because of commercial availability0 p ~s Á ~X : ð3? Comparison of data with Eqs. (1) and (3) is rou- tinely performed to assess

Danon, Yaron


The Implications of a Gasoline Price Floor for the California Budget and Greenhouse Gas Emissions  

E-Print Network (OSTI)

Gas Daily Quantity Daily GhG Emissions Oil Price Price elasGas Daily Quantity Daily GhG Emissions Oil Price Price elasDaily Quantity Daily GhG Emissions Surcharge Revenues Oil

Borenstein, Severin



New Cellulase Identification Method Holds Promise for Lower-Cost...  

NLE Websites -- All DOE Office Websites (Extended Search)

within the protein family GH48, a key component for degrading lignocellulose for biofuels. Cellulase enzymes, particularly from the glycoside hydrolase family 48 (GH48), are a...



E-Print Network (OSTI)

??Agriculture and Agri-Food Canada (AAFC), the Ontario Greenhouse Vegetable Growers Association (OGVG), and Queens Universitys Solar Calorimetry Laboratory (SCL) are undertaking a joint project to (more)




ANNUAL REPORTE X C E L L E N C E I N N O V A T I O N This time last year, my annual message focused on the building blocks Queen's School of Business had been putting  

E-Print Network (OSTI)


Ellis, Randy


Challenges, uncertainties and issues facing gas production from gas hydrate deposits  

E-Print Network (OSTI)

shales, silts, and non-commercial sand stringers above the target GH reservoirs. High gas production

Moridis, G.J.



futurs tudiants Entrer l'Universit de Montral, c'est explorer un domaine d'tudes afin  

E-Print Network (OSTI)

linguistique: www.cce.umontreal.ca ?cole de français: www.fep.umontreal.ca/langues tRouVER dE L'aIdE f cultures lusophones Mn Mod Lettres et sciences humaines B Linguistique Mj Mn Linguistique et Psychologie B Littératures de langue française et Linguistique B Littératures de langue française et Philosophie B

Parrott, Lael


Temperate Mountain Glacier-Melting Rates for the Period 200130: Estimates from Three Coupled GCM Simulations for the Greater Himalayas  

Science Conference Proceedings (OSTI)

The temperate glaciers in the greater Himalayas (GH) and the neighboring region contribute to the freshwater supply for almost one-half of the people on earth. Under global warming conditions, the GH glaciers may melt more rapidly than high-...

Diandong Ren; David J. Karoly; Lance M. Leslie



Biogeosciences, 4, 597612, 2007 www.biogeosciences.net/4/597/2007/  

E-Print Network (OSTI)

.7 Flame shape visualizations using OH , in a coaxial LOx/GH2 injector [Ju- niper 2001]: (a) instantaneous visualizations using OH , in a coaxial LOx/GH2 injector [Ju- niper 2001]: (a) instantaneous image, (b) top: time

Paris-Sud XI, Université de


Microsoft PowerPoint - Proceedings Cover Sheets  

NLE Websites -- All DOE Office Websites (Extended Search)

& Aerospace Engineering Arizona State University; Tempe, Arizona 85287 USA o National Energy Technology Laboratory - Albany 1450 Queen Avenue SW; Albany, Oregon 97321-2152 This...


The IMU's Electronic Initiatives (Revised Feb 2002)  

E-Print Network (OSTI)

Feb 15, 2002 ... This is a complicated world, for example, the CMS adheres to the IMU .... Queen Mary & Westfield College, London, UK; w.hodges@qmw.ac.uk...


Is heritage revitalization a compromise with town planning in Hong Kong?: a comparison of the Tsim Sha TsuiFormer Marine Police Headquarter, Kom Tong Hall, and Wanchai BlueHouse cluster?.  

E-Print Network (OSTI)

???Heritage conservation has become the hot issue since the well known public participated protection movement of Star Ferry Pier and Queen Pier. It made her (more)

Yeh, Wai-ki.



Monday Morning Sessions  

Science Conference Proceedings (OSTI)

... G. Slavens, Albany Research Center, U.S. Bureau of Mines, 1450 Queen Ave ... conventional hot-pressing and a new technique plasma activated slntering.


Former Worker Medical Screening Program - Brookhaven National...  

NLE Websites -- All DOE Office Websites (Extended Search)

Workers Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Website: http:www.worker-health.org This project is conducted by Queens College...


Browse by Discipline -- E-print Network Subject Pathways: Mathematics...  

Office of Scientific and Technical Information (OSTI)

Elkashlan, Maged (Maged Elkashlan) - School of Electronic Engineering and Computer Science, Queen Mary, University of London Erdogan, Hakan (Hakan Erdogan) - Faculty of Engineering...



Science Conference Proceedings (OSTI)

Mar 14, 2006 ... Michael L. Free, University of Utah; Boyd R. Davis, Queens. University ...... Magnetic Nanoparticles and Nanorods: Lynn Kurihara1; Michael.

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Former Worker Medical Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

of New Mexico Worker Health Protection Program conducted jointly by Queens College of the City University of New York, United Steelworkers, the Atomic Trades and Labor Council in...


Brookhaven National Lab Regional Middle School Science Bowl ...  

Office of Science (SC) Website

The following counties in New York: Suffolk, Nassau, Queens Date of Electric Car Competition: 312014 Please contact the regional coordinator for more information on...


NIST Provides Octagonal Window of Opportunity for Carbon ...  

Science Conference Proceedings (OSTI)

... MR Hudson, WL Queen, JA Mason, DW Fickel, RF Lobo and CM Brown. Unconventional, highly selective CO 2 adsorption in zeolite SSZ-13. ...




Science Conference Proceedings (OSTI)

She held a joint postdoctoral appointment in Materials Science at Queen Mary, University of London and Anatomy and Developmental Biology at University...


DOE Solar Decathlon: News Blog Norwich  

NLE Websites -- All DOE Office Websites (Extended Search)

and KentuckyIndiana from University of Louisville, Ball State University, and University of Kentucky (248,423). Team Ontario from Queen's University, Carleton...


DOE Solar Decathlon: News Blog Blog Archive Affordability...  

NLE Websites -- All DOE Office Websites (Extended Search)

and KentuckyIndiana from University of Louisville, Ball State University, and University of Kentucky (248,423). Team Ontario from Queen's University, Carleton...


DOE Solar Decathlon: News Blog Market Appeal  

NLE Websites -- All DOE Office Websites (Extended Search)

and KentuckyIndiana from University of Louisville, Ball State University, and University of Kentucky (248,423). Team Ontario from Queen's University, Carleton...


DOE Solar Decathlon: News Blog Stanford  

NLE Websites -- All DOE Office Websites (Extended Search)

and KentuckyIndiana from University of Louisville, Ball State University, and University of Kentucky (248,423). Team Ontario from Queen's University, Carleton...


Women @ Energy: Christina Swinson | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Women @ Energy: Christina Swinson Christina Swinson is a post doc. in Accelerator Physics at Brookhaven National Lab. She has a BSc. In Physics with Computing, Queen Mary...


--No Title--  

NLE Websites -- All DOE Office Websites (Extended Search)

Geoneutrinos from the Ground Up Mark Chen Queen's University, Kingston, Canada Abstract: In early March 2010, the second experimental detection of geoneutrinos was reported by the...



NLE Websites -- All DOE Office Websites (Extended Search)

US) * West Pearl Queen (SW US) * Sleipner (North Sea) 1M tonnesyr (1996) * Weyburn (Canada): 2M tonnesyr (2000) Sleipner Sleipner Time Time - - Lapse Seismic Lapse Seismic top...


Magnetic Order in Superconductors  

Science Conference Proceedings (OSTI)

... Intrinsic Properties of Stoichiometric LaOFeP, TM McQueen, M. Regulacio, AJ Williams, Q. Huang, JW Lynn, YS Hor, DV West, and RJ Cava, Phys. ...


Iron-based Superconductors  

Science Conference Proceedings (OSTI)

... Intrinsic Properties of Stoichiometric LaOFeP, TM McQueen, M. Regulacio, AJ Williams, Q. Huang, JW Lynn, YS Hor, DV West, and RJ Cava, Phys. ...


DOE Solar Decathlon: News Blog Blog Archive Vienna University...  

NLE Websites -- All DOE Office Websites (Extended Search)

Carleton University, and Algonquin College) placed first. Photo of the Team Ontario house. The Engineering Contest first-place winner is Team Ontario (Queen's University,...


BioCarbon Fund Project Portfolio | Open Energy Information  

Open Energy Info (EERE)

Portfolio Portfolio Jump to: navigation, search Name BioCarbon Fund Project Portfolio Agency/Company /Organization World Bank Sector Land Focus Area Forestry Topics Market analysis, Policies/deployment programs, Background analysis Website http://wbcarbonfinance.org/Rou Country Albania, China, Colombia, Costa Rica, Ethiopia, Honduras, India, Kenya, Madagascar, Mali, Moldova, Nicaragua, Niger, Uganda Southern Europe, Eastern Asia, South America, Central America, Eastern Africa, Central America, Southern Asia, Eastern Africa, Eastern Africa, Western Africa, Eastern Europe, Central America, Western Africa, Eastern Africa References BioFund Projects[1] Background "The BioCarbon Fund provides carbon finance for projects that sequester or conserve greenhouse gases in forests, agro- and other ecosystems. Through


The World Bank Partnership for Market Readiness (PMR) | Open Energy  

Open Energy Info (EERE)

for Market Readiness (PMR) for Market Readiness (PMR) Jump to: navigation, search Logo: The World Bank Partnership for Market Readiness (PMR) - Brazil Name The World Bank Partnership for Market Readiness (PMR) - Brazil Agency/Company /Organization World Bank Partner Australia, Denmark, EC, Germany, Japan, Netherlands, Norway Spain, Switzerland, UK, and US Sector Climate, Energy Focus Area Non-renewable Energy, Buildings, Economic Development, Energy Efficiency, Goods and Materials, Greenhouse Gas, Grid Assessment and Integration, Industry, Offsets and Certificates, People and Policy, Transportation Topics Baseline projection, Finance, GHG inventory, Implementation, Low emission development planning, Market analysis, Policies/deployment programs Website http://wbcarbonfinance.org/Rou


Exploring the HR Function at Maersk Oil  

E-Print Network (OSTI)

Exploring the HR Function at Maersk Oil An Interview with: Stina Bjerg Nielsen Senior Vice President, Human Resources Maersk Oil Interviewed by: Alison Hill Queen's University IRC A QUEEN'S UNIVERSITY IRC INTERVIEW #12;Exploring the HR Function at Maersk Oil An Interview with: Stina Bjerg Nielsen

Graham, Nick


BioMed Central Page 1 of 13  

E-Print Network (OSTI)

Status on Queen Overwintering Survival in the Social Wasp Vespula maculifrons Author(s): Jennifer L on Queen Overwintering Survival in the Social Wasp Vespula maculifrons JENNIFER L. KOVACS AND MICHAEL A. D in monogyne and polygyne colonies of Formica trun- corum(Hymenoptera:Formicidae):theimpactofkinship and mating

Goodisman, Michael


SHUG Executive Committee | ORNL Neutron Sciences Users  

NLE Websites -- All DOE Office Websites (Extended Search)

Executive Committee Executive Committee SHUG Executive Committee Members Tyrel McQueen Tyrel McQueen mcqueen@jhu.edu Term expires December 2014 Chair: Tyrel McQueen Assistant Professor of Chemistry Johns Hopkins University Research interests: New solid state chemistry materials design and synthesis techniques; experimental condensed matter physics, quantum magnetism, heat- and light-induced charge separation through strong electron correlations; superconductivity. Greg Beaucage Greg Beaucage beaucag@uc.edu Term expires December 2014 Past Chair: Greg Beaucage University of Cincinnati Research interests: Soft condensed matter and polymers, especially quantification of molecular topology using SANS, in the hierarchical structure of ceramic and metallic aggregates, and in the study of protein


NVN-086286 | Open Energy Information  

Open Energy Info (EERE)

6 6 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NVN-086286 CU at Desert Queen Geothermal Area for Geothermal/Exploration, Magma Energy Action Plan for Geophysical and Vibroseis Surveys General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CU Applicant Magma Energy Consultant RMT, Inc. Geothermal Area Desert Queen Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Magnetotellurics Comments Desert Queen and Leach Hot Springs Time Frame (days) Application Time 31 Participating Agencies Lead Agency Nevada Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


International Workshop: MFE Roadmapping in the ITER Era | Princeton...  

NLE Websites -- All DOE Office Websites (Extended Search)

Princeton University Princeton, NJ International Workshop: MFE Roadmapping in the ITER Era Princeton University Princeton, NJ Host: G.H. Neilson Coordinator: Pamela Hampton...


Magnetic Order in Superconductors  

Science Conference Proceedings (OSTI)

... Intrinsically Localized Mode in a-uranium as a Precursor to a Solid-state Phase Transition, ME Manley, JW Lynn, Y. Chen, and GH Lander, Phys. ...


Challenges, uncertainties and issues facing gas production from gas hydrate deposits  

E-Print Network (OSTI)

focus of GH exploration and production studies in northernoil and gas exploration and production activities; includingGas hydrate exploration and production activities will be

Moridis, G.J.



Cast Alloys for Advanced Ultra Supercritical Steam Turbines  

Science Conference Proceedings (OSTI)

Abstract Scope, The proposed steam inlet temperature in the Advanced Ultra ... 15 - The Effect of Primary ?' Distribution on Grain Growth Behavior of GH720Li...


Mathematical Programming Approaches for Generating p-Efficient ...  

E-Print Network (OSTI)

[4] Charnes A, Cooper, W.W, Symonds, G.H. Cost Horizons and Certainty Equivalents: An Approach to. Stochastic Programming of Heating Oil. Management...


Selected Topics in Robust Convex Optimization  

E-Print Network (OSTI)

Charnes, A., Cooper, W.W., Symonds, G.H.: Cost horizons and certainty equivalents: an approach to stochastic programming of heating oil. Manage-.


Microsoft Word - Agenda F&I Update 090804.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conference Room GH-019 Agenda Call in Number 301-903-6379 Confirmation Number 253041 Internet Access and Projector Will Be Available The presentations will be available via...


Flows and Decompositions of Games: Harmonic and Potential Games  

E-Print Network (OSTI)

142154, Washington, DC, USA, 2005. IEEE Computer Society. [15] G.H. Golub and C.F. Van Loan. Matrix computations. Johns Hopkins University Press, 1996.


Data:D6065448-af60-410e-83ea-d320f8298417 | Open Energy Information  

Open Energy Info (EERE)

Effective date: 20090101 End date if known: Rate name: SCHEDULE GH GENERAL SERVICE- HEATING (RESIDENTIAL) VERSION 2 Sector: Residential Description: The amount determined under...


Data:16a0459a-cecd-44d7-a3e7-75f9e929766a | Open Energy Information  

Open Energy Info (EERE)

Effective date: 20090101 End date if known: Rate name: SCHEDULE GH GENERAL SERVICE - HEATING (RESIDENTIAL) Sector: Residential Description: Additional Info: AVAILABILITY: Service...


Ultracapacitor Technologies and Application in Hybrid and Electric Vehicles  

E-Print Network (OSTI)

Moderate Hybrid-electric Vehicles. ESScap06, Switzerland,GH. SIMPLEV: A Simple Electric Vehicle Simulation Program-Ultracapacitors in Hybrid- electric Vehicle Applications.

Burke, Andy



New Cellulase Identification Method Holds Promise for Lower-Cost Biofuels (Fact Sheet)  

SciTech Connect

A new computational approach to genomic data effectively distinguishes cellulases and non-cellulases within the protein family GH48, a key component for degrading lignocellulose for biofuels.

Not Available



Microsoft Word - 2006FactSR116.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Including Corrosive Contaminants Typical of Those Arising by Using Alternate Fuels in Gas Turbines Fact Sheet I. PROJECT PARTICIPANTS G.H. Meier, Mechanical Engineering and...


Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin  

Science Conference Proceedings (OSTI)

The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie (Vermont); (Utah)



Coastal Countercurrent and Mesoscale Eddy Formation by Tidal Rectification near an Oceanic Cape  

Science Conference Proceedings (OSTI)

Cape St. James is an extensive triangular-shaped promontory located in a tidally energetic region at the southern tip of the Queen Charlotte Islands approximately 150 km off the mainland coast or British Columbia. Several years of oceanographic ...

Richard E. Thomson; Robert E. Wilson



Dec06netlog 150 dpi  

NLE Websites -- All DOE Office Websites (Extended Search)

ContaCt national Energy technology Laboratory 1450 Queen Avenue SW Albany, OR 97321 541-967-5892 2175 University Avenue South Suite 201 Fairbanks, AK 99709 907-452-2559 3610...


The Influence of Bubbles on Ambient Noise in the Ocean at High Wind Speeds  

Science Conference Proceedings (OSTI)

Observations of ambient noise in the ocean at high wind speeds reveal significant departures in spectral shape from previously reported values at lower wind speeds. The observations were made in open ocean conditions in Queen Charlotte Sound, ...

David M. Farmer; David D. Lemon




NLE Websites -- All DOE Office Websites (Extended Search)

These mate, and the young queens go into hibernation. The males and workers die. The white-faced hornet also builds a paper nest, on the branch of a tree or bush, containing a...


Numerical Simulations of a Case of Explosive Marine Cyclogenesis  

Science Conference Proceedings (OSTI)

The extratropical cyclone which damaged the liner Queen Elizabeth II in September 1978 is a well-documented example of explosive marine cyclogenesis in which the 24 h surface central pressure fall was 60 mb commencing 1200 GMT 9 September. ...

Richard A. Anthes; Ying-Hwa Kuo; John R. Gyakum



Coincident Lidar and Aircraft Observations of Entrainment into Thermals and Mixed Layers  

Science Conference Proceedings (OSTI)

Coincident observations of the daytime convective boundary layer over Oklahoma were made with the NCAR Queen Air aircraft and the University of Wisconsin ground-based lidar. The two data sets have been merged to provide a unique visual ...

Timothy D. Crum; Roland B. Stull; Edwin W. Eloranta


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Intercomparison of Aircraft and Surface Buoy Meteorological Data during CODE-1  

Science Conference Proceedings (OSTI)

Intercomparisons of meteorological datawind speed and direction, surface temperature and surface pressurewere obtained for NCAR Queen Air overflights of four buoys during the CODE-1 experiment. The overflights were at a nominal altitude of 33 ...

Carl A. Friehe; Robert C. Beardsley; Clinton D. Winant; Jerome P. Dean



in development and the urban environment  

E-Print Network (OSTI)

woodland The Queen's Inclosure, Havant, Hants Peri-urban Waterhayes, Newcastle-under-Lyme, Staffs Rural costs. 15 PERI-URBAN Waterhayes, Newcastle-under-Lyme RURALURBAN Environmental advantages Improved


NETL: News Release - First Geologic Sequestration Field Test...  

NLE Websites -- All DOE Office Websites (Extended Search)

tons of CO2 into Strata Production Company's West Pearl Queen reservoir near Hobbs. The quantity of CO2 injected in the New Mexico project is comparable to a single day of...


Seed: The Social Life http://www.seedmagazine.com/news/2006/08/the_social_life.php?pag... 1 of 2 04/09/2006 02:22  

E-Print Network (OSTI)

company, they can be overheard saying things like, "But ants represent 40 percent of the biomass in many their queen handle dangerous jobs. · Despite being only 3 percent of the way through their samples of mites

Wenseleers, Tom


The Nuclear Revolution, Relative Gains, and International Nuclear Assistance  

E-Print Network (OSTI)

ambitions: The spread of nuclear weapons 1989-1990. Boulder:Determinants of nuclear weapons proliferation. UnpublishedWhy nations forgo nuclear weapons. Montreal: McGill-Queens

Kroenig, Matthew




Annual Energy Outlook 2012 (EIA)



Updraft Evolution: A Perspective from Cloud Base  

Science Conference Proceedings (OSTI)

A Queen Air, instrumented to make 1-Hz measurements of the kinematic, dynamic, and thermodynamic fields, and radar, mesonet, and soundings from the Cooperative Convective Precipitation Experiment 1981 is used to monitor the evolution of the ...

Gary M. Barnes



A Study of the Source of Entrained Air in Montana Cumuli  

Science Conference Proceedings (OSTI)

Data gathered by the University of Wyoming King Air, the Atmospheric Environmental Services Twin otter and an NCAR Queen Air were used in thermodynamic analyses to determine the sources of environmental air entrained into cumulus clouds. The ...

Alan M. Blyth; William A. Cooper; Jrgen B. Jensen




NLE Websites -- All DOE Office Websites (Extended Search)

to Hurricane Destruction - A New Perspective Based on Recent Research on Irene 2011 and Sandy 2012 Professor Nicholas K. Coch Queens College CUNY In the last two years. the...


Mailing Addresses for National Laboratories and Technology Centers...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Center 1450 Queen Ave. SW Albany, OR 97321-2198 541-967-5892 U.S. Department of Energy Ames Laboratory 311 TASF, Iowa State University Ames, Iowa 50011 515-294-2680 U.S....


2010 NIST Sigma Xi Postdoctoral Poster Presentation ...  

Science Conference Proceedings (OSTI)

... 39A(B): Elijah J. Petersen, Roger A. Pinto ... 23P(M): Wendy L. Queen and Shiou-Jyh ... Anand Ramanathan, Sergio Muniz, Kevin Wright, William Phillips ...


Newsfront 19-25 March 2007, Issue 8  

E-Print Network (OSTI)

dispatched from other countries. Indias leading lawyers F S Nariman and Soli Sorabjee led their community in the protest. Over 70 lawyers, including Queens counsels (QC), barristers, and solicitors practicing in England expressed their concern over... the attack on independence of judiciary. The signatories, among others, included Cherie Booth - QC, wife of Prime Minister Tony Blair. Buoyed by the solidarity and moral support from outside, proponents of free judiciary including citizens, media and lawyers...

Ghimire, Yubaraj


HyLights -- Tools to Prepare the Large-Scale European Demonstration...  

NLE Websites -- All DOE Office Websites (Extended Search)

(Finnmark) LH 2 LH 2 GT GT SMR SMR Chain 4b Chain 4a Chain 3b Chain 3a Chain 2b Chain 2a LNG LNG LH 2 LH 2 H 2 H 2 SMR SMR NG NG H 2 H 2 Chain 1a Chain 1b GH 2 GH 2 SMR SMR LH 2 LH...


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Carbon Initiative for Development (Ci-Dev) | Open Energy Information  

Open Energy Info (EERE)

Ci-Dev) Ci-Dev) Jump to: navigation, search Name Carbon Initiative for Development (Ci-Dev) Agency/Company /Organization World Bank Sector Climate Topics Finance, GHG inventory, Low emission development planning Website http://wbcarbonfinance.org/Rou References Carbon Initiative for Development (Ci-Dev)[1] "The World Bank is proposing a new initiative, the Carbon Initiative for Development (Ci-Dev), which aims at helping low-income countries create sustainable access to financing for low-carbon investments through carbon markets. This initiative has three components: A Readiness Fund will support carbon capacity building, knowledge development and advocacy work for improving carbon market mechanisms, asset creation, and developing innovative approaches to leveraging carbon


Challenges, uncertainties and issues facing gas production from gas hydrate deposits  

SciTech Connect

The current paper complements the Moridis et al. (2009) review of the status of the effort toward commercial gas production from hydrates. We aim to describe the concept of the gas hydrate petroleum system, to discuss advances, requirement and suggested practices in gas hydrate (GH) prospecting and GH deposit characterization, and to review the associated technical, economic and environmental challenges and uncertainties, including: the accurate assessment of producible fractions of the GH resource, the development of methodologies for identifying suitable production targets, the sampling of hydrate-bearing sediments and sample analysis, the analysis and interpretation of geophysical surveys of GH reservoirs, well testing methods and interpretation of the results, geomechanical and reservoir/well stability concerns, well design, operation and installation, field operations and extending production beyond sand-dominated GH reservoirs, monitoring production and geomechanical stability, laboratory investigations, fundamental knowledge of hydrate behavior, the economics of commercial gas production from hydrates, and the associated environmental concerns.

Moridis, G.J.; Collett, T.S.; Pooladi-Darvish, M.; Hancock, S.; Santamarina, C.; Boswell, R.; Kneafsey, T.; Rutqvist, J.; Kowalsky, M.; Reagan, M.T.; Sloan, E.D.; Sum, A.K.; Koh, C.



Time-optimal Control of Spin Systems  

E-Print Network (OSTI)

The paper discusses various aspects of time-optimal control of quantum spin systems, modelled as right-invariant systems on a compact Lie group G. The main results are the reduction of such a system to an equivalent system on a homogeneous space G/H, and the explicit determination of optimal trajectories on G/H in the case where G/H is a Riemannian symmetric space. These results are mainly obtained by using methods from Lie theory and geometric control.

Jan Swoboda



Office of Educational Programs | FaST Professor Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

Sharon Lall-Ramnarine Sharon Lall-Ramnarine Assistant Professor Queensborough Community College, CUNY Chemistry Department Contact Information: 222-05 56th Avenue Bayside, NY 11364 (718) 281-5572 slallramnarine@qcc.cuny.edu Education University of Guyana B.Sc. Chemistry 1995 Chemistry w/ minor in Biology Queens College, CUNY M.A. 1998 Chemistry The Graduate Center, City University of NY M. Phil 2003 Chemistry The Graduate Center, City University of NY Ph.D. 2003 Analytical Chemistry Positions & Employment 2004 - Present Assistant Professor of Chemistry, Queensborough Community College, CUNY 2001 - Present Research Collaborator / Guest in Chemistry, Brookhaven Nat. Lab 2/2003 - 5/2003 Adjunct Lecturer in Chemistry, Queens College, CUNY 8/2001 - 5/2002 Graduate Assistant in Chemistry, Queens College, CUNY


DOI-LM-NV-W010-2012-0061-CX | Open Energy Information  

Open Energy Info (EERE)

LM-NV-W010-2012-0061-CX LM-NV-W010-2012-0061-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-LM-NV-W010-2012-0061-CX CX at Desert Queen Geothermal Area for Geothermal/Exploration, Geothermal Temperature Gradient Well Drilling at Desert Queen General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Nevada Bureau of Mines and Geology Geothermal Area Desert Queen Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Thermal Gradient Holes Time Frame (days) Application Time 127 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM


Hydrogen Delivery Infrastructure Option Analysis  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydrogen Delivery Infrastructure Hydrogen Delivery Infrastructure Option Analysis Option Analysis DOE and FreedomCAR & Fuel Partnership Hydrogen Delivery and On-Board Storage Analysis Workshop January 25, 2005 Washington DC This presentation does not contain any proprietary or confidential information Tan-Ping Chen Nexant Jim Campbell Bhadra Grover Air Liquide Stefan Unnasch TIAX Glyn Hazelden GTI Graham Moore Chevron Matt Ringer NREL Ray Hobbs Pinnacle West 2 Presentation Outline Project Background Knowledge Collected and Preliminary Results for Each Delivery Option Summary of Observations Next Step Project Background Project Background 4 Delivery Options Option 1* GH delivery by new pipelines Option 2 Converting NG/oil pipelines for GH delivery Option 3 Blending GH into NG pipelines Option 4* GH tube trailers

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Intermittency, quasiperiodicity and chaos in probe-induced ferroelectr...  

NLE Websites -- All DOE Office Websites (Extended Search)

doubling (f) and intermittent behaviours (g,h). i, Domain merging at U sw 50 V. j, Phase diagram of switching behaviour as a function of bias and domain spacing. Shown are...


Understanding the Relationships between Lightning, Cloud Microphysics, and Airborne Radar-Derived Storm Structure during Hurricane Karl (2010)  

Science Conference Proceedings (OSTI)

This study explores relationships between lightning, cloud microphysics, and tropical cyclone (TC) storm structure in Hurricane Karl (16 September 2010) using data collected by the NASA DC-8 and Global Hawk (GH) aircraft during NASAs Genesis and ...

Brad Reinhart; Henry Fuelberg; Richard Blakeslee; Douglas Mach; Andrew Heymsfield; Aaron Bansemer; Stephen L. Durden; Simone Tanelli; Gerald Heymsfield; Bjorn Lambrigtsen


All Price Tables.vp  

Gasoline and Diesel Fuel Update (EIA)

E8. Primary Energy, Electricity, and Total Energy Expenditure Estimates, 2011 (Million Dollars) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i...


Study of Free-Fluoride Mold Powder Based on Titanium-Bearing ...  

Science Conference Proceedings (OSTI)

Sep 1, 2004 ... Study of Free-Fluoride Mold Powder Based on Titanium-Bearing Blast Furnace Slag by G.H. Wen, P. Tang, L. Zhang, Y. Liu, and S. Miao...


Taraco Archaeological Project Report on 2003 Excavations at Kala Uyuni  

E-Print Network (OSTI)

Jars..short-necked olla (e), jar (f), medium-necked ollas (g-h) Asolla forms (Fig 30e) and jars (Fig 30f) and jars (Fig 31f).



Content-Based Video Copy Detection: PRISMA at TRECVID ...  

Science Conference Proceedings (OSTI)

... ?(Gi,Gj) = w1 ?1(Gi,Gj) + w2 ?2(Gi,Gj) We defined ? as L1 (Manhattan) distance for EHD, GH and CH vectors: L1(x, y) = d ? i=0 |xi ? yi| ...



JOM: The Member Journal of TMS - JOM Monthly  

Science Conference Proceedings (OSTI)

Jan 18, 2013 ... Y.C. Feng, G.J. Cao, G.H. Fan, L.P. Wang, and L. Geng In this article, the ZnWO4 coating was prepared successfully on the surfaces of WO3...


Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis  

Science Conference Proceedings (OSTI)

Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for CFA accumulation via heterologous expression in production plants.

Yu X. H.; Shanklin J.; Rawat, R.



NVN-091276 | Open Energy Information  

Open Energy Info (EERE)

6 6 Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NVN-091276 CU at Desert Queen Geothermal Area for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CU Applicant University of Nevada Geothermal Area Desert Queen Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Water Sampling Comments Archeological Surveys, Water Sampling, Shallow Temperature Surveys Time Frame (days) Application Time 125 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM


NVN-087930 | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: NVN-087930 CU at Desert Queen Geothermal Area for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CU Applicant Magma Energy Geothermal Area Desert Queen Geothermal Area Project Location Nevada Project Phase Geothermal/Exploration Techniques Magnetotelluric Methods Comments MT Survey Time Frame (days) Application Time 7 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office Winnemucca Managing Field Office Humboldt River Funding Agencies none provided Surface Manager BLM Mineral Manager BLM Selected Dates Application Date 2009/09/09 Application Document Type NOI


Second Interview with Professor Bob Hepple - 2 May 2008  

E-Print Network (OSTI)

Leonard Sealy, B J Berwin Professor of Corporate Law, University of London 10 b. 1927. Kenneth William Wedderburn, Baron Wedderburn of Charlton, QC, Labour Party Peer 1977. 11 1922-2003. Read law at Downing College 1947, Professor of Law, University... ' Associations 1965-1968, HMSO, Cmnd 3623, 1971. 13 b. 1947, Sir Patrick Elias QC, Judge of High Court Queens Bench 1999. 14 Head, Centre for Commercial Law Studies, University of London The Squire Law Library and the Faculty of Law also attracted...

Dingle, Lesley; Bates, Daniel



Experimental investigation of the impact, spreading, and drying of picolitre droplets onto substrates with a broad range of wettabilities  

E-Print Network (OSTI)

- erated using a Microfab nozzle (Horizon Instruments) with a piezoelectric driver. The diameter of the nozzle orifice is 53m. Side-view images of drying droplets are taken using a high-speed camera (Photron APX RS) coupled to a long working distance... at the Fuel Cell Research Centre at Queens University in Kingston, ON, Canada, before joining Durham University, UK, in 2010 as a post-doctoral fellow. His interests include sustainable energy systems (thermoacoustic devices, fuel cells), the development...

Berson, A



American Black Bear: Ursus americanus  

E-Print Network (OSTI)

3/21/2011 1 USFWS American Black Bear: Ursus americanus www.bear.org LDWF Historic Distribution, forested regions (Pelton et al. 1994) Glacier Kenai Queen Charlotte Island. Kermode Dall American Black regions (Pelton et al. 1994) #12;3/21/2011 2 Historic Range Louisiana black bear Louisiana Black Bear

Gray, Matthew


Enhanced biodegradation of phenol by a microbial consortium in a solidliquid two phase partitioning bioreactor  

E-Print Network (OSTI)

partitioning bioreactor George P. Prpich & Andrew J. Daugulis* Department of Chemical Engineering, Queen consortia were isolated from three biological sources and, based on an evaluation of their kinetic facility at a chemical plant known to have a wide variety of chemical exposures, and a commercial sample

Daugulis, Andrew J.


The History of Sexuality History 464  

E-Print Network (OSTI)

full text electronic newspapers via Databases. Globe and Mail 1844 ­ excluding last 3-4 years Toronto of the database. Queen's Library subscribes to about 90,000 full text e-journals via various publishers' packages Periodicals An invaluable bibliographic reference work of major 19th century British periodicals published

Graham, Nick


Town of Hempstead: Project Energy, From Project Execution to Outreach & Education  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Execution To Outreach & Education Town of Hempstead? * Located in western Long Island,bordering Queens, NY * Established 1644 * Population: 760,000 ENERGY PARK Information Gathering * Motivated by Conservation Commissioner Ron Masters * LIPA Feasibility Study on Wind * Installed Anemometer - Wind Data * Informational Meetings: * Local Municipalities, Universities, Private Industry


Applied Mathematical Sciences, Vol. 3, 2009, no. 54, 2703 -2706 The Limit of the Statistic R/P in Models  

E-Print Network (OSTI)

to predict that the peak of oil production in the U.S.A. would occur between 1965 and 1970. Oil produc- tion for the U.S.A actually peaked in 1970. In Hubbert's analysis the profile for oil production is approximated/P in Models of Oil Discovery and Production Dudley Stark School of Mathematical Sciences Queen Mary

Stark, Dudley


University of Colorado Boulder Colorado Springs Denver Anschutz Medical Campus  

E-Print Network (OSTI)

Chi float is right. 49 #12;so Sp,.ing on the Jerry Emison, senior business student and member of Tri around Queen Jerry include Marsha J ensch, Delta Gamma; Marlene Hopkins, Ddta Gamma; ) err)' Emison Joe Tom Tom Turpin Bob Wallace Jerry Wray Douglas Young #12;Tonsilitis. BETA 68 High-class garbage

Stowell, Michael


UrbanSolutionsCenter Managing Red Imported Fire Ants in Crops and Orchards  

E-Print Network (OSTI)

-Reeve, 1997; Thorne, 1997). The benefits of pleometrotic colony founding appear to vary substantially among for some paper wasp queens cooperating in establishment of new colonies are the benefits in terms of Lichanothrips Mound were used to infer the prevalence of pleometrosis in each species. The results indicate

Behmer, Spencer T.


Keystone rodent interactions: prairie dogs and kangaroo rats structure the biotic composition of a desertified grassland  

E-Print Network (OSTI)

La Vida del Fire Ant................................11 Lesson 4: Mound, Sweet Mound duties of workers include caring for the young, maintaining or repairing the mound, protecting the colony to the ground to begin the mounds. · There are two types of fire ant colonies in Texas: monogynous (one queen

Davidson, Ana

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On the Evolution of the QE II Storm. I: Synoptic Aspects  

Science Conference Proceedings (OSTI)

The hurricane-force winds and heavy seas which battered the liner Queen Elizabeth II on 10 and 11 September 1978 were associated with an extreme example of a meteorological bomb as defined by Sanders and Gyakum. Despite the existence of surface ...

John R. Gyakum



March/April 2001 Deprived or Depredated? Egg Laying Rates in Oregon  

E-Print Network (OSTI)

Burgett, in the November/December 2000 issue of The Bee Line (Newsletter of the Oregon State Beekeepers-year life span. Yes, certainly, some queens live longer than two years, but the average life span, which really means egg-laying duration, works out to be about 24 months. About seven years ago, I had

Hammock, Bruce D.



E-Print Network (OSTI)

and Trauma staff at Queen's work to save the lives of these moped and motorcycle riders who chose not to wear, Montgomery Powersports, and UH Mnoa Parking Services WHEN: Tuesday, April 17, 2012 6:30 p.m. -7:30 p.m. Line


Science Education and the External Perspective on Science A paper presented at the 2nd International Conference on the History and Philosophy of  

E-Print Network (OSTI)

Science Education and the External Perspective on Science A paper presented at the 2nd International Conference on the History and Philosophy of Science in Science Teaching, May 11-15, 1992, Queen's University, Kingston, Ontario, Canada A revised version was published as: Cobern, W. W. (1995). Science

Cobern, William W.


110 BULLETIN O F THE UNITED STATES FIST1 COMMISSION. The cost of the utensils required for the preserration OS fish accord-  

E-Print Network (OSTI)

being S4?and of a pressure-pump SZg. The cask isvery strong, ma& of steel, and reckoned to last" antiseptic. One pump is of course sufficient for a large number of casks. If the cost of the utensils. --..----- .--.-..--__..---..__.. .-..-.- -.-- 175 25 salmon canucrics, estimated value.. .......................... 449,500 1 oil factory, Queen


Oil production models with normal rate curves Dudley Stark  

E-Print Network (OSTI)

Oil production models with normal rate curves Dudley Stark School of Mathematical Sciences Queen;Abstract The normal curve has been used to fit the rate of both world and U.S.A. oil production. In this paper we give the first theoretical basis for these curve fittings. It is well known that oil field

Stark, Dudley


One persons response to a high omega-6 diet  

Science Conference Proceedings (OSTI)

In a departure from the norm, inform presents a single-subject study from Queen of Fats author Susan Allport. In this first-person account, Allport writes about how a monthlong experiment in radically altering her diet had almost immediat


23/03/2009 13:16Bees and ants are true team players | Sindh Today Page 1 of 3http://www.sindhtoday.net/world/77976.htm  

E-Print Network (OSTI)

the queen carries and passes on their genes," he added. (ANI) Flights to Pakistan For Cheap flights To Pakistan Call Us Now 08703805040 (24/7) www.southalltravel.co.uk Over 3,000 Pakistan Rugs & Carpets Movie Free Movie India Pakistan Kashmir Info Pakistan Pakistan Chat with Meetic Chat with European

Reece, Sarah


Computer analysis of the two versions of Byzantine chess  

E-Print Network (OSTI)

In the Byzantine Empire of 11-15 CE chess was played on the circular board. Two versions were known - REGULAR and SYMMETRIC. The difference between them is easy: the white queen is placed either on light (regular) or on dark square (symmetric). However, the computer analysis reveals the results of this 'small perturbation'.

Anatole Khalfine; Ed Troyan



Annals of Nuclear Eneroy, Vol. 7. pp. 171 to 183 Pergamon Press Ltd. 1980. Printed in Great Britain  

E-Print Network (OSTI)

slab reactor in the modified one-group theory, and subsequently, the neutronresponse to twoAnnals of Nuclear Eneroy, Vol. 7. pp. 171 to 183 Pergamon Press Ltd. 1980. Printed in Great Britain I. P.~ZSIT*and G. TH. ANALYTIS~ Department of Nuclear Engineering,Queen Mary College,Mile End Road

Pázsit, Imre


Algorithmic [Bar06]. Algorithms [Mae94a, Mae96c]. Amplitude [Sko94]. Amusement [Rud95b]. Analysis  

E-Print Network (OSTI)

Version 0.06 Title word cross-reference 2 [Tro99c]. 3 [Ful96b, SB94a, SB94b]. n [Fre93a]. p [De 99]. ? [Abb05b].-adic [De 99].-Queens [Fre93a]. 1 [TiS96]. 1999 [Ker98].

Nelson H. F. Beebe



Integrating Belief Functions with Model-based Diagnosis for Fault Management  

E-Print Network (OSTI)

and William Scanlon* School of Computing and Information Engineering University of Ulster at Coleraine, BT52 1 of Electrical and Electronic Engineering Queen's University of Belfast, Belfast, BT9 5AH, UK Phone: +44-28-90274519, Fax: +44-28-667023 email: w.scanlon@ee.qub.ac.uk ABSTRACT: The simulation model of a device

Liu, Weiru


Low Complexity Power Allocation in Multiple-antenna Relay Networks  

E-Print Network (OSTI)

Dept. of Electrical and Computer Engineering Queen's University, Kingston, Ontario, K7L3N6, Canada of research and enables efficient spectrum usage by resource sharing among multiple nodes in a network. Major antenna cooperative system is studied in [3], where the upper and lower bounds for capacity indicate

Blostein, Steven D.


Newsfront 10-16 March 2008, Issue 57  

E-Print Network (OSTI)

Ph:- Shop 5011685, Factory: 5555459 Kathmandu l 10-16 March, 2008 l # 57 l Price Rs. 25 www.newsfront.com.np Bh ash wo r O jha King Gyanendra accompanied by Queen Komal driving back after offering Pooja to Pashupatinath temple on the day...

Ghimire, Yubaraj


Technical Highlights for July 2012 New Collaboration Underway to Investigate Ionic Liquids for Enhancing Engine Efficiency  

E-Print Network (OSTI)

ORNL and the Center for Applied Energy Research, which is associated with the University of Kentucky Universities (ORAU). The students came from universities across the nation and from hometowns as far away and researchers from the University of Michigan, Queen's University of Belfast, and Institute of Chemical


Turing and Non-Turing Computers: A Tale of Two Complexities  

E-Print Network (OSTI)

Turing and Non-Turing Computers: A Tale of Two Complexities Ed Blakey ed.blakey@queens.oxon.org http://users.ox.ac.uk/~quee1871/ Computing 2011 20.x.2011 Oxford University Computer Science Department #12;Computational complexity. Why? Want to quantify efficiency of computers and difficulty

Martin, Ralph R.



E-Print Network (OSTI)


Müller, Jens-Dominik



Office of Scientific and Technical Information (OSTI)

HTGR-88111 HTGR-88111 Revision 0 AUG 0 5 1991 . _ I . .....~ .. . . . . . - . . . . . . GRAPHITE DESIGN HANDBOOK AUTHORSICONTRACTORS GENERAL ATOMICS BUnON OF THIS DOCUMENT I S UNLlMmD ISSUED BY GENERAL ATOMICS FOR THE DEPARTMEW OF ENERGY CONTRACT DE-AC03-88SF17367 SEPTEMBER 1988 D 0 E- H TG R- 8 8 1 1 1 Revision 0 9 0 9 5 9 7 / 0 p b 7 ~ rJ T shall be made of c ~ c A R G D DOE Patent Coun 7 - 4 - S ( GRAPHITE DESIGN HANDBOOK DtSPRIBUflON OF THIS DOCUMENP I S UNLlMm Thle daoument is Issued By General Atomics P.O. Box 85608 San Diego, California 92138-5608 DOE CONTRACT DE-AC03-88SF17367 GA Project 6 3 0 0 SEPTEMBER 1988 RoU 2\66 GA 1 4 8 5 (REV 4/88) GENERAL ATOMICS IISCIPLINE SYSTEM 0 11 ISSUE SUMMARY DOC. TYPE PROJECT ISSUE NO./LTR. MAN 6300 DOE-HTGR-88111 0 l U A L l T Y ASSURANCE LEVEL N /A


Eh:2,' %9'j-& : : _.i  

Office of Legacy Management (LM)

Eh:2,' %9'j-& : : _.i. Eh:2,' %9'j-& : : _.i. Gn Februnrp 23, 1951 the subject test naa run redueiafi three 3-M J,$/l60-D pickled arnrSm alpha mlled rods to 3/4&D at roan tmqmatwe with a +HP (Torrington size 6) eager and two piece die. ihendons and Fmkeull hurdnem of the bare before and after reduction are taulatei on the attaohed abart, to,*hmr r&h the dim~~Icne after (ijJilT~~8txakhtti-ng at..Qntkoff3t+el Capany*, flkrdnass readlngymiw @ken on-a-hand fued flat akthe center of the bur In eaah Cal.. ;_, ". ". : - -81l the bras PRT~ h6.i f& riO* 3,492 818 paSSed .&%%~ht thou* pnd Lleuuured 3.2 !dlaHJvelml~~ The dies were rdxwsaad ad sZter the srcmd $&+a the tma appaxred, dth rou& measurslPent* to be 0.h he .other two were then gmee~ rap through, turned end the other + emaged. The



U.S. Energy Information Administration (EIA) Indexed Site


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENERGY lab ENERGY lab Methane Hydrate Federal Advisory Committee Gas Hydrate Program Activities in FY2013 Ray Boswell, DOE/NETL June 7, 2013 DOE Gas Hydrate R&D Program Spending Historical Results (through 2010) - Conducted three safe/successful Arctic/Deepwater field programs on time, on budget. - Resolved GH-drilling hazards facing GoM operations. - Identified the resource target (sands:10,000s Tcf); with international implications. - 2007 test with BP key input to USGS confirmation of technically- recoverable resources in AK: test earned industry buy-in for subsequent scientific testing in PBU. - 2009 GoM program proved GH exploration approach with field results, and further informed 2008 BOEM assessment. - Enabled the first modeling of GH response to climate change.


A Quantizable Model of Massive Gauge Vector Bosons without Higgs  

E-Print Network (OSTI)

We incorporate the parameters of the gauge group G into the gauge theory of interactions through a non-linear partial-trace sigma-model Lagrangian on G/H. The minimal coupling of the new (Goldstone-like) scalar bosons provides mass terms to those intermediate vector bosons associated with the quotient G/H, without spoiling gauge invariance, remaining the H-vector potentials massless. The main virtue of a partial trace on G/H, rather than on the entire G, is that we can find an infinite-dimensional symmetry, with non-trivial Noether invariants, which ensures quantum integrability in a non-canonical quantization scheme. The present formalism is explicitly applied to the case G=SU(2)x U(1), as a Higgs-less alternative to the Standard Model of electroweak interactions, although it can also be used in low-energy phenomenological models for strong interactions.

V. Aldaya; M. Calixto; F. F. Lopez-Ruiz



Annotation and comparative analysis of the glycoside hydrolase genes in Brachypodium distachyon  

Science Conference Proceedings (OSTI)

Background Glycoside hydrolases cleave the bond between a carbohydrate and another carbohydrate, a protein, lipid or other moiety. Genes encoding glycoside hydrolases are found in a wide range of organisms, from archea to animals, and are relatively abundant in plant genomes. In plants, these enzymes are involved in diverse processes, including starch metabolism, defense, and cell-wall remodeling. Glycoside hydrolase genes have been previously cataloged for Oryza sativa (rice), the model dicotyledonous plant Arabidopsis thaliana, and the fast-growing tree Populus trichocarpa (poplar). To improve our understanding of glycoside hydrolases in plants generally and in grasses specifically, we annotated the glycoside hydrolase genes in the grasses Brachypodium distachyon (an emerging monocotyledonous model) and Sorghum bicolor (sorghum). We then compared the glycoside hydrolases across species, both at the whole-genome level and at the level of individual glycoside hydrolase families. Results We identified 356 glycoside hydrolase genes in Brachypodium and 404 in sorghum. The corresponding proteins fell into the same 34 families that are represented in rice, Arabidopsis, and poplar, helping to define a glycoside hydrolase family profile which may be common to flowering plants. Examination of individual glycoside hydrolase familes (GH5, GH13, GH18, GH19, GH28, and GH51) revealed both similarities and distinctions between monocots and dicots, as well as between species. Shared evolutionary histories appear to be modified by lineage-specific expansions or deletions. Within families, the Brachypodium and sorghum proteins generally cluster with those from other monocots. Conclusions This work provides the foundation for further comparative and functional analyses of plant glycoside hydrolases. Defining the Brachypodium glycoside hydrolases sets the stage for Brachypodium to be a monocot model for investigations of these enzymes and their diverse roles in planta. Insights gained from Brachypodium will inform translational research studies, with applications for the improvement of cereal crops and bioenergy grasses.

Tyler, Ludmila [USDA-ARS Western Regional Research Center; Bragg, Jennifer [USDA-ARS Western Regional Research Center; Wu, Jiajie [USDA-ARS Western Regional Research Center; Yang, Xiaohan [ORNL; Tuskan, Gerald A [ORNL; Vogel, John [USDA-ARS Western Regional Research Center



Elastocapillarity: adhesion and large deformations of thin sheets  

E-Print Network (OSTI)

at the other end, with ?s(l) = 0 and ?(l) = 0. The gravitational energy is then written as G(w) = ?ghw, with ? being the density of the beam, h its thickness and g the acceleration due to gravity. In this case ?s = ?gh and ? = ?gh(s ? l). Equation (1... to gravity see Appendix 2.A.) We must minimize this combined energy subject to the constraint of an imposed end-to-end displacement ?l. Supplementing the energy (measured relative to the flat, fully adhered, state) with a Lagrange multiplier to enforce...

Wagner, Till Jakob Wenzel



Herwig++ 2.0 Release Note.  

E-Print Network (OSTI)

: The transverse momentum of the Z0 boson at the Tevatron calculated by HERWIG6.5 and Herwig++ compared with run I CDF data taken from [7] with and without matrix element corrections. Photon plus jet production, i.e. qq ? ?g, qg ? ?q; Higgs boson production, i... .e. qq/gg ? h0; Higgs boson plus jet production, i.e. gg ? gh0, qg ? qh0 and qq ? gh0; Heavy quark pair production, i.e. qq/gg ? QQ; QCD 2 ? 2 scattering processes, i.e. gg ? gg, gg ? qq, qq ? gg, qg ? qg, qq ? qq, qq ? qq; in addition the W...

Gieseke, Stefan; Grellscheid, D; Hamilton, K; Ribon, Alberto; Richardson, P; Seymour, Michael H; Stephens, Phil; Webber, Bryan R


Free-wheeling hydraulic power mills  

DOE Green Energy (OSTI)

Free-wheeling power plants using free replenishable hydraulic forces of winds and water currents would consist of most or all of the following: fore and after cones to increase throughput; duplex impellers; rotors with dc/ac excitation, ac/dc inverters and dc field coils; stators with ac output of varying frequency, voltage and power; solid-state ac/dc inverters, dc electrolytic cell banks for GH/sub 2/ and GO/sub 2/ production; and neon refrigerators for reducing these to LOX and chilled GH/sub 2/ for ease in shipment or storage.

Hall, F.F.



Y-12 and ORNL Production Workers Needs Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and Oak Ridge National Laboratory and Oak Ridge National Laboratory Medical Surveillance Program Phase I: Needs Assessment Queens College, City University of New York Atomic Trades & Labor Council PACE International Union Creative Pollution Solutions, Inc. February 12, 2004 Work performed under DOE Contract No. DE-FCO3-96SF21260 1-12 and Oak Ridge National Laboratory Medical Surveillance Program Phase I: Needs Assessment Steven Markowitz, MD Queens College, City University of New York Carl Scarbrough Atomic Trades & Labor Council Sylvia Kieding PACE International Union Mark Griffon, MS Creative Pollution Solutions, Inc. TABLE OF CONTENTS Page Number Executive Summary Part I: OVERVIEW Section I. Introduction 1 Section II. Methods 3 Section ifi. Principal Findings 6 Section IV. Need for Medical Surveillance and Risk Communication


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in


WindPower Innovations Inc | Open Energy Information  

Open Energy Info (EERE)

WindPower Innovations Inc WindPower Innovations Inc Jump to: navigation, search Name WindPower Innovations Inc Place Queen Creek, Arizona Zip 85142 Sector Wind energy Product Arizona-based company focused on refurbishment and repair of wind turbine gearboxes. References WindPower Innovations Inc[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. WindPower Innovations Inc is a company located in Queen Creek, Arizona . References ↑ "WindPower Innovations Inc" Retrieved from "http://en.openei.org/w/index.php?title=WindPower_Innovations_Inc&oldid=353107" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version


Deputy Secretary Commends EM's Achievement Award Winners | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Deputy Secretary Commends EM's Achievement Award Winners Deputy Secretary Commends EM's Achievement Award Winners Deputy Secretary Commends EM's Achievement Award Winners June 7, 2013 - 12:00pm Addthis Deputy Secretary Daniel Poneman, center, presents the Secretary's Achievement Award to Oak Ridge Project Manager David Queen and Oak Ridge EM Deputy Manager Sue Cange for their work in Oak Ridge's K-33 Gaseous Diffusion Process Building Project. Deputy Secretary Daniel Poneman, center, presents the Secretary's Achievement Award to Oak Ridge Project Manager David Queen and Oak Ridge EM Deputy Manager Sue Cange for their work in Oak Ridge's K-33 Gaseous Diffusion Process Building Project. Deputy Secretary Daniel Poneman, right, presents the Secretary's Achievement Award to Richard Craun, representing the Idaho Operations Office.


Refueling Infrastructure for Alternative Fuel Vehicles: Lessons Learned for Hydrogen; Workshop Proceedings  

NLE Websites -- All DOE Office Websites (Extended Search)

Refueling Infrastructure for Refueling Infrastructure for Alternative Fuel Vehicles: Lessons Learned for Hydrogen Workshop Proceedings M.W. Melaina National Renewable Energy Laboratory S. McQueen and J. Brinch Energetics Incorporated Sacramento, California April 3, 2008 Proceedings NREL/BK-560-43669 July 2008 NREL is operated by Midwest Research Institute ● Battelle Contract No. DE-AC36-99-GO10337 Refueling Infrastructure for Alternative Fuel Vehicles: Lessons Learned for Hydrogen Workshop Proceedings M.W. Melaina National Renewable Energy Laboratory S. McQueen and J. Brinch Energetics Incorporated Sacramento, California April 3, 2008 Prepared under Task No. H278.2350 Proceedings NREL/BK-560-43669 July 2008 National Renewable Energy Laboratory 1617 Cole Boulevard, Golden, Colorado 80401-3393


NETL-Showcase July 9, 2013D.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL CO NETL CO 2 Capture Technology Meeting Pittsburgh, PA July 9, 2013 David J. Heldebrant CO 2 -Binding Organic Liquids, Enhanced CO 2 Capture Process With a Polarity-Swing-Assisted Regeneration Submitted by: Battelle Pacific Northwest Division Fluor Corporation Queen's University (Kingston) Submitted to: U.S. Department of Energy Office of Fossil Energy National Energy Technology Laboratory For Solicitation: Funding Opportunity Announcement: DE-FOA-0000403,


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACT CONTACT Cathy Summers Director, Process Development Division National Energy Technology Laboratory 1450 Queen Ave., SW Albany, OR 97321-2198 541-967-5844 cathy.summers@netl.doe.gov An Integrated Approach To Materials Development Traditional trial-and-error method in materials development is time consuming and costly. In order to speed up materials discovery for a variety of energy applications, an integrated approach for multi-scale materials simulations and materials design has


Annual Report 2009-2010  

E-Print Network (OSTI)

which make for a much more attractive and welcoming environment, especially on dark evenings. The scheme was devised by local sculptor, Harry Gray and a public unveiling was held in September 2009. In November Her Majesty The Queen sealed eight boxes... known as SMS Precis, produced by the School of Military Survey and covering such subjects as map compilation, field astronomy, lithographic processes and the use of oblique air photographs. Music ? Personal archive of musician, broadcaster...

Cambridge University Library




E-Print Network (OSTI)

and Education (ORISE) has prepared and enclosed the final survey plan for planned survey activities at the St. Albans Veterans Administration Extended Care Facility in Queens, New York. The survey is tentatively scheduled for February 26 through 27, 2001. Attachment A provides the spending plan for the proposed activities. If you have any questions, please direct them to me at (865) 576-0065 or Tim Vitkus at (865) 576-5073. Sincerely,

Or I S Ie; Region I; Wade C. Adams; R. Clement; W. Beck Orise/essap; E. Abelquist Orise/essap; T. Vitkus Orise/essap; D. Condra Orise/essap



May Day  

NLE Websites -- All DOE Office Websites (Extended Search)

May Day May Day Nature Bulletin No. 715 April 27, 1963 Forest Preserve District of Cook County Seymour Simon, President Roberts Mann, Conservation Editor MAY DAY You must wake and call me early, call me early, mother dear; For I'm to be Queen o' the May, mother, I'm to be Queen o' the May. (Tennyson. Sixty years and more ago, May Day was an occasion for festivities and fun in many country towns. At daybreak on the first day of the fifth month we youngsters went "a-maying". We brought back freshly picked wildflowers and put them in little baskets which we hung on the front door knobs of our favorite people. If you were secretly sweet on some winsome lass she got a special basket, maybe with a bow of ribbons on the handle. In those days wildflowers were abundant and we did not know that it is wrong to pick them -- that because of such picking, year after year, most of them would gradually disappear. There was also a Queen of the May, one of the loveliest girls in town; and a Maypole, twined with ribbons and with ropes of flowers, around which we danced and sang at the ends of colored streamers from its top.


Workplace Violence Prevention Employee Awareness Class | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Workplace Violence Prevention Employee Awareness Class Workplace Violence Prevention Employee Awareness Class Workplace Violence Prevention Employee Awareness Class November 22, 2013 9:30AM to 1:00PM EST Course Title: Workplace Violence Prevention Employee Awareness Classes Course Start/End Date: November 5 -22, 2013 (see list of course sessions below) Forrestal Location (each class is 2.5 Hrs) Friday, November 8 1E-245 9:30 am Tuesday, November 12 6A-092 10:30 am Tuesday, November 12 6E-069 1:30 pm Thursday, November 14 GH-019 9:00 am Thursday, November 14 GH-019 1:00 pm Tuesday, November 19 GH-035 10:30 am Tuesday, November 19 GH-035 2:00 pm Wednesday, November 20 1E-245 9:00 am Wednesday, November 20 1E-245 1:00 am Friday, November 22 1E-245 9:00am Germantown Location (each class is 2.5 Hrs) Thursday, November 7 Large Auditorium 9:00 am



NLE Websites -- All DOE Office Websites (Extended Search)

CONTENTS CONTENTS Japan's R&D Program ..................1 Hydrate in Nature..........................7 HYFLUX Expedition ......................12 Sub Sampling for GH ................ 16 Gas Production Geomechanical Implications ................................. 18 Announcements ...................... 23 * Database Now Available * Global Assessment * NETL-NAS Fellowship * New Zealand Workshop * EGU 2010 Abstracts


Benefits and Costs of Hydrogen Fuels  

E-Print Network (OSTI)

Processor Herbaceous Biomass Woody Biomass Petroleum Natural Gas Flared Gas Natural Gas #12;Production/Compression Pathways Gaseous H2 Liquid H2 Centralized Decentralized Electricity Methanol Flared Gas Landfill Gas Are Key Steps for Gaseous H2 NA NG Recovery (97.5%) Compressed G.H2 at Refueling Stations LNG Gasification

Argonne National Laboratory


Well-to-Wheels Energy and Emission Impacts of Vehicle/Fuel Systems  

E-Print Network (OSTI)

Biodiesel Corn Cellulosic Biomass Soybean Various Sources Electricity Flared Gas Landfill Gas Crude Naphtha Petroleum Conv. & Reform. Gasoline Conv. & Reform. Diesel Liquefied Petroleum Gas Compressed Natural Gas vs. MTBE #12;Production and Compression Are Key Steps for Centralized G.H2 Pathways NA NG Recovery

Argonne National Laboratory

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ANL/ESD/TM-163 Development and Use of GREET 1.6  

E-Print Network (OSTI)

-fuel vehicle FG flared gas FRFG federal reformulated gasoline FT Fischer-Tropsch FTD Fischer-Tropsch diesel GC Soybeans Various Sources Electricity Flared Gas Landfill Gas Crude Naphtha Liquefied Petroleum Gas and from NNA flared gas (FG). In the latter two cases, for production of CNG, G.H2, and station-produced L

Argonne National Laboratory


Experimental Lung Research, 27:121 141, 2001 Copyright 2001 Taylor & Francis  

E-Print Network (OSTI)

Zhang Department of An atomy and Cell Biology, The University of Iowa, School of Medicine, Iowa City, The University of Iowa, School of Medicine, Iowa City, Iowa, USA Althou gh lymphoid enhancer binding factor-1 is not an adequate signal for initiating gland morphogenesis. Because Lef-1 forms a bipartite transcription factor

Engelhardt, John F.


Well-to-Wheels Energy Use, Greenhouse Gas Emissions, and Criteria Pollutant Emissions  

E-Print Network (OSTI)

for a given facility were divided by its throughput to develop emissions factors Distribution curves were and Storage (99%) Transportation, Storage, and Distribution of Gasoline (99.5%) MTBE or EtOH for Gasoline.5%) Steam or Electricity Export NA: North American nNA: non-North American NG: natural gas G.H2 Compression

Argonne National Laboratory



E-Print Network (OSTI)

3&F>7$7$Fahw$\\"1CxC=9Xy]F>Fjiw7$Fafw7$$\\"15d%fgN,* RF1$\\"1IQ4=yLLoF> 7$7$Fahw$\\"1'HSZRTN%oF>Fdjw7$7$F\\\\ewF\\\\gw7$$\\"1%e'Gh! =...



E-Print Network (OSTI)

of greenhouse gases CO2, CH4, and N2O VOC, CO, and NOx as optional GHGs GREET estimates emissions of five/Compression Are Key Steps for Gaseous H2 NA NG Recovery (97.5%) Compressed G.H2 at Refueling Stations LNG Gasification Critical for Evaluating Costs Define Pathways Estimate Fuel Demand Estimate Size of Facilities Capital


Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community  

Science Conference Proceedings (OSTI)

Development of cellulosic biofuels from non-food crops is currently an area of intense research interest. Tailoring depolymerizing enzymes to particular feedstocks and pretreatment conditions is one promising avenue of research in this area. Here we added a green-waste compost inoculum to switchgrass (Panicum virgatum) and simulated thermophilic composting in a bioreactor to select for a switchgrass-adapted community and to facilitate targeted discovery of glycoside hydrolases. Smallsubunit (SSU) rRNA-based community profiles revealed that the microbial community changed dramatically between the initial and switchgrass-adapted compost (SAC) with some bacterial populations being enriched over 20-fold. We obtained 225 Mbp of 454-titanium pyrosequence data from the SAC community and conservatively identified 800 genes encoding glycoside hydrolase domains that were biased toward depolymerizing grass cell wall components. Of these, ,10percent were putative cellulasesmostly belonging to families GH5 and GH9. We synthesized two SAC GH9 genes with codon optimization for heterologous expression in Escherichia coli and observed activity for one on carboxymethyl cellulose. The active GH9 enzyme has a temperature optimum of 50uC and pH range of 5.5 to 8 consistent with the composting conditions applied. We demonstrate that microbial communities adapt to switchgrass decomposition using simulated composting condition and that full-length genes can be identified from complex metagenomic sequence data, synthesized and expressed resulting in active enzyme.

Reddy, Amitha; Allgaier, Martin; Park, Joshua I.; Ivanoval, Natalia; Dhaeseleer, Patrik; Lowry, Steve; Sapra, Rajat; Hazen, Terry C.; Simmons, Blake A.; VanderGheynst, Jean S.; Hugenholtz, Philip



The Position of Dalit Women in Caste System  

E-Print Network (OSTI)

~12053), Year 6, Issue 12. Kathmandu: JanaUthan Academy. Kamata Hemchuri (Ed.). Jijibisha, Quarterly (2056), Year 3, Issue 4. . Kathmandu: Ocr/it Sewa Sal1gh. LUltel, S. (1992). Women in Developmenl. Kathmandu: B.P. Luitel. Lllltel, S'. el. al (1997). Social...

Luintel, Samira



Difference from Median in T11U per Topic Difference from ...  

Science Conference Proceedings (OSTI)

... &'(( )01&2)2342354 6'7 89@ )ABCCD E&p &'E2)4F E)25G 6H4I'05H4'4HP@ I2GH0Q 6RS TA23(3U HP VI0 QCCp QIA3521AH@ W44H44I0 ...



Exploring the hidden impacts of HomeSys: energy and emissions of home sensing and automation  

Science Conference Proceedings (OSTI)

Home sensing and automation systems are rarely discussed with reference to their direct energy demand, much less other environmental impacts such as greenhouse gas (GhG) emissions arising from their manufacture and transport. It is imperative that designers ... Keywords: embodied carbon, home energy, home systems

Oliver Bates, Mike Hazas



Methods of using thermal tolerant avicelase from Acidothermus cellulolyticus  

DOE Patents (OSTI)

The invention provides a thermal tolerant (thermostable) cellulase, AviIII, that is a member of the glycoside hydrolase (GH) family. AviIII was isolated and characterized from Acidothermus cellulolyticus, and, like many cellulases, the disclosed polypeptide and/or its derivatives may be useful for the conversion of biomass into biofuels and chemicals.

Adney, William S. (Golden, CO); Vinzant, Todd B. (Golden, CO); Ding, Shih-You (Golden, CO); Himmel, Michael E. (Golden, CO)



Thermal tolerant avicelase from Acidothermus cellulolyticus  

DOE Patents (OSTI)

The invention provides a thermal tolerant (thermostable) cellulase, AviIII, that is a member of the glycoside hydrolase (GH) family. AviIII was isolated and characterized from Acidothermus cellulolyticus and, like many cellulases, the disclosed polypeptide and/or its derivatives may be useful for the conversion of biomass into biofuels and chemicals.

Ding, Shi-You (Golden, CO); Adney, William S. (Golden, CO); Vinzant, Todd B. (Golden, CO); Himmel, Michael E. (Littleton, CO)



Thermal tolerant avicelase from Acidothermus cellulolyticus  

DOE Patents (OSTI)

The invention provides a thermal tolerant (thermostable) cellulase, AviIII, that is a member of the glycoside hydrolase (GH) family. AviIII was isolated and characterized from Acidothermus cellulolyticus and, like many cellulases, the disclosed polypeptide and/or its derivatives may be useful for the conversion of biomass into biofuels and chemicals.

Ding, Shi-You (Golden, CO); Adney, William S. (Golden, CO); Vinzant, Todd B. (Golden, CO); Himmel, Michael E. (Littleton, CO)



User Guide for the GREET Fleet Footprint Calculator 1.0 Beginning in 1998, the Department of Energy's (DOE's) Clean Cities Program enlisted expertise  

E-Print Network (OSTI)

Gas (LNG) Landfill Gas (LFG) Liquifed Petroleum Gas/ Propane (LPG) Electricity Gaseous Hydrogen (G.H2 in accordance with the desire to measure the petroleum displacement and greenhouse gas (GHG) emissions of medium represents the vehicle's operation activities. It is important to examine transportation fuels

Argonne National Laboratory



E-Print Network (OSTI)

LITTLEWOOD-TYPE PROBLEMS ON [0,1]. PEtER BoRwEin, TAm bAs eRD bElyi , AnD u bExA ? bos. ?R????? ' ??????d?f gh ???d kl mopRC ?s C?h?f?t.


Section 1: Interfacial Turbulence and AirWater Scalar Transfer Turbulence and wave dynamics across gasliquid interfaces 1  

E-Print Network (OSTI)

The calculation of the gas transfer between the ocean and atmosphere13 S.A. Kitaigorodskii The influence of wind relationship to airwater gas transfer rates51 D. Turney, S. Banerjee Turbulent gas flux measurements near the airwater interface in an oscillating-grid tank 65 J.G. Janzen, H.E. Schulz, G.H. Jirka Sensible and latent

Takada, Shoji


Abyssal Channel Flow in Ocean General Circulation Models with Application to the Vema Channel  

Science Conference Proceedings (OSTI)

An idealized Cox model is shown to pass a flux given by g?H2/2f though a deep channel, single grid-box wide, consistent with analytical models. This flux can, however, be significantly increased or decreased by the presence of density gradients ...

Martin R. Wadley; Grant R. Bigg



Presentation to the Control Systems Security Outreach Coordination Meeting  

E-Print Network (OSTI)

23% Oil/Gas 18% Nuclear 17% Chemical 6% Water 6% Manufacturing 2% Transportation/Shipping 2% Natural Switzerland (.ch) 11 Ghana (.gh) 12 Pakistan (.pk) Rank Who? 1 Various ISPs 2 British-energy.com 3 Shell.com 4


Ovine placental lactogen binds specifically to endometrial glands of the ovine uterus  

E-Print Network (OSTI)

A hormonal servomechanism has been proposed to regulate differentiation and function of the endometrial glandular epithelium (GE) in the ovine uterus during pregnancy that involves sequential actions of estrogen, progesterone, ovine interferon tau (IFN[T]), placental lactogen (oPL), and placental growth hormone (oGH). The biological actions of oPL in vitro are mediated by homodimerization of the PRL receptor (oPRLR) as well as heterodimerization of the oPRLR and oGH receptor (oGHR). The objectives of this study were to: (1) determine effects of intrauterine oPL, oGH and their combination on endometrial histoarchitecture and gene expression; (2) localize and characterize binding sites for oPL in the ovine uterus in vivo using an in situ ligand binding assay; and (3) determine temporal and spatial alterations in STAT 1, 3 and 5 expression in the pregnant ovine uterus. Intrauterine infusion of oPL and/or oGH following IFN[T] into ovariectomized ewes treated daily with progesterone differentially affected endometrial gland number and expression of uterine milk proteins and osteopontin. However, neither hormone affected PRLR, IGF-I or IGF-II mRNA levels in the endometrium. A chimeric protein of placental secretory alkaline phosphatase (SEAP) and oPL (SEAP-oPL) was used to identify and characterize binding sites for oPL in frozen sections of interplacentomal endometrium from pregnant ewes. Specific binding of SEAP-oPL was detected in the endometrial GE on Days 30, 60, 90, and 120 of pregnancy. In Day 90 endometrium, SEAP-oPL binding to the endometrial GE was displaced completely by oPL and oPRL, but only partially by oGH. Binding experiments using the extracellular domain of the oPRLR also showed that iodinated oPL binding could be competed by oPRL and oPL, but not by oGH. Collectively, results indicate that oPL binds to receptors in the endometrial glands and that PRL is more effective than GH for competing these binding sites. Thus, effects of oPL on the endometrial glands may be mediated by both PRLR and GHR.

Noel, Sekoni Daouda



Hydrogen Delivery Options and Issues  

NLE Websites -- All DOE Office Websites (Extended Search)

Options and Issues Options and Issues Mark Paster DOE August, 2006 Scope * From the end point of central or distributed production (300 psi H2) to and including the dispenser at a refueling station or stationary power site - GH2 Pipelines and Trucks, LH2 Trucks, Carriers <$1.00/kg of Hydrogen by 2017 Hydrogen Delivery H2 Delivery Current Status * Technology - GH2 Tube Trailers: ~340 kg, ~2600 psi - LH2 Trucks: ~3900 kg - Pipelines: up to 1500 psi (~630 miles in the U.S.) - Refueling Site Operations (compression, storage dispensing): Demonstration projects * Cost (Does NOT include refueling Site Operations) - Trucks: $4-$12/kg - Pipeline: <$2/kg H2A Analysis * Consistent, comparable, transparent approach to hydrogen production and delivery cost analysis * Excel spreadsheet tools with common economic


Workplace Violence Prevention: Employee Awareness Class | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Workplace Violence Prevention: Employee Awareness Class Workplace Violence Prevention: Employee Awareness Class Workplace Violence Prevention: Employee Awareness Class December 13, 2013 9:00AM to 3:30PM EST Registration: Federal employees should sign up directly in CHRIS ("NTC Workplace Violence" Course #002647) for one of the sessions below. Approved contractor employees should email Steven Martinez with name, organization and requested session. Walk-ins are welcome on a space available basis. Forrestal Location: Course #002647 (each class is 2.5 Hrs) #0024 Friday, December 13, GH-027 9:00-11:30 am #0025 Friday, December 13, GH-027 1:00-3:30 pm Germantown Location: Course #002647 (each class is 2.5 Hrs) #0026 Tuesday, December 10, E-114 9:00-11:30 am #0027 Tuesday, December 10, E-114 1:00-3:30 pm

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

These courses have immediate open registraton These courses have immediate open registraton PLEASE LOOK FOR US AT http://energy.gov/dvu/professional-skills-and-technical-training OFFICE OF LEARNING & WORKFORCE DEVELOPMENT Professional Skills & Technical Training Program FY 2014 Corporate Schedule Points of Contact: If you have any logistical/registration questions please contact: Shira Kimble at 202-586-8449 or 301-903-5116. Course Title: Course Date: Time: CHRIS Code: Session: Location: Trustworthy Customer Services NEW January 15-16, 2014 8:30am-4:00pm 002452 0001 Forrestal RM GH- 043 CSRS Retirement Seminar January 28-30, 2014 8:30am-4:00pm 000033 0091 Forrestal RM GH- 043 Managing Up Down & Across February 11-12, 2014


Gain-assisted control of the Goos-Haenchen shift  

SciTech Connect

A gain-assisted model is considered to study the Goos-Haenchen (GH) shift behavior in the reflected and transmitted light. In this model, a probe light is incident on a cavity containing three-level dilute gaseous atomic medium. The atom-field interaction follows two-photon Raman transitions, and the dielectric susceptibility of the medium exhibits dispersion and gain properties [L. J. Wang, A. Kuzmich, and A. Dogariu, Nature (London) 406, 227 (2000)]. Under appropriate conditions, two gain peaks are observed with anomalous dispersion between the peaks, whereas normal dispersion can be observed at and around the gain maxima. The manipulation of the detuning associated with the probe light field which interacts with the intracavity medium during its propagation through the cavity can lead to a control over negative and positive GH shift in the reflected and transmitted light beam via the anomalous and normal dispersion of the medium.

Ziauddin,; Qamar, Sajid [Centre for Quantum Physics, COMSATS Institute of Information Technology, Islamabad (Pakistan); Department of Physics, COMSATS Institute of Information Technology, Islamabad (Pakistan)




Gasoline and Diesel Fuel Update (EIA)

8) 8) June 2010 State Energy Price and Expenditure Estimates 1970 Through 2008 2008 Price and Expenditure Summary Tables Table S1a. Energy Price Estimates by Source, 2008 (Dollars per Million Btu) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i Coal Natural Gas a Petroleum Nuclear Fuel Biomass Total g,h,i Distillate Fuel Oil Jet Fuel b LPG c Motor Gasoline d Residual Fuel Oil Other e Total Wood and


A multiple filter test for change point detection in renewal processes with varying variance  

E-Print Network (OSTI)

, the algorithm successively searches for extreme values of the filtered derivative, similar to the techniques of in the interval (a, b] (0, T]. For each point t h we compare the number of events Nle := N(t-h,t]() and Nri := N(t,t+h]() in the left and right window (Figure 4 A). 0 h t-h t t+h T - h T h ( ] Nle ( ] Nri A T = 700 h = 75 -2 0 Gh

Neininger, Ralph


Nonlinear Grassmann Sigma Models in Any Dimension and An Infinite Number of Conserved Currents  

E-Print Network (OSTI)

We first consider nonlinear Grassmann sigma models in any dimension and next construct their submodels. For these models we construct an infinite number of nontrivial conserved currents. Our result is independent of time-space dimensions and, therfore, is a full generalization of that of authors (Alvarez, Ferreira and Guillen). Our result also suggests that our method may be applied to other nonlinear sigma models such as chiral models, $G/H$ sigma models in any dimension.

Kazuyuki Fujii; Yasushi Homma; Tatsuo Suzuki



Fourth DOE Natural Phenomena Hazards Mitigation Conference: Proceedings. Volume 1  

SciTech Connect

This conference allowed an interchange in the natural phenomena area among designers, safety professionals, and managers. The papers presented in Volume I of the proceedings are from sessions I - VIII which cover the general topics of: DOE standards, lessons learned and walkdowns, wind, waste tanks, ground motion, testing and materials, probabilistic seismic hazards, risk assessment, base isolation and energy dissipation, and lifelines and floods. Individual papers are indexed separately. (GH)

Not Available



TransporTaTionresearch Group newsletter reporT 2010  

E-Print Network (OSTI)

for the future. The Transportation Research Group participated in the Transportation Research Board ConferenceTliGhT on TransiT research 6 selecTed publicaTions by The 7 miTsl research Group TransporTaTion research board 9 TransporTaTion sTudenT 13 inTernships sTudenT profiles 14 recenT alumni 14 special noTes 14 Transportation

Fernandez, Eduardo


The conformal group, point particles and twistors  

Science Conference Proceedings (OSTI)

The massless particle action is interpreted as mechanics with a vanishing Hamiltonian on a phase space which is a coset space of the form G/H, where G is the conformal group and H is a certain subgroup. In dimensions 3, 4 and 6, twistor variables emerge naturally. In these same dimensions, the formalism cam be extended straightforwardly to superparticles. In this paper the [kappa] symmetry of the superparticle is interpreted as a part of the H gauge invariance of the action.

Howe, P.S.; West, P.C. (King's Coll., London (United Kingdom). Dept. of Mathematics)



230 JOURNAL OF DISPLAY TECHNOLOGY, VOL. 1, NO. 2, DECEMBER 2005 Reflective Direct-View Displays Using a Dye-Doped  

E-Print Network (OSTI)

such as Cole-Kashnow cell [3], White-Taylor cell [4] or double orthogonal cells [5]­[7] have been proposed are added and a 10:1 contrast ratio is demonstrated using a PDLC in a twisted cell [10]. The response time viewing angle. In this paper, we demonstrate a new GH LCD using a dye-doped DFLC gel to realize polarizer

Wu, Shin-Tson


Effects of zeranol on serum concentrations of growth hormone, IGF-I and metabolites and on carcass composition of lambs fed at two levels of intake  

E-Print Network (OSTI)

Forty crossbred wether lambs (average initial weight = 30 kg) were used to determine the effects of zeranol on carcass composition and metabolite concentrations in blood when fed at two levels of feeding: Lambs were implanted with zeranol (12 mg) at 30-d intervals and fed at two levels of feed intake (restricted and ad libitum) in a 2 x 2 factorial arrangement of treatments. Restricted fed lambs were fed to gain 50% of body weight gained by lambs allowed ad libitum access to feed. Lambs with ad libitum and restricted access to feed were slaughtered after 98 and 154 d, respectively. Zeranol increased average daily gains (ADG) and gain to feed by 20 (P <.05) and 17% (P < .03), respectively. Carcass fat percentage tended to be reduced by 7.4% in implanted lambs, however, there was no difference in daily fat gain (g/d) in implanted vs non implanted lambs. Yet zeranol increased carcass protein by 33%(P<.10). Restricted feeding reduced (P <.05) daily fat gain (40%) and CP gain (32%) but increased (P < .06) feed to gain (45%), percentage carcass ash (12%), and dressing percentage (9%). Zeranol increased pituitary weight (P <.001), plasma glucose (P <.05), mean serum growth hormone (GH; P < .05), baseline GH (P < .05), GH pulse amplitude (P < .05), and insulin-like growth factor-I (IGF-1; P < .00 1) levels by 40%, 13 %, 42%, 7 1 %, 33%, and 53%, respectively. Restricted feeding reduced(P<.10)serum IGF-I by 16%. These results indicate that continuous administration of zeranol alters the GH-IGF-I axis regulation of growth and carcass composition in lambs.

Scott, Patricia Lynn




NLE Websites -- All DOE Office Websites (Extended Search)

National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321 541-967-5892 2175 University Avenue South Suite 201 Fairbanks, AK 99709 907-452-2559 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4764 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-4687 One West Third Street, Suite 1400 Tulsa, OK 74103-3519 918-699-2000 Visit the NETL website at:


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R R &D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


Former Worker Medical Screening Program Summary of Services Available to Former Workers, February 1, 2013  

NLE Websites -- All DOE Office Websites (Extended Search)

February 1, 2013 Former Worker Medical Screening Program Summary of Services Available to Former Workers (Sites listed below are primary sites served, but multiple small sites are also served by the Building Trades National Medical Screening Program for construction workers and by the National Supplemental Screening Program for production workers) State DOE Site Worker Population/Medical Screening Program Provider Local Office Location and Phone Number Alaska Amchitka Island All workers, primarily construction CPWR - The Center for Construction Research & Training (CPWR)/Building Trades National Medical Screening Program (BTMed) 1-800-866-9663 California Lawrence Berkeley National Laboratory All workers Queens College (QC)/Worker Health Protection


Browse by Discipline -- E-print Network Subject Pathways: Environmental  

Office of Scientific and Technical Information (OSTI)

S S T U V W X Y Z Rahmeyer, William J. (William J. Rahmeyer) - Utah Water Research Laboratory & Department of Civil and Environmental Engineering, Utah State University Ramsay, Juliana (Juliana Ramsay) - Department of Chemical Engineering, Queen's University (Kingston) Reysenbach, Anna-Louise (Anna-Louise Reysenbach) - Department of Biology, Portland State University Ritchie, Ewen (Ewen Ritchie) - Department of Energy Technology, Aalborg University Rood, Stewart (Stewart Rood) - Department of Biological Sciences, University of Lethbridge Rosendahl, Lasse (Lasse Rosendahl) - Department of Energy Technology, Aalborg University Röder, Beate (Beate Röder) - Institut für Physik, Humboldt-Universität zu Berlin Go back to Individual Researchers Collections:


Senenmut: An Ancient Egyptian Astronomer  

E-Print Network (OSTI)

The celestial phenomenon have always been a source of wonder and interest to people, even as long ago as the ancient Egyptians. While the ancient Egyptians did not know all the things about astronomy that we do now, they had a good understanding of the some celestial phenomenon. The achievements in astronomy of ancient Egyptians are relatively well known, but we know very little about the people who made these achievements. The goal of this paper is to bring some light on the life of Senenmut, the chief architect and astronomer during the reign of Queen Hatshepsut.

Bojan Novakovic



Nepali Aawaz Volume 1, Issue 12, 24 March 2006  

E-Print Network (OSTI)

restaurant often serve Nepali (including Tibetan) and Indian food, the Yamakaze: Japanese Sushi and Noodles Bar in Sunnyside, Queens, must be the first such restaurant to be run and operated by Nepalis here in the US. For a change, there is nothing... about the Yamakaze, not its woody Japanese styled decor or the world music playing in the speakers, that shouts Nepali to you, unlike most other restaurants run by Nepalis in New York. The small carved wood peacock window on the wall is perhaps...

Shrestha, Kashish Das


Fourth Interview with Sir Eli Lauterpacht - 20 March 2008  

E-Print Network (OSTI)

://www.mefacts.com/cached.asp?x_id=11028 #2; See item 29, interview 2. #2; See item 29, interview 2. #2; 1915-2002. Born Aubrey Solomon Meir, Cape Town. Israeli diplomat and politician. Queens College Cambridge. #2; b. 1937, Leeds. UN Assistant Secretary General for Legal Affairs... , Leeds. UN Assistant Secretary General for Legal Affairs 1998-2005 See: http://www.lcil.cam.ac.uk/lectures/2007-08_ralph_zacklin.php 13 See: http://www.20essexst.com/bar/%20j_wood_m/wood_m.htm 14 Taba Tribunal (Egypt/Israel, 1986-1989): G...

Dingle, Lesley; Bates, Daniel



Former Worker Medical Screening Program Summary of Services Available to Former Workers, February 1, 2013  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 1, 2013 Former Worker Medical Screening Program Summary of Services Available to Former Workers (Sites listed below are primary sites served, but multiple small sites are also served by the Building Trades National Medical Screening Program for construction workers and by the National Supplemental Screening Program for production workers) State DOE Site Worker Population/Medical Screening Program Provider Local Office Location and Phone Number Alaska Amchitka Island All workers, primarily construction CPWR - The Center for Construction Research & Training (CPWR)/Building Trades National Medical Screening Program (BTMed) 1-800-866-9663 California Lawrence Berkeley National Laboratory All workers Queens College (QC)/Worker Health Protection


Waste Isolation Pilot Plant Medical Screening Program, Phase I: Needs Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Waste Isolation Pilot Plant Waste Isolation Pilot Plant Medical Screening Program Phase I: Needs Assessment Presented to the Office of Worker Screening and Compensation Support, Office of Health, Safety, and Security U.S. Department of Energy Prepared by Queens College, City University of New York United Steelworkers Original Draft: August 22, 2011 Updated Version: May 1, 2012 Table of Contents Summary.............................................................................3 I. Background on the Former Worker Program................................4 II. History of the WIPP Facility......................................................4 III. Scope of this Report.................................................................7 IV. Exposure Characterization........................................................8


TRUPACT-II Hydrogen G-Valve Program Test Plan  

DOE Green Energy (OSTI)

This test plan describes the objectives, scope, participants, and components of the Transuranic Package Transporter-II (TRUPACT-II) Hydrogen G-Value Program (GH2P). The GH2P builds on the experience, results, and experimental setup of the TRUPACT-II Matrix Depletion Program (MDP) to establish effective hydrogen G-values (G-values) for additional waste matrices. This plan details the experimental design and test matrices for experiments to measure the G-value for additional waste matrices, including first- and second-stage sludges at the Idaho National Engineering and Environmental Laboratory, and molten salt extraction residues with varying amounts of residual moisture (i.e., unbound water). Data collected from the GH2P will be used to support an application to the US Nuclear Regulatory Commission for G-values and corresponding wattage limits for the TRUPACT-II payloads containing these waste matrices. The testing will also evaluate the ability to determine G-values on a waste stream basis.

Mroz, Eugene J.


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Data:41402a8c-1fbd-4ca0-aeb5-9e70b0791d18 | Open Energy Information  

Open Energy Info (EERE)

a8c-1fbd-4ca0-aeb5-9e70b0791d18 a8c-1fbd-4ca0-aeb5-9e70b0791d18 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Kenergy Corp Effective date: 2009/07/17 End date if known: Rate name: Rebate Adjustment Rider Sector: Description: APPLICABLE In all territory served. REBATE ADJUSTMENT RATE SECTION 1 BILLINGS TO CUSTOMERS SERVED FROM NON-DEDICATED DELIVERY POINTS Billings computed pursuant to rate schedules to which this section is applicable shall be adjusted based on the following formula where all references to costs and revenues will exclude amounts associated with customers served from Dedicated Delivery Paints. The wholesale Rebate Adjustment applicable to this section will be recorded in a payables account and returned in twelve equal installments without interest to the customers in accordance with the formula shown below. The Rebate Adjustment for this section will remain applicable for a twelve month period plus any additional months necessary to complete the over or under refunds or collections. Kenergy will synchronize application of the Rebate Adjustment per this Section with the application by Big Rivers of the wholesale Rebate Adjustment for purposes of the Rig Rivers Member Rate Stability Mechanism. Billings computed pursuant to rate schedules to which this section is applicable shall be decreased during each refund month by the following Rebate Adjustment factor applied to each kilowatt-hour sold: RF= (R-O+U) / (P(m) x L), Where: FW = the Rebate rate per KWH. R = one-twelfth of the portion of the most recent Rebate Adjustment Amount received from Kenergy's wholesale power supplier for all non-dedicated delivery points. P(m) = the KWH purchased in the second month preceding the month in which RF is applied. L = One minus the percent system energy losses equal to the rolling twelve month average not to exceed ten percent (1 0%). 0 = any over recovery amount from the second preceding month. TJ = any under recovery amount from the second preceding month.


Genetic Variation in DNA of Coho Salmon from the Lower Columbia River : Final Report 1993.  

DOE Green Energy (OSTI)

The goal of this project was to develop techniques to provide the information needed to determine if Lower Columbia River coho salmon represent a 'species' under the Endangered Species Act. Our report features two new nuclear DNA approaches to the improved detection of genetic variation: (1) Studies of DNA-level genetic variation for two nuclear growth hormone genes; (2) Use of arbitrary DNA primers (randomly amplified polymorphic DNA, or 'RAPD' primers) to detect variation at large numbers of nuclear genes. We used the polymerase chain reaction (PCR) to amplify variable sections (introns) of two growth hormone genes (GH-I and G/f-Z) in several salmonid species. Coho salmon had three DNA length variants for G/-I intron C. Restriction analysis and sequencing provided valuable information about the mode of evolution of these DNA sequences. We tested segregation of the variants in captive broods of coho salmon, and demonstrated that they are alleles at a single Mendelian locus. Population studies using the GH-1 alleles showed highly significant frequency differences between Lower Columbia River and Oregon Coast coho salmon, and marginal differences among stocks within these regions. These new markers are adequately defined and tested to use in coho salmon population studies of any size. The nature of the variation at GH-1 (Variable Number Tandem Repeats, or 'VNTRs') suggests that more genetic variants will be found in coho salmon from other areas. GH-2 intron C also showed length variation in coho salmon, and this variation was found to be sex-linked. Because PCR methods require minute amounts of tissue, this discovery provides a technique to determine the gender of immature coho salmon without killing them. Chinook salmon had restriction patterns and sequence divergences similar to coho salmon. Thus, we expect that sex linkage of GH-2 alleles predates the evolutionary divergence of Pacific salmon species, and that gender testing with this system will work on the entire group. Rainbow trout do not show this sex-linked variation. Genetic markers detected by DNA amplification using arbitrary 10-basepair primers (Randomly Amplified Polymorphic DNA, or 'RAPD' markers), are the newest and most promising method of assessing variation at large numbers of genetic loci. We have demonstrated the inheritance of these markers in rainbow trout, and we have found multiple variable genetic markers in coho salmon. Feasibility studies on the use of RAPDs on large salmon collections are described.

Fobes, Stephen; Knudsen, Kathy; Allendorf, Fred



Endocrine manipulation of growth and tissue development of broiler chickens  

E-Print Network (OSTI)

This study evaluated the potential use of in ovo administration of exogenous endocrine compounds to enhance growth and reduce fat content of posthatch broiler chickens. Effects of in ovo administration of growth hormone (GH) plus triiodothyronine (T3)on growth and adiposity of broiler chickens were investigated in experiment 1. Vehicle or vehicle containing .1 ng T3 plus .25 mg GH, . 1 ng T, plus 2.5 mg GH or .1 ng T3 plus 25 mg GH were injected into the albumen of fertile eggs on day 11 of incubation. Female broilers from eggs injected with .1 ng T3 plus 25 mg GH had significantly greater body weights as compared to controls from 5 weeks to 7 weeks of age. Administration of .1 ng T3 plus 2.5 mg G H resulted in a significant (P <. 05) 20.5 % reduction in fat pad weight in males. The effect of manipulating estrogen status in ovo on posthatch growth rate and skeletal development was examined by two trials in experiment 2. Effects of in ovo administration of tamoxifen citrate (T) or 17f3-estradiol (E) on growth and fattening of broiler chickens were assessed in trial 1. At day one of incubation, either vehicle, vehicle containing 20 Mg of E or 200 Mg of T was injected into the albumen of fertile eggs. Neither sex ratios, body weight, fat pad weight nor adipose cellularity parameters were altered by the concentrations of T or E administered in trial 1. In trial 2, eggs from a commercially selected broiler line and from a population of Athens-Canadian Randombreds (AC) were injected with either vehicle or vehicle containing 500 mg of T. At three weeks of age, chicks were sampled for fat pad weight and gonadal sex. The higher concentrations of T administered in trial 2 resulted in significant modifications in phenotypic sex ratios at hatch in both genotypes. However, these phenotypic changes in sex ratios did not yield significant alterations in body weight, fat pad weight or skeletal development. In conclusion, in ovo endocrine administration resulted in modifications of growth and tissue development in broilers. However, the alterations were dependent on the type and concentration of hormone.

Borbolla Sosa, Arturo German



Red Paper Wasps  

NLE Websites -- All DOE Office Websites (Extended Search)

Red Paper Wasps Red Paper Wasps Name: Sheldon Location: N/A Country: N/A Date: N/A Question: There are a lot of red paper wasps in and around our house. Why are there so many, and why do they hand around our front door? Replies: I'm not sure what species of wasp you have so I can't give you a very detailed answer. Paper wasps overwinter as fertile queens, all the rest die in the winter. In the spring a queen starts a paper nest and lays a few eggs, which hatch into workers. Over the summer the nest expands, and there are more and more workers until they all die again when it freezes in winter. how many workers there will be depends on the species of wasp and food supply, etc. So you have many wasps at this time of year because there is a nest somewhere nearby and they are at the maximum number of individuals before frost. Why they are by your door is probably just a coincidence, an accident, but I can't be sure



Office of Legacy Management (LM)

OR ' OR ' wuo March 30, 1954 .suBJEcr c TWO Q-11 DRUMS RECONDITIONED AT QUEEN CITY BARREL CO.,,CINCINNATI TO Ft. C. Heatherton FROM E. v. BarTy On Monday, March 29, the writer and Charles Yarborough visited the Queen City Barrel Co. for the purpose of observing the; reconditioning of 2 30-gallon Q-11 drums and 2 55-gallon Q-11 drums. Because of size, It was impossible at the time to use the wheelabrator on the smaller size drum.8. The two larger drums were first straightened and then shot blasted. The results are as follows: Before cleaning: Bfr 12 to 18 mreps/hr; average about 14 mreps/hr Y 0.7 to 0.9 mr/hr After cleaning: B f 7' high 0.2 mreps/hr; generally less than 0.1 aaPeps/hr r high 0.06 mr/hr; generally less,than 0.03 mr/hr The area around the wheelabrator shot blaster was checked for


Bumble Bees  

NLE Websites -- All DOE Office Websites (Extended Search)

Bumble Bees Bumble Bees Nature Bulletin No. 65 May 11, 1946 Forest Preserve District of Cook County Clayton F. Smith, President Roberts Mann, Superintendent of Conservation BUMBLE BEES Walking through the fields in early spring, occasionally you will see a big bumblebee flying slowly and very low. That is a queen, only the queens survive from last year' s colonies. For six or more months she has hibernated in the ground, alone and without food. Now she is sipping nectar from the early flowers and accumulating their pollen on her hairy body. From time to time she will comb this pollen into "baskets" on her hind legs. When her hunger is satisfied and the pollen baskets are full, she searches for a suitable nesting place in the ground -- frequently the abandoned den of a field mouse. There she mixes the pollen with nectar into a little loaf of beebread. and on it she lays a few eggs which she covers with wax secreted from her abdomen. She also makes a thimble- like pot which she fills with honey. Then she broods over the eggs, meanwhile feeding on the honey.


Nickel-iron battery system safety. Final report  

DOE Green Energy (OSTI)

Eagle-Picher Industries conducted a literature search and experimental tests to characterize the generated flow rates of gaseous hydrogen (GH/sub 2/) and gaseous oxygen (GO/sub 2/) from an electrical vehicle (EV) nickel-iron battery system. The resulting gassing rates were used to experimentally evaluate the flame quenching capabilities of several candidate devices to prevent the propagation of flame within batteries having central watering/venting systems. The battery generated hydrogen (GH/sub 2/) and oxygen (GO/sub 2/) gasses were measured for a complete charge and discharge cycle. The data correlates well with accepted theory during strong overcharge conditions indicating that the measurements are valid for other portions of the cycle. Tests have confirmed that the gas mixture in the cells is always flammable regardless of the battery status. Research of flame arrestor literature yielded little information regarding their operation with hydrogen-oxygen mixtures. It was indicated that a conventional flame arrestor would not be effective over the broad spectrum of gassing conditions presented by a nickel-iron battery. Four different types of protective devices were evaluated. A foam-metal arrestor design was successful in quenching GH/sub 2/-GO/sub 2/ flames, however; the application of this flame arrestor to individual cell or module protection in a battery is problematic. A possible rearrangement of the watering/venting system to accept the partial protection of simple one-way valves is presented. This in combination with the successful foam-metal arrestor as main vent protection, could result in a significant improvement in battery protection. This concept was not tested.

Saltat, R.



Structure Determination and Functional Analysis of a Chromate Reductase from Gluconacetobacter hansenii  

Science Conference Proceedings (OSTI)

Environmental protection through biological mechanisms that aid in the reductive immobilization of toxic metals (e.g.,chromate and uranyl) has been identified to involve specific NADH-dependent flavoproteins that promote cell viability. To understand the enzyme mechanisms responsible for metal reduction, the enzyme kinetics of a putative chromate reductasefrom Gluconacetobacter hansenii (Gh-ChrR) was measured and the crystal structure of the protein determined at 2.25 Aresolution. Gh-ChrR catalyzes the NADH-dependent reduction of chromate, ferricyanide, and uranyl anions under aerobic conditions. Kinetic measurements indicate that NADH acts as a substrate inhibitor; catalysis requires chromate binding prior to NADH association. The crystal structure of Gh-ChrR shows the protein is a homotetramer with one bound flavin mononucleotide (FMN) per subunit. A bound anion is visualized proximal to the FMN at the interface between adjacentsubunits within a cationic pocket, which is positioned at an optimal distance for hydride transfer. Site-directed substitutions of residues proposed to involve in both NADH and metal anion binding (N85A or R101A) result in 9095% reductions in enzyme efficiencies for NADH-dependent chromate reduction. In comparison site-directed substitution of a residue (S118A) participating in the coordination of FMN in the active site results in only modest (50%) reductions in catalytic efficiencies, consistent with the presence of a multitude of side chains that position the FMN in the active site. The proposed proximity relationships between metal anion binding site and enzyme cofactors is discussed in terms of rational design principles for the use of enzymes in chromate and uranyl bioremediation.

Jin, Hongjun; Zhang, Yanfeng; Buchko, Garry W.; Varnum, Susan M.; Robinson, Howard; Squier, Thomas C.; Long, Philip E.



F*G*F*G*F*G*F*G*F G F$G$F(G(F,G ...  

Science Conference Proceedings (OSTI)

F*G*F*G*F*G*F*G*F G F$G$F(G(F,G,F0G0F4G4F8G8F< GGH*?L ...



Aluminized film, seam sealing tests and observations. Final report  

DOE Green Energy (OSTI)

The purpose of this work was to investigate various seam sealing techniques, reinforcing methods, fitting installations, seam tolerances and geometric configurations pertinent to an aluminized plastic laminate. The program seeks a successful fabricating method for producing low-diffusion, cylindrical, spar liners to contain pressurized GH{sub 2} and GO{sub 2}. The test plan included: (1) seaming techniques on metallized Mylar film; (2) ``double patches`` for end fittings; (3) stainless steel bulkhead fitting assembly with seals; (4) minimum run tolerance on linear shear seam; (5) peel seam vs. inverted seal seam fabrication.

Not Available



Manabu Matsuoka Faculty of Child Sciences,  

E-Print Network (OSTI)

Manabu Matsuoka Faculty of Child Sciences, Osaka Shoin Women's University 1 F Fn = {(a0, · · · , an. Greferath M. E. O'Sullivan [2]. QF R n (g) g R[X] 2 QF R R- P R- g : M N R- f : P N R- h : P M f = gh R- Q R- g : N M R- f : N Q R- h : M Q f = hg R R R #12;R- M M R R R M R- X M X annihilator annl

Yoshii, Yoji


Summary Project Report for a Hypothetical Wind Project on the Gulf Coast of Florida  

Science Conference Proceedings (OSTI)

The Electric Power Research Institute (EPRI) contracted with Garrad Hassan America, Inc. (GL GH) to conduct independent preliminary assessments of the wind climate, hurricane risk, and capital and operating costs of a hypothetical wind farm site on the Gulf Coast of Florida. The results of the work are reported here.The proposed project site is located on a flat, sandy coastal beach on a barrier island with elevations ranging from 0 meters (m) to 2 m. The island is approximately 500 m in ...



Modelling of Mechanical Properties of Ferritic Weld Metals  

E-Print Network (OSTI)

?Q`]#21;lGOPYxQ`LJOPN#6;Q`LJn?]O`fMDGlGDGN#19;DRK\\F DGS?N#19;BZK^daKMmEOPL#19;N#19;[^K\\SoN3Q`]#31;?vOPN#6;KMLJDGO`lVF?gfMDRK\\SIfhK#11;O`SIH1?=KMN#19;O`lGlGXZL#19;b`nvOPN3N#19;BZK^qcSIDGr`KMLJF#19;DRNn&Q`]itiO`[#17;YILJDVHZb`K`u z#31;QTXIlGH#2;l...

Lalam, Sree Harsha



Spectra of Coset Sigma Models  

E-Print Network (OSTI)

We compute the complete 1-loop spectrum of anomalous dimensions for the bulk fields of non-linear sigma models on symmetric coset (super)spaces G/H, both with and without world-sheet supersymmetry. In addition, we provide two new methods for the construction of partition functions in the infinite radius limit and demonstrate their efficiency in the case of (super)sphere sigma models. Our results apply to a large number of target spaces including superspheres and superprojective spaces such as the N=2 sigma model on CP(3|4).

Candu, Constantin; Schomerus, Volker



Spectra of Coset Sigma Models  

E-Print Network (OSTI)

We compute the complete 1-loop spectrum of anomalous dimensions for the bulk fields of non-linear sigma models on symmetric coset (super)spaces G/H, both with and without world-sheet supersymmetry. In addition, we provide two new methods for the construction of partition functions in the infinite radius limit and demonstrate their efficiency in the case of (super)sphere sigma models. Our results apply to a large number of target spaces including superspheres and superprojective spaces such as the N=2 sigma model on CP(3|4).

Constantin Candu; Vladimir Mitev; Volker Schomerus



Curved Spacetime Geometry for Strings and Affine Non-compact Algebras  

E-Print Network (OSTI)

Based on lectures delivered at (1) the AMS meeting at USC, Nov. 1992 (2) Conference on Quantum Aspects of Black Holes, ITP, UC- Santa %Barbara, %%June 1993. (3) 25th Summer Institute, Ecole Normale Superieure, % Paris, Aug. 1992. To appear in "Interface Between Mathematics and Physics", Ed. S.-T. Yau. 1--Itroduction to String Theory in Curved Spacetime 2--G/H Coset Conformal Field Theory and String Theory 3--Time, Space and Classification of Non-Compact Cosets 4--Heterotic Strings in Curved Spacetime as gauged WZW Models 5--The Spacetime Manifold and the Geometry 6--Examples in 2D, 3D and 4D

Bars, Itzhak



Market-induced Asset Specificity: Redefining the Hold-up Problem  

E-Print Network (OSTI)

rqh zkrvh ydoxdwlrq lv uhgxfhg e| d idfwru #16;= Wkxv/ li zh gh#31;qh #30; wr eh wkh suredelolw| wkdw d vxssolhu fdq #31;qg d qhz ex|hu diwhu edujdlqlqj euhdnv grzq/ vhfwlrq LL dvvxphv wkdw #30; @ 4= Zh duh wkhuhiruh ohg wr dvn= Zk| vkrxog zh h... vhuyh dv d vxevwlwxwh1 Wr vhh zk| wklv uhyhuvdo rffxuv/ frqvlghu zkdw kdsshqv dv zh ydu| W= Iru W yhu| vpdoo/ #24; 4@ lv forvh wr #24; #30; A 4> vlqfh frqwudfwv duh doprvw frpsohwh1 Iru vxfk ohyhov ri W> frqwudfwlqj lv xvhg iru wkh hqwluh lqyhvwphqw...

Lewin-Solomons, Shira



Women @ Energy: Christina Swinson | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Christina Swinson Christina Swinson Women @ Energy: Christina Swinson March 11, 2013 - 5:10pm Addthis Women @ Energy: Christina Swinson Christina Swinson is a post doc. in Accelerator Physics at Brookhaven National Lab. She has a BSc. In Physics with Computing, Queen Mary College, University of London, United Kingdom, and a DPhil. (PhD.) in Accelerator Physics from the University of Oxford, United Kingtom. 1) What inspired you to work in STEM? My decision to work in STEM didn't come until I was in my twenties but the journey first began in high school. Unfortunately at the time I wasn't encouraged past the point of getting good grades, that I would become a physicists didn't cross the minds of my teachers, let alone my own mind. Fortunately I stuck with STEM, though probably only because I


Browse by Discipline -- E-print Network Subject Pathways: Power  

Office of Scientific and Technical Information (OSTI)

M N O P Q R S M N O P Q R S T U V W X Y Z La Peyre, Megan (Megan La Peyre) - Louisiana Fish and Wildlife Cooperative Research Unit U.S. Geological Service & School of Renewable Natural Resources, Louisiana State University Labat, Jean-Philippe (Jean-Philippe Labat) - Laboratoire d'Océanographie de Villefranche Lachenbruch, Barbara (Barbara Lachenbruch) - Department of Wood Science and Engineering, Oregon State University Lacy, Bob (Bob Lacy) - Chicago Zoological Society. Brookfield Zoo LaFrance, Jeffrey T. (Jeffrey T. LaFrance) - Department of Economics, Monash University Lahti, David C. (David C. Lahti) - Department of Biology, Queens College, City University of New York Lai, Chun-Ta (Chun-Ta Lai) - Department of Biology, San Diego State University Laidre, Kristin L. (Kristin L. Laidre) - Polar Science Center,


Browse by Discipline -- E-print Network Subject Pathways: Power  

Office of Scientific and Technical Information (OSTI)

F G H I J K L M N O P Q R S F G H I J K L M N O P Q R S T U V W X Y Z Early, Regan (Regan Early) - Cátedra Rui Nabeiro - Biodiversidade, Universidade de Évora Eberhard, Jessica R. (Jessica R. Eberhard) - Museum of Natural Science & Department of Biological Sciences, Louisiana State University Eckert, Christopher G. (Christopher G. Eckert) - Department of Biology, Queen's University (Kingston) Economo, Evan P. (Evan P. Economo) - Department of Ecology and Evolutionary Biology, University of Michigan Edwards Jr., Thomas C. (Thomas C. Edwards Jr.) - Fisheries and Wildlife Department, Utah State University Edwards, Andrew (Andrew Edwards) - British Antarctic Survey Edwards, Ceiridwen J. (Ceiridwen J. Edwards) - Smurfit Institute, Trinity College, University of Dublin

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Browse by Discipline -- E-print Network Subject Pathways: Environmental  

Office of Scientific and Technical Information (OSTI)

B C D E F G H I J K L M N O P Q R S B C D E F G H I J K L M N O P Q R S T U V W X Y Z Allen, John F. (John F. Allen) - School of Biological and Chemical Sciences, Queen Mary, University of London Angenent, Lars T. (Lars T. Angenent) - Department of Biological and Environmental Engineering, Cornell University Archer, Cristina Lozej (Cristina Lozej Archer) - College of Earth, Ocean, and Environment, University of Delaware Armanini, David G (David G Armanini) - Canadian Rivers Institute, University of New Brunswick Go back to Individual Researchers Collections: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z American University of Beirut, Faculty of Engineering and Architecture, Energy Research Group Australian Cooperative Research Centre for Renewable Energy, ACRELab


Browse by Discipline -- E-print Network Subject Pathways: Geosciences --  

Office of Scientific and Technical Information (OSTI)

Q R S Q R S T U V W X Y Z Palffy-Muhoray, Peter (Peter Palffy-Muhoray) - Liquid Crystal Institute, Kent State University Papoian, Garegin A. (Garegin A. Papoian) - Department of Chemistry, University of North Carolina at Chapel Hill Parent, J. Scott (J. Scott Parent) - Department of Chemical Engineering, Queen's University (Kingston) Park, Hongkun (Hongkun Park) - Department of Chemistry and Chemical Biology, Harvard University Park, Jong-Sang (Jong-Sang Park) - School of Chemistry, Seoul National University Park, Joon Taik (Joon Taik Park) - Department of Chemistry, Korea Advanced Institute of Science and Technology Parker, Carl (Carl Parker) - Division of Chemistry and Chemical Engineering, California Institute of Technology Patrick, David L. (David L. Patrick) - Department of Chemistry,


Browse by Discipline -- E-print Network Subject Pathways: Renewable Energy  

Office of Scientific and Technical Information (OSTI)

Renewable Energy Renewable Energy Go to Research Groups Preprints Provided by Individual Scientists: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z Allen, John F. (John F. Allen) - School of Biological and Chemical Sciences, Queen Mary, University of London Angenent, Lars T. (Lars T. Angenent) - Department of Biological and Environmental Engineering, Cornell University Archer, Cristina Lozej (Cristina Lozej Archer) - College of Earth, Ocean, and Environment, University of Delaware Armanini, David G (David G Armanini) - Canadian Rivers Institute, University of New Brunswick Go back to Individual Researchers Collections: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z American University of Beirut, Faculty of Engineering and



NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Duplex Rules June 2010 Atmospheric Radiation Measurement Climate Research Facility/ North Slope of Alaska/Adjacent Arctic Ocean (ACRF/NSA/AAO) Duplex Rules Who can stay in the duplex? The rental for the duplex is paid out of the ACRF/NSA/AAO Site Manager's (SM's) Site Development and Operations budget at Sandia National Laboratories. ACRF personnel working directly on tasks for the ACRF/NSA/AAO Site will have priority in the use of the duplex. Other ACRF users will be accommodated on an as-available basis. A total of six bedrooms are now available in the duplex; 4 rooms have twin bunk beds, 1 room has 2 twin beds, and 1 room has a queen size bed. The duplex can accommodate 11 people with doubling up in the rooms that have bunk and twin beds. The Site Manager, Mark Ivey, will confirm extension of duplex


District of Columbia | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

June 7, 2013 June 7, 2013 Photo courtesy of the Pacific Northwest National Laboratory. Building a 21st Century Electric Grid New Presidential Memorandum will speed the modernization of the nation's electric grid. June 7, 2013 Deputy Secretary Daniel Poneman, center, presents the Secretary's Achievement Award to Oak Ridge Project Manager David Queen and Oak Ridge EM Deputy Manager Sue Cange for their work in Oak Ridge's K-33 Gaseous Diffusion Process Building Project. Deputy Secretary Commends EM's Achievement Award Winners WASHINGTON, D.C. - Every year, DOE honors employees who streamline operations and avoid costs for U.S. taxpayers. June 7, 2013 Deputy Secretary Daniel Poneman talks to participants in EM's Contract and Project Management Workshop this week. Poneman Joins EM Contract and Project Management Workshop


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

2, 2003 2, 2003 Calendar Thursday, October 2 2:30 pm Theoretical Physics Seminar - Curia II Speaker: D. Kosower, Centre d'Etudes de Saclay Title: Real Emission at NNLO 3:30 pm Director's Coffee Break - 2nd Flr X-Over THERE WILL BE NO ACCELERATOR PHYSICS AND TECHNOLOGY SEMINAR TODAY Friday, October 3 3:30 pm Wine & Cheese- 2nd Flr X-Over 4:00 pm Joint Experimental Theoretical Physics Seminar - 1 West Speaker: M. Chen, Queen's University Title: New Results from SNO with Enhanced Neutral Current Sensitivity Cafeteria Thursday, October 2 Old fashioned tomato soup Sauerbratten $4.75 Herb crusted chicken breast $3.50 Shaved ham & cheese $4.75 Monte Cristo $4.75 Turkey club salad $3.75 Sushi Eurest Dining Center Weekly Menu Chez Leon Weather Weather Sunny 50º/36º Extended Forecast


Fernald, Former Production Workers Screening Projects | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Production Workers Screening Projects Production Workers Screening Projects Fernald, Former Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: Fernald Worker Population Served: Production Workers Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office Ray Beatty and Mooch Callaway 1150 Harrison Ave., Suite 106 Harrison, OH 45030 Website: http://www.worker-health.org/ This project is being conducted by Queens College of the City University of New York. Free of charge, eligible workers can receive a medical exam, including chest X-ray and breathing test. This program also offers CT scans for early lung cancer detection to workers who have an elevated risk of lung cancer as a result of a combination of occupational exposures, age,


Argonne National Laboratory-West, Former Production Workers Screening  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

West, Former Production Workers West, Former Production Workers Screening Projects (now known as the Idaho National Laboratory) Argonne National Laboratory-West, Former Production Workers Screening Projects (now known as the Idaho National Laboratory) Project Name: Worker Health Protection Program Covered DOE Site: Argonne National Laboratory-West Worker Population Served: Production Workers Principal Investigator: Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office: David Fry 1055 Austin Avenue Idaho Falls, ID 83404 Website: http://www.worker-health.org/ This project is conducted by the United Steelworkers, in partnership with Queens College of the City University of New York. Free of charge, eligible workers can receive a medical exam, including chest X-ray and breathing


Microsoft Word - 20.doc  

Office of Scientific and Technical Information (OSTI)

THE EFFECT OF SILICON AND ALUMINUM ADDITIONS ON THE OXIDATION THE EFFECT OF SILICON AND ALUMINUM ADDITIONS ON THE OXIDATION RESISTANCE OF LEAN CHROMIUM STAINLESS STEELS J. S. Dunning, D. E. Alman, and J. C. Rawers United States Department of Energy Albany Research Center 1450 Queen Avenue, SW Albany, OR 97321 ABSTRACT The effect of Si and Al additions on the oxidation of lean chromium austenitic stainless steels has been studied. A baseline composition of Fe-16Cr-16Ni-2Mn-1Mo was selected to allow combined Si and Al additions of up to 5 wt. pct. in a fully austenitic alloy. The baseline composition was selected using a net Cr equivalent equation to predict the onset of /-ferrite formation in austenite. Cyclic oxidation tests in air for 1000 hours were carried out on alloys with Si only or combined Si and Al additions in the temperature


NREL: Energy Sciences - Hui Wei  

NLE Websites -- All DOE Office Websites (Extended Search)

Hui Wei Hui Wei Research Scientist Photo of Hui Wei Phone: (303) 384-6620 Email: hui.wei@nrel.gov At NREL Since: 2008 Hui Wei joined NREL in 2008, and is a Research Scientist in the Biomolecular Sciences Team, the Bioscience Center. His main research interest and current research activities at NREl are focused on (1) the genetic modification of plants to increase their biomas digestibility, (2) the efficient microbial conversion of bimass to biofuels, including biodiesel and other long-chain hydrocarbons, and (3) the plant-microbe interactions. In 2003, he earned a Ph.D. in Plant and Microbial Physiology from Queen's University in Canada. During his Ph.D. studies, he worked on the metabolism of carbon, nitrogen and oxygen, and the ion transport in the bacteria-infected plant cells. He also earned an M.S. in Microbiology from


Mound, Former Production Workers Screening Projects | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Production Workers Screening Projects Production Workers Screening Projects Mound, Former Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: Mound Worker Population Served: Production Workers Principal Investigator: Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: 1-877-866-6802 Local Outreach Office Eric Parker, Paige Gibson and Mike Ball 113 East Central Avenue W. Carrollton, OH 45449 Website: http://www.worker-health.org/ This project is being conducted by the United Steelworkers, in conjunction with Queens College of the City University of New York. Free of charge, eligible workers can receive a medical exam, including chest X-ray and breathing test, and an educational workshop. This program also offers CT


netlognews, Volume 24, January 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

Teams Earn Secretary of Energy Achievement Awards Teams Earn Secretary of Energy Achievement Awards Electric Current Locator: Sees What No Eye Can See Former NETL ORISE Student Wins Award Novel Catalyst Technology Helps Convert Diesel to Syngas NETL Develops Technique for Detection of Mercury Catalysts Developed for Oxidation of Mercury in Coal-Burning Power Plants New Method Identified For Measuring Corrosion Rates of Metals and Alloys in Low Electric Conductivity Environments Novel Process and Device for Rapid Gas Hydrate Formation Raman Gas Composition Sensor Undergoes Field Test New Diagrams Illustrate How Energy Flowed in 2010 Recent NETL Publications Patents Issued Contact National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321 541-967-5892 2175 University Avenue South Suite 201 Fairbanks, AK 99709



Office of Legacy Management (LM)

Albany, Oregon, Site (formerly the Albany, Oregon, Site (formerly the Albany Research Center Site) is located at 1450 Queen Avenue SW, approximately 23 miles south of Salem, Oregon. The site consists of three main areas: the Albany Research Center (ARC), which comprises a number of buildings in the northern and central sections of the site, a 2-acre inactive biomass research facility that occupies the center of the site, and a 14-acre open area in the back of the site. ARC was established in 1943 to investigate innovative approaches for developing strategic mineral resources and for conducting other activities relevant to metallurgical research in the United States. From 1948 to 1956, the U.S. Bureau of Mines melted, machined, welded, and alloyed thorium at the site for the U.S. Atomic Energy Commission (AEC) and later,


"Magic mirror on the wall, who's the fastest Database of them all?" A Survey of Database Benchmarks  

E-Print Network (OSTI)

Benchmarks are important tools for measuring the performance of database management systems (DBMS) and for understanding vendor claims of performance. This paper defines DBMS benchmarks, explores the role of the Transaction Processing Performance Council as the only benchmark standards organization, and surveys eight existing DBMS benchmarks for on-line transaction processing, relational, and object-oriented databases. 1 Introduction When examining the performance of a commercial database management system (DBMS),one is bombarded with vendor performance claims. Each vendor will shower you with claims of "tpsA-Local" ratings, or top performance on the "TPC-C" benchmark. If you are looking at a commercial object-oriented DBMS, vendors will tell you they have the best performance on the "Cattell" (or OO1 or "Sun") benchmark. The use of benchmark performance measurements by commercial DBMS vendors seems a bit like the Queen in Snow White asking the magic mirror who is the fairest. If the ...

Usaf Maj; Timothy J. Halloran; Timothy J. Halloran; Mark A. Roth; Mark A. Roth



Unleashing the Power of Mobile Cloud Computing using ThinkAir  

E-Print Network (OSTI)

Smartphones have exploded in popularity in recent years, becoming ever more sophisticated and capable. As a result, developers worldwide are building increasingly complex applications that require ever increasing amounts of computational power and energy. In this paper we propose ThinkAir, a framework that makes it simple for developers to migrate their smartphone applications to the cloud. ThinkAir exploits the concept of smartphone virtualization in the cloud and provides method level computation offloading. Advancing on previous works, it focuses on the elasticity and scalability of the server side and enhances the power of mobile cloud computing by parallelizing method execution using multiple Virtual Machine (VM) images. We evaluate the system using a range of benchmarks starting from simple micro-benchmarks to more complex applications. First, we show that the execution time and energy consumption decrease two orders of magnitude for the N-queens puzzle and one order of magnitude for a face detection an...

Kosta, Sokol; Hui, Pan; Mortier, Richard; Zhang, Xinwen



User:J.M.Pearce | Open Energy Information  

Open Energy Info (EERE)

M.Pearce M.Pearce Jump to: navigation, search Me with ellip.JPG Name Joshua Pearce Edits 7 I am currently an Assistant Professor of Mechanical and Materials Engineering and cross-appointed in the School of Environmental Studies at Queen's University in Canada My primary technical research concentration is in electronic device physics of solar photovoltaic cells and materials physics of photovoltaic materials. My research interests, however, also include applied sustainability and sustainable development (both in the U.S. and in developing countries), open source appropriate technology, service learning, and energy policy. I am a frequent contributor to Appropedia.org, a wiki for appropriate technology and sustainable development where my Applied Sustainability Research Group houses our open source working pages.


Paducah Gaseous Diffusion Plant, Production Workers Screening Projects |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Production Workers Screening Production Workers Screening Projects Paducah Gaseous Diffusion Plant, Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: Paducah Worker Population Served: Production Workers Principal Investigator: Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office: James Harbison 2525 Cairo Road Paducah, KY 42001 Website: http://www.worker-health.org/ This project is conducted by the United Steelworkers in conjunction with Queens College of the City University of New York. The program is being offered as a service to both former and current workers. Free of charge, eligible workers can receive a medical exam, including chest X-ray and breathing test, and an educational workshop. This program also offers CT


Delivery Tech Team  

NLE Websites -- All DOE Office Websites (Extended Search)

Tech Team Tech Team Oak Ridge National Laboratory January, 2005 Team Members * Tony Bouza: DOE * Nick Burkhead: SC * Dan Casey: CVX * Maria Curry- Nkansah: BP* * Jim Kegerreis: XOM * George Parks: COP** * Mark Paster: DOE** * Steve Pawel: ORNL * Jim Simnick: BP * FOG Liaison ** Co-Leads Shawna McQueen (Energetics): Facilitator Mission * Provide a forum for the Partnership to help advance research aimed at developing low cost, safe, and energy efficient hydrogen delivery systems * Catalyze the development of hydrogen delivery technologies that enable the introduction and long-term viability of hydrogen as an energy carrier for transportation and stationary power Useful Facts * 1 kg H 2 = 1 gallon gasoline * Eff FCV = 2-3 x Eff ICEV = 1.2-1.4 x Eff HEV * Energy Density - 10,000 psi H 2 = 1.3 kWhr/l


ƒUPON COMMENCING public forum on Wednesday, Septembre 28, 2005 at Toronto, Ontario at 8:30 am  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Competition and Reliability In North American Electrical Markets technical Workshop Competition and Reliability In North American Electrical Markets technical Workshop Toronto, Ontario, CANADA September 28, 2005 Competition and Reliability in North American Electricity Markets Technical Workshop Sponsored by Canada-U.S. Power Outage Task Force September 28, 2005 Toronto Congress Centre, Pierre Berton Room 650 Dixon Road, Toronto, Ontario, CANADA This publication is the recorded verbatim transcript and, as such, is taped and transcribed in either of the official languages, depending on the languages spoken by the participant at the public forum. 1 Competition and Reliability In North American Electrical Markets technical Workshop Toronto, Ontario, CANADA September 28, 2005 Facilitator Mr. Bryne Purchase Queen's University


Step-by-Step Instructions  

NLE Websites -- All DOE Office Websites (Extended Search)

Maryland Maryland based upon the simple prescriptive option of the 2012 IECC. It does not provide a guarantee for meeting the IECC. This guide is not designed to reflect the actual energy code, with amendments, if any, adopted in Maryland and does not, therefore, provide a guarantee for meeting the state energy code. For details on the energy code adopted by Maryland, including how it may differ from the IECC, please contact your local building code official. Additional copies of this guide are available on www.reca-codes.com. CLIMATE ZONE 5 Garrett CLIMATE ZONE 4 Allegany Howard Anne Arundel Kent Baltimore Montgomery Baltimore City Prince George's Calvert Queen Anne's Caroline Somerset Carroll St. Mary's Cecil Talbot Charles Washington

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


New Orleans and Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

New Orleans and Energy Efficiency New Orleans and Energy Efficiency New Orleans and Energy Efficiency Addthis Description The Saint Bernard Project works tirelessly with volunteers, veterans and homeowners to continue the rebuilding. With the help of the Department of Energy and the Department of Housing and Urban Development they will be able to apply a greater energy efficiency strategy to help New Orleans and the country reduce our dependence on foreign oil. Speakers Zachary Rosenburg, Dominiqe Adansi-Bona, Sgt. James McQueen, Sgt John Johnson Duration 4:17 Topic Homes Construction Energy Sector Jobs Credit Energy Department Video ZACHARY ROSENBURG: My name is Zach Rosenburg. I'm the co-founder and CEO of the St. Bernard Project. The St. Bernard Project exists to help Katrina and oil spill survivors rebuild their homes, lives and communities.


Oak Ridge Y-12 and Oak Ridge National Laboratory, Former Production Workers  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Y-12 and Oak Ridge National Laboratory, Former Production Y-12 and Oak Ridge National Laboratory, Former Production Workers Screening Projects Oak Ridge Y-12 and Oak Ridge National Laboratory, Former Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: Y-12 and ORNL (X-10) Worker Population Served: Production Workers Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (800) 906-2019 Local Outreach Office: Linda Parker 109 Viking Road Oak Ridge, TN 37830 Website: http://www.worker-health.org/ Former workers at risk from exposures while working at Y-12 and X-10 are offered a free medical screening. This project is carried out by investigators from the Queens College of the City University of New York. This program also offers CT scans for early lung cancer detection to


Research Highlights | ORNL Neutron Sciences  

NLE Websites -- All DOE Office Websites (Extended Search)

Possible valence bond condensation in a frustrated cluster magnet Possible valence bond condensation in a frustrated cluster magnet Research at SNS's POWGEN instrument results in Nature Materials publication The work links magnetism on clusters to geometric magnetic frustration in extended solids, demonstrating a new paradigm for unparalleled chemical control and tunability in the search for collective, emergent electronic states of matter. A team from The Johns Hopkins University and led by Tyrel McQueen recently synthesized and characterized the geometrically frustrated magnetic system, LiZn2Mo3O8. In such systems, competing exchange interactions cannot all be satisfied and as a result, the ground state degenerates. The material appears to form a condensed valence bond state that is reminiscent of the long-sought resonating valence bond state and a possible


Program Management for Contracting Officers  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Government Contracting - Government Contracting - A Project Manager's Perspective ???!!! Presented by John Baniszewski, Deputy Project Manager and Former Procurement Manager, NASA Goddard Space Flight Center 2 Project Managers and Contracting Officers: The Need to Understand Each Other * "I can't understand it. I can't even understand the people who can understand it" - Queen Juliana of the Netherlands * "Seek first to understand, and then to be understood" - Stephen Covey * "If one does not understand a person, one tends to regard him as a fool" - Carl Jung * "Before you contradict an old man, my fair friend, you should endeavor to understand him" - George Santayana 3 Project Managers and Procurement * "A Guide to the Project Management Body of


2003 American Solar Challenge Official Starting Lineup  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

American Solar Challenge Official Starting Lineup American Solar Challenge Official Starting Lineup Starting Team Car # Time 9:00 Kansas State University 28 9:01 University of Minnesota 35 9:02 University of Missouri - Rolla 42 9:03 University of Missouri - Columbia 43 9:04 University of Toronto 11 9:05 University of Waterloo 24 9:06 North Dakota State University 22 9:07 Auburn University 7 9:08 CalSol 254 9:09 Principia College 32 9:10 Queen's University 100 9:11 Western Michigan University 786 9:12 Purdue University 314 9:13 University of Pennsylvania 76 9:14 Iowa State University 9 9:15 Texas A&M University 12 9:16 McGill University 66 9:17 University of Arizona 8 9:18 Stanford University 16 9:19 California Polytechnic State University - SLO 5


Browse by Discipline -- E-print Network Subject Pathways: Biotechnology --  

Office of Scientific and Technical Information (OSTI)

F G H I J K L M N O P Q R S F G H I J K L M N O P Q R S T U V W X Y Z Eastin, Matthew D. (Matthew D. Eastin) - Department of Geography and Earth Sciences, University of North Carolina at Charlotte Eaton, Brett (Brett Eaton) - Department of Geography, University of British Columbia Eaton, L. Scott (L. Scott Eaton) - Department of Geology and Environmental Science, James Madison University Eaton, Timothy (Timothy Eaton) - School of Earth and Environmental Sciences, Queens College, City University of New York Ebel, Denton (Denton Ebel) - Department of Earth and Planetary Sciences, American Museum of Natural History Ebert, Beth (Beth Ebert) - Centre for Australian Weather and Climate Research, Bureau of Meteorology & (CSIRO) Eckstein, Yoram (Yoram Eckstein) - Department of Geology, Kent State


Idaho National Laboratory, Former Production Workers Screening Projects |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Idaho National Laboratory, Former Production Workers Screening Idaho National Laboratory, Former Production Workers Screening Projects Idaho National Laboratory, Former Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: INL Worker Population Served: Production Workers Principal Investigator: Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office: David Fry 1055 Austin Avenue Idaho Falls, ID 83404 Community Care 2725 Channing Way Idaho Falls, ID 83404 Website: http://www.worker-health.org/ This project is conducted by the United Steelworkers, in conjunction with Queens College of the City University of New York. Free of charge, eligible workers can receive a medical exam, including chest X-ray and breathing



NLE Websites -- All DOE Office Websites (Extended Search)

Neutral Current Detector Phase of the Sudbury Neutrino Neutral Current Detector Phase of the Sudbury Neutrino Observatory Ryan Martin Queen's University ABSTRACT In this talk, I will present the latest published results from the Sudbury Neutrino Observatory (SNO). This Heavy-Water (D20) Cerenkov detector was designed to resolve the solar neutrino problem; since Ray Davis' experiment in the 1960s, there had been a discrepancy between the measured solar neutrino flux and that predicted by the solar model. The SNO experiment conclusively showed in 2001 that solar neutrinos, produced in the electron flavour, transform into muon and tau flavours on their way to earth. The detector was able to measure the electron flavour flux through a charged-current reaction, whereas the total flux of neutrinos was measured independently through a neutral-current reaction that produced a neutron.


INEEL Production Workers Needs Assessment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Idaho National Engineering and Environmental Laboratory Idaho National Engineering and Environmental Laboratory (INEEL) Phase I: Needs Assessment Robert Wages Oil, Chemical and Atomic International Union Steven Markowitz Queens College CUNY Medical School Sylvia Kieding Oil, Chemical and Atomic International Union Mark Griffon University of Massachusetts Lowell Michael Ellenbecker University of Massachusetts Lowell October 9, 1998 Work Performed Under DOE Contract No. DE-FCO3-97SF2 1512 TABLE OF CONTENTS Page Number Executive Summary 1 Part I: OVERVIEW Section I. Introduction 2 Section II. Methods 4 Section III. Principal Findings 8 Section IV. Need for Medical Surveillance and Risk Communication 20 PART II: METHODOLOGY AND RESULTS Section V. Exposure Assessment Appendix A: Risk Mapping Results Appendix B: Risk Map Exposures Appendix C: High Exposure Ranking Matrix


INEEL Production Workers Needs Assessment  

NLE Websites -- All DOE Office Websites (Extended Search)

Surveillance Program Surveillance Program at Idaho National Engineering and Environmental Laboratory (INEEL) Phase I: Needs Assessment Robert Wages Oil, Chemical and Atomic International Union Steven Markowitz Queens College CUNY Medical School Sylvia Kieding Oil, Chemical and Atomic International Union Mark Griffon University of Massachusetts Lowell Michael Ellenbecker University of Massachusetts Lowell October 9, 1998 Work Performed Under DOE Contract No. DE-FCO3-97SF2 1512 TABLE OF CONTENTS Page Number Executive Summary 1 Part I: OVERVIEW Section I. Introduction 2 Section II. Methods 4 Section III. Principal Findings 8 Section IV. Need for Medical Surveillance and Risk Communication 20 PART II: METHODOLOGY AND RESULTS Section V. Exposure Assessment Appendix A: Risk Mapping Results Appendix B: Risk Map Exposures



NLE Websites -- All DOE Office Websites (Extended Search)

penetrating radar survey and tracer observations at the West Pearl penetrating radar survey and tracer observations at the West Pearl Queen carbon sequestration pilot site, New Mexico Thomas H. Wilson*, Arthur W. Wells, J. Rodney Diehl, Grant S. Bromhal, Duane H. Smith, and William Carpenter*, National Energy Technology Laboratory (NETL), Pittsburgh, PA & Morgantown, WV & *West Virginia University Department of Geology and Geography The potential for leakage of injected CO 2 at carbon sequestration sites is a significant concern in the design and deployment of long-term carbon sequestration efforts. Effective and reliable monitoring of near-surface environments in the vicinity of these sites is essential to ensure the viability of sequestration activities as well as long term public and environmental safety. Identification of geological features such as faults, fracture zones,



NLE Websites -- All DOE Office Websites (Extended Search)

Genetic Genetic Variability of Cell Wall Degradability for the Selection of Alfalfa with Improved Saccharification Efficiency Marc-Olivier Duceppe & Annick Bertrand & Sivakumar Pattathil & Jeffrey Miller & Yves Castonguay & Michael G. Hahn & Réal Michaud & Marie-Pier Dubé # Her Majesty the Queen in Right of Canada 2012 Abstract Alfalfa (Medicago sativa L.) has a high potential for sustainable bioethanol production, particularly because of its low reliance on N fertilizer. We assessed near-infrared reflec- tance spectroscopy (NIRS) as a high-throughput technique to measure cell wall (CW) degradability in a large number of lignified alfalfa stem samples. We also used a powerful immu- nological approach, glycome profiling, and chemical analyses to increase our knowledge of the composition of CW poly- saccharides of alfalfa stems with various levels


Browse by Discipline -- E-print Network Subject Pathways: Computer  

Office of Scientific and Technical Information (OSTI)

K L M N O P Q R S K L M N O P Q R S T U V W X Y Z Jabin, Pierre-Emmanuel (Pierre-Emmanuel Jabin) - Laboratoire Jean Alexandre Dieudonné, Université de Nice Sophia Antipolis Jabuka, Stanislav (Stanislav Jabuka) - Department of Mathematics, University of Nevada, Reno Jacka, Saul (Saul Jacka) - Department of Statistics, University of Warwick Jackiewicz, Zdzislaw (Zdzislaw Jackiewicz) - School of Mathematical and Statistical Science, Arizona State University Jackson, Bill (Bill Jackson) - School of Mathematical Sciences, Queen Mary, University of London Jackson, Daniel R. (Daniel R. Jackson) - Department of Mathematics, University of Maine at Farmington Jackson, David A. (David A. Jackson) - Department of Mathematics and Computer Science, Saint Louis University


Oak Ridge K-25 Gaseous Diffusion Plant, Former Production Workers Screening  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

K-25 Gaseous Diffusion Plant, Former Production Workers K-25 Gaseous Diffusion Plant, Former Production Workers Screening Projects Oak Ridge K-25 Gaseous Diffusion Plant, Former Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: K-25 Worker Population Served: Production Workers Principal Investigator: Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office: Bruce Lawson 133 Raleigh Road Oak Ridge, TN 37830 Local Medical Clinics: ParkMed 110 S. Illinois Avenue Oak Ridge, TN 37380 Website: http://www.worker-health.org/ This project is conducted by the United Steelworkers in conjunction with Queens College of the City University of New York. The program is being offered as a service to both former and current workers. Free of charge,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV


DOE Electrolysis-Utility Integration Workshop Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

ELECTROLYSIS-UTILITY ELECTROLYSIS-UTILITY INTEGRATION WORKSHOP Renaissance Suites at Flatirons, Broomfield, CO September 22-23, 2004 September 22, 2004 7:30 am Registration and Continental Breakfast 8:30 am Welcome and Overview of Workshop Goals, Pete Devlin, DOE/OHFCIT 8:45 am Review Agenda and Objectives, Shawna McQueen, Energetics 9:00 am Electrolysis Hydrogen Generation, Steve Cohen, Teledyne Energy Systems 9:20 am Electrolyzers Operating in Real-World Conditions, Rob Regan, DTE Energy Systems 9:40 am Break 10:00 am Technology Advancements and New Concepts, Dan Smith, GE Global Research 10:20 am DG and Renewable Energy in the Electric Cooperative Sector, Ed Torerro, National Rural Electric Cooperative Association 10:40 am Electrolytic Hydrogen from a Blend of Nuclear- and Wind-Produced Electricity,


netlognews, Volume 23, October, 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

to Investigate Hydrate Phenomena to Investigate Hydrate Phenomena New Technologies Bolster Function of Prosthetic Limbs NETL Scientist Wins 2011 Gustav Eirich Award Researcher Recognized for Work in CO2 Utilization NETL's APECS Co-simulation Technology Highlighted in CAPE-OPEN Presentation National Risk Assessment Partnership holds Initial Stakeholder Group Meeting Research Team Develops/ Demonstrates Models to Optimize IGCC Computational Methods Used to Study Dissolution of Engineered Biomaterials Wyoming Geophysical Survey Completed for Potential Use of Produced Water Recent NETL Publications Contact National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321 541-967-5892 2175 University Avenue South Suite 201 Fairbanks, AK 99709 907-452-2559 3610 Collins Ferry Road P.O. Box 880


2-M Probe At Teels Marsh Area (Shevenell, Et Al., 2008) | Open Energy  

Open Energy Info (EERE)

2-M Probe At Teels Marsh Area (Shevenell, Et Al., 2008) 2-M Probe At Teels Marsh Area (Shevenell, Et Al., 2008) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: 2-M Probe At Teels Marsh Area (Shevenell, Et Al., 2008) Exploration Activity Details Location Teels Marsh Area Exploration Technique 2-M Probe Activity Date Usefulness useful DOE-funding Unknown Notes Coolbaugh et al. (2007), Sladek et al. (2007), and Kratt, et al. (2008, this volume) describe a shallow temperature survey system in which temperatures can be measured quickly and inexpensively at 2 m depths. This system was tested at Desert Queen based on its structural setting and availability of thermal gradient well data obtained in the 1970's from which to make thermal anomaly comparisons. The system was subsequently used


Portsmouth Gaseous Diffusion Plant, Former Production Workers Screening  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Portsmouth Gaseous Diffusion Plant, Former Production Workers Portsmouth Gaseous Diffusion Plant, Former Production Workers Screening Projects Portsmouth Gaseous Diffusion Plant, Former Production Workers Screening Projects Project Name: Worker Health Protection Program Covered DOE Site: Portsmouth Worker Population Served: Production Workers Principal Investigator: Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office: Jeanne Cisco 2288 Wakefield Mound Road Piketon, OH 45661 Website: http://www.worker-health.org/ This project is conducted by the Unitedsteel Workers in conjunction with Queens College of the City University of New York. The program is being offered as a service to both former and current workers. Free of charge, eligible workers can receive a medical exam, including chest X-ray and


Investigation of an Invasive Ant Species: Nylanderia fulva Colony Extraction, Management, Diet Preference, Fecundity, and Mechanical Vector Potential  

E-Print Network (OSTI)

Invasive species often threaten biodiversity and environmental processes in their introduced range by extirpating native species due to competition for resources. Nylanderia fulva (formerly N. (=Paratrechina) sp. nr. pubens) is an ecologically dominant and economically important invasive species in the United States. This dissertation addresses aspects of the biology, behavior, management, and collection techniques for N. fulva. Specifically, topics investigated include a modified drip technique for extracting ants from their substrate, the effectiveness of a broadcast ant bait as a stand-alone treatment, the foraging preference and peak activity of workers, the reproductive potential of queens, and the ability of this species to translocate pathogenic microorganisms. The primary goal of these works was to better understand the biological idiosyncrasies of this species that may ultimately lead to the mitigation N. fulva populations. A modified drip technique was developed to quickly and efficiently extract N. fulva from their nesting substrates. Ants and their associated substrates were collected in 18.9 L buckets lined with talcum powder and transported to the laboratory. Substrates were weighted down and a cardboard tower was provided for the immigration of ants as they were forced out of substrates with a slow influx of water. Three applications of Advance Carpenter Ant Bait (ACAB) were applied to a N. fulva population in East Columbia, TX. A series of GIS interpolated maps depict achieved management and subsequent rebound of N. fulva populations. As great as 77% population reduction was achieved by 1 week post treatment, but N. fulva populations rebounded within 3-4 weeks. As a stand-alone treatment, this bait did not provide adequate ant management in treatment plots. Diet preference experiments were performed using artificial diets and food lures. These results of these trials indicated that N. fulva preferred the most carbohydrate rich diet offered through all seasons and that mint apple jelly or hot dog slices were the favored food lures. Diel foraging behavior was observed when temperatures were between 9.95 and 37.26 degrees C. Peak foraging activity occurred at 28.24 +/- 3.12 degrees C. A laboratory investigation of N. fulva suggested that as the number of queens increased, individual queen fecundity increased. This phenomenon is a novel observation among ants and suggests an alternative mechanism for intracolony dominance. Hexagyne colony fecundity of 0.25 +/- 0.12 eggs/queen/hr was the maximum fecundity observed. Results of laboratory experiments showed that N. fulva were capable of transferring E. coli up to 4.5 m in 6 hrs after acquisition from a contaminated source. Pyrosequencing of ectomicrobial assemblages revealed a suite of 518 bacteria and 135 fungi species associated with N. fulva, many of which are known pathogens of plants and animals, including humans. These results suggested that N. fulva should be regarded as both a medically and agriculturally important species.

McDonald, Danny 1983-


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Elevated tritium levels at the World Trade Center  

SciTech Connect

Traces of tritiated water (HTO) were detected at [the]World Trade Center (WTC) ground zero after the 9/11/01 terrorist attack. A method of ultralow-background liquid scintillation counting was used after distilling HTO from the samples. A water sample from the WTC sewer, collected on 9/13/01, contained 0.174 plus or minus 0.074 (2s) nCi/L of HTO. A split water sample, collected on 9/21/01 from the basement of WTC Building 6, contained 3.53 plus or minus 0.17 and 2.83 plus or minus 0.15 nCi/L, respectively. Several water and vegetation samples were analyzed from areas outside the ground zero, located in Manhattan, Brooklyn, Queens, and Kensico Reservoir. No HTO above the background was found in those samples. All these results are well below the levels of concern to human exposure.

Semkow, Thomas M.; Hafner, Ronald S.; Parekh, Pravin P.; Wozniak, Gordon J.; Haines, Douglas K.; Husain, Liaquat; Rabun, Robert L.; Williams, Philip G.



Integration of advanced geoscience and engineering techniques to quantify interwell heterogeneity in reservoir models. First annual report, September 29, 1993--September 30, 1994  

Science Conference Proceedings (OSTI)

The goal of this project is to provide a more quantitative definition of reservoir heterogeneity. This objective will be accomplished through the integration of geologic, geophysical, and engineering databases into a multidisciplinary understanding of reservoir architecture and associated fluid-rock and fluid-fluid interactions. The intent is to obtain a quantitative reservoir description incorporating outcrop, field, well-to-well, and laboratory core and fluid data of widely varying scales. This interdisciplinary effort will integrate geological and geophysical data with engineering and petrophysical results through reservoir simulation to quantify reservoir architecture and the dynamics of fluid-rock and fluid-fluid interactions. A more accurate reservoir description will allow greater accuracy and confidence during simulation and modeling as steps toward gaining greater recovery efficiency from existing reservoirs. A field laboratory, the Sulimar Queen Unit, is available for the field research activities that will be conducted.

Martin, F.D.; Buckley, J.S.; Weiss, W.W.; Ouenes, A.



Mailing Addresses for National Laboratories and Technology Centers |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mailing Addresses for National Laboratories and Mailing Addresses for National Laboratories and Technology Centers Mailing Addresses for National Laboratories and Technology Centers Name Telephone Number U.S. Department of Energy Albany Research Center 1450 Queen Ave. SW Albany, OR 97321-2198 541-967-5892 U.S. Department of Energy Ames Laboratory #311 TASF, Iowa State University Ames, Iowa 50011 515-294-2680 U.S. Department of Energy Argonne National Laboratory (East) 9700 S. Cass Avenue Argonne, IL 60439 630-252-2000 U.S. Department of Energy Argonne National Laboratory (West) P.O. Box 2528 Idaho Fall, ID 83403-2528 208-533-7341 U.S. Department of Energy Bettis Atomic Power Laboratory, Bechtel Bettis, Inc. 814 Pittsburgh McKeesport Boulevard West Mifflin, PA 15122-0079 412-476-5000 U.S. Department of Energy


2-M Probe At Tungsten Mountain Area (Shevenell, Et Al., 2008) | Open Energy  

Open Energy Info (EERE)

Shevenell, Et Shevenell, Et Al., 2008) Exploration Activity Details Location Tungsten Mountain Area Exploration Technique 2-M Probe Activity Date Usefulness useful DOE-funding Unknown Notes Coolbaugh et al. (2007), Sladek et al. (2007), and Kratt, et al. (2008, this volume) describe a shallow temperature survey system in which temperatures can be measured quickly and inexpensively at 2 m depths. This system was tested at Desert Queen based on its structural setting and availability of thermal gradient well data obtained in the 1970's from which to make thermal anomaly comparisons. The system was subsequently used at Tungsten Mountain and Teels and Rhodes Marshes to help locate blind geothermal systems. Of the new, blind geothermal sites identified through collaboration with the minerals industry, shallow temperature surveys were


Fuel Cell Freeze Workshop Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

Tuesday, February 1, 2005 8:30 Welcome- Workshop Expectations Nancy Garland, DOE 8:45 Glenn Skala, General Motors 9:10 Jeremy Meyers, UTC Fuel Cells 9:35 Ballard Contribution presented by Larry Blair, DOE consultant 9:55 Richard Gaylord, Plug Power 10:15 Break 10:30 Tom Zawodzinski, CWRU 10:50 Phil Ross, LBNL 11:10 Bryan Pivovar, LANL 11:30 Rajesh Ahluwalia, ANL 11:50 Lunch 12:45 Open Discussion Moderated by Doug Wheeler (NREL consultant) 1:45 Breakout Group Assignments and instructions - Shawna McQueen, Energetics 2:00 Breakout Groups (Effects) 3:00 Break 3:20 Breakout Groups (Challlenges) 4:30 Reconvene/Discuss break out group findings Wednesday, February 2, 2005 8:00 Breakout Groups (Research Directions) 10:00 Break


April 2003.pub  

NLE Websites -- All DOE Office Websites (Extended Search)

*Sequestration in the News *Recent Publications April 2003 *Sequestration in the News *Recent Publications April 2003 *Events and Announcements *Legislative Activity Sequestration in the News SOFC with CO 2 capture. A methane and oxygen powered solid oxide fuel cell achieves a thermal efficiency of 63.6% with carbon capture, according to this paper. "Performance of High Performance SOFC Combined Power Generation System with Carbon Dioxide Recovery," Energy Conversion & Management, Mar 2003, Vol. 44 (4). Geologic Storage First U.S. geologic sequestration field test underway in depleted oil well. In early 2003 researchers injected 2,100 tons of CO 2 into Strata's West Pearl Queen reservoir, New Mexico - about 40 tons per day. The plume migration will be



NLE Websites -- All DOE Office Websites (Extended Search)

Air, Land, Rail and Water Transportation Air, Land, Rail and Water Transportation Some hyperlinks on this page will take you to information that is not maintained by Brookhaven. Brookhaven is not responsible for any inaccuracies or other errors contained therein, nor does it constitute an endorsement for any of the services listed. By clicking any remote or offsite hyperlink, you acknowledge that you have read and agree with this statement. Please verify rates at the time of booking. Air Transportation Long Island MacArthur, (ISP) Ronkonkoma, 1-800-542-4776 (Airport Information) John F. Kennedy International (JFK) - Brooklyn, (718) 244-4444 (Airport Information) LaGuardia (LGA) - Queens, NY (718) 476-5000 (Airport Information) Newark International (EWR) Newark, NJ (973) 961-6000 (Airport Information)


2-M Probe At Rhodes Marsh Area (Shevenell, Et Al., 2008) | Open Energy  

Open Energy Info (EERE)

2-M Probe At Rhodes Marsh Area (Shevenell, Et Al., 2-M Probe At Rhodes Marsh Area (Shevenell, Et Al., 2008) Exploration Activity Details Location Rhodes Marsh Area Exploration Technique 2-M Probe Activity Date Usefulness useful DOE-funding Unknown Notes Coolbaugh et al. (2007), Sladek et al. (2007), and Kratt, et al. (2008, this volume) describe a shallow temperature survey system in which temperatures can be measured quickly and inexpensively at 2 m depths. This system was tested at Desert Queen based on its structural setting and availability of thermal gradient well data obtained in the 1970's from which to make thermal anomaly comparisons. The system was subsequently used at Tungsten Mountain and Teels and Rhodes Marshes to help locate blind geothermal systems. References Lisa Shevenell, Mark Coolbaugh, Chris Sladek, Rick Zehner, Chris


Effect of pollen diet and honey bee (apis mellifera l.) primer pheromones on worker bee food producing glands  

E-Print Network (OSTI)

This thesis examines three factors that may influence the change in protein content and size of the brood food glands in honey bees. Effects on the mandibular gland, involved in the production of brood food and in royal jelly, have not been examined in relation to primer pheromones while effects on the hypopharyngeal glands, also involved in the production of brood food, have not been examined in relation to queen mandibular pheromone. This thesis provides preliminary insight into how these pheromones affect the extractable protein content of brood food glands. The first study in this thesis assessed the effects of brood pheromone (BP), queen mandibular pheromone (QMP), and pollen presence on the protein content of hypopharyngeal and mandibular glands of the honey bee. In this study, newly emerged bees were caged for 12 days in one of eight treatments: Queenless state: 1) control (no pollen + no pheromone), 2) pollen, 3) BP, 4) BP + pollen; Queenright state: 1) QMP, 2) QMP + pollen, 3) BP + QMP, 4) BP + QMP + pollen. This study indicated that regardless of pheromone treatment, the most influential factor on gland protein content and size was pollen. The second experiment examined effects of varying pollen dilution on hypopharyngeal and mandibular gland protein content, bee mass, and lipid content of the honey bee. In this experiment, newly emerged bees were caged for 7 days and fed one of five treatments: pollen, 1:1 pollen: cellulose (vol:vol), 1:2 pollen: cellulose (vol:vol); 1:3 pollen: cellulose (vol:vol), and cellulose. This study indicated that bees on the pollen diet were significantly greater than all other diluted diets in measurements of hypopharyngeal gland protein content, lipid content, and mass with significantly less consumption. However, mandibular gland protein content of bees on the pollen diet was significantly greater only from pure cellulose.

Peters, Lizette Alice



Equivariant Kaehler Geometry and Localization in the G/G Model  

E-Print Network (OSTI)

We analyze in detail the equivariant supersymmetry of the $G/G$ model. In spite of the fact that this supersymmetry does not model the infinitesimal action of the group of gauge transformations, localization can be established by standard arguments. The theory localizes onto reducible connections and a careful evaluation of the fixed point contributions leads to an alternative derivation of the Verlinde formula for the $G_{k}$ WZW model. We show that the supersymmetry of the $G/G$ model can be regarded as an infinite dimensional realization of Bismut's theory of equivariant Bott-Chern currents on K\\"ahler manifolds, thus providing a convenient cohomological setting for understanding the Verlinde formula. We also show that the supersymmetry is related to a non-linear generalization (q-deformation) of the ordinary moment map of symplectic geometry in which a representation of the Lie algebra of a group $G$ is replaced by a representation of its group algebra with commutator $[g,h] = gh-hg$. In the large $k$ limit it reduces to the ordinary moment map of two-dimensional gauge theories.

Matthias Blau; George Thompson



Fungal glycoside hydrolases for saccharification of lignocellulose: outlook for new discoveries fueled by genomics and functional studies  

DOE Green Energy (OSTI)

Genome sequencing of a variety of fungi is a major initiative currently supported by the Department of Energys Joint Genome Institute. Encoded within the genomes of many fungi are upwards of 200+ enzymes called glycoside hydrolases (GHs). GHs are known for their ability to hydrolyze the polysaccharide components of lignocellulosic biomass. Production of ethanol and next generation biofuels from lignocellulosic biomass represents a sustainable route to biofuels production. However this process has to become more economical before large scale operations are put into place. Identifying and characterizing GHs with improved properties for biomass degradation is a key factor for the development of cost effective processes to convert biomass to fuels and chemicals. With the recent explosion in the number of GH encoding genes discovered by fungal genome sequencing projects, it has become apparent that improvements in GH gene annotation processes have to be developed. This will enable more informed and efficient decision making with regard to selection and utilization of these important enzymes in bioprocess that produce fuels and chemicals from lignocellulosic feedstocks.

Jovanovic, Iva; Magnuson, Jon K.; Collart, Frank R.; Robbertse, Barbara; Adney, William S.; Himmel, Michael E.; Baker, Scott E.



Caldicellulosiruptor Core and Pangenomes Reveal Determinants for  

Science Conference Proceedings (OSTI)

Extremely thermophilic bacteria of the genus Caldicellulosiruptor utilize carbohydrate components of plant cell walls, including cellulose and hemicellulose, facilitated by a diverse set of glycoside hydrolases (GHs). From a biofuel perspective, this capability is crucial for deconstruction of plant biomass into fermentable sugars. While all species from the genus grow on xylan and acidpretreated switchgrass, growth on crystalline cellulose is variable. The basis for this variability was examined using microbiological, genomic, and proteomic analyses of eight globally diverse Caldicellulosiruptor species. The open Caldicellulosiruptor pangenome (4,009 open reading frames [ORFs]) encodes 106 GHs, representing 43 GH families, but only 26 GHs from 17 families are included in the core (noncellulosic) genome (1,543 ORFs). Differentiating the strongly cellulolytic Caldicellulosiruptor species from the others is a specific genomic locus that encodes multidomain cellulases from GH families 9 and 48, which are associated with cellulose-binding modules. This locus also encodes a novel adhesin associated with type IV pili, which was identified in the exoproteome bound to crystalline cellulose. Taking into account the core genomes, pangenomes, and individual genomes, the ancestral Caldicellulosiruptor was likely cellulolytic and evolved, in some cases, into species that lost the ability to degrade crystalline cellulose while maintaining the capacity to hydrolyze amorphous cellulose and hemicellulose.

Blumer-Schuette, Sara E. [North Carolina State University; Giannone, Richard J [ORNL; Zurawski, Jeffrey V [North Carolina State University; Ozdemir, Inci [North Carolina State University; Ma, Qin [University of Georgia, Athens, GA; Yin, Yanbin [University of Georgia, Athens, GA; Xu, Ying [University of Georgia, Athens, GA; Kataeva, Irena [University of Georgia, Athens, GA; Poole, Farris [University of Georgia, Athens, GA; Adams, Michael W. W. [University of Georgia, Athens, GA; Hamilton-Brehm, Scott [ORNL; Elkins, James G [ORNL; Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Cottingham, Robert W [ORNL; Hettich, Robert {Bob} L [ORNL; Kelly, Robert M [North Carolina State University



Distributed Sensor Coordination for Advanced Energy Systems  

Science Conference Proceedings (OSTI)

The ability to collect key system level information is critical to the safe, efficient and reli- able operation of advanced energy systems. With recent advances in sensor development, it is now possible to push some level of decision making directly to computationally sophisticated sensors, rather than wait for data to arrive to a massive centralized location before a decision is made. This type of approach relies on networked sensors (called agents from here on) to actively collect and process data, and provide key control deci- sions to significantly improve both the quality/relevance of the collected data and the as- sociating decision making. The technological bottlenecks for such sensor networks stem from a lack of mathematics and algorithms to manage the systems, rather than difficulties associated with building and deploying them. Indeed, traditional sensor coordination strategies do not provide adequate solutions for this problem. Passive data collection methods (e.g., large sensor webs) can scale to large systems, but are generally not suited to highly dynamic environments, such as ad- vanced energy systems, where crucial decisions may need to be reached quickly and lo- cally. Approaches based on local decisions on the other hand cannot guarantee that each agent performing its task (maximize an agent objective) will lead to good network wide solution (maximize a network objective) without invoking cumbersome coordination rou- tines. There is currently a lack of algorithms that will enable self-organization and blend the efficiency of local decision making with the system level guarantees of global decision making, particularly when the systems operate in dynamic and stochastic environments. In this work we addressed this critical gap and provided a comprehensive solution to the problem of sensor coordination to ensure the safe, reliable, and robust operation of advanced energy systems. The differentiating aspect of the proposed work is in shift- ing the focus towards what to observe rather than how to observe in large sensor networks, allowing the agents to actively determine both the structure of the network and the relevance of the information they are seeking to collect. In addition to providing an implicit coordination mechanism, this approach allows the system to be reconfigured in response to changing needs (e.g., sudden external events requiring new responses) or changing sensor network characteristics (e.g., sudden changes to plant condition). Outcome Summary: All milestones associated with this project have been completed. In particular, private sensor objective functions were developed which are aligned with the global objective function, sensor effectiveness has been improved by using sensor teams, system efficiency has been improved by 30% using difference evaluation func- tions, we have demonstrated system reconfigurability for 20% changes in system con- ditions, we have demonstrated extreme scalability of our proposed algorithm, we have demonstrated that sensor networks can overcome disruptions of up to 20% in network conditions, and have demonstrated system reconfigurability to 20% changes in system conditions in hardware-based simulations. This final report summarizes how each of these milestones was achieved, and gives insight into future research possibilities past the work which has been completed. The following publications support these milestones [6, 8, 9, 10, 16, 18, 19].

Tumer, Kagan



Navigating the Federal Hiring Process | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Navigating the Federal Hiring Process Navigating the Federal Hiring Process Navigating the Federal Hiring Process September 13, 2013 8:30AM to 4:00PM EDT Registration link: CHRIS (002298/0009) $200 Course type: Classroom Course Location: DOE Headquarters, Forrestal Building, Washington, DC/ Room GH-043 Course Description: Hiring decisions are among the most important decisions an organization makes. Successful accomplishment of DOE's mission depends on the ability of managers to recruit and retain a dedicated, high-performing workforce. This workshop focuses on The importance of planning and preparation to support new supervisors in finding the right employees with the right skills for the right jobs The partnership between supervisors and human resources in relation to: long-term planning with appropriate HR and budget data


Federal Budgeting Process | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Federal Budgeting Process Federal Budgeting Process Federal Budgeting Process September 11, 2013 8:30AM EDT to September 12, 2013 4:00PM EDT Registration link: CHRIS (000412/0031) $400.00 Course type: Classroom Course Location: DOE Headquarters, Forrestal Building, Washington, DC / WCF-GH-043 Course Description: This course is designed for experienced program and project managers to acquire a working knowledge of DOE's financial and managerial systems to accomplish the Department's budgeting and accounting processes. Processes include preparing, reviewing, presenting, and defending budget submissions. Foundation skills are taught in this course that are required to manage a DOE project through its financial life cycle, including managing the flow of funds to programs and projects, validating



NLE Websites -- All DOE Office Websites (Extended Search)

ENERGY: ENERGY: ITS TECHNOLOGIES AND APPLICATIONS P a u l C . Auh June 1978 BNL- 24832 7go75;a S o l a r Technology Group Department of Energy and Environment Brookhaven N a t i o n a l L a b o r a t o r y Upton, New York 11973 _ . . NOTICE ma report was prepared as an account of work sponsored by the United Stater Government. Neither the United Stater nor the United Stater Department of Encrw, nor any of their employees, nor any of their contractors, subcontractors, or their employees. makes any warranty, express or mplied, or assumes any legal liability or rcrponribdity far the accuracy. completeness or usefulness of any dormallon. apparatus, product or p r o w s daclased, or reprcsenU that 81s use would no1 infringe privately owned 6ghU. Date, Gs DISCLAIMER This report was prepared as an account of work sponsored by an


ESS 2012 Peer Review - Flow-Assisted Zinc Anode Batteries for Grid-Scale Electricity Storage - Sanjoy Banerjee, CUNY Energy Institute  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GRID-CONNECTED SYSTEM! GRID-CONNECTED SYSTEM! !"#$%&'()* !"#$%&'()* The CUNY EI is developing and testing hardware/software systems for peak shaving applications in commercial and industrial buildings 30KWH DEMONSTRATION !"#$%&'()*+&,-./01&2134/5& 6/57+340-4/3&809-+&6/5-+6&:%-0;/& 0/68:'?&@+/0;1&A+3<484/& & '()*+&B(CC&9/&(+4/;0-4/6&B(4%&D+E F )*+& (+&F"G!& G""H&=1:C/3& I&J"K&=7C859(:&@L:(/+:1& I&M"K&@+/0;1&@L:(/+:1& & =755/0:(-C(N/6&91&>09-+&@C/:40(:&O7B/0& %.PQRR340(+;"""GS8/P(+:S:75& FLOW-ASSISTED ZINC ANODE BATTERIES FOR GRID-SCALE ELECTRICITY STORAGE !


S A V A N N A H R I V E R S I T E  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Excerpts from Excerpts from "Strengthening Energy Security through Federal Partnerships" 67 ENE RGY The Military Engineer * No. 676 The need to shrink depen dence on fos- sil fuels is not a new conce pt in the na- tion's energy discus sion, nor is the need to invest in clean, renew able energy . But the challe nge of how to deliver solar, bioma ss, wind, wave, geothe rmal and other power genera tion techno logies in a cost effecti ve, large-s cale mann er-an d meet the chang - ing energy deman ds of the nation -is a very curren t one indeed . Throu gh a partne rship with the U.S. Army Corps of Engin eers (USAC E) Sa- vanna h Distri ct, Depar tment of Energ y (DOE ), Savan nah River Nation al Labor a- tory (SRNL ) and other federa l entitie s, the South east Energ y Initiat ive (SEEI) is pro- active


Microsoft Word - Agenda F&I Update 090804.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

August 4, 2009 August 4, 2009 10:00 AM to 12:00 PM - Conference Room GH-019 Agenda Call in Number 301-903-6379 Confirmation Number 253041 Internet Access and Projector Will Be Available The presentations will be available via webcast. To watch the presentation you will not need any software installed on your workstations nor will you need to enter a pass code to view the presentations. Go to the following link: https://vulcan.doe.gov:11776/imtapp/app/cmn_jm.uix?mID=249750&src=app/home Agenda Topic Speaker Welcome Phil Dalby Opening Comments Paul Bosco OMB Quarterly Goals Review: DOE Real Property Management Peter O'Konski MA F&I QPR 4th Quarter Deliverables Phil Dalby FY 2009/2010 FIMS Data Validations Phil Dalby FY 2010 FIMS/RPAM Training Schedule Phil Dalby


Managing Up Down & Across | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Managing Up Down & Across Managing Up Down & Across Managing Up Down & Across February 11, 2014 8:30AM EST to February 12, 2014 4:00PM EST Registration link: CHRIS 001818/0014 $400.00 Course Type: Classroom Course Location: Forrestal RM-GH 043 Course Description: The bottom line for all organizations is to get results, achieve the mission, and work effectively toward the vision set by top management. This course shows those in the middle of the management ladder how to develop the skills to achieve all of these goals. The course helps participants think and work differently to become a more effective manager, influencer, relationship-builder, persuader, delegator, and advisor who can be trusted to move people and the agenda along. This course's highly participatory class on managing from the middle lays the

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Glycoside hydrolase inventory drives plant polysaccharide deconstruction by the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus  

NLE Websites -- All DOE Office Websites (Extended Search)

Glycoside Glycoside Hydrolase Inventory Drives Plant Polysaccharide Deconstruction by the Extremely Thermophilic Bacterium Caldicellulosiruptor saccharolyticus Amy L. VanFossen, Inci Ozdemir, Samantha L. Zelin, Robert M. Kelly Department of Chemical and Biomolecular Engineering, North Carolina State University, Raleigh, NC 27695-7905; telephone: 919-515-6396; fax: 919-515-3465; e-mail: rmkelly@eos.ncsu.edu Received 15 November 2010; revision received 22 January 2011; accepted 1 February 2011 Published online in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/bit.23093 ABSTRACT: The genome of Caldicellulosiruptor saccharoly- ticus encodes a range of glycoside hydrolases (GHs) that mediate plant biomass deconstruction by this bacterium. Two GH-based genomic loci that appear to be central to the hydrolysis of hemicellulosic and cellulosic substrates


Structure of Acidothermus cellulolyticus family 74 glycoside hydrolase at 1.82 A resolution  

NLE Websites -- All DOE Office Websites (Extended Search)

Acta Acta Cryst. (2013). F69, 1335-1338 doi:10.1107/S1744309113030005 1335 Acta Crystallographica Section F Structural Biology and Crystallization Communications ISSN 1744-3091 Structure of Acidothermus cellulolyticus family 74 glycoside hydrolase at 1.82 A ˚ resolution Markus Alahuhta, William S. Adney, Michael E. Himmel and Vladimir V. Lunin* BioSciences Center, National Renewable Energy Laboratory, 15013 Denver West Parkway, Golden, CO 80401, USA Correspondence e-mail: vladimir.lunin@nrel.gov Received 27 September 2013 Accepted 1 November 2013 PDB reference: family 74 glycoside hydrolase, 4lgn Here, a 1.82 A ˚ resolution X-ray structure of a glycoside hydrolase family 74 (GH74) enzyme from Acidothermus cellulolyticus is reported. The resulting structure was refined to an R factor of 0.150 and an R free of 0.196. Structural analysis shows that five related structures



Office of Legacy Management (LM)

- . - . 'i,. . 4.... J ' I fice Memorandum * UNITED STATES GOVERNMENT ( :{:o ,: J.K. Gust&sfon, Director, Division of Raw DATE: August 4, 1948 P/ Materials I:OM :F.. SJr, and M.G. McGrath t SU3JECTSOIC2Gh:G TI£'N OF CAO30TITE ORES BY VANADIUM CORPORATICN OF AMT.ICA Tihe modern accepted laboratory research practice to develop the lowest cost and most eff.icient method of mineral dressing is, first, to attempt ccncen- tration of the ore minerals, with subsequent treatment of the concent,-ted prod:uct. It is only after thorough research efforts of concentrati-on hav fi-.led that treatment of the total ore is considered. The benefit. c.f : corceitra.tioin re several-fold and include lower rlant initial capital in- vcetm.ent :and lower pl-nt operating costs as the major achievements.


l!Jm~~Ut~'1CV GrandChalienge",regardiessexl,'Cpt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

,;,,,,,..<:,,) ,;,,,,,..<:,,) l!Jm~~Ut~'1CV GrandChalienge",regardiessexl,'Cpt tiide'rnJtlrsuant toP.,L 96-511,'asamended, and Natiunal i11lcnsifi.catiol1 capabHffies which yield.amatic cn~gf to a wide range chemical producti()n~ iB) High,. of stich inod refining, non.cmctallic.materials ·IKi[tHtle!tm4;ti. l't.~"<.4 u.an'~:1:;f:) .1.'<1 conventi onal hi gh jeat.!,\iltnillnl·l'AiJ1l~illl~t!l Recvvery - .... ,·"", :l~IWtlra.,;:c~ftjcjtl\tl'tsteaJn.PJtlfYd!uctio}jti!hilgh perr~lanceJllmacesand 5ustainability7 reduced ""liter and a carbQn t(lOtprint li)f indt.t,'}try; (D) Sustainable Manufacturing


Advanced Reading Workshop | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Advanced Reading Workshop Advanced Reading Workshop Advanced Reading Workshop October 22, 2013 8:30AM EDT to October 23, 2013 4:00PM EDT Registration link: CHRIS (002227/0006) $200 Course type: Classroom Course Location: DOE Headquarters, Forrestal Building, Washington, DC/ Room GH-043 Course Description: This workshop is designed to increase the reading rate of the average person from 2 to 5 times. There can be marked improvement in the areas of concentration, accuracy, retention and study skills for participants. This hands on learn-by-doing course is geared to all phases of reading, from light reading to in-depth study. Old "Dick and Jane" reading habits will be replaced with new phase reading skills achieved by a variety of eye-brain exercises to widen the span of perception, develop


MA - Office of Management - Energy Conservation Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MA Energy Conservation Plan MA Energy Conservation Plan January 2010 1 Office of Management Office-Level Energy Conservation Plan January 2010 I. BACKGROUND This energy conservation plan represents an effort to reduce energy consumption within Office of Management (MA) office spaces and to increase employee awareness of and participation in energy conservation measures. II. SCOPE The plan and procedures in this document apply to all Office of Management (MA) office suites in the Forrestal and Germantown Facilities as well as the 950 L'Enfant Plaza Building. The actions and procedures set forth in this plan apply to each separate MA office suite as follows: MA-1: 4A-107 MA-43: 1F-039 MA-70: 7E-074 MA-1.1: 7E-028 MA-43: 1F-037 MA-70: 7E-054 MA-30: GH-081 MA-43:



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I.OJ) I.OJ) RECIPIENT:3M Company U.S. DEPAR.TlV.IENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlVIINATION Page 1 of2 STATE: MN PROJECT TITLE: H1gh Performance. Durable, Low Cost Membrane Electrode Assemblies for Transportation Applications Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE FOA-0000360 DE-EE0005667 GF0-0005667-001 G05667 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45l.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 83.6 Small-scale S1t1ng, constructron, modification , operation, and decommrssronrng of facrlitres for smallscale research researc


Trustworthy Customer Services | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Trustworthy Customer Services Trustworthy Customer Services Trustworthy Customer Services January 15, 2014 8:30AM EST to January 16, 2014 4:00PM EST Registration link: CHRIS 002452/0001$400.00 Course Type: Classroom Course Location: Forrestal RM GH-043 Course Description: In this interactive course, participants learn how to improve their customer service skills to build stronger and more effective relationships with customers, and to improve their overall individual and organizational effectiveness. Participants learn how to identify customers and their needs, and learn the fundamental attributes of strong customer service skills. The course uses a series of mini case studies and individual assessments to help participants focus on the steps they need to take to provide exceptional customer service. Participants receive a set of


Multiple System Rate Process  

NLE Websites -- All DOE Office Websites (Extended Search)

DSW Multiple System Transmission Rate Process DSW Multiple System Transmission Rate Process Federal Register Notice Withdrawing Rate Proposal (PDF) Formal Process Extension Federal Register Notice (PDF) Customer Savings Under Various MSTR (XLS) Public Information Forum March 29, 2005 Customer Meeting Overview (Power Point) Customer Meeting Overview (PDF) Customer Meeting Transcript (PDF) Public Comment Forum April 6, 2005 Customer Meeting Transcript (PDF) Response Letter 5-17-05 (PDF) Customer Letters Tonopah ID-5/25/05 (PDF) APS-5/26/05 (PDF) SRP-5/27/05 (PDF) RSLynch-6/1/05 (PDF) KRSaline-6/1/05 (PDF) Formal Process Federal Register Notice (Word) Federal Register Notice (PDF) Brochure (Word) Appendices to Brochure: A B C D E1 E2 F1 F2 GH Public Information Forum July 14, 2004 Customer Meeting Overview (Power Point)


Accessibility of pores in coal to methane and carbon dioxide  

NLE Websites -- All DOE Office Websites (Extended Search)

Accessibility Accessibility of pores in coal to methane and carbon dioxide 3 Yuri B. Melnichenko a,b,⇑ , Lilin He a , Richard Sakurovs c,⇑ , Arkady L. Kholodenko d , Tomasz Blach e , 4 Maria Mastalerz f , Andrzej P. Radlin ´ ski e,f , Gang Cheng g,h , David F.R. Mildner i 5 a Neutron Scattering Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA 6 b Department of Physics and Astronomy, University of Tennessee, Knoxville, TN 37996, USA 7 c CSIRO Energy Technology, 11 Julius Avenue, North Ryde, 2113 NSW, Australia 8 d 375 H.L. Hunter Laboratories, Clemson University, Clemson, SC 29634-0973, USA 9 e Nanoscale Science and Technology Centre, Griffith University, Nathan 4111, Brisbane, Australia 10 f Indiana Geological Survey, Indiana University, Bloomington, IN 47405-2208, USA 11 g Sandia National Laboratories, Q1 Livermore, CA 94551, USA 12 h Sandia National Laboratories, Albuquerque,



NLE Websites -- All DOE Office Websites (Extended Search)

arabinan-specific arabinan-specific D D-1,2- arabinofuranosidase identified from screening the activities of bacterial GH43 glycoside hydrolases Alan Cartmell 1,2 *, Lauren McKee 1,2 *, Maria J. Peña 2 , Johan Larsbrink 3 , Harry Brumer 3 , Satoshi Kaneko 4 , Hitomi Ichinose 4 , Richard J. Lewis 1 , Anders Viksø-Nielsen 5 , Harry J. Gilbert 1,2¶ and Jon Marles-Wright 1 1 Institute for Cell and Molecular Biosciences, Newcastle University, The Medical School, Newcastle upon Tyne NE2 4HH, U.K; 2 The Complex Carbohydrate Research Center, The University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA; 3 School of Biotechnology, Royal Institute of Technology, AlbaNova University Centre, 10691 Stockholm, Sweden; 4 Food Biotechnology Division, National Food Research Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan,


The Family  

NLE Websites -- All DOE Office Websites (Extended Search)

Family Family 1 Glycoside Hydrolase from Clostridium cellulolyticum H10 is a Cellodextrin Glucohydrolase Wenjin Liu & David R. Bevan & Y.-H. Percival Zhang Received: 29 May 2009 / Accepted: 15 September 2009 # Humana Press 2009 Abstract The only family 1 glycoside hydrolase in Clostridium cellulolyticum H10 (CcGH1) is annotated as a beta-galactosidase but has high sequence homology with many beta- glucosidases. Given the possible importance of beta-glucosidase in cellulose utilization by C. cellulolyticum, the encoding open reading frame Ccel_0374 was cloned and expressed in E. coli as a soluble fusion protein with thioredoxin. After tag cleavage, the purified enzyme had a molecular mass of 52 kDa and was active in dimeric form on a broad range of substrates, including cellobiose, cellotriose, cellotetraose, p-nitrophenyl-beta-glucopyranoside, lactose, and o-nitrophenyl-beta-galactopyranoside.


Chemical Storage-Overview  

NLE Websites -- All DOE Office Websites (Extended Search)

Storage - Storage - Overview Ali T-Raissi, FSEC Hydrogen Storage Workshop Argonne National Laboratory, Argonne, Illinois August 14-15, 2002 Hydrogen Fuel - Attributes * H 2 +½ O 2 → H 2 O (1.23 V) * High gravimetric energy density: 27.1 Ah/g, based on LHV of 119.93 kJ/g * 1 wt % = 189.6 Wh/kg (0.7 V; i.e. η FC = 57%) * Li ion cells: 130-150 Wh/kg Chemical Hydrides - Definition * They are considered secondary storage methods in which the storage medium is expended - primary storage methods include reversible systems (e.g. MHs & C-nanostructures), GH 2 & LH 2 storage Chemical Hydrides - Definition (cont.) * The usual chemical hydride system is reaction of a reactant containing H in the "-1" oxidation state (hydride) with a reactant containing H in the "+1" oxidation


Microsoft Word - SAFARI 2000_special_ed_refs_20040804.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Global Change Biology Global Change Biology March 2004 - Volume 10 Issue 3 The SAFARI 2000 - Kalahari Transect Wet Season Campaign of year 2000 HH. Shugart, SA. Macko, P. Lesolle, TA. Szuba, MM. Mukelabai, P. Dowty, RJ. Swap Global Change Biology 2004 10:3 p. 273 Vegetation structure characteristics and relationships of Kalahari woodlands and savannas JL. Privette, Y. Tian, G. Roberts, RJ. Scholes, Y. Wang, KK. Caylor, P. Frost, M. Mukelabai Global Change Biology 2004 10:3 p. 281 Canopy structure in savannas along a moisture gradient on Kalahari sands Robert J. Scholes, Peter GH. Frost, Yuhong Tian Global Change Biology 2004 10:3 p. 292 Effects of precipitation and soil water potential on drought deciduous phenology in the Kalahari William M. Jolly, Steven W. Running



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STA'n:MENT OF CONSIDERAT STA'n:MENT OF CONSIDERAT IONS REQUEST BY CORNING J 'CORP ORA TED (CORNING) FOR AN ADV t\NCE WAIV ER OF DOMESTIC AN D FOREIGN P ATENT RIGHTS UNDER DOE A WARD 0 . DE-E£000575 7 W(A) 20 12-034 CORNING has req uested a waive r of domestic and fo reign patent rights for all subj ect in vent ions arising from its partjci pation und er the above-referenced awa rd entitled " Innovative Manufactw-ing of Protected Lithium Electrodes for UltraHi gh Energy Density Batteries." The award was made under the Innovative Manufacturing Initiati ve (DE-FOA-0000560). CORNING is a sub-recipient to PolyPfus Battery Company (Poly Plus), the prime recipi ent of the award. Johnson Controls Inc . is anothar sub-recipi ent under the award. This waiver only applies to CORNING. Johnson Control


Designing New Transit Bus Garages to be Fuel Flexible  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Designing New Transit Bus Garages to be Fuel Flexible Prepared By: Marathon Technical Services Six Venus Crescent P.O. Box 318 Heidelberg, Ontario, Canada N0B1Y0 Telephone: 519-699-9250 May 12, 2006 ______________________________________________________________________________ DESIGNING NEW TRANSIT BUS GARAGES TO BE FUEL FLEXIBLE Background Information Before discussing the building design features that are recommended for CNG and GH2 buses, it is important to understand what makes these fuels different from gasoline or diesel. The items below summarize the basic differences between the properties of gaseous and liquid fuels that influence the building design changes: 1. Natural Gas and Hydrogen are both lighter-than-air and in gaseous form at atmospheric


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81 - 17190 of 28,905 results. 81 - 17190 of 28,905 results. Rebate OGE- Commercial Energy Efficiency Rebate Programs Oklahoma Gas and Electric (OGE) offers lighting, HVAC, motor and other custom rebates to their commercial customers in Arkansas to improve the energy efficiency of their facilities. The lighting... http://energy.gov/savings/oge-commercial-energy-efficiency-rebate-programs-0 Event Managing Up Down & Across Registration link: CHRIS 001818/0014 $400.00Course Type: ClassroomCourse Location: Forrestal RM-GH 043Course Description: The bottom line for all organizations is to get results, achieve the... http://energy.gov/dvu/events/managing-down-across Download Class Patent Waiver W(C)2009-005 This is a request by PHOTOVOLTAIC SUPPLY CHAIN for a DOE waiver of domestic and foreign patent rights under agreement DE-PS36-09GO99003


MINI-REVIEW Processive  

NLE Websites -- All DOE Office Websites (Extended Search)

Processive Processive and nonprocessive cellulases for biofuel production-lessons from bacterial genomes and structural analysis David B. Wilson Received: 23 September 2011 / Revised: 18 October 2011 / Accepted: 1 November 2011 / Published online: 24 November 2011 # Springer-Verlag 2011 Abstract Cellulases are key enzymes used in many processes for producing liquid fuels from biomass. Cur- rently there many efforts to reduce the cost of cellulases using both structural approaches to improve the properties of individual cellulases and genomic approaches to identify new cellulases as well as other proteins that increase the activity of cellulases in degrading pretreated biomass materials. Fungal GH-61 proteins are important new enzymes that increase the activity of current commercial cellulases leading to lower total protein loading and thus lower cost. Recent work has greatly increased


Delegations Develop Others Through Shared Work | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Delegations Develop Others Through Shared Work Delegations Develop Others Through Shared Work Delegations Develop Others Through Shared Work March 4, 2014 8:30AM to 4:00PM EST Registration link: CHRIS 002438/0001 $200.00 Course Type: Classroom Course Location: Forrestal RM-GH 043 Course Description: Effective delegation is one of the most powerful tools for leading and directing the work of others. This workshop shows participants how to design delegation plans for their teams. It covers some of the common myths and misconceptions about delegating work to others and shows how good delegation is customized to needs and abilities of individual employees. Audience: Course meets the 8 hours of the mandatory second year 40-hour training for new supervisors. Experienced supervisors may want to take the course as a refresher. Appropriate for those directly or indirectly


Flexible Ultra Moisture Barrier Film for Thin-Film Photovoltaic Applications  

Science Conference Proceedings (OSTI)

Flexible Thin-film photovoltaic (TFPV) is a low cost alternative to incumbent c-Si PV products as it requires less volume of costly semiconductor materials and it can potentially reduce installation cost. Among the TFPV options, copper indium gallium diselenide (CIGS) has the highest efficiency and is believed to be one of the most attractive candidates to achieve PV cost reduction. However, CIGS cells are very moisture sensitive and require module water vapor transmission rate (WVTR) of less than 1x10-4 gram of water per square meter per day (g-H2O/m2/day). Successful development and commercialization of flexible transparent ultra moisture barrier film is the key to enable flexible CIGS TFPV products, and thus enable ultimate PV cost reduction. At DuPont, we have demonstrated at lab scale that we can successfully make polymer-based flexible transparent ultra moisture barrier film by depositing alumina on polymer films using atomic layer deposition (ALD) technology. The layer by layer ALD approach results in uniform and amorphous structure which effectively reduces pinhole density of the inorganic coating on the polymer, and thus allow the fabrication of flexible barrier film with WVTR of 10-5 g-H2O/m2/day. Currently ALD is a time-consuming process suitable only for high-value, relatively small substrates. To successfully commercialize the ALD-on-plastic technology for the PV industry, there is the need to scale up this technology and improve throughput. The goal of this contract work was to build a prototype demonstrating that the ALD technology could be scaled-up for commercial use. Unfortunately, the prototype failed to produce an ultra-barrier film by the close of the project.

David M. Dean


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Leptin gene expression and circulating leptin in relation to luteinizing hormone, growth hormone, insulin, and insulin-like growth factor-I in prepubertal heifers  

E-Print Network (OSTI)

The present study tested the hypothesis that short-term fasting would reduce leptin gene expression, circulating leptin, and luteinizing hormone (LH) pulsatility in prepubertal heifers in association with a decrease in circulating concentrations of insulin and insulin-like growth factor-I (IGF-I). Twelve prepubertal crossbred heifers (average body weight = 315 [] 5 kg) were assigned randomly to one of two treatments in two replicates: 1) Control; normal feed consumption (n=6) and 2) Fasted; 48 h of total feed restriction (n=6). Blood samples were collected at 15-min intervals for 8 h on Days 0 and 2 of the experiment, and twice on Day 1. Subcutaneous fat samples were collected before treatment onset (Day -1) and at the end of the intensive blood sampling on Day 2. Acute feed restriction markedly reduced leptin messenger ribonucleic acid (mRNA) in adipose tissue (p < 0.01) and circulating concentrations of leptin (p < 0.05), IGF-I (p < 0.01), and insulin (p = 0.05) compared to Controls on Day 2. Moreover, the treatment x day interaction (p < 0.076) and within-day contrasts (expressed as a percentage of Day 0 values) revealed that the mean frequency of LH pulses in the fasted group declined (p < 0.01) and was lower (p < 0.06) than in Controls on Day 2. Neither mean concentrations of growth hormone (GH) nor GH secretory dynamics were affected by acute feed restriction. Fasting-mediated decreases in leptin gene expression and circulating leptin, in association with reductions in secretion of IGF-I, insulin, and LH, provide a basis for investigating leptin as a metabolic hormone that signals energy status to the central reproductive axis in cattle.

Amstalden, Marcel




NLE Websites -- All DOE Office Websites (Extended Search)

Bees Bees Nature Bulletin No. 13 May 5, 1945 Forest Preserve District of Cook County Clayton F. Smith, President Roberts Mann, Superintendent of Conservation BEES Last week, in a big hollow tree that had been blown down, we found a squirrel's den, a screech owl's nest, and the comb of a hive of honey- bees. There are many such bee-trees in the forest preserves. They may be located by following the flight of the bees because once it has taken on its load of pollen and honey, a bee returns to the hive in a straight "bee-line. "Dr. David H. Thompson tells of a big elm in Indiana that yielded 350 pounds of honey. Honey-bees are the original communists. Like the bumblebee, the wasp and the ant, they live in large colonies (sometimes 50,000 individuals), and are called social insects. They live in a commune where the citizens govern, where the many kings (drones) are powerless, and where the one queen works as hard as any of her subjects and longer. They have an elaborate caste system, with specific tasks for certain classes of workers.


Iron Availability in the Southern Ocean  

NLE Websites -- All DOE Office Websites (Extended Search)

Iron Availability in the Southern Ocean Print Iron Availability in the Southern Ocean Print The Southern Ocean, circling the Earth between Antarctica and the southernmost regions of Africa, South America, and Australia, is notorious for its high-nutrient, low-chlorophyll areas, which are rich in nutrients-but poor in essential iron. Sea life is less abundant in these regions because the growth of phytoplankton-the marine plants that form the base of the food chain-is suppressed. A study by scientists from South Africa's Stellenbosch University, Princeton University, and the Advanced Light Source (ALS) suggests that it is not just a lack of iron, but a lack of iron in an easy-to-use form, that is affecting the ecosystems. The researchers sampled two north-south corridors across the Southern Ocean, traveling an easterly transect between the base of the South African National Antarctic Expeditions (SANAE IV) in Queen Maud Land and Cape Town, and a westerly transect between SANAE IV and South Georgia Island. Along the way they collected particles containing solid iron from a series of ocean systems with different characteristics.


Neuromorphic quantum computation with energy dissipation  

SciTech Connect

Real parallel computing with a quantum computer attracts vast interest due to its extreme high potential. We propose a neuromorphic quantum computation algorithm based on an adiabatic Hamiltonian evolution with energy dissipation. This algorithm can be applied to problems if a cost function can be expressed in a quadratic form. This requirement results from the fact that our Hamiltonian is designed by following a method similar to an artificial neural network (ANN). The state of an ANN is often trapped at local minima, and the network outputs an error. Since the state of a quantum system with the proposed algorithm is always in the ground state according to the adiabatic theorem, it is not necessary to be concerned that the quantum state is trapped at local minima. However, there is no guarantee that a quantum algorithm based on an adiabatic Hamiltonian evolution with degeneration or level crossing is successfully executed. We show successful numerical simulation results with the proposed algorithm by introducing energy dissipation to keep the quantum state staying in the ground state, and then we show an application to the n-queen problem, which is one of the combinatorial optimization problems.

Kinjo, Mitsunaga; Sato, Shigeo; Nakamiya, Yuuki; Nakajima, Koji [Laboratory for Brainware Systems, Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, 980-8577, 2-1-1 Katahira, Aoba-ku, Sendai (Japan)




NLE Websites -- All DOE Office Websites (Extended Search)

National National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321 541-967-5892 2175 University Avenue South Suite 201 Fairbanks, AK 99709 907-452-2559 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304-285-4764 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-4687 One West Third Street, Suite 1400 Tulsa, OK 74103-3519 918-699-2000 Visit the NETL website: www.netl.doe.gov Customer Service: 1-800-553-7681 doe The March 2006 NETL Newsletter NETL Contributes to Public Safety The National Energy Technology Laboratory (NETL) is providing leading-edge technology and scientists to assist Pennsylvania's State Department of Environmental Quality in identifying the sources and concentration levels of natural gas leaks that are plaguing a small community in southwestern Pennsylvania. Some long-abandoned wells located in the Borough of Versailles, which is situated on the McKeesport Gas Field, were improperly plugged. Moreover, steel lining for the wells was in many cases retrieved and recycled during World War II to meet defense needs. As a result, natural gas is leaking through some of the old wells and collecting in dangerous concentrations in homes and businesses in Versailles.



Office of Legacy Management (LM)

P-2 P-2 7~ \k 29 ' 9 1 11:34 IJ.S EPFI 26 FED.PLK% .,' p-ji-j= Q UNITED STATES El$ViRONMENTAL PROTECTION A6iZNCY ~ RESION II JAC+ i, JAW78 FEDl!RAL BUILDING ', NW YORK. NEW YORK 10278 March,29,,1991' - ' Mr. Joseph A/Kelly 201 East 66th Street. New York, New York 10021 Re: Documents Available et Radium Chemical Company,. 60-06 27th Avenue, woodaide, Queens County, New York Dear Mr. Kelly: I have attempted to reach.youby telephone on several occasion& over.the past two veeks to give you an update on the availability of your personal papers r@maining in the referenced facility. Your personal papers and documents (such as your military records) are now availabliz at the facility. You had stated in an earlier conversation thatfit would be more convenient for you to pick up these documents in Woo.dside as opposed to our offices in


Iron Availability in the Southern Ocean  

NLE Websites -- All DOE Office Websites (Extended Search)

Iron Availability in the Southern Ocean Print Iron Availability in the Southern Ocean Print The Southern Ocean, circling the Earth between Antarctica and the southernmost regions of Africa, South America, and Australia, is notorious for its high-nutrient, low-chlorophyll areas, which are rich in nutrients-but poor in essential iron. Sea life is less abundant in these regions because the growth of phytoplankton-the marine plants that form the base of the food chain-is suppressed. A study by scientists from South Africa's Stellenbosch University, Princeton University, and the Advanced Light Source (ALS) suggests that it is not just a lack of iron, but a lack of iron in an easy-to-use form, that is affecting the ecosystems. The researchers sampled two north-south corridors across the Southern Ocean, traveling an easterly transect between the base of the South African National Antarctic Expeditions (SANAE IV) in Queen Maud Land and Cape Town, and a westerly transect between SANAE IV and South Georgia Island. Along the way they collected particles containing solid iron from a series of ocean systems with different characteristics.


A uGNI-Based Asynchronous Message-driven Runtime System for Cray Supercomputers with Gemini Interconnect  

SciTech Connect

Gemini as the network for new Cray XE/XT systems features low latency, high bandwidth and strong scalability. Its hardware support for remote direct memory access enables efficient implementation of the global address space programming languages. Although the Generic Network Interface (GNI) is designed to support message-passing applications, it is still challenging to attain good performance for applications written in alternative programming models, such as the message-driven programming model. In our earlier work we showed that CHARM++, an object-oriented message-driven programming model, scales up to the full Jaguar Cray machine. In this paper, we describe a general and light-weight asynchronous Low-level RunTime System (LRTS) for CHARM+, and its implementation on the uGNI software stack for Cray XE systems. Several techniques are presented to exploit the uGNI capability by reducing memory copy and registration overhead, taking advantage of persistent communication, and improving intra-node communication. Our micro-benchmark results demonstrate that the uGNI-based runtime system outperforms the MPI-based implementation by up to 50% in terms of message latency. For communication intensive applications such as N-Queens, this implementation scales up to 15,360 cores of a Cray XE6 machine and is 70% faster than an MPI-based implementation. In molecular dynamics application NAMD, the performance is also considerably improved by as high as 18%.

Sun, Yanhua [University of Illinois, Urbana-Champaign; Zheng, Gengbin [University of Illinois, Urbana-Champaign; Olson, Ryan M [Cray, Inc.; Jones, Terry R [ORNL; Kale, Laxmikant V [University of Illinois, Urbana-Champaign



Special Experiments: AES-UES  

NLE Websites -- All DOE Office Websites (Extended Search)

Special Experiments at the APS Special note is made of the following experimental activities. (Updated 2/19/2012 17:00) BEAMLINE DATES SPOKESPERSON COMMENTS 2BM-B rad #92404 2/24- 2/27 Patrick LaReviere U of C *Approvals pending *No special procedure, samples must be surveyed before and after experiment by APS-HP. 10ID-B #92409 2/29- 3/05 Ken Kemner ANL-203 *Approvals pending *Samples may be left unattended for up to 12 hours with beam ON when hutch door is secured with lock and chain. 10BM-B rad #92408 3/01- 3/06 Ken Kemner ANL-203 *Approvals Pending *Samples may be left unattended for up to 12 hours with beam ON when hutch door is secured with lock and chain. 1ID-B rad #91277 3/07- 3/12 Don Brown- LANL Mark Daymond Queen's University *Approvals Pending 3ID-B #92107 3/10- 3/19 Valentin Iota UNLV


Human Resources  

NLE Websites -- All DOE Office Websites (Extended Search)

Homepage Homepage BNL: Departments | Science | ESS&H | Newsroom | Administration | Visitors | Directory search Go HROM Homepage BNL Blood Drive Links Blood Drive Home Blood Drive Captains Donor Procedure List of Iron-Rich Foods Blood Facts (PDF) Blood Donation FAQ Blood Donation Facts Reasons for Deferrals BNL Blood Drive Next Blood Drive: December 12, 2013 You may schedule an appointment online by clicking the button below or call Elizabeth Gilbert at x2315. When calling, please provide your name, extension, and your preferred time. Schedule Appointment Brookhaven National Laboratory - a legacy of caring... Brookhaven National Laboratory has been organizing Blood Drives for the past thirty years. Our employees and guests have generously rolled up their sleeves to anonymously give of themselves to individuals in our Long Island Community. In partnership with the Long Island Blood Services (LIBS), a division of New York Blood Center, we encourage donations of life-giving blood to our friends, neighbors and families in dire need in hospitals throughout Nassau, Suffolk and Queens.


Validation studies for assessing unsaturated flow and transport through fractured rock  

SciTech Connect

*The objectives of this contract are to examine hypotheses and conceptual models concerning unsaturated flow and transport through heterogeneous fractured rock and to design and execute confirmatory field and laboratory experiments to test these hypotheses and conceptual models. Important new information is presented such as the application and evaluation of procedures for estimating hydraulic, pneumatic, and solute transport coefficients for a range of thermal regimes. A field heater experiment was designed that focused on identifying the suitability of existing monitoring equipment to obtain required data. A reliable method was developed for conducting and interpreting tests for air permeability using a straddle-packer arrangement. Detailed studies of fracture flow from Queen Creek into the Magina Copper Company ore haulage tunnel have been initiated. These studies will provide data on travel time for transport of water and solute in unsaturated tuff. The collection of rainfall runoff, and infiltration data at two small watersheds at the Apache Leap Tuff Site enabled us to evaluate the quantity and rate of water infiltrating into the subsurface via either fractures or matrix. Characterization methods for hydraulic parameters relevant to Weigh-level waste transport, including fracture apertures, transmissivity, matrix porosity, and fracture wetting front propagation velocities, were developed.

Bassett, R.L.; Neuman, S.P.; Rasmussen, T.C.; Guzman, A.; Davidson, G.R.; Lohrstorfer, C.F. [Arizona Univ., Tucson, AZ (United States). Dept. of Hydrology and Water Resources



1 Modules and exactness  

E-Print Network (OSTI)

Suppose that R is an associative ring with 1. In most commutative cases, R is either the integers Z or some field k. Example: Suppose that k is a field and G is a group. The group-algebra k(G) over k is the direct sum k(G) = ? k, g?G with elements written as finite sums ? g?G ?g g, with ?g ? k and all but finitely many ?g = 0. The rule (?g g)(?h h) = (?g?h) (gh) defines the algebra structure on k(G), with multiplicative identity 1 = 1 e, where e is the identity element of G. A k(G)-module M is a k-vector space M, with bilinear map ? : k(G) M ? M with (r, m) ? ? r?m, such that r?(s?m) = (rs)? m and 1 ? m = m, or equivalently M is a k-vector 1 space equipped with a group homomorphism G ? Autk(M). k(G)-modules are often called G-modules for that reason. Not even that is the most enlightened way to describe a k(G)-module. A group G can be thought of as a category (actually a groupoid) with one object ? and a morphism ? g ? ? ? for every g ? G. Then a k(G)-module is a functor M: G ? k ? Mod which takes values in the category of k-vector spaces. NB: Ive only based these notions on fields k and their vector spaces to make them seem real. The object k could be a ring; then k(G) is a k-algebra still and a k(G)-module is a k-module M equipped with a group homomorphism G ? Autk(M). Now we recall some basic definitions and facts about R-modules. Suppose that f: M ? N is an R-module homomorphism. Then the kernel ker(f) of f is defined by ker(f) = {all x ? M such that f(x) = 0}. ker(f) is plainly a submodule of M. The image 2 im(f) of f is the submodule of N consisting of all y ? N such that y = f(x) for some x ? M. The cokernel of f cok(f) is defined to be the quotient A sequence cok(f) = N / im(f). M f ? ? M ? g ? ? M of R-module homomorphisms is said to be exact if ker(g) = im(f). Equivalently, the sequence is exact if g f = 0 and for all y ? M ? with g(y) = 0 there is an x ? M such that f(x) = y. A sequence M1 ? M2 ? ? Mn of R-module homomorphisms is said to be exact if ker = im everywhere. Example 1.1. The sequence 0 ? ker(f) ? M f ? ? N ? cok(f) ? 0 is exact for all R-module homomorphisms f. Note that 0 ? M f ? ? N is exact if and only if f is a monomorphism (injective), and that

unknown authors



Directed evolution of phosphotriesterase: towards the efficient detoxification of sarin and soman  

E-Print Network (OSTI)

Directed evolution studies were done with PTE for the enhancement of hydrolysis of both sarin and soman analogs. Particular attention was focused on the toxic SpRc and SpSc isomers of the soman analog, and the Sp isomer of the sarin analog. Double substitution libraries yielded several mutants that had enhanced activity for the substrates. Among them was the double mutant, H257Y-L303T, which displayed a 462-fold increase in activity for hydrolysis of the most toxic SpSc isomer of the GD analog in comparison to the wild type. Several other mutants such as the triple mutants H254R-H257A-L303T and H254R-H257S-L303T had enhancements of between 150- and 200-fold, and had also displayed a different order of stereoselectivity relative to the wild type. For these mutants, the order of preferential hydrolysis was such that the SpRc isomer was preferentially hydrolyzed first. In contrast, the order of preferential hydrolysis for the wild type was that the RpRc was hydrolyzed first, followed by the RpSc, SpRc, and then the SpSc isomer. The reversal of stereoselective preference was also seen with the double substitution library members for hydrolysis of the sarin analog isomers. However, there were no significant improvements for sarin analog hydrolysis in these libraries. Among the best mutants obtained were H254G-H257W, H254G-H257R, and H257Y, all of which had catalytic efficiencies on the order of 106 M-1 s-1 for hydrolysis of the Sp isomer. The toxicity for analogs of sarin, soman, and VX was evaluated using Hydra attenuata as a model organism. The toxicity of each compound was assessed quantitatively by measuring the minimal effective concentration within 92 h in H. attenuata. There was a positive correlation between the molecular hydrophobicity of the compound and its ability to cause toxicity. Results from this study indicate the potential for application of this assay in the field of organophosphate nerve agent detection, as well as for the prediction of toxicity of structurally similar organophosphate compounds. The minimal effective concentration for two of the VX analogs was 2 orders of magnitude more toxic than the analog for soman and four orders of magnitude more toxic than the analog for sarin.

Lum, Karin Tien



Mechanism for the hydrolysis of organophosphates and investigations into the stereoselective hydrolysis of organophosphorus Esters by Phosphotriesterase.  

E-Print Network (OSTI)

Phosphotriesterase (PTE) is a zinc metalloenzyme that catalyzes the hydrolysis of organophosphorus compounds. Metal ion roles during binding and catalysis are probed by comparing the kinetic properties of Zn/Zn, Cd/Cd, and Zn/Cd PTE with a variety of phosphate trisesters. The metal in the ?-site of the binuclear metal center modulates the pKa values determined from pH-rate profiles. These results suggest that the ?-metal is responsible for activating the nucleophilic hydroxide. In an effort to determine the function of the ?-metal, the kinetic parameters for diethyl p-chlorophenyl thiophosphate are compared with diethyl p-chlorophenyl phosphate. The thiophosphate substrate is hydrolyzed 20 to 100-times faster than the phosphate substrate for Zn/Zn, Cd/Cd, and Zn/Cd PTE. When Cd2+ occupies the ?-site, the inverse thio effect increases which suggests polarization by the ?-metal on the phosphoryl oxygen or sulfur bond. The catalytic roles of Asp 233, His 254, and Asp 301 are determined by comparing the kinetic parameters of a series of alanine and asparagine mutations with paraoxon and diethyl p-chlorophenyl phosphate. The increased rate of hydrolysis for diethyl p-chlorophenyl phosphate with the mutants is consistent with the existence of a proton relay system from Asp 301 to His 254 to Asp 233. A detailed mechanism for the hydrolysis of organophosphates by PTE has been proposed. PTE hydrolyzes a number of chiral organophosphorus esters. The pKa of the leaving group phenol is altered for a series of chiral phosphate, phosphonate, and phosphinate esters. The stereoselectivity of wild-type, G60A, and I106G/F132G/H257Y PTE is enhanced as the pKa value of the leaving group phenol increases for phosphate, phosphonate, and phosphinate esters. In addition to improving the stereoselectivity of phosphotriesterase, mutations that affect the size of the active site of PTE are screened to identify a mutant enzyme that preferentially hydrolyzes the opposite isomer of wild-type PTE. The rate constants and stereoselectivity ratios for a number of active site mutants have been determined. H254Y/L303T PTE reverses the stereoselective preference of phosphonate and phosphinate substrates. The PTE stereoselectivity of O-methyl, O-phenyl acetylphenyl phosphate is reversed 970-fold by I106G/F132G/H257Y. A reversal mutant was resolved for phosphate, phosphonate, and phosphinate esters.

Aubert, Sarah Dwyer



Development of Sirikit oil field, Thailand  

SciTech Connect

The Sirikit oil field, Thailand's first significant oil find, was discovered in late 1981 by Thai Shell Exploration and Production Company, Ltd., with its second exploration well. After deciding to develop the field (named after Thailand's queen), Thai Shell took only 1 year to design and install the production station, and organize an unconventional evacuation system (road tanker and railway) before oil came on stream in January 1983. A series of facility upgradings kept pace with the production buildup, to a plateau of about 21,000 b/d. The crude oil is waxy (pour point = about 35/sup 0/C), but it is light (40/sup 0/ API) and has an attractive refinery yield. Associated gas is sold to the nearby (specially installed) electricity generating station. Gas compression was commissioned in 1985 to increase utilization of gas, which previously was flared. The agricultural environment dictated the need for cluster drilling of deviated wells, as well as highlighting the importance of good relationships with the local population and authorities. Safety and security are of particular interest. The field is geologically complex, being very faulted in a lacustrine environment and extremely stratified and heterogeneous in reservoir quality. One of two major reservoirs has a gas cap. After some early surprises in delineating the field, a three-dimensional seismic survey was conducted, which better defined the structure and the reserve potential. Nevertheless, parallel appraisal and development continues on a careful step-by-step approach, using the latest production and pressure data to refine the reservoir geologic model. In November 1985, the Petroleum Authority of Thailand became a minority partner, with Shell remaining as operator.

Brooks, J.



NYPA/TH!NK Clean Commute Program Final Report - Inception through December 2004  

Science Conference Proceedings (OSTI)

The Clean Commute Program uses TH!NK city electric vehicles from Ford Motor Companys electric vehicle group, TH!NK Mobility, to demonstrate the feasibility of using electric transportation in urban applications. Suburban New York City railroad commuters use the TH!NK city vehicles to commute from their private residences to railroad stations, where they catch commuter trains into New York City. Electric vehicle charging infrastructure for the TH!NK city vehicles is located at the commuters private residences as well as seven train stations. Ford leased at total of 97 TH!NK city electric vehicles to commuters from Westchester, Putnam, Rockland, Queens, Nassau, and Suffolk counties for $199 per month. First Clean Commute Program vehicle deliveries occurred late in 2001, with data collection commencing in February 2002. Through May, 2004, 24 of the lessees have returned their vehicles to Ford and no longer participate in the Clean Commute Program. Reasons given for leaving the Program include relocation out of the Program area, change in employment status, change in commuting status, and, in a few cases, dissatisfaction with the vehicle. Additionally, 13 vehicles were returned to Ford when the lease was completed. In August 2002, Ford announced that it was ceasing production of the TH!NK city and would not extend any TH!NK city leases. Mileage accumulation dropped in the last quarter of the program as vehicle leases were returned to Ford. The impact of the program overall was significant as participants in the Clean Commute Program drove their vehicles over 406,074 miles, avoiding the use of over 18,887 gallons of gasoline. During the active portion of the program, the TH!NK city vehicles were driven an average of between 180 and 230 miles per month. Over 95% of all trips taken with the TH!NK city vehicles replaced trips previously taken in gasoline vehicles. This report covers the period from Program inception through December 2004.

James Francfort; Don Karner



NYPA/TH!NK Clean Commute Program Report Inception Through May 2004  

Science Conference Proceedings (OSTI)

The Clean Commute Program uses TH!NK city electric vehicles from Ford Motor Companys electric vehicle group, TH!NK Mobility, to demonstrate the feasibility of using electric vehicles for transportation in urban applications. Suburban New York City railroad commuters use the TH!NK city vehicles to commute from their private residences to railroad stations, where they catch commuter trains into New York City. Electric vehicle charging infrastructure for the TH!NK city vehicles is located at the commuters private residences as well as seven train stations. Ford leased 97 TH!NK city electric vehicles to commuters from Westchester, Putnam, Rockland, Queens, Nassau, and Suffolk counties for $199 per month per vehicle. The first Clean Commute Program vehicle deliveries occurred late in 2001, with data collection commencing in February 2002. Through May 2004, 24 of the lessees have returned their vehicles to Ford and no longer participate in the Clean Commute Program. Reasons given for returning the vehicles include relocation out of the Program area, change in employment status, change in commuting status, and, in a few cases, dissatisfaction with the vehicle. Additionally, 13 vehicles have been returned to Ford as their leases have completed. In August 2002, Ford announced that it was ceasing production of the TH!NK city and would not extend any TH!NK city leases. Through May 2004, participants in the Clean Commute Program have driven their vehicles over 370,000 miles, avoiding the use of over 17,000 gallons of gasoline. The TH!NK city vehicles are driven an average of between 180 and 230 miles per month, and over 95% of all trips taken with the TH!NK city vehicles replace trips previously taken in gasoline vehicles. This report covers the period from Program inception through May 2004.

Don Karner; James Francfort; Randall Solomon



Dressing for England: fashion and nationalism in victorian novels  

E-Print Network (OSTI)

Victorian women were not merely the symbols of nation nineteenth-century imagery would suggest in an era marked by the images of Queen Victoria and the symbolic representation of Britannia. They also were producers, maintainers, and even protectors of England at a time when imperial anxiety and xenophobic fears called the definition of Englishness into question. Dress, particularly fashionable dress, often was viewed as a feminine weakness in Victorian England. At the same time women were chastised for their attentions to the details of their clothing, they also were instructed to offer a pretty and neat presentation publicly and privately. Novels by George Eliot, Elizabeth Gaskell, William Thackeray, and H. G. Wells and manners and conduct texts by such authors as Sarah Stickney Ellis, Eliza Lynn Linton, and Margaret Oliphant demonstrate how Victorian women used fashion and dress to redefine and manipulate the socially accepted understanding of traditional English womanhood and to communicate national ideologies and concerns without violating or transgressing completely the more passive construction of Victorian femininity. By declaring their nationality through the public display that is fashiondress designated by its appeal to a sophisticated, cultured, and perhaps continental society these fictional and non-fictional women legitimized the demand for female access to social and cultural spheres as well as to the political sphere. Through an examination of the material culture of Victorian Englandpersonal letters about the role of specific dress in Suffragette demonstrations, or the Indian shawl, for examplealongside an examination of the literary texts of the period, Dressing for England argues that the novels of the nineteenth century and that centurys ephemera reveal its social concerns, its political crises, and the fabric of its everyday domesticity at the same time they reveal the active and intimate participation of Victorian women in the establishment and maintenance of nation.

Montz, Amy Louise



Liability issues surrounding oil drilling mud sumps  

Science Conference Proceedings (OSTI)

This presentation examines liability issues surrounding oil drilling mud sumps and discusses them in relation to two recent cases that arose in Ventura County, California. Following a brief history of regulatory interest in oil drilling mud and its common hazardous substances, various cause of action arising from oil drilling mud deposits are enumerated, followed by defenses to these causes of action. Section 8002 (m) of the Resource Conservation and Recovery Act is mentioned, as are constituents of oil and gas waste not inherent in petroleum and therefore not exempt from regulation under the petroleum exclusion in the Comprehensive Environmental Response, Compensation and Recovery Act. Key legal words such as hazardous substance, release, public and private nuisance, trespass, responsible parties, joint and several liability, negligence, and strict liability are explained. The effects on liability of knowledge of the deposits, duty to restore land to its original condition, consent to the deposit of oil drilling mud, and noncompliance and compliance with permit conditions are analyzed. The state-of-the-art defense and research to establish this defense are mentioned. The newly created cause of action for fear of increased risk of cancer is discussed. Issues on transfer of property where oil drilling mud has been deposited are explored, such as knowledge of prior owners being imputed to later owners, claims of fraudulent concealment, and as is' clauses. The effects on the oil and gas industry of the California Court of Appeals for the Second District rulings in Dolan v. Humacid-MacLeod and Stevens v. McQueen are speculated.

Dillon, J.J.



hourly solar radiation | OpenEI  

Open Energy Info (EERE)

solar radiation solar radiation Dataset Summary Description (Abstract): A need for predicting hourly global radiation exists for many locations particularly in Bangladesh for which measured values are not available and daily values have to be estimated from sunshine data. The CPRG model has been used to predict values of hourly Gh for Dhaka (23.770N, 90.380E), Chittagong (22.270N, 91.820E) and Bogra (24.850N, 89.370E) for = ±7.50, ±22.50, ±37.50, ±52.50, ±67.50, ±82.50 and ±97.50 i.e., for ±1/2, ±3/2, ±5/2, ±7/2, ±9/2, ±11/2, ±13/2 hours before and after solar noon and the computed values for Source Renewable Energy Research Centre Date Released October 22nd, 2003 (11 years ago) Date Updated Unknown Keywords Bangladesh documentation hourly solar radiation SWERA

Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

PERSPECTIVES ON THE ROLE OF ÔLUCKY DROPSÕ IN DRIZZLE PERSPECTIVES ON THE ROLE OF ÔLUCKY DROPSÕ IN DRIZZLE FORMATION Robert McGraw, Yangang Liu and Peter Daum Atmospheric Sciences Division * * * * * * 10µ ... ... 20µ 30µ * ... * ... * cloud droplet growth kinetics cloud droplets drizzle drops condensation evaporation collection β g cond g D = γ g eff β g coll dg dt v dv drop dt g L = = ≈ × - 1 3 13 10 1 13 2 ( ) . (Long's polynomial collection kernel) 3. Threshold Function (T LDM ) Autoconversion parameterizations can be generically written as: where P 0 is the rate after onset of the autoconversion process and T describes the threshold behavior. T P P 0 = H H H HI I I IG G G GH H H H D D D DR R R RI I I IZ Z Z ZZ Z Z ZL L L LE E E E C C C CO O O ON N N ND D D DI I I IT T T TI I I IO O O ON N N NS S S S L L L LO O O OW W W W D D D DR R R RI I I IZ Z Z ZZ Z Z ZL L L LE E E E T LDM = 0.9 0.1 N D = droplet concentration (cm -3 ) L = liquid water fraction


TMY | OpenEI  

Open Energy Info (EERE)

TMY TMY Dataset Summary Description (Abstract): A need for predicting hourly global radiation exists for many locations particularly in Bangladesh for which measured values are not available and daily values have to be estimated from sunshine data. The CPRG model has been used to predict values of hourly Gh for Dhaka (23.770N, 90.380E), Chittagong (22.270N, 91.820E) and Bogra (24.850N, 89.370E) for = ±7.50, ±22.50, ±37.50, ±52.50, ±67.50, ±82.50 and ±97.50 i.e., for ±1/2, ±3/2, ±5/2, ±7/2, ±9/2, ±11/2, ±13/2 hours before and after solar noon and the computed values for Source Renewable Energy Research Centre Date Released October 22nd, 2003 (11 years ago) Date Updated Unknown Keywords Bangladesh documentation hourly solar radiation SWERA TMY Data application/pdf icon Download Report (pdf, 410.5 KiB)


FY 2008 Annual Performance Report  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hyd Hyd rog en Tan k Res earc h, LLN L PH EN IX Ex pe rim en t, BN L Fu el Ce ll Re sea rch , AN L Ca rb on Se qu es tra tio n Re se ar ch , PN NL Hi gh Ex pl os iv es Ap pl ic at io ns Fa ci lit y, LL NL Com put er Sim ulat ion The ater , LAN L Al ga e Re se ar ch , NR EL Ad va nc ed Bio fue ls Re se arc h, LB NL T ra in in g Nuc lear Mat eria ls Sto rag e, SRS C o a l G a s if ic a ti o n R e s e a rc h , P N N L Cli ma te Mo de lin g, OR NL AnnuAl PerformAnce rePort fY 2008 Table of Contents Introduction....................................................................................................................................1 Performance Summary Scorecard..................................................................................................2 Department Performance ...............................................................................................................4


Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner  

SciTech Connect

The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

Fujita, Toshitsugu; Piuz, Isabelle [Fondation pour Recherches Medicales, University of Geneva, 64 av. de la Roseraie, 1211 Geneva (Switzerland); Schlegel, Werner [Fondation pour Recherches Medicales, University of Geneva, 64 av. de la Roseraie, 1211 Geneva (Switzerland)], E-mail: werner.schlegel@unige.ch



Measuring solar reflectance - Part I: Defining a metric that accurately predicts solar heat gain  

Science Conference Proceedings (OSTI)

Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective ''cool colored'' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland US latitudes, this metric R{sub E891BN} can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {roofs in a building energy simulation can exaggerate the economic value N of annual cool roof net energy savings by as much as 23%. We define clear sky air mass one global horizontal (''AM1GH'') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer. (author)

Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul [Heat Island Group, Environmental Energy Technologies Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States)



Successful Experimental Verification of the Tokamak Exhaust Processing Concept of ITER with the CAPER Facility  

SciTech Connect

One of the design targets for the Tokamak Exhaust Processing (TEP) system of ITER is not to lose more than 10{sup -5}gh{sup -1} into the Normal Vent Detritiation system of the Tritium Plant. The plasma exhaust gas therefore needs to be processed in a way that a tritium removal efficiency of about 10{sup 8} with respect to the flow rate is achieved. Expressed in terms of tritium concentrations this corresponds to a decontamination from about 130 gm{sup -3} down to about 10{sup -4} gm{sup -3} (about 1 Cim{sup -3} = 3.7*10{sup 10} Bqm{sup -3}). The three step reference process for the TEP system of ITER is called CAPER and has been developed and realized at the Tritium Laboratory Karlsruhe (TLK). After the successful commissioning of the PERMCAT reactor as the key component of the third step detailed parametric tritium testing of the 3 steps involving the processing of more than 300 g tritium has been carried out and decontamination factors beyond the design requirements have been demonstrated for each process step and for the process as a whole. Not only the decontamination factor of 10{sup 8} as required by ITER, but also the operational mode of TEP as a waste dump for gases from diverse sources has been experimentally validated with the CAPER facility.

Bornschein, B.; Glugla, M.; Guenther, K.; Le, T.L.; Simon, K.H.; Welte, S. [Forschungszentrum Karlsruhe (Germany)



Development of a rapid and efficient microinjection technique for gene insertion into fertilized salmonid eggs  

DOE Green Energy (OSTI)

An efficient one-step injection technique for gene insertion into fertilized rainbow trout (Oncorhynchus mykiss) eggs is described, and basic parameters affecting egg survival are reported. Freshly fertilized rainbow trout eggs were injected in the perivitelline space with a recombinant mouse metallothionein-genomic bovine growth hormone (bGH) DNA construct using a 30-gauge hypodermic needle and a standard microinjection system. Relative to control, site of injection and DNA concentration did not affect the egg survival, but injections later than 3--4 hours post fertilization were detrimental. The injection technique permitted treatment of 100 eggs/hr with survivals up to 100%, resulting in a 4% DNA uptake rate as indicated by DNA dot blot analysis. Positive dot blot results also indicated that the injected DNA is able to cross the vitelline membrane and persist for 50--60 days post hatching, obviating the need for direct injection into the germinal disk. Results are consistent with previous transgenic fish work, underscoring the usefulness of the technique for generating transgenic trout and salmonids. 24 refs., 6 figs., 3 tabs.

Chandler, D.P.; Welt, M.; Leung, F.C.



Fuel Cell Technologies Program - DOD-DOE Workshop: Shipboard APUs Overview  

NLE Websites -- All DOE Office Websites (Extended Search)

FUEL CELL TECHNOLOGIES PROGRAM DOD-DOE Workshop: Shipboard APUs Overview 3/29/2011 Dr. Sunita Satyapal Program Manager F l C ll T h l i P Fuel Cell Technologies Program U.S. Department of Energy Rest of E U France 272 MW Germany 9 785 MW U.S. Rest of E.U. 1,333 MW 9,785 MW Japan U.S. share of PV production has fallen significantly over the last 10 years Global & U.S. Annual PV Production by Region Cumulative Installed PV ( (throug gh 2009) ) Italy 1,167 MW China 305 MW 1,650 MW Rest of World 2,374 MW 2 633 MW Spain 2,633 MW 3,386 MW 1995: 43% 2000: 27% 2009: 6% 2 | Fuel Cell Technologies Program Source: US DOE 3/3/2011 eere.energy.gov i Global Market Overview Global Shipments of Fuel Cell Systems by US Global Shipments of Fuel Cell Systems by US Companies and Non-US Companies


All Price Tables.vp  

Gasoline and Diesel Fuel Update (EIA)

1) 1) June 2013 State Energy Price and Expenditure Estimates 1970 Through 2011 2011 Price and Expenditure Summary Tables Table E1. Primary Energy, Electricity, and Total Energy Price Estimates, 2011 (Dollars per Million Btu) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i Coal Natural Gas a Petroleum Nuclear Fuel Biomass Total g,h,i Distillate Fuel Oil Jet Fuel b LPG c Motor Gasoline d Residual Fuel Oil Other e Total Wood and Waste f Alabama 3.09 5.66 26.37 22.77 25.54 27.12 13.18 19.42 25.90 0.61 3.01 8.75 2.56 27.08 19.85 Alaska 3.64 6.70 29.33 23.12 29.76 31.60 20.07 34.62 26.61 - 14.42 20.85 6.36 47.13 25.17 Arizona 1.99 7.07 27.73 22.84 31.95 26.97 17.00 17.23 26.71 0.75 6.31 10.79 2.16 28.46 25.23 Arkansas 1.93 6.94 26.37 22.45 26.66 27.35 17.35 33.22



Gasoline and Diesel Fuel Update (EIA)

9) 9) June 2011 State Energy Price and Expenditure Estimates 1970 Through 2009 2009 Price and Expenditure Summary Tables Table E1. Primary Energy, Electricity, and Total Energy Price Estimates, 2009 (Dollars per Million Btu) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i Coal Natural Gas a Petroleum Nuclear Fuel Biomass Total g,h,i Distillate Fuel Oil Jet Fuel b LPG c Motor Gasoline d Residual Fuel Oil Other e Total Wood and Waste f Alabama 2.81 6.63 16.38 12.88 21.25 17.63 9.62 13.88 16.73 0.55 2.82 6.88 2.24 26.23 16.18 Alaska 2.81 6.39 20.85 13.24 26.28 22.73 10.74 24.01 17.57 - 9.57 14.30 4.26 44.29 18.23 Arizona 1.83 6.38 16.14 12.50 27.59 18.28 - 11.60 17.18 0.59 7.83 7.67 2.04 28.01 19.66 Arkansas 1.73 7.82 16.07 12.42 20.51 17.40 6.65 21.59 17.08 0.66



NLE Websites -- All DOE Office Websites (Extended Search)

Plan Plan for Spin Physics at RHIC February 11, 2005 Abstract In this report we present the research plan for the RHIC spin program. The report covers 1) the science of the RHIC spin program in a world-wide context; 2) the collider performance require- ments for the RHIC spin program; 3) the detector upgrades required, including timelines; 4) time evolution of the spin program. Authors Christine Aidala a , Mei Bai b , Leslie Bland b , Alessandro Bravar b , Gerry Bunce b,c , Mickey Chiu d , Abhay Deshpande c,e , Douglas Fields c,f , Wolfram Fischer b , Yoshinori Fukao g,h , Yuji Goto c,h , Matthias Grosse Perdekamp c,d , Wlodek Guryn b , Masanori Hirai h , David Kawall c,i , Edward Kistenev b , Stefan Kretzer b,c , Akio Ogawa b , Kensuke Okada c , Jianwei Qiu j , Greg Rakness b,k , Vladimir Rykov h , Naohito Saito g , Hal Spinka l , Marco Stratmann m , Kazutaka Sudoh h , Bernd Surrow n , Atsushi Taketani c,h , Michael Tannenbaum


Phylogenetic Distribution of Potential Cellulases in Bacteria  

E-Print Network (OSTI)

Project Goals: The main goal of this project is to connect diverse microbial groups with the extracellular enzyme systems that catalyze the decay of organic material. We will also determine whether different groups of microbes and their enzymes respond to environmental changes, and whether they can recover from such changes. Finally, we will develop mathematical models to predict the responses of microbial communities and their associated functions under new environmental conditions. In most terrestrial ecosystems, the depolymerization of plant cell wall is the rate limiting step in the turnover of organic material. The composition of plant detritus is known to depend mainly on enzymes produced by microorganisms. This raises the question: which phylogenetic lineages of microorganisms can degrade plant cell wall material, including cellulose? To address this question, we compared the distribution of Glycoside Hydrolases (GH) potentially related to the cellulose degradation among 3744 bacteria. Some phylogenetic groups are especially rich in GHs whereas some are very poor. For example, in bacteria from the Bacteroidetes phylum ~40 GHs (from the families 1,

Genomic Science Awardee; Renaud Berlemont



Vehicular Storage of Hydrogen in Insulated Pressure Vessels  

DOE Green Energy (OSTI)

This paper describes the development of an alternative technology for storing hydrogen fuel onboard automobiles. Insulated pressure vessels are cryogenic-capable pressure vessels that can accept cryogenic liquid fuel, cryogenic compressed gas or compressed gas at ambient temperature. Insulated pressure vessels offer advantages over conventional H{sub 2} storage approaches. Insulated pressure vessels are more compact and require less carbon fiber than GH{sub 2} vessels. They have lower evaporative losses than LH{sub 2} tanks, and are much lighter than metal hydrides. After outlining the advantages of hydrogen fuel and insulated pressure vessels, the paper describes the experimental and analytical work conducted to verify that insulated pressure vessels can be used safely for vehicular H{sub 2} storage. The paper describes tests that have been conducted to evaluate the safety of insulated pressure vessels. Insulated pressure vessels have successfully completed a series of DOT, ISO and SAE certification tests. A draft procedure for insulated pressure vessel certification has been generated to assist in a future commercialization of this technology. An insulated pressure vessel has been installed in a hydrogen fueled truck and it is currently being subjected to extensive testing.

Aceves, S M; Berry, G D; Martinez-Frias, J; Espinosa-Loza, F



Suite of Activity-Based Probes for Cellulose-Degrading Enzymes  

Science Conference Proceedings (OSTI)

Microbial glycoside hydrolases play a dominant role in the biochemical conversion of cellulosic biomass to high-value biofuels. Anaerobic cellulolytic bacteria are capable of producing multicomplex catalytic subunits containing cell-adherent cellulases, hemicellulases, xylanases, and other glycoside hydrolases to facilitate the degradation of highly recalcitrant cellulose and other related plant cell wall polysaccharides. Clostridium thermocellum is a cellulosome producing bacterium that couples rapid reproduction rates to highly efficient degradation of crystalline cellulose. Herein, we have developed and applied a suite of difluoromethylphenyl aglycone, N-halogenated glycosylamine, and 2-deoxy-2-fluoroglycoside activity-based protein profiling (ABPP) probes to the direct labeling of the C. thermocellum cellulosomal secretome. These activity-based probes (ABPs) were synthesized with alkynes to harness the utility and multimodal possibilities of click chemistry, and to increase enzyme active site inclusion for LC-MS analysis. We directly analyzed ABP-labeled and unlabeled global MS data, revealing ABP selectivity for glycoside hydrolase (GH) enzymes in addition to a large collection of integral cellulosome-containing proteins. By identifying reactivity and selectivity profiles for each ABP, we demonstrate our ability to widely profile the functional cellulose degrading machinery of the bacterium. Derivatization of the ABPs, including reactive groups, acetylation of the glycoside binding groups, and mono- and disaccharide binding groups, resulted in considerable variability in protein labeling. Our probe suite is applicable to aerobic and anaerobic cellulose degrading systems, and facilitates a greater understanding of the organismal role associated within biofuel development.

Chauvigne-Hines, Lacie M.; Anderson, Lindsey N.; Weaver, Holly M.; Brown, Joseph N.; Koech, Phillip K.; Nicora, Carrie D.; Hofstad, Beth A.; Smith, Richard D.; Wilkins, Michael J.; Callister, Stephen J.; Wright, Aaron T.



Hydrotreating of coal-derived liquids  

SciTech Connect

The objective of Sandia`s refining of coal-derived liquids project is to determine the relationship between hydrotreating conditions and Product characteristics. The coal-derived liquids used in this work were produced In HTI`s first proof-of-concept run using Illinois No. 8 coal. Samples of the whole coal liquid product, distillate fractions of this liquid, and Criterion HDN-60 catalyst were obtained from Southwest Research Inc. Hydrotreating experiments were performed using a continuous operation, unattended, microflow reactor system. A factorial experimental design with three variables (temperature, (310{degrees}C to 388{degrees}C), liquid hourly space velocity (1 to 3 g/h/cm{sup 3}(cat)), pressure (500 to 1000 psig H{sub 2}) is being used in this project. Sulfur and nitrogen contents of the hydrotreated products were monitored during the hydrotreating experiments to ensure that activity was lined out at each set of reaction conditions. Results of hydrotreating the whole coal liquid showed that nitrogen values in the products ranged from 549 ppM at 320{degrees}C, 3 g/h/cm{sup 3}(cat), 500 psig H{sub 2} to <15 ppM at 400{degrees}C, 1 g/h/ cm{sup 3}(cat), 1000 psig H{sub 2}.

Stohl, F.V.; Lott, S.E.; Diegert, K.V.; Goodnow, D.C.; Oelfke, J.B.



Hemicellulolytic organisms in the particle-associated microbiota of the hoatzin crop  

DOE Green Energy (OSTI)

The hoatzin (Opisthocomus hoazin) is a South American herbivorous bird, that has an enlarged crop analogous to the rumen, where foregut microbes degrade the otherwise indigestible plant materials, providing energy to the host. The crop harbors an impressive array of microorganisms with potentially novel cellulolytic enzymes. Thie study describes the composition ofthe particle-associated microbiota in the hoatzin crop, combining a survey of 16S rRNA genes in 7 adult birds and metagenome sequencing of two animals. The pyrotag survey demonstrates that Prevotellaceae, are the most abundant and ubiquitous taxa, suggesting that the degradation of hemicellulose is an important activity in the crop. Nonetheless, preliminary results from the metagnome of the particle-associated microbiota of two adult birds show that the crop microbiome contains a high number of genes encoding cellulases (such as GH5) more abundant than those of the termite gut, as well as genes encoding hemicellulases. These preliminary results show that the carbohydate-active enzyme genes in the cropmetagenome could be a source of biochemical catalysts able to deconstruct plant biomass.

Godoy-Vitorino, Filipa; Malfatti, Stephanie; Garcia-Amado, Maria A.; Dominguez-Bello, Maria Gloria; Hugenholtz, Phillip; Tringe, Susannah



Prediction of clock time hourly global radiation from daily values over  

Open Energy Info (EERE)

Prediction of clock time hourly global radiation from daily values over Prediction of clock time hourly global radiation from daily values over Bangladesh Dataset Summary Description (Abstract): A need for predicting hourly global radiation exists for many locations particularly in Bangladesh for which measured values are not available and daily values have to be estimated from sunshine data. The CPRG model has been used to predict values of hourly Gh for Dhaka (23.770N, 90.380E), Chittagong (22.270N, 91.820E) and Bogra (24.850N, 89.370E) for = ±7.50, ±22.50, ±37.50, ±52.50, ±67.50, ±82.50 and ±97.50 i.e., for ±1/2, ±3/2, ±5/2, ±7/2, ±9/2, ±11/2, ±13/2 hours before and after solar noon and the computed values for different months are symmetrical about solar noon whereas for many months experimental data show a clear asymmetry. To obtain improved


All Price Tables.vp  

Gasoline and Diesel Fuel Update (EIA)

. Primary Energy, Electricity, and Total Energy Price Estimates, 2011 . Primary Energy, Electricity, and Total Energy Price Estimates, 2011 (Dollars per Million Btu) State Primary Energy Electric Power Sector g,h Retail Electricity Total Energy g,i Coal Natural Gas a Petroleum Nuclear Fuel Biomass Total g,h,i Distillate Fuel Oil Jet Fuel b LPG c Motor Gasoline d Residual Fuel Oil Other e Total Wood and Waste f Alabama 3.09 5.66 26.37 22.77 25.54 27.12 13.18 19.42 25.90 0.61 3.01 8.75 2.56 27.08 19.85 Alaska 3.64 6.70 29.33 23.12 29.76 31.60 20.07 34.62 26.61 - 14.42 20.85 6.36 47.13 25.17 Arizona 1.99 7.07 27.73 22.84 31.95 26.97 17.00 17.23 26.71 0.75 6.31 10.79 2.16 28.46 25.23 Arkansas 1.93 6.94 26.37 22.45 26.66 27.35 17.35 33.22 27.02 0.64 3.31 10.54 2.13 22.02 19.63 California 3.13 7.08 27.34 22.51 31.21 30.02 20.92 21.45 27.51 0.71 4.88 17.99 3.32 38.35 24.14 Colorado 1.73 6.79 26.86 22.41 26.35


Measuring solar reflectance Part I: Defining a metric that accurately predicts solar heat gain  

SciTech Connect

Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective 'cool colored' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland U.S. latitudes, this metric RE891BN can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {le} 5:12 [23{sup o}]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool-roof net energy savings by as much as 23%. We define clear-sky air mass one global horizontal ('AM1GH') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer.

Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul



Measuring solar reflectance Part I: Defining a metric that accurately predicts solar heat gain  

SciTech Connect

Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective 'cool colored' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland U.S. latitudes, this metric RE891BN can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {le} 5:12 [23{sup o}]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool-roof net energy savings by as much as 23%. We define clear-sky air mass one global horizontal ('AM1GH') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer.

Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul


Note: This page contains sample records for the topic "queen rou gh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Dehydration of isobutanol to isobutene in a slurry reactor  

DOE Green Energy (OSTI)

The April 1990 Alternative Fuels Proposal to the Department of Energy involved the development of new technology, based on the liquid phase process, for conversion of coal-derived synthesis gas to oxygenated hydrocarbon fuels, fuel additives, and fuel intermediates. The objective of this work was to develop a slurry reactor based process for the dehydration of isobutanol to isobutene. The isobutene can serve as a feedstock for the high octane oxygenated fuel additive methyl tertiary-butyl either (MTBE). Alumina catalysts were investigated because of their wide use as a dehydration catalyst. Four commercially available alumina catalysts (Catapal B, Versal B, Versal GH, and Al-3996R) were evaluated for both activity and selectivity to the branched olefin. All four catalysts demonstrated conversions greater than 80% at 290 C, while conversions of near 100% could be obtained at 330 C. The reaction favors low pressures and moderate to low space velocities. A yield of 0.90 mole isobutene per mole reacted isobutanol or better was obtained at conversions of 60--70% and higher. From 75 to 98% conversion, the four catalysts all provide isobutene yields ranging from 0.92 to 0.94 with the maximum occurring around 90% conversion. At low conversions, the concentration of diisobutyl ether becomes significant while the concentration of linear butenes is essentially a linear function of isobutanol conversion. Doping the catalyst with up to 0.8 wt % potassium showed a modest increase in isobutene selectivity; however, this increase was more than offset by a reduction in activity. Investigations using a mixed alcohols feed (consistent with isobutanol synthesis from syngas) demonstrated a small increase in the C4 iso-olefin selectivity over that observed for a pure isobutanol feed. 55 refs.

Latshaw, B.E.



Alumina-Forming Austenitics: A New Approach to Thermal and Degradation Resistant Stainless Steels for Industrial Use  

SciTech Connect

A series of developmental AFA alloys was selected for study based on: 25 Ni wt.% (alloys A-F), 20 wt% Ni (alloys G-H), and 12 Ni wt.% (alloys I-L). An emphasis in this work was placed on the lower alloy content direction for AFA alloys to reduce alloy raw material cost, rather than more highly alloyed and costly AFA alloys for higher temperature performance. Alloys A-D explored the effects of Al (3-4 wt.%) and C (0.05-0.2 wt.%) in the Fe-25Ni-14Cr-2Mn-2Mo-1W-1Nb wt.% base range; alloys E and F explored the effects of removing costly Mo and W additions in a Fe-25Ni-14Cr-4Al-2.5Nb-2Mn-0.2C base, alloys G and H examined Nb (1-2.5wt.%) and removal of Mo, W in a Fe-20Ni-14Cr-3Al-2Mn-0.2 C wt.% base; and alloys I-L examined effects of C (0.1-0.2 wt.%) and Mn (5-10 wt.%) on a low cost Fe-14Cr-12Ni-3Cu-2.5Al wt.% base (no Mo, W additions). Creep testing resulted in elemental trends that included the beneficial effect of higher carbon and lower niobium in 20-25%Ni AFA alloys and, the beneficial of lower Mn in 12%Ni AFA alloys. Corrosion tests in steam and sulfidation-oxidation environments showed, in general, these alloys were capable of a ten-fold improvement in performance when compared to conventional austenitic stainless steels. Also, corrosion test results in metal-dusting environments were promising and, warrant further investigation.

David A Helmick; John H Magee; Michael P Brady



Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product  

SciTech Connect

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-length WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.

Goodyer, P.R.; Torban, E.; Dehbi, M. [and others



Group-invariant soliton equations and bi-Hamiltonian geometric curve flows in Riemannian symmetric spaces  

E-Print Network (OSTI)

Universal bi-Hamiltonian hierarchies of group-invariant (multicomponent) soliton equations are derived from non-stretching geometric curve flows $\\map(t,x)$ in Riemannian symmetric spaces $M=G/H$, including compact semisimple Lie groups $M=K$ for $G=K\\times K$, $H={\\rm diag} G$. The derivation of these soliton hierarchies utilizes a moving parallel frame and connection 1-form along the curve flows, related to the Klein geometry of the Lie group $G\\supset H$ where $H$ is the local frame structure group. The soliton equations arise in explicit form from the induced flow on the frame components of the principal normal vector $N=\\covder{x}\\mapder{x}$ along each curve, and display invariance under the equivalence subgroup in $H$ that preserves the unit tangent vector $T=\\mapder{x}$ in the framing at any point $x$ on a curve. Their bi-Hamiltonian integrability structure is shown to be geometrically encoded in the Cartan structure equations for torsion and curvature of the parallel frame and its connection 1-form in the tangent space $T_\\map M$ of the curve flow. The hierarchies include group-invariant versions of sine-Gordon (SG) and modified Korteweg-de Vries (mKdV) soliton equations that are found to be universally given by curve flows describing non-stretching wave maps and mKdV analogs of non-stretching Schrodinger maps on $G/H$. These results provide a geometric interpretation and explicit bi-Hamiltonian formulation for many known multicomponent soliton equations. Moreover, all examples of group-invariant (multicomponent) soliton equations given by the present geometric framework can be constructed in an explicit fashion based on Cartan's classification of symmetric spaces.

Stephen C. Anco



Refueliing Infrastructure for Alternative Fuel Vehicles: Lessons Learned for Hydrogen  

NLE Websites -- All DOE Office Websites (Extended Search)

WEDNESDAY, APRIL 2 WEDNESDAY, APRIL 2 6:00-8:00 pm R Re eg gi is st tr ra at ti io on n a an nd d N Ne et tw wo or rk ki in ng g R Re ec ce ep pt ti io on n ( (l li ig gh ht t f fa ar re e) ) THURSDAY, APRIL 3 7:00 am R Re eg gi is st tr ra at ti io on n a an nd d C Co on nt ti in ne en nt ta al l B Br re ea ak kf fa as st t 8:00 am W We el lc co om me e 8:10 am P Pa an ne el l S Se es ss si io on n I I: : L Le es ss so on ns s f fr ro om m t th he e A AF FV V E Ex xp pe er ri ie en nc ce e Moderator: Dan Sperling, UC Davis Marc Melaina, National Renewable Energy Laboratory Stephe Yborra, NGV America Joan Ogden, US Davis Discussion 9:25 am B Br re ea ak k 9:40 am P Pa an ne el l S Se es ss si io on n I II I: : L Le es ss so on ns s f fr ro om m H Hy yd dr ro og ge en n S St ta at ti io on n D De em mo on ns st tr ra at ti io on n P Pr ro oj je ec ct ts s Moderator: John Garbak, U.S. Department of Energy Puneet Verma, Chevron


Calder Hall Cooling Tower Demolition: Landmark Milestone for Decommissioning at Sellafield  

Science Conference Proceedings (OSTI)

September 2007 saw a very visible change to the Sellafield site following the culmination of a major decommissioning project; the demolition of the four Calder Hall cooling towers. A key part of the UK's nuclear industrial heritage, Calder Hall, the world's first commercial nuclear power station, was opened by Her Majesty Queen Elizabeth II in October 1953 and continued to generate electricity until its closure in 2003. Following the decision to decommission the Calder Hall site, explosive demolition was identified as the safest and most cost effective route for the removal of the towers. The technique, involving the placement of explosive in 60% of the circumference of both shell and legs, is a tried and tested method which had already been used successfully in more than 200 cooling towers in the UK in the last 30 years. The location and composition of the four 88 metre high towers also created additional challenges. Situated only 40 metres away from the UK's only nuclear Fuel Handling Plant, as well as other sensitive structures on the Sellafield site, the project had to address the impact of a number of key areas, including dust, ground vibration and air over pressure, to ensure that the demolition could be carried out safely and without significant impact on other operational areas on the site. At the same time, the towers had to be prepared for demolition in a way that minimised the amounts of radioactive or hazardous waste materials arising. This paper follows the four year journey from the initial decision to demolish the towers right through to the demolition itself as well as the clean up of the site post demolition. It will also consider the massive programme of work necessary not only to carry out the physical work safely but also to gain regulatory confidence and stakeholder support to carry out the project successfully. In summary: The demolition of the four Calder Hall cooling towers was a highly visible symbol of the changes that are occurring on the Sellafield site as it moves forward towards a decommissioning future. Although in itself the demolition was both straightforward and standard, the various complexities posed by the towers situation at Sellafield introduced an entirely new element to the project, with a number of complex challenges which had to be overcome or resolved before the demolition could take place. It is a testament to the skill and dedication of the project team and its associated contractors that the project was delivered safely and successfully without a single accident, injury or event throughout the entire four years, and with minimal impact on both site operations and the local community. (authors)

Williamson, E.J. [Nuclear Decommissioning and Major Projects Group, Sellafield Ltd, Seascale, Cumbria (United Kingdom)



Truckstop -- and Truck!-- Electrification  

SciTech Connect

The conclusions of this paper are: 0.5-1.5 G/H and/or BUSG/Y--how much time and money will it take to quantify and WHY BOTHER TO DO SO? No shortage of things to do re truckstop--+ truck!-- electrification; Better that government and industry should put many eggs in lots of baskets vs. all in one or few; Best concepts will surface as most viable; Economic appeal better than regulation or brute force; Launch Ground Freight Partnership and give it a chance to work; Demonstration is an effective means to educate, and learn from, customers--learning is a two way street; Research, Development, Demonstration, and Deployment (RD 3) are all important but only deployment gets results; TSE can start small in numbers of spaces to accommodate economically inspired growth but upfront plans should be made for expansion if meaningful idle reduction is to follow via TE; 110VAC 15A service/ parking space is minimal--if infrastructure starts like this, upfront plans must be made to increase capacity; Increased electrification of truckstop and truck alike will result in much better life on the road; Improved sleep will improve driver alertness and safety; Reduced idling will significantly reduce fuel use and emissions; Universal appeal for DOD, DOE, DOT, EPA, OEMs, and users alike; Clean coal, gas, hydro, nuclear, or wind energy sources are all distinctly American means by which to generate electricity; Nothing can compete with diesel fuel to serve mobile truck needs; stationary trucks are like power plants--they don't move and should NOT be powered by petroleum products whenever possible; Use American fueled power plants--electricity--to serve truck idling needs wherever practical to do so; encourage economic aspect; Create and reward industry initiatives to reduce fuel use; Eliminate FET on new trucks, provide tax credits (non highway fuel use and investment), provide incentives based on results; Encourage newer/ cleaner truck use; solicit BAAs with mandatory OEM/ fleet participation/ lead; and A gallon saved is a gallon earned-- start NOW, not later.

Skip Yeakel



Truckstop -- and Truck!-- Electrification  

DOE Green Energy (OSTI)

The conclusions of this paper are: 0.5-1.5 G/H and/or BUSG/Y--how much time and money will it take to quantify and WHY BOTHER TO DO SO? No shortage of things to do re truckstop--+ truck!-- electrification; Better that government and industry should put many eggs in lots of baskets vs. all in one or few; Best concepts will surface as most viable; Economic appeal better than regulation or brute force; Launch Ground Freight Partnership and give it a chance to work; Demonstration is an effective means to educate, and learn from, customers--learning is a two way street; Research, Development, Demonstration, and Deployment (RD 3) are all important but only deployment gets results; TSE can start small in numbers of spaces to accommodate economically inspired growth but upfront plans should be made for expansion if meaningful idle reduction is to follow via TE; 110VAC 15A service/ parking space is minimal--if infrastructure starts like this, upfront plans must be made to increase capacity; Increased electrification of truckstop and truck alike will result in much better life on the road; Improved sleep will improve driver alertness and safety; Reduced idling will significantly reduce fuel use and emissions; Universal appeal for DOD, DOE, DOT, EPA, OEMs, and users alike; Clean coal, gas, hydro, nuclear, or wind energy sources are all distinctly American means by which to generate electricity; Nothing can compete with diesel fuel to serve mobile truck needs; stationary trucks are like power plants--they don't move and should NOT be powered by petroleum products whenever possible; Use American fueled power plants--electricity--to serve truck idling needs wherever practical to do so; encourage economic aspect; Create and reward industry initiatives to reduce fuel use; Eliminate FET on new trucks, provide tax credits (non highway fuel use and investment), provide incentives based on results; Encourage newer/ cleaner truck use; solicit BAAs with mandatory OEM/ fleet participation/ lead; and A gallon saved is a gallon earned-- start NOW, not later.

Skip Yeakel



Incorporating Amino Acid Esters into Catalysts for Hydrogen Oxidation: Steric and Electronic Effects and the Role of Water as a Base  

Science Conference Proceedings (OSTI)

Four derivatives of a hydrogen oxidation catalyst, [Ni(PCy2NBn-R2)]2+ (Cy=cyclohexyl, Bn=benzyl, R= OMe, COOMe, CO-Alanine-methyl ester or CO-Phenylalanine-methyl ester), have been prepared to investigate steric and electronic effects on catalysis. Each complex was characterized spectroscopically and electrochemically, and thermodynamic data were determined. Crystal structures are also reported for the -OMe and -COOMe derivatives. All four catalysts were found to be active for H2 oxidation. The methyl ester (R = COOMe) and amino acid ester containing complexes (R = CO-Alanine-methyl ester or CO-Phenylalanine-methyl ester) had slower rates (4 s-1) than that of the parent complex (10 s-1), in which R = H, consistent with the lower amine pKas and less favorable ?GH2s found for these electron-withdrawing substituents. Dynamic processes for the amino acid ester containing complexes were also investigated and found not to hinder catalysis. The electron-donating methoxy ether derivative (R = OMe) was prepared to compare electronic effects and has a similar catalytic rate as the parent complex. In the course of these studies, it was found that water could act as a weak base for H2 oxidation, although catalytic turnover requires a significantly higher potential and utilizes a different sequence of catalytic steps than when using a base with a higher pKa. Importantly, these catalysts provide a foundation upon which larger peptides can be attached to [Ni(PCy2NBn2)2]2+ hydrogen oxidation catalysts in order to more fully investigate and implement the effects of the outer-coordination sphere. This work was funded by the DOE Office of Science Early Career Research Program through the Office of Basic Energy Sciences (SL and WJS), by the Center for Molecular Electrocatalysis, an Energy Frontier Research Center funded by the US Department of Energy, Office of Science, Office of Basic Energy Sciences (JR), and by the US DOE Basic Energy Sciences, Chemical Sciences, Geoscience and Biosciences Division (AMA, AJ). Pacific Northwest National Laboratory is operated by Battelle for the U.S. Department of Energy.

Lense, Sheri; Ho, Ming-Hsun; Chen, Shentan; Jain, Avijita; Raugei, Simone; Linehan, John C.; Roberts, John A.; Appel, Aaron M.; Shaw, Wendy J.



Hydrogen production and delivery analysis in US markets : cost, energy and greenhouse gas emissions.  

DOE Green Energy (OSTI)

Hydrogen production cost conclusions are: (1) Steam Methane Reforming (SMR) is the least-cost production option at current natural gas prices and for initial hydrogen vehicle penetration rates, at high production rates, SMR may not be the least-cost option; (2) Unlike coal and nuclear technologies, the cost of natural gas feedstock is the largest contributor to SMR production cost; (3) Coal- and nuclear-based hydrogen production have significant penalties at small production rates (and benefits at large rates); (4) Nuclear production of hydrogen is likely to have large economies of scale, but because fixed O&M costs are uncertain, the magnitude of these effects may be understated; and (5) Given H2A default assumptions for fuel prices, process efficiencies and labor costs, nuclear-based hydrogen is likely to be more expensive to produce than coal-based hydrogen. Carbon taxes and caps can narrow the gap. Hydrogen delivery cost conclusions are: (1) For smaller urban markets, compressed gas delivery appears most economic, although cost inputs for high-pressure gas trucks are uncertain; (2) For larger urban markets, pipeline delivery is least costly; (3) Distance from hydrogen production plant to city gate may change relative costs (all results shown assume 100 km); (4) Pipeline costs may be reduced with system 'rationalization', primarily reductions in service pipeline mileage; and (5) Liquefier and pipeline capital costs are a hurdle, particularly at small market sizes. Some energy and greenhouse gas Observations: (1) Energy use (per kg of H2) declines slightly with increasing production or delivery rate for most components (unless energy efficiency varies appreciably with scale, e.g., liquefaction); (2) Energy use is a strong function of production technology and delivery mode; (3) GHG emissions reflect the energy efficiency and carbon content of each component in a production-delivery pathway; (4) Coal and natural gas production pathways have high energy consumption and significant GHG emissions (in the absence of carbon caps, taxes or sequestration); (5) Nuclear pathway is most favorable from energy use and GHG emissions perspective; (6) GH2 Truck and Pipeline delivery have much lower energy use and GHG emissions than LH2 Truck delivery; and (7) For LH2 Truck delivery, the liquefier accounts for most of the energy and GHG emissions.

Mintz, M.; Gillette, J.; Elgowainy, A. (Decision and Information Sciences); ( ES)



Directed Evolution of Phosphotriesterase for Stereoselective Detoxification of Organophosphate Nerve Agents  

E-Print Network (OSTI)

The bacterial phosphotriesterase (PTE) from Pseudomonas diminuta possess very broad substrate specificity for organophosphorus compounds. It is capable of hydrolyzing several insecticides including paraoxon and various chemical warfare agents such as sarin (GB), soman (GD), cyclosarin (GF) and VX. The catalytic ability of PTE for the hydrolysis of paraoxon is close to the limit of diffusion of the reactant in solution. However, the catalytic activity of PTE for the organophosphate nerve agents is lower than that for paraoxon. It was reported that the wild-type PTE preferentially catalyze the hydrolysis of the less toxic Rp- enantiomers of organophosphate nerve agents and their analogues than the more toxic Sp- enantiomers. The first generation of PTE mutants that contains a modified substrate binding pocket was identified and it was observed that their catalytic activity towards the more toxic Sp- enantiomers organophosphate nerve agent analogues was enhanced. The H254G/H257W/L303T mutant was shown to have a reversed stereoselectivity. The kcat/Km values of this mutant towards the hydrolysis of the SpRc- and SpSc-enantiomers of the GD analogue and the Sp-enantiomer of the GF analogue were enhanced by 73-, 543-, and 1340-fold relatively to the wile-type enzyme, respectively. The second generation of PTE mutants were isolated and shown to have higher activity toward the Sp-enantiomers of the GD and GF analogues than the first generation mutants. Saturation mutagenesis, in vitro screening and in vivo selection were conducted using the gene for the mutants from the first generation. The GWT-d3 mutant was identified as the most active PTE mutant towards the hydrolysis of the Spenantiomers of the GD analogue, the kcat/Km values were 780- and 3530-fold higher than the wild-type enzyme toward the SpRc- and SpSc-enantiomers of the GD analogues. The GWT-f5 mutant was the best PTE mutant towards the Sp-enantiomer of the GF analogue, the kcat/Km values were 15500-fold higher than the wild-type enzyme. The X-ray crystal structures of the wild-type PTE and the G60A mutant were determined in the presence of the hydrolysis product diethyl phosphate and a product analogue cacodylate, respectively. This result supports the reaction mechanism previously proposed by Dr. Sarah Aubert.

Tsai, Ping-Chuan



Energy Information Administration  

U.S. Energy Information Administration (EIA) Indexed Site

24, 2000 24, 2000 http://www.eia.doe.gov/oil_gas/natural_gas/nat_frame.html N Y M E X N a t u r a l G a s F u t u r e P r i c e , H e n r y H u b S p o t P r ic e , a n d W e s t T e x a s I n t e r m e d i a t e C r u d e O i l P r i c e 2 . 0 0 2 . 5 0 3 . 0 0 3 . 5 0 4 . 0 0 4 . 5 0 5 . 0 0 5 . 5 0 6 . 0 0 Dollars Per Million BTU N Y M E X S e t t le m e n t P r ic e H e n r y H u b S p o t W T I in $ / M M B t u N o te : T h e H e n r y H u b s p o t p r ic e is fr o m th e G A S D A IL Y a n d is t h e m id p o in t o f t hei r h i gh and l o w p ri c e f o r a d a y . T h e W e st T e x a s I n t e r m e d i a t e c r u d e o il p r ic e , in d o lla r s p e r b a r r e l, is th e " s e ll p r ic e " f r o m t h e G A S D A I L Y , a n d is c o n v e r t e d t o $ / M M B tu u s in g a c o n v e r s io n fa c to r o f 5 .8 0 M M B tu p e r b a r r e l. T h e d a t e s m a r k e d b y v e r t ic a l l i n e s a r e t h e N Y M E X n e a r - m o n t h c ont r a ct s e ttl e m e n t d a t e s . 0 . 0 0 M O N T H N Y M E X D e li v e r y M o n t h ( n e a r - m o n t h c o n t r a c t ) * H o l id a y + C lo s e d A P R I L M A Y 3 /2 9 /0


Energy Information Administration  

U.S. Energy Information Administration (EIA) Indexed Site

15, 2000 15, 2000 http://www.eia.doe.gov N Y M E X F u t u r e P r i c e s v s H e n r y H u b S p o t P r i c e s 1 . 5 0 1 . 7 0 1 . 9 0 2 . 1 0 2 . 3 0 2 . 5 0 2 . 7 0 2 . 9 0 3 . 1 0 3 . 3 0 3 . 5 0 3 . 7 0 3 . 9 0 4 . 1 0 4 . 3 0 4 . 5 0 4 . 7 0 4 . 9 0 5 . 1 0 5 . 3 0 5 . 5 0 5 . 7 0 5 . 9 0 Dollars Per Million BTU N Y M E X S e t t l e m e n t P r ic e H e n r y H u b S p o t W T I i n $ / M M B t u N o t e : T h e H e n r y H u b s p o t p r i c e i s f r o m t h e G A S D A I L Y a n d i s t h e m id p o i n t o f t hei r h i gh and l o w p r i c e f o r a d a y . T h e W T I p r i c e , i n d o l l a r s p e r b a r r e l , i s t h e " s e l l p r ic e " f r o m t h e G A S D A I L Y , a n d i s c o n v e r t e d t o $ / M M B t u u s in g a c o n v e r s i o n f a c t o r o f 5 . 8 0 M M B t u p e r b a r r e l . T h e d a t e s m a r k e d b y v e r t i c a l l i n e s a r e t h e N Y M E X n e a r - m o n t h c o n t r a c t s e t t l e m e n t d a t e s . 0 . 0 0 M O N T H N Y M E X D e liv e r y M o n t h ( n e a r - m o n t h c o n t r a c t ) * H o lid a y + C l o s e d F E B R U A R Y M A R C H 1 /2 7 / 0 0 A P R I L 2 /2 8 / 0 0 M A Y 3 /3 0 / 0 0 4 /2 6 / 0 J U N E D a i ly A v e r a g e o f H ig h T e


Tritium in the World Trade Center September 11, 2001 Terrorist Attack: It's Possible Sources and Fate  

SciTech Connect

Traces of tritiated water (HTO) were determined at World Trade Center (WTC) ground zero after the 9/11/01 terrorist attack. A method of ultralow-background liquid scintillation counting was used after distilling HTO from the samples. A water sample from the WTC sewer, collected on 9/13/01, contained 0.174{plus_minus}0.074 (2{sigma}) nCi/L of HTO. A split water sample, collected on 9/21/01 from the basement of WTC Building 6, contained 3.53{plus_minus}0.17 and 2.83{plus_minus}0.15 nCi/L, respectively. Several water and vegetation samples were analyzed from areas outside the ground zero, located in Manhattan, Brooklyn, Queens, and Kensico Reservoir. No HTO above the background was found in those samples. All these results are well below the levels of concern to human exposure. Several tritium radioluminescent (RL) devices were investigated as possible sources of the traces of tritium at ground zero. Tritium is used in self-luminescent emergency EXIT signs. No such signs were present inside the WTC buildings. However, it was determined that Boeing 767-222 aircraft operated by the United Airlines that hit WTC Tower 2 as well as Boeing 767-223ER operated by the American Airlines, that hit WTC Tower 1, had a combined 34.3 Ci of tritium at the time of impact. Other possible sources of tritium include dials and lights of fire and emergency equipment, sights and scopes in weaponry, as well as time devices equipped with tritium dials. It was determined that emergency equipment was not a likely source. However, WTC hosted several law-enforcement agencies such as ATF, CIA, US Secret Service and US Customs. The ATF office had two weapon vaults in WTC Building 6. Also 63 Police Officers, possibly carrying handguns with tritium sights, died in the attack. The weaponry containing tritium was therefore a likely and significant source of tritium. It is possible that some of the 2830 victims carried tritium watches, however this source appears to be less significant that the other two. The fate of tritium in the attack depended on its chemistry. Any tritium present in the vicinity of jet-fuel explosion or fire would convert to HTO. The molecular tritium is also known to quickly exchange with water adsorbed on surfaces at ambient temperatures. Therefore, the end product of reacted tritium was HTO. A part of it would disperse into the atmosphere and a part would remain on site. The dynamic aspect of HTO removal was investigated taking into a consideration water flow at ground zero. Most of ground zero is encircled by the Slurry Wall, 70 ft deep underground, called a Bathtub. Approximately three million gallons of water were hosed on site in the fire-fighting efforts, and 1 million gallons fell as rainwater, between 9/11 and 9/21 (the day of the reported measurement). The combined water percolated through the debris down to the bottom of the Bathtub dissolving and removing HTO with it. That water would meet and combine with the estimated 26 million gallons of water that leaked from the Hudson River as well as broken mains, during the same period of 10 days after the attack. The combined water was collecting in the PATH train tunnel and continuously being pumped out to prevent flooding. A %Box model of water flow was developed to describe the above scenario. Considering the uncertainty in the amount of tritium present from sources other than the aircraft, as well as the dynamic character of tritium removal from the site, it is feasible to provide only a qualitative picture of the fate and behavior of tritium at WTC with the limited experimental data available. If the time history of tritium concentration at WTC had been measured, this study could have been a tracer study of water flow at WTC possibly useful to civil engineering.

Parekh, P; Semkow, T; Husain, L; Haines, D; Woznial, G; Williams, P; Hafner, R; Rabun, R



Particle Data Group - 2009 Authors  

NLE Websites -- All DOE Office Websites (Extended Search)

08 Edition and 2009 Web Update 08 Edition and 2009 Web Update (Click on Author Name to get Email address, phone numbers, etc.) New authors of 2009 Web Update D. de Florian, 109 G. Dissertori, 31 D. Edwards, 27 S. Golwala, 108 M. Heffner, 45 B. Heltsley, 62 J. Holder, 34 A. Karle, 7 J. Lys, 8 G. Salam, 112 K. Scholberg, 111 M. Syphers, 15 A. Vogt, 110 W. Walkowiak, 113 C. Walter, 111 E. Weinberg, 90 L. Wiencke, 114 Authors of the 2008 Review of Particle Physics C. Amsler et al. (Particle Data Group), Physics Letters B667, 1 (2008) (Also see: PDF format) AUTHORS: (Click on Author Name to get Email address, phone numbers, etc.) C. Amsler, 1 M. Doser, 2 M. Antonelli, 3 D. Asner, 4 K.S. Babu, 5 H. Baer, 6 H.R. Band, 7 R.M. Barnett, 8 J. Beringer, 8 E. Bergren, G. Bernardi, 9 W. Bertl, 10 H. Bichsel, 11 O. Biebel, 12 P. Bloch, 2 E. Blucher, 13 S. Blusk, 14 R.N. Cahn, 8 M. Carena, 15,13,16 C. Caso, 17,* A. Ceccucci, 2 D. Chakraborty, 18 M.-C. Chen, 19 R.S. Chivukula, 20 G. Cowan, 21 O. Dahl, 8 G. D'Ambrosio, 22 T. Damour, 23 A. de Gouvea, 24 T. DeGrand, 25 B. Dobrescu, 15 M. Drees, 26 A. Edwards, 27 S. Eidelman, 28 V.D. Elvira, 15 J. Erler, 29 V.V. Ezhela, 30 J.L. Feng, 19 W. Fetscher, 31 B.D. Fields, 32 B. Foster, 33 T.K. Gaisser, 34 L. Garren, 15 H.-J. Gerber, 31 G. Gerbier, 35 T. Gherghetta, 36 G.F. Giudice, 2 M. Goodman, 37 C. Grab, 31 A.V. Gritsan, 38 J.-F. Grivaz, 39 D.E. Groom, 8 M. Grünewald, 40 A. Gurtu, 41,2 T. Gutsche, 42 H.E. Haber, 43 K. Hagiwara, 44 C. Hagmann, 45 K.G. Hayes, 46 J.J. Hernández-Rey, 47,¶ K. Hikasa, 48 I. Hinchliffe, 8 A. Höcker, 2 J. Huston, 20 P. Igo-Kemenes, 49 J.D. Jackson, 8 K.F. Johnson, 6 T. Junk, 15 D. Karlen, 50 B. Kayser, 15 D. Kirkby, 19 S.R. Klein, 51 I.G. Knowles, 52 C. Kolda, 53 R.V. Kowalewski, 50 P. Kreitz, 54 B. Krusche, 55 Yu.V. Kuyanov, 30 Y. Kwon, 56 O. Lahav, 57 P. Langacker, 58 A. Liddle, 59 Z. Ligeti, 8 C.-J. Lin, 8 T.M. Liss, 60 L. Littenberg, 61 J.C. Liu, 54 K.S. Lugovsky, 30 S.B. Lugovsky, 30 H. Mahlke, 62 M.L. Mangano, 2 T. Mannel, 63 A.V. Manohar, 64 W.J. Marciano, 61 A.D. Martin, 65 A. Masoni, 66 D. Milstead, 67 R. Miquel, 68 K. Mönig, 69 H. Murayama, 70,71,8 K. Nakamura, 44 M. Narain, 72 P. Nason, 73 S. Navas, 74,¶ P. Nevski, 61 Y. Nir, 75 K.A. Olive, 76 L. Pape, 31 C. Patrignani, 17 J.A. Peacock, 52 A. Piepke, 77 G. Punzi, 78 A. Quadt, 79, S. Raby, 80 G. Raffelt, 81 B.N. Ratcliff, 54 B. Renk, 82 P. Richardson, 65 S. Roesler, 2 S. Rolli, 83 A. Romaniouk, 84 L.J. Rosenberg, 11 J.L. Rosner, 13 C.T. Sachrajda, 85 Y. Sakai, 44 S. Sarkar, 86 F. Sauli, 2 O. Schneider, 87 D. Scott, 88 B. Seligman, 89 M. Shaevitz, 90 T. Sjöstrand, 91 J.G. Smith, 25 G.F. Smoot, 8 S. Spanier, 54 H. Spieler, 8 A. Stahl, 92 T. Stanev, 34 S.L. Stone, 14 T. Sumiyoshi, 93 M. Tanabashi, 94 J. Terning, 95 M. Titov, 96 N.P. Tkachenko, 30 N.A. Törnqvist, 97 D. Tovey, 98 G.H. Trilling, 8 T.G. Trippe, 8 G. Valencia, 99 K. van Bibber, 45 M.G. Vincter, 4 P. Vogel, 100 D.R. Ward, 101 T. Watari, 102 B.R. Webber, 101 G. Weiglein, 65 J.D. Wells, 103 M. Whalley, 65 A. Wheeler, 54 C.G. Wohl, 8 L. Wolfenstein, 104 J. Womersley, 105 C.L. Woody, 61 R.L. Workman, 106 A. Yamamoto, 44 W. -M. Yao, 8 O.V. Zenin, 30 J. Zhang, 107 R.-Y. Zhu 108 P.A. Zyla 8


Particle Data Group - Authors  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Edition 8 Edition C. Amsler et al. (Particle Data Group), Physics Letters B667, 1 (2008) Also see: PDF format. AUTHORS: (Click on Author Name to get Email address, phone numbers, etc.) RPP authors C. Amsler, 1 M. Doser, 2 M. Antonelli, 3 D. Asner, 4 K.S. Babu, 5 H. Baer, 6 H.R. Band, 7 R.M. Barnett, 8 J. Beringer, 8 E. Bergren, G. Bernardi, 9 W. Bertl, 10 H. Bichsel, 11 O. Biebel, 12 P. Bloch, 2 E. Blucher, 13 S. Blusk, 14 R.N. Cahn, 8 M. Carena, 15,13,16 C. Caso, 17,* A. Ceccucci, 2 D. Chakraborty, 18 M.-C. Chen, 19 R.S. Chivukula, 20 G. Cowan, 21 O. Dahl, 8 G. D'Ambrosio, 22 T. Damour, 23 A. de Gouvea, 24 T. DeGrand, 25 B. Dobrescu, 15 M. Drees, 26 A. Edwards, 27 S. Eidelman, 28 V.D. Elvira, 15 J. Erler, 29 V.V. Ezhela, 30 J.L. Feng, 19 W. Fetscher, 31 B.D. Fields, 32 B. Foster, 33 T.K. Gaisser, 34 L. Garren, 15 H.-J. Gerber, 31 G. Gerbier, 35 T. Gherghetta, 36 G.F. Giudice, 2 M. Goodman, 37 C. Grab, 31 A.V. Gritsan, 38 J.-F. Grivaz, 39 D.E. Groom, 8 M. Grünewald, 40 A. Gurtu, 41,2 T. Gutsche, 42 H.E. Haber, 43 K. Hagiwara, 44 C. Hagmann, 45 K.G. Hayes, 46 J.J. Hernández-Rey, 47,¶ K. Hikasa, 48 I. Hinchliffe, 8 A. Höcker, 2 J. Huston, 20 P. Igo-Kemenes, 49 J.D. Jackson, 8 K.F. Johnson, 6 T. Junk, 15 D. Karlen, 50 B. Kayser, 15 D. Kirkby, 19 S.R. Klein, 51 I.G. Knowles, 52 C. Kolda, 53 R.V. Kowalewski, 50 P. Kreitz, 54 B. Krusche, 55 Yu.V. Kuyanov, 30 Y. Kwon, 56 O. Lahav, 57 P. Langacker, 58 A. Liddle, 59 Z. Ligeti, 8 C.-J. Lin, 8 T.M. Liss, 60 L. Littenberg, 61 J.C. Liu, 54 K.S. Lugovsky, 30 S.B. Lugovsky, 30 H. Mahlke, 62 M.L. Mangano, 2 T. Mannel, 63 A.V. Manohar, 64 W.J. Marciano, 61 A.D. Martin, 65 A. Masoni, 66 D. Milstead, 67 R. Miquel, 68 K. Mönig, 69 H. Murayama, 70,71,8 K. Nakamura, 44 M. Narain, 72 P. Nason, 73 S. Navas, 74,¶ P. Nevski, 61 Y. Nir, 75 K.A. Olive, 76 L. Pape, 31 C. Patrignani, 17 J.A. Peacock, 52 A. Piepke, 77 G. Punzi, 78 A. Quadt, 79, S. Raby, 80 G. Raffelt, 81 B.N. Ratcliff, 54 B. Renk, 82 P. Richardson, 65 S. Roesler, 2 S. Rolli, 83 A. Romaniouk, 84 L.J. Rosenberg, 11 J.L. Rosner, 13 C.T. Sachrajda, 85 Y. Sakai, 44 S. Sarkar, 86 F. Sauli, 2 O. Schneider, 87 D. Scott, 88 B. Seligman, 89 M. Shaevitz, 90 T. Sjöstrand, 91 J.G. Smith, 25 G.F. Smoot, 8 S. Spanier, 54 H. Spieler, 8 A. Stahl, 92 T. Stanev, 34 S.L. Stone, 14 T. Sumiyoshi, 93 M. Tanabashi, 94 J. Terning, 95 M. Titov, 96 N.P. Tkachenko, 30 N.A. Törnqvist, 97 D. Tovey, 98 G.H. Trilling, 8 T.G. Trippe, 8 G. Valencia, 99 K. van Bibber, 45 M.G. Vincter, 4 P. Vogel, 100 D.R. Ward, 101 T. Watari, 102 B.R. Webber, 101 G. Weiglein, 65 J.D. Wells, 103 M. Whalley, 65 A. Wheeler, 54 C.G. Wohl, 8 L. Wolfenstein, 104 J. Womersley, 105 C.L. Woody, 61 R.L. Workman, 106 A. Yamamoto, 44 W. -M. Yao, 8 O.V. Zenin, 30 J. Zhang, 107 R.-Y. Zhu 108 P.A. Zyla 8