National Library of Energy BETA

Sample records for quantitative trait loci

  1. Phylogenetically structured traits in root systems influence arbuscular mycorrhizal colonization in woody angiosperms

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Valverde-Barrantes, Oscar J.; Horning, Amber L.; Smemo, Kurt A.; Blackwood, Christopher B.


    In this study, there is little quantitative information about the relationship between root traits and the extent of arbuscular mycorrhizal fungi (AMF) colonization. We expected that ancestral species with thick roots will maximize AMF habitat by maintaining similar root traits across root orders (i.e., high root trait integration), whereas more derived species are expected to display a sharp transition from acquisition to structural roots. Moreover, we hypothesized that interspecific morphological differences rather than soil conditions will be the main driver of AMF colonization We analyzed 14 root morphological and chemical traits and AMF colonization rates for the first three rootmore » orders of 34 temperate tree species grown in two common gardens. We also collected associated soil to measure the effect of soil conditions on AMF colonization Results Thick-root magnoliids showed less variation in root traits along root orders than more-derived angiosperm groups. Variation in stele:root diameter ratio was the best indicator of AMF colonization within and across root orders. Root functional traits rather than soil conditions largely explained the variation in AMF colonization among species. In conclusion, not only the traits of first order but the entire structuring of the root system varied among plant lineages, suggesting alternative evolutionary strategies of resource acquisition. Understanding evolutionary pathways in below ground organs could open new avenues to understand tree species influence on soil carbon and nutrient cycling.« less

  2. Arbuscular mycorrhizal interactions … an important trait for...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Arbuscular mycorrhizal interactions an important trait for biomass production of bioenergy crops? Arbuscular mycorrhizal interactions an important trait for biomass ...

  3. Genetic maps of polymorphic DNA loci on rat chromosome 1

    SciTech Connect (OSTI)

    Ding, Yan-Ping; Remmers, E.F.; Longman, R.E.


    Genetic linkage maps of loci defined by polymorphic DNA markers on rat chromosome 1 were constructed by genotyping F2 progeny of F344/N x LEW/N, BN/SsN x LEW/N, and DA/Bkl x F344/Hsd inbred rat strains. In total, 43 markers were mapped, of which 3 were restriction fragment length polymorphisms and the others were simple sequence length polymorphisms. Nineteen of these markers were associated with genes. Six markers for five genes, {gamma}-aminobutyric acid receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}1 (Adrb1), carcinoembryonic antigen gene family member 1 (Cgm1), and lipogenic protein S14 (Lpgp), and 20 anonymous loci were not previously reported. Thirteen gene loci (Myl2, Aldoa, Tnt, Igf2, Prkcg, Cgm4, Calm3, Cgm3, Psbp1, Sa, Hbb, Ins1, and Tcp1) were previously mapped. Comparative mapping analysis indicated that the large portion of rat chromosome 1 is homologous to mouse chromosome 7, although the homologous to mouse chromosome 7, although the homologs of two rat genes are located on mouse chromosomes 17 and 19. Homologs of the rat chromosome 1 genes that we mapped are located on human chromosomes 6, 10, 11, 12, 15, 16, and 19. 38 refs., 1 fig., 3 tabs.

  4. Quantitative film radiography

    SciTech Connect (OSTI)

    Devine, G.; Dobie, D.; Fugina, J.; Hernandez, J.; Logan, C.; Mohr, P.; Moss, R.; Schumacher, B.; Updike, E.; Weirup, D.


    We have developed a system of quantitative radiography in order to produce quantitative images displaying homogeneity of parts. The materials that we characterize are synthetic composites and may contain important subtle density variations not discernible by examining a raw film x-radiograph. In order to quantitatively interpret film radiographs, it is necessary to digitize, interpret, and display the images. Our integrated system of quantitative radiography displays accurate, high-resolution pseudo-color images in units of density. We characterize approximately 10,000 parts per year in hundreds of different configurations and compositions with this system. This report discusses: the method; film processor monitoring and control; verifying film and processor performance; and correction of scatter effects.

  5. Genomic architecture of risk loci associated with autoimmunity (7th Annual SFAF Meeting, 2012)

    ScienceCinema (OSTI)

    Wakeland, Ward [University of Texas Southwestern Medical Center


    Ward Wakeland on "Genomic architecture of risk loci associated with autoimmunity" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.

  6. Fetal weight at term influenced by H-2-associated loci

    SciTech Connect (OSTI)

    Tyan, M.L.


    Pregnant mice which in theory differ only in the region of the major histocompatibility complex (MHC) on chromosome 17 (C57BL/10, the inbred partner [host strain], and B10.D2, B10.BR, BI0.A, B10.A[2R], Bl0.A[5R], B10.A[15R] and B10.A[18R]) were sacrificed on the 11th and 18th days of gestation, and the fetuses were sexed and weighed. Fetuses from reciprocal crosses between B10.A and B10BR, B10.D2 and C57BL/10 were weighed and sexed on the 18th day of gestation. It was found that (i) fetal weights were not significantly different among the strains examined on day 11 (Bl0.BR, B10.A[15R] and B10.A[18R]), (ii) B10.BR fetuses of both sexes weighed significantly less than fetuses from the other strains on day 18, (iii) B10.D2 18-day-old male but not female fetuses were heavier than the males from the other strains (this difference was not present when corrections for litter size were made), (iv) the fetuses from the B10.A x B10.BR cross were the smallest, those from the B10.D2 x 810.A cross the largest, and those from the B10.A x C57BL/10 crosses intermediate, and (v) maternal effects were noted In the B10.A x B10.BR and B10.A x B10.D2 but not the B10.A x C57BL/10 crosses. The results suggest that there are two or more MHC associated loci that influence growth rate in late gestation. Among the candidate genes are Ped and Igfr II. 17 refs., 4 tabs.

  7. Berkeley Quantitative Genome Browser

    Energy Science and Technology Software Center (OSTI)


    The Berkeley Quantitative Genome Browser provides graphical browsing functionality for genomic data organized, at a minimum, by sequence and position. While supporting the annotation browsing features typical of many other genomic browsers, additional emphasis is placed on viewing and utilizing quantitative data. Data may be read from GFF, SGR, FASTA or any column delimited format. Once the data has been read into the browser's buffer, it may be searched. filtered or subjected to mathematical transformation.more » The browser also supplies some graphical design manipulation functionality geared towards preparing figures for presentations or publication. A plug-in mechanism enables development outside the core functionality that adds more advanced or esoteric analysis capabilities. BBrowse's development and distribution is open-source and has been built to run on Linux, OSX and MS Windows operating systems.« less

  8. Primary enzyme quantitation

    DOE Patents [OSTI]

    Saunders, G.C.


    The disclosure relates to the quantitation of a primary enzyme concentration by utilizing a substrate for the primary enzyme labeled with a second enzyme which is an indicator enzyme. Enzyme catalysis of the substrate occurs and results in release of the indicator enzyme in an amount directly proportional to the amount of primary enzyme present. By quantifying the free indicator enzyme one determines the amount of primary enzyme present.

  9. Try-A Global Database of Plant Traits

    SciTech Connect (OSTI)

    Thornton, Peter E [ORNL


    Plant traits the morphological, anatomical, physiological, biochemical and phenological characteristics of plants and their organs determine how primary producers respond to environmental factors, affect other trophic levels, influence ecosystem processes and services and provide a link from species richness to ecosystem functional diversity. Trait data thus represent the raw material for a wide range of research from evolutionary biology, community and functional ecology to biogeography. Here we present the global database initiative named TRY, which has united a wide range of the plant trait research community worldwide and gained an unprecedented buy-in of trait data: so far 93 trait databases have been contributed. The data repository currently contains almost three million trait entries for 69 000 out of the world s 300 000 plant species, with a focus on 52 groups of traits characterizing the vegetative and regeneration stages of the plant life cycle, including growth, dispersal, establishment and persistence. A first data analysis shows that most plant traits are approximately log-normally distributed, with widely differing ranges of variation across traits. Most trait variation is between species (interspecific), but significant intraspecific variation is also documented, up to 40% of the overall variation. Plant functional types (PFTs), as commonly used in vegetation models, capture a substantial fraction of the observed variation but for several traits most variation occurs within PFTs, up to 75% of the overall variation. In the context of vegetation models these traits would better be represented by state variables rather than fixed parameter values. The improved availability of plant trait data in the unified global database is expected to support a paradigm shift from species to trait-based ecology, offer new opportunities for synthetic plant trait research and enable a more realistic and empirically grounded representation of terrestrial vegetation in Earth system models.

  10. A taxonomy of bacterial microcompartment loci constructed by a novel scoring method

    SciTech Connect (OSTI)

    Axen, Seth D.; Erbilgin, Onur; Kerfeld, Cheryl A.; Tanaka, Mark M.


    Bacterial microcompartments (BMCs) are proteinaceous organelles involved in both autotrophic and heterotrophic metabolism. All BMCs share homologous shell proteins but differ in their complement of enzymes; these are typically encoded adjacent to shell protein genes in genetic loci, or operons. To enable the identification and prediction of functional (sub)types of BMCs, we developed LoClass, an algorithm that finds putative BMC loci and inventories, weights, and compares their constituent pfam domains to construct a locus similarity network and predict locus (sub)types. In addition to using LoClass to analyze sequences in the Non-redundant Protein Database, we compared predicted BMC loci found in seven candidate bacterial phyla (six from single-cell genomic studies) to the LoClass taxonomy. Together, these analyses resulted in the identification of 23 different types of BMCs encoded in 30 distinct locus (sub)types found in 23 bacterial phyla. These include the two carboxysome types and a divergent set of metabolosomes, BMCs that share a common catalytic core and process distinct substrates via specific signature enzymes. Furthermore, many Candidate BMCs were found that lack one or more core metabolosome components, including one that is predicted to represent an entirely new paradigm for BMC-associated metabolism, joining the carboxysome and metabolosome. By placing these results in a phylogenetic context, we provide a framework for understanding the horizontal transfer of these loci, a starting point for studies aimed at understanding the evolution of BMCs. This comprehensive taxonomy of BMC loci, based on their constituent protein domains, foregrounds the functional diversity of BMCs and provides a reference for interpreting the role of BMC gene clusters encoded in isolate, single cell, and metagenomic data. Many loci encode ancillary functions such as transporters or genes for cofactor assembly; this expanded vocabulary of BMC-related functions should be useful for design of genetic modules for introducing BMCs in bioengineering applications.

  11. A taxonomy of bacterial microcompartment loci constructed by a novel scoring method

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Axen, Seth D.; Erbilgin, Onur; Kerfeld, Cheryl A.; Tanaka, Mark M.


    Bacterial microcompartments (BMCs) are proteinaceous organelles involved in both autotrophic and heterotrophic metabolism. All BMCs share homologous shell proteins but differ in their complement of enzymes; these are typically encoded adjacent to shell protein genes in genetic loci, or operons. To enable the identification and prediction of functional (sub)types of BMCs, we developed LoClass, an algorithm that finds putative BMC loci and inventories, weights, and compares their constituent pfam domains to construct a locus similarity network and predict locus (sub)types. In addition to using LoClass to analyze sequences in the Non-redundant Protein Database, we compared predicted BMC loci found inmore » seven candidate bacterial phyla (six from single-cell genomic studies) to the LoClass taxonomy. Together, these analyses resulted in the identification of 23 different types of BMCs encoded in 30 distinct locus (sub)types found in 23 bacterial phyla. These include the two carboxysome types and a divergent set of metabolosomes, BMCs that share a common catalytic core and process distinct substrates via specific signature enzymes. Furthermore, many Candidate BMCs were found that lack one or more core metabolosome components, including one that is predicted to represent an entirely new paradigm for BMC-associated metabolism, joining the carboxysome and metabolosome. By placing these results in a phylogenetic context, we provide a framework for understanding the horizontal transfer of these loci, a starting point for studies aimed at understanding the evolution of BMCs. This comprehensive taxonomy of BMC loci, based on their constituent protein domains, foregrounds the functional diversity of BMCs and provides a reference for interpreting the role of BMC gene clusters encoded in isolate, single cell, and metagenomic data. Many loci encode ancillary functions such as transporters or genes for cofactor assembly; this expanded vocabulary of BMC-related functions should be useful for design of genetic modules for introducing BMCs in bioengineering applications.« less

  12. Localizing multiple X chromosome-linked retinitis pigmentosa loci using multilocus homogeneity tests

    SciTech Connect (OSTI)

    Ott, J.; Terwilliger, J.D. ); Bhattacharya, S. ); Chen, J.D.; Denton, J.; Donald, J. ); Dubay, C.; Litt, M.; Weleber, R.G. ); Farrar, G.J.; Humphries, P. ); Fishman, G.A.; Wong, F. ); Frey, D.; Maechler, M. )


    Multilocus linkage analysis of 62 family pedigrees with X chromosome-linked retinitis pigmentosa (XLRP) was undertaken to determine the presence of possible multiple disease loci and to reliability estimate their map location. Multilocus homogeneity tests furnish convincing evidence for the presence of two XLRP loci, the likelihood ratio being 6.4 {times} 10{sup 9}:1 in a favor of two versus a single XLRP locus and gave accurate estimates for their map location. In 60-75% of the families, location of an XLRP gene was estimated at 1 centimorgan distal to OTC, and in 25-40% of the families, an XLRP locus was located halfway between DXS14 (p58-1) and DXZ1 (Xcen), with an estimated recombination fraction of 25% between the two XLRP loci. There is also good evidence for third XLRP locus, midway between DXS28 (C7) and DXS164 (pERT87), supported by a likelihood ratio of 293:1 for three versus two XLRP loci.

  13. Quantitive DNA Fiber Mapping

    SciTech Connect (OSTI)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.


    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  14. Arbuscular mycorrhizal interactions … an important trait for biomass

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    production of bioenergy crops? | Department of Energy Arbuscular mycorrhizal interactions … an important trait for biomass production of bioenergy crops? Arbuscular mycorrhizal interactions … an important trait for biomass production of bioenergy crops? This presentation was given by Heike Bucking at the Symbiosis Conference. PDF icon symbiosis_conference_bucking.pdf More Documents & Publications CX-005436: Categorical Exclusion Determination Symbiosis Conference Speaker and Attendee

  15. Quantitative Analysis of Biofuel Sustainability, Including Land...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Quantitative Analysis of Biofuel Sustainability, Including Land Use Change GHG Emissions Quantitative Analysis of Biofuel Sustainability, Including Land Use Change GHG Emissions ...

  16. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    SciTech Connect (OSTI)

    Chakraborty, R.; Zhong, Y.; Jin, L. ); Budowle, B. )


    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  17. Identification of genetic loci that control mammary tumor susceptibility through the host microenvironment

    SciTech Connect (OSTI)

    Zhang, Pengju; Lo, Alvin; Huang, Yurong; Huang, Ge; Liang, Guozhou; Mott, Joni; Karpen, Gary H.; Blakely, Eleanor A.; Bissell, Mina J.; Barcellos-Hoff, Mary Helen; Snijders, Antoine M.; Mao, Jian-Hua


    The interplay between host genetics, tumor microenvironment and environmental exposure in cancer susceptibility remains poorly understood. Here we assessed the genetic control of stromal mediation of mammary tumor susceptibility to low dose ionizing radiation (LDIR) using backcrossed F1 into BALB/c (F1Bx) between cancer susceptible (BALB/c) and resistant (SPRET/EiJ) mouse strains. Tumor formation was evaluated after transplantation of non-irradiated Trp53-/- BALB/c mammary gland fragments into cleared fat pads of F1Bx hosts. Genome-wide linkage analysis revealed 2 genetic loci that constitute the baseline susceptibility via host microenvironment. However, once challenged with LDIR, we discovered 13 additional loci that were enriched for genes involved in cytokines, including TGF?1 signaling. Surprisingly, LDIR-treated F1Bx cohort significantly reduced incidence of mammary tumors from Trp53-/- fragments as well as prolonged tumor latency, compared to sham-treated controls. We demonstrated further that plasma levels of specific cytokines were significantly correlated with tumor latency. Using an ex vivo 3-D assay, we confirmed TGF?1 as a strong candidate for reduced mammary invasion in SPRET/EiJ, which could explain resistance of this strain to mammary cancer risk following LDIR. Our results open possible new avenues to understand mechanisms of genes operating via the stroma that affect cancer risk from external environmental exposures.

  18. Identification of genetic loci that control mammary tumor susceptibility through the host microenvironment

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Pengju; Lo, Alvin; Huang, Yurong; Huang, Ge; Liang, Guozhou; Mott, Joni; Karpen, Gary H.; Blakely, Eleanor A.; Bissell, Mina J.; Barcellos-Hoff, Mary Helen; et al


    The interplay between host genetics, tumor microenvironment and environmental exposure in cancer susceptibility remains poorly understood. Here we assessed the genetic control of stromal mediation of mammary tumor susceptibility to low dose ionizing radiation (LDIR) using backcrossed F1 into BALB/c (F1Bx) between cancer susceptible (BALB/c) and resistant (SPRET/EiJ) mouse strains. Tumor formation was evaluated after transplantation of non-irradiated Trp53-/- BALB/c mammary gland fragments into cleared fat pads of F1Bx hosts. Genome-wide linkage analysis revealed 2 genetic loci that constitute the baseline susceptibility via host microenvironment. However, once challenged with LDIR, we discovered 13 additional loci that were enriched for genesmore » involved in cytokines, including TGFβ1 signaling. Surprisingly, LDIR-treated F1Bx cohort significantly reduced incidence of mammary tumors from Trp53-/- fragments as well as prolonged tumor latency, compared to sham-treated controls. We demonstrated further that plasma levels of specific cytokines were significantly correlated with tumor latency. Using an ex vivo 3-D assay, we confirmed TGFβ1 as a strong candidate for reduced mammary invasion in SPRET/EiJ, which could explain resistance of this strain to mammary cancer risk following LDIR. Our results open possible new avenues to understand mechanisms of genes operating via the stroma that affect cancer risk from external environmental exposures.« less

  19. Ethnic differentiation at VNTR loci, with special reference to forensic applications

    SciTech Connect (OSTI)

    Devlin, B.; Risch, N. )


    Allele-rich VNTR loci provide valuable information for forensic inference. Interpretation of this information is complicated by measurement error, which renders discrete alleles difficult to distinguish. Two methods have been used to circumvent this difficulty-i.e, binning methods and direct evaluation of allele frequencies, the latter achieved by modeling the data as a mixture distribution. The authors use this modeling approach to estimate the allele frequency distributions for two loci-D17S79 and D2S44-for black, Caucasian, and Hispanic samples from the Lifecodes and FBI data bases. The databases are differentiated by the restriction enzyme used: PstI (Lifecodes) and HaeIII (FBI). The results show that alleles common in one ethnic group are almost always common in all ethnic groups, and likewise for rare alleles; this pattern holds for both loci. Gene diversity, or heterozygosity, measured as one minus the sum of the squared allele frequencies, is greater for D2S44 than for D17S79, in both data bases. The average gene diversity across ethnic groups when PstI (HaeIII) is used is .918 (.918) for D17S79 and is .985 (.983) for D2S44. The variance in gene diversity among ethnic groups is greater for D17S79 than for D2S44. The number of alleles, like the gene diversity, is greater for D2S44 than for D17S79. The mean numbers of alleles across ethnic groups, estimated from the PstI (HaeIII) data, are 40.25 (41.5) for D 17S79 and 104 (103) for D2S44. The number of alleles is correlated with sample size. The authors use the estimated allele frequency distributions for each ethnic group to explore the effects of unwittingly mixing populations and thereby violating independence assumptions. They show that, even in extreme cases of mixture, the estimated genotype probabilities are good estimates of the true probabilities, contradicting recent claims. 35 refs., 9 figs., 3 tabs.

  20. Quantitative Characterization of Nanostructured Materials

    SciTech Connect (OSTI)

    Dr. Frank Bridges, University of California-Santa Cruz


    The two-and-a-half day symposium on the "Quantitative Characterization of Nanostructured Materials" will be the first comprehensive meeting on this topic held under the auspices of a major U.S. professional society. Spring MRS Meetings provide a natural venue for this symposium as they attract a broad audience of researchers that represents a cross-section of the state-of-the-art regarding synthesis, structure-property relations, and applications of nanostructured materials. Close interactions among the experts in local structure measurements and materials researchers will help both to identify measurement needs pertinent to ??real-world? materials problems and to familiarize the materials research community with the state-of-the-art local structure measurement techniques. We have chosen invited speakers that reflect the multidisciplinary and international nature of this topic and the need to continually nurture productive interfaces among university, government and industrial laboratories. The intent of the symposium is to provide an interdisciplinary forum for discussion and exchange of ideas on the recent progress in quantitative characterization of structural order in nanomaterials using different experimental techniques and theory. The symposium is expected to facilitate discussions on optimal approaches for determining atomic structure at the nanoscale using combined inputs from multiple measurement techniques.

  1. Ten polymorphic DNA loci, including five in the rat MHC (RT1) region, form a single linkage group on rat chromosome 20

    SciTech Connect (OSTI)

    Remmers, E.F.; Du, Y.; Zha, H.; Goldmuntz, E.A.; Wilder, R.L.


    We have described ten markers for polymorphic loci on rat chromosome 20, including five in the rat MHC (RT1) region. These markers formed a single linkage group spanning a recombination distance of 0.40. The markers identified five expressed gene loci - RT1.N1 (thymus leukemia antigen 1), Tnfa (tumor necrosis factor {alpha}), Hspa1 (heat shock protein 70), Ggt1 ({gamma} glutamyl-transferase 1), and Prkacn2 (protein kinase C catalytic subunit binding inhibitor 2), two loci with sequences that are related to expressed genes - RT1.Aw2 (sequence related to a non-RT1A class I {alpha} chain) and Mt21 (sequence related to metallothionein 2), and three anonymous loci - D20Arb548, D20Arb234, and D20Arb249. These polymorphic markers should facilitate mapping studies and genetic monitoring of inbred rat strains. 18 refs., 2 figs., 3 tabs.

  2. Quantitative Modeling of High Temperature Magnetization Dynamics

    SciTech Connect (OSTI)

    Zhang, Shufeng


    Final Technical Report Project title: Quantitative Modeling of High Temperature Magnetization Dynamics DOE/Office of Science Program Manager Contact: Dr. James Davenport

  3. Combining Quantitative Electrochemistry and Electron Microscopy...

    Office of Scientific and Technical Information (OSTI)

    Microscopy to Study Reversible Lithiation of Silicon Nanowires. Citation Details In-Document Search Title: Combining Quantitative Electrochemistry and Electron Microscopy to ...

  4. Direct and quantitative broadband absorptance spectroscopy with...

    Office of Scientific and Technical Information (OSTI)

    Direct and quantitative broadband absorptance spectroscopy with multilayer cantilever ... Visit OSTI to utilize additional information resources in energy science and technology. A ...

  5. Zinc Speciation in Contaminated Sediments: Quantitative Determination...

    Office of Scientific and Technical Information (OSTI)

    Zinc Speciation in Contaminated Sediments: Quantitative Determination of Zinc Coordination by X-ray Absorption Spectroscopy Citation Details In-Document Search Title: Zinc ...

  6. Spatially Resolved Quantitative Mapping for Thermal Analysis...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Spatially Resolved Quantitative Mapping for Thermal Analysis Using Scanning Probe Microscopy ... This technique probes thermomechanical properties and phase transition temperatures of ...

  7. ARM - Evaluation Product - Quantitative Precipitation Estimates...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to hear from you Send us a note below or call us at 1-888-ARM-DATA. Send Evaluation Product : Quantitative Precipitation Estimates (QPE) from the CSAPR Precipitation rates from...

  8. Report on Solar Water Heating Quantitative Survey

    SciTech Connect (OSTI)

    Focus Marketing Services


    This report details the results of a quantitative research study undertaken to better understand the marketplace for solar water-heating systems from the perspective of home builders, architects, and home buyers.

  9. The importance of retaining a phylogenetic perspective in traits-based community analyses

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Poteat, Monica D.; Buchwalter, David B.; Jacobus, Luke M.


    1) Many environmental stressors manifest their effects via physiological processes (traits) that can differ significantly among species and species groups. We compiled available data for three traits related to the bioconcentration of the toxic metal cadmium (Cd) from 42 aquatic insect species representing orders Ephemeroptera (mayfly), Plecoptera (stonefly), and Trichoptera (caddisfly). These traits included the propensity to take up Cd from water (uptake rate constant, ku), the ability to excrete Cd (efflux rate constant, ke), and the net result of these two processes (bioconcentration factor, BCF). 2) Ranges in these Cd bioaccumulation traits varied in magnitude across lineages (some lineagesmore » had a greater tendency to bioaccumulate Cd than others). Overlap in the ranges of trait values among different lineages was common and highlights situations where species from different lineages can share a similar trait state, but represent the high end of possible physiological values for one lineage and the low end for another. 3) Variance around the mean trait state differed widely across clades, suggesting that some groups (e.g., Ephemerellidae) are inherently more variable than others (e.g., Perlidae). Thus, trait variability/lability is at least partially a function of lineage. 4) Akaike information criterion (AIC) comparisons of statistical models were more often driven by clade than by other potential biological or ecological explanation tested. Clade-driven models generally improved with increasing taxonomic resolution. 5) Altogether, these findings suggest that lineage provides context for the analysis of species traits, and that failure to consider lineage in community-based analysis of traits may obscure important patterns of species responses to environmental change.« less

  10. The importance of retaining a phylogenetic perspective in traits-based community analyses

    SciTech Connect (OSTI)

    Poteat, Monica D; Buchwalter, David; Jacobus, Luke


    1) Many environmental stressors manifest their effects via physiological processes (traits) that can differ significantly among species and species groups. We compiled available data for three traits related to the bioconcentration of the toxic metal cadmium (Cd) from 42 aquatic insect species representing orders Ephemeroptera (mayfly), Plecoptera (stonefly), and Trichoptera (caddisfly). These traits included the propensity to take up Cd from water (uptake rate constant, ku), the ability to excrete Cd (efflux rate constant, ke), and the net result of these two processes (bioconcentration factor, BCF). 2) Ranges in these Cd bioaccumulation traits varied in magnitude across lineages (some lineages had a greater tendency to bioaccumulate Cd than others). Overlap in the ranges of trait values among different lineages was common and highlights situations where species from different lineages can share a similar trait state, but represent the high end of possible physiological values for one lineage and the low end for another. 3) Variance around the mean trait state differed widely across clades, suggesting that some groups (e.g., Ephemerellidae) are inherently more variable than others (e.g., Perlidae). Thus, trait variability/lability is at least partially a function of lineage. 4) Akaike information criterion (AIC) comparisons of statistical models were more often driven by clade than by other potential biological or ecological explanation tested. Clade-driven models generally improved with increasing taxonomic resolution. 5) Together, these findings suggest that lineage provides context for the analysis of species traits, and that failure to consider lineage in community-based analysis of traits may obscure important patterns of species responses to environmental change.

  11. Conducting Quantitative Electrochemistry on a TEM to Study Rate...

    Office of Scientific and Technical Information (OSTI)

    Conducting Quantitative Electrochemistry on a TEM to Study Rate Dependencies in the ... Citation Details In-Document Search Title: Conducting Quantitative Electrochemistry on a ...

  12. Manual for Quantitative Evaluation of the Co-Benefits Approach...

    Open Energy Info (EERE)

    Manual for Quantitative Evaluation of the Co-Benefits Approach to Climate Change Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Manual for Quantitative Evaluation of...

  13. Method and apparatus for chromatographic quantitative analysis

    DOE Patents [OSTI]

    Fritz, James S.; Gjerde, Douglas T.; Schmuckler, Gabriella


    An improved apparatus and method for the quantitative analysis of a solution containing a plurality of anion species by ion exchange chromatography which utilizes a single eluent and a single ion exchange bed which does not require periodic regeneration. The solution containing the anions is added to an anion exchange resin bed which is a low capacity macroreticular polystyrene-divinylbenzene resin containing quarternary ammonium functional groups, and is eluted therefrom with a dilute solution of a low electrical conductance organic acid salt. As each anion species is eluted from the bed, it is quantitatively sensed by conventional detection means such as a conductivity cell.

  14. A radiation hybrid map of the distal short arm of human chromosome II, containing the Beckwith-Weidemann and associated embroyonal tumor disease loci

    SciTech Connect (OSTI)

    Richard, C.W. III; Berg, D.J.; Meeker, T.C.; Myers, R.M.; Cox, D.R. ); Boehnke, M.; Hauser, E. ); Lichy, J.H. )


    The authors describe a high-resolution radiation hybrid (RH) map of the distal short arm of human chromosome 11 containing the Beckwith-Weidemann gene and the associated embryonal tumor disease loci. Thirteen human 11p15 genes and 17 new anonymous probes were mapped by a statistical analysis of the cosegregation of markers in 102 rodent-human radiation hybrids retaining fragments of human chromosome 11. The 17 anonymous probes were generated from lambda phage containing human 11p15.5 inserts, by using ALU-PCR. A comprehensive map of all 30 loci and a framework map of nine clusters of loci ordered at odds of 1,000:1 were constructed by a multipoint maximum-likelihood approach by using the computer program RHMAP. This RH map localizes one new gene to chromosome 11p15 (WEE1), provides more precise order information for several 11p15 genes (CTSD, H19, HPX,.ST5, RNH, and SMPD1), confirms previous map orders for other 11p15 genes (CALCA, PTH, HBBC, TH, HRAS, and DRD4), and maps 17 new anonymous probes within the 11p15.5 region. This RH map should prove useful in better defining the positions of the Beckwith-Weidemann and associated embryonal tumor disease-gene loci. 41 refs., 1 fig., 2 tabs.

  15. Quantitative multiplex detection of pathogen biomarkers

    DOE Patents [OSTI]

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.


    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  16. Quantitative multiplex detection of pathogen biomarkers

    DOE Patents [OSTI]

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K


    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  17. Quantitative organic vapor-particle sampler

    DOE Patents [OSTI]

    Gundel, Lara; Daisey, Joan M.; Stevens, Robert K.


    A quantitative organic vapor-particle sampler for sampling semi-volatile organic gases and particulate components. A semi-volatile organic reversible gas sorbent macroreticular resin agglomerates of randomly packed microspheres with the continuous porous structure of particles ranging in size between 0.05-10 .mu.m for use in an integrated diffusion vapor-particle sampler.

  18. Quantitative determination of atmospheric hydroperoxyl radical

    DOE Patents [OSTI]

    Springston, Stephen R.; Lloyd, Judith; Zheng, Jun


    A method for the quantitative determination of atmospheric hydroperoxyl radical comprising: (a) contacting a liquid phase atmospheric sample with a chemiluminescent compound which luminesces on contact with hydroperoxyl radical; (b) determining luminescence intensity from the liquid phase atmospheric sample; and (c) comparing said luminescence intensity from the liquid phase atmospheric sample to a standard luminescence intensity for hydroperoxyl radical. An apparatus for automating the method is also included.

  19. Quantitative resilience analysis through control design.

    SciTech Connect (OSTI)

    Sunderland, Daniel; Vugrin, Eric D.; Camphouse, Russell Chris


    Critical infrastructure resilience has become a national priority for the U. S. Department of Homeland Security. System resilience has been studied for several decades in many different disciplines, but no standards or unifying methods exist for critical infrastructure resilience analysis. Few quantitative resilience methods exist, and those existing approaches tend to be rather simplistic and, hence, not capable of sufficiently assessing all aspects of critical infrastructure resilience. This report documents the results of a late-start Laboratory Directed Research and Development (LDRD) project that investigated the development of quantitative resilience through application of control design methods. Specifically, we conducted a survey of infrastructure models to assess what types of control design might be applicable for critical infrastructure resilience assessment. As a result of this survey, we developed a decision process that directs the resilience analyst to the control method that is most likely applicable to the system under consideration. Furthermore, we developed optimal control strategies for two sets of representative infrastructure systems to demonstrate how control methods could be used to assess the resilience of the systems to catastrophic disruptions. We present recommendations for future work to continue the development of quantitative resilience analysis methods.

  20. Real-Time Quantitative Imaging of Failure Events in Materials...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Real-Time Quantitative Imaging of Failure Events in Materials Under Load at Temperatures Above 1,600 C Real-Time Quantitative Imaging of Failure Events in Materials Under Load at ...

  1. Quantitative imaging of turbulent and reacting flows

    SciTech Connect (OSTI)

    Paul, P.H.


    Quantitative digital imaging, using planar laser light scattering techniques is being developed for the analysis of turbulent and reacting flows. Quantitative image data, implying both a direct relation to flowfield variables as well as sufficient signal and spatial dynamic range, can be readily processed to yield two-dimensional distributions of flowfield scalars and in turn two-dimensional images of gradients and turbulence scales. Much of the development of imaging techniques to date has concentrated on understanding the requisite molecular spectroscopy and collision dynamics to be able to determine how flowfield variable information is encoded into the measured signal. From this standpoint the image is seen as a collection of single point measurements. The present effort aims at realizing necessary improvements in signal and spatial dynamic range, signal-to-noise ratio and spatial resolution in the imaging system as well as developing excitation/detection strategies which provide for a quantitative measure of particular flowfield scalars. The standard camera used for the study is an intensified CCD array operated in a conventional video format. The design of the system was based on detailed modeling of signal and image transfer properties of fast UV imaging lenses, image intensifiers and CCD detector arrays. While this system is suitable for direct scalar imaging, derived quantities (e.g. temperature or velocity images) require an exceptionally wide dynamic range imaging detector. To apply these diagnostics to reacting flows also requires a very fast shuttered camera. The authors have developed and successfully tested a new type of gated low-light level detector. This system relies on fast switching of proximity focused image-diode which is direct fiber-optic coupled to a cooled CCD array. Tests on this new detector show significant improvements in detection limit, dynamic range and spatial resolution as compared to microchannel plate intensified arrays.

  2. Path to development of quantitative safety goals

    SciTech Connect (OSTI)

    Joksimovic, V.; Houghton, W.J.


    There is a growing interest in defining numerical safety goals for nuclear power plants as exemplified by an ACRS recommendation. This paper proposes a lower frequency limit of approximately 10/sup -4//reactor-year for design basis events. Below this frequency, down, to a small frequency such as 10/sup -5//reactor-year, safety margin can be provided by, say, site emergency plans. Accident sequences below 10/sup -5/ should not impact public safety, but it is prudent that safety research programs examine sequences with significant consequences. Once tentatively agreed upon, quantitative safety goals together with associated implementation tools would be factored into regulatory and design processes.

  3. 10 Questions for a Quantitative Geneticist: Wellington Muchero | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    of Energy Quantitative Geneticist: Wellington Muchero 10 Questions for a Quantitative Geneticist: Wellington Muchero July 1, 2013 - 11:15am Addthis Wellington Muchero is a quantitative geneticist at the Bioenergy Science Center in Oak Ridge, Tennessee. | Photo by Jason Richards, Oak Ridge National Laboratory. Wellington Muchero is a quantitative geneticist at the Bioenergy Science Center in Oak Ridge, Tennessee. | Photo by Jason Richards, Oak Ridge National Laboratory. On what led him to a

  4. Quantitative tomographic measurements of opaque multiphase flows

    SciTech Connect (OSTI)



    An electrical-impedance tomography (EIT) system has been developed for quantitative measurements of radial phase distribution profiles in two-phase and three-phase vertical column flows. The EIT system is described along with the computer algorithm used for reconstructing phase volume fraction profiles. EIT measurements were validated by comparison with a gamma-densitometry tomography (GDT) system. The EIT system was used to accurately measure average solid volume fractions up to 0.05 in solid-liquid flows, and radial gas volume fraction profiles in gas-liquid flows with gas volume fractions up to 0.15. In both flows, average phase volume fractions and radial volume fraction profiles from GDT and EIT were in good agreement. A minor modification to the formula used to relate conductivity data to phase volume fractions was found to improve agreement between the methods. GDT and EIT were then applied together to simultaneously measure the solid, liquid, and gas radial distributions within several vertical three-phase flows. For average solid volume fractions up to 0.30, the gas distribution for each gas flow rate was approximately independent of the amount of solids in the column. Measurements made with this EIT system demonstrate that EIT may be used successfully for noninvasive, quantitative measurements of dispersed multiphase flows.

  5. A 45-year followup study of breast and other cancers in kindred 107 and linkage analysis of candidate loci

    SciTech Connect (OSTI)

    Goldgar, D.E.; Neuhausen, S.L.; Ward, J.H.


    One of the earliest large kindreds with inherited susceptibility to breast cancer was reported by Gardner and Stephens in 1950. This family, denoted K107, was ascertained in 1947 by a genetics student with two great aunts who died of breast cancer in their 40`s. Subsequent clinical and genealogical follow-up identified 7 additional cases of early-onset breast cancer. The family was updated several times, most notably in 1980. For the present study K107 was recently reinvestigated and over 75 blood samples gathered for genotyping. The kindred now contains 38 cases of female breast cancer, 3 cases of male breast cancer, and 6 cases of ovarian cancer, 18 of which have been identified since the 1980 report. Examination of the obligate carriers demonstrates that that gene responsible for the breast and ovarian cancer in K107 is highly penetrant. Other cancers appear to be associated with expression of this gene, most notably prostate cancer, melanoma, and uterine cancer. Linkage to the BRCA1 region in K107 was excluded based upon the analysis of genotypings at four loci covering the BRCA1 gene on chromosome 17q has been excluded in this family, using four highly polymorphic markers in the BRCA1 region (multipoint LOD score -3.27). Eight other candidate breast cancer susceptibility genes and candidate regions, including p53 and ESR have also been tested for linkage and excluded. Studies to formally re-estimate penetrance and test for excesses of all cancer sites and a genomic search in this family are in progress.

  6. Toward quantitative modeling of silicon phononic thermocrystals

    SciTech Connect (OSTI)

    Lacatena, V.; Haras, M.; Robillard, J.-F. Dubois, E.; Monfray, S.; Skotnicki, T.


    The wealth of technological patterning technologies of deca-nanometer resolution brings opportunities to artificially modulate thermal transport properties. A promising example is given by the recent concepts of 'thermocrystals' or 'nanophononic crystals' that introduce regular nano-scale inclusions using a pitch scale in between the thermal phonons mean free path and the electron mean free path. In such structures, the lattice thermal conductivity is reduced down to two orders of magnitude with respect to its bulk value. Beyond the promise held by these materials to overcome the well-known “electron crystal-phonon glass” dilemma faced in thermoelectrics, the quantitative prediction of their thermal conductivity poses a challenge. This work paves the way toward understanding and designing silicon nanophononic membranes by means of molecular dynamics simulation. Several systems are studied in order to distinguish the shape contribution from bulk, ultra-thin membranes (8 to 15 nm), 2D phononic crystals, and finally 2D phononic membranes. After having discussed the equilibrium properties of these structures from 300 K to 400 K, the Green-Kubo methodology is used to quantify the thermal conductivity. The results account for several experimental trends and models. It is confirmed that the thin-film geometry as well as the phononic structure act towards a reduction of the thermal conductivity. The further decrease in the phononic engineered membrane clearly demonstrates that both phenomena are cumulative. Finally, limitations of the model and further perspectives are discussed.

  7. Hydrogen quantitative risk assessment workshop proceedings.

    SciTech Connect (OSTI)

    Groth, Katrina M.; Harris, Aaron P.


    The Quantitative Risk Assessment (QRA) Toolkit Introduction Workshop was held at Energetics on June 11-12. The workshop was co-hosted by Sandia National Laboratories (Sandia) and HySafe, the International Association for Hydrogen Safety. The objective of the workshop was twofold: (1) Present a hydrogen-specific methodology and toolkit (currently under development) for conducting QRA to support the development of codes and standards and safety assessments of hydrogen-fueled vehicles and fueling stations, and (2) Obtain feedback on the needs of early-stage users (hydrogen as well as potential leveraging for Compressed Natural Gas [CNG], and Liquefied Natural Gas [LNG]) and set priorities for %E2%80%9CVersion 1%E2%80%9D of the toolkit in the context of the commercial evolution of hydrogen fuel cell electric vehicles (FCEV). The workshop consisted of an introduction and three technical sessions: Risk Informed Development and Approach; CNG/LNG Applications; and Introduction of a Hydrogen Specific QRA Toolkit.

  8. Quantitative Electrochemical TEM to Study Alloying for Advanced...

    Office of Scientific and Technical Information (OSTI)

    Title: Quantitative Electrochemical TEM to Study Alloying for Advanced Battery Anodes. Abstract not provided. Authors: Zavadil, Kevin Robert ; Liu, Yang ; Kotula, Paul Gabriel ; ...

  9. Method of quantitating dsDNA

    DOE Patents [OSTI]

    Stark, Peter C.; Kuske, Cheryl R.; Mullen, Kenneth I.


    A method for quantitating dsDNA in an aqueous sample solution containing an unknown amount of dsDNA. A first aqueous test solution containing a known amount of a fluorescent dye-dsDNA complex and at least one fluorescence-attenutating contaminant is prepared. The fluorescence intensity of the test solution is measured. The first test solution is diluted by a known amount to provide a second test solution having a known concentration of dsDNA. The fluorescence intensity of the second test solution is measured. Additional diluted test solutions are similarly prepared until a sufficiently dilute test solution having a known amount of dsDNA is prepared that has a fluorescence intensity that is not attenuated upon further dilution. The value of the maximum absorbance of this solution between 200-900 nanometers (nm), referred to herein as the threshold absorbance, is measured. A sample solution having an unknown amount of dsDNA and an absorbance identical to that of the sufficiently dilute test solution at the same chosen wavelength is prepared. Dye is then added to the sample solution to form the fluorescent dye-dsDNA-complex, after which the fluorescence intensity of the sample solution is measured and the quantity of dsDNA in the sample solution is determined. Once the threshold absorbance of a sample solution obtained from a particular environment has been determined, any similarly prepared sample solution taken from a similar environment and having the same value for the threshold absorbance can be quantified for dsDNA by adding a large excess of dye to the sample solution and measuring its fluorescence intensity.

  10. Asbestos exposure--quantitative assessment of risk

    SciTech Connect (OSTI)

    Hughes, J.M.; Weill, H.


    Methods for deriving quantitative estimates of asbestos-associated health risks are reviewed and their numerous assumptions and uncertainties described. These methods involve extrapolation of risks observed at past relatively high asbestos concentration levels down to usually much lower concentration levels of interest today--in some cases, orders of magnitude lower. These models are used to calculate estimates of the potential risk to workers manufacturing asbestos products and to students enrolled in schools containing asbestos products. The potential risk to workers exposed for 40 yr to 0.5 fibers per milliliter (f/ml) of mixed asbestos fiber type (a permissible workplace exposure limit under consideration by the Occupational Safety and Health Administration (OSHA) ) are estimated as 82 lifetime excess cancers per 10,000 exposed. The risk to students exposed to an average asbestos concentration of 0.001 f/ml of mixed asbestos fiber types for an average enrollment period of 6 school years is estimated as 5 lifetime excess cancers per one million exposed. If the school exposure is to chrysotile asbestos only, then the estimated risk is 1.5 lifetime excess cancers per million. Risks from other causes are presented for comparison; e.g., annual rates (per million) of 10 deaths from high school football, 14 from bicycling (10-14 yr of age), 5 to 20 for whooping cough vaccination. Decisions concerning asbestos products require participation of all parties involved and should only be made after a scientifically defensible estimate of the associated risk has been obtained. In many cases to date, such decisions have been made without adequate consideration of the level of risk or the cost-effectiveness of attempts to lower the potential risk. 73 references.

  11. Combining Quantitative Electrochemistry and Electron Microscopy to Study

    Office of Scientific and Technical Information (OSTI)

    Reversible Lithiation of Silicon Nanowires. (Conference) | SciTech Connect Conference: Combining Quantitative Electrochemistry and Electron Microscopy to Study Reversible Lithiation of Silicon Nanowires. Citation Details In-Document Search Title: Combining Quantitative Electrochemistry and Electron Microscopy to Study Reversible Lithiation of Silicon Nanowires. Authors: Zavadil, Kevin R. ; Liu, Yang ; Harris, Charles Thomas ; Sullivan, John P. [1] + Show Author Affiliations (Sandia National

  12. System and method for leveraging human physiological traits to control microprocessor frequency

    DOE Patents [OSTI]

    Shye, Alex; Pan, Yan; Scholbrock, Benjamin; Miller, J. Scott; Memik, Gokhan; Dinda, Peter A; Dick, Robert P


    A system and method for leveraging physiological traits to control microprocessor frequency are disclosed. In some embodiments, the system and method may optimize, for example, a particular processor-based architecture based on, for example, end user satisfaction. In some embodiments, the system and method may determine, for example, whether their users are satisfied to provide higher efficiency, improved reliability, reduced power consumption, increased security, and a better user experience. The system and method may use, for example, biometric input devices to provide information about a user's physiological traits to a computer system. Biometric input devices may include, for example, one or more of the following: an eye tracker, a galvanic skin response sensor, and/or a force sensor.

  13. The effects of emotional states and traits on risky decision-making.

    SciTech Connect (OSTI)

    Bernard, Michael Lewis; Smith, Bruce W., 1959-


    Understanding the role of emotional states is critical for predicting the kind of decisions people will make in risky situations. Currently, there is little understanding as to how emotion influences decision-making in situations such as terrorist attacks, natural disasters, pandemics, and combat. To help address this, we used behavioral and neuroimaging methods to examine how emotion states and traits influence decisions. Specifically, this study used a wheel of fortune behavioral task and functional magnetic resonance imaging (fMRI) to examine the effects of emotional states and traits on decision-making pertaining to the degree of risk people are willing to make in specific situations. The behavioral results are reported here. The neural data requires additional time to analyze and will be reported at a future date. Biases caused by emotion states and traits were found regarding the likelihood of making risky decisions. The behavioral results will help provide a solid empirical foundation for modeling the effects of emotion on decision in risky situations.

  14. Molecular Breeding Algae For Improved Traits For The Conversion Of Waste To Fuels And Commodities.

    SciTech Connect (OSTI)

    Bagwell, C.


    This Exploratory LDRD aimed to develop molecular breeding methodology for biofuel algal strain improvement for applications in waste to energy / commodity conversion technologies. Genome shuffling technologies, specifically protoplast fusion, are readily available for the rapid production of genetic hybrids for trait improvement and have been used successfully in bacteria, yeast, plants and animals. However, genome fusion has not been developed for exploiting the remarkable untapped potential of eukaryotic microalgae for large scale integrated bio-conversion and upgrading of waste components to valued commodities, fuel and energy. The proposed molecular breeding technology is effectively sexual reproduction in algae; though compared to traditional breeding, the molecular route is rapid, high-throughput and permits selection / improvement of complex traits which cannot be accomplished by traditional genetics. Genome fusion technologies are the cutting edge of applied biotechnology. The goals of this Exploratory LDRD were to 1) establish reliable methodology for protoplast production among diverse microalgal strains, and 2) demonstrate genome fusion for hybrid strain production using a single gene encoded trait as a proof of the concept.

  15. Imaging spectroscopy algorithms for mapping canopy foliar chemical and morphological traits and their uncertainties

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Singh, Aditya; Serbin, Shawn P.; McNeil, Brenden E.; Kingdon, Clayton C.; Townsend, Philip A.


    A major goal of remote sensing is the development of generalizable algorithms to repeatedly and accurately map ecosystem properties across space and time. Imaging spectroscopy has great potential to map vegetation traits that cannot be retrieved from broadband spectral data, but rarely have such methods been tested across broad regions. Here we illustrate a general approach for estimating key foliar chemical and morphological traits through space and time using NASA's Airborne Visible/Infrared Imaging Spectrometer (AVIRIS-Classic). We apply partial least squares regression (PLSR) to data from 237 field plots within 51 images acquired between 2008 and 2011. Using a series ofmore » 500 randomized 50/50 subsets of the original data, we generated spatially explicit maps of seven traits (leaf mass per area (Marea), percentage nitrogen, carbon, fiber, lignin, and cellulose, and isotopic nitrogen concentration, δ15N) as well as pixel-wise uncertainties in their estimates based on error propagation in the analytical methods. Both Marea and %N PLSR models had a R2 > 0.85. Root mean square errors (RMSEs) for both variables were less than 9% of the range of data. Fiber and lignin were predicted with R2 > 0.65 and carbon and cellulose with R2 > 0.45. Although R2 of %C and cellulose were lower than Marea and %N, the measured variability of these constituents (especially %C) was also lower, and their RMSE values were beneath 12% of the range in overall variability. Model performance for δ15N was the lowest (R2 = 0.48, RMSE = 0.95‰), but within 15% of the observed range. The resulting maps of chemical and morphological traits, together with their overall uncertainties, represent a first-of-its-kind approach for examining the spatiotemporal patterns of forest functioning and nutrient cycling across a broad range of temperate and sub-boreal ecosystems. These results offer an alternative to categorical maps of functional or physiognomic types by providing non-discrete maps (i.e., on a continuum) of traits that define those functional types. A key contribution of this work is the ability to assign retrieval uncertainties by pixel, a requirement to enable assimilation of these data products into ecosystem modeling frameworks to constrain carbon and nutrient cycling projections.« less

  16. Imaging spectroscopy algorithms for mapping canopy foliar chemical and morphological traits and their uncertainties

    SciTech Connect (OSTI)

    Singh, Aditya; Serbin, Shawn P.; McNeil, Brenden E.; Kingdon, Clayton C.; Townsend, Philip A.


    A major goal of remote sensing is the development of generalizable algorithms to repeatedly and accurately map ecosystem properties across space and time. Imaging spectroscopy has great potential to map vegetation traits that cannot be retrieved from broadband spectral data, but rarely have such methods been tested across broad regions. Here we illustrate a general approach for estimating key foliar chemical and morphological traits through space and time using NASA's Airborne Visible/Infrared Imaging Spectrometer (AVIRIS-Classic). We apply partial least squares regression (PLSR) to data from 237 field plots within 51 images acquired between 2008 and 2011. Using a series of 500 randomized 50/50 subsets of the original data, we generated spatially explicit maps of seven traits (leaf mass per area (Marea), percentage nitrogen, carbon, fiber, lignin, and cellulose, and isotopic nitrogen concentration, δ15N) as well as pixel-wise uncertainties in their estimates based on error propagation in the analytical methods. Both Marea and %N PLSR models had a R2 > 0.85. Root mean square errors (RMSEs) for both variables were less than 9% of the range of data. Fiber and lignin were predicted with R2 > 0.65 and carbon and cellulose with R2 > 0.45. Although R2 of %C and cellulose were lower than Marea and %N, the measured variability of these constituents (especially %C) was also lower, and their RMSE values were beneath 12% of the range in overall variability. Model performance for δ15N was the lowest (R2 = 0.48, RMSE = 0.95‰), but within 15% of the observed range. The resulting maps of chemical and morphological traits, together with their overall uncertainties, represent a first-of-its-kind approach for examining the spatiotemporal patterns of forest functioning and nutrient cycling across a broad range of temperate and sub-boreal ecosystems. These results offer an alternative to categorical maps of functional or physiognomic types by providing non-discrete maps (i.e., on a continuum) of traits that define those functional types. A key contribution of this work is the ability to assign retrieval uncertainties by pixel, a requirement to enable assimilation of these data products into ecosystem modeling frameworks to constrain carbon and nutrient cycling projections.

  17. Zinc Speciation in Contaminated Sediments: Quantitative Determination of

    Office of Scientific and Technical Information (OSTI)

    Zinc Coordination by X-ray Absorption Spectroscopy (Journal Article) | SciTech Connect Zinc Speciation in Contaminated Sediments: Quantitative Determination of Zinc Coordination by X-ray Absorption Spectroscopy Citation Details In-Document Search Title: Zinc Speciation in Contaminated Sediments: Quantitative Determination of Zinc Coordination by X-ray Absorption Spectroscopy Authors: Webb, Samuel M. ; Gaillard, Jean-François [1] ; NWU) [2] + Show Author Affiliations (SSRL) ( Publication

  18. Quantitative Electrochemical TEM to Study Alloying for Advanced Battery

    Office of Scientific and Technical Information (OSTI)

    Anodes. (Conference) | SciTech Connect Conference: Quantitative Electrochemical TEM to Study Alloying for Advanced Battery Anodes. Citation Details In-Document Search Title: Quantitative Electrochemical TEM to Study Alloying for Advanced Battery Anodes. Abstract not provided. Authors: Zavadil, Kevin Robert ; Liu, Yang ; Kotula, Paul Gabriel ; Jungjohann, Katherine Leigh ; Hahn, Nathan Publication Date: 2014-02-01 OSTI Identifier: 1141149 Report Number(s): SAND2014-1392C 503568 DOE Contract

  19. Quantitative Experimental Determination of the Solid Solution Hardening

    Office of Scientific and Technical Information (OSTI)

    Potential of Rhenium, Tungsten and Molybdenum in Single Crystal Nickel-based Superalloys (Journal Article) | SciTech Connect Quantitative Experimental Determination of the Solid Solution Hardening Potential of Rhenium, Tungsten and Molybdenum in Single Crystal Nickel-based Superalloys Citation Details In-Document Search Title: Quantitative Experimental Determination of the Solid Solution Hardening Potential of Rhenium, Tungsten and Molybdenum in Single Crystal Nickel-based Superalloys

  20. Conducting Quantitative Electrochemistry on a TEM to Study Rate

    Office of Scientific and Technical Information (OSTI)

    Dependencies in the Reversible Lithiation of Silicon Nanowires. (Conference) | SciTech Connect Conducting Quantitative Electrochemistry on a TEM to Study Rate Dependencies in the Reversible Lithiation of Silicon Nanowires. Citation Details In-Document Search Title: Conducting Quantitative Electrochemistry on a TEM to Study Rate Dependencies in the Reversible Lithiation of Silicon Nanowires. Abstract not provided. Authors: Zavadil, Kevin R. ; Liu, Yang ; Kotula, Paul G. ; Sullivan, John P [1]

  1. Direct and quantitative broadband absorptance spectroscopy with multilayer

    Office of Scientific and Technical Information (OSTI)

    cantilever probes (Patent) | SciTech Connect Patent: Direct and quantitative broadband absorptance spectroscopy with multilayer cantilever probes Citation Details In-Document Search Title: Direct and quantitative broadband absorptance spectroscopy with multilayer cantilever probes A system for measuring the absorption spectrum of a sample is provided that includes a broadband light source that produces broadband light defined within a range of an absorptance spectrum. An interferometer

  2. Atractylenolide I-mediated Notch pathway inhibition attenuates gastric cancer stem cell traits

    SciTech Connect (OSTI)

    Ma, Li; Mao, Rurong; Shen, Ke; Zheng, Yuanhong; Li, Yueqi; Liu, Jianwen; Ni, Lei


    Highlights: This paper supports the anti-tumor effects of AT-I on gastric cancer in vitro. AT-I attenuates gastric cancer stem cell traits. It is the systematic study regarding AT-I suppression of Notch pathway in GC and GCSLCs. - Abstract: Atractylenolide I (AT-I), one of the main naturally occurring compounds of Rhizoma Atractylodis Macrocephalae, has remarkable anti-cancer effects on various cancers. However, its effects on the treatment of gastric cancer remain unclear. Via multiple cellular and molecular approaches, we demonstrated that AT-I could potently inhibit cancer cell proliferation and induce apoptosis through inactivating Notch pathway. AT-I treatment led to the reduction of expressions of Notch1, Jagged1, and its downstream Hes1/ Hey1. Our results showed that AT-I inhibited the self-renewal capacity of gastric stem-like cells (GCSLCs) by suppression of their sphere formation capacity and cell viability. AT-I attenuated gastric cancer stem cell (GCSC) traits partly through inactivating Notch1, leading to reducing the expressions of its downstream target Hes1, Hey1 and CD44 in vitro. Collectively, our results suggest that AT-I might develop as a potential therapeutic drug for the treatment of gastric cancer.

  3. Associations among hydrologic classifications and fish traits to support environmental flow standards

    SciTech Connect (OSTI)

    McManamay, Ryan A; Bevelhimer, Mark S; Frimpong, Dr. Emmanuel A,


    Classification systems are valuable to ecological management in that they organize information into consolidated units thereby providing efficient means to achieve conservation objectives. Of the many ways classifications benefit management, hypothesis generation has been discussed as the most important. However, in order to provide templates for developing and testing ecologically relevant hypotheses, classifications created using environmental variables must be linked to ecological patterns. Herein, we develop associations between a recent US hydrologic classification and fish traits in order to form a template for generating flow ecology hypotheses and supporting environmental flow standard development. Tradeoffs in adaptive strategies for fish were observed across a spectrum of stable, perennial flow to unstable intermittent flow. In accordance with theory, periodic strategists were associated with stable, predictable flow, whereas opportunistic strategists were more affiliated with intermittent, variable flows. We developed linkages between the uniqueness of hydrologic character and ecological distinction among classes, which may translate into predictions between losses in hydrologic uniqueness and ecological community response. Comparisons of classification strength between hydrologic classifications and other frameworks suggested that spatially contiguous classifications with higher regionalization will tend to explain more variation in ecological patterns. Despite explaining less ecological variation than other frameworks, we contend that hydrologic classifications are still useful because they provide a conceptual linkage between hydrologic variation and ecological communities to support flow ecology relationships. Mechanistic associations among fish traits and hydrologic classes support the presumption that environmental flow standards should be developed uniquely for stream classes and ecological communities, therein.

  4. Improved method and apparatus for chromatographic quantitative analysis

    DOE Patents [OSTI]

    Fritz, J.S.; Gjerde, D.T.; Schmuckler, G.

    An improved apparatus and method are described for the quantitative analysis of a solution containing a plurality of anion species by ion exchange chromatography which utilizes a single element and a single ion exchange bed which does not require periodic regeneration. The solution containing the anions is added to an anion exchange resin bed which is a low capacity macroreticular polystyrene-divinylbenzene resin containing quarternary ammonium functional groups, and is eluted therefrom with a dilute solution of a low electrical conductance organic acid salt. As each anion species is eluted from the bed, it is quantitatively sensed by conventional detection means such as a conductivity cell.

  5. Quantitative evaluation of ocean thermal energy conversion (OTEC): executive briefing

    SciTech Connect (OSTI)

    Gritton, E.C.; Pei, R.Y.; Hess, R.W.


    Documentation is provided of a briefing summarizing the results of an independent quantitative evaluation of Ocean Thermal Energy Conversion (OTEC) for central station applications. The study concentrated on a central station power plant located in the Gulf of Mexico and delivering power to the mainland United States. The evaluation of OTEC is based on three important issues: resource availability, technical feasibility, and cost.

  6. Phenotypic Data Collection and Sample Preparation for Genomics of Wood Formation and Cellulosic Biomass Traits in Sunflower: Ames, IA location.

    SciTech Connect (OSTI)

    Marek, Laura F.


    Three fields were planted in Ames in 2010, two association mapping fields, N3 and A, and a recombinant inbred line field, N13. Phenotype data and images were transferred to UGA to support genetic and genomic analyses of woody biomass-related traits.

  7. High-throughput behavioral phenotyping of drug and alcohol susceptibility traits in the expanded panel of BXD recombinant inbred strains

    SciTech Connect (OSTI)

    Philip, Vivek M [ORNL; Ansah, T [University of Tennessee Health Science Center, Memphis; Blaha, C, [University of Tennessee Health Science Center, Memphis; Cook, Melloni N. [University of Memphis; Hamre, Kristin M. [University of Tennessee Health Science Center, Memphis; Lariviere, William R [University of Pittsburgh; Matthews, Douglas B [Baylor University; Goldowitz, Daniel [University of British Columbia, Vancouver; Chesler, Elissa J [ORNL


    Genetic reference populations, particularly the BXD recombinant inbred strains, are a valuable resource for the discovery of the bio-molecular substrates and genetic drivers responsible for trait variation and co- ariation. This approach can be profitably applied in the analysis of susceptibility and mechanisms of drug and alcohol use disorders for which many predisposing behaviors may predict occurrence and manifestation of increased preference for these substances. Many of these traits are modeled by common mouse behavioral assays, facilitating the detection of patterns and sources of genetic co-regulation of predisposing phenotypes and substance consumption. Members of the Tennessee Mouse Genome Consortium have obtained behavioral phenotype data from 260 measures related to multiple behavioral assays across several domains: self-administration, response to, and withdrawal from cocaine, MDMA, morphine and alcohol; novelty seeking; behavioral despair and related neurological phenomena; pain sensitivity; stress sensitivity; anxiety; hyperactivity; and sleep/wake cycles. All traits have been measured in both sexes and the recently expanded panel of 69 additional BXD recombinant inbred strains (N=69). Sex differences and heritability estimates were obtained for each trait, and a comparison of early (N = 32) and recent BXD RI lines was performed. Primary data is publicly available for heritability, sex difference and genetic analyses using These analyses include QTL detection and genetic analysis of gene expression. Stored results from these analyses are available at for comparison to other genomic analysis results. Together with the results of related studies, these data form a public resource for integrative systems genetic analysis of neurobehavioral traits.

  8. Review of progress in quantitative NDE. [Nondestructive Evaluation (NDE)

    SciTech Connect (OSTI)

    Not Available


    This booklet is composed of abstracts from papers submitted at a meeting on quantitative NDE. A multitude of topics are discussed including analysis of composite materials, NMR uses, x-ray instruments and techniques, manufacturing uses, neural networks, eddy currents, stress measurements, magnetic materials, adhesive bonds, signal processing, NDE of mechanical structures, tomography,defect sizing, NDE of plastics and ceramics, new techniques, optical and electromagnetic techniques, and nonlinear techniques. (GHH)

  9. Quantitative NMR Analysis of Partially Substituted Biodiesel Glycerols

    SciTech Connect (OSTI)

    Nagy, M.; Alleman, T. L.; Dyer, T.; Ragauskas, A. J.


    Phosphitylation of hydroxyl groups in biodiesel samples with 2-chloro-4,4,5,5-tetramethyl-1,3,2-dioxaphospholane followed by 31P-NMR analysis provides a rapid quantitative analytical technique for the determination of substitution patterns on partially esterified glycerols. The unique 31P-NMR chemical shift data was established with a series mono and di-substituted fatty acid esters of glycerol and then utilized to characterize an industrial sample of partially processed biodiesel.

  10. Quantitative phase retrieval with arbitrary pupil and illumination

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Claus, Rene A.; Naulleau, Patrick P.; Neureuther, Andrew R.; Waller, Laura


    We present a general algorithm for combining measurements taken under various illumination and imaging conditions to quantitatively extract the amplitude and phase of an object wave. The algorithm uses the weak object transfer function, which incorporates arbitrary pupil functions and partially coherent illumination. The approach is extended beyond the weak object regime using an iterative algorithm. Finally, we demonstrate the method on measurements of Extreme Ultraviolet Lithography (EUV) multilayer mask defects taken in an EUV zone plate microscope with both a standard zone plate lens and a zone plate implementing Zernike phase contrast.

  11. Integration of hydrothermal-energy economics: related quantitative studies

    SciTech Connect (OSTI)

    Not Available


    A comparison of ten models for computing the cost of hydrothermal energy is presented. This comparison involved a detailed examination of a number of technical and economic parameters of the various quantitative models with the objective of identifying the most important parameters in the context of accurate estimates of cost of hydrothermal energy. Important features of various models, such as focus of study, applications, marked sectors covered, methodology, input data requirements, and output are compared in the document. A detailed sensitivity analysis of all the important engineering and economic parameters is carried out to determine the effect of non-consideration of individual parameters.

  12. Quantitative structure parameters from the NMR spectroscopy of quadrupolar nuclei

    SciTech Connect (OSTI)

    Perras, Frédéric A.



    Nuclear magnetic resonance (NMR) spectroscopy is one of the most important characterization tools in chemistry, however, 3/4 of the NMR active nuclei are underutilized due to their quadrupolar nature. This short review centers on the development of methods that use solid-state NMR of quadrupolar nuclei for obtaining quantitative structural information. Namely, techniques using dipolar recoupling as well as the resolution afforded by double-rotation are presented for the measurement of spin–spin coupling between quadrupoles, enabling the measurement of internuclear distances and connectivities. Two-dimensional

  13. Quantitative structure parameters from the NMR spectroscopy of quadrupolar nuclei

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Perras, Frederic A.


    Here, nuclear magnetic resonance (NMR) spectroscopy is one of the most important characterization tools in chemistry, however, 3/4 of the NMR active nuclei are underutilized due to their quadrupolar nature. This short review centers on the development of methods that use solid-state NMR of quadrupolar nuclei for obtaining quantitative structural information. Namely, techniques using dipolar recoupling as well as the resolution afforded by double-rotation are presented for the measurement of spin–spin coupling between quadrupoles, enabling the measurement of internuclear distances and connectivities.

  14. A quantitative method for measuring the quality of history matches

    SciTech Connect (OSTI)

    Shaw, T.S.; Knapp, R.M.


    History matching can be an efficient tool for reservoir characterization. A {open_quotes}good{close_quotes} history matching job can generate reliable reservoir parameters. However, reservoir engineers are often frustrated when they try to select a {open_quotes}better{close_quotes} match from a series of history matching runs. Without a quantitative measurement, it is always difficult to tell the difference between a {open_quotes}good{close_quotes} and a {open_quotes}better{close_quotes} matches. For this reason, we need a quantitative method for testing the quality of matches. This paper presents a method for such a purpose. The method uses three statistical indices to (1) test shape conformity, (2) examine bias errors, and (3) measure magnitude of deviation. The shape conformity test insures that the shape of a simulated curve matches that of a historical curve. Examining bias errors assures that model reservoir parameters have been calibrated to that of a real reservoir. Measuring the magnitude of deviation assures that the difference between the model and the real reservoir parameters is minimized. The method was first tested on a hypothetical model and then applied to published field studies. The results showed that the method can efficiently measure the quality of matches. It also showed that the method can serve as a diagnostic tool for calibrating reservoir parameters during history matching.

  15. Single beam Fourier transform digital holographic quantitative phase microscopy

    SciTech Connect (OSTI)

    Anand, A. Chhaniwal, V. K.; Mahajan, S.; Trivedi, V.; Faridian, A.; Pedrini, G.; Osten, W.; Dubey, S. K.; Javidi, B.


    Quantitative phase contrast microscopy reveals thickness or height information of a biological or technical micro-object under investigation. The information obtained from this process provides a means to study their dynamics. Digital holographic (DH) microscopy is one of the most used, state of the art single-shot quantitative techniques for three dimensional imaging of living cells. Conventional off axis DH microscopy directly provides phase contrast images of the objects. However, this process requires two separate beams and their ratio adjustment for high contrast interference fringes. Also the use of two separate beams may make the system more vulnerable to vibrations. Single beam techniques can overcome these hurdles while remaining compact as well. Here, we describe the development of a single beam DH microscope providing whole field imaging of micro-objects. A hologram of the magnified object projected on to a diffuser co-located with a pinhole is recorded with the use of a commercially available diode laser and an arrayed sensor. A Fourier transform of the recorded hologram directly yields the complex amplitude at the image plane. The method proposed was investigated using various phase objects. It was also used to image the dynamics of human red blood cells in which sub-micrometer level thickness variation were measurable.

  16. The quantitative ion exchange separation of uranium from impurities

    SciTech Connect (OSTI)

    Narayanan, U.I.; Mason, P.B.; Zebrowski, J.P.; Rocca, M.; Frank, I.W.; Smith, M.M.; Johnson, K.D.; Orlowicz, G.J.; Dallmann, E.


    Two methods were tested for the quantitative separation of uranium from elemental impurities using commercially available resins. The sorption and elution behavior of uranium and the separation of it from a variety of other elements was studied. The first method utilized an anion exchange resin while the second method employed an extraction resin. The first method, the anion exchange of uranium (VI) in an acid chloride medium, was optimized and statistically tested for quantitative recovery of uranium. This procedure involved adsorption of uranium onto Blo-Rad AG 1-X8 or MP-1 ion exchange resins in 8 M HCl, separation of uncompleted or weakly complexed matrix ions with an 8 M HCI wash, and subsequent elution of uranium with 1 M HCl. Matrix ions more strongly adsorbed than uranium were left on the resin. Uranium recoveries with this procedure averaged greater than 99.9% with a standard deviation of 0.1%. In the second method, recovery of uranium on the extraction resin did not meet the criteria of this study and further examination was terminated.

  17. Quantitative fire risk assessment for a proposed tritium technology facility

    SciTech Connect (OSTI)

    Zeng, Y. )


    A new Tritium Technology Facility has been proposed for the Chalk River Laboratories to support fusion research and the commercial use of tritium. One of the major safety and licensing issues for the new facility raised by the internal Safety Review Committee is the potential hazard fire poses to it. Fire could cause a large release from tritium from the facility's metal tritide storage beds, resulting in conversion of elemental tritium (HT) into oxide tritium (HTO). The radiological hazard of HTO is {approximately}10,000 times higher than that of HT. Because of the potential significance of fire in the tritium facility, a quantitative fire risk assessment has been conducted for the proposed new facility. The frequency of a large tritium release due to a fire in the Tritium Technology Facility was assessed as being on the order of 10{sup {minus}5} per year, which satisfies the safety goal requirement of the facility.

  18. Quantitative analytical model for magnetic reconnection in hall magnetohydrodynamics

    SciTech Connect (OSTI)

    Simakov, Andrei N


    Magnetic reconnection is of fundamental importance for laboratory and naturally occurring plasmas. Reconnection usually develops on time scales which are much shorter than those associated with classical collisional dissipation processes, and which are not fully understood. While such dissipation-independent (or 'fast') reconnection rates have been observed in particle and Hall magnetohydrodynamics (MHD) simulations and predicted analytically in electron MHD, a quantitative analytical theory of fast reconnection valid for arbitrary ion inertial lengths d{sub i} has been lacking. Here we propose such a theory without a guide field. The theory describes two-dimensional magnetic field diffusion regions, provides expressions for the reconnection rates, and derives a formal criterion for fast reconnection in terms of dissipation parameters and di. It also demonstrates that both open X-point and elongated diffusion regions allow dissipation-independent reconnection and reveals a possibility of strong dependence of the reconnection rates on d{sub i}.

  19. Quantitative analysis of forest island pattern in selected Ohio landscapes

    SciTech Connect (OSTI)

    Bowen, G.W.; Burgess, R.L.


    The purpose of this study was to quantitatively describe the various aspects of regional distribution patterns of forest islands and relate those patterns to other landscape features. Several maps showing the forest cover of various counties in Ohio were selected as representative examples of forest patterns to be quantified. Ten thousand hectare study areas (landscapes) were delineated on each map. A total of 15 landscapes representing a wide variety of forest island patterns was chosen. Data were converted into a series of continuous variables which contained information pertinent to the sizes, shape, numbers, and spacing of woodlots within a landscape. The continuous variables were used in a factor analysis to describe the variation among landscapes in terms of forest island pattern. The results showed that forest island patterns are related to topography and other environmental features correlated with topography.

  20. Quantitative nanometer-scale mapping of dielectric tunability

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Tselev, Alexander; Klein, Andreas; Gassmann, Juergen; Jesse, Stephen; Li, Qian; Kalinin, Sergei V.; Wisinger, Nina Balke


    Two scanning probe microscopy techniques—near-field scanning microwave microscopy (SMM) and piezoresponse force microscopy (PFM)—are used to characterize and image tunability in a thin (Ba,Sr)TiO3 film with nanometer scale spatial resolution. While sMIM allows direct probing of tunability by measurement of the change in the dielectric constant, in PFM, tunability can be extracted via electrostrictive response. The near-field microwave imaging and PFM provide similar information about dielectric tunability with PFM capable to deliver quantitative information on tunability with a higher spatial resolution close to 15 nm. This is the first time that information about the dielectric tunability is available on suchmore » length scales.« less

  1. Quantitative ion-exchange separation of plutonium from impurities

    SciTech Connect (OSTI)

    Pietri, C.E.; Freeman, B.P.; Weiss, J.R.


    The methods used at the New Brunswick Laboratory for the quantitative ion exchange separation of plutonium from impurities prior to plutonium assay are described. Other ion exchange separation procedures for impurity determination and for isotopic abundance measurements are given. The primary technique used consists of sorption of plutonium(IV) in 8N HNO/sub 3/ on Dowex-1 anion exchange resin and elution of the purified plutonium with 0.3N HCl-0.01N HF. Other methods consist of the anion exchange separation of plutonium(IV) in 12N HCl and the cation exchange separation of plutonium(III) in 0.2 N HNO/sub 3/. The application of these procedures to the subsequent assay of plutonium, isotopic analysis, and impurity determination is described.

  2. Natural bacterial communities serve as quantitative geochemical biosensors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Smith, Mark B.; Rocha, Andrea M.; Smillie, Chris S.; Olesen, Scott W.; Paradis, Charles; Wu, Liyou; Campbell, James H.; Fortney, Julian L.; Mehlhorn, Tonia L.; Lowe, Kenneth A.; et al


    Biological sensors can be engineered to measure a wide range of environmental conditions. Here we show that statistical analysis of DNA from natural microbial communities can be used to accurately identify environmental contaminants, including uranium and nitrate at a nuclear waste site. In addition to contamination, sequence data from the 16S rRNA gene alone can quantitatively predict a rich catalogue of 26 geochemical features collected from 93 wells with highly differing geochemistry characteristics. We extend this approach to identify sites contaminated with hydrocarbons from the Deepwater Horizon oil spill, finding that altered bacterial communities encode a memory of prior contamination,more » even after the contaminants themselves have been fully degraded. We show that the bacterial strains that are most useful for detecting oil and uranium are known to interact with these substrates, indicating that this statistical approach uncovers ecologically meaningful interactions consistent with previous experimental observations. Future efforts should focus on evaluating the geographical generalizability of these associations. Taken as a whole, these results indicate that ubiquitous, natural bacterial communities can be used as in situ environmental sensors that respond to and capture perturbations caused by human impacts. These in situ biosensors rely on environmental selection rather than directed engineering, and so this approach could be rapidly deployed and scaled as sequencing technology continues to become faster, simpler, and less expensive. Here we show that DNA from natural bacterial communities can be used as a quantitative biosensor to accurately distinguish unpolluted sites from those contaminated with uranium, nitrate, or oil. These results indicate that bacterial communities can be used as environmental sensors that respond to and capture perturbations caused by human impacts.« less

  3. Natural bacterial communities serve as quantitative geochemical biosensors

    SciTech Connect (OSTI)

    Smith, Mark B.; Rocha, Andrea M.; Smillie, Chris S.; Olesen, Scott W.; Paradis, Charles; Wu, Liyou; Campbell, James H.; Fortney, Julian L.; Mehlhorn, Tonia L.; Lowe, Kenneth A.; Earles, Jennifer E.; Phillips, Jana; Techtmann, Steve M.; Joyner, Dominique C.; Elias, Dwayne A.; Bailey, Kathryn L.; Hurt, Richard A.; Preheim, Sarah P.; Sanders, Matthew C.; Yang, Joy; Mueller, Marcella A.; Brooks, Scott; Watson, David B.; Zhang, Ping; He, Zhili; Dubinsky, Eric A.; Adams, Paul D.; Arkin, Adam P.; Fields, Matthew W.; Zhou, Jizhong; Alm, Eric J.; Hazen, Terry C.


    Biological sensors can be engineered to measure a wide range of environmental conditions. Here we show that statistical analysis of DNA from natural microbial communities can be used to accurately identify environmental contaminants, including uranium and nitrate at a nuclear waste site. In addition to contamination, sequence data from the 16S rRNA gene alone can quantitatively predict a rich catalogue of 26 geochemical features collected from 93 wells with highly differing geochemistry characteristics. We extend this approach to identify sites contaminated with hydrocarbons from the Deepwater Horizon oil spill, finding that altered bacterial communities encode a memory of prior contamination, even after the contaminants themselves have been fully degraded. We show that the bacterial strains that are most useful for detecting oil and uranium are known to interact with these substrates, indicating that this statistical approach uncovers ecologically meaningful interactions consistent with previous experimental observations. Future efforts should focus on evaluating the geographical generalizability of these associations. Taken as a whole, these results indicate that ubiquitous, natural bacterial communities can be used as in situ environmental sensors that respond to and capture perturbations caused by human impacts. These in situ biosensors rely on environmental selection rather than directed engineering, and so this approach could be rapidly deployed and scaled as sequencing technology continues to become faster, simpler, and less expensive. Here we show that DNA from natural bacterial communities can be used as a quantitative biosensor to accurately distinguish unpolluted sites from those contaminated with uranium, nitrate, or oil. These results indicate that bacterial communities can be used as environmental sensors that respond to and capture perturbations caused by human impacts.

  4. Quantitative genetic activity graphical profiles for use in chemical evaluation

    SciTech Connect (OSTI)

    Waters, M.D.; Stack, H.F.; Garrett, N.E.; Jackson, M.A.


    A graphic approach, terms a Genetic Activity Profile (GAP), was developed to display a matrix of data on the genetic and related effects of selected chemical agents. The profiles provide a visual overview of the quantitative (doses) and qualitative (test results) data for each chemical. Either the lowest effective dose or highest ineffective dose is recorded for each agent and bioassay. Up to 200 different test systems are represented across the GAP. Bioassay systems are organized according to the phylogeny of the test organisms and the end points of genetic activity. The methodology for producing and evaluating genetic activity profile was developed in collaboration with the International Agency for Research on Cancer (IARC). Data on individual chemicals were compiles by IARC and by the US Environmental Protection Agency (EPA). Data are available on 343 compounds selected from volumes 1-53 of the IARC Monographs and on 115 compounds identified as Superfund Priority Substances. Software to display the GAPs on an IBM-compatible personal computer is available from the authors. Structurally similar compounds frequently display qualitatively and quantitatively similar profiles of genetic activity. Through examination of the patterns of GAPs of pairs and groups of chemicals, it is possible to make more informed decisions regarding the selection of test batteries to be used in evaluation of chemical analogs. GAPs provided useful data for development of weight-of-evidence hazard ranking schemes. Also, some knowledge of the potential genetic activity of complex environmental mixtures may be gained from an assessment of the genetic activity profiles of component chemicals. The fundamental techniques and computer programs devised for the GAP database may be used to develop similar databases in other disciplines. 36 refs., 2 figs.

  5. Discovering the desirable alleles contributing to the lignocellulosic biomass traits in saccharum germplasm collections for energy cane improvement

    SciTech Connect (OSTI)

    Todd, James; Comstock, Jack C.


    Phenotyping Methods: The accessions (which includes 21 taxa and 1,177 accessions) in the World Collection of Sugarcane and Related Grasses (WCSRG) was evaluated for the following traits: arenchyma, internode length and diameter, pubescence, pith, Brix, stalk number and fiber. A core of 300 accessions that included each species in the World Collection was selected by using the Maximization Strategy in MStrat software. Results: The core had a higher diversity rating than random selections of 300 accessions. The Shannon–Weaver Diversity Index scores of the core and whole collection were similar indicating that the majority of the diversity was captured by the core collection. The ranges and medians between the core and WCSRG were similar; only two of the trait medians were not significant at P = 0.05 using the non-parametric Wilcoxon method and the coincidence rate (CR % = 96.2) was high (>80) indicating that extreme values were retained. Thus, the phenotypic diversity of these traits in the WCSRG was well represented by the core collection. Associations Methods: Genotypic and phenotypic data were collected for 1002 accessions of the WCSRG including 209 SSR markers. Association analysis was performed using both General Linear (GLM) and Maximum Likelihood (MLM) models. Different core collections with 300 accessions each were selected based on genotypic, phenotypic and combined data based on the Maximization Strategy in MStrat software. Results: A major portion of the genotyping involving SNPs is being conducted by Dr. Jianping Wang of the University of Florida under the DOE award DE-FG 02-11ER 65214 and the genotypic and phenotypic associations will be reported separately next year. In the current, study forty one and seventeen markers were found to be associated with traits using the GLM and MLM methods respectively including associations with arenchyma, internode length and diameter, pubescence, pith, and Sugar Cane Yellow Leaf Virus. The data indicates that each of the cores and the World Collection are similar to each other genotypically and phenotypically, but the core that was selected using only genotypic data was significantly different phenotypically. This indicates that there is not enough association between the genotypic and phenotypic diversity as to select using only genotypic diversity and get the full phenotypic diversity. Core Collection: Creation and Phenotyping Methods: To evaluate this germplasm for breeding purposes, a representative diversity panel selected from the WCSRG of approximately 300 accessions was planted at Canal Point, FL in three replications. These accessions were measured for stalk height and stalk number multiple times throughout the growing season and Brix and fresh biomass during harvest in 2013 and, stalk height, stalk number, stalk diameter, internode length, Brix and fresh and dry biomass was determined in the ratoon crop harvest in 2014. Results: In correlations of multiple measurements, there were higher correlations for early measurements of stalk number and stalk height with harvest traits like Brix and fresh weight. Hybrids had higher fresh mass and Brix while Saccharum spontaneum had higher stalk number and dry mass. The heritability of hybrid mass traits was lower in the ratoon crop. According to the principal component analysis, the diversity panel was divided into two groups. One group had accessions with high stalk number and high dry biomass like S. spontaneum and the other groups contained accessions with higher Brix and fresh biomass like S. officinarum. Mass traits correlated with each other as expected but hybrids had lower correlations between fresh and dry mass. Stalk number and the mass traits correlated with each other except in S. spontaneum and hybrids in the first ratoon. There were 110 accessions not significantly different in Brix from the commercial sugarcane checks including 10 S. spontaneum accessions. There were 27 dry and 6 fresh mass accessions significantly higher than the commercial sugarcane checks. Core Collection: Fiber analysis Methods: A biomass sample was taken from each accession then shredded and dried. Fiber analysis was then performed on each sample. The acetyl groups, acid insoluble lignin, acid soluble lignin, arabinan, glucan, holocellulose, total lignin, structural ash, and xylan were quantified on a % fiber basis and nonstructural ash on a % total basis. Results: There were significant, but not large differences between species for holocellulose, lignin, acetyl, acid soluble lignin, nonstructural ash, and glucan. For each trait, S. spontaneum had significantly more holocellulose, glucan, lignin, and nonstructural ash and less acetyl and acid soluble lignin than the other species. In all populations, glucan and was positively correlated with holocellulose were positively correlated and glucan and and holocellulose were negatively correlated with lignin. In hybrids, internode length correlated positively with holocellulose and nonstructural ash and negatively with lignin. The heritability estimates for each of the fiber component traits is low indicating that environment is an important factor in fiber composition. Principal component analysis indicated that a large amount of diversity exists within each of the species.

  6. Linkage mapping of the aldo-2, Pax-5, Ambp, and D4H9S3E loci on mouse chromosome 4 in the region of homology with human chromosome 9

    SciTech Connect (OSTI)

    Pilz, A.; Abbott, C. ); Fountain, J. ); Peters, J. )


    The genes for aldolase-B (ALDOB), the [alpha]-microglobulin/bikunin precursor (AMBP), the paired box gene PAX5, and the anonymous DNA marker D9S3 map to human chromosome 9 (HSA9). The authors have set out to map the mouse homologues of each of these genes. The mouse genes for Pax-5 and Ambp previously been shown to map to MMU4. They have used an interspecific backcross to confirm these localizations and to map the mouse homologues of ALDOB (Aldo-2) and D9S3 (D4H9S3E) to the same chromosome. These genes were mapped with respect to the four anchor loci for MMU4. In addition, the panel of backcross DNAs had previously been typed for [delta]-amino levulinate dehydratase (Lv), orosomucoid-1 (Orm-1), and hexabranchion (Hxb), the human homologues of which map to HSA9q. The recombination distances [+-] the standard error between each pair of loci are D4Nds4-1.6[+-]1.1-D4H9S3E-4.0[+-]1.7 (Galt) 0.8[+-]0.8-Pax-5-4.8[+-]1.9-Aldo-2-6.3[+-]2.2-(Lv, Orm-1, Ambp)-1.6[+-]1.1-Hxb-4.0[+-]1.7-Tyrp-1-4.8[+-]1.9-Ifa. The data from this study have extended the known region of conserved synteny between human chromosome 9 and mouse chromosome 4. 17 refs., 2 figs.

  7. Quantitative cleaning characterization of a lithium-fluoride ion diode

    SciTech Connect (OSTI)

    Menge, P.R.; Cuneo, M.E.


    An ion source cleaning testbed was created to test plasma-cleaning techniques, and to provide quantitative data on plasma-cleaning protocols prior to implementation on the SABRE accelerator. The testbed was designed to resolve issues regarding the quantity of contaminants absorbed by the anode source (LiF), and the best cleaning methodology. A test chamber was devised containing a duplicate of the SABRE diode. Radio-frequency (RF) power was fed to the anode, which was isolated from ground and thus served as the plasma discharge electrode. RF plasma discharges in 1--3 mtorr of Ar with 10% O{sub 2} were found to provide the best cleaning of the LiF surface. X-ray photoelectron spectroscopy (XPS) showed that the LiF could accrue dozens of monolayers of carbon just by sitting in a 2 {times} 10{sup {minus}5} vacuum for 24 h. Tests of various discharge cleaning protocols indicated that 15 min of an Ar/O{sub 2} discharge was sufficient to reduce this initial 13--45 monolayers of carbon impurities to 2--4 monolayers. Rapid recontamination of the LiF was also observed. Up to ten monolayers of carbon returned in 2 min after termination of the plasma discharge and subsequent pumping back to the 10{sup {minus}5} torr range. Heating of the LiF also was found to provide anode cleaning. Application of heating combined with plasma cleaning provided the highest cleaning rates.

  8. Quantitative infrared absorption cross sections of isoprene for atmospheric measurements

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Brauer, C. S.; Blake, T. A.; Guenther, A. B.; Sharpe, S. W.; Sams, R. L.; Johnson, T. J.


    Isoprene (C5H8, 2-methyl-1,3-butadiene) is a volatile organic compound (VOC) and is one of the primary contributors to annual global VOC emissions. Isoprene is produced primarily by vegetation as well as anthropogenic sources, and its OH- and O3-initiated oxidations are a major source of atmospheric oxygenated organics. Few quantitative infrared studies have been reported for isoprene, limiting the ability to quantify isoprene emissions via remote or in situ infrared detection. We thus report absorption cross sections and integrated band intensities for isoprene in the 600–6500 cm-1 region. The pressure-broadened (1 atmosphere N2) spectra were recorded at 278, 298, and 323 Kmore » in a 19.94 cm path-length cell at 0.112 cm-1 resolution, using a Bruker IFS 66v/S Fourier transform infrared (FTIR) spectrometer. Composite spectra are derived from a minimum of seven isoprene sample pressures, each at one of three temperatures, and the number densities are normalized to 296 K and 1 atm.« less

  9. Comprehensive Quantitative Analysis of Ovarian and Breast Cancer Tumor Peptidomes

    SciTech Connect (OSTI)

    Xu, Zhe; Wu, Chaochao; Xie, Fang; Slysz, Gordon W.; Tolic, Nikola; Monroe, Matthew E.; Petyuk, Vladislav A.; Payne, Samuel H.; Fujimoto, Grant M.; Moore, Ronald J.; Fillmore, Thomas L.; Schepmoes, Athena A.; Levine, Douglas; Townsend, Reid; Davies, Sherri; Li, Shunqiang; Ellis, Matthew; Boja, Emily; Rodriguez, Henry; Rodland, Karin D.; Liu, Tao; Smith, Richard D.


    Aberrant degradation of proteins is associated with many pathological states, including cancers. Mass spectrometric analysis of tumor peptidomes, the intracellular and intercellular products of protein degradation, has the potential to provide biological insights on proteolytic processing in cancer. However, attempts to use the information on these smaller protein degradation products from tumors for biomarker discovery and cancer biology studies have been fairly limited to date, largely due to the lack of effective approaches for robust peptidomics identification and quantification, and the prevalence of confounding factors and biases associated with sample handling and processing. Herein, we have developed an effective and robust analytical platform for comprehensive analyses of tissue peptidomes, and which is suitable for high throughput quantitative studies. The reproducibility and coverage of the platform, as well as the suitability of clinical ovarian tumor and patient-derived breast tumor xenograft samples with post-excision delay of up to 60 min before freezing for peptidomics analysis, have been demonstrated. Moreover, our data also show that the peptidomics profiles can effectively separate breast cancer subtypes, reflecting tumor-associated protease activities. Peptidomics complements results obtainable from conventional bottom-up proteomics, and provides insights not readily obtainable from such approaches.

  10. Quantitative planar laser-induced fluorescence imaging of multi-component

    Office of Scientific and Technical Information (OSTI)

    fuel/air mixing in a firing gasoline-direct-injection engine: Effects of residual exhaust gas on quantitative PLIF (Journal Article) | SciTech Connect Journal Article: Quantitative planar laser-induced fluorescence imaging of multi-component fuel/air mixing in a firing gasoline-direct-injection engine: Effects of residual exhaust gas on quantitative PLIF Citation Details In-Document Search Title: Quantitative planar laser-induced fluorescence imaging of multi-component fuel/air mixing in a

  11. Quantitative Analysis of Biofuel Sustainability, Including Land Use Change GHG Emissions

    Broader source: [DOE]

    Plenary V: Biofuels and Sustainability: Acknowledging Challenges and Confronting MisconceptionsQuantitative Analysis of Biofuel Sustainability, Including Land Use Change GHG EmissionsJennifer B....

  12. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    As a result, it is critical to have a tool to facilitate the quantitative visualization of differences between transcription factors and the genomic regions they bind to understand ...

  13. Quantitation of absorbed or deposited materials on a substrate that measures energy deposition

    DOE Patents [OSTI]

    Grant, Patrick G.; Bakajin, Olgica; Vogel, John S.; Bench, Graham


    This invention provides a system and method for measuring an energy differential that correlates to quantitative measurement of an amount mass of an applied localized material. Such a system and method remains compatible with other methods of analysis, such as, for example, quantitating the elemental or isotopic content, identifying the material, or using the material in biochemical analysis.

  14. Evaluating quantitative 3-D image analysis as a design tool for low

    Office of Scientific and Technical Information (OSTI)

    enriched uranium fuel compacts for the transient reactor test facility: A preliminary study (Journal Article) | SciTech Connect Journal Article: Evaluating quantitative 3-D image analysis as a design tool for low enriched uranium fuel compacts for the transient reactor test facility: A preliminary study Citation Details In-Document Search This content will become publicly available on February 5, 2017 Title: Evaluating quantitative 3-D image analysis as a design tool for low enriched uranium

  15. Final Report (2010-2015) for the Topical Collaboration on Quantitative Jet

    Office of Scientific and Technical Information (OSTI)

    and Electromagnetic Tomography (JET) of Extreme Phases of Matter in Heavy-ion Collisions (Technical Report) | SciTech Connect Technical Report: Final Report (2010-2015) for the Topical Collaboration on Quantitative Jet and Electromagnetic Tomography (JET) of Extreme Phases of Matter in Heavy-ion Collisions Citation Details In-Document Search Title: Final Report (2010-2015) for the Topical Collaboration on Quantitative Jet and Electromagnetic Tomography (JET) of Extreme Phases of Matter in

  16. Quantitative determination of mineral composition by powder X-ray diffraction

    DOE Patents [OSTI]

    Pawloski, Gayle A. (Livermore, CA)


    An external standard intensity ratio method is used for quantitatively determining mineralogic compositions of samples by x-ray diffraction. The method uses ratios of x-ray intensity peaks from a single run. Constants are previously determined for each mineral which is to be quantitatively measured. Ratios of the highest intensity peak of each mineral to be quantified in the sample and the highest intensity peak of a reference mineral contained in the sample are used to calculate sample composition.

  17. Quantitative evaluation of wrist posture and typing performance: A comparative study of 4 computer keyboards

    SciTech Connect (OSTI)

    Burastero, S.


    The present study focuses on an ergonomic evaluation of 4 computer keyboards, based on subjective analyses of operator comfort and on a quantitative analysis of typing performance and wrist posture during typing. The objectives of this study are (1) to quantify differences in the wrist posture and in typing performance when the four different keyboards are used, and (2) to analyze the subjective preferences of the subjects for alternative keyboards compared to the standard flat keyboard with respect to the quantitative measurements.

  18. Quantitative determination of mineral composition by powder x-ray diffraction

    DOE Patents [OSTI]

    Pawloski, G.A.


    An external standard intensity ratio method is used for quantitatively determining mineralogic compositions of samples by x-ray diffraction. The method uses ratios of x-ray intensity peaks from a single run. Constants are previously determined for each mineral which is to be quantitatively measured. Ratios of the highest intensity peak of each mineral to be quantified in the sample and the highest intensity peak of a reference mineral contained in the sample are used to calculate sample composition.

  19. Final technical report. Can microbial functional traits predict the response and resilience of decomposition to global change?

    SciTech Connect (OSTI)

    Allison, Steven D.


    The role of specific micro-organisms in the carbon cycle, and their responses to environmental change, are unknown in most ecosystems. This knowledge gap limits scientists’ ability to predict how important ecosystem processes, like soil carbon storage and loss, will change with climate and other environmental factors. The investigators addressed this knowledge gap by transplanting microbial communities from different environments into new environments and measuring the response of community composition and carbon cycling over time. Using state-of-the-art sequencing techniques, computational tools, and nanotechnology, the investigators showed that microbial communities on decomposing plant material shift dramatically with natural and experimentally-imposed drought. Microbial communities also shifted in response to added nitrogen, but the effects were smaller. These changes had implications for carbon cycling, with lower rates of carbon loss under drought conditions, and changes in the efficiency of decomposition with nitrogen addition. Even when transplanted into the same conditions, microbial communities from different environments remained distinct in composition and functioning for up to one year. Changes in functioning were related to differences in enzyme gene content across different microbial groups. Computational approaches developed for this project allowed the conclusions to be tested more broadly in other ecosystems, and new computer models will facilitate the prediction of microbial traits and functioning across environments. The data and models resulting from this project benefit the public by improving the ability to predict how microbial communities and carbon cycling functions respond to climate change, nutrient enrichment, and other large-scale environmental changes.

  20. Quantitative Risk reduction estimation Tool For Control Systems, Suggested Approach and Research Needs

    SciTech Connect (OSTI)

    Miles McQueen; Wayne Boyer; Mark Flynn; Sam Alessi


    For the past year we have applied a variety of risk assessment technologies to evaluate the risk to critical infrastructure from cyber attacks on control systems. More recently, we identified the need for a stand alone control system risk reduction estimation tool to provide owners and operators of control systems with a more useable, reliable, and credible method for managing the risks from cyber attack. Risk is defined as the probability of a successful attack times the value of the resulting loss, typically measured in lives and dollars. Qualitative and ad hoc techniques for measuring risk do not provide sufficient support for cost benefit analyses associated with cyber security mitigation actions. To address the need for better quantitative risk reduction models we surveyed previous quantitative risk assessment research; evaluated currently available tools; developed new quantitative techniques [17] [18]; implemented a prototype analysis tool to demonstrate how such a tool might be used; used the prototype to test a variety of underlying risk calculational engines (e.g. attack tree, attack graph); and identified technical and research needs. We concluded that significant gaps still exist and difficult research problems remain for quantitatively assessing the risk to control system components and networks, but that a useable quantitative risk reduction estimation tool is not beyond reach.

  1. Nanotag-enabled photonic crystal fiber as quantitative surface-enhanced Raman scattering optofluidic platform

    SciTech Connect (OSTI)

    Pinkhasova, Polina; Chen, Hui; Du, Henry; Kanka, Jiri; Mergo, Pawel


    Core-shell nanotags that are active in surface-enhanced Raman scattering (SERS) and entrapped with thiocyanate (SCN) label molecules were immobilized in the air channels of suspended-core photonic crystal fiber (PCF) to impart quantitative capacity to SERS-based PCF optofluidic sensing platform. The Raman intensity of Rhodamine 6G increases with concentration, whereas the intensity of SCN remains constant when measured using this platform. The signal from the SCN label can be used as an internal reference to establish calibration for quantitative measurements of analytes of unknown concentrations. The long optical path-length PCF optofluidic platform integrated with SERS-active core-shell nanotags holds significant promise for sensitive quantitative chem/bio measurements with the added benefit of small sampling volume. The dependence of SERS intensity on the nanotag coverage density and PCF length was interpreted based on numerical-analytical simulations.

  2. Time-resolved quantitative multiphase interferometric imaging of a highly focused ultrasound pulse

    SciTech Connect (OSTI)

    Souris, Fabien; Grucker, Jules; Dupont-Roc, Jacques; Jacquier, Philippe; Arvengas, Arnaud; Caupin, Frederic


    Interferometric imaging is a well-established method to image phase objects by mixing the image wavefront with a reference one on a CCD camera. It has also been applied to fast transient phenomena, mostly through the analysis of single interferograms. It is shown that, for repetitive phenomena, multiphase acquisition brings significant advantages. A 1MHz focused sound field emitted by a hemispherical piezotransducer in water is imaged as an example. Quantitative image analysis provides high resolution sound field profiles. Pressure at focus determined by this method agrees with measurements from a fiber-optic probe hydrophone. This confirms that multiphase interferometric imaging can indeed provide quantitative measurements.

  3. Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples

    DOE Patents [OSTI]

    Caldwell, John T. (Los Alamos, NM); Kunz, Walter E. (Santa Fe, NM); Cates, Michael R. (Oak Ridge, TN); Franks, Larry A. (Santa Barbara, CA)


    Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fissions are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for .sup.239 Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

  4. Real-Time Quantitative Imaging of Failure Events in Materials Under Load at

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Temperatures Above 1,600 °C Real-Time Quantitative Imaging of Failure Events in Materials Under Load at Temperatures Above 1,600 °C Real-Time Quantitative Imaging of Failure Events in Materials Under Load at Temperatures Above 1,600 °C Print Monday, 25 March 2013 00:00 Gathering information on the evolution of small cracks in ceramic matrix composites used in hostile environments such as in gas turbines and hypersonic flights has been a challenge. It is now shown that sequences of

  5. Metabolomics relative quantitation with mass spectrometry using chemical derivatization and isotope labeling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    O'Maille, Grace; Go, Eden P.; Hoang, Linh; Want, Elizabeth J.; Smith, Colin; O'Maille, Paul; NordstrÖm, Anders; Morita, Hirotoshi; Qin, Chuan; Uritboonthai, Wilasinee; et al


    Comprehensive detection and quantitation of metabolites from a biological source constitute the major challenges of current metabolomics research. Two chemical derivatization methodologies, butylation and amination, were applied to human serum for ionization enhancement of a broad spectrum of metabolite classes, including steroids and amino acids. LC-ESI-MS analysis of the derivatized serum samples provided a significant signal elevation across the total ion chromatogram to over a 100-fold increase in ionization efficiency. It was also demonstrated that derivatization combined with isotopically labeled reagents facilitated the relative quantitation of derivatized metabolites from individual as well as pooled samples.

  6. Predicting the impacts of climate change on animal distributions: the importance of local adaptation and species' traits

    SciTech Connect (OSTI)

    HELLMANN, J. J.; LOBO, N. F.


    The geographic range limits of many species are strongly affected by climate and are expected to change under global warming. For species that are able to track changing climate over broad geographic areas, we expect to see shifts in species distributions toward the poles and away from the equator. A number of ecological and evolutionary factors, however, could restrict this shifting or redistribution under climate change. These factors include restricted habitat availability, restricted capacity for or barriers to movement, or reduced abundance of colonists due the perturbation effect of climate change. This research project examined the last of these constraints - that climate change could perturb local conditions to which populations are adapted, reducing the likelihood that a species will shift its distribution by diminishing the number of potential colonists. In the most extreme cases, species ranges could collapse over a broad geographic area with no poleward migration and an increased risk of species extinction. Changes in individual species ranges are the processes that drive larger phenomena such as changes in land cover, ecosystem type, and even changes in carbon cycling. For example, consider the poleward range shift and population outbreaks of the mountain pine beetle that has decimated millions of acres of Douglas fir trees in the western US and Canada. Standing dead trees cause forest fires and release vast quantities of carbon to the atmosphere. The beetle likely shifted its range because it is not locally adapted across its range, and it appears to be limited by winter low temperatures that have steadily increased in the last decades. To understand range and abundance changes like the pine beetle, we must reveal the extent of adaptive variation across species ranges - and the physiological basis of that adaptation - to know if other species will change as readily as the pine beetle. Ecologists tend to assume that range shifts are the dominant response of species to climate change, but our experiments suggest that other processes may act in some species that reduce the likelihood of geographic range change. In the first part of our DOE grant (ending 2008) we argued that the process of local adaptation of populations within a species range, followed by climatic changes that occur too quickly for adaptive evolution, is an underappreciated mechanism by which climate change could affect biodiversity. When this process acts, species ranges may not shift readily toward the poles, slowing the rate of species and biome change. To test this claim, we performed an experiment comparing core and peripheral populations in a series of field observations, translocation experiments, and genetic analyses. The papers in Appendix A were generated from 2005-2008 funding. In the second part of the DOE grant (ending 2011) we studied which traits promote population differentiation and local adaptation by building genomic resources for our study species and using these resources to reveal differences in gene expression in peripheral and core populations. The papers in Appendix B were generated from 2008-2011 funding. This work was pursued with two butterfly species that have contrasting life history traits (body size and resource specialization) and occupy a common ecosystem and a latitudinal range. These species enabled us to test the following hypotheses using a single phylogenetic group.

  7. ANSI/ASHRAE/IES Standard 90.1-2013 Preliminary Determination: Quantitative Analysis

    SciTech Connect (OSTI)

    Halverson, Mark A.; Rosenberg, Michael I.; Wang, Weimin; Zhang, Jian; Mendon, Vrushali V.; Athalye, Rahul A.; Xie, YuLong; Hart, Reid; Goel, Supriya


    This report provides a preliminary quantitative analysis to assess whether buildings constructed according to the requirements of ANSI/ASHRAE/IES Standard 90.1-2013 would result in energy savings compared with buildings constructed to ANSI/ASHRAE/IES Standard 90.1-2010.

  8. Gas chromatograph-mass spectrometer (GC/MS) system for quantitative analysis of reactive chemical compounds

    DOE Patents [OSTI]

    Grindstaff, Quirinus G.


    Described is a new gas chromatograph-mass spectrometer (GC/MS) system and method for quantitative analysis of reactive chemical compounds. All components of such a GC/MS system external to the oven of the gas chromatograph are programmably temperature controlled to operate at a volatilization temperature specific to the compound(s) sought to be separated and measured.

  9. Sources of Technical Variability in Quantitative LC-MS Proteomics: Human Brain Tissue Sample Analysis.

    SciTech Connect (OSTI)

    Piehowski, Paul D.; Petyuk, Vladislav A.; Orton, Daniel J.; Xie, Fang; Moore, Ronald J.; Ramirez Restrepo, Manuel; Engel, Anzhelika; Lieberman, Andrew P.; Albin, Roger L.; Camp, David G.; Smith, Richard D.; Myers, Amanda J.


    To design a robust quantitative proteomics study, an understanding of both the inherent heterogeneity of the biological samples being studied as well as the technical variability of the proteomics methods and platform is needed. Additionally, accurately identifying the technical steps associated with the largest variability would provide valuable information for the improvement and design of future processing pipelines. We present an experimental strategy that allows for a detailed examination of the variability of the quantitative LC-MS proteomics measurements. By replicating analyses at different stages of processing, various technical components can be estimated and their individual contribution to technical variability can be dissected. This design can be easily adapted to other quantitative proteomics pipelines. Herein, we applied this methodology to our label-free workflow for the processing of human brain tissue. For this application, the pipeline was divided into four critical components: Tissue dissection and homogenization (extraction), protein denaturation followed by trypsin digestion and SPE clean-up (digestion), short-term run-to-run instrumental response fluctuation (instrumental variance), and long-term drift of the quantitative response of the LC-MS/MS platform over the 2 week period of continuous analysis (instrumental stability). From this analysis, we found the following contributions to variability: extraction (72%) >> instrumental variance (16%) > instrumental stability (8.4%) > digestion (3.1%). Furthermore, the stability of the platform and its suitability for discovery proteomics studies is demonstrated.

  10. Quantitative Tools for Dissection of Hydrogen-Producing Metabolic Networks-Final Report

    SciTech Connect (OSTI)

    Rabinowitz, Joshua D.; Dismukes, G.Charles.; Rabitz, Herschel A.; Amador-Noguez, Daniel


    During this project we have pioneered the development of integrated experimental-computational technologies for the quantitative dissection of metabolism in hydrogen and biofuel producing microorganisms (i.e. C. acetobutylicum and various cyanobacteria species). The application of these new methodologies resulted in many significant advances in the understanding of the metabolic networks and metabolism of these organisms, and has provided new strategies to enhance their hydrogen or biofuel producing capabilities. As an example, using mass spectrometry, isotope tracers, and quantitative flux-modeling we mapped the metabolic network structure in C. acetobutylicum. This resulted in a comprehensive and quantitative understanding of central carbon metabolism that could not have been obtained using genomic data alone. We discovered that biofuel production in this bacterium, which only occurs during stationary phase, requires a global remodeling of central metabolism (involving large changes in metabolite concentrations and fluxes) that has the effect of redirecting resources (carbon and reducing power) from biomass production into solvent production. This new holistic, quantitative understanding of metabolism is now being used as the basis for metabolic engineering strategies to improve solvent production in this bacterium. In another example, making use of newly developed technologies for monitoring hydrogen and NAD(P)H levels in vivo, we dissected the metabolic pathways for photobiological hydrogen production by cyanobacteria Cyanothece sp. This investigation led to the identification of multiple targets for improving hydrogen production. Importantly, the quantitative tools and approaches that we have developed are broadly applicable and we are now using them to investigate other important biofuel producers, such as cellulolytic bacteria.

  11. Genomics Mechanisms of Carbon Allocation and Partitioning in Poplar

    SciTech Connect (OSTI)

    Kirst, Matias; Peter, Gary; Martin, Timothy


    The genetic control of carbon allocation and partitioning in woody perennial plants is poorly understood despite its importance for carbon sequestration. It is also unclear how environmental cues such as nitrogen availability impact the genes that regulate growth, and biomass allocation and wood composition in trees. To address these questions we phenotyped 396 clonally replicated genotypes of an interspecific pseudo-backcross pedigree of Populus for wood composition and biomass traits in above and below ground organs. The loci that regulate growth, carbon allocation and partitioning under two nitrogen conditions were identified, defining the contribution of environmental cues to their genetic control. Fifty-seven quantitative trait loci (QTL) were identified for twenty traits analyzed. The majority of QTL are specific to one of the two nitrogen treatments, demonstrating significant nitrogen-dependent genetic control. A highly significant genetic correlation was observed between plant growth and lignin/cellulose composition, and QTL co-localization identified the genomic position of potential pleiotropic regulators. Gene expression analysis of all poplar genes was also characterized in differentiating xylem, whole-roots and developing leaves of 192 of the segregating population. By integrating the QTL and gene expression information we identified genes that regulate carbon partitioning and several biomass growth related properties. The work developed in this project resulted in the publication of three book chapters, four scientific articles (three others currently in preparation), 17 presentations in international conferences and two provisional patent applications.

  12. Identification and genetic characterization of maize cell wall variation for improved biorefinery feedstock characteristics

    SciTech Connect (OSTI)

    Pauly, Markus; Hake, Sarah


    The objectives of this program are to 1) characterize novel maize mutants with altered cell walls for enhanced biorefinery characteristics and 2) find quantitative trait loci (QTLs) related to biorefinery characteristics by taking advantage of the genetic diversity of maize. As a result a novel non-transgenic maize plant (cal1) has been identified, whose stover (leaves and stalk) contain more glucan in their walls leading to a higher saccharification yield, when subjected to a standard enzymatic digestion cocktail. Stacking this trait with altered lignin mutants yielded evene higher saccharification yields. Cal-1 mutants do not show a loss of kernel and or biomass yield when grown in the field . Hence, cal1 biomass provides an excellent feedstock for the biofuel industry.

  13. Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen

    SciTech Connect (OSTI)

    Olson, Ake; Aerts, Andrea; Asiegbu, Fred; Belbahri, Lassaad; Bouzid, Ourdia; Broberg, Anders; Canback, Bjorn; Coutinho, Pedro M.; Cullen, Dan; Dalman, Kerstin; Deflorio, Giuliana; van Diepen, Linda T. A.; Dunand, Christophe; Duplessis, Sebastien; Durling, Mikael; Gonthier, Paolo; Grimwood, Jane; Fossdal, Carl Gunnar; Hansson, David; Henrissat, Bernard; Hietala, Ari; Himmelstrand, Kajsa; Hoffmeister, Dirk; Hogberg, Nils; James, Timothy Y.; Karlsson, Magnus; Kohler, Annegret; Lucas, Susan; Lunden, Karl; Morin, Emmanuelle; Murat, Claude; Park, Jongsun; Raffaello, Tommaso; Rouze, Pierre; Salamov, Asaf; Schmutz, Jeremy; Solheim, Halvor; Stahlberg, Jerry; Velez, Heriberto; de Vries, Ronald P.; Wiebenga, Ad; Woodward, Steve; Yakovlev, Igor; Garbelotto, Matteo; Martin, Francis; Grigoriev, Igor V.; Stenlid, Jan


    Parasitism and saprotrophic wood decay are two fungal strategies fundamental for succession and nutrient cycling in forest ecosystems. An opportunity to assess the trade-off between these strategies is provided by the forest pathogen and wood decayer Heterobasidion annosum sensu lato. We report the annotated genome sequence and transcript profiling, as well as the quantitative trait loci mapping, of one member of the species complex: H. irregulare. Quantitative trait loci critical for pathogenicity, and rich in transposable elements, orphan and secreted genes, were identified. A wide range of cellulose-degrading enzymes are expressed during wood decay. By contrast, pathogenic interaction between H. irregulare and pine engages fewer carbohydrate-active enzymes, but involves an increase in pectinolytic enzymes, transcription modules for oxidative stress and secondary metabolite production. Our results show a trade-off in terms of constrained carbohydrate decomposition and membrane transport capacity during interaction with living hosts. Our findings establish that saprotrophic wood decay and necrotrophic parasitism involve two distinct, yet overlapping, processes.

  14. A model system for QTL analysis: Effects of alcohol dehydrogenase genotype on alcohol pharmacokinetics

    SciTech Connect (OSTI)

    Martin, N.G.; Nightingale, B.; Whitfield, J.B.


    There is much interest in the detection of quantitative trait loci (QTL) - major genes which affect quantitative phenotypes. The relationship of polymorphism at known alcohol metabolizing enzyme loci to alcohol pharmacokinetics is a good model system. The three class I alcohol dehydrogenase genes are clustered on chromosome 4 and protein electrophoresis has revealed polymorphisms at the ADH2 and ADH3 loci. While different activities of the isozymes have been demonstrated in vitro, little work has been done in trying to relate ADH polymorphism to variation in ethanol metabolism in vivo. We previously measured ethanol metabolism and psychomotor reactivity in 206 twin pairs and demonstrated that most of the repeatable variation was genetic. We have now recontacted the twins to obtain DNA samples and used PCR with allele specific primers to type the ADH2 and ADH3 polymorphisms in 337 individual twins. FISHER has been used to estimate fixed effects of typed polymorphisms simultaneously with remaining linked and unlinked genetic variance. The ADH2*1-2 genotypes metabolize ethanol faster and attain a lower peak blood alcohol concentration than the more common ADH2*1-1 genotypes, although less than 3% of the variance is accounted for. There is no effect of ADH3 genotype. However, sib-pair linkage analysis suggests that there is a linked polymorphism which has a much greater effect on alcohol metabolism that those typed here.

  15. Quantitative measurements of electromechanical response with a combined optical beam and interferometric atomic force microscope

    SciTech Connect (OSTI)

    Labuda, Aleksander; Proksch, Roger


    An ongoing challenge in atomic force microscope (AFM) experiments is the quantitative measurement of cantilever motion. The vast majority of AFMs use the optical beam deflection (OBD) method to infer the deflection of the cantilever. The OBD method is easy to implement, has impressive noise performance, and tends to be mechanically robust. However, it represents an indirect measurement of the cantilever displacement, since it is fundamentally an angular rather than a displacement measurement. Here, we demonstrate a metrological AFM that combines an OBD sensor with a laser Doppler vibrometer (LDV) to enable accurate measurements of the cantilever velocity and displacement. The OBD/LDV AFM allows a host of quantitative measurements to be performed, including in-situ measurements of cantilever oscillation modes in piezoresponse force microscopy. As an example application, we demonstrate how this instrument can be used for accurate quantification of piezoelectric sensitivity—a longstanding goal in the electromechanical community.

  16. Low-frequency quantitative ultrasound imaging of cell death in vivo

    SciTech Connect (OSTI)

    Sadeghi-Naini, Ali; Falou, Omar; Czarnota, Gregory J.; Department of Radiation Oncology, Odette Cancer Centre, Sunnybrook Health Sciences Centre, Toronto, Ontario M4N 3M5; Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, Ontario M4N 3M5; Department of Radiation Oncology, Faculty of Medicine, University of Toronto, Toronto, Ontario M4N 3M5 ; Papanicolau, Naum; Tadayyon, Hadi; Lee, Justin; Zubovits, Judit; Sadeghian, Alireza; Karshafian, Raffi; Al-Mahrouki, Azza; Giles, Anoja; Kolios, Michael C.


    Purpose: Currently, no clinical imaging modality is used routinely to assess tumor response to cancer therapies within hours to days of the delivery of treatment. Here, the authors demonstrate the efficacy of ultrasound at a clinically relevant frequency to quantitatively detect changes in tumors in response to cancer therapies using preclinical mouse models.Methods: Conventional low-frequency and corresponding high-frequency ultrasound (ranging from 4 to 28 MHz) were used along with quantitative spectroscopic and signal envelope statistical analyses on data obtained from xenograft tumors treated with chemotherapy, x-ray radiation, as well as a novel vascular targeting microbubble therapy.Results: Ultrasound-based spectroscopic biomarkers indicated significant changes in cell-death associated parameters in responsive tumors. Specifically changes in the midband fit, spectral slope, and 0-MHz intercept biomarkers were investigated for different types of treatment and demonstrated cell-death related changes. The midband fit and 0-MHz intercept biomarker derived from low-frequency data demonstrated increases ranging approximately from 0 to 6 dBr and 0 to 8 dBr, respectively, depending on treatments administrated. These data paralleled results observed for high-frequency ultrasound data. Statistical analysis of ultrasound signal envelope was performed as an alternative method to obtain histogram-based biomarkers and provided confirmatory results. Histological analysis of tumor specimens indicated up to 61% cell death present in the tumors depending on treatments administered, consistent with quantitative ultrasound findings indicating cell death. Ultrasound-based spectroscopic biomarkers demonstrated a good correlation with histological morphological findings indicative of cell death (r{sup 2}= 0.71, 0.82; p < 0.001).Conclusions: In summary, the results provide preclinical evidence, for the first time, that quantitative ultrasound used at a clinically relevant frequency, in addition to high-frequency ultrasound, can detect tissue changes associated with cell death in vivo in response to cancer treatments.

  17. Reliability of Quantitative Ultrasonic Assessment of Normal-Tissue Toxicity in Breast Cancer Radiotherapy

    SciTech Connect (OSTI)

    Yoshida, Emi J.; Chen Hao; Torres, Mylin; Andic, Fundagul; Liu Haoyang; Chen Zhengjia; Sun, Xiaoyan; Curran, Walter J.; Liu Tian


    Purpose: We have recently reported that ultrasound imaging, together with ultrasound tissue characterization (UTC), can provide quantitative assessment of radiation-induced normal-tissue toxicity. This study's purpose is to evaluate the reliability of our quantitative ultrasound technology in assessing acute and late normal-tissue toxicity in breast cancer radiotherapy. Method and Materials: Our ultrasound technique analyzes radiofrequency echo signals and provides quantitative measures of dermal, hypodermal, and glandular tissue toxicities. To facilitate easy clinical implementation, we further refined this technique by developing a semiautomatic ultrasound-based toxicity assessment tool (UBTAT). Seventy-two ultrasound studies of 26 patients (720 images) were analyzed. Images of 8 patients were evaluated for acute toxicity (<6 months postradiotherapy) and those of 18 patients were evaluated for late toxicity ({>=}6 months postradiotherapy). All patients were treated according to a standard radiotherapy protocol. To assess intraobserver reliability, one observer analyzed 720 images in UBTAT and then repeated the analysis 3 months later. To assess interobserver reliability, three observers (two radiation oncologists and one ultrasound expert) each analyzed 720 images in UBTAT. An intraclass correlation coefficient (ICC) was used to evaluate intra- and interobserver reliability. Ultrasound assessment and clinical evaluation were also compared. Results: Intraobserver ICC was 0.89 for dermal toxicity, 0.74 for hypodermal toxicity, and 0.96 for glandular tissue toxicity. Interobserver ICC was 0.78 for dermal toxicity, 0.74 for hypodermal toxicity, and 0.94 for glandular tissue toxicity. Statistical analysis found significant changes in dermal (p < 0.0001), hypodermal (p = 0.0027), and glandular tissue (p < 0.0001) assessments in the acute toxicity group. Ultrasound measurements correlated with clinical Radiation Therapy Oncology Group (RTOG) toxicity scores of patients in the late toxicity group. Patients with RTOG Grade 1 or 2 had greater ultrasound-assessed toxicity percentage changes than patients with RTOG Grade 0. Conclusion: Early and late radiation-induced effects on normal tissue can be reliably assessed using quantitative ultrasound.

  18. Technique to quantitatively measure magnetic properties of thin structures at <10 NM spatial resolution

    DOE Patents [OSTI]

    Bajt, Sasa


    A highly sensitive and high resolution magnetic microscope images magnetic properties quantitatively. Imaging is done with a modified transmission electron microscope that allows imaging of the sample in a zero magnetic field. Two images from closely spaced planes, one in focus and one slightly out of focus, are sufficient to calculate the absolute values of the phase change imparted to the electrons, and hence obtain the magnetization vector field distribution.

  19. Real-Time High Resolution Quantitative Imaging by Three Wavelength Digital

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Holography - Energy Innovation Portal Real-Time High Resolution Quantitative Imaging by Three Wavelength Digital Holography Oak Ridge National Laboratory Contact ORNL About This Technology Technology Marketing Summary An optical system capable of reproducing three-dimensional images was invented at ORNL. This system can detect height changes of a few nanometers or less and render clear, single shot images. These types of precise, high speed measurements are important for a variety of

  20. Financing U.S. Renewable Energy Projects Through Public Capital Vehicles: Qualitative and Quantitative Benefits

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Financing U.S. Renewable Energy Projects Through Public Capital Vehicles: Qualitative and Quantitative Benefits Michael Mendelsohn and David Feldman Technical Report NREL/TP-6A20-58315 April 2013 NREL is a national laboratory of the U.S. Department of Energy, Office of Energy Efficiency & Renewable Energy, operated by the Alliance for Sustainable Energy, LLC. National Renewable Energy Laboratory 15013 Denver West Parkway Golden, Colorado 80401 303-275-3000 * Contract No.

  1. Apparatus and method for quantitative assay of generic transuranic wastes from nuclear reactors

    DOE Patents [OSTI]

    Caldwell, John T.; Kunz, Walter E.; Atencio, James D.


    A combination of passive and active neutron measurements which yields quantitative information about the isotopic composition of transuranic wastes from nuclear power or weapons material manufacture reactors is described. From the measurement of prompt and delayed neutron emission and the incidence of two coincidentally emitted neutrons from induced fission of fissile material in the sample, one can quantify .sup.233 U, .sup.235 U and .sup.239 Pu isotopes in waste samples. Passive coincidence counting, including neutron multiplicity measurement and determination of the overall passive neutron flux additionally enables the separate quantitative evaluation of spontaneous fission isotopes such as .sup.240 Pu, .sup.244 Cm and .sup.252 Cf, and the spontaneous alpha particle emitter .sup.241 Am. These seven isotopes are the most important constituents of wastes from nuclear power reactors and once the mass of each isotope present is determined by the apparatus and method of the instant invention, the overall alpha particle activity can be determined to better than 1 nCi/g from known radioactivity data. Therefore, in addition to the quantitative analysis of the waste sample useful for later reclamation purposes, the alpha particle activity can be determined to decide whether "permanent" low-level burial is appropriate for the waste sample.

  2. Apparatus and method for quantitative assay of generic transuranic wastes from nuclear reactors

    DOE Patents [OSTI]

    Caldwell, J.T.; Kunz, W.E.; Atencio, J.D.


    A combination of passive and active neutron measurements which yields quantitative information about the isotopic composition of transuranic wastes from nuclear power or weapons material manufacture reactors is described. From the measurement of prompt and delayed neutron emission and the incidence of two coincidentally emitted neutrons from induced fission of fissile material in the sample, one can quantify /sup 233/U, /sup 235/U and /sup 239/Pu isotopes in waste samples. Passive coincidence counting, including neutron multiplicity measurement and determination of the overall passive neutron flux additionally enables the separate quantitative evaluation of spontaneous fission isotopes such as /sup 240/Pu, /sup 244/Cm and /sup 252/Cf, and the spontaneous alpha particle emitter /sup 241/Am. These seven isotopes are the most important constituents of wastes from nuclear power reactors and once the mass of each isotope present is determined by the apparatus and method of the instant invention, the overall alpha particle activity can be determined to better than 1 nCi/g from known radioactivity data. Therefore, in addition to the quantitative analysis of the waste sample useful for later reclamation purposes, the alpha particle activity can be determined to decide whether permanent low-level burial is appropriate for the waste sample.

  3. Elevated carbon dioxide is predicted to promote coexistence among competing species in a trait-based model

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ali, Ashehad A.; Medlyn, Belinda E.; Aubier, Thomas G.; Crous, Kristine Y.; Reich, Peter B.


    Differential species responses to atmospheric CO2 concentration (Ca) could lead to quantitative changes in competition among species and community composition, with flow-on effects for ecosystem function. However, there has been little theoretical analysis of how elevated Ca (eCa) will affect plant competition, or how composition of plant communities might change. Such theoretical analysis is needed for developing testable hypotheses to frame experimental research. Here, we investigated theoretically how plant competition might change under eCa by implementing two alternative competition theories, resource use theory and resource capture theory, in a plant carbon and nitrogen cycling model. The model makes several novelmore » predictions for the impact of eCa on plant community composition. Using resource use theory, the model predicts that eCa is unlikely to change species dominance in competition, but is likely to increase coexistence among species. Using resource capture theory, the model predicts that eCa may increase community evenness. Collectively, both theories suggest that eCa will favor coexistence and hence that species diversity should increase with eCa. Our theoretical analysis leads to a novel hypothesis for the impact of eCa on plant community composition. In this study, the hypothesis has potential to help guide the design and interpretation of eCa experiments.« less

  4. The Application of Traits-Based Assessment Approaches to Estimate the Effects of Hydroelectric Turbine Passage on Fish Populations

    SciTech Connect (OSTI)

    Cada, Glenn F; Schweizer, Peter E


    One of the most important environmental issues facing the hydropower industry is the adverse impact of hydroelectric projects on downstream fish passage. Fish that migrate long distances as part of their life cycle include not only important diadromous species (such as salmon, shads, and eels) but also strictly freshwater species. The hydropower reservoirs that downstream-moving fish encounter differ greatly from free-flowing rivers. Many of the environmental changes that occur in a reservoir (altered water temperature and transparency, decreased flow velocities, increased predation) can reduce survival. Upon reaching the dam, downstream-migrating fish may suffer increased mortality as they pass through the turbines, spillways and other bypasses, or turbulent tailraces. Downstream from the dam, insufficient environmental flow releases may slow downstream fish passage rates or decrease survival. There is a need to refine our understanding of the relative importance of causative factors that contribute to turbine passage mortality (e.g., strike, pressure changes, turbulence) so that turbine design efforts can focus on mitigating the most damaging components. Further, present knowledge of the effectiveness of turbine improvements is based on studies of only a few species (mainly salmon and American shad). These data may not be representative of turbine passage effects for the hundreds of other fish species that are susceptible to downstream passage at hydroelectric projects. For example, there are over 900 species of fish in the United States. In Brazil there are an estimated 3,000 freshwater fish species, of which 30% are believed to be migratory (Viana et al. 2011). Worldwide, there are some 14,000 freshwater fish species (Magurran 2009), of which significant numbers are susceptible to hydropower impacts. By comparison, in a compilation of fish entrainment and turbine survival studies from over 100 hydroelectric projects in the United States, Winchell et al. (2000) found useful turbine passage survival data for only 30 species. Tests of advanced hydropower turbines have been limited to seven species - Chinook and coho salmon, rainbow trout, alewife, eel, smallmouth bass, and white sturgeon. We are investigating possible approaches for extending experimental results from the few tested fish species to predict turbine passage survival of other, untested species (Cada and Richmond 2011). In this report, we define the causes of injury and mortality to fish tested in laboratory and field studies, based on fish body shape and size, internal and external morphology, and physiology. We have begun to group the large numbers of unstudied species into a small number of categories, e.g., based on phylogenetic relationships or ecological similarities (guilds), so that subsequent studies of a few representative species (potentially including species-specific Biological Index Testing) would yield useful information about the overall fish community. This initial effort focused on modifying approaches that are used in the environmental toxicology field to estimate the toxicity of substances to untested species. Such techniques as the development of species sensitivity distributions (SSDs) and Interspecies Correlation Estimation (ICE) models rely on a considerable amount of data to establish the species-toxicity relationships that can be extended to other organisms. There are far fewer studies of turbine passage stresses from which to derive the turbine passage equivalent of LC{sub 50} values. Whereas the SSD and ICE approaches are useful analogues to predicting turbine passage injury and mortality, too few data are available to support their application without some form of modification or simplification. In this report we explore the potential application of a newer, related technique, the Traits-Based Assessment (TBA), to the prediction of downstream passage mortality at hydropower projects.

  5. Elevated carbon dioxide is predicted to promote coexistence among competing species in a trait-based model

    SciTech Connect (OSTI)

    Ali, Ashehad A.; Medlyn, Belinda E.; Aubier, Thomas G.; Crous, Kristine Y.; Reich, Peter B.


    Differential species responses to atmospheric CO2 concentration (Ca) could lead to quantitative changes in competition among species and community composition, with flow-on effects for ecosystem function. However, there has been little theoretical analysis of how elevated Ca (eCa) will affect plant competition, or how composition of plant communities might change. Such theoretical analysis is needed for developing testable hypotheses to frame experimental research. Here, we investigated theoretically how plant competition might change under eCa by implementing two alternative competition theories, resource use theory and resource capture theory, in a plant carbon and nitrogen cycling model. The model makes several novel predictions for the impact of eCa on plant community composition. Using resource use theory, the model predicts that eCa is unlikely to change species dominance in competition, but is likely to increase coexistence among species. Using resource capture theory, the model predicts that eCa may increase community evenness. Collectively, both theories suggest that eCa will favor coexistence and hence that species diversity should increase with eCa. Our theoretical analysis leads to a novel hypothesis for the impact of eCa on plant community composition. In this study, the hypothesis has potential to help guide the design and interpretation of eCa experiments.

  6. Improved Protein Arrays for Quantitative Systems Analysis of the Dynamics of Signaling Pathway Interactions

    SciTech Connect (OSTI)



    Astronauts and workers in nuclear plants who repeatedly exposed to low doses of ionizing radiation (IR, <10 cGy) are likely to incur specific changes in signal transduction and gene expression in various tissues of their body. Remarkable advances in high throughput genomics and proteomics technologies enable researchers to broaden their focus from examining single gene/protein kinetics to better understanding global gene/protein expression profiling and biological pathway analyses, namely Systems Biology. An ultimate goal of systems biology is to develop dynamic mathematical models of interacting biological systems capable of simulating living systems in a computer. This Glue Grant is to complement Dr. Boothman’s existing DOE grant (No. DE-FG02-06ER64186) entitled “The IGF1/IGF-1R-MAPK-Secretory Clusterin (sCLU) Pathway: Mediator of a Low Dose IR-Inducible Bystander Effect” to develop sensitive and quantitative proteomic technology that suitable for low dose radiobiology researches. An improved version of quantitative protein array platform utilizing linear Quantum dot signaling for systematically measuring protein levels and phosphorylation states for systems biology modeling is presented. The signals are amplified by a confocal laser Quantum dot scanner resulting in ~1000-fold more sensitivity than traditional Western blots and show the good linearity that is impossible for the signals of HRP-amplification. Therefore this improved protein array technology is suitable to detect weak responses of low dose radiation. Software is developed to facilitate the quantitative readout of signaling network activities. Kinetics of EGFRvIII mutant signaling was analyzed to quantify cross-talks between EGFR and other signaling pathways.

  7. Quantitative ultrasound characterization of locally advanced breast cancer by estimation of its scatterer properties

    SciTech Connect (OSTI)

    Tadayyon, Hadi; Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, Ontario M5G 2M9 ; Sadeghi-Naini, Ali; Czarnota, Gregory; Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, Ontario M5G 2M9; Department of Radiation Oncology, Odette Cancer Centre, Sunnybrook Health Sciences Centre, Toronto, Ontario M4N 3M5; Department of Radiation Oncology, Faculty of Medicine, University of Toronto, Toronto, Ontario M5T 1P5 ; Wirtzfeld, Lauren; Wright, Frances C.


    Purpose: Tumor grading is an important part of breast cancer diagnosis and currently requires biopsy as its standard. Here, the authors investigate quantitative ultrasound parameters in locally advanced breast cancers that can potentially separate tumors from normal breast tissue and differentiate tumor grades. Methods: Ultrasound images and radiofrequency data from 42 locally advanced breast cancer patients were acquired and analyzed. Parameters related to the linear regression of the power spectrummidband fit, slope, and 0-MHz-interceptwere determined from breast tumors and normal breast tissues. Mean scatterer spacing was estimated from the spectral autocorrelation, and the effective scatterer diameter and effective acoustic concentration were estimated from the Gaussian form factor. Parametric maps of each quantitative ultrasound parameter were constructed from the gated radiofrequency segments in tumor and normal tissue regions of interest. In addition to the mean values of the parametric maps, higher order statistical features, computed from gray-level co-occurrence matrices were also determined and used for characterization. Finally, linear and quadratic discriminant analyses were performed using combinations of quantitative ultrasound parameters to classify breast tissues. Results: Quantitative ultrasound parameters were found to be statistically different between tumor and normal tissue (p < 0.05). The combination of effective acoustic concentration and mean scatterer spacing could separate tumor from normal tissue with 82% accuracy, while the addition of effective scatterer diameter to the combination did not provide significant improvement (83% accuracy). Furthermore, the two advanced parameters, including effective scatterer diameter and mean scatterer spacing, were found to be statistically differentiating among grade I, II, and III tumors (p = 0.014 for scatterer spacing, p = 0.035 for effective scatterer diameter). The separation of the tumor grades further improved when the textural features of the effective scatterer diameter parametric map were combined with the mean value of the map (p = 0.004). Conclusions: Overall, the binary classification results (tumor versus normal tissue) were more promising than tumor grade assessment. Combinations of advanced parameters can further improve the separation of tumors from normal tissue compared to the use of linear regression parameters. While the linear regression parameters were sufficient for characterizing breast tumors and normal breast tissues, advanced parameters and their textural features were required to better characterize tumor subtypes.

  8. Apparatus and method for quantitative determination of materials contained in fluids

    DOE Patents [OSTI]

    Radziemski, L.J.; Cremers, D.A.


    Apparatus and method for near real-time in-situ monitoring of particulates and vapors contained in fluids are described. Initial filtration of a known volume of the fluid sample is combined with laser-induced dielectric breakdown spectroscopy of the filter employed to obtain qualitative and quantitative information with high sensitivity. Application of the invention to monitoring of beryllium, beryllium oxide, or other beryllium-alloy dusts is shown. Significant shortening of analysis time is achieved from the usual chemical techniques of analysis.

  9. Apparatus and method for quantitative determination of materials contained in fluids

    DOE Patents [OSTI]

    Radziemski, Leon J.; Cremers, David A.


    Apparatus and method for near real-time in-situ monitoring of particulates and vapors contained in fluids. Initial filtration of a known volume of the fluid sample is combined with laser-induced dielectric breakdown spectroscopy of the filter employed to obtain qualitative and quantitative information with high sensitivity. Application of the invention to monitoring of beryllium, beryllium oxide, or other beryllium-alloy dusts is demonstrated. Significant shortening of analysis time is achieved from those of the usual chemical techniques of analysis.

  10. A x-ray radiography-densitometry technique for the quantitative determination of metal deposit profiles

    SciTech Connect (OSTI)

    Will, F.G.; Iacovangelo, C.D.


    The application of x-ray radiography in conjunction with high resolution optical densitometry for the quantitative determination of metal deposit profiles parallel and perpendicular to the substrate surface is described. The principles of the technique and the range of its applicability are discussed. The technique is applied to the study of zinc deposition on highly porous carbon foams from circulating aqueous zinc bromide solutions. The effect of substrate pore size on the zinc distribution is explored. Zinc is found to deposit predominantly on the porous substrate/electrolyte and substrate/current collector interfaces. Smaller pore size favors smoother and more uniform deposits throughout the substrate.

  11. Comprehensive, Quantitative Risk Assessment of CO{sub 2} Geologic Sequestration

    SciTech Connect (OSTI)

    Lepinski, James


    A Quantitative Failure Modes and Effects Analysis (QFMEA) was developed to conduct comprehensive, quantitative risk assessments on CO{sub 2} capture, transportation, and sequestration or use in deep saline aquifers, enhanced oil recovery operations, or enhanced coal bed methane operations. The model identifies and characterizes potential risks; identifies the likely failure modes, causes, effects and methods of detection; lists possible risk prevention and risk mitigation steps; estimates potential damage recovery costs, mitigation costs and costs savings resulting from mitigation; and ranks (prioritizes) risks according to the probability of failure, the severity of failure, the difficulty of early failure detection and the potential for fatalities. The QFMEA model generates the necessary information needed for effective project risk management. Diverse project information can be integrated into a concise, common format that allows comprehensive, quantitative analysis, by a cross-functional team of experts, to determine: What can possibly go wrong? How much will damage recovery cost? How can it be prevented or mitigated? What is the cost savings or benefit of prevention or mitigation? Which risks should be given highest priority for resolution? The QFMEA model can be tailored to specific projects and is applicable to new projects as well as mature projects. The model can be revised and updated as new information comes available. It accepts input from multiple sources, such as literature searches, site characterization, field data, computer simulations, analogues, process influence diagrams, probability density functions, financial analysis models, cost factors, and heuristic best practices manuals, and converts the information into a standardized format in an Excel spreadsheet. Process influence diagrams, geologic models, financial models, cost factors and an insurance schedule were developed to support the QFMEA model. Comprehensive, quantitative risk assessments were conducted on three (3) sites using the QFMEA model: (1) SACROC Northern Platform CO{sub 2}-EOR Site in the Permian Basin, Scurry County, TX, (2) Pump Canyon CO{sub 2}-ECBM Site in the San Juan Basin, San Juan County, NM, and (3) Farnsworth Unit CO{sub 2}-EOR Site in the Anadarko Basin, Ochiltree County, TX. The sites were sufficiently different from each other to test the robustness of the QFMEA model.

  12. Spatially resolved quantitative mapping of thermomechanical properties and phase transition temperatures using scanning probe microscopy

    SciTech Connect (OSTI)

    Jesse, Stephen; Kalinin, Sergei V; Nikiforov, Maxim P


    An approach for the thermomechanical characterization of phase transitions in polymeric materials (polyethyleneterephthalate) by band excitation acoustic force microscopy is developed. This methodology allows the independent measurement of resonance frequency, Q factor, and oscillation amplitude of a tip-surface contact area as a function of tip temperature, from which the thermal evolution of tip-surface spring constant and mechanical dissipation can be extracted. A heating protocol maintained a constant tip-surface contact area and constant contact force, thereby allowing for reproducible measurements and quantitative extraction of material properties including temperature dependence of indentation-based elastic and loss moduli.

  13. Abstracts of papers presented at the LVIII Cold Spring Harbor Symposium on quantitative Biology: DNA and chromosomes

    SciTech Connect (OSTI)

    Not Available


    This volume contains the abstracts of oral and poster presentations made at the LVIII Cold Spring Harbor Symposium on Quantitative Biology entitles DNA & Chromosomes. The meeting was held June 2--June 9, 1993 at Cold Spring Harbor, New York.

  14. New facility design and work method for the quantitative fit testing laboratory. Master's thesis

    SciTech Connect (OSTI)

    Ward, G.F.


    The United States Air Force School of Aerospace Medicine (USAFSAM) tests the quantitative fit of masks which are worn by military personnel during nuclear, biological, and chemical warfare. Subjects are placed in a Dynatech-Frontier Fit Testing Chamber, salt air is fed into the chamber, and samples of air are drawn from the mask and the chamber. The ratio of salt air outside the mask to salt air inside the mask is called the quantitative fit factor. A motion-time study was conducted to evaluate the efficiency of the layout and work method presently used in the laboratory. A link analysis was done to determine equipment priorities, and the link data and design guidelines were used to develop three proposed laboratory designs. The proposals were evaluated by projecting the time and motion efficiency, and the energy expended working in each design. Also evaluated were the lengths of the equipment links for each proposal, and each proposal's adherence to design guidelines. A mock-up was built of the best design proposal, and a second motion-time study was run. Results showed that with the new laboratory and work procedures, the USAFSAM analyst could test 116 more subjects per year than are currently tested. Finally, the results of a questionnaire given to the analyst indicated that user acceptance of the work area improved with the new design.

  15. Quantitative Reflectance Spectra of Solid Powders as a Function of Particle Size

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Myers, Tanya L.; Brauer, Carolyn S.; Su, Yin-Fong; Blake, Thomas A.; Tonkyn, Russell G.; Ertel, Alyssa B.; Johnson, Timothy J.; Richardson, Robert L.


    We have recently developed vetted methods for obtaining quantitative infrared directional-hemispherical reflectance spectra using a commercial integrating sphere. In this paper, the effects of particle size on the spectral properties are analyzed for several samples such as ammonium sulfate, calcium carbonate, and sodium sulfate as well as one organic compound, lactose. We prepared multiple size fractions for each sample and confirmed the mean sizes using optical microscopy. Most species displayed a wide range of spectral behavior depending on the mean particle size. General trends of reflectance vs. particle size are observed such as increased albedo for smaller particles: for mostmorewavelengths, the reflectivity drops with increased size, sometimes displaying a factor of 4 or more drop in reflectivity along with a loss of spectral contrast. In the longwave infrared, several species with symmetric anions or cations exhibited reststrahlen features whose amplitude was nearly invariant with particle size, at least for intermediate- and large-sized sample fractions; that is, > ~150 microns. Trends of other types of bands (Christiansen minima, transparency features) are also investigated as well as quantitative analysis of the observed relationship between reflectance vs. particle diameter.less

  16. Surface and grain boundary scattering in nanometric Cu thin films: A quantitative analysis including twin boundaries

    SciTech Connect (OSTI)

    Barmak, Katayun [Department of Applied Physics and Applied Mathematics, Columbia University, New York, New York 10027 and Department of Materials Science and Engineering and Materials Research Science and Engineering Center, Carnegie Mellon University, 5000 Forbes Avenue, Pittsburgh, Pennsylvania 15213 (United States); Darbal, Amith [Department of Materials Science and Engineering and Materials Research Science and Engineering Center, Carnegie Mellon University, 5000 Forbes Avenue, Pittsburgh, Pennsylvania 15213 (United States); Ganesh, Kameswaran J.; Ferreira, Paulo J. [Materials Science and Engineering, The University of Texas at Austin, 1 University Station, Austin, Texas 78712 (United States); Rickman, Jeffrey M. [Department of Materials Science and Engineering and Department of Physics, Lehigh University, Bethlehem, Pennsylvania 18015 (United States); Sun, Tik; Yao, Bo; Warren, Andrew P.; Coffey, Kevin R., E-mail: [Department of Materials Science and Engineering, University of Central Florida, 4000 Central Florida Boulevard, Orlando, Florida 32816 (United States)


    The relative contributions of various defects to the measured resistivity in nanocrystalline Cu were investigated, including a quantitative account of twin-boundary scattering. It has been difficult to quantitatively assess the impact twin boundary scattering has on the classical size effect of electrical resistivity, due to limitations in characterizing twin boundaries in nanocrystalline Cu. In this study, crystal orientation maps of nanocrystalline Cu films were obtained via precession-assisted electron diffraction in the transmission electron microscope. These orientation images were used to characterize grain boundaries and to measure the average grain size of a microstructure, with and without considering twin boundaries. The results of these studies indicate that the contribution from grain-boundary scattering is the dominant factor (as compared to surface scattering) leading to enhanced resistivity. The resistivity data can be well-described by the combined FuchsSondheimer surface scattering model and MayadasShatzkes grain-boundary scattering model using Matthiessen's rule with a surface specularity coefficient of p?=?0.48 and a grain-boundary reflection coefficient of R?=?0.26.

  17. New Tool Quantitatively Maps Minority-Carrier Lifetime of Multicrystalline Silicon Bricks (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available


    NREL's new imaging tool could provide manufacturers with insight on their processes. Scientists at the National Renewable Energy Laboratory (NREL) have used capabilities within the Process Development and Integration Laboratory (PDIL) to generate quantitative minority-carrier lifetime maps of multicrystalline silicon (mc-Si) bricks. This feat has been accomplished by using the PDIL's photoluminescence (PL) imaging system in conjunction with transient lifetime measurements obtained using a custom NREL-designed resonance-coupled photoconductive decay (RCPCD) system. PL imaging can obtain rapid high-resolution images that provide a qualitative assessment of the material lifetime-with the lifetime proportional to the pixel intensity. In contrast, the RCPCD technique provides a fast quantitative measure of the lifetime with a lower resolution and penetrates millimeters into the mc-Si brick, providing information on bulk lifetimes and material quality. This technique contrasts with commercially available minority-carrier lifetime mapping systems that use microwave conductivity measurements. Such measurements are dominated by surface recombination and lack information on the material quality within the bulk of the brick. By combining these two complementary techniques, we obtain high-resolution lifetime maps at very fast data acquisition times-attributes necessary for a production-based diagnostic tool. These bulk lifetime measurements provide manufacturers with invaluable feedback on their silicon ingot casting processes. NREL has been applying the PL images of lifetime in mc-Si bricks in collaboration with a U.S. photovoltaic industry partner through Recovery Act Funded Project ARRA T24. NREL developed a new tool to quantitatively map minority-carrier lifetime of multicrystalline silicon bricks by using photoluminescence imaging in conjunction with resonance-coupled photoconductive decay measurements. Researchers are not hindered by surface recombination and can look deeper into the material to map bulk lifetimes. The tool is being applied to silicon bricks in a project collaborating with a U.S. photovoltaic industry partner. Photovoltaic manufacturers can use the NREL tool to obtain valuable feedback on their silicon ingot casting processes.

  18. Quantitative Cyber Risk Reduction Estimation Methodology for a Small Scada Control System

    SciTech Connect (OSTI)

    Miles A. McQueen; Wayne F. Boyer; Mark A. Flynn; George A. Beitel


    We propose a new methodology for obtaining a quick quantitative measurement of the risk reduction achieved when a control system is modified with the intent to improve cyber security defense against external attackers. The proposed methodology employs a directed graph called a compromise graph, where the nodes represent stages of a potential attack and the edges represent the expected time-to-compromise for differing attacker skill levels. Time-to-compromise is modeled as a function of known vulnerabilities and attacker skill level. The methodology was used to calculate risk reduction estimates for a specific SCADA system and for a specific set of control system security remedial actions. Despite an 86% reduction in the total number of vulnerabilities, the estimated time-to-compromise was increased only by about 3 to 30% depending on target and attacker skill level.

  19. Quantitative measurement of binary liquid distributions using multiple-tracer x-ray fluorescence and radiography

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Halls, Benjamin R.; Meyer, Terrence R.; Kastengren, Alan L.


    The complex geometry and large index-of-refraction gradients that occur near the point of impingement of binary liquid jets present a challenging environment for optical interrogation. A simultaneous quadruple-tracer x-ray fluorescence and line-of-sight radiography technique is proposed as a means of distinguishing and quantifying individual liquid component distributions prior to, during, and after jet impact. Two different pairs of fluorescence tracers are seeded into each liquid stream to maximize their attenuation ratio for reabsorption correction and differentiation of the two fluids during mixing. This approach for instantaneous correction of x-ray fluorescence reabsorption is compared with a more time-intensive approach of usingmorestereographic reconstruction of x-ray attenuation along multiple lines of sight. The proposed methodology addresses the need for a quantitative measurement technique capable of interrogating optically complex, near-field liquid distributions in many mixing systems of practical interest involving two or more liquid streams.less

  20. Quantitative analysis of directional spontaneous emission spectra from light sources in photonic crystals

    SciTech Connect (OSTI)

    Nikolaev, Ivan S.; Lodahl, Peter; Vos, Willem L.


    We have performed angle-resolved measurements of spontaneous-emission spectra from laser dyes and quantum dots in opal and inverse opal photonic crystals. Pronounced directional dependencies of the emission spectra are observed: angular ranges of strongly reduced emission adjoin with angular ranges of enhanced emission. It appears that emission from embedded light sources is affected both by the periodicity and by the structural imperfections of the crystals: the photons are Bragg diffracted by lattice planes and scattered by unavoidable structural disorder. Using a model comprising diffuse light transport and photonic band structure, we quantitatively explain the directional emission spectra. This work provides detailed understanding of the transport of spontaneously emitted light in real photonic crystals, which is essential in the interpretation of quantum optics in photonic-band-gap crystals and for applications wherein directional emission and total emission power are controlled.

  1. Quantitative multiplex detection of biomarkers on a waveguide-based biosensor using quantum dots

    SciTech Connect (OSTI)

    Xie, Hongzhi; Mukundan, Harshini; Martinez, Jennifer S; Swanson, Basil I; Anderson, Aaron S; Grace, Kevin


    The quantitative, simultaneous detection of multiple biomarkers with high sensitivity and specificity is critical for biomedical diagnostics, drug discovery and biomarker characterization [Wilson 2006, Tok 2006, Straub 2005, Joos 2002, Jani 2000]. Detection systems relying on optical signal transduction are, in general, advantageous because they are fast, portable, inexpensive, sensitive, and have the potential for multiplex detection of analytes of interest. However, conventional immunoassays for the detection of biomarkers, such as the Enzyme Linked Immunosorbant Assays (ELISAs) are semi-quantitative, time consuming and insensitive. ELISA assays are also limited by high non-specific binding, especially when used with complex biological samples such as serum and urine (REF). Organic fluorophores that are commonly used in such applications lack photostability and possess a narrow Stoke's shift that makes simultaneous detection of multiple fluorophores with a single excitation source difficult, thereby restricting their use in multiplex assays. The above limitations with traditional assay platforms have resulted in the increased use of nanotechnology-based tools and techniques in the fields of medical imaging [ref], targeted drug delivery [Caruthers 2007, Liu 2007], and sensing [ref]. One such area of increasing interest is the use of semiconductor quantum dots (QDs) for biomedical research and diagnostics [Gao and Cui 2004, Voura 2004, Michalet 2005, Chan 2002, Jaiswal 2004, Gao 2005, Medintz 2005, So 2006 2006, Wu 2003]. Compared to organic dyes, QDs provide several advantages for use in immunoassay platforms, including broad absorption bands with high extinction coefficients, narrow and symmetric emission bands with high quantum yields, high photostablility, and a large Stokes shift [Michalet 2005, Gu 2002]. These features prompted the use of QDs as probes in biodetection [Michalet 2005, Medintz 2005]. For example, Jaiswal et al. reported long term multiple color imaging of live cells using QD-bioconjugates [Jaiswal 2003]. Gao [Gao 2004] and So [So 2006] have used QDs as probes for in-vivo cancer targeting and imaging. Medintz et al. reported self-assembled QD-based biosensors for detection of analytes based on energy transfer [Medintz 2003]. Others have developed an approach for multiplex optical encoding of biomolecules using QDs [Han 2001]. Immunoassays have also benefited from the advantages of QDs. Recently, dihydrolipoic acid (DHLA) capped-QDs have been attached to antibodies and used as fluorescence reporters in plate-based multiplex immunoassays [Goodman 2004]. However, DHLA-QDs are associated with low quantum efficiency and are unstable at neutral pH. These problems limit the application of this technology to the sensitive detection of biomolecules, especially in complex biological samples. Thus, the development of a rapid, sensitive, quantitative, and specific multiplex platform for the detection of biomarkers in difficult samples remains an elusive target. The goal stated above has applications in many fields including medical diagnostics, biological research, and threat reduction. The current decade alone has seen the development of a need to rapidly and accurately detect potential biological warfare agents. For example, current methods for the detection of anthrax are grossly inadequate for a variety of reasons including long incubation time (5 days from time of exposure to onset of symptoms) and non-specific ('flu-like') symptoms. When five employees of the United State Senate were exposed to B. anthracis in the mail (2001), only one patient had a confirmed diagnosis before death. Since then, sandwich immunoassays using both colorimetric and fluorescence detectors have been developed for key components of the anthrax lethal toxin, namely protective antigen (PA), lethal factor (LF), and the edema factor [Mourez 2001]. While these platforms were successful in assays against anthrax toxins, the sensitivity was poor. Furthermore, no single platform exists for the simultaneous and quantitative detection of mul

  2. Shotgun Approach for Quantitative Imaging of Phospholipids Using Nanospray Desorption Electrospray Ionization Mass Spectrometry

    SciTech Connect (OSTI)

    Lanekoff, Ingela T.; Thomas, Mathew; Laskin, Julia


    Mass spectrometry imaging (MSI) has been extensively used for determining spatial distributions of molecules in biological samples, and there is increasing interest in using MSI for quantification. Nanospray desorption electrospray ionization, or nano-DESI, is an ambient MSI technique where a solvent is used for localized extraction of molecules followed by nanoelectrospray ionization. Doping the nano-DESI solvent with carefully selected standards enables online quantification during MSI experiments. In this proof-of-principle study, we demonstrate this quantification approach can be extended to provide shotgun-like quantification of phospholipids in thin brain tissue sections. Specifically, two phosphatidylcholine (PC) standards were added to the nano-DESI solvent for simultaneous imaging and quantification of 22 PC species observed in nano-DESI MSI. Furthermore, by combining the quantitative data obtained in the individual pixels, we demonstrate quantification of these PC species in seven different regions of a rat brain tissue section.

  3. DanteR: an extensible R-based tool for quantitative analysis of -omics data

    SciTech Connect (OSTI)

    Taverner, Thomas; Karpievitch, Yuliya; Polpitiya, Ashoka D.; Brown, Joseph N.; Dabney, Alan R.; Anderson, Gordon A.; Smith, Richard D.


    Motivation: The size and complex nature of LC-MS proteomics data sets motivates development of specialized software for statistical data analysis and exploration. We present DanteR, a graphical R package that features extensive statistical and diagnostic functions for quantitative proteomics data analysis, including normalization, imputation, hypothesis testing, interactive visualization and peptide-to-protein rollup. More importantly, users can easily extend the existing functionality by including their own algorithms under the Add-On tab. Availability: DanteR and its associated user guide are available for download at For Windows, a single click automatically installs DanteR along with the R programming environment. For Linux and Mac OS X, users must first install R and then follow instructions on the DanteR web site for package installation.

  4. ANSI/ASHRAE/IES Standard 90.1-2013 Determination of Energy Savings: Quantitative Analysis

    SciTech Connect (OSTI)

    Halverson, Mark A.; Athalye, Rahul A.; Rosenberg, Michael I.; Xie, YuLong; Wang, Weimin; Hart, Philip R.; Zhang, Jian; Goel, Supriya; Mendon, Vrushali V.


    This report provides a final quantitative analysis to assess whether buildings constructed according to the requirements of ANSI/ASHRAE/IES Standard 90.1-2013 would result in improved energy efficiency in commercial buildings. The final analysis considered each of the 110 addenda to Standard 90.1-2010 that were included in Standard 90.1-2013. PNNL reviewed all addenda included by ASHRAE in creating Standard 90.1-2013 from Standard 90.1-2010, and considered their combined impact on a suite of prototype building models across all U.S. climate zones. Most addenda were deemed to have little quantifiable impact on building efficiency for the purpose of DOE’s final determination. However, out of the 110 total addenda, 30 were identified as having a measureable and quantifiable impact.

  5. Quantitative assessment of electrostatic embedding in Density Functional Theory calculations of biomolecular systems

    SciTech Connect (OSTI)

    Fattebert, J; Law, R J; Bennion, B; Lau, E Y; Schwegler, E; Lightstone, F C


    We evaluate the accuracy of density functional theory quantum calculations of biomolecular subsystems using a simple electrostatic embedding scheme. Our scheme is based on dividing the system of interest into a primary and secondary subsystem. A finite difference discretization of the Kohn-Sham equations is used for the primary subsystem, while its electrostatic environment is modeled with a simple one-electron potential. Force-field atomic partial charges are used to generate smeared Gaussian charge densities and to model the secondary subsystem. We illustrate the utility of this approach with calculations of truncated dipeptide chains. We analyze quantitatively the accuracy of this approach by calculating atomic forces and comparing results with fullQMcalculations. The impact of the choice made in terminating dangling bonds at the frontier of the QM region is also investigated.

  6. Quantitative degenerate four-wave mixing spectroscopy: Probes for molecular species

    SciTech Connect (OSTI)

    Farrow, R.; Rakestraw, D.; Paul, P.; Lucht, R.; Danehy, P.; Friedman-Hill, E.; Germann, G.


    Resonant degenerate four-wave mixing (DFWM) is currently the subject of intensive investigation as a sensitive diagnostic tool for molecular species. DFWM has the advantage of generating a coherent (beam-like) signal which results in null-background detection and provides excellent immunity to background-light interference. Since multiple one-photon resonances are involved in the signal generation process, the DFWM technique can allow sensitive detection of molecules via electronic, vibrational or rotational transitions. These properties combine to make DFWM a widely applicable diagnostic technique for the probing of molecular species. The authors are conducting fundamental and applied investigations of DFWM for quantitative measurements of trace species in reacting gases. During the past year, efforts have been focussed in two areas: (1) understanding the effects of collisional processes on the DFWM signal generation process, and (2) exploring the applicability of infrared DFWM to detect polyatomic molecules via rovibrational transitions.

  7. Quantitative measurement of binary liquid distributions using multiple-tracer x-ray fluorescence and radiography

    SciTech Connect (OSTI)

    Halls, Benjamin R.; Meyer, Terrence R.; Kastengren, Alan L.


    The complex geometry and large index-of-refraction gradients that occur near the point of impingement of binary liquid jets present a challenging environment for optical interrogation. A simultaneous quadruple-tracer x-ray fluorescence and line-of-sight radiography technique is proposed as a means of distinguishing and quantifying individual liquid component distributions prior to, during, and after jet impact. Two different pairs of fluorescence tracers are seeded into each liquid stream to maximize their attenuation ratio for reabsorption correction and differentiation of the two fluids during mixing. This approach for instantaneous correction of x-ray fluorescence reabsorption is compared with a more time-intensive approach of using stereographic reconstruction of x-ray attenuation along multiple lines of sight. The proposed methodology addresses the need for a quantitative measurement technique capable of interrogating optically complex, near-field liquid distributions in many mixing systems of practical interest involving two or more liquid streams.

  8. Quantitative PCR Analysis of Molds in the Dust from Homes of Asthmatic Children in North Carolina

    SciTech Connect (OSTI)

    Vesper, Stephen J.; McKinstry, Craig A.; Ashley, Peter; Haugland, Richard A.; Yeatts, Karin; Bradham, Karen; Svendsen, Eric


    The vacuum cleaner bag (VCB) dust from the homes of 19 asthmatic children in North Carolina (NC) was analyzed by mold specific quantitative PCR. These results were compared to the analysis of the VCB dust from 157 homes in the HUD American Healthy Home Survey of homes in the US. The American Relative Moldiness Index (ARMI) was calculated for each of the homes. The mean and standard deviation (SD) of the ARMI values in the homes of the NC asthmatic children was 11.0 (5.3), compared to the HUD survey VCB ARMI value mean and SD of 6.6 (4.4). The median ARMI value was significantly higher(p < 0.001) in the asthmatic childrenss homes. The molds Chaetomium globosum and Eurotium amsterdameli were the primary species in the NC homes making the ARMI values higher. Vacuum cleaner bag dust samples may be a less expensive but still useful method of home mold analysis.

  9. Quantitative comparison of the in situ microbial communities in different biomes

    SciTech Connect (OSTI)

    White, D.C. |; Ringelberg, D.B.; Palmer, R.J.


    A system to define microbial communities in different biomes requires the application of non-traditional methodology. Classical microbiological methods have severe limitations for the analysis of environmental samples. Pure-culture isolation, biochemical testing, and/or enumeration by direct microscopic counting are not well suited for the estimation of total biomass or the assessment of community composition within environmental samples. Such methods provide little insight into the in situ phenotypic activity of the extant microbiota since these techniques are dependent on microbial growth and thus select against many environmental microorganisms which are non- culturable under a wide range of conditions. It has been repeatedly documented in the literature that viable counts or direct counts of bacteria attached to sediment grains are difficult to quantitative and may grossly underestimate the extent of the existing community. The traditional tests provide little indication of the in situ nutritional status or for evidence of toxicity within the microbial community. A more recent development (MIDI Microbial Identification System), measure free and ester-linked fatty acids from isolated microorganisms. Bacterial isolates are identified by comparing their fatty acid profiles to the MIKI database which contains over 8000 entries. The application of the MIKI system to the analysis of environmental samples however, has significant drawbacks. The MIDI system was developed to identify clinical microorganisms and requires their isolation and culture on trypticase soy agar at 27{degrees}C. Since many isolates are unable to grow at these restrictive growth conditions, the system does not lend itself to identification of some environmental organisms. A more applicable methodology for environmental microbial analysis is based on the liquid extrication and separation of microbial lipids from environmental samples, followed by quantitative analysis using gas chromatography/

  10. Quantitative Proteomic Profiling of Low Dose Ionizing Radiation Effects in a Human Skin Model

    SciTech Connect (OSTI)

    Hengel, Shawna; Aldrich, Joshua T.; Waters, Katrina M.; Pasa-Tolic, Ljiljana; Stenoien, David L.


    To assess molecular responses to low doses of radiation that may be encountered during medical diagnostic procedures, nuclear accidents, or terrorist acts, a quantitative global proteomic approach was used to identify protein alterations in a reconstituted human skin tissue treated with 10 cGy of ionizing radiation. Subcellular fractionation was employed to remove highly abundant structural proteins and provide insight on radiation induced alterations in protein abundance and localization. In addition, peptides were post-fractionated using high resolution 2-dimensional liquid chromatography to increase the dynamic range of detection of protein abundance and translocation changes. Quantitative data was obtained by labeling peptides with 8-plex isobaric iTRAQ tags. A total of 207 proteins were detected with statistically significant alterations in abundance and/or subcellular localization compared to sham irradiated tissues. Bioinformatics analysis of the data indicated that the top canonical pathways affected by low dose radiation are related to cellular metabolism. Among the proteins showing alterations in abundance, localization and proteolytic processing was the skin barrier protein filaggrin which is consistent with our previous observation that ionizing radiation alters profilaggrin processing with potential effects on skin barrier functions. In addition, a large number of proteases and protease regulators were affected by low dose radiation exposure indicating that altered proteolytic activity may be a hallmark of low dose radiation exposure. While several studies have demonstrated altered transcriptional regulation occurs following low dose radiation exposures, the data presented here indicates post-transcriptional regulation of protein abundance, localization, and proteolytic processing play an important role in regulating radiation responses in complex human tissues.

  11. Use of Quantitative Uncertainty Analysis to Support M&VDecisions in ESPCs

    SciTech Connect (OSTI)

    Mathew, Paul A.; Koehling, Erick; Kumar, Satish


    Measurement and Verification (M&V) is a critical elementof an Energy Savings Performance Contract (ESPC) - without M&V, thereisno way to confirm that the projected savings in an ESPC are in factbeing realized. For any given energy conservation measure in an ESPC,there are usually several M&V choices, which will vary in terms ofmeasurement uncertainty, cost, and technical feasibility. Typically,M&V decisions are made almost solely based on engineering judgmentand experience, with little, if any, quantitative uncertainty analysis(QUA). This paper describes the results of a pilot project initiated bythe Department of Energy s Federal Energy Management Program to explorethe use of Monte-Carlo simulation to assess savings uncertainty andthereby augment the M&V decision-making process in ESPCs. The intentwas to use QUA selectively in combination with heuristic knowledge, inorder to obtain quantitative estimates of the savings uncertainty withoutthe burden of a comprehensive "bottoms-up" QUA. This approach was used toanalyze the savings uncertainty in an ESPC for a large federal agency.The QUA was seamlessly integrated into the ESPC development process andthe incremental effort was relatively small with user-friendly tools thatare commercially available. As the case study illustrates, in some casesthe QUA simply confirms intuitive or qualitative information, while inother cases, it provides insight that suggests revisiting the M&Vplan. The case study also showed that M&V decisions should beinformed by the portfolio risk diversification. By providing quantitativeuncertainty information, QUA can effectively augment the M&Vdecision-making process as well as the overall ESPC financialanalysis.

  12. Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples. [Patent application

    DOE Patents [OSTI]

    Caldwell, J.T.; Kunz, W.E.; Cates, M.R.; Franks, L.A.


    Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fission are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for /sup 239/Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

  13. Formation resistivity measurements from within a cased well used to quantitatively determine the amount of oil and gas present

    DOE Patents [OSTI]

    Vail, III, William B.


    Methods to quantitatively determine the separate amounts of oil and gas in a geological formation adjacent to a cased well using measurements of formation resistivity are disclosed. The steps include obtaining resistivity measurements from within a cased well of a given formation, obtaining the porosity, obtaining the resistivity of formation water present, computing the combined amounts of oil and gas present using Archie's Equations, determining the relative amounts of oil and gas present from measurements within a cased well, and then quantitatively determining the separate amounts of oil and gas present in the formation.

  14. Formation resistivity measurements from within a cased well used to quantitatively determine the amount of oil and gas present

    DOE Patents [OSTI]

    Vail, W.B. III


    Methods to quantitatively determine the separate amounts of oil and gas in a geological formation adjacent to a cased well using measurements of formation resistivity are disclosed. The steps include obtaining resistivity measurements from within a cased well of a given formation, obtaining the porosity, obtaining the resistivity of formation water present, computing the combined amounts of oil and gas present using Archie`s Equations, determining the relative amounts of oil and gas present from measurements within a cased well, and then quantitatively determining the separate amounts of oil and gas present in the formation. 7 figs.

  15. TU-C-12A-02: Development of a Multiparametric Statistical Response Map for Quantitative Imaging

    SciTech Connect (OSTI)

    Bosca, R; Mahajan, A; Brown, PD; Stafford, RJ; Johnson, VE; Dong, L; Jackson, EF


    Purpose: Quantitative imaging biomarkers (QIB) are becoming increasingly utilized in early phase clinical trials as a means of non-invasively assessing treatment response and associated response heterogeneity. The aim of this study was to develop a flexible multiparametric statistical framework to predict voxel-by-voxel response of several potential MRI QIBs. Methods: Patients with histologically proven glioblastomas (n=11) were treated with chemoradiation (with/without bevacizumab) and underwent one baseline and two mid-treatment (3–4wks) MRIs. Dynamic contrast-enhanced (3D FSPGR, 6.3sec/phase, 0.1 mmol/kg Gd-DTPA), dynamic susceptibility contrast (2D GRE-EPI, 1.5sec/phase, 0.2mmol/kg Gd-DTPA), and diffusion tensor (2D DW-EPI, b=0, 1200 s/mm{sup 2}, 27 directions) imaging acquisitions were obtained during each study. Mid-treatment and pre-treatment images were rigidly aligned, and regions of partial response (PR), stable disease (SD), and progressive disease (PD) were contoured in consensus by two experienced radiation oncologists. Voxels in these categories were used to train ordinal (PRquantitative imaging data and, for these particular data, can potentially distinguish PR from PD. Additional training data exhibiting a full range of treatment responses is expected to allow prediction of all three treatment outcomes. Moreover, these models are extensible to multi-modality, multiparametric analyses.

  16. Quantitative comparison of noise texture across CT scanners from different manufacturers

    SciTech Connect (OSTI)

    Solomon, Justin B.; Christianson, Olav; Samei, Ehsan


    Purpose: To quantitatively compare noise texture across computed tomography (CT) scanners from different manufacturers using the noise power spectrum (NPS). Methods: The American College of Radiology CT accreditation phantom (Gammex 464, Gammex, Inc., Middleton, WI) was imaged on two scanners: Discovery CT 750HD (GE Healthcare, Waukesha, WI), and SOMATOM Definition Flash (Siemens Healthcare, Germany), using a consistent acquisition protocol (120 kVp, 0.625/0.6 mm slice thickness, 250 mAs, and 22 cm field of view). Images were reconstructed using filtered backprojection and a wide selection of reconstruction kernels. For each image set, the 2D NPS were estimated from the uniform section of the phantom. The 2D spectra were normalized by their integral value, radially averaged, and filtered by the human visual response function. A systematic kernel-by-kernel comparison across manufacturers was performed by computing the root mean square difference (RMSD) and the peak frequency difference (PFD) between the NPS from different kernels. GE and Siemens kernels were compared and kernel pairs that minimized the RMSD and |PFD| were identified. Results: The RMSD (|PFD|) values between the NPS of GE and Siemens kernels varied from 0.01 mm{sup 2} (0.002 mm{sup -1}) to 0.29 mm{sup 2} (0.74 mm{sup -1}). The GE kernels 'Soft,''Standard,''Chest,' and 'Lung' closely matched the Siemens kernels 'B35f,''B43f,''B41f,' and 'B80f' (RMSD < 0.05 mm{sup 2}, |PFD| < 0.02 mm{sup -1}, respectively). The GE 'Bone,''Bone+,' and 'Edge' kernels all matched most closely with Siemens 'B75f' kernel but with sizeable RMSD and |PFD| values up to 0.18 mm{sup 2} and 0.41 mm{sup -1}, respectively. These sizeable RMSD and |PFD| values corresponded to visually perceivable differences in the noise texture of the images. Conclusions: It is possible to use the NPS to quantitatively compare noise texture across CT systems. The degree to which similar texture across scanners could be achieved varies and is limited by the kernels available on each scanner.

  17. Multiple-wavelength spectroscopic quantitation of light-absorbing species in scattering media

    DOE Patents [OSTI]

    Nathel, Howard; Cartland, Harry E.; Colston, Jr., Billy W.; Everett, Matthew J.; Roe, Jeffery N.


    An oxygen concentration measurement system for blood hemoglobin comprises a multiple-wavelength low-coherence optical light source that is coupled by single mode fibers through a splitter and combiner and focused on both a target tissue sample and a reference mirror. Reflections from both the reference mirror and from the depths of the target tissue sample are carried back and mixed to produce interference fringes in the splitter and combiner. The reference mirror is set such that the distance traversed in the reference path is the same as the distance traversed into and back from the target tissue sample at some depth in the sample that will provide light attenuation information that is dependent on the oxygen in blood hemoglobin in the target tissue sample. Two wavelengths of light are used to obtain concentrations. The method can be used to measure total hemoglobin concentration [Hb.sub.deoxy +Hb.sub.oxy ] or total blood volume in tissue and in conjunction with oxygen saturation measurements from pulse oximetry can be used to absolutely quantify oxyhemoglobin [HbO.sub.2 ] in tissue. The apparatus and method provide a general means for absolute quantitation of an absorber dispersed in a highly scattering medium.

  18. Quantitative law describing market dynamics before and after interest-rate change

    SciTech Connect (OSTI)

    Petersen, Alexander M.; Wang Fengzhong; Stanley, H. Eugene; Havlin, Shlomo


    We study the behavior of U.S. markets both before and after U.S. Federal Open Market Commission meetings and show that the announcement of a U.S. Federal Reserve rate change causes a financial shock, where the dynamics after the announcement is described by an analog of the Omori earthquake law. We quantify the rate n(t) of aftershocks following an interest-rate change at time T and find power-law decay which scales as n(t-T)approx(t-T){sup -O}MEGA, with OMEGA positive. Surprisingly, we find that the same law describes the rate n{sup '}(|t-T|) of 'preshocks' before the interest-rate change at time T. This study quantitatively relates the size of the market response to the news which caused the shock and uncovers the presence of quantifiable preshocks. We demonstrate that the news associated with interest-rate change is responsible for causing both the anticipation before the announcement and the surprise after the announcement. We estimate the magnitude of financial news using the relative difference between the U.S. Treasury Bill and the Federal Funds effective rate. Our results are consistent with the 'sign effect', in which 'bad news' has a larger impact than 'good news'. Furthermore, we observe significant volatility aftershocks, confirming a 'market under-reaction' that lasts at least one trading day.

  19. Quantitative infrared absorption cross-sections of isoprene for atmospheric measurements

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Brauer, C. S.; Blake, T. A.; Guenther, A. B.; Sams, R. L.; Johnson, T. J.


    Isoprene (C5H8, 2-methyl-1,3-butadiene) is a volatile organic compound (VOC) that is one of the primary contributors to annual global VOC emissions. Produced by vegetation as well as anthropogenic sources, the OH- and O3-initiated oxidations of isoprene are a major source of atmospheric oxygenated organics. Few quantitative infrared studies have been reported for isoprene, however, limiting the ability to quantify isoprene emissions via stand-off infrared or in situ detection. We thus report absorption coefficients and integrated band intensities for isoprene in the 600–6500 cm−1 region. The pressure-broadened (1 atmosphere N2) spectra were recorded at 278, 298 and 323 K in amore » 19.94 cm path length cell at 0.112 cm−1 resolution, using a Bruker 66v FTIR. Composite spectra are derived from a minimum of seven isoprene sample pressures at each temperature and the number densities are normalized to 296 K and 1 atmosphere.« less

  20. A method for rapid quantitative assessment of biofilms with biomolecular staining and image analysis

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Larimer, Curtis J.; Winder, Eric M.; Jeters, Robert T.; Prowant, Matthew S.; Nettleship, Ian; Addleman, Raymond S.; Bonheyo, George T.


    Here, the accumulation of bacteria in surface attached biofilms, or biofouling, can be detrimental to human health, dental hygiene, and many industrial processes. A critical need in identifying and preventing the deleterious effects of biofilms is the ability to observe and quantify their development. Analytical methods capable of assessing early stage fouling are cumbersome or lab-confined, subjective, and qualitative. Herein, a novel photographic method is described that uses biomolecular staining and image analysis to enhance contrast of early stage biofouling. A robust algorithm was developed to objectively and quantitatively measure surface accumulation of Pseudomonas putida from photographs and results weremore » compared to independent measurements of cell density. Results from image analysis quantified biofilm growth intensity accurately and with approximately the same precision of the more laborious cell counting method. This simple method for early stage biofilm detection enables quantifiable measurement of surface fouling and is flexible enough to be applied from the laboratory to the field. Broad spectrum staining highlights fouling biomass, photography quickly captures a large area of interest, and image analysis rapidly quantifies fouling in the image.« less

  1. Quantitative IR Spectrum and Vibrational Assignments for Glycolaldehyde Vapor: Glycolaldehyde Measurements in Biomass Burning Plumes

    SciTech Connect (OSTI)

    Johnson, Timothy J.; Sams, Robert L.; Profeta, Luisa T.; Akagi, Sheryl; Burling, Ian R.; Yokelson, Robert J.; Williams, Stephen D.


    Glycolaldehyde (GA, 2-hydroxyethanal, C2H4O2) is a semi-volatile molecule of atmospheric importance, recently proposed as a precursor in the formation of aqueous-phase secondary organic aerosol (SOA). There are few methods to measure glycolaldehyde vapor, but infrared spectroscopy has been used successfully. Using vetted protocols we have completed the first assignment of all fundamental vibrational modes and derived quantitative IR absorption band strengths using both neat and pressure-broadened GA vapor. Even though GA is problematic due to its propensity to both dimerize and condense, our intensities agree well with the few previously published values. Using the reference ?10 band Q-branch at 860.51 cm-1, we have also determined GA mixing ratios in biomass burning plumes generated by field and laboratory burns of fuels from the southeastern and southwestern United States, including the first field measurements of glycolaldehyde in smoke. The GA emission factors were anti-correlated with modified combustion efficiency confirming release of GA from smoldering combustion. The GA emission factors (g of GA emitted per kg dry biomass burned on a dry mass basis) had a low dependence on fuel type consistent with the production mechanism being pyrolysis of cellulose. GA was emitted at 0.23 0.13% of CO from field fires and we calculate that it accounts for ~18% of the aqueous-phase SOA precursors that we were able to measure.

  2. Nucleophosmin in the pathogenesis of arsenic-related bladder carcinogenesis revealed by quantitative proteomics

    SciTech Connect (OSTI)

    Chen Shuhui [Department of Chemistry, College of Sciences, National Cheng Kung University, Tainan 701, Taiwan (China); Wang Yiwen [Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Hsu Jueliang [Department of Chemistry, College of Sciences, National Cheng Kung University, Tainan 701, Taiwan (China); Chang Hongyi [Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Wang Chiyun [Graduate Institute of Molecular Medicine, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Shen Potsun [Department of Chemistry, College of Sciences, National Cheng Kung University, Tainan 701, Taiwan (China); Chiang Chiwu [Graduate Institute of Molecular Medicine, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Chuang Jingjing [Department of Microbiology and Immunology, National Chiayi University, Chiayi 600, Taiwan (China); Tsai Hungwen [Department of Pathology, National Cheng Kung University Hospital, Tainan 704, Taiwan (China); Gu Powen [Department of Clinical Pathology, Chang Gung Memorial Hospital, Tao-Yuan 333, Taiwan (China); Chang Fangchih [Instrument Center, National Cheng Kung University, Tainan 701, Taiwan (China); Liu Hsiaosheng, E-mail: [Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Chow Nanhaw, E-mail: [Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Graduate Institute of Molecular Medicine, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Department of Pathology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China)


    To investigate the molecular mechanisms of arsenic (As)-associated carcinogenesis, we performed proteomic analysis on E7 immortalized human uroepithelial cells after treatment with As in vitro. Quantitative proteomics was performed using stable isotope dimethyl labeling coupled with two-dimensional liquid chromatography peptide separation and mass spectrometry (MS)/MS analysis. Among 285 proteins, a total of 26 proteins were upregulated (ratio > 2.0) and 18 proteins were downregulated (ratio < 0.65) by As treatment, which are related to nucleotide binding, lipid metabolism, protein folding, protein biosynthesis, transcription, DNA repair, cell cycle control, and signal transduction. This study reports the potential significance of nucleophosmin (NPM) in the As-related bladder carcinogenesis. NPM was universally expressed in all of uroepithelial cell lines examined, implying that NPM may play a role in human bladder carcinogenesis. Upregulation of NPM tends to be dose- and time-dependent after As treatment. Expression of NPM was associated with cell proliferation, migration and anti-apoptosis. On the contrary, soy isoflavones inhibited the expression of NPM in vitro. The results suggest that NPM may play a role in the As-related bladder carcinogenesis, and soybean-based foods may have potential in the suppression of As/NPM-related tumorigenesis.

  3. Assessing the toxic effects of ethylene glycol ethers using Quantitative Structure Toxicity Relationship models

    SciTech Connect (OSTI)

    Ruiz, Patricia; Mumtaz, Moiz; Gombar, Vijay


    Experimental determination of toxicity profiles consumes a great deal of time, money, and other resources. Consequently, businesses, societies, and regulators strive for reliable alternatives such as Quantitative Structure Toxicity Relationship (QSTR) models to fill gaps in toxicity profiles of compounds of concern to human health. The use of glycol ethers and their health effects have recently attracted the attention of international organizations such as the World Health Organization (WHO). The board members of Concise International Chemical Assessment Documents (CICAD) recently identified inadequate testing as well as gaps in toxicity profiles of ethylene glycol mono-n-alkyl ethers (EGEs). The CICAD board requested the ATSDR Computational Toxicology and Methods Development Laboratory to conduct QSTR assessments of certain specific toxicity endpoints for these chemicals. In order to evaluate the potential health effects of EGEs, CICAD proposed a critical QSTR analysis of the mutagenicity, carcinogenicity, and developmental effects of EGEs and other selected chemicals. We report here results of the application of QSTRs to assess rodent carcinogenicity, mutagenicity, and developmental toxicity of four EGEs: 2-methoxyethanol, 2-ethoxyethanol, 2-propoxyethanol, and 2-butoxyethanol and their metabolites. Neither mutagenicity nor carcinogenicity is indicated for the parent compounds, but these compounds are predicted to be developmental toxicants. The predicted toxicity effects were subjected to reverse QSTR (rQSTR) analysis to identify structural attributes that may be the main drivers of the developmental toxicity potential of these compounds.

  4. Highly Quantitative Electrochemical Characterization of Non-Aqueous Electrolytes & Solid Electrolyte Interphases

    SciTech Connect (OSTI)

    Sergiy V. Sazhin; Kevin L. Gering; Mason K. Harrup; Harry W. Rollins


    The methods to measure solid electrolyte interphase (SEI) electrochemical properties and SEI formation capability of non-aqueous electrolyte solutions are not adequately addressed in the literature. And yet, there is a strong demand in new electrolyte generations that promote stabilized SEIs and have an influence to resolve safety, calendar life and other limitations of Li-ion batteries. To fill this gap, in situ electrochemical approach with new descriptive criteria for highly quantitative characterization of SEI and electrolytes is proposed. These criteria are: SEI formation capacity, SEI corrosion rate, SEI maintenance rate, and SEI kinetic stability. These criteria are associated with battery parameters like irreversible capacity, self-discharge, shelf-life, power, etc. Therefore, they are especially useful for electrolyte development and standard fast screening, allowing a skillful approach to narrow down the search for the best electrolyte. The characterization protocol also allows retrieving information on interfacial resistance for SEI layers and the electrochemical window of electrolytes, the other important metrics of characterization. The method validation was done on electrolyte blends containing phosphazenes, developed at Idaho National Laboratory, as 1.2M LiPF6 [80 % EC-MEC (2:8) (v/v) + 20% Phosphazene variety] (v/v), which were targeted for safer electrolyte variations.

  5. Quantitative studies of human cardiac metabolism by /sup 31/P rotating-frame NMR

    SciTech Connect (OSTI)

    Blackledge, M.J.; Rajagopalan, B.; Oberhaensli, R.D.; Bolas, N.M.; Styles, P.; Radda, G.K.


    The authors have developed /sup 31/P NMR spectroscopic methods to determine quantitatively relative levels of phosphorus-containing metabolites in the human myocardium. They have used localization techniques based on the rotating-frame imaging experiment and carried out the double-surface coil probe. Information is obtained from selected slices by rotating-frame depth selection and from a complete one-dimensional spectroscopic image using phase-modulated rotating-frame imaging. The methods collect biochemical information from metabolites in human heart, and they use the fact that the phosphocreatine/ATP molar ratio in skeletal muscle at rest is higher than that in working heart to demonstrate that localization ha been achieved for each investigation. The phosphocreatine/ATP molar ratio in normal human heart has been measured as 1.55 +/- 0.20 in six subjects using dept selection and as 1.53 +/- 0.25 in four subjects using spectroscopic imaging. Measurement of this ratio is expected to give a useful and reproducible index of myocardial energetics in normal and pathological states.

  6. ANSI/ASHRAE/IESNA Standard 90.1-2010 Preliminary Determination Quantitative Analysis

    SciTech Connect (OSTI)

    Halverson, Mark A.; Liu, Bing; Rosenberg, Michael I.


    The United States (U.S.) Department of Energy (DOE) conducted a preliminary quantitative analysis to assess whether buildings constructed according to the requirements of the American National Standards Institute (ANSI)/American Society of Heating, Refrigerating and Air-Conditioning Engineers (ASHRAE)/Illuminating Engineering Society of North America (IESNA) Standard 90.1-2010 (ASHRAE Standard 90.1-2010, Standard 90.1-2010, or 2010 edition) would result in energy savings compared with buildings constructed to ANSI/ASHRAE/IESNA Standard 90.1-2007(ASHRAE Standard 90.1-2007, Standard 90.1-2007, or 2007 edition). The preliminary analysis considered each of the 109 addenda to ASHRAE Standard 90.1-2007 that were included in ASHRAE Standard 90.1-2010. All 109 addenda processed by ASHRAE in the creation of Standard 90.1-2010 from Standard 90.1-2007 were reviewed by DOE, and their combined impact on a suite of 16 building prototype models in 15 ASHRAE climate zones was considered. Most addenda were deemed to have little quantifiable impact on building efficiency for the purpose of DOEs preliminary determination. However, out of the 109 addenda, 34 were preliminarily determined to have measureable and quantifiable impact.

  7. ANSI/ASHRAE/IESNA Standard 90.1-2007 Final Determination Quantitative Analysis

    SciTech Connect (OSTI)

    Halverson, Mark A.; Liu, Bing; Richman, Eric E.; Winiarski, David W.


    The United States (U.S.) Department of Energy (DOE) conducted a final quantitative analysis to assess whether buildings constructed according to the requirements of the American National Standards Institute (ANSI)/American Society of Heating, Refrigerating and Air-Conditioning Engineers (ASHRAE)/Illuminating Engineering Society of North America (IESNA) Standard 90.1-2007 would result in energy savings compared with buildings constructed to ANSI/ASHRAE/IESNA Standard 90.1-2004. The final analysis considered each of the 44 addenda to ANSI/ASHRAE/IESNA Standard 90.1-2004 that were included in ANSI/ASHRAE/IESNA Standard 90.1-2007. All 44 addenda processed by ASHRAE in the creation of Standard 90.1-2007 from Standard 90.1-2004 were reviewed by DOE, and their combined impact on a suite of 15 building prototype models in 15 ASHRAE climate zones was considered. Most addenda were deemed to have little quantifiable impact on building efficiency for the purpose of DOEs final determination. However, out of the 44 addenda, 9 were preliminarily determined to have measureable and quantifiable impact.

  8. Delineating Rearrangements in Single Yeast Artificial Chromosomes by Quantitative DNA Fiber Mapping

    SciTech Connect (OSTI)

    Weier, Heinz-Ulrich G.; Greulich-Bode, Karin M.; Wu, Jenny; Duell, Thomas


    Cloning of large chunks of human genomic DNA in recombinant systems such as yeast or bacterial artificial chromosomes has greatly facilitated the construction of physical maps, the positional cloning of disease genes or the preparation of patient-specific DNA probes for diagnostic purposes. For this process to work efficiently, the DNA cloning process and subsequent clone propagation need to maintain stable inserts that are neither deleted nor otherwise rearranged. Some regions of the human genome; however, appear to have a higher propensity than others to rearrange in any host system. Thus, techniques to detect and accurately characterize such rearrangements need to be developed. We developed a technique termed 'Quantitative DNA Fiber Mapping (QDFM)' that allows accurate tagging of sequence elements of interest with near kilobase accuracy and optimized it for delineation of rearrangements in recombinant DNA clones. This paper demonstrates the power of this microscopic approach by investigating YAC rearrangements. In our examples, high-resolution physical maps for regions within the immunoglobulin lambda variant gene cluster were constructed for three different YAC clones carrying deletions of 95 kb and more. Rearrangements within YACs could be demonstrated unambiguously by pairwise mapping of cosmids along YAC DNA molecules. When coverage by YAC clones was not available, distances between cosmid clones were estimated by hybridization of cosmids onto DNA fibers prepared from human genomic DNA. In addition, the QDFM technology provides essential information about clone stability facilitating closure of the maps of the human genome as well as those of model organisms.

  9. Quantitative interpretation of the transition voltages in gold-poly(phenylene) thiol-gold molecular junctions

    SciTech Connect (OSTI)

    Wu, Kunlin; Bai, Meilin; Hou, Shimin; Sanvito, Stefano


    The transition voltage of three different asymmetric Au/poly(phenylene) thiol/Au molecular junctions in which the central molecule is either benzene thiol, biphenyl thiol, or terphenyl thiol is investigated by first-principles quantum transport simulations. For all the junctions, the calculated transition voltage at positive polarity is in quantitative agreement with the experimental values and shows weak dependence on alterations of the Au-phenyl contact. When compared to the strong coupling at the Au-S contact, which dominates the alignment of various molecular orbitals with respect to the electrode Fermi level, the coupling at the Au-phenyl contact produces only a weak perturbation. Therefore, variations of the Au-phenyl contact can only have a minor influence on the transition voltage. These findings not only provide an explanation to the uniformity in the transition voltages found for ?-conjugated molecules measured with different experimental methods, but also demonstrate the advantage of transition voltage spectroscopy as a tool for determining the positions of molecular levels in molecular devices.

  10. Quantitative method for measuring heat flux emitted from a cryogenic object

    DOE Patents [OSTI]

    Duncan, Robert V.


    The present invention is a quantitative method for measuring the total heat flux, and of deriving the total power dissipation, of a heat-fluxing object which includes the steps of placing an electrical noise-emitting heat-fluxing object in a liquid helium bath and measuring the superfluid transition temperature of the bath. The temperature of the liquid helium bath is thereafter reduced until some measurable parameter, such as the electrical noise, exhibited by the heat-fluxing object or a temperature-dependent resistive thin film in intimate contact with the heat-fluxing object, becomes greatly reduced. The temperature of the liquid helum bath is measured at this point. The difference between the superfluid transition temperature of the liquid helium bath surrounding the heat-fluxing object, and the temperature of the liquid helium bath when the electrical noise emitted by the heat-fluxing object becomes greatly reduced, is determined. The total heat flux from the heat-fluxing object is determined as a function of this difference between these temperatures. In certain applications, the technique can be used to optimize thermal design parameters of cryogenic electronics, for example, Josephson junction and infra-red sensing devices.

  11. Identification of Salmonella Typhimurium deubiquitinase SseL substrates by immunoaffinity enrichment and quantitative proteomic analysis

    SciTech Connect (OSTI)

    Nakayasu, Ernesto S.; Sydor, Michael A.; Brown, Roslyn N.; Sontag, Ryan L.; Sobreira, Tiago; Slysz, Gordon W.; Humphrys, Daniel R.; Skarina, Tatiana; Onoprienko, Olena; Di Leo, Rosa; Kaiser, Brooke LD; Li, Jie; Ansong, Charles; Cambronne, Eric; Smith, Richard D.; Savchenko, Alexei; Adkins, Joshua N.


    Ubiquitination is a key protein post-translational modification that regulates many important cellular pathways and whose levels are regulated by equilibrium between the activities of ubiquitin ligases and deubiquitinases. Here we present a method to identify specific deubiquitinase substrates based on treatment of cell lysates with recombinant enzymes, immunoaffinity purification and global quantitative proteomic analysis. As model system to identify substrates, we used a virulence-related deubiquitinase secreted by Salmonella enterica serovar Typhimurium into the host cells, SseL. Using this approach two SseL substrates were identified in RAW 264.7 murine macrophage-like cell line, S100A6 and het-erogeneous nuclear ribonuclear protein K, in addition to the previously reported K63-linked ubiquitin chains. These substrates were further validated by a combination of enzymatic and binding assays. This method can be used for the systematic identification of substrates of deubiquitinases from other organisms and applied to study their functions in physiology and disease.

  12. Proteomic analysis of astrocytic secretion that regulates neurogenesis using quantitative amine-specific isobaric tagging

    SciTech Connect (OSTI)

    Yan, Hu; Zhou, Wenhao; Wei, Liming; Zhong, Fan; Yang, Yi


    Astrocytes are essential components of neurogenic niches that affect neurogenesis through membrane association and/or the release of soluble factors. To identify factors released from astrocytes that could regulate neural stem cell differentiation and proliferation, we used mild oxygen-glucose deprivation (OGD) to inhibit the secretory capacity of astrocytes. Using the Transwell co-culture system, we found that OGD-treated astrocytes could not promote neural stem cell differentiation and proliferation. Next, isobaric tagging for the relative and absolute quantitation (iTRAQ) proteomics techniques was performed to identify the proteins in the supernatants of astrocytes (with or without OGD). Through a multi-step analysis and gene ontology classification, 130 extracellular proteins were identified, most of which were involved in neuronal development, the inflammatory response, extracellular matrix composition and supportive functions. Of these proteins, 44 had never been reported to be produced by astrocytes. Using ProteinPilot software analysis, we found that 60 extracellular proteins were significantly altered (27 upregulated and 33 downregulated) in the supernatant of OGD-treated astrocytes. Among these proteins, 7 have been reported to be able to regulate neurogenesis, while others may have the potential to regulate neurogenesis. This study profiles the major proteins released by astrocytes, which play important roles in the modulation of neurogenesis.

  13. Quantitative method for measuring heat flux emitted from a cryogenic object

    DOE Patents [OSTI]

    Duncan, R.V.


    The present invention is a quantitative method for measuring the total heat flux, and of deriving the total power dissipation, of a heat-fluxing object which includes the steps of placing an electrical noise-emitting heat-fluxing object in a liquid helium bath and measuring the superfluid transition temperature of the bath. The temperature of the liquid helium bath is thereafter reduced until some measurable parameter, such as the electrical noise, exhibited by the heat-fluxing object or a temperature-dependent resistive thin film in intimate contact with the heat-fluxing object, becomes greatly reduced. The temperature of the liquid helum bath is measured at this point. The difference between the superfluid transition temperature of the liquid helium bath surrounding the heat-fluxing object, and the temperature of the liquid helium bath when the electrical noise emitted by the heat-fluxing object becomes greatly reduced, is determined. The total heat flux from the heat-fluxing object is determined as a function of this difference between these temperatures. In certain applications, the technique can be used to optimize thermal design parameters of cryogenic electronics, for example, Josephson junction and infrared sensing devices.

  14. A method for rapid quantitative assessment of biofilms with biomolecular staining and image analysis

    SciTech Connect (OSTI)

    Larimer, Curtis J.; Winder, Eric M.; Jeters, Robert T.; Prowant, Matthew S.; Nettleship, Ian; Addleman, Raymond S.; Bonheyo, George T.


    Here, the accumulation of bacteria in surface attached biofilms, or biofouling, can be detrimental to human health, dental hygiene, and many industrial processes. A critical need in identifying and preventing the deleterious effects of biofilms is the ability to observe and quantify their development. Analytical methods capable of assessing early stage fouling are cumbersome or lab-confined, subjective, and qualitative. Herein, a novel photographic method is described that uses biomolecular staining and image analysis to enhance contrast of early stage biofouling. A robust algorithm was developed to objectively and quantitatively measure surface accumulation of Pseudomonas putida from photographs and results were compared to independent measurements of cell density. Results from image analysis quantified biofilm growth intensity accurately and with approximately the same precision of the more laborious cell counting method. This simple method for early stage biofilm detection enables quantifiable measurement of surface fouling and is flexible enough to be applied from the laboratory to the field. Broad spectrum staining highlights fouling biomass, photography quickly captures a large area of interest, and image analysis rapidly quantifies fouling in the image.

  15. Quantitative extraction and concentration of synthetic water-soluble acid dyes from aqueous media using a quinine-chloroform solution

    SciTech Connect (OSTI)

    Kobayashi, F.; Ozawa, N.; Hanai, J.; Isobe, M.; Watabe, T.


    Twenty-one water-soluble acid dyes, including eleven azo, five triphenylmethane four xanthene, one naphthol derivatives, used at practical concentrations for food coloration, were quantitatively extracted from water and various carbonated beverages into a 0.1 M quinine-chloroform solution in the presence of 0.5 M boric acid by brief shaking. Quantitative extraction of these dyes was also accomplished by the 0.1 M quinine-chloroform solution made conveniently from chloroform, quinine hydrochloride, and sodium hydroxide added successively to water or beverages containing boric acid. Quinine acted as a countercation on the dyes having sulfonic and/or carboxylic acid group(s) to form chloroform-soluble ion-pair complexes. The diacidic base alkaloid interacted with each acid group of mono-, di-, tri-, and tetrasulfonic acid dyes approximately in the ratio 0.8-0.9 to 1. The dyes in the chloroform solution were quantitatively concentrated into a small volume of sodium hydroxide solution also by brief shaking. The convenient quinine-chloroform method was applicable to the quantitative extraction of a mixture of 12 dyes from carbonated beverages, which are all currently used for food coloration. A high-pressure liquid chromatographic method is also presented for the systematic separation and determination of these 12 dyes following their concentration into the aqueous alkaline solution. The chromatogram was monitored by double-wavelength absorptiometry in the visible and ultraviolet ray regions.

  16. Molecular biology of Homo sapiens: Abstracts of papers presented at the 51st Cold Spring Harbor symposium on quantitative biology

    SciTech Connect (OSTI)

    Watson, J.D.; Siniscalco, M.


    This volume contains abstracts of papers presented at the 51st Cold Springs Harbor Symposium on Quantitative Biology. The topic for this meeting was the ''Molecular Biology of Homo sapiens.'' Sessions were entitled Human Gene Map, Human Cancer Genes, Genetic Diagnosis, Human Evolution, Drugs Made Off Human Genes, Receptors, and Gene Therapy. (DT)

  17. ANSI/ASHRAE/IES Standard 90.1-2010 Final Determination Quantitative Analysis

    SciTech Connect (OSTI)

    Halverson, Mark A.; Rosenberg, Michael I.; Liu, Bing


    The U.S. Department of Energy (DOE) conducted a final quantitative analysis to assess whether buildings constructed according to the requirements of the American National Standards Institute (ANSI)/American Society of Heating, Refrigerating and Air-Conditioning Engineers (ASHRAE)/Illuminating Engineering Society of North America (IESNA) Standard 90.1-2010 (ASHRAE Standard 90.1-2010, Standard 90.1-2010, or 2010 edition) would result in energy savings compared with buildings constructed to ANSI/ASHRAE/IESNA Standard 90.1-2007(ASHRAE Standard 90.1-2007, Standard 90.1-2007, or 2007 edition). The final analysis considered each of the 109 addenda to ASHRAE Standard 90.1-2007 that were included in ASHRAE Standard 90.1-2010. All 109 addenda processed by ASHRAE in the creation of Standard 90.1-2010 from Standard 90.1-2007 were reviewed by DOE, and their combined impact on a suite of 16 building prototype models in 15 ASHRAE climate zones was considered. Most addenda were deemed to have little quantifiable impact on building efficiency for the purpose of DOE's final determination. However, out of the 109 addenda, 34 were preliminarily determined to have a measureable and quantifiable impact. A suite of 240 computer energy simulations for building prototypes complying with ASHRAE 90.1-2007 was developed. These prototypes were then modified in accordance with these 34 addenda to create a second suite of corresponding building simulations reflecting the same buildings compliant with Standard 90.1-2010. The building simulations were conducted using the DOE EnergyPlus building simulation software. The resulting energy use from the complete suite of 480 simulation runs was then converted to energy use intensity (EUI, or energy use per unit floor area) metrics (Site EUI, Primary EUI, and energy cost intensity [ECI]) results for each simulation. For each edition of the standard, these EUIs were then aggregated to a national basis for each prototype using weighting factors based on construction floor area developed for each of the 15 U.S. climate zones using commercial construction data. When compared, the resulting weighted EUIs indicated that each of the 16 building prototypes used less energy under Standard 90.1-2010 than under Standard 90.1-2007 on a national basis when considering site energy, primary energy, or energy cost. The EUIs were also aggregated across building types to a national commercial building basis using the same weighting data. On a national basis, the final quantitative analysis estimated a floor-space-weighted national average reduction in new building energy consumption of 18.2 percent for source energy and 18.5 percent when considering site energy. An 18.2 percent savings in energy cost, based on national average commercial energy costs for electricity and natural gas, was also estimated.

  18. Reflection thermal diffuse x-ray scattering for quantitative determination of phonon dispersion relations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mei, A. B.; Hellman, O.; Schlepuetz, C. M.; Rockett, A.; Chiang, T. -C.; Hultman, L.; Petrov, I.; Greene, J. E.


    Synchrotron reflection x-ray thermal diffuse scattering (TDS) measurements, rather than previously reported transmission TDS, are carried out at room temperature and analyzed using a formalism based upon second-order interatomic force constants and long-range Coulomb interactions to obtain quantitative determinations of MgO phonon dispersion relations (h) over bar omega(j) (q), phonon densities of states g((h) over bar omega), and isochoric temperature-dependent vibrational heat capacities cv (T). We use MgO as a model system for investigating reflection TDS due to its harmonic behavior as well as its mechanical and dynamic stability. Resulting phonon dispersion relations and densities of states are found tomore » be in good agreement with independent reports from inelastic neutron and x-ray scattering experiments. Temperature-dependent isochoric heat capacities cv (T), computed within the harmonic approximation from (h) over bar omega(j) (q) values, increase with temperature from 0.4 x 10-4 eV/atom K at 100 K to 1.4 x 10-4 eV/atom K at 200 K and 1.9 x 10-4 eV/atom K at 300 K, in excellent agreement with isobaric heat capacity values cp (T) between 4 and 300 K. We anticipate that the experimental approach developed here will be valuable for determining vibrational properties of heteroepitaxial thin films since the use of grazing-incidence (θ ≲ θc where θc is the density-dependent critical angle) allows selective tuning of x-ray penetration depths to ≲ 10 nm.« less


    SciTech Connect (OSTI)

    Nielson, K. K.; Sanders, R. W.


    SAP3 is a dual-function FORTRAN computer program which performs peak analysis of energy-dispersive x-ray fluorescence spectra and then quantitatively interprets the results of the multielement analysis. It was written for mono- or bi-chromatic excitation as from an isotopic or secondary excitation source, and uses the separate incoherent and coherent backscatter intensities to define the bulk sample matrix composition. This composition is used in performing fundamental-parameter matrix corrections for self-absorption, enhancement, and particle-size effects, obviating the need for specific calibrations for a given sample matrix. The generalized calibration is based on a set of thin-film sensitivities, which are stored in a library disk file and used for all sample matrices and thicknesses. Peak overlap factors are also determined from the thin-film standards, and are stored in the library for calculating peak overlap corrections. A detailed description is given of the algorithms and program logic, and the program listing and flow charts are also provided. An auxiliary program, SPCAL, is also given for use in calibrating the backscatter intensities. SAP3 provides numerous analysis options via seventeen control switches which give flexibility in performing the calculations best suited to the sample and the user needs. User input may be limited to the name of the library, the analysis livetime, and the spectrum filename and location. Output includes all peak analysis information, matrix correction factors, and element concentrations, uncertainties and detection limits. Twenty-four elements are typically determined from a 1024-channel spectrum in one-to-two minutes using a PDP-11/34 computer operating under RSX-11M.

  20. Mammographic quantitative image analysis and biologic image composition for breast lesion characterization and classification

    SciTech Connect (OSTI)

    Drukker, Karen Giger, Maryellen L.; Li, Hui; Duewer, Fred; Malkov, Serghei; Joe, Bonnie; Kerlikowske, Karla; Shepherd, John A.; Flowers, Chris I.; Drukteinis, Jennifer S.


    Purpose: To investigate whether biologic image composition of mammographic lesions can improve upon existing mammographic quantitative image analysis (QIA) in estimating the probability of malignancy. Methods: The study population consisted of 45 breast lesions imaged with dual-energy mammography prior to breast biopsy with final diagnosis resulting in 10 invasive ductal carcinomas, 5 ductal carcinomain situ, 11 fibroadenomas, and 19 other benign diagnoses. Analysis was threefold: (1) The raw low-energy mammographic images were analyzed with an established in-house QIA method, QIA alone, (2) the three-compartment breast (3CB) composition measurederived from the dual-energy mammographyof water, lipid, and protein thickness were assessed, 3CB alone, and (3) information from QIA and 3CB was combined, QIA + 3CB. Analysis was initiated from radiologist-indicated lesion centers and was otherwise fully automated. Steps of the QIA and 3CB methods were lesion segmentation, characterization, and subsequent classification for malignancy in leave-one-case-out cross-validation. Performance assessment included box plots, BlandAltman plots, and Receiver Operating Characteristic (ROC) analysis. Results: The area under the ROC curve (AUC) for distinguishing between benign and malignant lesions (invasive and DCIS) was 0.81 (standard error 0.07) for the QIA alone method, 0.72 (0.07) for 3CB alone method, and 0.86 (0.04) for QIA+3CB combined. The difference in AUC was 0.043 between QIA + 3CB and QIA alone but failed to reach statistical significance (95% confidence interval [0.17 to + 0.26]). Conclusions: In this pilot study analyzing the new 3CB imaging modality, knowledge of the composition of breast lesions and their periphery appeared additive in combination with existing mammographic QIA methods for the distinction between different benign and malignant lesion types.

  1. Correction for FDG PET dose extravasations: Monte Carlo validation and quantitative evaluation of patient studies

    SciTech Connect (OSTI)

    Silva-Rodrguez, Jess Aguiar, Pablo; Servicio de Medicina Nuclear, Complexo Hospitalario Universidade de Santiago de Compostela , 15782, Galicia; Grupo de Imaxe Molecular, Instituto de Investigacin Sanitarias , Santiago de Compostela, 15706, Galicia ; Snchez, Manuel; Mosquera, Javier; Luna-Vega, Vctor; Corts, Julia; Garrido, Miguel; Pombar, Miguel; Ruibal, lvaro; Grupo de Imaxe Molecular, Instituto de Investigacin Sanitarias , Santiago de Compostela, 15706, Galicia; Fundacin Tejerina, 28003, Madrid


    Purpose: Current procedure guidelines for whole body [18F]fluoro-2-deoxy-D-glucose (FDG)-positron emission tomography (PET) state that studies with visible dose extravasations should be rejected for quantification protocols. Our work is focused on the development and validation of methods for estimating extravasated doses in order to correct standard uptake value (SUV) values for this effect in clinical routine. Methods: One thousand three hundred sixty-seven consecutive whole body FDG-PET studies were visually inspected looking for extravasation cases. Two methods for estimating the extravasated dose were proposed and validated in different scenarios using Monte Carlo simulations. All visible extravasations were retrospectively evaluated using a manual ROI based method. In addition, the 50 patients with higher extravasated doses were also evaluated using a threshold-based method. Results: Simulation studies showed that the proposed methods for estimating extravasated doses allow us to compensate the impact of extravasations on SUV values with an error below 5%. The quantitative evaluation of patient studies revealed that paravenous injection is a relatively frequent effect (18%) with a small fraction of patients presenting considerable extravasations ranging from 1% to a maximum of 22% of the injected dose. A criterion based on the extravasated volume and maximum concentration was established in order to identify this fraction of patients that might be corrected for paravenous injection effect. Conclusions: The authors propose the use of a manual ROI based method for estimating the effectively administered FDG dose and then correct SUV quantification in those patients fulfilling the proposed criterion.

  2. Pneumatic Microvalve-Based Hydrodynamic Sample Injection for High-Throughput, Quantitative Zone Electrophoresis in Capillaries

    SciTech Connect (OSTI)

    Kelly, Ryan T.; Wang, Chenchen; Rausch, Sarah J.; Lee, Cheng S.; Tang, Keqi


    A hybrid microchip/capillary CE system was developed to allow unbiased and lossless sample loading and high throughput repeated injections. This new hybrid CE system consists of a polydimethylsiloxane (PDMS) microchip sample injector featuring a pneumatic microvalve that separates a sample introduction channel from a short sample loading channel and a fused silica capillary separation column that connects seamlessly to the sample loading channel. The sample introduction channel is pressurized such that when the pneumatic microvalve opens briefly, a variable-volume sample plug is introduced into the loading channel. A high voltage for CE separation is continuously applied across the loading channel and the fused silica capillary separation column. Analytes are rapidly separated in the fused silica capillary with high resolution. High sensitivity MS detection after CE separation is accomplished via a sheathless CE/ESI-MS interface. The performance evaluation of the complete CE/ESI-MS platform demonstrated that reproducible sample injection with well controlled sample plug volumes could be achieved by using the PDMS microchip injector. The absence of band broadening from microchip to capillary indicated a minimum dead volume at the junction. The capabilities of the new CE/ESI-MS platform in performing high throughput and quantitative sample analyses were demonstrated by the repeated sample injection without interrupting an ongoing separation and a good linear dependence of the total analyte ion abundance on the sample plug volume using a mixture of peptide standards. The separation efficiency of the new platform was also evaluated systematically at different sample injection times, flow rates and CE separation voltages.

  3. Quantitative Effects of Vehicle Parameters on Fuel Consumption for Heavy-Duty Vehicle

    SciTech Connect (OSTI)

    Wang, Lijuan; Kelly, Kenneth; Walkowicz, Kevin; Duran, Adam


    The National Renewable Energy Laboratory's (NREL's) Fleet Test and Evaluations team recently conducted chassis dynamometer tests of a class 8 conventional regional delivery truck over the Heavy Heavy-Duty Diesel Truck (HHDDT), West Virginia University City (WVU City), and Composite International Truck Local and Commuter Cycle (CILCC) drive cycles. A quantitative study was conducted by analyzing the impacts of various factors on fuel consumption (FC) and fuel economy (FE) by modeling and simulating the truck using NREL's Future Automotive Systems Technology Simulator (FASTSim). Factors used in this study included vehicle weight, and the coefficients of rolling resistance and aerodynamic drag. The simulation results from a single parametric study revealed that FC was approximately a linear function of the weight, coefficient of aerodynamic drag, and rolling resistance over various drive cycles. Among these parameters, the truck weight had the largest effect on FC. The study of the impact of two technologies on FE suggested that, depending on the circumstances, it may be more cost effective to reduce one parameter (such as coefficient of aerodynamic drag) to increase fuel economy, or it may be more beneficial to reduce another (such as the coefficient of rolling resistance). It also provided a convenient way to estimate FE by interpolating within the parameter values and extrapolating outside of them. The simulation results indicated that the FC could be reduced from 38.70 L/100 km, 50.72 L/100 km, and 38.42 L/100 km in the baseline truck to 26.78 L/100 km, 43.14 L/100 km and 29.84 L/100 km over the HHDDT, WVU City and CILCC drive cycles, respectively, when the U.S. Department of Energy's three targeted new technologies were applied simultaneously.

  4. Quantitative metrics for assessment of chemical image quality and spatial resolution

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kertesz, Vilmos; Cahill, John F.; Van Berkel, Gary J.


    Rationale: Currently objective/quantitative descriptions of the quality and spatial resolution of mass spectrometry derived chemical images are not standardized. Development of these standardized metrics is required to objectively describe chemical imaging capabilities of existing and/or new mass spectrometry imaging technologies. Such metrics would allow unbiased judgment of intra-laboratory advancement and/or inter-laboratory comparison for these technologies if used together with standardized surfaces. Methods: We developed two image metrics, viz., chemical image contrast (ChemIC) based on signal-to-noise related statistical measures on chemical image pixels and corrected resolving power factor (cRPF) constructed from statistical analysis of mass-to-charge chronograms across features of interest inmore » an image. These metrics, quantifying chemical image quality and spatial resolution, respectively, were used to evaluate chemical images of a model photoresist patterned surface collected using a laser ablation/liquid vortex capture mass spectrometry imaging system under different instrument operational parameters. Results: The calculated ChemIC and cRPF metrics determined in an unbiased fashion the relative ranking of chemical image quality obtained with the laser ablation/liquid vortex capture mass spectrometry imaging system. These rankings were used to show that both chemical image contrast and spatial resolution deteriorated with increasing surface scan speed, increased lane spacing and decreasing size of surface features. Conclusions: ChemIC and cRPF, respectively, were developed and successfully applied for the objective description of chemical image quality and spatial resolution of chemical images collected from model surfaces using a laser ablation/liquid vortex capture mass spectrometry imaging system.« less

  5. A quantitative acoustic emission study on fracture processes in ceramics based on wavelet packet decomposition

    SciTech Connect (OSTI)

    Ning, J. G.; Chu, L.; Ren, H. L.


    We base a quantitative acoustic emission (AE) study on fracture processes in alumina ceramics on wavelet packet decomposition and AE source location. According to the frequency characteristics, as well as energy and ringdown counts of AE, the fracture process is divided into four stages: crack closure, nucleation, development, and critical failure. Each of the AE signals is decomposed by a 2-level wavelet package decomposition into four different (from-low-to-high) frequency bands (AA{sub 2}, AD{sub 2}, DA{sub 2}, and DD{sub 2}). The energy eigenvalues P{sub 0}, P{sub 1}, P{sub 2}, and P{sub 3} corresponding to these four frequency bands are calculated. By analyzing changes in P{sub 0} and P{sub 3} in the four stages, we determine the inverse relationship between AE frequency and the crack source size during ceramic fracture. AE signals with regard to crack nucleation can be expressed when P{sub 0} is less than 5 and P{sub 3} more than 60; whereas AE signals with regard to dangerous crack propagation can be expressed when more than 92% of P{sub 0} is greater than 4, and more than 95% of P{sub 3} is less than 45. Geiger location algorithm is used to locate AE sources and cracks in the sample. The results of this location algorithm are consistent with the positions of fractures in the sample when observed under a scanning electronic microscope; thus the locations of fractures located with Geiger's method can reflect the fracture process. The stage division by location results is in a good agreement with the division based on AE frequency characteristics. We find that both wavelet package decomposition and Geiger's AE source locations are suitable for the identification of the evolutionary process of cracks in alumina ceramics.

  6. A quantitative approach to the characterization of cumulative and average solvent exposure in paint manufacturing plants

    SciTech Connect (OSTI)

    Ford, D.P.; Schwartz, B.S.; Powell, S.; Nelson, T.; Keller, L.; Sides, S.; Agnew, J.; Bolla, K.; Bleecker, M. )


    Previous reports have attributed a range of neurobehavioral effects to low-level, occupational solvent exposure. These studies have generally been limited in their exposure assessments and have specifically lacked good estimates of exposure intensity. In the present study, the authors describe the development of two exposure variables that quantitatively integrate industrial hygiene sampling data with estimates of exposure duration--a cumulative exposure (CE) estimate and a lifetime weighted average exposure (LWAE) estimate. Detailed occupational histories were obtained from 187 workers at two paint manufacturing plants. Historic industrial hygiene sampling data for total hydrocarbons (a composite variable of the major neurotoxic solvents present) were grouped according to 20 uniform, temporally stable exposure zones, which had been defined during plant walk-through surveys. Sampling at the time of the study was used to characterize the few zones for which historic data were limited or unavailable. For each participant, the geometric mean total hydrocarbon level for each exposure zone worked in was multiplied by the duration of employment in that zone; the resulting products were summed over the working lifetime to create the CE variable. The CE variable was divided by the total duration of employment in solvent-exposed jobs to create the LWAE variable. The explanatory value of each participant's LWAE estimate in the regression of simple visual reaction time (a neurobehavioral test previously shown to be affected by chronic solvent exposure) on exposure was compared with that of several other exposure variables, including exposure duration and an exposure variable based on an ordinal ranking of the exposure zones.

  7. A quantitative quantum-chemical analysis tool for the distribution of mechanical force in molecules

    SciTech Connect (OSTI)

    Stauch, Tim; Dreuw, Andreas


    The promising field of mechanochemistry suffers from a general lack of understanding of the distribution and propagation of force in a stretched molecule, which limits its applicability up to the present day. In this article, we introduce the JEDI (Judgement of Energy DIstribution) analysis, which is the first quantum chemical method that provides a quantitative understanding of the distribution of mechanical stress energy among all degrees of freedom in a molecule. The method is carried out on the basis of static or dynamic calculations under the influence of an external force and makes use of a Hessian matrix in redundant internal coordinates (bond lengths, bond angles, and dihedral angles), so that all relevant degrees of freedom of a molecule are included and mechanochemical processes can be interpreted in a chemically intuitive way. The JEDI method is characterized by its modest computational effort, with the calculation of the Hessian being the rate-determining step, and delivers, except for the harmonic approximation, exact ab initio results. We apply the JEDI analysis to several example molecules in both static quantum chemical calculations and Born-Oppenheimer Molecular Dynamics simulations in which molecules are subject to an external force, thus studying not only the distribution and the propagation of strain in mechanically deformed systems, but also gaining valuable insights into the mechanochemically induced isomerization of trans-3,4-dimethylcyclobutene to trans,trans-2,4-hexadiene. The JEDI analysis can potentially be used in the discussion of sonochemical reactions, molecular motors, mechanophores, and photoswitches as well as in the development of molecular force probes.

  8. Exposure to monocrotophos pesticide during sexual development causes the feminization/demasculinization of the reproductive traits and a reduction in the reproductive success of male guppies (Poecilia reticulata)

    SciTech Connect (OSTI)

    Tian, Hua; Li, Yun; Wang, Wei; Wu, Peng; Ru, Shaoguo


    Monocrotophos is a highly toxic organophosphorus pesticide that has been confirmed to be an endocrine‐disrupting chemical. To evaluate the influence of this pollutant on the reproductive system of male fish, we studied the sex steroid levels, reproductive traits, sex ratio, and reproductive success in male guppies (Poecilia reticulata) exposed to 40% monocrotophos pesticide at the nominal concentrations of 0.01, 0.10, and 1.00 mg/L for 90 days from birth to adulthood in a semi‐static exposure system. Radioimmunoassay and western blot analyses demonstrated that the long‐term exposure to monocrotophos pesticide during the sexual development of male guppies caused a significant increase in 17β‐estradiol levels and consequently induced vitellogenin synthesis, suggesting the feminization of the males. Monocrotophos pesticide also caused a significant decrease in testosterone levels, which consequently inhibited testis growth and reduced the sperm count and the area and intensity of their sexually attractive orange spots, which collectively indicated the significant demasculinization of the male sexual characteristics. Furthermore, these changes in the sexual characteristics at the cellular and organ levels translated into ecologically important effects on the reproductive success at the individual level, as measured by a decrease in offspring production and survival rate. The present study provides the first evidence that monocrotophos pesticide can cause severe reproductive abnormalities in fish due to its endocrine‐disrupting action. -- Highlights: ► Monocrotophos pesticide caused an increase in 17β‐estradiol levels of male guppies. ► Monocrotophos pesticide induced vitellogenin synthesis of male guppies. ► Monocrotophos pesticide caused a decrease in testosterone levels of male guppies. ► Monocrotophos pesticide caused demasculinization of male sexual characteristics. ► Monocrotophos pesticide caused a reduction in reproductive success of male guppies.

  9. Quantitative Analysis of Variability and Uncertainty in Environmental Data and Models. Volume 1. Theory and Methodology Based Upon Bootstrap Simulation

    SciTech Connect (OSTI)

    Frey, H. Christopher; Rhodes, David S.


    This is Volume 1 of a two-volume set of reports describing work conducted at North Carolina State University sponsored by Grant Number DE-FG05-95ER30250 by the U.S. Department of Energy. The title of the project is “Quantitative Analysis of Variability and Uncertainty in Acid Rain Assessments.” The work conducted under sponsorship of this grant pertains primarily to two main topics: (1) development of new methods for quantitative analysis of variability and uncertainty applicable to any type of model; and (2) analysis of variability and uncertainty in the performance, emissions, and cost of electric power plant combustion-based NOx control technologies. These two main topics are reported separately in Volumes 1 and 2.

  10. Formation resistivity measurements from within a cased well used to quantitatively determine the amount of oil and gas present

    DOE Patents [OSTI]

    Vail, III, William Banning


    Methods to quantitatively determine the separate amounts of oil and gas in a geological formation adjacent to a cased well using measurements of formation resistivity. The steps include obtaining resistivity measurements from within a cased well of a given formation, obtaining the porosity, obtaining the resistivity of formation water present, computing the combined amounts of oil and gas present using Archie's Equations, determining the relative amounts of oil and gas present from measurements within a cased well, and then quantitatively determining the separate amounts of oil and gas present in the formation. Resistivity measurements are obtained from within the cased well by conducting A.C. current from within the cased well to a remote electrode at a frequency that is within the frequency range of 0.1 Hz to 20 Hz.

  11. Foundations for quantitative microstructural models to track evolution of the metallurgical state during high purity Nb cavity fabrication

    SciTech Connect (OSTI)

    Bieler, Thomas R; Wright, Neil T; Compton, Chris C


    The goal of the Materials Science SRF Cavity Group of Michigan State University and the National Superconducting Cyclotron has been (and continues to be) to understand quantitatively the effects of process history on functional properties. These relationships were assessed via studies on Nb samples and cavity parts, which had various combinations of forming processes, welding, heat treatments, and surface preparation. A primary focus was on large-grain cavity building strategies. Effects of processing operations and exposure to hydrogen on the thermal conductivity has been identified in single and bi-crystal samples, showing that the thermal conductivity can be altered by a factor of 5 depending on process history. Characterization of single crystal tensile samples show a strong effect of crystal orientation on deformation resistance and shape changes. Large grain half cells were examined to characterize defect content and surface damage effects, which provided quantitative information about the depth damage layers from forming.

  12. Quantitative Assessment of Detection Frequency for the INL Ambient Air Monitoring Network

    SciTech Connect (OSTI)

    A. Jeffrey Sondrup; Arthur S. Rood


    A quantitative assessment of the Idaho National Laboratory (INL) air monitoring network was performed using frequency of detection as the performance metric. The INL air monitoring network consists of 37 low-volume air samplers in 31 different locations. Twenty of the samplers are located on INL (onsite) and 17 are located off INL (offsite). Detection frequencies were calculated using both BEA and ESER laboratory minimum detectable activity (MDA) levels. The CALPUFF Lagrangian puff dispersion model, coupled with 1 year of meteorological data, was used to calculate time-integrated concentrations at sampler locations for a 1-hour release of unit activity (1 Ci) for every hour of the year. The unit-activity time-integrated concentration (TICu) values were calculated at all samplers for releases from eight INL facilities. The TICu values were then scaled and integrated for a given release quantity and release duration. All facilities modeled a ground-level release emanating either from the center of the facility or at a point where significant emissions are possible. In addition to ground-level releases, three existing stacks at the Advanced Test Reactor Complex, Idaho Nuclear Technology and Engineering Center, and Material and Fuels Complex were also modeled. Meteorological data from the 35 stations comprising the INL Mesonet network, data from the Idaho Falls Regional airport, upper air data from the Boise airport, and three-dimensional gridded data from the weather research forecasting model were used for modeling. Three representative radionuclides identified as key radionuclides in INLs annual National Emission Standards for Hazardous Air Pollutants evaluations were considered for the frequency of detection analysis: Cs-137 (beta-gamma emitter), Pu-239 (alpha emitter), and Sr-90 (beta emitter). Source-specific release quantities were calculated for each radionuclide, such that the maximum inhalation dose at any publicly accessible sampler or the National Emission Standards for Hazardous Air Pollutants maximum exposed individual location (i.e., Frenchmans Cabin) was no more than 0.1 mrem yr1 (i.e., 1% of the 10 mrem yr1 standard). Detection frequencies were calculated separately for the onsite and offsite monitoring network. As expected, detection frequencies were generally less for the offsite sampling network compared to the onsite network. Overall, the monitoring network is very effective at detecting the potential releases of Cs-137 or Sr-90 from all sources/facilities using either the ESER or BEA MDAs. The network was less effective at detecting releases of Pu-239. Maximum detection frequencies for Pu-239 using ESER MDAs ranged from 27.4 to 100% for onsite samplers and 3 to 80% for offsite samplers. Using BEA MDAs, the maximum detection frequencies for Pu-239 ranged from 2.1 to 100% for onsite samplers and 0 to 5.9% for offsite samplers. The only release that was not detected by any of the samplers under any conditions was a release of Pu-239 from the Idaho Nuclear Technology and Engineering Center main stack (CPP-708). The methodology described in this report could be used to improve sampler placement and detection frequency, provided clear performance objectives are defined.

  13. International Committee on Traffic Conflict Techniques (ICTCT) calibration study at Malmo: a quantitative analysis of video recordings

    SciTech Connect (OSTI)

    van der Horst, A.R.A.


    To investigate a number of Traffic Conflict Techniques, three intersections at Malmo (Sweden) were studied by observer teams of eight countries while simultaneous video recordings were made. This set was analyzed quantitatively from video in order to get an objective description in terms of speed, deceleration, minimum distance, time-to-collision (TTC), and post-encroachment time (PET). The minimum TTC appeared to be the most important variable in explaining a common severity scale, but not the only one. Conflict type contributes substantially to the prediction of severity. Comparisons were made between calculated and estimated measures, like TTC for Sweden and Finland and PET for Canada.

  14. Quantitative characterization of collagen in the fibrotic capsule surrounding implanted polymeric microparticles through second harmonic generation imaging

    SciTech Connect (OSTI)

    Akilbekova, Dana; Bratlie, Kaitlin M.; Abraham, Thomas


    The collagenous capsule formed around an implant will ultimately determine the nature of its in vivo fate. To provide a better understanding of how surface modifications can alter the collagen orientation and composition in the fibrotic capsule, we used second harmonic generation (SHG) microscopy to evaluate collagen organization and structure generated in mice subcutaneously injected with chemically functionalized polystyrene particles. SHG is sensitive to the orientation of a molecule, making it a powerful tool for measuring the alignment of collagen fibers. Additionally, SHG arises from the second order susceptibility of the interrogated molecule in response to the electric field. Variation in these tensor components distinguishes different molecular sources of SHG, providing collagen type specificity. Here, we demonstrated the ability of SHG to differentiate collagen type I and type III quantitatively and used this method to examine fibrous capsules of implanted polystyrene particles. Data presented in this work shows a wide range of collagen fiber orientations and collagen compositions in response to surface functionalized polystyrene particles. Dimethylamino functionalized particles were able to form a thin collagenous matrix resembling healthy skin. These findings have the potential to improve the fundamental understanding of how material properties influence collagen organization and composition quantitatively.

  15. Quantitative characterization of collagen in the fibrotic capsule surrounding implanted polymeric microparticles through second harmonic generation imaging

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Akilbekova, Dana; Bratlie, Kaitlin M.; Abraham, Thomas


    The collagenous capsule formed around an implant will ultimately determine the nature of its in vivo fate. To provide a better understanding of how surface modifications can alter the collagen orientation and composition in the fibrotic capsule, we used second harmonic generation (SHG) microscopy to evaluate collagen organization and structure generated in mice subcutaneously injected with chemically functionalized polystyrene particles. SHG is sensitive to the orientation of a molecule, making it a powerful tool for measuring the alignment of collagen fibers. Additionally, SHG arises from the second order susceptibility of the interrogated molecule in response to the electric field. Variationmore » in these tensor components distinguishes different molecular sources of SHG, providing collagen type specificity. Here, we demonstrated the ability of SHG to differentiate collagen type I and type III quantitatively and used this method to examine fibrous capsules of implanted polystyrene particles. Data presented in this work shows a wide range of collagen fiber orientations and collagen compositions in response to surface functionalized polystyrene particles. Dimethylamino functionalized particles were able to form a thin collagenous matrix resembling healthy skin. These findings have the potential to improve the fundamental understanding of how material properties influence collagen organization and composition quantitatively.« less

  16. Assessment of ERCC1 and XPF Protein Expression Using Quantitative Immunohistochemistry in Nasopharyngeal Carcinoma Patients Undergoing Curative Intent Treatment

    SciTech Connect (OSTI)

    Jagdis, Amanda; Phan, Tien; Faculty of Medicine, University of Calgary, Calgary, Alberta ; Klimowicz, Alexander C.; Faculty of Medicine, University of Calgary, Calgary, Alberta ; Laskin, Janessa J.; Faculty of Medicine, University of British Columbia, Vancouver, British Columbia ; Lau, Harold Y.; Faculty of Medicine, University of Calgary, Calgary, Alberta ; Petrillo, Stephanie K.; Siever, Jodi E.; Thomson, Thomas A.; Faculty of Medicine, University of British Columbia, Vancouver, British Columbia ; Magliocco, Anthony M.; Faculty of Medicine, University of Calgary, Calgary, Alberta ; Hao, Desire; Faculty of Medicine, University of Calgary, Calgary, Alberta


    Purpose: We sought to evaluate the prognostic/predictive value of ERCC1 and XPF in patients with nonmetastatic nasopharyngeal carcinoma (NPC) treated with curative intent. Methods and Materials: ERCC1 and XPF protein expression was evaluated by immunofluorescence combined with automated quantitative analysis (AQUA) using the FL297 and 3F2 antibodies, respectively. ERCC1 and XPF protein expression levels were correlated with clinical outcomes. Results: Patient characteristics were as follows: mean age 52 years (range, 18-85 years), 67% male, 72% Karnofsky performance status (KPS) ?90%, World Health Organization (WHO) type 1/2/3 = 12%/28%/60%, stage III/IV 65%. With a median follow-up time of 50 months (range, 2.9 to 120 months), the 5-year overall survival (OS) was 70.8%. Median standardized nuclear AQUA scores were used as cutpoints for ERCC1 (n=138) and XPF (n=130) protein expression. Agreement between dichotomized ERCC1 and XPF scores was high at 79.4% (kappa = 0.587, P<.001). Neither biomarker predicted locoregional recurrence, DFS, or OS after adjustment for age and KPS, irrespective of stratification by stage, WHO type, or treatment. Conclusions: Neither ERCC1 nor XPF, analyzed by quantitative immunohistochemistry using the FL297 and 3F2 antibodies, was prognostic or predictive in this cohort of NPC patients.

  17. Quantitative Chromatographic Determination of Dissolved Elemental Sulfur in the Non-aqueous Electrolyte for Lithium-Sulfur Batteries

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zheng, Dong; Yang, Xiao-Qing; Zhang, Xuran; Li, Chao; McKinnon, Meaghan E.; Sadok, Rachel G.; Qu, Deyu; Yu, Xiqian; Lee, Hung-Sui; Qu, Deyang


    A fast and reliable analytical method is reported for the quantitative determination of dissolved elemental sulfur in non-aqueous electrolytes for Li-S batteries. By using high performance liquid chromatography with a UV detector, the solubility of S in 12 different pure solvents and in 22 different electrolytes was determined. It was found that the solubility of elemental sulfur is dependent on the Lewis basicity, the polarity of solvents and the salt concentration in the electrolytes. In addition, the S content in the electrolyte recovered from a discharged Li-S battery was successfully determined by the proposed HPLC/UV method. Thus, the feasibility ofmore » the method to the online analysis for a Li-S battery is demonstrated. Interestingly, the S was found super-saturated in the electrolyte recovered from a discharged Li-S cell.« less

  18. Multi-scale modeling of microstructure dependent intergranular brittle fracture using a quantitative phase-field based method

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chakraborty, Pritam; Zhang, Yongfeng; Tonks, Michael R.


    In this study, the fracture behavior of brittle materials is strongly influenced by their underlying microstructure that needs explicit consideration for accurate prediction of fracture properties and the associated scatter. In this work, a hierarchical multi-scale approach is pursued to model microstructure sensitive brittle fracture. A quantitative phase-field based fracture model is utilized to capture the complex crack growth behavior in the microstructure and the related parameters are calibrated from lower length scale atomistic simulations instead of engineering scale experimental data. The workability of this approach is demonstrated by performing porosity dependent intergranular fracture simulations in UO2 and comparing themore » predictions with experiments.« less

  19. Quantitative Chromatographic Determination of Dissolved Elemental Sulfur in the Non-aqueous Electrolyte for Lithium-Sulfur Batteries

    SciTech Connect (OSTI)

    Zheng, Dong; Yang, Xiao-Qing; Zhang, Xuran; Li, Chao; McKinnon, Meaghan E.; Sadok, Rachel G.; Qu, Deyu; Yu, Xiqian; Lee, Hung-Sui; Qu, Deyang


    A fast and reliable analytical method is reported for the quantitative determination of dissolved elemental sulfur in non-aqueous electrolytes for Li-S batteries. By using high performance liquid chromatography with a UV detector, the solubility of S in 12 different pure solvents and in 22 different electrolytes was determined. It was found that the solubility of elemental sulfur is dependent on the Lewis basicity, the polarity of solvents and the salt concentration in the electrolytes. In addition, the S content in the electrolyte recovered from a discharged Li-S battery was successfully determined by the proposed HPLC/UV method. Thus, the feasibility of the method to the online analysis for a Li-S battery is demonstrated. Interestingly, the S was found super-saturated in the electrolyte recovered from a discharged Li-S cell.

  20. Approaches to advancing quantitative human health risk assessment of environmental chemicals in the post-genomic era

    SciTech Connect (OSTI)

    Chiu, Weihsueh A.; Euling, Susan Y.; Scott, Cheryl Siegel; Subramaniam, Ravi P.


    The contribution of genomics and associated technologies to human health risk assessment for environmental chemicals has focused largely on elucidating mechanisms of toxicity, as discussed in other articles in this issue. However, there is interest in moving beyond hazard characterization to making more direct impacts on quantitative risk assessment (QRA) i.e., the determination of toxicity values for setting exposure standards and cleanup values. We propose that the evolution of QRA of environmental chemicals in the post-genomic era will involve three, somewhat overlapping phases in which different types of approaches begin to mature. The initial focus (in Phase I) has been and continues to be on augmentation of weight of evidence using genomic and related technologies qualitatively to increase the confidence in and scientific basis of the results of QRA. Efforts aimed towards integration of these data with traditional animal-based approaches, in particular quantitative predictors, or surrogates, for the in vivo toxicity data to which they have been anchored are just beginning to be explored now (in Phase II). In parallel, there is a recognized need for expansion of the use of established biomarkers of susceptibility or risk of human diseases and disorders for QRA, particularly for addressing the issues of cumulative assessment and population risk. Ultimately (in Phase III), substantial further advances could be realized by the development of novel molecular and pathway-based biomarkers and statistical and in silico models that build on anticipated progress in understanding the pathways of human diseases and disorders. Such efforts would facilitate a gradual reorientation of QRA towards approaches that more directly link environmental exposures to human outcomes.

  1. A fast and reliable readout method for quantitative analysis of surface-enhanced Raman scattering nanoprobes on chip surface

    SciTech Connect (OSTI)

    Chang, Hyejin; Jeong, Sinyoung; Ko, Eunbyeol; Jeong, Dae Hong E-mail:; Kang, Homan; Lee, Yoon-Sik E-mail:; Lee, Ho-Young E-mail:


    Surface-enhanced Raman scattering techniques have been widely used for bioanalysis due to its high sensitivity and multiplex capacity. However, the point-scanning method using a micro-Raman system, which is the most common method in the literature, has a disadvantage of extremely long measurement time for on-chip immunoassay adopting a large chip area of approximately 1-mm scale and confocal beam point of ca. 1-μm size. Alternative methods such as sampled spot scan with high confocality and large-area scan method with enlarged field of view and low confocality have been utilized in order to minimize the measurement time practically. In this study, we analyzed the two methods in respect of signal-to-noise ratio and sampling-led signal fluctuations to obtain insights into a fast and reliable readout strategy. On this basis, we proposed a methodology for fast and reliable quantitative measurement of the whole chip area. The proposed method adopted a raster scan covering a full area of 100 μm × 100 μm region as a proof-of-concept experiment while accumulating signals in the CCD detector for single spectrum per frame. One single scan with 10 s over 100 μm × 100 μm area yielded much higher sensitivity compared to sampled spot scanning measurements and no signal fluctuations attributed to sampled spot scan. This readout method is able to serve as one of key technologies that will bring quantitative multiplexed detection and analysis into practice.

  2. A quantitative method to analyze the quality of EIA information in wind energy development and avian/bat assessments

    SciTech Connect (OSTI)

    Chang, Tony; Nielsen, Erik; Auberle, William; Solop, Frederic I.


    The environmental impact assessment (EIA) has been a tool for decision makers since the enactment of the National Environmental Policy Act (NEPA). Since that time, few analyses have been performed to verify the quality of information and content within EIAs. High quality information within assessments is vital in order for decision makers, stake holders, and the public to understand the potential impact of proposed actions on the ecosystem and wildlife species. Low quality information has been a major cause for litigation and economic loss. Since 1999, wind energy development has seen an exponential growth with unknown levels of impact on wildlife species, in particular bird and bat species. The purpose of this article is to: (1) develop, validate, and apply a quantitative index to review avian/bat assessment quality for wind energy EIAs; and (2) assess the trends and status of avian/bat assessment quality in a sample of wind energy EIAs. This research presents the development and testing of the Avian and Bat Assessment Quality Index (ABAQI), a new approach to quantify information quality of ecological assessments within wind energy development EIAs in relation to avian and bat species based on review areas and factors derived from 23 state wind/wildlife siting guidance documents. The ABAQI was tested through a review of 49 publicly available EIA documents and validated by identifying high variation in avian and bat assessments quality for wind energy developments. Of all the reviewed EIAs, 66% failed to provide high levels of preconstruction avian and bat survey information, compared to recommended factors from state guidelines. This suggests the need for greater consistency from recommended guidelines by state, and mandatory compliance by EIA preparers to avoid possible habitat and species loss, wind energy development shut down, and future lawsuits. - Highlights: Black-Right-Pointing-Pointer We developed, validated, and applied a quantitative index to review avian/bat assessment quality for wind energy EIAs. Black-Right-Pointing-Pointer We assessed the trends and status of avian/bat assessment quality in a sample of wind energy EIAs. Black-Right-Pointing-Pointer Applied index to 49 EIA documents and identified high variation in assessment quality for wind energy developments. Black-Right-Pointing-Pointer For the reviewed EIAs, 66% provided inadequate preconstruction avian and bat survey information.

  3. Quantitative luminescence imaging system

    DOE Patents [OSTI]

    Erwin, D.N.; Kiel, J.L.; Batishko, C.R.; Stahl, K.A.


    The QLIS images and quantifies low-level chemiluminescent reactions in an electromagnetic field. It is capable of real time nonperturbing measurement and simultaneous recording of many biochemical and chemical reactions such as luminescent immunoassays or enzyme assays. The system comprises image transfer optics, a low-light level digitizing camera with image intensifying microchannel plates, an image process or, and a control computer. The image transfer optics may be a fiber image guide with a bend, or a microscope, to take the light outside of the RF field. Output of the camera is transformed into a localized rate of cumulative digitalized data or enhanced video display or hard-copy images. The system may be used as a luminescent microdosimetry device for radiofrequency or microwave radiation, as a thermal dosimeter, or in the dosimetry of ultra-sound (sonoluminescence) or ionizing radiation. It provides a near-real-time system capable of measuring the extremely low light levels from luminescent reactions in electromagnetic fields in the areas of chemiluminescence assays and thermal microdosimetry, and is capable of near-real-time imaging of the sample to allow spatial distribution analysis of the reaction. It can be used to instrument three distinctly different irradiation configurations, comprising (1) RF waveguide irradiation of a small Petri-dish-shaped sample cell, (2) RF irradiation of samples in a microscope for the microscopic imaging and measurement, and (3) RF irradiation of small to human body-sized samples in an anechoic chamber. 22 figs.

  4. Quantitative Risk Assessment

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Solar Energy Wind Energy Water Power Supercritical CO2 Geothermal Natural Gas Safety, Security & Resilience of the Energy Infrastructure Energy Storage Nuclear Power & Engineering ...

  5. Quantitative luminescence imaging system

    DOE Patents [OSTI]

    Erwin, David N.; Kiel, Johnathan L.; Batishko, Charles R.; Stahl, Kurt A.


    The QLIS images and quantifies low-level chemiluminescent reactions in an electromagnetic field. It is capable of real time nonperturbing measurement and simultaneous recording of many biochemical and chemical reactions such as luminescent immunoassays or enzyme assays. The system comprises image transfer optics, a low-light level digitizing camera with image intensifying microchannel plates, an image process or, and a control computer. The image transfer optics may be a fiber image guide with a bend, or a microscope, to take the light outside of the RF field. Output of the camera is transformed into a localized rate of cumulative digitalized data or enhanced video display or hard-copy images. The system may be used as a luminescent microdosimetry device for radiofrequency or microwave radiation, as a thermal dosimeter, or in the dosimetry of ultra-sound (sonoluminescence) or ionizing radiation. It provides a near-real-time system capable of measuring the extremely low light levels from luminescent reactions in electromagnetic fields in the areas of chemiluminescence assays and thermal microdosimetry, and is capable of near-real-time imaging of the sample to allow spatial distribution analysis of the reaction. It can be used to instrument three distinctly different irradiation configurations, comprising (1) RF waveguide irradiation of a small Petri-dish-shaped sample cell, (2) RF irradiation of samples in a microscope for the microscopie imaging and measurement, and (3) RF irradiation of small to human body-sized samples in an anechoic chamber.

  6. Quantitative DNA fiber mapping

    DOE Patents [OSTI]

    Gray, Joe W.; Weier, Heinz-Ulrich G.


    The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.


    SciTech Connect (OSTI)

    DeForest, C. E.; Howard, T. A.; McComas, D. J.


    We have tracked a slow magnetic cloud associated coronal mass ejection (CME) continuously from its origin as a flux rope structure in the low solar corona over a four-day passage to impact with spacecraft located near Earth. Combining measurements from the STEREO, ACE, and Wind space missions, we are able to follow major elements with enough specificity to relate pre-CME coronal structure in the low corona to the corresponding elements seen in the near-Earth in situ data. Combining extreme ultraviolet imaging, quantitative Thomson scattering data throughout the flight of the CME, and ''ground-truth'' in situ measurements, we: (1) identify the plasma observed by ACE and Wind with specific features in the solar corona (a segment of a long flux rope); (2) determine the onset mechanism of the CME (destabilization of a filament channel following flare reconnection, coupled with the mass draining instability) and demonstrate that it is consistent with the in situ measurements; (3) identify the origin of different layers of the sheath material around the central magnetic cloud (closed field lifted from the base of the corona, closed field entrained during passage through the corona, and solar wind entrained by the front of the CME); (4) measure mass accretion of the system via snowplow effects in the solar wind as the CME crossed the solar system; and (5) quantify the kinetic energy budget of the system in interplanetary space, and determine that it is consistent with no long-term driving force on the CME.


    SciTech Connect (OSTI)

    Claire, Mark W.; Sheets, John; Meadows, Victoria S.; Cohen, Martin; Ribas, Ignasi; Catling, David C.


    Understanding changes in the solar flux over geologic time is vital for understanding the evolution of planetary atmospheres because it affects atmospheric escape and chemistry, as well as climate. We describe a numerical parameterization for wavelength-dependent changes to the non-attenuated solar flux appropriate for most times and places in the solar system. We combine data from the Sun and solar analogs to estimate enhanced UV and X-ray fluxes for the young Sun and use standard solar models to estimate changing visible and infrared fluxes. The parameterization, a series of multipliers relative to the modern top of the atmosphere flux at Earth, is valid from 0.1 nm through the infrared, and from 0.6 Gyr through 6.7 Gyr, and is extended from the solar zero-age main sequence to 8.0 Gyr subject to additional uncertainties. The parameterization is applied to a representative modern day flux, providing quantitative estimates of the wavelength dependence of solar flux for paleodates relevant to the evolution of atmospheres in the solar system (or around other G-type stars). We validate the code by Monte Carlo analysis of uncertainties in stellar age and flux, and with comparisons to the solar proxies {kappa}{sup 1} Cet and EK Dra. The model is applied to the computation of photolysis rates on the Archean Earth.

  9. Calibration of laser ablation inductively coupled plasma mass spectrometry using dried solution aerosols for the quantitative analysis of solid samples

    SciTech Connect (OSTI)

    Leach, J.


    Inductively coupled plasma mass spectrometry (ICP-MS) has become the method of choice for elemental and isotopic analysis. Several factors contribute to its success. Modern instruments are capable of routine analysis at part per trillion levels with relative detection limits in part per quadrillion levels. Sensitivities in these instruments can be as high as 200 million counts per second per part per million with linear dynamic ranges up to eight orders of magnitude. With standards for only a few elements, rapid semiquantitative analysis of over 70 elements in an individual sample can be performed. Less than 20 years after its inception ICP-MS has shown to be applicable to several areas of science. These include geochemistry, the nuclear industry, environmental chemistry, clinical chemistry, the semiconductor industry, and forensic chemistry. In this introduction, the general attributes of ICP-MS will be discussed in terms of instrumentation and sample introduction. The advantages and disadvantages of current systems are presented. A detailed description of one method of sample introduction, laser ablation, is given. The paper also gives conclusions and suggestions for future work. Chapter 2, Quantitative analysis of solids by laser ablation inductively coupled plasma mass spectrometry using dried solution aerosols for calibration, has been removed for separate processing.

  10. Multifunctional gold coated rare-earth hydroxide fluoride nanotubes for simultaneous wastewater purification and quantitative pollutant determination

    SciTech Connect (OSTI)

    Zhang, Da-Quan; Sun, Tian-Ying; Yu, Xue-Feng; Jia, Yue; Chen, Ming; Wang, Jia-Hong; Huang, Hao; Chu, Paul K.


    Highlights: • The morphology and properties of Ce-doped yttrium hydroxide fluoride nanotubes (YHF:Ce NTs) were investigated. • YHF:Ce NTs were conjugated with Au nanoparticles to produce Au-YHF:Ce nanocomposites. • Au-YHF:Ce NTs showed excellent capability and efficiency in removing Congo red from solutions. • Au-YHF:Ce NTs were utilized to determine the concentration of Congo red based on SERS. - Abstract: Ce-doped yttrium hydroxide fluoride nanotubes (YHF:Ce NTs) with large surface area are synthesized and conjugated with Au nanoparticles (NPs) to produce Au-YHF:Ce nanocomposites. The Au-YHF:Ce NTs have a hollow structure, rough surface, polymer coating, and good surface-enhanced Raman spectroscopy (SERS) properties. They are applied to wastewater treatment to remove Congo red as a typical pollutant. The materials not only remove pollutants rapidly from the wastewater, but also detect trace amounts of the pollutants quantitatively. The multifunctional Au-YHF:Ce NTs have commercial potential as nano-absorbents and nano-detectors in water treatment and environmental monitoring.

  11. Apparatus and method for qualitative and quantitative measurements of optical properties of turbid media using frequency-domain photon migration

    DOE Patents [OSTI]

    Tromberg, Bruce J.; Tsay, Tsong T.; Berns, Michael W.; Svaasand, Lara O.; Haskell, Richard C.


    Optical measurements of turbid media, that is media characterized by multiple light scattering, is provided through an apparatus and method for exposing a sample to a modulated laser beam. The light beam is modulated at a fundamental frequency and at a plurality of integer harmonics thereof. Modulated light is returned from the sample and preferentially detected at cross frequencies at frequencies slightly higher than the fundamental frequency and at integer harmonics of the same. The received radiance at the beat or cross frequencies is compared against a reference signal to provide a measure of the phase lag of the radiance and modulation ratio relative to a reference beam. The phase and modulation amplitude are then provided as a frequency spectrum by an array processor to which a computer applies a complete curve fit in the case of highly scattering samples or a linear curve fit below a predetermined frequency in the case of highly absorptive samples. The curve fit in any case is determined by the absorption and scattering coefficients together with a concentration of the active substance in the sample. Therefore, the curve fitting to the frequency spectrum can be used both for qualitative and quantitative analysis of substances in the sample even though the sample is highly turbid.

  12. Apparatus and method for qualitative and quantitative measurements of optical properties of turbid media using frequency-domain photon migration

    DOE Patents [OSTI]

    Tromberg, B.J.; Tsay, T.T.; Berns, M.W.; Svaasand, L.O.; Haskell, R.C.


    Optical measurements of turbid media, that is media characterized by multiple light scattering, is provided through an apparatus and method for exposing a sample to a modulated laser beam. The light beam is modulated at a fundamental frequency and at a plurality of integer harmonics thereof. Modulated light is returned from the sample and preferentially detected at cross frequencies at frequencies slightly higher than the fundamental frequency and at integer harmonics of the same. The received radiance at the beat or cross frequencies is compared against a reference signal to provide a measure of the phase lag of the radiance and modulation ratio relative to a reference beam. The phase and modulation amplitude are then provided as a frequency spectrum by an array processor to which a computer applies a complete curve fit in the case of highly scattering samples or a linear curve fit below a predetermined frequency in the case of highly absorptive samples. The curve fit in any case is determined by the absorption and scattering coefficients together with a concentration of the active substance in the sample. Therefore, the curve fitting to the frequency spectrum can be used both for qualitative and quantitative analysis of substances in the sample even though the sample is highly turbid. 14 figs.

  13. Use of Label-Free Quantitative Proteomics To Distinguish the Secreted Cellulolytic Systems of Caldicellulosiruptor bescii and Caldicellulosiruptor obsidiansis

    SciTech Connect (OSTI)

    Lochner, Adriane; Giannone, Richard J; Rodriguez, Jr., Miguel; Mielenz, Jonathan R; Keller, Martin; Antranikian, Garabed; Graham, David E; Hettich, Robert {Bob} L


    The understanding of microbial cellulose degradation systems is a crucial prerequisite to designing an effective operating process for the bioconversion of lignocellulosic biomass into sustainable biofuels. Relevant in this context are members of the extremely thermophilic Gram-positive bacteria genus Caldicellulosiruptor that have been shown to efficiently degrade cellulose, as well as hemicellulose. Although individual representatives from this genus have been closely examined in bioenergy related studies and single components of their cellulolytic enzyme systems have been described, an overall characterization of the cellulose degradation system is still lacking. To this end, a comparative systems level investigation of two closely related species, Caldicellulosiruptor bescii and Caldicellulosiruptor obsidiansis, based on label free quantitative proteomics was conducted to determine the protein composition in the organisms secretome over the course of crystalline cellulose fermentations. Mass spectrometric characterizations together with cellulase activity measurements revealed a substantial abundance increase of a few bifunctional multidomain glycosidases that were composed of the domain families 5, 9, 10 and 48, that appear to be important elements for the cellulose degradation process in Caldicellulosiruptor. However, the number and arrangement of these domains varied in the two organisms, and C. bescii enzymes also contained an additional family 44 and 74, indicating significant differences at the species level. Investigation of a glycosidase solution enriched via affinity digestion revealed the presence of highly thermostable enzymes with optimum cellulase activity at 85 C and pH 5 in both organisms. The C. obsidiansis preparation, however, displayed twice the CMCase and Avicelase activity as the C. bescii preparation.

  14. Impact of Pretreated Switchgrass and Biomass Carbohydrates on Clostridium thermocellum 27405 Cellulosome Composition- a Quantitative Proteomic Analysis

    SciTech Connect (OSTI)

    Raman, Babu; Pan, Chongle; Hurst, Gregory {Greg} B; Rodriguez, Jr., Miguel; McKeown, Catherine K; Lankford, Patricia K; Samatova, Nagiza F; Mielenz, Jonathan R


    The anaerobic thermophilic bacterium Clostridium thermocellum is a cellulolytic organism capable of hydrolyzing cellulose and fermenting the hydrolysis products to ethanol and other metabolic products. C. thermocellum achieves efficient cellulose hydrolysis using multiprotein extracellular enzymatic complexes, termed the cellulosomes. In this study, we used quantitative proteomics (multidimensional LC-MS/MS and 15N-metabolic labeling) to measure relative changes in levels of cellulosomal subunit proteins (per CipA scaffoldin basis) when C. thermocellum was grown on a variety of carbon sources [dilute-acid pretreated switchgrass, cellobiose, amorphous cellulose, crystalline cellulose (Avicel) and combinations of crystalline cellulose with pectin or xylan or both]. Cellulosome samples isolated from cultures grown on these carbon sources were compared to 15N labeled cellulosome samples isolated from crystalline cellulose grown cultures. In total from all samples, proteomic analysis identified 59 dockerin- and 8 cohesin-module containing components, including 15 previously undetected cellulosomal subunits. Many cellulosomal components showed differential protein abundance in the presence of non-cellulose substrates in the growth medium. Cellulosome samples from amorphous cellulose, cellobiose and pretreated switchgrass grown cultures displayed the most distinct differences in composition as compared to cellulosome samples from crystalline cellulose grown cultures. While Glycoside Hydrolase Family 9 enzymes showed increased levels in the presence of crystalline cellulose, and pretreated switchgrass in particular, GH5 enzymes showed increased levels in response to the presence of cellulose in general, amorphous or crystalline. Overall, the results suggest a coordinated substrate-specific regulation of cellulosomal composition in C. thermocellum.

  15. Quantitative and Qualitative Determination of Polysulfide Species in the Electrolyte of a Lithium-Sulfur Battery using HPLC ESI/MS with One-Step Derivatization

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zheng, Dong; Qu, Deyu; Yang, Xiao-Qing; Yu, Xiqian; Lee, Hung-Sui; Qu, Deyang


    The polysulfide species dissolved in aprotic solvents can be separated and analyzed by reverse phase (RP) high performance liquid chromatography (HPLC) in tandem with electrospray-mass spectroscopy. The relative distribution of polysulfide species in the electrolyte recovered from Li-S batteries is quantitatively and reliably determined for the first time.

  16. Quantitative comparison between PGNAA measurements and MCNP calculations in view of the characterization of radioactive wastes in Germany and France

    SciTech Connect (OSTI)

    Mauerhofer, E.; Havenith, A.; Kettler, J.; Carasco, C.; Payan, E.; Ma, J. L.; Perot, B.


    The Forschungszentrum Juelich GmbH (FZJ), together with the Aachen University Rheinisch-Westfaelische Technische Hochschule (RWTH) and the French Alternative Energies and Atomic Energy Commission (CEA Cadarache) are involved in a cooperation aiming at characterizing toxic and reactive elements in radioactive waste packages by means of Prompt Gamma Neutron Activation Analysis (PGNAA). The French and German waste management agencies have indeed defined acceptability limits concerning these elements in view of their projected geological repositories. A first measurement campaign was performed in the new Prompt Gamma Neutron Activation Analysis (PGNAA) facility called MEDINA, at FZJ, to assess the capture gamma-ray signatures of some elements of interest in large samples up to waste drums with a volume of 200 liter. MEDINA is the acronym for Multi Element Detection based on Instrumental Neutron Activation. This paper presents MCNP calculations of the MEDINA facility and quantitative comparison between measurement and simulation. Passive gamma-ray spectra acquired with a high purity germanium detector and calibration sources are used to qualify the numerical model of the crystal. Active PGNAA spectra of a sodium chloride sample measured with MEDINA then allow for qualifying the global numerical model of the measurement cell. Chlorine indeed constitutes a usual reference with reliable capture gamma-ray production data. The goal is to characterize the entire simulation protocol (geometrical model, nuclear data, and postprocessing tools) which will be used for current measurement interpretation, extrapolation of the performances to other types of waste packages or other applications, as well as for the study of future PGNAA facilities.

  17. Characterization and analysis methods for the examination of the heterogeneous solid oxide fuel cell electrode microstructure: Part 2. Quantitative measurement of the microstructure and contributions to transport losses

    SciTech Connect (OSTI)

    Grew, Kyle N.; Peracchio, Aldo A.; Chiu, W. K. S.


    Advanced characterization and analysis of multifunctional materials, such as the materials found in heterogeneous solid oxide fuel cell (SOFC) electrode architectures, can help to provide a qualitative and quantitative understanding of how these structures respond to different manufacturing and operating practices. Dense, opaque materials, which have large X-ray mass absorption coefficients and features on sub-micrometer length scales, can make characterization difficult. Advances in tomographic X-ray imaging can permit this level of detailed characterization, and complement stereographic scanning electron microscope measurements that have also been reported. In this second part of a two-part study, details regarding quantitative characterization methods that have been used to examine the SOFC anode microstructure are reported. The detailed formulation and validation of a phase size distributions for the three constitutive phases, as well as resistive loss microstructure-induced resistive loss distributions in the nickel (Ni) and yttria-stabilized zirconia (YSZ) phases are provided in this section.

  18. A quantitative method for determination of carrier escape efficiency in GaN-based light-emitting diodes: A comparison of open- and short-circuit photoluminescence

    SciTech Connect (OSTI)

    Lim, Seung-Hyuk; Ko, Young-Ho; Cho, Yong-Hoon


    We propose a method to quantitatively analyze the internal quantum efficiency (IQE) as well as the efficiencies of non-radiative recombination in the active region (NRA) and carrier escape out of the active region (ESC) by comparing open-circuit (OC) to short-circuit (SC) conditions of InGaN-based light-emitting diodes (LEDs). First, the IQE was extracted from excitation-power dependent photoluminescence at low temperature, and the electron-hole wavefunction overlaps were calculated under OC and SC conditions. Then, the NRA and ESC efficiencies were quantitatively deduced and also compared with photocurrent data. The proposed method would be useful for assessing and designing quantum barriers and analyzing leakage current in LEDs.

  19. SU-E-QI-17: Dependence of 3D/4D PET Quantitative Image Features On Noise

    SciTech Connect (OSTI)

    Oliver, J; Budzevich, M; Zhang, G; Latifi, K; Dilling, T; Balagurunathan, Y; Gu, Y; Grove, O; Feygelman, V; Gillies, R; Moros, E; Lee, H.


    Purpose: Quantitative imaging is a fast evolving discipline where a large number of features are extracted from images; i.e., radiomics. Some features have been shown to have diagnostic, prognostic and predictive value. However, they are sensitive to acquisition and processing factors; e.g., noise. In this study noise was added to positron emission tomography (PET) images to determine how features were affected by noise. Methods: Three levels of Gaussian noise were added to 8 lung cancer patients PET images acquired in 3D mode (static) and using respiratory tracking (4D); for the latter images from one of 10 phases were used. A total of 62 features: 14 shape, 19 intensity (1stO), 18 GLCM textures (2ndO; from grey level co-occurrence matrices) and 11 RLM textures (2ndO; from run-length matrices) features were extracted from segmented tumors. Dimensions of GLCM were 256256, calculated using 3D images with a step size of 1 voxel in 13 directions. Grey levels were binned into 256 levels for RLM and features were calculated in all 13 directions. Results: Feature variation generally increased with noise. Shape features were the most stable while RLM were the most unstable. Intensity and GLCM features performed well; the latter being more robust. The most stable 1stO features were compactness, maximum and minimum length, standard deviation, root-mean-squared, I30, V10-V90, and entropy. The most stable 2ndO features were entropy, sum-average, sum-entropy, difference-average, difference-variance, difference-entropy, information-correlation-2, short-run-emphasis, long-run-emphasis, and run-percentage. In general, features computed from images from one of the phases of 4D scans were more stable than from 3D scans. Conclusion: This study shows the need to characterize image features carefully before they are used in research and medical applications. It also shows that the performance of features, and thereby feature selection, may be assessed in part by noise analysis.

  20. Imaging and quantitative data acquisition of biological cell walls with Atomic Force Microscopy and Scanning Acoustic Microscopy

    SciTech Connect (OSTI)

    Tittmann, B. R.; Xi, X.


    This chapter demonstrates the feasibility of Atomic Force Microscopy (AFM) and High Frequency Scanning Acoustic Microscopy (HF-SAM) as tools to characterize biological tissues. Both the AFM and the SAM have shown to provide imaging (with different resolution) and quantitative elasticity measuring abilities. Plant cell walls with minimal disturbance and under conditions of their native state have been examined with these two kinds of microscopy. After descriptions of both the SAM and AFM, their special features and the typical sample preparation is discussed. The sample preparation is focused here on epidermal peels of onion scales and celery epidermis cells which were sectioned for the AFM to visualize the inner surface (closest to the plasma membrane) of the outer epidermal wall. The nm-wide cellulose microfibrils orientation and multilayer structure were clearly observed. The microfibril orientation and alignment tend to be more organized in older scales compared with younger scales. The onion epidermis cell wall was also used as a test analog to study cell wall elasticity by the AFM nanoindentation and the SAM V(z) feature. The novelty in this work was to demonstrate the capability of these two techniques to analyze isolated, single layered plant cell walls in their natural state. AFM nanoindentation was also used to probe the effects of Ethylenediaminetetraacetic acid (EDTA), and calcium ion treatment to modify pectin networks in cell walls. The results suggest a significant modulus increase in the calcium ion treatment and a slight decrease in EDTA treatment. To complement the AFM measurements, the HF-SAM was used to obtain the V(z) signatures of the onion epidermis. These measurements were focused on documenting the effect of pectinase enzyme treatment. The results indicate a significant change in the V(z) signature curves with time into the enzyme treatment. Thus AFM and HF-SAM open the door to a systematic nondestructive structure and mechanical property study of complex biological cell walls. A unique feature of this approach is that both microscopes allow the biological samples to be examined in their natural fluid (water) environment.

  1. Implications of CT noise and artifacts for quantitative {sup 99m}Tc SPECT/CT imaging

    SciTech Connect (OSTI)

    Hulme, K. W.; Kappadath, S. C.


    Purpose: This paper evaluates the effects of computed tomography (CT) image noise and artifacts on quantitative single-photon emission computed-tomography (SPECT) imaging, with the aim of establishing an appropriate range of CT acquisition parameters for low-dose protocols with respect to accurate SPECT attenuation correction (AC). Methods: SPECT images of two geometric and one anthropomorphic phantom were reconstructed iteratively using CT scans acquired at a range of dose levels (CTDI{sub vol} = 0.4 to 46 mGy). Resultant SPECT image quality was evaluated by comparing mean signal, background noise, and artifacts to SPECT images reconstructed using the highest dose CT for AC. Noise injection was performed on linear-attenuation (?) maps to determine the CT noise threshold for accurate AC. Results: High levels of CT noise (? ? 200400 HU) resulted in low ?-maps noise (? ? 1%3%). Noise levels greater than ?10% in 140 keV ?-maps were required to produce visibly perceptible increases of ?15% in {sup 99m}Tc SPECT images. These noise levels would be achieved at low CT dose levels (CTDI{sub vol} = 4 ?Gy) that are over 2 orders of magnitude lower than the minimum dose for diagnostic CT scanners. CT noise could also lower (bias) the expected ? values. The relative error in reconstructed SPECT signal trended linearly with the relative shift in ?. SPECT signal was, on average, underestimated in regions corresponding with beam-hardening artifacts in CT images. Any process that has the potential to change the CT number of a region by ?100 HU (e.g., misregistration between CT images and SPECT images due to motion, the presence of contrast in CT images) could introduce errors in ?{sub 140} {sub keV} on the order of 10%, that in turn, could introduce errors on the order of ?10% into the reconstructed {sup 99m}Tc SPECT image. Conclusions: The impact of CT noise on SPECT noise was demonstrated to be negligible for clinically achievable CT parameters. Because CT dose levels that affect SPECT quantification is low (CTDI{sub vol} ? 4 ?Gy), the low dose limit for the CT exam as part of SPECT/CT will be guided by CT image quality requirements for anatomical localization and artifact reduction. A CT technique with higher kVp in combination with lower mAs is recommended when low-dose CT images are used for AC to minimize beam-hardening artifacts.

  2. Assessment of beating parameters in human induced pluripotent stem cells enables quantitative in vitro screening for cardiotoxicity

    SciTech Connect (OSTI)

    Sirenko, Oksana; Cromwell, Evan F.; Crittenden, Carole; Wignall, Jessica A.; Wright, Fred A.; Rusyn, Ivan


    Human induced pluripotent stem cell (iPSC)-derived cardiomyocytes show promise for screening during early drug development. Here, we tested a hypothesis that in vitro assessment of multiple cardiomyocyte physiological parameters enables predictive and mechanistically-interpretable evaluation of cardiotoxicity in a high-throughput format. Human iPSC-derived cardiomyocytes were exposed for 30 min or 24 h to 131 drugs, positive (107) and negative (24) for in vivo cardiotoxicity, in up to 6 concentrations (3 nM to 30 uM) in 384-well plates. Fast kinetic imaging was used to monitor changes in cardiomyocyte function using intracellular Ca{sup 2+} flux readouts synchronous with beating, and cell viability. A number of physiological parameters of cardiomyocyte beating, such as beat rate, peak shape (amplitude, width, raise, decay, etc.) and regularity were collected using automated data analysis. Concentrationresponse profiles were evaluated using logistic modeling to derive a benchmark concentration (BMC) point-of-departure value, based on one standard deviation departure from the estimated baseline in vehicle (0.3% dimethyl sulfoxide)-treated cells. BMC values were used for cardiotoxicity classification and ranking of compounds. Beat rate and several peak shape parameters were found to be good predictors, while cell viability had poor classification accuracy. In addition, we applied the Toxicological Prioritization Index (ToxPi) approach to integrate and display data across many collected parameters, to derive cardiosafety ranking of tested compounds. Multi-parameter screening of beating profiles allows for cardiotoxicity risk assessment and identification of specific patterns defining mechanism-specific effects. These data and analysis methods may be used widely for compound screening and early safety evaluation in drug development. - Highlights: Induced pluripotent stem cell-derived cardiomyocytes are promising in vitro models. We tested if evaluation of cardiotoxicity is possible in a high-throughput format. The assay shows benefits of automated data integration across multiple parameters. Quantitative assessment of concentrationresponse is possible using iPSCs. Multi-parametric screening allows for cardiotoxicity risk assessment.

  3. SU-E-QI-14: Quantitative Variogram Detection of Mild, Unilateral Disease in Elastase-Treated Rats

    SciTech Connect (OSTI)

    Jacob, R; Carson, J


    Purpose: Determining the presence of mild or early disease in the lungs can be challenging and subjective. We present a rapid and objective method for evaluating lung damage in a rat model of unilateral mild emphysema based on a new approach to heterogeneity assessment. We combined octree decomposition (used in three-dimensional (3D) computer graphics) with variograms (used in geostatistics to assess spatial relationships) to evaluate 3D computed tomography (CT) lung images for disease. Methods: Male, Sprague-Dawley rats (232 ± 7 g) were intratracheally dosed with 50 U/kg of elastase dissolved in 200 μL of saline to a single lobe (n=6) or with saline only (n=5). After four weeks, 3D micro-CT images were acquired at end expiration on mechanically ventilated rats using prospective gating. Images were masked, and lungs were decomposed to homogeneous blocks of 2×2×2, 4×4×4, and 8×8×8 voxels using octree decomposition. The spatial variance – the square of the difference of signal intensity – between all pairs of the 8×8×8 blocks was calculated. Variograms – graphs of distance vs. variance - were made, and data were fit to a power law and the exponent determined. The mean HU values, coefficient of variation (CoV), and the emphysema index (EI) were calculated and compared to the variograms. Results: The variogram analysis showed that significant differences between groups existed (p<0.01), whereas the mean HU (p=0.07), CoV (p=0.24), and EI (p=0.08) did not. Calculation time for the variogram for a typical 1000 block decomposition was ∼6 seconds, and octree decomposition took ∼2 minutes. Decomposing the images prior to variogram calculation resulted in a ∼700x decrease in time as compared to other published approaches. Conclusions: Our results suggest that the approach combining octree decomposition and variogram analysis may be a rapid, non-subjective, and sensitive imaging-based biomarker for quantitative characterization of lung disease.

  4. Quantitative Single-Particle Digital Autoradiography with ?-Particle Emitters for Targeted Radionuclide Therapy using the iQID Camera

    SciTech Connect (OSTI)

    Miller, Brian W.; Frost, Sophia; Frayo, Shani; Kenoyer, Aimee L.; Santos, E. B.; Jones, Jon C.; Green, Damian J.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.; Orozco, Johnnie J.; Press, Oliver W.; Pagel, John M.; Sandmaier, B. M.


    Abstract Alpha emitting radionuclides exhibit a potential advantage for cancer treatments because they release large amounts of ionizing energy over a few cell diameters (5080 ?m) causing localized, irreparable double-strand DNA breaks that lead to cell death. Radioimmunotherapy (RIT) approaches using monoclonal antibodies labeled with alpha emitters may inactivate targeted cells with minimal radiation damage to surrounding tissues. For accurate dosimetry in alpha-RIT, tools are needed to visualize and quantify the radioactivity distribution and absorbed dose to targeted and non-targeted cells, especially for organs and tumors with heterogeneous radionuclide distributions. The aim of this study was to evaluate and characterize a novel single-particle digital autoradiography imager, iQID (ionizing-radiation Quantum Imaging Detector), for use in alpha-RIT experiments. Methods: The iQID camera is a scintillator-based radiation detection technology that images and identifies charged-particle and gamma-ray/X-ray emissions spatially and temporally on an event-by-event basis. It employs recent advances in CCD/CMOS cameras and computing hardware for real-time imaging and activity quantification of tissue sections, approaching cellular resolutions. In this work, we evaluated this systems characteristics for alpha particle imaging including measurements of spatial resolution and background count rates at various detector configurations and quantification of activity distributions. The technique was assessed for quantitative imaging of astatine-211 (211At) activity distributions in cryosections of murine and canine tissue samples. Results: The highest spatial resolution was measured at ~20 ?m full width at half maximum (FWHM) and the alpha particle background was measured at a rate of (2.6 0.5) 104 cpm/cm2 (40 mm diameter detector area). Simultaneous imaging of multiple tissue sections was performed using a large-area iQID configuration ( 11.5 cm). Estimation of the 211At activity distribution was demonstrated at mBq/?g levels. Conclusion: Single-particle digital autoradiography of alpha emitters has advantages over traditional autoradiographic techniques in terms of spatial resolution, sensitivity, and activity quantification capability. The system features and characterization results presented in this study show that iQID is a promising technology for microdosimetry, because it provides necessary information for interpreting alpha-RIT outcomes and for predicting the therapeutic efficacy of cell-targeted approaches using alpha emitters.

  5. Quantitative single-particle digital autoradiography with ?-particle emitters for targeted radionuclide therapy using the iQID camera

    SciTech Connect (OSTI)

    Miller, Brian W.; Frost, Sofia H. L.; Frayo, Shani L.; Kenoyer, Aimee L.; Santos, Erlinda; Jones, Jon C.; Orozco, Johnnie J.; Green, Damian J.; Press, Oliver W.; Pagel, John M.; Sandmaier, Brenda M.; Hamlin, Donald K.; Wilbur, D. Scott; Fisher, Darrell R.


    Purpose: Alpha-emitting radionuclides exhibit a potential advantage for cancer treatments because they release large amounts of ionizing energy over a few cell diameters (5080 ?m), causing localized, irreparable double-strand DNA breaks that lead to cell death. Radioimmunotherapy (RIT) approaches using monoclonal antibodies labeled with ? emitters may thus inactivate targeted cells with minimal radiation damage to surrounding tissues. Tools are needed to visualize and quantify the radioactivity distribution and absorbed doses to targeted and nontargeted cells for accurate dosimetry of all treatment regimens utilizing ? particles, including RIT and others (e.g., Ra-223), especially for organs and tumors with heterogeneous radionuclide distributions. The aim of this study was to evaluate and characterize a novel single-particle digital autoradiography imager, the ionizing-radiation quantum imaging detector (iQID) camera, for use in ?-RIT experiments. Methods: The iQID camera is a scintillator-based radiation detection system that images and identifies charged-particle and gamma-ray/x-ray emissions spatially and temporally on an event-by-event basis. It employs CCD-CMOS cameras and high-performance computing hardware for real-time imaging and activity quantification of tissue sections, approaching cellular resolutions. In this work, the authors evaluated its characteristics for ?-particle imaging, including measurements of intrinsic detector spatial resolutions and background count rates at various detector configurations and quantification of activity distributions. The technique was assessed for quantitative imaging of astatine-211 ({sup 211}At) activity distributions in cryosections of murine and canine tissue samples. Results: The highest spatial resolution was measured at ?20 ?m full width at half maximum and the ?-particle background was measured at a rate as low as (2.6 0.5) 10{sup ?4} cpm/cm{sup 2} (40 mm diameter detector area). Simultaneous imaging of multiple tissue sections was performed using a large-area iQID configuration ( 11.5 cm). Estimation of the {sup 211}At activity distribution was demonstrated at mBq/?g-levels. Conclusions: Single-particle digital autoradiography of ? emitters has advantages over traditional film-based autoradiographic techniques that use phosphor screens, in terms of spatial resolution, sensitivity, and activity quantification capability. The system features and characterization results presented in this study show that the iQID is a promising technology for microdosimetry, because it provides necessary information for interpreting alpha-RIT outcomes and for predicting the therapeutic efficacy of cell-targeted approaches using ? emitters.

  6. Quantitative modeling of the accuracy in registering preoperative patient-specific anatomic models into left atrial cardiac ablation procedures

    SciTech Connect (OSTI)

    Rettmann, Maryam E. Holmes, David R.; Camp, Jon J.; Cameron, Bruce M.; Robb, Richard A.; Kwartowitz, David M.; Gunawan, Mia; Johnson, Susan B.; Packer, Douglas L.; Dalegrave, Charles; Kolasa, Mark W.


    Purpose: In cardiac ablation therapy, accurate anatomic guidance is necessary to create effective tissue lesions for elimination of left atrial fibrillation. While fluoroscopy, ultrasound, and electroanatomic maps are important guidance tools, they lack information regarding detailed patient anatomy which can be obtained from high resolution imaging techniques. For this reason, there has been significant effort in incorporating detailed, patient-specific models generated from preoperative imaging datasets into the procedure. Both clinical and animal studies have investigated registration and targeting accuracy when using preoperative models; however, the effect of various error sources on registration accuracy has not been quantitatively evaluated. Methods: Data from phantom, canine, and patient studies are used to model and evaluate registration accuracy. In the phantom studies, data are collected using a magnetically tracked catheter on a static phantom model. Monte Carlo simulation studies were run to evaluate both baseline errors as well as the effect of different sources of error that would be present in a dynamicin vivo setting. Error is simulated by varying the variance parameters on the landmark fiducial, physical target, and surface point locations in the phantom simulation studies. In vivo validation studies were undertaken in six canines in which metal clips were placed in the left atrium to serve as ground truth points. A small clinical evaluation was completed in three patients. Landmark-based and combined landmark and surface-based registration algorithms were evaluated in all studies. In the phantom and canine studies, both target registration error and point-to-surface error are used to assess accuracy. In the patient studies, no ground truth is available and registration accuracy is quantified using point-to-surface error only. Results: The phantom simulation studies demonstrated that combined landmark and surface-based registration improved landmark-only registration provided the noise in the surface points is not excessively high. Increased variability on the landmark fiducials resulted in increased registration errors; however, refinement of the initial landmark registration by the surface-based algorithm can compensate for small initial misalignments. The surface-based registration algorithm is quite robust to noise on the surface points and continues to improve landmark registration even at high levels of noise on the surface points. Both the canine and patient studies also demonstrate that combined landmark and surface registration has lower errors than landmark registration alone. Conclusions: In this work, we describe a model for evaluating the impact of noise variability on the input parameters of a registration algorithm in the context of cardiac ablation therapy. The model can be used to predict both registration error as well as assess which inputs have the largest effect on registration accuracy.

  7. Integrating mRNA and protein sequencing enables the detection and quantitative profiling of natural protein sequence variants of Populus trichocarpa

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Abraham, Paul E.; Wang, Xiaojing; Ranjan, Priya; Zhang, Bing; Tuskan, Gerald A.; Robert L. Hettich; Nookaew, Intawat


    The availability of next-generation sequencing technologies has rapidly transformed our ability to link genotypes to phenotypes, and as such, promises to facilitate the dissection of genetic contribution to complex traits. Although discoveries of genetic associations will further our understanding of biology, once candidate variants have been identified, investigators are faced with the challenge of characterizing the functional effects on proteins encoded by such genes. Here we show how next-generation RNA sequencing data can be exploited to construct genotype-specific protein sequence databases, which provide a clearer picture of the molecular toolbox underlying cellular and organismal processes and their variation in amore » natural population. For this study, we used two individual genotypes (DENA-17-3 and VNDL-27-4) from a recent genome wide association (GWA) study of Populus trichocarpa, an obligate outcrosser that exhibits tremendous phenotypic variation across the natural population. This strategy allowed us to comprehensively catalogue proteins containing single amino acid polymorphisms (SAAPs) and insertions and deletions (INDELS). Based on large-scale identification of SAAPs, we profiled the frequency of 128 types of naturally occurring amino acid substitutions, with a subset of SAAPs occurring in regions of the genome having strong polymorphism patterns consistent with recent positive and/or divergent selection. In addition, we were able to explore the diploid landscape of Populus at the proteome-level, allowing the characterization of heterozygous variants.« less

  8. Development of a Multi-Point Quantitation Method to Simultaneously Measure Enzymatic and Structural Components of the Clostridium thermocellum Cellulosome Protein Complex

    SciTech Connect (OSTI)

    Dykstra, Andrew B; St. Brice, Lois; Rodriguez, Jr., Miguel; Raman, Babu; Izquierdo, Javier; Cook, Kelsey; Lynd, Lee R; Hettich, Robert {Bob} L


    Clostridium thermocellum has emerged as a leading bioenergy-relevant microbe due to its ability to solubilize cellulose into carbohydrates, mediated by multi-component membrane-attached complexes termed cellulosomes. To probe microbial cellulose utilization rates, it is desirable to be able to measure the concentrations of saccharolytic enzymes and estimate the total amount of cellulosome present on a mass basis. Current cellulase determination methodologies involve labor-intensive purification procedures and only allow for indirect determination of abundance. We have developed a method using multiple reaction monitoring (MRM-MS) to simultaneously quantitate both enzymatic and structural components of the cellulosome protein complex in samples ranging in complexity from purified cellulosomes to whole cell lysates, as an alternative to a previously-developed enzyme-linked immunosorbent assay (ELISA) method of cellulosome quantitation. The precision of the cellulosome mass concentration in technical replicates is better than 5% relative standard deviation for all samples, indicating high precision for determination of the mass concentration of cellulosome components.

  9. Sci—Thur PM: Imaging — 05: Calibration of a SPECT/CT camera for quantitative SPECT with {sup 99m}Tc

    SciTech Connect (OSTI)

    Gaudin, Émilie; Montégiani, Jean-François; Després, Philippe; Beauregard, Jean-Mathieu


    While quantitation is the norm in PET, it is not widely available yet in SPECT. This work's aim was to calibrate a commercially available SPECT/CT system to perform quantitative SPECT. Counting sensitivity, dead-time (DT) constant and partial volume effect (PVE) of the system were assessed. A dual-head Siemens SymbiaT6 SPECT/CT camera equipped with low energy high-resolution collimators was studied. {sup 99m}Tc was the radioisotope of interest because of its wide usage in nuclear medicine. First, point source acquisitions were performed (activity: 30–990MBq). Further acquisitions were then performed with a uniform Jaszczak phantom filled with water at high activity (25–5000MBq). PVE was studied using 6 hot spheres (diameters: 9.9–31.2 mm) filled with {sup 99m}Tc (2.8MBq/cc) in the Jaszczak phantom, which was: (1) empty, (2) water-filled and (3) water-filled with low activity (0.1MBq/cc). The data was reconstructed with the Siemens's Flash3D iterative algorithm with 4 subsets and 8 iterations, attenuation-correction (AC) and scatter-correction (SC). DT modelling was based on the total spectrum counting rate. Sensitivity was assessed using AC-SC reconstructed SPECT data. Sensitivity and DT for the sources were 99.51±1.46cps/MBq and 0.60±0.04µs. For the phantom, sensitivity and DT were 109.9±2.3cps/MBq and 0.62±0.13µs. The recovery-coefficient varied from 5% for the 9.9mm, to 80% for the 31.2mm spheres. With our calibration methods, both sensitivity and DT constant of the SPECT camera had little dependence on the object geometry and attenuation. For small objects of known size, recovery-coefficient can be applied to correct PVE. Clinical quantitative SPECT appears to be possible and has many potential applications.

  10. Quantitative assessment of alkali-reactive aggregate mineral content through XRD using polished sections as a supplementary tool to RILEM AAR-1 (petrographic method)

    SciTech Connect (OSTI)

    Castro, Nelia; Sorensen, Bjorn E.; Broekmans, Maarten A.T.M.


    The mineral content of 5 aggregate samples from 4 different countries, including reactive and non-reactive aggregate types, was assessed quantitatively by X-ray diffraction (XRD) using polished sections. Additionally, electron probe microanalyzer (EPMA) mapping and cathodoluminescence (CL) were used to characterize the opal-CT identified in one of the aggregate samples. Critical review of results from polished sections against traditionally powdered specimen has demonstrated that for fine-grained rocks without preferred orientation the assessment of mineral content by XRD using polished sections may represent an advantage over traditional powder specimens. Comparison of data on mineral content and silica speciation with expansion data from PARTNER project confirmed that the presence of opal-CT plays an important role in the reactivity of one of the studied aggregates. Used as a complementary tool to RILEM AAR-1, the methodology suggested in this paper has the potential to improve the strength of the petrographic method.

  11. Towards quantitative off-axis electron holographic mapping of the electric field around the tip of a sharp biased metallic needle

    SciTech Connect (OSTI)

    Beleggia, M.; Kasama, T.; Larson, D. J.; Kelly, T. F.; Dunin-Borkowski, R. E.; Pozzi, G.


    We apply off-axis electron holography and Lorentz microscopy in the transmission electron microscope to map the electric field generated by a sharp biased metallic tip. A combination of experimental data and modelling provides quantitative information about the potential and the field around the tip. Close to the tip apex, we measure a maximum field intensity of 82 MV/m, corresponding to a field k factor of 2.5, in excellent agreement with theory. In order to verify the validity of the measurements, we use the inferred charge density distribution in the tip region to generate simulated phase maps and Fresnel (out-of-focus) images for comparison with experimental measurements. While the overall agreement is excellent, the simulations also highlight the presence of an unexpected astigmatic contribution to the intensity in a highly defocused Fresnel image, which is thought to result from the geometry of the applied field.

  12. Method for quantitative determination and separation of trace amounts of chemical elements in the presence of large quantities of other elements having the same atomic mass

    DOE Patents [OSTI]

    Miller, C.M.; Nogar, N.S.


    Photoionization via autoionizing atomic levels combined with conventional mass spectroscopy provides a technique for quantitative analysis of trace quantities of chemical elements in the presence of much larger amounts of other elements with substantially the same atomic mass. Ytterbium samples smaller than 10 ng have been detected using an ArF* excimer laser which provides the atomic ions for a time-of-flight mass spectrometer. Elemental selectivity of greater than 5:1 with respect to lutetium impurity has been obtained. Autoionization via a single photon process permits greater photon utilization efficiency because of its greater absorption cross section than bound-free transitions, while maintaining sufficient spectroscopic structure to allow significant photoionization selectivity between different atomic species. Separation of atomic species from others of substantially the same atomic mass is also described.

  13. Evaluating quantitative 3-D image analysis as a design tool for low enriched uranium fuel compacts for the transient reactor test facility: A preliminary study

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kane, J. J.; van Rooyen, I. J.; Craft, A. E.; Roney, T. J.; Morrell, S. R.


    In this study, 3-D image analysis when combined with a non-destructive examination technique such as X-ray computed tomography (CT) provides a highly quantitative tool for the investigation of a material’s structure. In this investigation 3-D image analysis and X-ray CT were combined to analyze the microstructure of a preliminary subsized fuel compact for the Transient Reactor Test Facility’s low enriched uranium conversion program to assess the feasibility of the combined techniques for use in the optimization of the fuel compact fabrication process. The quantitative image analysis focused on determining the size and spatial distribution of the surrogate fuel particles andmore » the size, shape, and orientation of voids within the compact. Additionally, the maximum effect of microstructural features on heat transfer through the carbonaceous matrix of the preliminary compact was estimated. The surrogate fuel particles occupied 0.8% of the compact by volume with a log-normal distribution of particle sizes with a mean diameter of 39 μm and a standard deviation of 16 μm. Roughly 39% of the particles had a diameter greater than the specified maximum particle size of 44 μm suggesting that the particles agglomerate during fabrication. The local volume fraction of particles also varies significantly within the compact although uniformities appear to be evenly dispersed throughout the analysed volume. The voids produced during fabrication were on average plate-like in nature with their major axis oriented perpendicular to the compaction direction of the compact. Finally, the microstructure, mainly the large preferentially oriented voids, may cause a small degree of anisotropy in the thermal diffusivity within the compact. α∥/α⊥, the ratio of thermal diffusivities parallel to and perpendicular to the compaction direction are expected to be no less than 0.95 with an upper bound of 1.« less

  14. [Studies of biologic activation associated with molecular receptor increase and tumor response in ChL6/L6 protocol patients; Studies in phantoms; Quantitative SPECT; Preclinical studies; and Clinical studies]. DOE annual report, 1994--95

    SciTech Connect (OSTI)

    DeNardo, S.J.


    The authors describe results which have not yet been published from their associated studies listed in the title. For the first, they discuss Lym-1 single chain genetically engineered molecules, analysis of molecular genetic coded messages to enhance tumor response, and human dosimetry and therapeutic human use radiopharmaceuticals. Studies in phantoms includes a discussion of planar image quantitation, counts coincidence correction, organ studies, tumor studies, and {sup 90}Y quantitation with Bremsstrahlung imaging. The study on SPECT discusses attenuation correction and scatter correction. Preclinical studies investigated uptake of {sup 90}Y-BrE-3 in mice using autoradiography. Clinical studies discuss image quantitation verses counts from biopsy samples, S factors for radiation dose calculation, {sup 67}Cu imaging studies for lymphoma cancer, and {sup 111}In MoAb imaging studies for breast cancer to predict {sup 90}Y MoAb therapy.

  15. Final technical report for project titled Quantitative Characterization of Cell Aggregation/Adhesion as Predictor for Distribution and Transport of Microorganisms in Subsurface Environment

    SciTech Connect (OSTI)

    Gu, April Z; Wan, Kai-tak


    This project aims to explore and develop enabling methodology and techniques for nano-scale characterization of microbe cell surface contact mechanics, interactions and adhesion quantities that allow for identification and quantification of indicative properties related to microorganism migration and transport behavior in porous media and in subsurface environments. Microbe transport has wide impact and therefore is of great interest in various environmental applications such as in situ or enhanced subsurface bioremediation,filtration processes for water and wastewater treatments and protection of drinking water supplies. Although great progress has been made towards understanding the identities and activities of these microorganisms in the subsurface, to date, little is known of the mechanisms that govern the mobility and transport of microorganisms in DOE’s contaminated sites, making the outcomes of in situ natural attenuation or contaminant stability enhancement unpredictable. Conventionally, movement of microorganisms was believed to follows the rules governing solute (particle) transport. However, recent studies revealed that cell surface properties, especially those pertaining to cell attachment/adhesion and aggregation behavior, can cause the microbe behavior to deviate from non-viable particles and hence greatly influence the mobility and distribution of microorganisms in porous media.This complexity highlights the need to obtain detailed information of cell-cell and cell-surface interactions in order to improve and refine the conceptual and quantitative model development for fate and transport of microorganisms and contaminant in subsurface. Traditional cell surface characterization methods are not sufficient to fully predict the deposition rates and transport behaviors of microorganism observed. A breakthrough of methodology that would allow for quantitative and molecular-level description of intrinsic cell surface properties indicative for cell-surface interactions is essential for the field. To tackle this, we have developed a number of new Bio-nanomechanical techniques, including reflection interference contrast microscopy (RICM) and bio-AFM (Atomic Force Microscopy), for cell adhesion-detachment measurement of the long-range surface interactions, in combination with mathematical modeling, which would allow us to characterize the mechanical behavior from single cell to multi-cell aggregate, critical thresholds for large scale coaggregation and transportation of cells and aggregates in the presence of long range inter-surface forces etc. Although some technical and mathematical challenges remain, the preliminary results promise great breakthrough potential. In this study, we investigated the cellular surface characteristics of representative bio-remediating microorganisms relevant to DOE IFRC (Integrated Field-Scale Subsurface Research Challenges) sites and their transport behaviors in porous media, aiming to draw a groundbreaking correlation between the micro-scale genetic and biological origin-based cell surface properties, the consequent mechanical adhesion and aggregation behaviors, and the macro-scale microbial mobility and retention in porous media, which are unavailable in the literature. The long-term goal is to significantly improve the mechanistic and quantitative understanding of microbial mobility, sorption, and transport within reactive transport models as needed to manipulate subsurface contaminant fate and transport predictions.

  16. SU-E-J-229: Quantitative Assessment for Timely Adaptive Re-Planning Using Weekly Dose Monitoring for Head and Neck Cancer

    SciTech Connect (OSTI)

    Shang, Q; Liu, H; Greskovich, J; Koyfman, S; Xia, P; Li, Z


    Purpose: For patients with head and neck (HN) cancer, mid-course adaptive radiation therapy (ART) is a common practice in our institution to accommodate anatomic changes. The aim of the study is to evaluate whether dose re-calculation on weekly verification images can provide quantitative assessment for timely adaptive re-planning with daily image-guided intensity modulated radiotherapy (IMRT). Methods: We retrospectively selected sixty daily verification images acquired on CT-on-rail/CBCT from ten HN patients. These image sets were typically a week apart. Among these patients, six patients received a mid-course ART. Contours of the tumors and organ-at-risks (OARs) were manually delineated by a physician on each verification CT. After placing the treatment iso-center on the verification CTs according to the recorded clinical shifts, daily dose was re-calculated with the same beam configuration as the original plan. For the purpose of this study, electron densities for both verification CTs and planning CTs were set to 1.0 g/cm3. Results: Two patients had D99 of the CTV < 97% of the planned dose for more than three fractions due to remarkable tumor volume shrinkages. D-max of the spinal cord exceeded a tolerance of 45 Gy for four fractions in additional two patients. D-mean of the parotid increased within 25% of the planned value. D-max of the brainstem and D-mean of the oral cavity did not show significant variation. If the re-planning criteria included D99 of the CTV < 97% of the planned dose and D-max of the spinal cord > 45 Gy, two out ten patients required ART at week 2 and two patients required ART at week 3, respectively. Conclusion: Weekly dose monitoring with re-calculation on verification images can provide quantitative dose guidance for timely adaptive re-planning. Future work will include accumulative dose analysis for the decision of adaptive re-planning. The study is supported in part by Siemens Medical Solutions.

  17. Time-Resolved Quantitative Measurement of OH HO2 and CH2O in Fuel Oxidation Reactions by High Resolution IR Absorption Spectroscopy.

    SciTech Connect (OSTI)

    Huang, Haifeng; Rotavera, Brandon; Taatjes, Craig A.


    Combined with a Herriott-type multi-pass slow flow reactor, high-resolution differential direct absorption spectroscopy has been used to probe, in situ and quantitatively, hydroxyl (OH), hydroperoxy (HO 2 ) and formaldehyde (CH 2 O) molecules in fuel oxidation reactions in the reactor, with a time resolution of about 1 micro-second. While OH and CH 2 O are probed in the mid-infrared (MIR) region near 2870nm and 3574nm respectively, HO 2 can be probed in both regions: near-infrared (NIR) at 1509nm and MIR at 2870nm. Typical sensitivities are on the order of 10 10 - 10 11 molecule cm -3 for OH at 2870nm, 10 11 molecule cm -3 for HO 2 at 1509nm, and 10 11 molecule cm -3 for CH 2 O at 3574nm. Measurements of multiple important intermediates (OH and HO 2 ) and product (CH 2 O) facilitate to understand and further validate chemical mechanisms of fuel oxidation chemistry.

  18. Quantitative Phase Composition of TiO2-Coated Nanoporous-Au Monoliths by X-ray Absorption Spectroscopy and Correlations to Catalytic

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bagge-Hansen, Michael; Wichmann, Andre; Wittstock, Arne; Lee, Jonathan R. I.; Ye, Jianchao; Willey, Trevor M.; Kuntz, Joshua D.; van Buuren, Tony; Biener, Juergen; Baumer, Marcus; et al


    Porous titania/metal composite materials have many potential applications in the fields of green catalysis, energy harvesting, and storage in which both the overall morphology of the nanoporous host material and the crystallographic phase of the titania (TiO 2) guest determine the material’s performance. New insights into the structure–function relationships of these materials were obtained by near-edge X-ray absorption fine structure (NEXAFS) spectroscopy that, for example, provides quantitative crystallographic phase composition from ultrathin, nanostructured titania films, including sensitivity to amorphous components. We demonstrate that crystallographic phase, morphology, and catalytic activity of TiO 2-functionalized nanoporous gold (np-Au) can be controlled by amore » simple annealing procedure (T < 1300 K). The material was prepared by atomic layer deposition of ~2 nm thick TiO2 on millimeter-sized samples of np-Au (40–50 nm mean ligament size) and catalytically investigated with respect to aerobic CO oxidation. Moreover, the annealing-induced changes in catalytic activity are correlated with concurrent morphology and phase changes as provided by cross-sectional scanning electron microscopy, transmission electron microscopy, and near-edge X-ray absorption fine structure (NEXAFS) spectroscopy.« less

  19. Homogeneity testing and quantitative analysis of manganese (Mn) in vitrified Mn-doped glasses by laser-induced breakdown spectroscopy (LIBS)

    SciTech Connect (OSTI)

    Unnikrishnan, V. K.; Nayak, Rajesh; Kartha, V. B.; Santhosh, C. E-mail:; Sonavane, M. S.; Yeotikar, R. G.; Shah, M. L.; Gupta, G. P.; Suri, B. M.


    Laser-induced breakdown spectroscopy (LIBS), an atomic emission spectroscopy method, has rapidly grown as one of the best elemental analysis techniques over the past two decades. Homogeneity testing and quantitative analysis of manganese (Mn) in manganese-doped glasses have been carried out using an optimized LIBS system employing a nanosecond ultraviolet Nd:YAG laser as the source of excitation. The glass samples have been prepared using conventional vitrification methods. The laser pulse irradiance on the surface of the glass samples placed in air at atmospheric pressure was about 1.710{sup 9} W/cm{sup 2}. The spatially integrated plasma emission was collected and imaged on to the spectrograph slit using an optical-fiber-based collection system. Homogeneity was checked by recording LIBS spectra from different sites on the sample surface and analyzing the elemental emission intensities for concentration determination. Validation of the observed LIBS results was done by comparison with scanning electron microscope- energy dispersive X-ray spectroscopy (SEM-EDX) surface elemental mapping. The analytical performance of the LIBS system has been evaluated through the correlation of the LIBS determined concentrations of Mn with its certified values. The results are found to be in very good agreement with the certified concentrations.

  20. Quantitative prediction of radio frequency induced local heating derived from measured magnetic field maps in magnetic resonance imaging: A phantom validation at 7 T

    SciTech Connect (OSTI)

    Zhang, Xiaotong; Liu, Jiaen; Van de Moortele, Pierre-Francois; Schmitter, Sebastian; He, Bin


    Electrical Properties Tomography (EPT) technique utilizes measurable radio frequency (RF) coil induced magnetic fields (B1 fields) in a Magnetic Resonance Imaging (MRI) system to quantitatively reconstruct the local electrical properties (EP) of biological tissues. Information derived from the same data set, e.g., complex numbers of B1 distribution towards electric field calculation, can be used to estimate, on a subject-specific basis, local Specific Absorption Rate (SAR). SAR plays a significant role in RF pulse design for high-field MRI applications, where maximum local tissue heating remains one of the most constraining limits. The purpose of the present work is to investigate the feasibility of such B1-based local SAR estimation, expanding on previously proposed EPT approaches. To this end, B1 calibration was obtained in a gelatin phantom at 7 T with a multi-channel transmit coil, under a particular multi-channel B1-shim setting (B1-shim I). Using this unique set of B1 calibration, local SAR distribution was subsequently predicted for B1-shim I, as well as for another B1-shim setting (B1-shim II), considering a specific set of parameter for a heating MRI protocol consisting of RF pulses plaid at 1% duty cycle. Local SAR results, which could not be directly measured with MRI, were subsequently converted into temperature change which in turn were validated against temperature changes measured by MRI Thermometry based on the proton chemical shift.

  1. Investigation of EMIC wave scattering as the cause for the BARREL 17 January 2013 relativistic electron precipitation event: A quantitative comparison of simulation with observations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Li, Zan; Millan, Robyn M.; Hudson, Mary K.; Woodger, Leslie A.; Smith, David M.; Chen, Yue; Friedel, Reiner; Rodriguez, Juan V.; Engebretson, Mark J.; Goldstein, Jerry; et al


    Electromagnetic ion cyclotron (EMIC) waves were observed at multiple observatory locations for several hours on 17 January 2013. During the wave activity period, a duskside relativistic electron precipitation (REP) event was observed by one of the Balloon Array for Radiation belt Relativistic Electron Losses (BARREL) balloons and was magnetically mapped close to Geostationary Operational Environmental Satellite (GOES) 13. We simulate the relativistic electron pitch angle diffusion caused by gyroresonant interactions with EMIC waves using wave and particle data measured by multiple instruments on board GOES 13 and the Van Allen Probes. We show that the count rate, the energy distribution,more » and the time variation of the simulated precipitation all agree very well with the balloon observations, suggesting that EMIC wave scattering was likely the cause for the precipitation event. The event reported here is the first balloon REP event with closely conjugate EMIC wave observations, and our study employs the most detailed quantitative analysis on the link of EMIC waves with observed REP to date.« less

  2. Investigation of EMIC wave scattering as the cause for the BARREL 17 January 2013 relativistic electron precipitation event: A quantitative comparison of simulation with observations

    SciTech Connect (OSTI)

    Li, Zan; Millan, Robyn M.; Hudson, Mary K.; Woodger, Leslie A.; Smith, David M.; Chen, Yue; Friedel, Reiner; Rodriguez, Juan V.; Engebretson, Mark J.; Goldstein, Jerry; Fennell, Joseph F.; Spence, Harlan E.


    Electromagnetic ion cyclotron (EMIC) waves were observed at multiple observatory locations for several hours on 17 January 2013. During the wave activity period, a duskside relativistic electron precipitation (REP) event was observed by one of the Balloon Array for Radiation belt Relativistic Electron Losses (BARREL) balloons and was magnetically mapped close to Geostationary Operational Environmental Satellite (GOES) 13. We simulate the relativistic electron pitch angle diffusion caused by gyroresonant interactions with EMIC waves using wave and particle data measured by multiple instruments on board GOES 13 and the Van Allen Probes. We show that the count rate, the energy distribution, and the time variation of the simulated precipitation all agree very well with the balloon observations, suggesting that EMIC wave scattering was likely the cause for the precipitation event. The event reported here is the first balloon REP event with closely conjugate EMIC wave observations, and our study employs the most detailed quantitative analysis on the link of EMIC waves with observed REP to date.

  3. A resilience assessment framework for infrastructure and economic systems : quantitative and qualitative resilience analysis of petrochemical supply chains to a hurricane.

    SciTech Connect (OSTI)

    Ehlen, Mark Andrew; Vugrin, Eric D.; Warren, Drake E.


    In recent years, the nation has recognized that critical infrastructure protection should consider not only the prevention of disruptive events, but also the processes that infrastructure systems undergo to maintain functionality following disruptions. This more comprehensive approach has been termed critical infrastructure resilience (CIR). Given the occurrence of a particular disruptive event, the resilience of a system to that event is the system's ability to efficiently reduce both the magnitude and duration of the deviation from targeted system performance levels. Sandia National Laboratories (Sandia) has developed a comprehensive resilience assessment framework for evaluating the resilience of infrastructure and economic systems. The framework includes a quantitative methodology that measures resilience costs that result from a disruption to infrastructure function. The framework also includes a qualitative analysis methodology that assesses system characteristics that affect resilience in order to provide insight and direction for potential improvements to resilience. This paper describes the resilience assessment framework. This paper further demonstrates the utility of the assessment framework through application to a hypothetical scenario involving the disruption of a petrochemical supply chain by a hurricane.

  4. Departures from local thermodynamic equilibrium in cutting arc plasmas derived from electron and gas density measurements using a two-wavelength quantitative Schlieren technique

    SciTech Connect (OSTI)

    Prevosto, L.; Mancinelli, B.; Artana, G.; Kelly, H.


    A two-wavelength quantitative Schlieren technique that allows inferring the electron and gas densities of axisymmetric arc plasmas without imposing any assumption regarding statistical equilibrium models is reported. This technique was applied to the study of local thermodynamic equilibrium (LTE) departures within the core of a 30 A high-energy density cutting arc. In order to derive the electron and heavy particle temperatures from the inferred density profiles, a generalized two-temperature Saha equation together with the plasma equation of state and the quasineutrality condition were employed. Factors such as arc fluctuations that influence the accuracy of the measurements and the validity of the assumptions used to derive the plasma species temperature were considered. Significant deviations from chemical equilibrium as well as kinetic equilibrium were found at elevated electron temperatures and gas densities toward the arc core edge. An electron temperature profile nearly constant through the arc core with a value of about 14000-15000 K, well decoupled from the heavy particle temperature of about 1500 K at the arc core edge, was inferred.

  5. Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population

    SciTech Connect (OSTI)

    Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; Dugard, Christopher K.; Held, Michael A.; Klimek, John F.; Shreve, Jacob T.; Fowler, Matthew; Ziebell, Angela; Davis, Mark F.; Decker, Stephen R.; Turner, Geoffrey B.; Mosier, Nathan S.; Springer, Nathan M.; Thimmapuram, Jyothi; Weil, Clifford F.; McCann, Maureen C.; Carpita, Nicholas C.


    Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 x 3 Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yield was shared. A genome-wide association study for lignin abundance and sugar yield of the 282- member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. Finally, these results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass.

  6. Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; Dugard, Christopher K.; Held, Michael A.; Klimek, John F.; Shreve, Jacob T.; Fowler, Matthew; Ziebell, Angela; Davis, Mark F.; et al


    Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 x 3 Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yieldmore » was shared. A genome-wide association study for lignin abundance and sugar yield of the 282- member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. Finally, these results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass.« less

  7. Quantitative assessment of the accuracy of dose calculation using pencil beam and Monte Carlo algorithms and requirements for clinical quality assurance

    SciTech Connect (OSTI)

    Ali, Imad; Ahmad, Salahuddin


    To compare the doses calculated using the BrainLAB pencil beam (PB) and Monte Carlo (MC) algorithms for tumors located in various sites including the lung and evaluate quality assurance procedures required for the verification of the accuracy of dose calculation. The dose-calculation accuracy of PB and MC was also assessed quantitatively with measurement using ionization chamber and Gafchromic films placed in solid water and heterogeneous phantoms. The dose was calculated using PB convolution and MC algorithms in the iPlan treatment planning system from BrainLAB. The dose calculation was performed on the patient's computed tomography images with lesions in various treatment sites including 5 lungs, 5 prostates, 4 brains, 2 head and necks, and 2 paraspinal tissues. A combination of conventional, conformal, and intensity-modulated radiation therapy plans was used in dose calculation. The leaf sequence from intensity-modulated radiation therapy plans or beam shapes from conformal plans and monitor units and other planning parameters calculated by the PB were identical for calculating dose with MC. Heterogeneity correction was considered in both PB and MC dose calculations. Dose-volume parameters such as V95 (volume covered by 95% of prescription dose), dose distributions, and gamma analysis were used to evaluate the calculated dose by PB and MC. The measured doses by ionization chamber and EBT GAFCHROMIC film in solid water and heterogeneous phantoms were used to quantitatively asses the accuracy of dose calculated by PB and MC. The dose-volume histograms and dose distributions calculated by PB and MC in the brain, prostate, paraspinal, and head and neck were in good agreement with one another (within 5%) and provided acceptable planning target volume coverage. However, dose distributions of the patients with lung cancer had large discrepancies. For a plan optimized with PB, the dose coverage was shown as clinically acceptable, whereas in reality, the MC showed a systematic lack of dose coverage. The dose calculated by PB for lung tumors was overestimated by up to 40%. An interesting feature that was observed is that despite large discrepancies in dose-volume histogram coverage of the planning target volume between PB and MC, the point doses at the isocenter (center of the lesions) calculated by both algorithms were within 7% even for lung cases. The dose distributions measured with EBT GAFCHROMIC films in heterogeneous phantoms showed large discrepancies of nearly 15% lower than PB at interfaces between heterogeneous media, where these lower doses measured by the film were in agreement with those by MC. The doses (V95) calculated by MC and PB agreed within 5% for treatment sites with small tissue heterogeneities such as the prostate, brain, head and neck, and paraspinal tumors. Considerable discrepancies, up to 40%, were observed in the dose-volume coverage between MC and PB in lung tumors, which may affect clinical outcomes. The discrepancies between MC and PB increased for 15 MV compared with 6 MV indicating the importance of implementation of accurate clinical treatment planning such as MC. The comparison of point doses is not representative of the discrepancies in dose coverage and might be misleading in evaluating the accuracy of dose calculation between PB and MC. Thus, the clinical quality assurance procedures required to verify the accuracy of dose calculation using PB and MC need to consider measurements of 2- and 3-dimensional dose distributions rather than a single point measurement using heterogeneous phantoms instead of homogenous water-equivalent phantoms.

  8. Evaluation of dual energy quantitative CT for determining the spatial distributions of red marrow and bone for dosimetry in internal emitter radiation therapy

    SciTech Connect (OSTI)

    Goodsitt, Mitchell M. Shenoy, Apeksha; Howard, David; Christodoulou, Emmanuel; Dewaraja, Yuni K.; Shen, Jincheng; Schipper, Matthew J.; Wilderman, Scott; Chun, Se Young


    Purpose: To evaluate a three-equation three-unknown dual-energy quantitative CT (DEQCT) technique for determining region specific variations in bone spongiosa composition for improved red marrow dose estimation in radionuclide therapy. Methods: The DEQCT method was applied to 80/140 kVp images of patient-simulating lumbar sectional body phantoms of three sizes (small, medium, and large). External calibration rods of bone, red marrow, and fat-simulating materials were placed beneath the body phantoms. Similar internal calibration inserts were placed at vertebral locations within the body phantoms. Six test inserts of known volume fractions of bone, fat, and red marrow were also scanned. External-to-internal calibration correction factors were derived. The effects of body phantom size, radiation dose, spongiosa region segmentation granularity [single (?17 17 mm) region of interest (ROI), 2 2, and 3 3 segmentation of that single ROI], and calibration method on the accuracy of the calculated volume fractions of red marrow (cellularity) and trabecular bone were evaluated. Results: For standard low dose DEQCT x-ray technique factors and the internal calibration method, the RMS errors of the estimated volume fractions of red marrow of the test inserts were 1.21.3 times greater in the medium body than in the small body phantom and 1.31.5 times greater in the large body than in the small body phantom. RMS errors of the calculated volume fractions of red marrow within 2 2 segmented subregions of the ROIs were 1.61.9 times greater than for no segmentation, and RMS errors for 3 3 segmented subregions were 2.32.7 times greater than those for no segmentation. Increasing the dose by a factor of 2 reduced the RMS errors of all constituent volume fractions by an average factor of 1.40 0.29 for all segmentation schemes and body phantom sizes; increasing the dose by a factor of 4 reduced those RMS errors by an average factor of 1.71 0.25. Results for external calibrations exhibited much larger RMS errors than size matched internal calibration. Use of an average body size external-to-internal calibration correction factor reduced the errors to closer to those for internal calibration. RMS errors of less than 30% or about 0.01 for the bone and 0.1 for the red marrow volume fractions would likely be satisfactory for human studies. Such accuracies were achieved for 3 3 segmentation of 5 mm slice images for: (a) internal calibration with 4 times dose for all size body phantoms, (b) internal calibration with 2 times dose for the small and medium size body phantoms, and (c) corrected external calibration with 4 times dose and all size body phantoms. Conclusions: Phantom studies are promising and demonstrate the potential to use dual energy quantitative CT to estimate the spatial distributions of red marrow and bone within the vertebral spongiosa.

  9. Application of quantitative time-lapse imaging (QTLI) for evaluation of Mrp2-based drugdrug interaction induced by liver metabolites

    SciTech Connect (OSTI)

    Nakanishi, Takeo; Ikenaga, Miho; Fukuda, Hajime; Matsunaga, Norikazu; Tamai, Ikumi


    We previously reported a quantitative time-lapse imaging (QTLI)-based analysis method to assess drugdrug interactions (DDI) at multidrug resistance-associated protein 2 (Mrp2) in rat sandwich-cultured hepatocyte (SCH) system, utilizing the fluorescent Mrp2 substrate, 5-(and 6)-carboxy-2?,7?-dichlorofluorescein (CDF). Here, we aimed to examine the feasibility of using QTLI to evaluate DDI involving drug metabolite(s) generated in hepatocytes. We used estradiol (E2) and bilirubin as model compounds; both are not substrates of MRP2, whereas their hepatic metabolites, estradiol-17?-glucuronide (E17G) or bilirubin glucuronides, are known to be its substrates as well as inhibitors. When rat SCHs were pre-exposed with E2, fluorescence of CDF accumulated in bile canaliculi decreased depending upon both the duration of pre-exposure and the concentration of extracellular E2. The decrease corresponded with the increase in intracellular concentration of E17G in hepatocytes. Furthermore, cytotoxicity of vinblastine, a substrate of MRP2, was enhanced in SCHs treated with E2. Similarly, CDF accumulated in bile canaliculi was significantly reduced in rat SCHs pre-exposed with bilirubin. In conclusion, these results suggest that phase II biotransformation of a competitor is reflected in alteration of MRP2-mediated CDF transport detected in QTLI. The QTLI might provide a convenient platform to evaluate transporter-based DDIs involving hepatic metabolites of drug candidates without the need to identify the metabolites. -- Highlights: ? Mrp2-mediated CDF transport is inhibited by E2, but not E17G in vesicle study. ? Both E2 and E17G do not compromise CDF formation from CDFDA in hepatocytes. ? CDF accumulation in bile canaliculi is inhibited by E2 or E17G in QTLI. ? Increasing exposure to E2 decreases CDF accumulation in bile canaliculi in QTLI. ? QTLI is feasible to assess Mrp2-based DDI involving drug metabolite in hepatocytes.

  10. Structural and chemical ordering of Heusler CoxMnyGez epitaxial films on Ge (111). Quantitative study using traditional and anomalous x-ray diffraction techniques

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Collins, B. A.; Chu, Y.; He, L.; Haskel, D.; Tsui, F.


    We found that epitaxial films of CoxMnyGez grown on Ge (111) substrates by molecular-beam-epitaxy techniques have been investigated as a continuous function of composition using combinatorial synchrotron x-ray diffraction (XRD) and x-ray fluorescence (XRF) spectroscopy techniques. A high-resolution ternary epitaxial phase diagram is obtained, revealing a small number of structural phases stabilized over large compositional regions. Ordering of the constituent elements in the compositional region near the full Heusler alloy Co2MnGe has been examined in detail using both traditional XRD and a new multiple-edge anomalous diffraction (MEAD) technique. Multiple-edge anomalous diffraction involves analyzing the energy dependence of multiple reflections acrossmore » each constituent absorption edge in order to detect and quantify the elemental distribution of occupation in specific lattice sites. Results of this paper show that structural and chemical ordering are very sensitive to the Co : Mn atomic ratio, such that the ordering is the highest at an atomic ratio of 2 but significantly reduced even a few percent off this ratio. The in-plane lattice is nearly coherent with that of the Ge substrate, while the approximately 2% lattice mismatch is accommodated by the out-of-plane tetragonal strain. Furthermore, the quantitative MEAD analysis reveals no detectable amount (<0.5%) of Co-Mn site swapping, but instead high levels (26%) of Mn-Ge site swapping. Increasing Ge concentration above the Heusler stoichiometry (Co 0.5 Mn 0.25 Ge 0.25 ) is shown to correlate with increased lattice vacancies, antisites, and stacking faults, but reduced lattice relaxation. The highest degree of chemical ordering is observed off the Heusler stoichiometry with a Ge enrichment of 5 at.%.« less

  11. SU-E-J-219: Quantitative Evaluation of Motion Effects On Accuracy of Image-Guided Radiotherapy with Fiducial Markers Using CT Imaging

    SciTech Connect (OSTI)

    Ali, I; Oyewale, S; Ahmad, S; Algan, O; Alsbou, N


    Purpose: To investigate quantitatively patient motion effects on the localization accuracy of image-guided radiation with fiducial markers using axial CT (ACT), helical CT (HCT) and cone-beam CT (CBCT) using modeling and experimental phantom studies. Methods: Markers with different lengths (2.5 mm, 5 mm, 10 mm, and 20 mm) were inserted in a mobile thorax phantom which was imaged using ACT, HCT and CBCT. The phantom moved with sinusoidal motion with amplitudes ranging 0–20 mm and a frequency of 15 cycles-per-minute. Three parameters that include: apparent marker lengths, center position and distance between the centers of the markers were measured in the different CT images of the mobile phantom. A motion mathematical model was derived to predict the variations in the previous three parameters and their dependence on the motion in the different imaging modalities. Results: In CBCT, the measured marker lengths increased linearly with increase in motion amplitude. For example, the apparent length of the 10 mm marker was about 20 mm when phantom moved with amplitude of 5 mm. Although the markers have elongated, the center position and the distance between markers remained at the same position for different motion amplitudes in CBCT. These parameters were not affected by motion frequency and phase in CBCT. In HCT and ACT, the measured marker length, center and distance between markers varied irregularly with motion parameters. The apparent lengths of the markers varied with inverse of the phantom velocity which depends on motion frequency and phase. Similarly the center position and distance between markers varied inversely with phantom speed. Conclusion: Motion may lead to variations in maker length, center position and distance between markers using CT imaging. These effects should be considered in patient setup using image-guided radiation therapy based on fiducial markers matching using 2D-radiographs or volumetric CT imaging.

  12. Quantitative Profiling of Protein S-Glutathionylation Reveals Redox-Dependent Regulation of Macrophage Function During Nanoparticle-Induced Oxidative Stress

    SciTech Connect (OSTI)

    Duan, Jicheng; Kodali, Vamsi K.; Gaffrey, Matthew J.; Guo, Jia; Chu, Rosalie K.; Camp, David G.; Smith, Richard D.; Thrall, Brian D.; Qian, Weijun


    Engineered nanoparticles (ENPs) are emerging functional materials increasingly utilized for commercial and medical applications. Due to the potential hazard effects of ENPs to human health, it is significant to assess and understand the underlying mechanisms of nanotoxicity. Herein, we investigate protein S-glutathionylation (SSG) as an underlying regulatory mechanism for ENP-induced oxidative stress in macrophages by applying a recently developed quantitative redox proteomics approach for site-specific measurements of SSG. Three high-volume production ENPs (SiO2, Fe3O4 and CoO) were selected as representative ENPs with low, moderate, and high reactive oxygen species (ROS) activity, respectively. Among these nanoparticles, we observe that CoO led to the most significant dose-dependent oxidative stress and increase of protein SSG modifications in macrophages. Our site-specific SSG changes highlighted a broad set of redox sensitive proteins and their specific Cys residues potentially implicated in stress response. Functional analysis revealed that the most significantly enriched functional categories for SSG-modified proteins were stress response, cellular structure change, and cell death or survival. Moreover, ENPs-induce oxidative stress levels (CoO > Fe3O4 > SiO2) were found to correlate well with the levels of impairment of macrophage phagocytic activity and the overall degrees of increases in SSG. RNA silencing knockdown experiment of glutaredoxin 1 (Grx1) also led to a decreased phagocytic activity in macrophages, which suggested a regulatory role of SSG in phagocytosis. Together, the results provided valuable insights of protein SSG as a potential regulatory mechanism in response to nanomaterial-induced oxidative stress and immunity dysfunction.

  13. Quantitative Analysis of Variability and Uncertainty in Environmental Data and Models. Volume 2. Performance, Emissions, and Cost of Combustion-Based NOx Controls for Wall and Tangential Furnace Coal-Fired Power Plants

    SciTech Connect (OSTI)

    Frey, H. Christopher; Tran, Loan K.


    This is Volume 2 of a two-volume set of reports describing work conducted at North Carolina State University sponsored by Grant Number DE-FG05-95ER30250 by the U.S. Department of Energy. The title of the project is “Quantitative Analysis of Variability and Uncertainty in Acid Rain Assessments.” The work conducted under sponsorship of this grant pertains primarily to two main topics: (1) development of new methods for quantitative analysis of variability and uncertainty applicable to any type of model; and (2) analysis of variability and uncertainty in the performance, emissions, and cost of electric power plant combustion-based NOx control technologies. These two main topics are reported separately in Volumes 1 and 2.

  14. TU-C-12A-07: Characterization of Longitudinal Reproducibility of Quantitative Diffusion Imaging Data Acquired with Four Different Protocols Using a Phantom

    SciTech Connect (OSTI)

    Li, X; Buzzelli, M; Randazzo, W; Yanasak, N


    Purpose: To characterize and compare the longitudinal reproducibility of diffusion imaging data acquired with four different protocols using a phantom. Methods: The Diffusive Quantitative Imaging Phantom (DQIP) was constructed using fifteen cylindrical compartments within a larger compartment, filled with deionized water doped with CuSO4 and NaCl. The smaller compartments contained arrays of hexagonal or cylindrical glass capillaries of varying inner diameters, for differing restraint of water diffusion. The sensitivity of diffusion imaging metrics to signal-to-noise ratio (SNR) was probed by doping compartments with differing ratios of deuterium oxide to H2O. A cork phantom enclosure was constructed to increase thermal stability during scanning and a cork holder was made to reproduce scanner positioning. Four different protocols of DWI (diffusion weighted imaging) and DTI (Diffusion tensor imaging) imaging were assembled on a GE Excite HDx 3.0T MRI scanner to collect imaging data over 9-10 days. Data was processed with in-house software created in Matlab to obtain fractional anisotropy (FA) and apparent diffusion coefficient (ADC) values. Results: All DTI and DWI sequences showed good longitudinal stability of mean FA and ADC values per compartment, exhibiting low standard deviation ∼9%. A t-test was performed to compare mean FA values from the DTI clinical protocol to those of the DTI special protocol, indicating significantly different values in the majority of compartments. ANOVA performed on ADC values for all DTI and DWI sequences also showed significantly different values in a majority of compartments. Conclusion: This work has the potential for quantifying systemic variations between diffusion imaging sequences from different platforms. Characterization of DWI and DTI performance were done over four sequences with predictable results. This data suggests that the DQIP phantom may be a reliable method of monitoring day-to-day and scan-to-scan variation in diffusion imaging sequences from different platforms. Schott Glass North America and The Phantom Laboratory have donated materials and personnel time to this project.

  15. Quantitation of repaglinide and metabolites in mouse whole-body thin tissue sections using droplet-based liquid microjunction surface sampling-high-performance liquid chromatography-electrospray ionization tandem mass spectrometry

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chen, Weiqi; Wang, Lifei; Van Berkel, Gary J.; Gan, Jinping; Kertesz, Vilmos


    Herein, quantitation aspects of a fully automated autosampler/HPLC-MS/MS system applied for unattended droplet-based surface sampling of repaglinide dosed thin tissue sections with subsequent HPLC separation and mass spectrometric analysis of parent drug and various drug metabolites was studied. Major organs (brain, lung, liver, kidney, muscle) from whole-body thin tissue sections and corresponding organ homogenates prepared from repaglinide dosed mice were sampled by surface sampling and by bulk extraction, respectively, and analyzed by HPLC-MS/MS. A semi-quantitative agreement between data obtained by surface sampling and that by employing organ homogenate extraction was observed. Drug concentrations obtained by the two methods followed themore » same patterns for post-dose time points (0.25, 0.5, 1 and 2 h). Drug amounts determined in the specific tissues was typically higher when analyzing extracts from the organ homogenates. Furthermore, relative comparison of the levels of individual metabolites between the two analytical methods also revealed good semi-quantitative agreement.« less

  16. Orthogonal control of expression mean and variance by epigenetic features at different genomic loci

    SciTech Connect (OSTI)

    Dey, Siddharth S.; Foley, Jonathan E.; Limsirichai, Prajit; Schaffer, David V.; Arkin, Adam P.


    While gene expression noise has been shown to drive dramatic phenotypic variations, the molecular basis for this variability in mammalian systems is not well understood. Gene expression has been shown to be regulated by promoter architecture and the associated chromatin environment. However, the exact contribution of these two factors in regulating expression noise has not been explored. Using a dual-reporter lentiviral model system, we deconvolved the influence of the promoter sequence to systematically study the contribution of the chromatin environment at different genomic locations in regulating expression noise. By integrating a large-scale analysis to quantify mRNA levels by smFISH and protein levels by flow cytometry in single cells, we found that mean expression and noise are uncorrelated across genomic locations. Furthermore, we showed that this independence could be explained by the orthogonal control of mean expression by the transcript burst size and noise by the burst frequency. Finally, we showed that genomic locations displaying higher expression noise are associated with more repressed chromatin, thereby indicating the contribution of the chromatin environment in regulating expression noise.

  17. Orthogonal control of expression mean and variance by epigenetic features at different genomic loci

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Dey, Siddharth S.; Foley, Jonathan E.; Limsirichai, Prajit; Schaffer, David V.; Arkin, Adam P.


    While gene expression noise has been shown to drive dramatic phenotypic variations, the molecular basis for this variability in mammalian systems is not well understood. Gene expression has been shown to be regulated by promoter architecture and the associated chromatin environment. However, the exact contribution of these two factors in regulating expression noise has not been explored. Using a dual-reporter lentiviral model system, we deconvolved the influence of the promoter sequence to systematically study the contribution of the chromatin environment at different genomic locations in regulating expression noise. By integrating a large-scale analysis to quantify mRNA levels by smFISH andmore » protein levels by flow cytometry in single cells, we found that mean expression and noise are uncorrelated across genomic locations. Furthermore, we showed that this independence could be explained by the orthogonal control of mean expression by the transcript burst size and noise by the burst frequency. Finally, we showed that genomic locations displaying higher expression noise are associated with more repressed chromatin, thereby indicating the contribution of the chromatin environment in regulating expression noise.« less

  18. High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus

    SciTech Connect (OSTI)

    Muchero, Wellington [ORNL; Guo, Jianjun [ORNL; Difazio, Stephen P. [West Virginia University, Morgantown; Chen, Jay [ORNL; Ranjan, Priya [ORNL; Slavov, Gancho [West Virginia University, Morgantown; Gunter, Lee E [ORNL; Jawdy, Sara [ORNL; Bryan, Anthony C [ORNL; Sykes, Robert [National Renewable Energy Laboratory (NREL); Ziebell, Angela L [ORNL; Porth, Ilga [University of British Columbia, Vancouver; Skyba, Oleksandr [University of British Columbia, Vancouver; Unda, Faride [University of British Columbia, Vancouver; El-Kassaby, Yousry [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver; Mansfield, Shawn [University of British Columbia, Vancouver; Martin, Joel [U.S. Department of Energy, Joint Genome Institute; Schackwitz, Wendy [U.S. Department of Energy, Joint Genome Institute; Evans, Luke M [West Virginia University, Morgantown; Tuskan, Gerald A [ORNL


    We report the identification of six genetic loci and the allelic-variants associated with Populus cell wall phenotypes determined independently using pyrolysis Molecular Beam Mass Spectrometry (pyMBMS), saccharification assay and wet chemistry in two partially overlapping populations of P. trichocarpa genotypes sampled from multiple environments in the Pacific Northwest of North America. All 6 variants co-located with a quantitative trait locus (QTL) hotspot on chromosome XIV for lignin content, syringyl to guaiacyl (S/G) ratio, 5- and 6- carbon sugars identified in an interspecific P. trichocarpa x P. deltoides pseudo-backcross mapping pedigree. Genomic intervals containing an amino acid transporter, a MYB transcription factor, an angustifolia CtBP transcription factor, a copper transport protein ATOX1-related, a Ca2+ transporting ATPase and a protein kinase were identified within 5 QTL regions. Each interval contained single nucleotide polymorphisms (SNPs) that were significantly associated to cell-wall phenotypes, with associations exceeding the chromosome-wise Bonferroni-adjusted p-values in at least one environment. cDNA sequencing for allelic variants of 3 of the 6 genes identified polymorphisms leading to premature stop codons in the MYB transcription factor and protein kinase. On the other hand, variants of the Angustifolia CtBP transcription factor exhibited a polyglutamine (PolyQ) length polymorphism. Results from transient protoplast assays suggested that each of the polymorphisms conferred allelic differences in activation of cellulose, hemicelluloses and lignin pathway marker genes, with truncated and short PolyQ alleles exhibiting significantly reduced marker gene activation. Genes identified in this study represent novel targets for reducing cell wall recalcitrance for lignocellulosic biofuels production using plant biomass.

  19. High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus

    SciTech Connect (OSTI)

    Muchero, Wellington; Guo, Jianjun; Difazio, Stephen P.; Chen, Jay; Ranjan, Priya; Slavov, Gancho; Gunter, Lee E.; Jawdy, Sara; Bryan, Anthony C.; Sykes, Robert; Ziebell, Angela L.; Klapste, Jaroslav; Porth, Ilga; Skyba, Oleksandr; Unda, Faride; El-Kassaby, Yousry; Douglas, Carl; Mansfield, Shawn; Martin, Joel; Schackwitz, Wendy; Evans, Luke M.; Czarnecki, Olaf; Tuskan, Gerald A.


    We report the identification of six genetic loci and the allelic-variants associated with Populus cell wall phenotypes determined independently using pyrolysis Molecular Beam Mass Spectrometry (pyMBMS), saccharification assay and wet chemistry in two partially overlapping populations of P. trichocarpa genotypes sampled from multiple environments in the Pacific Northwest of North America. All 6 variants co-located with a quantitative trait locus (QTL) hotspot on chromosome XIV for lignin content, syringyl to guaiacyl (S/G) ratio, 5- and 6- carbon sugars identified in an interspecific P. trichocarpa x P. deltoides pseudo-backcross mapping pedigree. Genomic intervals containing an amino acid transporter, a MYB transcription factor, an angustifolia CtBP transcription factor, a copper transport protein ATOX1-related, a Ca2+ transporting ATPase and a protein kinase were identified within 5 QTL regions. Each interval contained single nucleotide polymorphisms (SNPs) that were significantly associated to cell-wall phenotypes, with associations exceeding the chromosome-wise Bonferroni-adjusted p-values in at least one environment. cDNA sequencing for allelic variants of 3 of the 6 genes identified polymorphisms leading to premature stop codons in the MYB transcription factor and protein kinase. On the other hand, variants of the Angustifolia CtBP transcription factor exhibited a polyglutamine (PolyQ) length polymorphism. Results from transient protoplast assays suggested that each of the polymorphisms conferred allelic differences in activation of cellulose, hemicelluloses and lignin pathway marker genes, with truncated and short PolyQ alleles exhibiting significantly reduced marker gene activation. Genes identified in this study represent novel targets for reducing cell wall recalcitrance for lignocellulosic biofuels production using plant biomass.

  20. Bottlebrush Block Polymers: Quantitative Theory and Experiments...

    Office of Scientific and Technical Information (OSTI)

    1225404 GrantContract Number: AC02-06CH11357 Type: Published Article Journal Name: ACS Nano Additional Journal Information: Journal Volume: 9; Journal Issue: 12; Journal ID: ISSN...


    SciTech Connect (OSTI)

    Coutts, D


    Fire barriers, and physical separation are key components in managing the fire risk in Nuclear Facilities. The expected performance of these features have often been predicted using rules-of-thumb or expert judgment. These approaches often lack the convincing technical bases that exist when addressing other Nuclear Facility accident events. This paper presents science-based approaches to demonstrate the effectiveness of fire separation methods.

  2. Category:Quantitative Incentives | Open Energy Information

    Open Energy Info (EERE)

    - Residential Energy Efficient Appliance Rebate Program (Energize Missouri) (Missouri) N National Grid (Gas) - Commercial Solar Thermal Rebate Program (Massachusetts) National...

  3. Natural bacterial communities serve as quantitative geochemical...

    Office of Scientific and Technical Information (OSTI)

    approach to identify sites contaminated with hydrocarbons from the Deepwater Horizon oil spill, finding that altered bacterial communities encode a memory of prior...

  4. Direct and quantitative broadband absorptance spectroscopy with...

    Office of Scientific and Technical Information (OSTI)

    A detector mechanism measures and records the deflection of the probe arm so as to obtain the absorptance spectrum of the sample. Authors: Hsu, Wei-Chun ; Tong, Jonathan Kien-Kwok ...

  5. Geothermal Reconnaissance From Quantitative Analysis Of Thermal...

    Open Energy Info (EERE)

    Geothermal Exploration Activities Activities (1) Thermal And-Or Near Infrared At Raft River Geothermal Area (1974-1976) Areas (1) Raft River Geothermal Area Regions (0)...

  6. Review of Quantitative Software Reliability Methods

    SciTech Connect (OSTI)

    Chu, T.L.; Yue, M.; Martinez-Guridi, M.; Lehner, J.


    The current U.S. Nuclear Regulatory Commission (NRC) licensing process for digital systems rests on deterministic engineering criteria. In its 1995 probabilistic risk assessment (PRA) policy statement, the Commission encouraged the use of PRA technology in all regulatory matters to the extent supported by the state-of-the-art in PRA methods and data. Although many activities have been completed in the area of risk-informed regulation, the risk-informed analysis process for digital systems has not yet been satisfactorily developed. Since digital instrumentation and control (I&C) systems are expected to play an increasingly important role in nuclear power plant (NPP) safety, the NRC established a digital system research plan that defines a coherent set of research programs to support its regulatory needs. One of the research programs included in the NRC's digital system research plan addresses risk assessment methods and data for digital systems. Digital I&C systems have some unique characteristics, such as using software, and may have different failure causes and/or modes than analog I&C systems; hence, their incorporation into NPP PRAs entails special challenges. The objective of the NRC's digital system risk research is to identify and develop methods, analytical tools, and regulatory guidance for (1) including models of digital systems into NPP PRAs, and (2) using information on the risks of digital systems to support the NRC's risk-informed licensing and oversight activities. For several years, Brookhaven National Laboratory (BNL) has worked on NRC projects to investigate methods and tools for the probabilistic modeling of digital systems, as documented mainly in NUREG/CR-6962 and NUREG/CR-6997. However, the scope of this research principally focused on hardware failures, with limited reviews of software failure experience and software reliability methods. NRC also sponsored research at the Ohio State University investigating the modeling of digital systems using dynamic PRA methods. These efforts, documented in NUREG/CR-6901, NUREG/CR-6942, and NUREG/CR-6985, included a functional representation of the system's software but did not explicitly address failure modes caused by software defects or by inadequate design requirements. An important identified research need is to establish a commonly accepted basis for incorporating the behavior of software into digital I&C system reliability models for use in PRAs. To address this need, BNL is exploring the inclusion of software failures into the reliability models of digital I&C systems, such that their contribution to the risk of the associated NPP can be assessed.

  7. Quantitative Analysis of Biofuel Sustainability, Including Land...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    life cycle analysis of biofuels continue to improve 2 Feedstock Production Feedstock Logistics, Storage and Transportation Feedstock Conversion Fuel Transportation and...

  8. Natural bacterial communities serve as quantitative geochemical...

    Office of Scientific and Technical Information (OSTI)

    that respond to and capture perturbations caused by human impacts. less Authors: Smith, Mark B. 1 ; Rocha, Andrea M. 2 ; Smillie, Chris S. 1 ; Olesen, Scott W. 1 ;...

  9. Quantitative Assessment of Distributed Energy Resource Benefits

    SciTech Connect (OSTI)

    Hadley, S.W.


    Distributed energy resources (DER) offer many benefits, some of which are readily quantified. Other benefits, however, are less easily quantifiable because they may require site-specific information about the DER project or analysis of the electrical system to which the DER is connected. The purpose of this study is to provide analytical insight into several of the more difficult calculations, using the PJM power pool as an example. This power pool contains most of Pennsylvania, New Jersey, Maryland, and Delaware. The techniques used here could be applied elsewhere, and the insights from this work may encourage various stakeholders to more actively pursue DER markets or to reduce obstacles that prevent the full realization of its benefits. This report describes methodologies used to quantify each of the benefits listed in Table ES-1. These methodologies include bulk power pool analyses, regional and national marginal cost evaluations, as well as a more traditional cost-benefit approach for DER owners. The methodologies cannot however determine which stakeholder will receive the benefits; that must be determined by regulators and legislators, and can vary from one location to another.

  10. Quantitative Experimental Determination of the Solid Solution...

    Office of Scientific and Technical Information (OSTI)

    Close Cite: Bibtex Format Close 0 pages in this document matching the terms "" Search For Terms: Enter terms in the toolbar above to search the full text of this document for ...

  11. Quantitative Phosphoproteomic Analysis of Soybean Root Hairs...

    Office of Scientific and Technical Information (OSTI)

    were labeled with the isobaric tag 8-plex ITRAQ, enriched using Ni-NTA magnetic beads and subjected to nRPLC-MSMS analysis using HCD and decision tree guided CIDETD strategy. ...

  12. Fluorometric method of quantitative cell mutagenesis

    DOE Patents [OSTI]

    Dolbeare, Frank A.


    A method for assaying a cell culture for mutagenesis is described. A cell culture is stained first with a histochemical stain, and then a fluorescent stain. Normal cells in the culture are stained by both the histochemical and fluorescent stains, while abnormal cells are stained only by the fluorescent stain. The two stains are chosen so that the histochemical stain absorbs the wavelengths that the fluorescent stain emits. After the counterstained culture is subjected to exciting light, the fluorescence from the abnormal cells is detected.

  13. Quantitative damage evaluation of localized deep pitting

    SciTech Connect (OSTI)

    Al Beed, A.A.; Al Garni, M.A.


    Localized deep pitting is considered difficult to precisely measure and evaluate using simple techniques and daily-use analysis approaches. A case study was made of carbon steel heat exchangers in a typical fresh cooling water environment that experienced severe pitting. To effectively and precisely evaluate the encountered pitting damage, a simple measurement and analyses approach was devised. In this article, the pitting measurement technique and the damage evaluation approach are presented and discussed in detail.

  14. Fluorometric method of quantitative cell mutagenesis

    DOE Patents [OSTI]

    Dolbeare, F.A.


    A method for assaying a cell culture for mutagenesis is described. A cell culture is stained first with a histochemical stain, and then a fluorescent stain. Normal cells in the culture are stained by both the histochemical and fluorescent stains, while abnormal cells are stained only by the fluorescent stain. The two stains are chosen so that the histochemical stain absorbs the wavelengths that the fluorescent stain emits. After the counterstained culture is subjected to exciting light, the fluorescence from the abnormal cells is detected.

  15. Effects of spin-lock field direction on the quantitative measurement of spin-lattice relaxation time constant in the rotating frame (T1ρ) in a clinical MRI system

    SciTech Connect (OSTI)

    Yee, Seonghwan; Gao, Jia-Hong


    Purpose: To investigate whether the direction of spin-lock field, either parallel or antiparallel to the rotating magnetization, has any effect on the spin-lock MRI signal and further on the quantitative measurement of T1ρ, in a clinical 3 T MRI system. Methods: The effects of inverted spin-lock field direction were investigated by acquiring a series of spin-lock MRI signals for an American College of Radiology MRI phantom, while the spin-lock field direction was switched between the parallel and antiparallel directions. The acquisition was performed for different spin-locking methods (i.e., for the single- and dual-field spin-locking methods) and for different levels of clinically feasible spin-lock field strength, ranging from 100 to 500 Hz, while the spin-lock duration was varied in the range from 0 to 100 ms. Results: When the spin-lock field was inverted into the antiparallel direction, the rate of MRI signal decay was altered and the T1ρ value, when compared to the value for the parallel field, was clearly different. Different degrees of such direction-dependency were observed for different spin-lock field strengths. In addition, the dependency was much smaller when the parallel and the antiparallel fields are mixed together in the dual-field method. Conclusions: The spin-lock field direction could impact the MRI signal and further the T1ρ measurement in a clinical MRI system.

  16. Apparatuses and methods for detecting, identifying and quantitating radioactive nuclei and methods of distinguishing neutron stimulation of a radiation particle detector from gamma-ray stimulation of a detector

    DOE Patents [OSTI]

    Cole, Jerald D. (Idaho Falls, ID); Drigert, Mark W. (Idaho Falls, ID); Reber, Edward L. (Idaho Falls, ID); Aryaeinejad, Rahmat (Idaho Falls, ID)


    In one aspect, the invention encompasses a method of detecting radioactive decay, comprising: a) providing a sample comprising a radioactive material, the radioactive material generating decay particles; b)providing a plurality of detectors proximate the sample, the detectors comprising a first set and a second set, the first set of the detectors comprising liquid state detectors utilizing liquid scintillation material coupled with photo tubes to generate a first electrical signal in response to decay particles stimulating the liquid scintillation material, the second set of the detectors comprising solid state detectors utilizing a crystalline solid to generate a second electrical signal in response to decay particles stimulating the crystalline solid; c) stimulating at least one of the detectors to generate at least one of the first and second electrical signals, the at least one of the first and second electrical signals being indicative of radioactive decay in the sample. In another aspect, the invention encompasses an apparatus for identifying and quantitating radioactive nuclei of a sample comprising radioactive material that decays to generate neutrons and high-energy .gamma.-rays.

  17. Characterization of Nitrogen use efficiency in sweet sorghum

    SciTech Connect (OSTI)

    Dweikat, Ismail; Clemente, Thomas


    Sweet sorghum (Sorghum bicolor L. Moench) has the potential to augment the increasing demand for alternative fuels and for the production of input efficient, environmentally friendly bioenergy crops. Nitrogen (N) and water availability are considered two of the major limiting factors in crop growth. Nitrogen fertilization accounts for about 40% of the total production cost in sorghum. In cereals, including sorghum, the nitrogen use efficiency (NUE) from fertilizer is approximately 33% of the amount applied. There is therefore extensive concern in relation to the N that is not used by the plant, which is lost by leaching of nitrate, denitrification from the soil, and loss of ammonia to the atmosphere, all of which can have deleterious environmental effects. To improve the potential of sweet sorghum as a leading and cost effective bioenergy crop, the enhancement of NUE must be addressed. To this end, we have identified a sorghum line (SanChi San) that displays about 25% increase in NUE over other sorghum lines. As such, the overarching goal of this project is to employ three complementary strategies to enhance the ability of sweet sorghum to become an efficient nitrogen user. To achieve the project goal, we will pursue the following specific objectives: Objective 1: Phenotypic characterization of SanChi San/Ck60 RILs under low and moderate N-availability including biochemical profiles, vegetative growth and seed yield Objective 2: Conduct quantitative trait loci (QTL) analysis and marker identification for nitrogen use efficiency (NUE) in a grain sorghum RIL population. Objective 3: Identify novel candidate genes for NUE using proteomic and gene expression profiling comparisons of high- and low-NUE RILs. Candidate genes will be brought into the pipeline for transgenic manipulation of NUE This project will apply the latest genomics resources to discover genes controlling NUE, one of the most complex and economically important traits in cereal crops. As a result of the completion of the proposed work, we will have: 1) identified novel alleles in wild sorghum germplasm that is useful to improve both cultivated grain and sweet sorghum; 2) been able to select individuals plants that exhibit high NUE within a breeding population on the basis of these markers; 3) acquired essential information necessary to examine the roles of GS and GOGAT, AlaT, along with impact of transcription factor Dof1, on N assimilation in sweet sorghum; and 4) The information learned will provide new opportunities for improving NUE in sorghum and other cereals.

  18. Structural and chemical ordering of Heusler CoxMnyGez epitaxial films on Ge (111). Quantitative study using traditional and anomalous x-ray diffraction techniques

    SciTech Connect (OSTI)

    Collins, B. A.; Chu, Y.; He, L.; Haskel, D.; Tsui, F.


    We found that epitaxial films of CoxMnyGez grown on Ge (111) substrates by molecular-beam-epitaxy techniques have been investigated as a continuous function of composition using combinatorial synchrotron x-ray diffraction (XRD) and x-ray fluorescence (XRF) spectroscopy techniques. A high-resolution ternary epitaxial phase diagram is obtained, revealing a small number of structural phases stabilized over large compositional regions. Ordering of the constituent elements in the compositional region near the full Heusler alloy Co2MnGe has been examined in detail using both traditional XRD and a new multiple-edge anomalous diffraction (MEAD) technique. Multiple-edge anomalous diffraction involves analyzing the energy dependence of multiple reflections across each constituent absorption edge in order to detect and quantify the elemental distribution of occupation in specific lattice sites. Results of this paper show that structural and chemical ordering are very sensitive to the Co : Mn atomic ratio, such that the ordering is the highest at an atomic ratio of 2 but significantly reduced even a few percent off this ratio. The in-plane lattice is nearly coherent with that of the Ge substrate, while the approximately 2% lattice mismatch is accommodated by the out-of-plane tetragonal strain. Furthermore, the quantitative MEAD analysis reveals no detectable amount (<0.5%) of Co-Mn site swapping, but instead high levels (26%) of Mn-Ge site swapping. Increasing Ge concentration above the Heusler stoichiometry (Co 0.5 Mn 0.25 Ge 0.25 ) is shown to correlate with increased lattice vacancies, antisites, and stacking faults, but reduced lattice relaxation. The highest degree of chemical ordering is observed off the Heusler stoichiometry with a Ge enrichment of 5 at.%.

  19. SU-D-204-05: Quantitative Comparison of a High Resolution Micro-Angiographic Fluoroscopic (MAF) Detector with a Standard Flat Panel Detector (FPD) Using the New Metric of Generalized Measured Relative Object Detectability (GM-ROD)

    SciTech Connect (OSTI)

    Russ, M; Ionita, C; Bednarek, D; Rudin, S


    Purpose: In endovascular image-guided neuro-interventions, visualization of fine detail is paramount. For example, the ability of the interventionist to visualize the stent struts depends heavily on the x-ray imaging detector performance. Methods: A study to examine the relative performance of the high resolution MAF-CMOS (pixel size 75µm, Nyquist frequency 6.6 cycles/mm) and a standard Flat Panel Detector (pixel size 194µm, Nyquist frequency 2.5 cycles/mm) detectors in imaging a neuro stent was done using the Generalized Measured Relative Object Detectability (GM-ROD) metric. Low quantum noise images of a deployed stent were obtained by averaging 95 frames obtained by both detectors without changing other exposure or geometric parameters. The square of the Fourier transform of each image is taken and divided by the generalized normalized noise power spectrum to give an effective measured task-specific signal-to-noise ratio. This expression is then integrated from 0 to each of the detector’s Nyquist frequencies, and the GM-ROD value is determined by taking a ratio of the integrals for the MAF-CMOS to that of the FPD. The lower bound of integration can be varied to emphasize high frequencies in the detector comparisons. Results: The MAF-CMOS detector exhibits vastly superior performance over the FPD when integrating over all frequencies, yielding a GM-ROD value of 63.1. The lower bound of integration was stepped up in increments of 0.5 cycles/mm for higher frequency comparisons. As the lower bound increased, the GM-ROD value was augmented, reflecting the superior performance of the MAF-CMOS in the high frequency regime. Conclusion: GM-ROD is a versatile metric that can provide quantitative detector and task dependent comparisons that can be used as a basis for detector selection. Supported by NIH Grant: 2R01EB002873 and an equipment grant from Toshiba Medical Systems Corporation.

  20. Combinational pixel-by-pixel and object-level classifying, segmenting, and agglomerating in performing quantitative image analysis that distinguishes between healthy non-cancerous and cancerous cell nuclei and delineates nuclear, cytoplasm, and stromal material objects from stained biological tissue materials

    DOE Patents [OSTI]

    Boucheron, Laura E


    Quantitative object and spatial arrangement-level analysis of tissue are detailed using expert (pathologist) input to guide the classification process. A two-step method is disclosed for imaging tissue, by classifying one or more biological materials, e.g. nuclei, cytoplasm, and stroma, in the tissue into one or more identified classes on a pixel-by-pixel basis, and segmenting the identified classes to agglomerate one or more sets of identified pixels into segmented regions. Typically, the one or more biological materials comprises nuclear material, cytoplasm material, and stromal material. The method further allows a user to markup the image subsequent to the classification to re-classify said materials. The markup is performed via a graphic user interface to edit designated regions in the image.

  1. Development of Biomarkers for Chronic Beryllium Disease in Mice

    SciTech Connect (OSTI)

    Gordon, Terry


    Beryllium is a strategic metal, indispensable for national defense programs in aerospace, telecommunications, electronics, and weaponry. Exposure to beryllium is an extensively documented occupational hazard that causes irreversible, debilitating granulomatous lung disease in as much as 3 - 5% of exposed workers. Mechanistic research on beryllium exposure-disease relationships has been severely limited by a general lack of a sufficient CBD animal model. We have now developed and tested an animal model which can be used for dissecting dose-response relationships and pathogenic mechanisms and for testing new diagnostic and treatment paradigms. We have created 3 strains of transgenic mice in which the human antigen-presenting moiety, HLA-DP, was inserted into the mouse genome. Each mouse strain contains HLA-DPB1 alleles that confer different magnitude of risk for chronic beryllium disease (CBD): HLA-DPB1*0401 (odds ratio = 0.2), HLA-DPB1*0201 (odds ratio = 15), HLA-DPB1*1701 (odds ratio = 240). Our preliminary work has demonstrated that the *1701 allele, as predicted by human studies, results in the greatest degree of sensitization in a mouse ear swelling test. We have also completed dose-response experiments examining beryllium-induced lung granulomas and identified susceptible and resistant inbred strains of mice (without the human transgenes) as well as quantitative trait loci that may contain gene(s) that modify the immune response to beryllium. In this grant application, we propose to use the transgenic and ?normal inbred strains of mice to identify biomarkers for the progression of beryllium sensitization and CBD. To achieve this goal, we propose to compare the sensitivity and accuracy of the lymphocyte proliferation test (blood and bronchoalveolar lavage fluid) with the ELISPOT test in the three HLA-DP transgenic mice strains throughout a 6 month treatment with beryllium particles. Because of the availability of high-throughput proteomics, we will also identify changes in potential protein biomarkers in beryllium-treated mice. We will correlate these findings with the ability of the transgenic mice to develop a beryllium-specific adaptive immune response in blood and bronchoalveolar lavage (BAL) fluid. We will also determine whether beryllium-responsive CD4+ T cells in blood and BAL correlate with the onset of granuloma formation. Thus, we will provide the scientific community with biomarkers of sensitization and disease progression for CBD. These biomarkers will serve as critical tools for development of improved industrial hygiene and therapeutic interventions.

  2. Characterization of novel sorghum brown midrib mutants from an EMS-mutagenized population

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L.; Vermerris, Wilfred; Pedersen, Jeffrey F.


    Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6,and bmr12, and, in addition, six bmr mutants were identified that were not allelic tomore » these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles.« less

  3. Linkage of the Wiskott-Aldrich syndrome with polymorphic DNA sequences from the human X chromosome

    SciTech Connect (OSTI)

    Peacocke, M.; Siminovitch, K.A.


    The Wiskott-Aldrich syndrome (WAS) is one of several human immunodeficiency diseases inherited as an X-linked trait. The location of WAS on the X chromosome is unknown. The authors have studied 10 kindreds segregating for WAS for linkage with cloned, polymorphic DNA markers and have demonstrated significant linkage between WAS and two loci, DXS14 and DXS7, that map to the proximal short arm of the X chromosome. Maximal logarithm of odds (lod scores) for WAS-DXS14 and WAS-DWS7 were 4.29 (at 0 = 0.03) and 4.12 (at 0 = 0.00), respectively. Linkage data between WAS and six markers loci indicate the order of the loci to be (DXYS1-DXS1)-WAS-DXS14-DXS7-(DXS84-OTC). These results suggest that the WAS locus lies within the pericentric region of the X chromosome and provide an initial step toward identifying the WAS gene and improving the genetic counselling WAS families.

  4. Quantitative characterization of arc discharge as vacuum interface

    SciTech Connect (OSTI)

    Huang, S.; Zhu, K. Lu, Y. R.; Wang, S. Z.; Hershcovitch, A.; Yang, L.; Zhang, X. Y.


    An arc discharge with channel diameters of 3 mm and 6 mm and lengths between 30 mm and 60 mm was experimentally investigated for its potential to function as plasma window, i.e., interface vacuum regions of different pressures. Electron temperature of the plasma channel measured spectroscopically varied in the range of 7000 K to 15 000 K, increasing with discharge current while decreasing with gas flow rate. That plasma window had a slightly positive I-V characteristics over the whole range of investigated current 30 A–70 A. Measurements of pressure separation capability, which were determined by input current, gas flow rate, discharge channel diameter, and length, were well explained by viscosity effect and “thermal-block” effect. The experimental results of global parameters including temperature, gas flow rate, and voltage had a good agreement with the simulation results calculated by an axis-symmetry Fluent-based magneto-hydrodynamic model.

  5. Quantitative characterization of arc discharge as vacuum interface

    SciTech Connect (OSTI)

    Huang, S.; Zhu, K.; Lu, Y. R.; Wang, S. Z.; Hershcovitch, A.; Yang, L.; Zhang, X. Y.


    An arc discharge with channel diameters of 3 mm and 6 mm and lengths between 30mm and 60mm was experimentally investigated for its potential to function as plasma window, i.e., interface vacuum regions of different pressures. In this study, electron temperature of the plasma channel measured spectroscopically varied in the range of 7000K to 15000K, increasing with discharge current while decreasing with gas flow rate. The plasma window had a slightly positive I-V characteristics over the whole range of investigated current 30A–70 A. Measurements of pressure separation capability, which were determined by input current, gas flow rate, discharge channel diameter, and length, were well explained by viscosity effect and “thermal-block” effect. The experimental results of global parameters including temperature, gas flow rate, and voltage had a good agreement with the simulation results calculated by an axis-symmetry Fluent-based magneto-hydrodynamic model.

  6. Quantitative interpretation of tracer test data | Open Energy...

    Open Energy Info (EERE)

    of tracer test data Abstract Geothermal reinjection is an important part of sustainable management of geothermal resources. Reinjection started out as a method of waste-water...

  7. Quantitative planar laser-induced fluorescence imaging of multi...

    Office of Scientific and Technical Information (OSTI)

    ... Authors: Williams, Ben ; Ewart, Paul 1 ; Wang, Xiaowei ; Stone, Richard 2 ; Ma, Hongrui ; Walmsley, Harold ; Cracknell, Roger 3 ; Stevens, Robert ; Richardson, David ; Fu, ...

  8. Quantitative assessment of proposals on assurance of nuclear fuel supply

    SciTech Connect (OSTI)

    Tanaka, T.; Kuno, Y.; Tanaka, S.


    The assurance of nuclear fuel supply has the potential to contribute to balancing peaceful use of nuclear power and nuclear nonproliferation. 5 proposals which provide the backup supply of the enrichment service in case of supply disruption, are investigated in this study. We investigated the 20 NPT countries which are non-nuclear-weapon states and possess operable commercial LWRs in October 2012 as potential participants for each proposal. As a result of literature researching, we have extracted factors that can be considered as important for a country to participate or not participate in the assurance of nuclear fuel supply. Then we have computed incentive and disincentive parameters for each country. The results show that the participation expectancy decreases in the order of IAEA Fuel Bank proposal, Russian LEU Reserve proposal, AFS proposal, WNA proposal and 6-Country proposal. The 'IAEA fuel bank proposal' would be triggered in case of the supply disruption which cannot be solved by the market mechanism and bilateral agreements.

  9. Quantitative characterization of arc discharge as vacuum interface

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Huang, S.; Zhu, K.; Lu, Y. R.; Wang, S. Z.; Hershcovitch, A.; Yang, L.; Zhang, X. Y.


    An arc discharge with channel diameters of 3 mm and 6 mm and lengths between 30mm and 60mm was experimentally investigated for its potential to function as plasma window, i.e., interface vacuum regions of different pressures. In this study, electron temperature of the plasma channel measured spectroscopically varied in the range of 7000K to 15000K, increasing with discharge current while decreasing with gas flow rate. The plasma window had a slightly positive I-V characteristics over the whole range of investigated current 30A–70 A. Measurements of pressure separation capability, which were determined by input current, gas flow rate, discharge channel diameter,more » and length, were well explained by viscosity effect and “thermal-block” effect. The experimental results of global parameters including temperature, gas flow rate, and voltage had a good agreement with the simulation results calculated by an axis-symmetry Fluent-based magneto-hydrodynamic model.« less

  10. Education and Outreach in the Life Sciences: Quantitative Analysis Report

    SciTech Connect (OSTI)

    Burbank, Roberta L.; John, Lisa; Mahy, Heidi A.; Rose, Shyanika W.; Weller, Richard E.; Nelson-Wally, Anjanette


    The DOE's National Nuclear Security Agency (NNSA) asked Pacific Northwest National Laboratory (PNNL) to consider the role of individual scientists in upholding safety and security. The views of scientists were identified as being a critical component of this policy process. Therefore, scientists, managers, and representatives of Institutional Biosafety Committees (IBCs) at the national labs were invited to participate in a brief survey. This report presents the results from the web survey.

  11. Quantitative Adaptation Analytics for Assessing Dynamic Systems of Systems.

    SciTech Connect (OSTI)

    Gauthier, John H.; Miner, Nadine E.; Wilson, Michael L.; Le, Hai D.; Kao, Gio K; Melander, Darryl J.; Longsine, Dennis Earl; Vander Meer, Robert Charles,


    Our society is increasingly reliant on systems and interoperating collections of systems, known as systems of systems (SoS). These SoS are often subject to changing missions (e.g., nation- building, arms-control treaties), threats (e.g., asymmetric warfare, terrorism), natural environments (e.g., climate, weather, natural disasters) and budgets. How well can SoS adapt to these types of dynamic conditions? This report details the results of a three year Laboratory Directed Research and Development (LDRD) project aimed at developing metrics and methodologies for quantifying the adaptability of systems and SoS. Work products include: derivation of a set of adaptability metrics, a method for combining the metrics into a system of systems adaptability index (SoSAI) used to compare adaptability of SoS designs, development of a prototype dynamic SoS (proto-dSoS) simulation environment which provides the ability to investigate the validity of the adaptability metric set, and two test cases that evaluate the usefulness of a subset of the adaptability metrics and SoSAI for distinguishing good from poor adaptability in a SoS. Intellectual property results include three patents pending: A Method For Quantifying Relative System Adaptability, Method for Evaluating System Performance, and A Method for Determining Systems Re-Tasking.

  12. Quantitative assessment of landslide risk in design practice

    SciTech Connect (OSTI)

    Romanov, A.M.; Darevskii, V.E.


    Developments of the State Institute for River Transport Protection, which are directed toward practical implementation of an engineering method recommended by regulatory documents for calculation of landslide phenomena, are cited; the potential of operating computer software is demonstrated. Results of calculations are compared with test data, and also with problems solved in the new developments.

  13. Direct and quantitative broadband absorptance spectroscopy with multilayer cantilever probes

    DOE Patents [OSTI]

    Hsu, Wei-Chun; Tong, Jonathan Kien-Kwok; Liao, Bolin; Chen, Gang


    A system for measuring the absorption spectrum of a sample is provided that includes a broadband light source that produces broadband light defined within a range of an absorptance spectrum. An interferometer modulates the intensity of the broadband light source for a range of modulation frequencies. A bi-layer cantilever probe arm is thermally connected to a sample arm having at most two layers of materials. The broadband light modulated by the interferometer is directed towards the sample and absorbed by the sample and converted into heat, which causes a temperature rise and bending of the bi-layer cantilever probe arm. A detector mechanism measures and records the deflection of the probe arm so as to obtain the absorptance spectrum of the sample.

  14. Quantitative Comparison of the Responses of Three Floating Platforms

    SciTech Connect (OSTI)

    Jonkman, J.; Matha, D.


    This report presents a comprehensive dynamic-response analysis of three offshore floating wind turbine concepts. Models were composed of one 5-MW turbine supported on land and three 5-MW turbines located offshore on a tension leg platform, a spar buoy, and a barge. A loads and stability analysis adhering to the procedures of international design standards was performed for each model using the fully coupled time-domain aero-hydro-servo-elastic design code FAST with AeroDyn and HydroDyn. The concepts are compared based on the calculated ultimate loads, fatigue loads, and instabilities. The results of this analysis will help resolve the fundamental design trade-offs between the floating-system concepts.

  15. Quantitative Electron Nanodiffraction. (Technical Report) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    (1) used for solid state lighting, and to understand the effects of stacking sequence variations and interfaces in digital oxide superlattices (8). Other projects include...

  16. Quantitative study on the chemical solution deposition of zinc oxysulfide

    SciTech Connect (OSTI)

    Reinisch, Michael; Perkins, Craig L.; Steirer, K. Xerxes


    Zinc Oxysulfide (ZnOS) has demonstrated potential in the last decade to replace CdS as a buffer layer material since it is a wide-band-gap semiconductor with performance advantages over CdS (Eg = 2.4 eV) in the near UV-range for solar energy conversion. However, questions remain on the growth mechanisms of chemical bath deposited ZnOS. In this study, a detailed model is employed to calculate solubility diagrams that describe simple conditions for complex speciation control using only ammonium hydroxide without additional base. For these conditions, ZnOS is deposited via aqueous solution deposition on a quartz crystal microbalance in a continuous flow cell. Data is used to analyze the growth rate dependence on temperature and also to elucidate the effects of dimethylsulfoxide (DMSO) when used as a co-solvent. Activation energies (EA) of ZnOS are calculated for different flow rates and solution compositions. As a result, the measured EA relationships are affected by changes in the primary growth mechanism when DMSO is included.

  17. Parallel k-Means Clustering for Quantitative Ecoregion Delineation...

    Office of Scientific and Technical Information (OSTI)

    model-model and model-measurement intercomparison. With the advances in state-of-the-art satellite remote sensing and climate models, observations and model outputs are...

  18. Optogalvanic intracavity quantitative detector and method for its use

    DOE Patents [OSTI]

    Zalewski, E.F.; Keller, R.A.; Apel, C.T.


    The disclosure relates to an optogalvanic intracavity detector and method for its use. Measurement is made of the amount of light absorbed by atoms, small molecules and ions in a laser cavity utilizing laser-produced changes in plasmas containing the same atoms, molecules or ions.

  19. Optogalvanic intracavity quantitative detector and method for its use

    DOE Patents [OSTI]

    Zalewski, E.F.; Keller, R.A.; Apel, C.T.


    The disclosure relates to an optogalvanic intracavity detector and method for its use. Measurement is made of the amount of light absorbed by atoms, small molecules and ions in a laser cavity utilizing laser-produced changes in plasmas containing the same atoms, molecules, or ions. 6 figs.

  20. Optogalvanic intracavity quantitative detector and method for its use

    DOE Patents [OSTI]

    Zalewski, Edward F.; Keller, Richard A.; Apel, Charles T.


    The disclosure relates to an optogalvanic intracavity detector and method for its use. Measurement is made of the amount of light absorbed by atoms, small molecules and ions in a laser cavity utilizing laser-produced changes in plasmas containing the same atoms, molecules, or ions.

  1. Quantitative and qualitative measures of decomposition: Is there a link?

    SciTech Connect (OSTI)

    Eaton, Robert, J.; Sanchez, Felipe, G.


    Decomposition rates of loblolly pine coarse woody debris (CWD) were determined by mass loss and wood density changes for trees that differed in source of mortality (natural, girdle-poison, and felling). Specifically, three treatments were examined: (1) control (CON): natural mortality; (2) CD: 5-fold increase in CWD compared with the CON; and (3) CS: 12-fold increase in snags compared with the CON. The additional CWD in the CD treatment plots and the additional snags in the CS plots were achieved by felling (for the CD plots) or girdling followed by herbicide injection (for the CS plots) select trees in these plots. Consequently,mortality on the CD plots is due to natural causes and felling. Likewise, mortality on the CS plots is due to natural causes and girdle-poison. In each treatment plot, mortality due to natural causes was inventoried since 1997, whereas mortality due to girdle-poison and felling were inventoried since 2001. No significant difference was detected between the rates of decomposition for the CWD on these treatment plots, indicating that source of the tree mortality did not influence rates of decomposition once the tree fell. These experimental measures of decomposition were compared with two decay classification systems (three- and five-unit classifications) to determine linkages. Changes in wood density did not correlate to any decay classification, whereas mass loss had a weak correlation with decay class. However, the large degree of variation limits the utility of decay classification systems in estimating mass loss.

  2. Quantitative study on the chemical solution deposition of zinc oxysulfide

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Reinisch, Michael; Perkins, Craig L.; Steirer, K. Xerxes


    Zinc Oxysulfide (ZnOS) has demonstrated potential in the last decade to replace CdS as a buffer layer material since it is a wide-band-gap semiconductor with performance advantages over CdS (Eg = 2.4 eV) in the near UV-range for solar energy conversion. However, questions remain on the growth mechanisms of chemical bath deposited ZnOS. In this study, a detailed model is employed to calculate solubility diagrams that describe simple conditions for complex speciation control using only ammonium hydroxide without additional base. For these conditions, ZnOS is deposited via aqueous solution deposition on a quartz crystal microbalance in a continuous flow cell.more » Data is used to analyze the growth rate dependence on temperature and also to elucidate the effects of dimethylsulfoxide (DMSO) when used as a co-solvent. Activation energies (EA) of ZnOS are calculated for different flow rates and solution compositions. As a result, the measured EA relationships are affected by changes in the primary growth mechanism when DMSO is included.« less

  3. Quantitative real-time single particle analysis of virions

    SciTech Connect (OSTI)

    Heider, Susanne; Metzner, Christoph


    Providing information about single virus particles has for a long time been mainly the domain of electron microscopy. More recently, technologies have been developed—or adapted from other fields, such as nanotechnology—to allow for the real-time quantification of physical virion particles, while supplying additional information such as particle diameter concomitantly. These technologies have progressed to the stage of commercialization increasing the speed of viral titer measurements from hours to minutes, thus providing a significant advantage for many aspects of virology research and biotechnology applications. Additional advantages lie in the broad spectrum of virus species that may be measured and the possibility to determine the ratio of infectious to total particles. A series of disadvantages remain associated with these technologies, such as a low specificity for viral particles. In this review we will discuss these technologies by comparing four systems for real-time single virus particle analysis and quantification. - Highlights: • We introduce four methods for virus particle-based quantification of viruses. • They allow for quantification of a wide range of samples in under an hour time. • The additional measurement of size and zeta potential is possible for some.

  4. Quantitative Electron Nanodiffraction. (Technical Report) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    on lithography by STEM. less Authors: Spence, John 1 + Show Author Affiliations Arizona State University Publication Date: 2015-01-30 OSTI Identifier: 1168970 Report...

  5. Quantitative Analysis of Spectral Impacts on Silicon Photodiode Radiometers

    SciTech Connect (OSTI)

    Myers, D. R.


    Inexpensive broadband pyranometers with silicon photodiode detectors have a non-uniform spectral response over the spectral range of 300-1100 nm. The response region includes only about 70% to 75% of the total energy in the terrestrial solar spectral distribution from 300 nm to 4000 nm. The solar spectrum constantly changes with solar position and atmospheric conditions. Relative spectral distributions of diffuse hemispherical irradiance sky radiation and total global hemispherical irradiance are drastically different. This analysis convolves a typical photodiode response with SMARTS 2.9.5 spectral model spectra for different sites and atmospheric conditions. Differences in solar component spectra lead to differences on the order of 2% in global hemispherical and 5% or more in diffuse hemispherical irradiances from silicon radiometers. The result is that errors of more than 7% can occur in the computation of direct normal irradiance from global hemispherical irradiance and diffuse hemispherical irradiance using these radiometers.

  6. Quantitative Analysis of Spectral Impacts on Silicon Photodiode Radiometers: Preprint

    SciTech Connect (OSTI)

    Myers, D. R.


    Inexpensive broadband pyranometers with silicon photodiode detectors have a non-uniform spectral response over the spectral range of 300-1100 nm. The response region includes only about 70% to 75% of the total energy in the terrestrial solar spectral distribution from 300 nm to 4000 nm. The solar spectrum constantly changes with solar position and atmospheric conditions. Relative spectral distributions of diffuse hemispherical irradiance sky radiation and total global hemispherical irradiance are drastically different. This analysis convolves a typical photodiode response with SMARTS 2.9.5 spectral model spectra for different sites and atmospheric conditions. Differences in solar component spectra lead to differences on the order of 2% in global hemispherical and 5% or more in diffuse hemispherical irradiances from silicon radiometers. The result is that errors of more than 7% can occur in the computation of direct normal irradiance from global hemispherical irradiance and diffuse hemispherical irradiance using these radiometers.

  7. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    SciTech Connect (OSTI)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop; Lister, Ryan; Rowley, M. J.; Gregory, Brian D.; Ecker, Joseph R.; Tang, Haixu; Pikaard, Craig S.


    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sites of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.

  8. Image analysis of anatomical traits in stalk transections of maize and other grasses

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Heckwolf, Sven; Heckwolf, Marlies; Kaeppler, Shawn M.; de Leon, Natalia; Spalding, Edgar P


    Grass stalks architecturally support leaves and reproductive structures, functionally support the transport of water and nutrients, and are harvested for multiple agricultural uses. Research on these basic and applied aspects of grass stalks would benefit from improved capabilities for measuring internal anatomical features. In particular, methods suitable for phenotyping populations of plants are needed.

  9. The genome of the polar eukaryotic microalga Coccomyxa subellipsoidea reveals traits of cold adaptation

    SciTech Connect (OSTI)

    Blanc, Guillaume; Agarkova, Irina; Grimwood, Jane; Kuo, Alan; Brueggeman, Andrew; Dunigan, David D.; Gurnon, James; Ladunga, Istvan; Lindquist, Erika; Lucas, Susan; Pangilinan, Jasmyn; Proschold, Thomas; Salamov, Asaf; Schmutz, Jeremy; Weeks, Donald; Tamada, Takashi; Lomsadze, Alexandre; Borodovsky, Mark; Claverie, Jean-Michel; Grigoriev, Igor V.; Van Etten, James L.


    Background Little is known about the mechanisms of adaptation of life to the extreme environmental conditions encountered in polar regions. Here we present the genome sequence of a unicellular green alga from the division chlorophyta, Coccomyxa subellipsoidea C-169, which we will hereafter refer to as C-169. This is the first eukaryotic microorganism from a polar environment to have its genome sequenced. Results The 48.8 Mb genome contained in 20 chromosomes exhibits significant synteny conservation with the chromosomes of its relatives Chlorella variabilis and Chlamydomonas reinhardtii. The order of the genes is highly reshuffled within synteny blocks, suggesting that intra-chromosomal rearrangements were more prevalent than inter-chromosomal rearrangements. Remarkably, Zepp retrotransposons occur in clusters of nested elements with strictly one cluster per chromosome probably residing at the centromere. Several protein families overrepresented in C. subellipsoidae include proteins involved in lipid metabolism, transporters, cellulose synthases and short alcohol dehydrogenases. Conversely, C-169 lacks proteins that exist in all other sequenced chlorophytes, including components of the glycosyl phosphatidyl inositol anchoring system, pyruvate phosphate dikinase and the photosystem 1 reaction center subunit N (PsaN). Conclusions We suggest that some of these gene losses and gains could have contributed to adaptation to low temperatures. Comparison of these genomic features with the adaptive strategies of psychrophilic microbes suggests that prokaryotes and eukaryotes followed comparable evolutionary routes to adapt to cold environments.

  10. Consequences of stand age and species functional trait changes on ecosystem water use of forests

    SciTech Connect (OSTI)

    Ewers, Brent; Bond-Lamberty, Benjamin; Mackay, D. Scott


    We tested whether using stomatal conductance could capture the dynamic in transpiration with forest age. To do this we by answered the question If we chose a reference stomatal conductance from one stand age of the entire chronosequence to put into a model, would modeled transpiration be biased from the other ages? with a resounding yes. We found that obtaining the right stomatal conductance was crucial for accurate models in two different chronosequences. This strongly suggests that stomatal conductance is the appropriate integrator of inter- and intra-species change in tree transpiration with forest age. If we had tried to use a single reference canopy stomatal conductance, it would not have been able to capture the variability in transpiration with stand age despite the suggestion that hydraulic limitation was consistently acting on the trees; the situation is even more complex in many boreal systems, where a transition to nonstomatal bryophytes may occur over the course of succession. Because we used a biophysical approach, even if our and other researchers chronosequences do not fit the assumptions, the results are still useful. Further, our synthesis of sap flux based estimates of tree transpiration showing a large dynamic suggest that our approach to modeling is crucial in the face of anthropogenic changes to forest age structure. We have now provided the framework for a mechanistically rigorous yet simple approach based on simple tree hydraulics to measuring and modeling stand transpiration with changing forest age and/or species composition.

  11. Translational Genomics for the Improvement of Switchgrass

    SciTech Connect (OSTI)

    Carpita, Nicholas; McCann, Maureen


    Our objectives were to apply bioinformatics and high throughput sequencing technologies to identify and classify the genes involved in cell wall formation in maize and switchgrass. Targets for genetic modification were to be identified and cell wall materials isolated and assayed for enhanced performance in bioprocessing. We annotated and assembled over 750 maize genes into gene families predicted to function in cell wall biogenesis. Comparative genomics of maize, rice, and Arabidopsis sequences revealed differences in gene family structure. In addition, differences in expression between gene family members of Arabidopsis, maize and rice underscored the need for a grass-specific genetic model for functional analyses. A forward screen of mature leaves of field-grown maize lines by near-infrared spectroscopy yielded several dozen lines with heritable spectroscopic phenotypes, several of which near-infrared (nir) mutants had altered carbohydrate-lignin compositions. Our contributions to the maize genome sequencing effort built on knowledge of copy number variation showing that uneven gene losses between duplicated regions were involved in returning an ancient allotetraploid to a genetically diploid state. For example, although about 25% of all duplicated genes remain genome-wide, all of the cellulose synthase (CesA) homologs were retained. We showed that guaiacyl and syringyl lignin in lignocellulosic cell-wall materials from stems demonstrate a two-fold natural variation in content across a population of maize Intermated B73 x Mo7 (IBM) recombinant inbred lines, a maize Association Panel of 282 inbreds and landraces, and three populations of the maize Nested Association Mapping (NAM) recombinant inbred lines grown in three years. We then defined quantitative trait loci (QTL) for stem lignin content measured using pyrolysis molecular-beam mass spectrometry, and glucose and xylose yield measured using an enzymatic hydrolysis assay. Among five multi-year QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yield was shared. A genome-wide association study (GWAS) for lignin abundance and sugar yield of the 282-member maize Association Panel provided candidate genes in the eleven QTL and showed that many other alleles impacting these traits exist in the broader pool of maize genetic diversity. The maize B73 and Mo17 genotypes exhibited surprisingly large differences in gene expression in developing stem tissues, suggesting certain regulatory elements can significantly enhance activity of biomass synthesis pathways. Candidate genes, identified by GWAS or by differential expression, include genes of cell-wall metabolism, transcription factors associated with vascularization and fiber formation, and components of cellular signaling pathways. Our work provides new insights and strategies beyond modification of lignin to enhance yields of biofuels from genetically tailored biomass.

  12. TU-F-12A-01: Quantitative Non-Linear Compartment Modeling of 89Zr- and 124I- Labeled J591 Monoclonal Antibody Kinetics Using Serial Non-Invasive Positron Emission Tomography Imaging in a Pre-Clinical Human Prostate Cancer Mouse Model

    SciTech Connect (OSTI)

    Fung, EK; Cheal, SM; Chalasani, S; Fareedy, SB; Punzalan, B; Humm, JL; Osborne, JR; Larson, SM; Zanzonico, PB; Otto, B; Bander, NH


    Purpose: To examine the binding kinetics of human IgG monoclonal antibody J591 which targets prostate-specific membrane antigen (PSMA) in a pre-clinical mouse cancer model using quantitative PET compartmental analysis of two radiolabeled variants. Methods: PSMA is expressed in normal human prostate, and becomes highly upregulated in prostate cancer, making it a promising therapeutic target. Two forms of J591, radiolabeled with either {sup 89}Zr or {sup 124}I, were prepared. {sup 89}Zr is a radiometal that becomes trapped in the cell upon internalization by the antigen-antibody complex, while radioiodine leaves the cell. Mice with prostate cancer xenografts underwent non-invasive serial imaging on a Focus 120 microPET up to 144 hours post-injection of J591. A non-linear compartmental model describing the binding and internalization of antibody in tumor xenograft was developed and applied to the PET-derived time-activity curves. The antibody-antigen association rate constant (ka), total amount of antigen per gram tumor (Ag-total), internalization rate of antibody-antigen complex, and efflux rate of radioisotope from tumor were fitted using the model. The surface-bound and the internalized activity were also estimated. Results: Values for ka, Ag-total, and internalization rate were found to be similar regardless of radiolabel payload used. The efflux rate, however, was ? 9-fold higher for {sup 124}I-J591 than for {sup 89}Zr-J591. Time-dependent surface-bound and internalized radiotracer activity were similar for both radiolabels at early times post-injection, but clearly differed beyond 24 hours. Conclusion: Binding and internalization of J591 to PSMA-expressing tumor xenografts were similar when radiolabeled with either {sup 89}Zr or {sup 124}I payload. The difference in efflux of radioactivity from tumor may be attributable to differential biological fate intracellularly of the radioisotopes. This has great significance for radioimmunotherapy and antibody-drug conjugates. Further exploration using the model will examine binding and radioisotope residence as antibody dose is increased to antigen saturation. The Center for Targeted Radioimmunotherapy and Theranostics, Ludwig Center for Cancer Immunotherapy, Memorial Sloan Kettering Cancer Center (MSK), NIH (R25-CA096945). Technical services provided by the MSK Small-Animal Imaging Core Facility were supported by the NIH (R24-CA83084, P30-CA08748, and P50-CA92629; Zanzonico). NCI, Center to Reduce Cancer Health Disparity (R21 CA153177-03; Osborne)

  13. Characterization of novel sorghum brown midrib mutants from an EMS-mutagenized population

    SciTech Connect (OSTI)

    Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L.; Vermerris, Wilfred; Pedersen, Jeffrey F.


    Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6,and bmr12, and, in addition, six bmr mutants were identified that were not allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles.

  14. SREL Reprint #3160

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from the snails. We isolated and characterized 17 microsatellite loci from the invasive faucet snail, B. tentaculata (Gastropoda: Caenogastropoda: Bithyniidae). Loci were...

  15. Quantitative Imaging and In Situ Concentration Measurements of Quantum Dot Nanomaterials in Variably Saturated Porous Media

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Uyuşur, Burcu; Snee, Preston T.; Li, Chunyan; Darnault, Christophe J. G.


    Knowledge of the fate and transport of nanoparticles in the subsurface environment is limited, as techniques to monitor and visualize the transport and distribution of nanoparticles in porous media and measure their in situ concentrations are lacking. To address these issues, we have developed a light transmission and fluorescence method to visualize and measure in situ concentrations of quantum dot (QD) nanoparticles in variably saturated environments. Calibration cells filled with sand as porous medium and various known water saturation levels and QD concentrations were prepared. By measuring the intensity of the light transmitted through porous media exposed to fluorescent lightmore » and by measuring the hue of the light emitted by the QDs under UV light exposure, we obtained simultaneously in situ measurements of water saturation and QD nanoparticle concentrations with high spatial and temporal resolutions. Water saturation was directly proportional to the light intensity. A linear relationship was observed between hue-intensity ratio values and QD concentrations for constant water saturation levels. The advantages and limitations of the light transmission and fluorescence method as well as its implications for visualizing and measuring in situ concentrations of QDs nanoparticles in the subsurface environment are discussed.« less


    SciTech Connect (OSTI)

    James W. Castle; Fred J. Molz; Ronald W. Falta; Cynthia L. Dinwiddie; Scott E. Brame; Robert A. Bridges


    Improved prediction of interwell reservoir heterogeneity has the potential to increase productivity and to reduce recovery cost for California's heavy oil sands, which contain approximately 2.3 billion barrels of remaining reserves in the Temblor Formation and in other formations of the San Joaquin Valley. This investigation involves application of advanced analytical property-distribution methods conditioned to continuous outcrop control for improved reservoir characterization and simulation, particularly in heavy oil sands. The investigation was performed in collaboration with Chevron Production Company U.S.A. as an industrial partner, and incorporates data from the Temblor Formation in Chevron's West Coalinga Field. Observations of lateral variability and vertical sequences observed in Temblor Formation outcrops has led to a better understanding of reservoir geology in West Coalinga Field. Based on the characteristics of stratigraphic bounding surfaces in the outcrops, these surfaces were identified in the subsurface using cores and logs. The bounding surfaces were mapped and then used as reference horizons in the reservoir modeling. Facies groups and facies tracts were recognized from outcrops and cores of the Temblor Formation and were applied to defining the stratigraphic framework and facies architecture for building 3D geological models. The following facies tracts were recognized: incised valley, estuarine, tide- to wave-dominated shoreline, diatomite, and subtidal. A new minipermeameter probe, which has important advantages over previous methods of measuring outcrop permeability, was developed during this project. The device, which measures permeability at the distal end of a small drillhole, avoids surface weathering effects and provides a superior seal compared with previous methods for measuring outcrop permeability. The new probe was used successfully for obtaining a high-quality permeability data set from an outcrop in southern Utah. Results obtained from analyzing the fractal structure of permeability data collected from the southern Utah outcrop and from core permeability data provided by Chevron from West Coalinga Field were used in distributing permeability values in 3D reservoir models. Spectral analyses and the Double Trace Moment method (Lavallee et al., 1991) were used to analyze the scaling and multifractality of permeability data from cores from West Coalinga Field. T2VOC, which is a numerical flow simulator capable of modeling multiphase, multi-component, nonisothermal flow, was used to model steam injection and oil production for a portion of section 36D in West Coalinga Field. The layer structure and permeability distributions of different models, including facies group, facies tract, and fractal permeability models, were incorporated into the numerical flow simulator. The injection and production histories of wells in the study area were modeled, including shutdowns and the occasional conversion of production wells to steam injection wells. The framework provided by facies groups provides a more realistic representation of the reservoir conditions than facies tracts, which is revealed by a comparison of the history-matching for the oil production. Permeability distributions obtained using the fractal results predict the high degree of heterogeneity within the reservoir sands of West Coalinga Field. The modeling results indicate that predictions of oil production are strongly influenced by the geologic framework and by the boundary conditions. The permeability data collected from the southern Utah outcrop, support a new concept for representing natural heterogeneity, which is called the fractal/facies concept. This hypothesis is one of the few potentially simplifying concepts to emerge from recent studies of geological heterogeneity. Further investigation of this concept should be done to more fully apply fractal analysis to reservoir modeling and simulation. Additional outcrop permeability data sets and further analysis of the data from distinct facies will be needed in order to fully develop

  17. A new scaling approach and quantitative angular critical current measurement using magnetization

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Maiorov, Boris


    This is a viewpoint article that discusses fast track communication by Mishev et al (2015 Supercond. Sci. Technol. 28 102001)

  18. Quantitative evaluation of material composition of composites using x-ray energy-dispersive NDE technique

    SciTech Connect (OSTI)

    Ting, J.


    This technique worked well for determining the thickness and densities for composite components having the higher linear attenuation coefficient; it accurately determined thickness of epoxy-resin and Al metal, and the denisty of bone, to {le} 4% in the graphite-epoxy, bone-plexiglas, and Al-Al corrosion composites. Accuracy is dictated by the magnitude and uncertainty of the linear attenuation coefficient. Use of Ge detector and multichannel analyzer are limited by inspection time (1 day for point measurement) and access limitation. Immediate development of a rapid in-service inspection tool is limited by the amplifier and MCA systems. The MCA should be replaced with a single-channel analyzer, and an electronic device should be built for monitoring the incoming signal for Pile-Up-Rejection.

  19. Quantitative/Statistical Approach to Bullet-to-Firearm Identification with Consecutively Manufactured Barrels

    SciTech Connect (OSTI)

    Peter Striupaitis; R.E. Gaensslen


    Efforts to use objective image comparison and bullet scanning technologies to distinguish bullets from consecutively manufactured handgun barrels from two manufacturers gave mixed results. The ability of a technology to reliably distinguish between matching and non-matching bullets, where the non-matching bullets were as close in pattern to the matching ones as is probably possible, would provide evidence that the distinctions could be made ''objectively'', and independently of human eyes. That evidence is identical or very close to what seems to be needed to satisfy Daubert standards. It is fair to say that the FTI IBIS image comparison technology correctly distinguished between all the Springfield barrel bullets, and between most but not all of the HiPoint barrel bullets. In the HiPoint cases that were not distinguished 100% of the time, they would he distinguished correctly at least 83% of the time. These results, although obviously limited to the materials used in the comparisons, provide strong evidence that barrel-to-bullet matching is objectively reliable. The results with SciClops were less compelling. The results do not mean that bullet-to-barrel matching is not objectively reliable--rather, they mean that this version of the particular technology could not quite distinguish between these extremely similar yet different bullets as well as the image comparison technology did. In a number of cases, the numerical results made the correct distinctions, although they were close to one another. It is hard to say from this data that this technology differs in its ability to make distinctions between the manufacturers, because the results are very similar with both. The human examiner results were as expected. We did not expect any misidentifications, and there were not any. It would have been preferable to have a higher return rate, and thus more comparisons in the overall sample. As noted, the ''consecutively manufactured barrel exercise'' has been done before, with the same outcome.

  20. Quantitative comparison of organic photovoltaic bulk heterojunction photostability under laser illumination

    SciTech Connect (OSTI)

    Lesoine, Michael D.; Bobbitt, Jonathan M.; Carr, John A.; Elshobaki, Moneim; Chaudhary, Sumit; Smith, Emily A.


    The photostability of bulk heterojunction organic photovoltaic films containing a polymer donor and a fullerene-derivative acceptor was examined using resonance Raman spectroscopy and controlled laser power densities. The polymer donors were poly(3-hexylthiophene-2,5-diyl) (P3HT), poly[[9-(1-octylnonyl)-9H-carbazole-2,7-diyl]-2,5-thiophenediyl-2,1,3-benzothiadiazole-4,7-diyl-2,5-thiophenediyl] (PCDTBT), or poly({4,8-bis[(2-ethylhexyl)oxy]benzo[1,2-b:4,5-b']dithiophene-2,6-diyl}{3-fluoro-2-[(2-ethylhexyl)carbonyl]thieno[3,4-b]thiophenediyl}) (PTB7). Four sample preparation methods were studied: (i) thin or (ii) thick films with fast solvent evaporation under nitrogen, (iii) thick films with slow solvent evaporation under nitrogen, and (iv) thin films dried under nitrogen followed by thermal annealing. Polymer order was assessed by monitoring a Raman peak’s full width at half-maximum and location as a function of illumination time and laser power densities from 2.5 × 103 to 2.5 × 105 W cm–2. Resonance Raman spectroscopy measurements show that before prolonged illumination, PCDTBT and PTB7 have the same initial order for all preparation conditions, while P3HT order improves with slow solvent drying or thermal annealing. All films exhibited changes to bulk heterojunction structure with 2.5 × 105 Wcm–2 laser illumination as measured by resonance Raman spectroscopy, and atomic force microscopy images show evidence of sample heating that affects the polymer over an area greater than the illumination profile. Furthermore, photostability data are important for proper characterization by techniques involving illumination and the development of devices suitable for real-world applications.

  1. Effect of Intrafraction Prostate Motion on Proton Pencil Beam Scanning Delivery: A Quantitative Assessment

    SciTech Connect (OSTI)

    Tang, Shikui; Deville, Curtiland; McDonough, James; Tochner, Zelig; Wang, Ken Kang-Hsin; Vapiwala, Neha; Both, Stefan


    Purpose: To assess the dosimetric impact caused by the interplay between intrafraction prostate motion and the intermittent delivery of proton pencil beam scanning (PBS). Methods and Materials: A cohort of 10 prostate patients was treated with PBS using a bilateral single-field uniform dose (SFUD) modality. Bilateral intensity-modulated proton therapy (IMPT) plans were generated for comparison. Because beam-on time in PBS was intermittent, the actual beam-on time was determined from treatment logs. Prostate motion was generalized according to real-time Calypso tracking data from our previously reported prospective photon trial. We investigated potential dose deviations by considering the interplay effect resulting from the worst-case scenario motion and the PBS delivery sequence. Results: For both bilateral-field SFUD and IMPT plans, clinical target volume (CTV) D{sub 99}% coverage was degraded <2% owing to prostate intrafraction motion when averaged over the course of treatment, but was >10% for the worst fraction. The standard deviation of CTV D{sub 99}% distribution was approximately 1.2%. The CTV coverage of individual fields in SFUD plans degraded as time elapsed after the initial alignment, owing to prostate drift. Intensity-modulated proton therapy and SFUD demonstrated comparable results when bilateral opposed fields were used. Single-field SFUD plans that were repainted twice, which could reduce half of the treatment time, resulted in similar CTV coverage as bilateral-field plans. Conclusions: Intrafraction prostate motion affects the actual delivered dose to CTV; however, when averaged over the course of treatment, CTV D{sub 99}% coverage degraded only approximately 2% even for the worst-case scenario. The IMPT plan results are comparable to those of the SFUD plan, and similar coverage can be achieved if treated by SFUD 1 lateral field per day when rescanning the field twice to shorten the treatment time and mitigate intrafraction motion.

  2. Quadrature conductivity: A quantitative indicator of bacterial abundance in porous media

    SciTech Connect (OSTI)

    Chi Zhang; Andre Revil; Yoshiko Fujita; Junko Munakata-Marr; George Redden


    ABSTRACT The abundance and growth stages of bacteria in subsurface porous media affect the concentrations and distributions of charged species within the solid-solution interfaces. Therefore, spectral induced polarization (SIP) measurements can be used to monitor changes in bacterial biomass and growth stage. Our goal was to gain a better understanding of the SIP response of bacteria present in a porous material. Bacterial cell surfaces possess an electric double layer and therefore become polarized in an electric field. We performed SIP measurements over the frequency range of 0.11 kHz on cell suspensions alone and cell suspensions mixed with sand at four pore water conductivities. We used Zymomonas mobilis at four different cell densities (in- cluding the background). The quadrature conductivity spectra exhibited two peaks, one around 0.050.10 Hz and the other around 110 Hz. Because SIP measurements on bacterial suspensions are typically made at frequencies greater than 1 Hz, these peaks have not been previously reported. In the bac-terial suspensions in growth medium, the quadrature conduc-tivity at peak I was linearly proportional to the density of the bacteria. For the case of the suspensions mixed with sands, we observed that peak II presented a smaller increase in the quadrature conductivity with the cell density. A comparison of the experiments with and without sand grains illustrated the effect of the porous medium on the overall quadrature con- ductivity response (decrease in the amplitude and shift of the peaks to the lower frequencies). Our results indicate that for a given porous medium, time-lapse SIP has potential for mon- itoring changes in bacterial abundance within porous media.

  3. Quantitative Clinical Evaluation of a Simultaneous PETI MRI Breast Imaging System

    SciTech Connect (OSTI)

    Schlyer D. J.; Schlyer, D.J.


    A prototype simultaneous PET-MRI breast scanner has been developed for conducting clinical studies with the goal of obtaining high resolution anatomical and functional information in the same scan which can lead to faster and better diagnosis, reduction of unwanted biopsies, and better patient care.

  4. Quantitative method of determining beryllium or a compound thereof in a sample

    DOE Patents [OSTI]

    McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.


    A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.

  5. Quantitative analysis of iron dissolution during repassivation of freshly generated metallic surfaces

    SciTech Connect (OSTI)

    Itagaki, M.; Oltra, R.; Vuillemin, B.; Keddam, M.; Takenouti, H.


    A channel flow double electrode was coupled with the pulsed laser depassivation technique to investigate the repassivation kinetics on iron in sulfuric acid (pH 1 to 3). The amount of ferrous ion dissolved from the activated iron electrode during repassivation was measured. The total charge for repassivation is separated into partial charges for dissolution of ions, Q{sub d}, and formation of adsorbed species, Q{sub f}. The charge Q{sub d} decreases with the electrode potential. The charge Q{sub f} does not depend on the electrode potential. Its value corresponds to the formation of a monolayer of trivalent oxide film. A reaction model for repassivation of iron involving two adsorbed species was simulated numerically in good agreement with the experimental results. The actual rate of repassivation was characterized by the fractional coverage of passivating species.

  6. Quantitative X-ray microanalysis of submicron carbide formation in chromium (III) oxide rich scale

    SciTech Connect (OSTI)

    Collins, W.K.; Ziomek-Moroz, M.; Holcomb, G.R.; Danielson, P.; Hunt, A.H


    This paper discusses the chemical microanalysis techniques adapted to identify the precipitates that form on the surface of, or within, the oxide scale of a Fe-22Cr ferritic steel during exposure to a carbon-monoxide rich environment at 750C for 800 hours. Examination of oxidized test coupons revealed the presence of a fiber like structure at the surface, shown in figure 1. Other studies have reported that these structures are carbon precipitates.

  7. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect (OSTI)

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.


    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  8. A tool for the quantitative spatial analysis of mammary gland epithelium

    SciTech Connect (OSTI)

    Ortiz de Solorzano, Carlos; Fernandez-Gonzalez, Rodrigo


    In this paper we present a method for the spatial analysis of complex cellular systems based on a multiscale study of neighborhood relationships. A function to measure those relationships, M, is introduced. The refined Relative Neighborhood Graph is then presented as a method to establish vicinity relationships within layered cellular structures, and particularized to epithelial cell nuclei in the mammary gland. Finally, the method is illustrated with two examples that show interactions within one population of epithelial cells and between two different populations.


    SciTech Connect (OSTI)

    Morley, Caroline V.; Fortney, Jonathan J.; Kempton, Eliza M.-R.; Marley, Mark S.; Zahnle, Kevin; Vissher, Channon


    Recent observations of the super-Earth GJ 1214b show that it has a relatively featureless transmission spectrum. One suggestion is that these observations indicate that the planet's atmosphere is vertically compact, perhaps due to a water-rich composition that yields a large mean molecular weight. Another suggestion is that the atmosphere is hydrogen/helium-rich with clouds that obscure predicted absorption features. Previous models that incorporate clouds have included their effect without a strong physical motivation for their existence. Here, we present model atmospheres of GJ 1214b that include physically motivated clouds of two types. We model the clouds that are present in chemical equilibrium, as has been suggested to occur on brown dwarfs, which include KCl and ZnS for this planet. We also include clouds that form as a result of photochemistry, forming a hydrocarbon haze layer. We use a photochemical kinetics model to understand the vertical distribution and available mass of haze-forming molecules. We model both solar and enhanced-metallicity cloudy models and determine the cloud properties necessary to match observations. In enhanced-metallicity atmospheres, we find that the equilibrium clouds can match the observations of GJ 1214b if they are lofted high into the atmosphere and have a low sedimentation efficiency (f{sub sed} = 0.1). We find that models with a variety of hydrocarbon haze properties can match the observations. Particle sizes from 0.01 to 0.25 ?m can match the transmission spectrum with haze-forming efficiencies as low as 1%-5%.

  10. Actuatable capacitive transducer for quantitative nanoindentation combined with transmission electron microscopy

    DOE Patents [OSTI]

    Warren, Oden L; Asif, Syed Amanula Syed; Cyrankowski, Edward; Kounev, Kalin


    An actuatable capacitive transducer including a transducer body, a first capacitor including a displaceable electrode and electrically configured as an electrostatic actuator, and a second capacitor including a displaceable electrode and electrically configured as a capacitive displacement sensor, wherein the second capacitor comprises a multi-plate capacitor. The actuatable capacitive transducer further includes a coupling shaft configured to mechanically couple the displaceable electrode of the first capacitor to the displaceable electrode of the second capacitor to form a displaceable electrode unit which is displaceable relative to the transducer body, and an electrically-conductive indenter mechanically coupled to the coupling shaft so as to be displaceable in unison with the displaceable electrode unit.

  11. Actuatable capacitive transducer for quantitative nanoindentation combined with transmission electron microscopy

    DOE Patents [OSTI]

    Warren, Oden L.; Asif, S. A. Syed; Cyrankowski, Edward; Kounev, Kalin


    An actuatable capacitive transducer including a transducer body, a first capacitor including a displaceable electrode and electrically configured as an electrostatic actuator, and a second capacitor including a displaceable electrode and electrically configured as a capacitive displacement sensor, wherein the second capacitor comprises a multi-plate capacitor. The actuatable capacitive transducer further includes a coupling shaft configured to mechanically couple the displaceable electrode of the first capacitor to the displaceable electrode of the second capacitor to form a displaceable electrode unit which is displaceable relative to the transducer body, and an electrically-conductive indenter mechanically coupled to the coupling shaft so as to be displaceable in unison with the displaceable electrode unit.-

  12. Correction to “Quantitatively probing the Al distribution in zeolites”

    SciTech Connect (OSTI)

    Vjunov, Aleksei; Fulton, John L.; Huthwelker, Thomas; Pin, Sonia; Mei, Donghai; Schenter, Gregory K.; Govind, Niranjan; Camaioni, Donald M.; Hu, Jian Z.; Lercher, Johannes A.


    This is a correction of the published article, which fixes errors in the spectra depicted in figures 9 and 10.

  13. Quantitative method of determining beryllium or a compound thereof in a sample

    DOE Patents [OSTI]

    McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.


    A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.

  14. Quantitative phase analysis of Mg:ZrO{sub 2} nanoparticles by Rietveld refinement method

    SciTech Connect (OSTI)

    Balaji, V. Senthilkumaran, S. Thangadurai, P.


    To quantify the structural phases of nanocrystalline ZrO{sub 2} doped with Mg ions of varying concentrations (3, 5, 10, 15 and 20%) and annealed at different temperatures. Magnesia doped zirconia was prepared by chemical co-precipitation method and annealed up to 1000°C. The monoclinic and tetragonal phases present in Mg:ZrO{sub 2} were quantified using Rietveld refinement analysis of the X-ray diffraction data and compared with the Direct method based on peak intensity calculations. Tetragonal phase was dominant in the 600°C annealed Mg:ZrO{sub 2} for all Mg concentrations.

  15. Reservoir architecture modeling: Nonstationary models for quantitative geological characterization. Final report, April 30, 1998

    SciTech Connect (OSTI)

    Kerr, D.; Epili, D.; Kelkar, M.; Redner, R.; Reynolds, A.


    The study was comprised of four investigations: facies architecture; seismic modeling and interpretation; Markov random field and Boolean models for geologic modeling of facies distribution; and estimation of geological architecture using the Bayesian/maximum entropy approach. This report discusses results from all four investigations. Investigations were performed using data from the E and F units of the Middle Frio Formation, Stratton Field, one of the major reservoir intervals in the Gulf Coast Basin.

  16. Quantitative analysis of the local phase transitions induced by the laser heating

    SciTech Connect (OSTI)

    Levlev, Anton V.; Susner, Michael A.; McGuire, Michael A.; Maksymovych, Petro; Kalinin, Sergei V.


    Functional imaging enabled by scanning probe microscopy (SPM) allows investigations of nanoscale material properties under a wide range of external conditions, including temperature. However, a number of shortcomings preclude the use of the most common material heating techniques, thereby limiting precise temperature measurements. Here we discuss an approach to local laser heating on the micron scale and its applicability for SPM. We applied local heating coupled with piezoresponse force microscopy and confocal Raman spectroscopy for nanoscale investigations of a ferroelectric-paraelectric phase transition in the copper indium thiophosphate layered ferroelectric. Bayesian linear unmixing applied to experimental results allowed extraction of the Raman spectra of different material phases and enabled temperature calibration in the heated region. Lastly, the obtained results enable a systematic approach for studying temperature-dependent material functionalities in heretofore unavailable temperature regimes.

  17. Quantitative NO{sub 2} molecular tagging velocimetry at 500 kHz frame rate

    SciTech Connect (OSTI)

    Jiang, Naibo; Nishihara, Munetake; Lempert, Walter R.


    NO{sub 2} molecular tagging velocimetry (MTV) is demonstrated at repetition rates as high as 500 kHz in a laboratory scale Mach 5 wind tunnel. A pulse burst laser and a home built optical parametric oscillator system were used to simultaneously generate the required 355 and 226 nm wavelengths for NO{sub 2} photodissociation (tagging) and NO planar laser induced fluorescence imaging (interrogation), respectively. NO{sub 2} MTV images were obtained both in front and behind the characteristic bow shock from a 5 mm diameter cylinder. From Gaussian curve fitting, an average free stream flow velocity of 719 m/s was obtained. Absolute statistical precision in velocity of {approx}11.5 m/s was determined, corresponding to relative precision of 1.6%-5%, depending upon the region of the flow probed.

  18. Quantitative x-ray imager (abstract) (Journal Article) | SciTech...

    Office of Scientific and Technical Information (OSTI)

    ... Publication Date: 2001-01-01 OSTI Identifier: 40204814 Resource Type: Journal Article Resource Relation: Journal Name: Review of Scientific Instruments; Journal Volume: 72; Journal ...

  19. Financing U.S. Renewable Energy Projects Through Public Capital Vehicles: Qualitative and Quantitative Benefits

    SciTech Connect (OSTI)

    Mendelsohn, M.; Feldman, D.


    This paper explores the possibility of financing renewable energy projects through raising capital in the public markets. It gives an overview of the size, structure, and benefits of public capital markets, as well as showing how renewable energy projects might take advantage of this source of new funds to lower the cost of electricity.

  20. Quantitative EDS Analysis of Nanometer-Scale Core/Shell Pd/Rh...

    Office of Scientific and Technical Information (OSTI)

    of Nanometer-Scale CoreShell PdRh Structures. Authors: Sugar, Joshua Daniel ; Kotula, Paul Gabriel 1 ; Robinson, David ; Cappillino, Patrick + Show Author Affiliations (Sandia...

  1. A Quantitative Assessment of Utility Reporting Practices for Reporting Electric Power Distribution Events

    SciTech Connect (OSTI)

    Hamachi La Commare, Kristina


    Metrics for reliability, such as the frequency and duration of power interruptions, have been reported by electric utilities for many years. This study examines current utility practices for collecting and reporting electricity reliability information and discusses challenges that arise in assessing reliability because of differences among these practices. The study is based on reliability information for year 2006 reported by 123 utilities in 37 states representing over 60percent of total U.S. electricity sales. We quantify the effects that inconsistencies among current utility reporting practices have on comparisons of System Average Interruption Duration Index (SAIDI) and System Average Interruption Frequency Index (SAIFI) reported by utilities. We recommend immediate adoption of IEEE Std. 1366-2003 as a consistent method for measuring and reporting reliability statistics.

  2. Linking atomistic and mesoscale simulations of nanocrystalline materials : quantitative validation for the case of grain growth.

    SciTech Connect (OSTI)

    Moldovan, D.; Wolf, D.; Phillpot, S. R.; Materials Science Division; Louisiana State Univ.


    Using grain growth in nanocrystalline palladium as a simple case study, we demonstrate how a novel mesoscale approach for simulating microstructural evolution in polycrystalline materials can be validated directly against atomic-level simulations of the same system. We first describe molecular dynamics simulations of grain growth in a columnar model microstructure. The atomic-level insights into the grain-growth mechanism gained from these simulations, particularly in the role of grain rotations, are captured theoretically for incorporation into the mesoscale approach, in which the objects evolving in space and time are the grain boundaries and grain junctions rather than the atoms. With all the input parameters to the mesoscale being physically well defined and obtained directly from the atomic-level simulations, the mesoscale simulations are fully prescribed. We find that the morphology of the mesoscale system evolves in an almost identical manner with that of the molecular dynamics simulation, demonstrating that the length- and time-scale linking has been performed correctly. When applied to systems containing large numbers of grains, the now validated mesoscale simulation approach allows the growth topology and long-time growth kinetics to be determined. As an outlook, we describe how the effects of applied stress can be incorporated.

  3. Development and testing of biosensors that quantitatively and specifically detect organic contaminants

    SciTech Connect (OSTI)

    Jackson, P.; Keim, P.; Kuske, C.; Willardson, B.


    This is the final report of a two-year Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The project sought to develop a more sensitive and less expensive method of detecting organic contaminants. Assaying complex environmental samples for organic contaminant content is costly and labor intensive. This often limits extensive testing. Sensitive microbial biosensors that detect specific organic contaminants in complex waste mixtures without prior separation from other waste components have been developed. Some soil microbes degrade organic compounds that contaminate the environment. These bacteria sense minute quantities of particular organic compounds then respond by activating genes encoding enzymes that degrade these molecules. Genetic manipulation of these gene regulatory processes has been employed to develop unique biosensors that detect specific organic compounds using standard biochemical assays. Such biosensors allow rapid, sensitive testing of environmental samples for selected organic contaminants. The cost of biosensor assays is at least 100-fold less than present methods, allowing more rapid and extensive testing and site characterization.

  4. Quantitative evaluation of savings in outage costs by using emergency actions strategy

    SciTech Connect (OSTI)

    Akhtar, A.; Asuhaimi, A.; Shaibon, H. [Univ. Teknologi Malaysia, Johor Bharu (Malaysia); Lo, K.L. [Univ. of Strathclyde, Glasgow (United Kingdom)


    This paper presents the results of a study carried out to assess the savings in consumer outage costs that can be accrued as a result of implementing Emergency Actions Strategy. The use of Emergency Actions Strategy plays a significant role in curtailing the consumer outage costs ensuing from unreliable electric service. In order to calculate the savings in outage costs, the probabilistic framework of the frequency and duration method has been used in conjunction with emergency actions. At first, the outage costs of various consumer sectors are estimated without considering the emergency actions. Secondly, the consumer outage costs are calculated by combining the frequency and duration method, and unserved energy with the emergency actions invoked. The results of the savings in consumer outage costs that can be accrued by utilizing Emergency Actions Strategy are presented for a synthetic system. The results of the study show that substantial savings in consumer outage costs are obtained by devising and implementing emergency actions strategy in situations of capacity outages. The results are of particular relevance and utility to the underdeveloped and developing countries where capacity shortages occur quite frequently. These results also suggest the importance of emergency actions strategy for electric utilities in reducing the consumer economic losses arising from unreliable electric service.

  5. Quantitative comparison of organic photovoltaic bulk heterojunction photostability under laser illumination

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lesoine, Michael D.; Bobbitt, Jonathan M.; Carr, John A.; Elshobaki, Moneim; Chaudhary, Sumit; Smith, Emily A.


    The photostability of bulk heterojunction organic photovoltaic films containing a polymer donor and a fullerene-derivative acceptor was examined using resonance Raman spectroscopy and controlled laser power densities. The polymer donors were poly(3-hexylthiophene-2,5-diyl) (P3HT), poly[[9-(1-octylnonyl)-9H-carbazole-2,7-diyl]-2,5-thiophenediyl-2,1,3-benzothiadiazole-4,7-diyl-2,5-thiophenediyl] (PCDTBT), or poly({4,8-bis[(2-ethylhexyl)oxy]benzo[1,2-b:4,5-b']dithiophene-2,6-diyl}{3-fluoro-2-[(2-ethylhexyl)carbonyl]thieno[3,4-b]thiophenediyl}) (PTB7). Four sample preparation methods were studied: (i) thin or (ii) thick films with fast solvent evaporation under nitrogen, (iii) thick films with slow solvent evaporation under nitrogen, and (iv) thin films dried under nitrogen followed by thermal annealing. Polymer order was assessed by monitoring a Raman peak’s full width at half-maximum and location as a function of illumination time and laser powermore » densities from 2.5 × 103 to 2.5 × 105 W cm–2. Resonance Raman spectroscopy measurements show that before prolonged illumination, PCDTBT and PTB7 have the same initial order for all preparation conditions, while P3HT order improves with slow solvent drying or thermal annealing. All films exhibited changes to bulk heterojunction structure with 2.5 × 105 Wcm–2 laser illumination as measured by resonance Raman spectroscopy, and atomic force microscopy images show evidence of sample heating that affects the polymer over an area greater than the illumination profile. Furthermore, photostability data are important for proper characterization by techniques involving illumination and the development of devices suitable for real-world applications.« less

  6. Quantitative analysis of the local phase transitions induced by the laser heating

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Levlev, Anton V.; Susner, Michael A.; McGuire, Michael A.; Maksymovych, Petro; Kalinin, Sergei V.


    Functional imaging enabled by scanning probe microscopy (SPM) allows investigations of nanoscale material properties under a wide range of external conditions, including temperature. However, a number of shortcomings preclude the use of the most common material heating techniques, thereby limiting precise temperature measurements. Here we discuss an approach to local laser heating on the micron scale and its applicability for SPM. We applied local heating coupled with piezoresponse force microscopy and confocal Raman spectroscopy for nanoscale investigations of a ferroelectric-paraelectric phase transition in the copper indium thiophosphate layered ferroelectric. Bayesian linear unmixing applied to experimental results allowed extraction of themore » Raman spectra of different material phases and enabled temperature calibration in the heated region. Lastly, the obtained results enable a systematic approach for studying temperature-dependent material functionalities in heretofore unavailable temperature regimes.« less

  7. Quantitative validation of carbon-fiber laminate low velocity impact simulations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    English, Shawn A.; Briggs, Timothy M.; Nelson, Stacy M.


    Simulations of low velocity impact with a flat cylindrical indenter upon a carbon fiber fabric reinforced polymer laminate are rigorously validated. Comparison of the impact energy absorption between the model and experiment is used as the validation metric. Additionally, non-destructive evaluation, including ultrasonic scans and three-dimensional computed tomography, provide qualitative validation of the models. The simulations include delamination, matrix cracks and fiber breaks. An orthotropic damage and failure constitutive model, capable of predicting progressive damage and failure, is developed in conjunction and described. An ensemble of simulations incorporating model parameter uncertainties is used to predict a response distribution which ismore » then compared to experimental output using appropriate statistical methods. Lastly, the model form errors are exposed and corrected for use in an additional blind validation analysis. The result is a quantifiable confidence in material characterization and model physics when simulating low velocity impact in structures of interest.« less

  8. Evaluating quantitative 3-D image analysis as a design tool for...

    Office of Scientific and Technical Information (OSTI)

    Additionally, the maximum effect of microstructural features on heat transfer through the carbonaceous matrix of the preliminary compact was estimated. The surrogate fuel particles ...

  9. A quantitative assessment of microbiological contributions to corrosion of candidate nuclear waste package materials

    SciTech Connect (OSTI)

    Lian, T.; Jones, D.; Martin, S.; Horn, J.


    The US Department of Energy is contributing to the design of a potential nuclear waste repository at Yucca Mountain, Nevada. A system to predict the contribution of Yucca Mountain (YM) bacteria to overall corrosion rates of candidate waste package (WP) materials was designed and implemented. DC linear polarization resistance techniques were applied to candidate material coupons that had been inoculated with a mixture of YM-derived bacteria with potentially corrosive activities, or left sterile. Inoculated bacteria caused a 5- to 6-fold increase in corrosion rate of carbon steel C1020 (to approximately 7--8 {micro}m/yr), and an almost 100-fold increase in corrosion rate of Alloy 400 (to approximately 1 {micro}m/yr) was observed due to microbiological activities. Microbiologically Influenced Corrosion (MIC) rates on more resistant materials (CRMs: Alloy 625, Type 304 Stainless Steel, and Alloy C22) were on the order of hundredths of micrometers per year ({micro}m/yr). Bulk chemical and surfacial endpoint analyses of spent media and coupon surfaces showed preferential dissolution of nickel from Alloy 400 coupons and depletion of chromium from CRMs after incubation with YM bacteria. Scanning electron microscopy also showed greater damage to the Alloy 400 surface than that indicated by electrochemical detection methods.

  10. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Most analyses of ChIP-chip in vivo DNA binding have focused on qualitative descriptions of ... analyze and explore in vivo DNA binding data of multiple transcription factors. ...


    SciTech Connect (OSTI)

    Borra, E. F.


    We evaluate with numerical simulations the hypothesis that BL Lacertae objects (BLLs) are the remnants of quasi-stellar objects. This hypothesis is based on their highly peculiar redshift evolution. They have a comoving space density that increases with decreasing redshift, contrary to all other active galactic nuclei. We assume that relativistic jets are below detection in young radio-quiet quasars and increase in strength with cosmic time so that they eventually are detected as BLLs. Our numerical simulations fit very well the observed redshift distributions of BLLs. There are strong indications that only the high-synchrotron-peaked BLLs could be QSO remnants.

  12. Quantitative validation of carbon-fiber laminate low velocity impact simulations

    SciTech Connect (OSTI)

    English, Shawn A.; Briggs, Timothy M.; Nelson, Stacy M.


    Simulations of low velocity impact with a flat cylindrical indenter upon a carbon fiber fabric reinforced polymer laminate are rigorously validated. Comparison of the impact energy absorption between the model and experiment is used as the validation metric. Additionally, non-destructive evaluation, including ultrasonic scans and three-dimensional computed tomography, provide qualitative validation of the models. The simulations include delamination, matrix cracks and fiber breaks. An orthotropic damage and failure constitutive model, capable of predicting progressive damage and failure, is developed in conjunction and described. An ensemble of simulations incorporating model parameter uncertainties is used to predict a response distribution which is then compared to experimental output using appropriate statistical methods. Lastly, the model form errors are exposed and corrected for use in an additional blind validation analysis. The result is a quantifiable confidence in material characterization and model physics when simulating low velocity impact in structures of interest.

  13. Advanced Mass Spectrometric Methods for the Rapid and Quantitative Characterization of Proteomes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Smith, Richard D.


    Progress is reviewedmore » towards the development of a global strategy that aims to extend the sensitivity, dynamic range, comprehensiveness and throughput of proteomic measurements based upon the use of high performance separations and mass spectrometry. The approach uses high accuracy mass measurements from Fourier transform ion cyclotron resonance mass spectrometry (FTICR) to validate peptide ‘accurate mass tags’ (AMTs) produced by global protein enzymatic digestions for a specific organism, tissue or cell type from ‘potential mass tags’ tentatively identified using conventional tandem mass spectrometry (MS/MS). This provides the basis for subsequent measurements without the need for MS/ MS. High resolution capillary liquid chromatography separations combined with high sensitivity, and high resolution accurate FTICR measurements are shown to be capable of characterizing peptide mixtures of more than 10 5 components. The strategy has been initially demonstrated using the microorganisms Saccharomyces cerevisiae and Deinococcus radiodurans. Advantages of the approach include the high confidence of protein identification, its broad proteome coverage, high sensitivity, and the capability for stableisotope labeling methods for precise relative protein abundance measurements. Abbreviations : LC, liquid chromatography; FTICR, Fourier transform ion cyclotron resonance; AMT, accurate mass tag; PMT, potential mass tag; MMA, mass measurement accuracy; MS, mass spectrometry; MS/MS, tandem mass spectrometry; ppm, parts per million.« less

  14. Tagging CO2 to Enable Quantitative Inventories of Geological Carbon Storage

    SciTech Connect (OSTI)

    Lackner, Klaus; Matter, Juerg; Park, Ah-Hyung; Stute, Martin; Carson, Cantwell; Ji, Yinghuang


    In the wake of concerns about the long term integrity and containment of sub-surface CO2 sequestration reservoirs, many efforts have been made to improve the monitoring, verification, and accounting methods for geo-sequestered CO2. Our project aimed to demonstrate the feasibility of a system designed to tag CO2 with carbon isotope 14C immediately prior to sequestration to a level that is normal on the surface (one part per trillion). Because carbon found at depth is naturally free of 14C, this tag would easily differentiate pre-existing carbon from anthropogenic injected carbon and provide an excellent handle for monitoring its whereabouts in the subsurface. It also creates an excellent handle for adding up anthropogenic carbon inventories. Future inventories in effect count 14C atoms. Accordingly, we have developed a 14C tagging system suitable for use at the part-per-trillion level. This system consists of a gas-exchange apparatus to make disposable cartridges ready for controlled injection into a fast flowing stream of pressurized CO2. We built a high-pressure injection and tagging system, and a 14C detection system. The disposable cartridge and injection system have been successfully demonstrated in the lab with a high-pressure flow reactor, as well as in the field at the CarbFix CO2 sequestration site in Iceland. The laser-based 14C detection system originally conceived has been shown to possess inadequate sensitivity for ambient levels. Alternative methods for detecting 14C, such as saturated cavity absorption ringdown spectroscopy and scintillation counting, may still be suitable. KEYWORDS

  15. Final Report (2010-2015) for the Topical Collaboration on Quantitative...

    Office of Scientific and Technical Information (OSTI)

    hydrodynamic simulations of bulk matter evolution; developed Monte Carlo tools that ... METHOD; COORDINATED RESEARCH PROGRAMS; EVOLUTION; RECOMBINATION; SIMULATION; TRANSPORT ...

  16. Quantitative characterization of a nonreacting, supersonic combustor flowfield using unified, laser-induced iodine fluorescence

    SciTech Connect (OSTI)

    Fletcher, D.G.; McDaniel, J.C.


    A calibrated, nonintrusive optical technique, laser-induced iodine fluorescence (LIIF) was used to quantify the steady, compressible flowfield of a nonreacting, supersonic combustor. The combustor was configured with single and staged, transverse-air injection into a supersonic-air freestream behind a rearward-facing step. Pressure, temperature, two-velocity components, and injectant mole fraction were measured with high spatial resolution in the three-dimensional flowfields. These experimental results provide a benchmark set of data for validation of computational fluid dynamic (CFD) codes being developed to model supersonic combustor flowfields. 8 refs.

  17. Strategic Sequencing for State Distributed PV Policies: A Quantitative Analysis of Policy Impacts and Interactions

    SciTech Connect (OSTI)

    Doris, E.; Krasko, V.A.


    State and local policymakers show increasing interest in spurring the development of customer-sited distributed generation (DG), in particular solar photovoltaic (PV) markets. Prompted by that interest, this analysis examines the use of state policy as a tool to support the development of a robust private investment market. This analysis builds on previous studies that focus on government subsidies to reduce installation costs of individual projects and provides an evaluation of the impacts of policies on stimulating private market development.

  18. Computational, Integrative, and Comparative Methods for the Elucidation of Genetic Coexpression Networks

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Baldwin, Nicole E.; Chesler, Elissa J.; Kirov, Stefan; Langston, Michael A.; Snoddy, Jay R.; Williams, Robert W.; Zhang, Bing


    Gene expression microarray data can be used for the assembly of genetic coexpression network graphs. Using mRNA samples obtained from recombinant inbred Mus musculus strains, it is possible to integrate allelic variation with molecular and higher-order phenotypes. The depth of quantitative genetic analysis of microarray data can be vastly enhanced utilizing this mouse resource in combination with powerful computational algorithms, platforms, and data repositories. The resulting network graphs transect many levels of biological scale. This approach is illustrated with the extraction of cliques of putatively co-regulated genes and their annotation using gene ontology analysis and cis -regulatory element discovery.more » The causal basis for co-regulation is detected through the use of quantitative trait locus mapping.« less

  19. Fast, Quantitative, and Nondestructive Evaluation on Hydrided LWR Fuel Cladding by Small Angle Incoherent Neutron Scattering of Hydrogen

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Littrell, Ken; Parish, Chad M


    A non-destructive neutron scattering method to precisely measure the uptake of hydrogen and the distribution of hydride precipitates in light water reactor (LWR) fuel cladding was developed. Zircaloy-4 cladding used in commercial LWRs was used to produce hydrided specimens. The hydriding apparatus consists of a closed stainless steel vessel that contains Zr alloy specimens and hydrogen gas. Following hydrogen charging, the hydrogen content of the hydrided specimens was measured using the vacuum hot extraction method, by which the samples with desired hydrogen concentration were selected for the neutron study. Optical microscopy shows that our hydriding procedure results in uniform distributionmore » of circumferential hydrides across the wall. Small angle neutron incoherent scattering was performed in the High Flux Isotope Reactor at Oak Ridge National Laboratory. Our study demonstrates that the hydrogen in commercial Zircaloy-4 cladding can be measured very accurately in minutes by this nondestructive method over a wide range of hydrogen concentrations from a very small amount ( 20 ppm) to over 1000 ppm. The hydrogen distribution in a tube sample was obtained by scaling the neutron scattering rate with a factor determined by a calibration process using standard, destructive direct chemical analysis methods on the specimens. This scale factor can be used in future tests with unknown hydrogen concentrations, thus providing a nondestructive method for absolute hydrogen concentration determination.« less

  20. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOE Patents [OSTI]

    McCutchen-Maloney, Sandra L.


    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.


    SciTech Connect (OSTI)

    Bromberg, Omer; Piran, Tsvi; Sari, Re'em [Racah Institute of Physics, The Hebrew University, 91904 Jerusalem (Israel)] [Racah Institute of Physics, The Hebrew University, 91904 Jerusalem (Israel); Nakar, Ehud [The Raymond and Berverly Sackler School of Physics and Astronomy, Tel Aviv University, 69978 Tel Aviv (Israel)] [The Raymond and Berverly Sackler School of Physics and Astronomy, Tel Aviv University, 69978 Tel Aviv (Israel)


    Gamma-ray bursts (GRBs) are traditionally divided into long and short according to their durations (lg2 s). It was generally believed that this reflects a different physical origin: collapsars (long) and non-collapsars (short). We have recently shown that the duration distribution of collapsars is flat, namely, independent of the duration, at short durations. Using this model for the distribution of Collapsars we determine the duration distribution of non-Collapsars and estimate the probability that a burst with a given duration (and hardness) is a Collapsar or not. We find that this probability depends strongly on the spectral window of the observing detector. While the commonly used limit of 2 s is conservative and suitable for BATSE bursts, 40% of Swift's bursts shorter than 2 s are Collapsars and the division lg0.8 s is more suitable for Swift. We find that the duration overlap of the two populations is very large. On the one hand there is a non-negligible fraction of non-Collapsars longer than 10 s, while on the other hand even bursts shorter than 0.5 s in the Swift sample have a non-negligible probability to be Collapsars. Our results enable the construction of non-Collapsar samples while controlling the Collapsar contamination. They also highlight that no firm conclusions can be drawn based on a single burst and they have numerous implications concerning previous studies of non-Collapsar properties that were based on the current significantly contaminated Swift samples of localized short GRBs. Specifically (1) all known short bursts with z > 1 are most likely Collapsars; (2) the only short burst with a clear jet break is most likely a Collapsar, indicating our lack of knowledge concerning non-Collapsar beaming; and (3) the existence of non-Collapsars with durations up to 10 s imposes new challenges to non-Collapsar models.

  2. Mechanistic and quantitative studies of bystander response in 3D tissues for low-dose radiation risk estimations

    SciTech Connect (OSTI)

    Amundson, Sally A.


    We have used the MatTek 3-dimensional human skin model to study the gene expression response of a 3D model to low and high dose low LET radiation, and to study the radiation bystander effect as a function of distance from the site of irradiation with either alpha particles or low LET protons. We have found response pathways that appear to be specific for low dose exposures, that could not have been predicted from high dose studies. We also report the time and distance dependent expression of a large number of genes in bystander tissue. the bystander response in 3D tissues showed many similarities to that described previously in 2D cultured cells, but also showed some differences.

  3. Integrated sensing platform and method for improved quantitative and selective monitoring of chemical analytes in both liquid and gas phase

    DOE Patents [OSTI]

    Blair, Dianna S.; Frye-Mason, Gregory C.; Butler, Michael A.


    By measuring two or more physical parameters of a thin sensing film which are altered when exposed to chemicals, more effective discrimination between chemicals can be achieved. In using more than one sensor, the sensors are preferably integrated on the same substrate so that they may measure the same thin film. Even more preferably, the sensors are provided orthogonal to one another so that they may measure the same portion of the thin film. These provisions reduce problems in discrimination arising from variations in thin films.

  4. Longitudinal, intermodality registration of quantitative breast PET and MRI data acquired before and during neoadjuvant chemotherapy: Preliminary results

    SciTech Connect (OSTI)

    Atuegwu, Nkiruka C.; Williams, Jason M.; Li, Xia; Arlinghaus, Lori R.; Abramson, Richard G.; Department of Radiology and Radiological Sciences, Vanderbilt University Medical Center, Nashville, Tennessee 37232-2675; Vanderbilt Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, Tennessee 37232-6838 ; Chakravarthy, A. Bapsi; Abramson, Vandana G.; Yankeelov, Thomas E.


    Purpose: The authors propose a method whereby serially acquired DCE-MRI, DW-MRI, and FDG-PET breast data sets can be spatially and temporally coregistered to enable the comparison of changes in parameter maps at the voxel level. Methods: First, the authors aligned the PET and MR images at each time point rigidly and nonrigidly. To register the MR images longitudinally, the authors extended a nonrigid registration algorithm by including a tumor volume-preserving constraint in the cost function. After the PET images were aligned to the MR images at each time point, the authors then used the transformation obtained from the longitudinal registration of the MRI volumes to register the PET images longitudinally. The authors tested this approach on ten breast cancer patients by calculating a modified Dice similarity of tumor size between the PET and MR images as well as the bending energy and changes in the tumor volume after the application of the registration algorithm. Results: The median of the modified Dice in the registered PET and DCE-MRI data was 0.92. For the longitudinal registration, the median tumor volume change was −0.03% for the constrained algorithm, compared to −32.16% for the unconstrained registration algorithms (p = 8 × 10{sup −6}). The medians of the bending energy were 0.0092 and 0.0001 for the unconstrained and constrained algorithms, respectively (p = 2.84 × 10{sup −7}). Conclusions: The results indicate that the proposed method can accurately spatially align DCE-MRI, DW-MRI, and FDG-PET breast images acquired at different time points during therapy while preventing the tumor from being substantially distorted or compressed.

  5. Hawaii Clean Energy Initiative (HCEI) Scenario Analysis: Quantitative Estimates Used to Facilitate Working Group Discussions (2008-2010)

    SciTech Connect (OSTI)

    Braccio, R.; Finch, P.; Frazier, R.


    This report provides details on the Hawaii Clean Energy Initiative (HCEI) Scenario Analysis to identify potential policy options and evaluate their impact on reaching the 70% HECI goal, present possible pathways to attain the goal based on currently available technology, with an eye to initiatives under way in Hawaii, and provide an 'order-of-magnitude' cost estimate and a jump-start to action that would be adjusted with a better understanding of the technologies and market.

  6. Quantitative analysis of the x-ray diffraction intensities of undulated smectic phases in bent-core liquid crystals

    SciTech Connect (OSTI)

    Folcia, C. L.; Etxebarria, J.; Ortega, J.


    X-ray diffraction diagrams of undulated smectic phases in bent-core liquid crystals have been theoretically studied. The intensities of the reflections have been obtained for different layer modulations, and a general expression has been deduced for orthogonal cells in terms of the different harmonics of the distortion. The case of sinusoidal modulation is especially simple and has been studied also in oblique cells. High-quality x-ray measurements of three compounds reported in the literature have been analyzed as examples. In all cases it has been deduced that the modulation is sinusoidal and its amplitude has been easily obtained by fitting the experimental intensities. Equatorial (h0) reflections have been also considered to obtain information about the structure of defects at the maxima and minima of the undulation.

  7. TU-A-12A-01: Consistency of Lung Expansion and Contraction During Respiration: Implications for Quantitative Imaging

    SciTech Connect (OSTI)

    Patton, T; Du, K; Bayouth, J; Christensen, G; Reinhardt, J


    Purpose: Four-dimensional computed tomography (4DCT) can be used to evaluate longitudinal changes in pulmonary function. The sensitivity of such measurements to identify function change may be improved with reproducible breathing patterns. The purpose of this study was to determine if inhale was more consistent than exhale, i.e., lung expansion during inhalation compared to lung contraction during exhalation. Methods: Repeat 4DCT image data acquired within a short time interval from 8 patients. Using a tissue volume preserving deformable image registration algorithm, Jacobian ventilation maps in two scanning sessions were computed and compared on the same coordinate for reproducibility analysis. Equivalent lung volumes (ELV) were used for 5 subjects and equivalent title volumes (ETV) for the 3 subjects who experienced a baseline shift between scans. In addition, gamma pass rate was calculated from a modified gamma index evaluation between two ventilation maps, using acceptance criterions of 2mm distance-to-agreement and 5% ventilation difference. The gamma pass rates were then compared using paired t-test to determine if there was a significant difference. Results: Inhalation was more reproducible than exhalation. In the 5 ELV subjects 78.5% of the lung voxels met the gamma criteria for expansion during inhalation when comparing the two scans, while significantly fewer (70.9% of the lung voxels) met the gamma criteria for contraction during exhalation (p = .027). In the 8 total subjects analyzed the average gamma pass rate for expansion during inhalation was 75.2% while for contraction during exhalation it was 70.3%; which trended towards significant (p = .064). Conclusion: This work implies inhalation is more reproducible than exhalation, when equivalent respiratory volumes are considered. The reason for this difference is unknown. Longitudinal investigation of pulmonary function change based on inhalation images appears appropriate for Jacobian-based measure of lung tissue expansion. NIH Grant: R01 CA166703.

  8. Quantitative broadband absorption and scattering spectroscopy in turbid media by combined frequency-domain and steady state methodologies

    DOE Patents [OSTI]

    Tromberg, Bruce J.; Berger, Andrew J.; Cerussi, Albert E.; Bevilacqua, Frederic; Jakubowski, Dorota


    A technique for measuring broadband near-infrared absorption spectra of turbid media that uses a combination of frequency-domain and steady-state reflectance methods. Most of the wavelength coverage is provided by a white-light steady-state measurement, whereas the frequency-domain data are acquired at a few selected wavelengths. Coefficients of absorption and reduced scattering derived from the frequency-domain data are used to calibrate the intensity of the steady-state measurements and to determine the reduced scattering coefficient at all wavelengths in the spectral window of interest. The absorption coefficient spectrum is determined by comparing the steady-state reflectance values with the predictions of diffusion theory, wavelength by wavelength. Absorption spectra of a turbid phantom and of human breast tissue in vivo, derived with the combined frequency-domain and steady-state technique, agree well with expected reference values.

  9. Bandgap widening in thermochromic Mg-doped VO{sub 2} thin films: Quantitative data based on optical absorption

    SciTech Connect (OSTI)

    Li, Shu-Yi; Niklasson, Gunnar A.; Granqvist, Claes G.; Mlyuka, Nuru R.; Department of Physics, University of Dar es Salaam, P.O. Box 35063, Dar es Salaam ; Primetzhofer, Daniel; Possnert, Gran; Halln, Anders


    Thermochromic Mg-doped VO{sub 2} films were deposited by reactive direct current magnetron sputtering onto heated glass and carbon substrates. Elemental compositions were inferred from Rutherford backscattering. Optical bandgaps were obtained from spectral transmittance and reflectance measurementsfrom both the film side and the back side of the samplesand ensuing determination of absorption coefficients. The bandgap of Mg-doped films was found to increase by 3.9 0.5 eV per unit of atom ratio Mg/(Mg + V) for 0 < Mg/(Mg + V) < 0.21. The presence of ?0.45 at. % Si enhanced the bandgap even more.

  10. Tests with Inconel 600 to obtain quantitative stress-corrosion cracking data for evaluating service performance. [PWR

    SciTech Connect (OSTI)

    Bandy, R.; van Rooyen, D.


    Inconel 600 tubes in pressurized water reactor (PWR) steam generators form a pressure boundary between radioactive primary water and secondary water which is converted to steam and used for generating electricity. Under operating conditions the performance of alloy 600 has been good, but with some occasional small leaks resulting from stress corrosion cracking (SCC), related to the presence of unusually high residual or operating stresses. The suspected high stresses can result from either the deformation of tubes during manufacture, or distortion during abnormal conditions such as denting. The present experimental program addresses two specific conditions, i.e., (1) where deformation occurs but is no longer active, such as when denting is stopped and (2) where plastic deformation of the metal continues, as would occur during denting. Laboratory media consist of pure water as well as solutions to simulate environments that would apply in service; tubing from actual production is used in carrying out these tests. The environments include both normal and off chemistries for primary and secondary water. The results reported here were obtained in several different tests. The main ones are (1) split tube reverse U-bends, (2) constant extension rate tests (CERT), and (3) constant load. The temperature range covered is 290 to 365/sup 0/C.

  11. Quantitative analysis of electron energy loss spectra and modelling of optical properties of multilayer systems for extreme ultraviolet radiation regime

    SciTech Connect (OSTI)

    Gusenleitner, S.; Hauschild, D.; Reinert, F.; Handick, E.


    Ruthenium capped multilayer coatings for use in the extreme ultraviolet (EUV) radiation regime have manifold applications in science and industry. Although the Ru cap shall protect the reflecting multilayers, the surface of the heterostructures suffers from contamination issues and surface degradation. In order to get a better understanding of the effects of these impurities on the optical parameters, reflection electron energy loss spectroscopy (REELS) measurements of contaminated and H cleaned Ru multilayer coatings were taken at various primary electron beam energies. Experiments conducted at low primary beam energies between 100?eV and 1000?eV are very surface sensitive due to the short inelastic mean free path of the electrons in this energy range. Therefore, influences of the surface condition on the above mentioned characteristics can be appraised. In this paper, it can be shown that carbon and oxide impurities on the mirror surface decrease the transmission of the Ru cap by about 0.75% and the overall reflectance of the device is impaired as the main share of the non-transmitted EUV light is absorbed in the contamination layer.

  12. Quantitative Determination of the Hubbard Model Phase Diagram from Optical Lattice Experiments by Two-Parameter Scaling

    SciTech Connect (OSTI)

    Campo, V. L. Jr.; Capelle, K.; Quintanilla, J.; Hooley, C.


    We propose an experiment to obtain the phase diagram of the fermionic Hubbard model, for any dimensionality, using cold atoms in optical lattices. It is based on measuring the total energy for a sequence of trap profiles. It combines finite-size scaling with an additional 'finite-curvature scaling' necessary to reach the homogeneous limit. We illustrate its viability in the 1D case, simulating experimental data in the Bethe-ansatz local-density approximation. Including experimental errors, the filling corresponding to the Mott transition can be determined with better than 3% accuracy.

  13. Apparatus and method for quantitative assay of samples of transuranic waste contained in barrels in the presence of matrix material

    DOE Patents [OSTI]

    Caldwell, J.T.; Herrera, G.C.; Hastings, R.D.; Shunk, E.R.; Kunz, W.E.


    Apparatus and method for performing corrections for matrix material effects on the neutron measurements generated from analysis of transuranic waste drums using the differential-dieaway technique. By measuring the absorption index and the moderator index for a particular drum, correction factors can be determined for the effects of matrix materials on the ''observed'' quantity of fissile and fertile material present therein in order to determine the actual assays thereof. A barrel flux monitor is introduced into the measurement chamber to accomplish these measurements as a new contribution to the differential-dieaway technology. 9 figs.

  14. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.


    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  15. Quantitative proteomic analysis of the inhibitory effects of CIL-102 on viability and invasiveness in human glioma cells

    SciTech Connect (OSTI)

    Teng, Chih-Chuan; Kuo, Hsing-Chun; Sze, Chun-I


    CIL-102 (1-[4-(furo[2,3-b]quinolin-4-ylamino)phenyl]ethanone), the major active agent of the alkaloid derivative, has been demonstrated to exert anticancer effects. Herein, we present an investigation focused on the identification of the target(s) of CIL-102's action and the mechanism of its action in apoptotic and anti-invasive pathways. Proteomic approaches were used to purify and identify the protein substrates using 2D difference gel electrophoresis (2D SDS-PAGE) to assess changes in the expression of relevant protein treatment with CIL-102 that resulted in the inhibition of viability and invasion. Our results demonstrate that CIL-102 treatment of U87 cells decreased cell proliferation and invasiveness. CIL-102 dose-dependent induction of apoptosis and inhibitory invasiveness were accompanied by sustained phosphorylation of JNK1/2 and p70S6K as well as generation of the reactive oxygen species. In addition, differential proteins displayed between CIL-102-treated and untreated U87 were determined and validated. There were 11 differentially expressed proteins between the CIL-102-treated and untreated groups. Furthermore, we demonstrated that CIL-102 inhibited cancer cell proliferation and reduced anti-invasion properties by up-regulating the levels of FUMH (Fumarate hydratase). The investigation demonstrated that there was an increase in the cellular levels of FUMH in the CIL-102 reduction in viability and invasion via the activation of JNK1/2 and mTOR signaling modules. NAC administration and shRNA FUMH conferred resistance to CIL-102-inhibited HIF1? and MMP-2 levels via inhibition of JNK1/2 and mTOR activation. We concluded that CIL-102-induced an apoptosis cascade and decreased aggressiveness in astrocytoma cells by modulation of mitochondria function, providing a new mechanism for CIL-102 treatment. - Highlights: We found the effect of CIL-102 on neuroblastoma cells. Fumarate hydratase as a CIL-102's target by proteomic differential displays. CIL-102 regulated-FUMH stimulates apoptosis-related protein and inactivation HIF1.

  16. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOE Patents [OSTI]

    McCutchen-Maloney, Sandra L.


    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  17. Fast, Quantitative, and Nondestructive Evaluation on Hydrided LWR Fuel Cladding by Small Angle Incoherent Neutron Scattering of Hydrogen

    SciTech Connect (OSTI)

    Yan, Yong; Qian, Shuo; Littrell, Ken; Parish, Chad M; Plummer, Lee K


    A non-destructive neutron scattering method to precisely measure the uptake of hydrogen and the distribution of hydride precipitates in light water reactor (LWR) fuel cladding was developed. Zircaloy-4 cladding used in commercial LWRs was used to produce hydrided specimens. The hydriding apparatus consists of a closed stainless steel vessel that contains Zr alloy specimens and hydrogen gas. Following hydrogen charging, the hydrogen content of the hydrided specimens was measured using the vacuum hot extraction method, by which the samples with desired hydrogen concentration were selected for the neutron study. Optical microscopy shows that our hydriding procedure results in uniform distribution of circumferential hydrides across the wall. Small angle neutron incoherent scattering was performed in the High Flux Isotope Reactor at Oak Ridge National Laboratory. Our study demonstrates that the hydrogen in commercial Zircaloy-4 cladding can be measured very accurately in minutes by this nondestructive method over a wide range of hydrogen concentrations from a very small amount ( 20 ppm) to over 1000 ppm. The hydrogen distribution in a tube sample was obtained by scaling the neutron scattering rate with a factor determined by a calibration process using standard, destructive direct chemical analysis methods on the specimens. This scale factor can be used in future tests with unknown hydrogen concentrations, thus providing a nondestructive method for absolute hydrogen concentration determination.

  18. Development of an objective questionnaire to assess perception, concern, and knowledge of, and attention and response to, the threat of nuclear war

    SciTech Connect (OSTI)

    Kulman, I.R.


    In addition to the subject objective, the relationship of specified personality variables (i.e., trait anxiety, locus of control, response tendency towards threat, and denial) to behavioral and psychological responses to the threat of nuclear war were assessed. The quantitative questionnaire, titled the Nuclear Reaction Scale, was composed of items selected from issues discussed in the psychological literature on the threat of nuclear war. These issues included: psychic numbing, cognitive reality, perceptions of likelihood and survival, nuclear illusions, and attention to the threat of nuclear war. A standardization sample of 360 college students was administered the Nuclear Reaction Scale, Trait Anxiety Scale, Internal-External Locus of Control Scale, Facilitation-Inhibition Scale, and Haan Denial Scale. Three additional subsamples, identified as Military, Nuclear Freeze, and Church, were given the Nuclear Reaction Scale to assess the validity of the scale. A factor analysis of the Nuclear Reaction Scale indicated a nine-factor solution that described issues such as concern perceptions, likelihood, survivability, and control over the threat of nuclear war. A number of strong relationships existed between computed factors on the Nuclear Reaction Scale. Demographic comparisons found significant differences related to sex and political affiliation.

  19. Mineralogical evaluation and industrial applications of the Triassic clay deposits, Southern Tunisia

    SciTech Connect (OSTI)

    Baccour, H. Medhioub, M.; Jamoussi, F.; Mhiri, T.; Daoud, A.


    This study deals with the mineralogical and thermal analysis of Triassic clays in the south-Eastern Tunisia (Medenine area) in order to use them in the faience ceramic. That is why the study had recourse to several quantitative and qualitative research instruments: chemical analysis, mineralogical study, thermal analyses and analyses of geotechnical traits. The data collected from these techniques show that illite and kaolinite are the major clay phases. The accessory minerals detected in powdered rock are; quartz, dolomite and hematite. Geotechnical characterization was carried out on the three representative mixtures of Triassic clay samples. Each mixture is fired at three different temperatures 850,900 and 950 deg. C. Firing characteristics (shrinkage, water absorption, and mechanical resistance to the inflection) were measured and the neomineralization processes were investigated principally by X-ray diffraction. At the end of this study, one can affirm that these clays have qualities necessary for the manufacture of faience ceramic and earthenware production.

  20. SREL Reprint #3174

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4 Novel microsatellite loci for the compost earthworm Eisenia fetida: A genetic comparison of three North American vermiculture stocks Christopher M. Somers1, Kara Neudorf1,...

  1. SREL Reprint #3226

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    endemic to wetlands dispersed throughout southeastern Arizona, USA, and northern Sonora, Mexico. Methods and Results: Eight loci (one of which was monomorphic) were developed...

  2. SREL Reprint #3213

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    annual plant species introduced into North America from Asia that has recently become invasive. Methods and Results: A total of 12 polymorphic and 3 monomorphic loci were screened...

  3. SREL Reprint #3153

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    amplified in R. saharica. These loci provide tools for examining the population genetics and taxomomic boundaries in R. decollata and its allies. Keywords: Rumina, Land...

  4. SREL Reprint #3161

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species. Conservation Genetics Resources 2010(2): 251-254...

  5. SREL Reprint #3171

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2011. Development and characterization of ten polymorphic microsatellite loci in the yellowtail flounder (Limanda ferruginea). Conservation Genetics Resources (2011) 3:369-37...

  6. SREL Reprint #3077

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Isolation and characterization of microsatellite loci for Florida largemouth bass, Micropterus salmoides floridanus, and other micropterids DIJAR J. LUTZ-CARRILLO1, CRIS HAGEN2,...

  7. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... similarities of 6 loci of Shewanella genome selected from a shared gene list of the ... gene function, regulation, network and evolution of Desulfovibrio vugaris Hildenborough ...

  8. Low-dose gold nanoparticles exert subtle endocrine-modulating effects on the ovarian steroidogenic pathway ex vivo independent of oxidative stress

    SciTech Connect (OSTI)

    Larson, Jeremy K.; Carvan, Michael J.; Teeguarden, Justin G.; Watanabe, Gen; Taya, Kazuyoshi; Krystofiak, Evan; Hutz, Reinhold J.


    Gold nanoparticles (GNPs) have gained considerable attention for application in science and industry. However, the untoward effects of such particles on female fertility remain unclear. The objectives of this study were to (1) examine the effects of 10-nm GNPs on progesterone and estradiol-17b accumulation by rat ovaries ex vivo and (2) to identify the locus/loci whereby GNPs modulate steroidogenesis via multiple-reference gene quantitative real-time RT-PCR. Regression analyses indicated a positive relationship between both Star (p < 0.05, r2 = 0.278) and Cyp11a1 (p < 0.001, r2 = 0.366) expression and P4 accumulation. upon exposure to 1.43 * 106 GNPs/mL. Additional analyses showed that E2 accumulation was positively associated with Hsd3b1 (p < 0.05, r2 = 0.181) and Cyp17a1 (p < 0.01, r2 = 0.301) expression upon exposure to 1.43 * 13 and 1.43 * 109 GNPs/mL, respectively. These results suggest a subtle treatmentdependent impact of low-dose GNPs on the relationship between progesterone or estradiol-17b and specific steroidogenic target genes, independent of oxidative stress or inhibin.

  9. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, D.A.; Keller, R.A.


    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect have been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical path length of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10[sup [minus]5] cm[sup [minus]1] can then be determined in the presence of background absorptions in excess of 10[sup [minus]3] cm[sup [minus]1]. In addition, the smallest absorption measured with the instant apparatus and method is about 5 [times] 10[sup [minus]6] cm[sup [minus]1]. 6 figs.

  10. Quantitation and localization of intracellular redox active metals by X-ray fluorescence microscopy in cortical neurons derived from APP and APLP2 knockout tissue

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ciccotosto, Giuseppe D.; James, Simon A.; Altissimo, Matteo; Paterson, David; Vogt, Stefan; Lai, Barry; de Jonge, Martin D.; Howard, Daryl L.; Bush, Ashley I.; Cappai, Roberto


    The amyloid precursor protein (APP) gene family includes APP and the amyloid precursor-like proteins, APLP1 and APLP2. These proteins contain metal binding sites for copper, zinc and iron and are known to have physiological roles in modulating the metal homeostasis in brain cells. Here we report the application of X-ray fluorescence microscopy (XFM) to investigate the subcellular distribution patterns of the metal ions Cu, Zn, Fe, and Ca in individual neurons derived from APP and APLP2 knockout mice brains to further define their role in metal homeostasis. These studies add to the growing body of data that the APP familymore » of proteins are metalloproteins that have shared as well as distinct effects on metals. As we continue to delineate the cellular effects of the APP family of proteins it is important to consider how metals are involved in their actions.« less

  11. Syntrophic interactions and mechanisms underpinning anaerobic methane oxidation: targeted metaproteogenomics, single-cell protein detection and quantitative isotope imaging of microbial consortia

    SciTech Connect (OSTI)

    Orphan, Victoria Jeanne


    Syntrophy and mutualism play a central role in carbon and nutrient cycling by microorganisms. Yet, our ability to effectively study symbionts in culture has been hindered by the inherent interdependence of syntrophic associations, their dynamic behavior, and their frequent existence at thermodynamic limits. Now solutions to these challenges are emerging in the form of new methodologies. Developing strategies that establish links between the identity of microorganisms and their metabolic potential, as well as techniques that can probe metabolic networks on a scale that captures individual molecule exchange and processing, is at the forefront of microbial ecology. Understanding the interactions between microorganisms on this level, at a resolution previously intractable, will lead to our greater understanding of carbon turnover and microbial community resilience to environmental perturbations. In this project, we studied an enigmatic syntrophic association between uncultured methane-oxidizing archaea and sulfate-reducing bacteria. This environmental archaeal-bacterial partnership represents a globally important sink for methane in anoxic environments. The specific goals of this project were organized into 3 major tasks designed to address questions relating to the ecophysiology of these syntrophic organisms under changing environmental conditions (e.g. different electron acceptors and nutrients), primarily through the development of microanalytical imaging methods which enable the visualization of the spatial distribution of the partners within aggregates, consumption and exchange of isotopically labeled substrates, and expression of targeted proteins identified via metaproteomics. The advanced tool set developed here to collect, correlate, and analyze these high resolution image and isotope-based datasets from methane-oxidizing consortia has the potential to be widely applicable for studying and modeling patterns of activity and interactions across a broad range of spatially structured microbial partnerships, including other syntrophic associations, microbial mats, biofilms, and plant-microbe or animal-microbe symbioses in nature.

  12. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, David A.; Keller, Richard A.


    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect has been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical pathlength of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10.sup.-5 cm.sup.-1 can then be determined in the presence of background absorptions in excess of 10.sup.-3 cm.sup.-1. In addition, the smallest absorption measured with the instant apparatus and method is about 5.times. 10.sup.-6 cm.sup.-1.

  13. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, D.A.; Keller, R.A.


    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect has been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical pathlength of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10/sup -5/ cm/sup -1/ can then be determined in the presence of background absorptions in excess of 10/sup -3/ cm/sup -1/. In addition, the smallest absorption measured with the instant apparatus and method is about 5 x 10/sup -6/ cm/sup -1/.

  14. Quantitative understanding of Forbush decrease drivers based on shock-only and CME-only models using global signature of February 14, 1978 event

    SciTech Connect (OSTI)

    Raghav, Anil; Lotekar, Ajay; Bhaskar, Ankush; Vichare, Geeta; Yadav, Virendra E-mail: E-mail:


    We have studied the Forbush decrease (FD) event that occurred on February 14, 1978 using 43 neutron monitor observatories to understand the global signature of FD. We have studied rigidity dependence of shock amplitude and total FD amplitude. We have found almost the same power law index for both shock phase amplitude and total FD amplitude. Local time variation of shock phase amplitude and maximum depression time of FD have been investigated which indicate possible effect of shock/CME orientation. We have analyzed rigidity dependence of time constants of two phase recovery. Time constants of slow component of recovery phase show rigidity dependence and imply possible effect of diffusion. Solar wind speed was observed to be well correlated with slow component of FD recovery phase. This indicates solar wind speed as possible driver of recovery phase. To investigate the contribution of interplanetary drivers, shock and CME in FD, we have used shock-only and CME-only models. We have applied these models separately to shock phase and main phase amplitudes respectively. This confirms presently accepted physical scenario that the first step of FD is due to propagating shock barrier and second step is due to flux rope of CME/magnetic cloud.

  15. A quantitative comparison of the cost of employing EOR-coupled CSS supplemented with secondary DSF storage for two large CO2 point sources

    SciTech Connect (OSTI)

    Davidson, Casie L.; Dahowski, Robert T.; Dooley, James J.


    This paper explores the impact of the temporally dynamic demand for CO2 for enhanced hydrocarbon recovery with CO2 storage. Previous evaluations of economy-wide CO2 capture and geologic storage (CCS) deployment have typically applied a simplifying assumption that 100% of the potential storage capacity for a given formation is available on the first day of the analysis, and that the injection rate impacts only the number of wells required to inject a given volume of fluid per year, making it a cost driver rather than a technical one. However, as discussed by Dahowski and Bachu [1], storing CO2 in a field undergoing CO2 flooding for enhanced oil recovery (EOR) is subject to a set of constraints to which storage in DSFs is not, and these constraints combined with variable demand for CO2 may strongly influence the ability of an EOR field to serve as a baseload storage formation for commercial scale CCS projects undertaken as a means of addressing climate change mitigation targets. This analysis assumes that CCS is being undertaken in order to reduce CO2 emissions from the industrial sources evaluated and that there is enough of a disincentive associated with venting CO2 to the atmosphere that any CO2 not used within the EOR field will be stored in a suitable nearby deep saline formation (DSF). The authors have applied a CO2 demand profile to two cases chosen to illustrate the differences in cost impacts of employing EOR-based CCS as a part of a given source’s CCS portfolio. The first scenario is a less-than-ideal case in which a single EOR field is used for storage and all CO2 not demanded by the EOR project is stored in a DSF; the second scenario is designed to optimize costs by minimizing storage in the DSF and maximizing lower-cost EOR-based storage. Both scenarios are evaluated for two facilities emitting 3 and 6 MtCO2/y, corresponding to a natural gas processing facility and an IGCC electric power plant, respectively. Annual and lifetime average CO2 transport and storage costs are presented, and the impact of added capture and compression costs on overall project economics is examined.

  16. Quantitation and localization of intracellular redox active metals by X-ray fluorescence microscopy in cortical neurons derived from APP and APLP2 knockout tissue

    SciTech Connect (OSTI)

    Ciccotosto, Giuseppe D.; James, Simon A.; Altissimo, Matteo; Paterson, David; Vogt, Stefan; Lai, Barry; de Jonge, Martin D.; Howard, Daryl L.; Bush, Ashley I.; Cappai, Roberto


    The amyloid precursor protein (APP) gene family includes APP and the amyloid precursor-like proteins, APLP1 and APLP2. These proteins contain metal binding sites for copper, zinc and iron and are known to have physiological roles in modulating the metal homeostasis in brain cells. Here we report the application of X-ray fluorescence microscopy (XFM) to investigate the subcellular distribution patterns of the metal ions Cu, Zn, Fe, and Ca in individual neurons derived from APP and APLP2 knockout mice brains to further define their role in metal homeostasis. These studies add to the growing body of data that the APP family of proteins are metalloproteins that have shared as well as distinct effects on metals. As we continue to delineate the cellular effects of the APP family of proteins it is important to consider how metals are involved in their actions.

  17. Quantitative analysis of magnetic spin and orbital moments from an oxidized iron (1 1 0) surface using electron magnetic circular dichroism

    SciTech Connect (OSTI)

    Thersleff, Thomas; Rusz, Jan; Rubino, Stefano; Hjörvarsson, Björgvin; Ito, Yasuo; J. Zaluzec, Nestor; Leifer, Klaus


    Understanding the ramifications of reduced crystalline symmetry on magnetic behavior is a critical step in improving our understanding of nanoscale and interfacial magnetism. However, investigations of such effects are often controversial largely due to the challenges inherent in directly correlating nanoscale stoichiometry and structure to magnetic behavior. Here, we describe how to use Transmission Electron Microscope (TEM) to obtain Electron Magnetic Circular Dichroism (EMCD) signals as a function of scattering angle to locally probe the magnetic behavior of thin oxide layers grown on an Fe (1 1 0) surface. Experiments and simulations both reveal a strong dependence of the magnetic orbital to spin ratio on its scattering vector in reciprocal space. We exploit this variation to extract the magnetic properties of the oxide cladding layer, showing that it locally may exhibit an enhanced orbital to spin moment ratio. This finding is supported here by both spatially and angularly resolved EMCD measurements, opening up the way for compelling investigations into how magnetic properties are affected by nanoscale features.

  18. Quantitative analysis of magnetic spin and orbital moments from an oxidized iron (1 1 0) surface using electron magnetic circular dichroism

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Thersleff, Thomas; Rusz, Jan; Rubino, Stefano; Hjörvarsson, Björgvin; Ito, Yasuo; J. Zaluzec, Nestor; Leifer, Klaus


    Understanding the ramifications of reduced crystalline symmetry on magnetic behavior is a critical step in improving our understanding of nanoscale and interfacial magnetism. However, investigations of such effects are often controversial largely due to the challenges inherent in directly correlating nanoscale stoichiometry and structure to magnetic behavior. Here, we describe how to use Transmission Electron Microscope (TEM) to obtain Electron Magnetic Circular Dichroism (EMCD) signals as a function of scattering angle to locally probe the magnetic behavior of thin oxide layers grown on an Fe (1 1 0) surface. Experiments and simulations both reveal a strong dependence of the magneticmore » orbital to spin ratio on its scattering vector in reciprocal space. We exploit this variation to extract the magnetic properties of the oxide cladding layer, showing that it locally may exhibit an enhanced orbital to spin moment ratio. This finding is supported here by both spatially and angularly resolved EMCD measurements, opening up the way for compelling investigations into how magnetic properties are affected by nanoscale features.« less

  19. SU-E-I-63: Quantitative Evaluation of the Effects of Orthopedic Metal Artifact Reduction (OMAR) Software On CT Images for Radiotherapy Simulation

    SciTech Connect (OSTI)

    Jani, S [Sharp Memorial Hospital, San Diego, CA (United States)


    Purpose: CT simulation for patients with metal implants can often be challenging due to artifacts that obscure tumor/target delineation and normal organ definition. Our objective was to evaluate the effectiveness of Orthopedic Metal Artifact Reduction (OMAR), a commercially available software, in reducing metal-induced artifacts and its effect on computed dose during treatment planning. Methods: CT images of water surrounding metallic cylindrical rods made of aluminum, copper and iron were studied in terms of Hounsfield Units (HU) spread. Metal-induced artifacts were characterized in terms of HU/Volume Histogram (HVH) using the Pinnacle treatment planning system. Effects of OMAR on enhancing our ability to delineate organs on CT and subsequent dose computation were examined in nine (9) patients with hip implants and two (2) patients with breast tissue expanders. Results: Our study characterized water at 1000 HU with a standard deviation (SD) of about 20 HU. The HVHs allowed us to evaluate how the presence of metal changed the HU spread. For example, introducing a 2.54 cm diameter copper rod in water increased the SD in HU of the surrounding water from 20 to 209, representing an increase in artifacts. Subsequent use of OMAR brought the SD down to 78. Aluminum produced least artifacts whereas Iron showed largest amount of artifacts. In general, an increase in kVp and mA during CT scanning showed better effectiveness of OMAR in reducing artifacts. Our dose analysis showed that some isodose contours shifted by several mm with OMAR but infrequently and were nonsignificant in planning process. Computed volumes of various dose levels showed <2% change. Conclusions: In our experience, OMAR software greatly reduced the metal-induced CT artifacts for the majority of patients with implants, thereby improving our ability to delineate tumor and surrounding organs. OMAR had a clinically negligible effect on computed dose within tissues. Partially funded by unrestricted educational grant from Philips.

  20. Quantitative Analysis of the Principal-Agent Problem in Commercial Buildings in the U.S.: Focus on Central Space Heating and Cooling

    SciTech Connect (OSTI)

    Blum, Helcio; Sathaye, Jayant


    We investigate the existence of the principal-agent (PA) problem in non-government, non-mall commercial buildings in the U.S. in 2003. The analysis concentrates on space heating and cooling energy consumed by centrally installed equipment in order to verify whether a market failure caused by the PA problem might have prevented the installation of energy-efficient devices in non-owner-occupied buildings (efficiency problem) and/or the efficient operation of space-conditioning equipment in these buildings (usage problem). Commercial Buildings Energy Consumption Survey (CBECS) 2003 data for single-owner, single-tenant and multi-tenant occupied buildings were used for conducting this evaluation. These are the building subsets with the appropriate conditions for assessing both the efficiency and the usage problems. Together, these three building types represent 51.9percent of the total floor space of all buildings with space heating and 59.4percent of the total end-use energy consumption of such buildings; similarly, for space cooling, they represent 52.7percent of floor space and 51.6percent of energy consumption. Our statistical analysis shows that there is a usage PA problem. In space heating it applies only to buildings with a small floor area (<_50,000 sq. ft.). We estimate that in 2003 it accounts for additional site energy consumption of 12.3 (+ 10.5 ) TBtu (primary energy consumption of 14.6 [+- 12.4] TBtu), corresponding to 24.0percent (+- 20.5percent) of space heating and 10.2percent (+- 8.7percent) of total site energy consumed in those buildings. In space cooling, however, the analysis shows that the PA market failure affects the complete set of studied buildings. We estimate that it accounts for a higher site energy consumption of 8.3 (+-4.0) TBtu (primary energy consumption of 25.5 [+- 12.2]TBtu), which corresponds to 26.5percent (+- 12.7percent) of space cooling and 2.7percent (+- 1.3percent) of total site energy consumed in those buildings.

  1. Quantitative in-situ scanning electron microscope pull-out experiments and molecular dynamics simulations of carbon nanotubes embedded in palladium

    SciTech Connect (OSTI)

    Hartmann, S., E-mail:; Blaudeck, T.; Hermann, S.; Wunderle, B. [Technische Universitt Chemnitz, Reichenhainer Str. 70, 09126 Chemnitz (Germany); Hlck, O. [Technische Universitt Chemnitz, Reichenhainer Str. 70, 09126 Chemnitz (Germany); Fraunhofer IZM Berlin, Gustav-Meyer-Allee 25, 13355 Berlin (Germany); Schulz, S. E.; Gessner, T. [Technische Universitt Chemnitz, Reichenhainer Str. 70, 09126 Chemnitz (Germany); Fraunhofer ENAS Chemnitz, Technologie-Campus 3, 09126 Chemnitz (Germany)


    In this paper, we present our results of experimental and numerical pull-out tests on carbon nanotubes (CNTs) embedded in palladium. We prepared simple specimens by employing standard silicon wafers, physical vapor deposition of palladium and deposition of CNTs with a simple drop coating technique. An AFM cantilever with known stiffness connected to a nanomanipulation system was utilized inside a scanning electron microscope (SEM) as a force sensor to determine forces acting on a CNT during the pull-out process. SEM-images of the cantilever attached to a CNT have been evaluated for subsequent displacement steps with greyscale correlation to determine the cantilever deflection. We compare the experimentally obtained pull-out forces with values of numerical investigations by means of molecular dynamics and give interpretations for deviations according to material impurities or defects and their influence on the pull-out data. We find a very good agreement of force data from simulation and experiment, which is 17 nN and in the range of 1061 nN, respectively. Our findings contribute to the ongoing research of the mechanical characterization of CNT-metal interfaces. This is of significant interest for the design of future mechanical sensors utilizing the intrinsic piezoresistive effect of CNTs or other future devices incorporating CNT-metal interfaces.

  2. Performance Testing and Validation Plan for HMS4 Quantitative Gamma Measurements, K-25/K-27 D&D Project, East Tennessee Technology Park, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    Thiesing, J. W.; Donohoue, Tom; McCague, Jim; Martin, Ray; Royce, Ralph; Thomas, Troy


    The Holdup Measurement System 4 (HMS4) is a portable thallium activated sodium iodide (NaI[Tl]) gamma ray energy spectrometer that, when properly calibrated, is able to make quantifiable assessment of U-235 holdup in the presence of other uranium isotopes and prevailing background radiation. The use and calibration of the HMS4 is based upon the methodologies defined by Russo in La-14206, (Russo 2005), where detection efficiency determination protocols are defined (called Generalized Geometry Holdup [GGH]). The GGH methodology together with attenuation correction algorithms and other modeling parameters are combined in the HMS4 software package to provide a comprehensive tool for conducting in situ gamma-ray measurements. The fundamental principles of these capabilities are discussed.

  3. Evaluation of Life History Diversity, Habitat Connectivity, and Survival Benefits Associated with Habitat Restoration Actions in the Lower Columbia River and Estuary, Annual Report 2010

    SciTech Connect (OSTI)

    Diefenderfer, Heida L.; Johnson, Gary E.; Sather, Nichole K.; Skalski, J. R.; Dawley, Earl M.; Coleman, Andre M.; Ostrand, Kenneth G.; Hanson, Kyle C.; Woodruff, Dana L.; Donley, Erin E.; Ke, Yinghai; Buenau, Kate E.; Bryson, Amanda J.; Townsend, Richard L.


    This report describes the 2010 research conducted under the U.S. Army Corps of Engineers (USACE) project EST-P-09-1, titled Evaluation of Life History Diversity, Habitat Connectivity, and Survival Benefits Associated with Habitat Restoration Actions in the Lower Columbia River and Estuary, and known as the 'Salmon Benefits' study. The primary goal of the study is to establish scientific methods to quantify habitat restoration benefits to listed salmon and trout in the lower Columbia River and estuary (LCRE) in three required areas: habitat connectivity, early life history diversity, and survival (Figure ES.1). The general study approach was to first evaluate the state of the science regarding the ability to quantify benefits to listed salmon and trout from habitat restoration actions in the LCRE in the 2009 project year, and then, if feasible, in subsequent project years to develop quantitative indices of habitat connectivity, early life history diversity, and survival. Based on the 2009 literature review, the following definitions are used in this study. Habitat connectivity is defined as a landscape descriptor concerning the ability of organisms to move among habitat patches, including the spatial arrangement of habitats (structural connectivity) and how the perception and behavior of salmon affect the potential for movement among habitats (functional connectivity). Life history is defined as the combination of traits exhibited by an organism throughout its life cycle, and for the purposes of this investigation, a life history strategy refers to the body size and temporal patterns of estuarine usage exhibited by migrating juvenile salmon. Survival is defined as the probability of fish remaining alive over a defined amount of space and/or time. The objectives of the 4-year study are as follows: (1) develop and test a quantitative index of juvenile salmon habitat connectivity in the LCRE incorporating structural, functional, and hydrologic components; (2) develop and test a quantitative index of the early life history diversity of juvenile salmon in the LCRE; (3) assess and, if feasible, develop and test a quantitative index of the survival benefits of tidal wetland habitat restoration (hydrologic reconnection) in the LCRE; and (4) synthesize the results of investigations into the indices for habitat connectivity, early life history diversity, and survival benefits.

  4. Performance evaluation of diaminoazoxyfurazan (DAAF) as a booster material for insensitive high explosives using the onionskin test

    SciTech Connect (OSTI)

    Morris, John S; Francois, Elizabeth G; Hooks, Daniel E; Hill, Larry G; Harry, Herbert H


    Initiation of insensitive high explosive (IHE) formulations requires the use of a booster explosive in the initiation train. Booster material selection is crucial, as the initiation must reliably function across some spectrum of physical parameters. The interest in DAAF for this application stems from the fact that it possesses many traits of an IHE but is shock sensitive enough to serve as an explosive booster. A hemispherical wave breakout test, termed the onionskin test, is one of the methods used to evaluate the performance of a booster material. The wave breakout time-position history at the surface of a hemisphericallHE charge is recorded and the relative uniformity of the breakout can be quantitatively compared between booster materials. A series of onionskin tests were performed to investigate breakout and propagation diaminoazoxyfurazan (DAAF) at low temperatures to evaluate ignition and detonation spreading in comparison to other explosives commonly used in booster applications. Some wave perturbation was observed with the DAAF booster in the onionskin tests presented. The results of these tests will be presented and discussed.

  5. SREL Reprint #3075

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    5 Fifteen polymorphic microsatellite DNA loci from Hawaii’s Metrosideros polymorpha (Myrtaceae: Myrtales), a model species for ecology and evolution NICHOLAS G. CRAWFORD1, CRIS HAGEN1, HEATHER F. SAHLI2, ELIZABETH A. STACY2, and TRAVIS C. GLENN1 1Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29802, USA 2Department of Biology, University of Hawaii at Hilo, 200 W. Kawili Street, Hilo, HI 96720, USA Abstract: We developed 15 polymorphic microsatellite loci from the

  6. SREL Reprint #3157

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Development and characterization of twelve polymorphic microsatellite loci in the Bog Copper, Lycaena epixanthe Sarah P. Flanagan1, W. Herbert Wilson1, Kenneth L. Jones2, and Stacey L. Lance3 1Department of Biology, Colby College, Waterville, ME 04901, USA 2Georgia Genomics Facility, University of Georgia, Athens, GA 30602, USA 3Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29802, USA Abstract: We isolated and characterized 12 microsatellite loci from the Bog

  7. Linkage maps of rat chromosomes 15, 16, 17, 19, and X

    SciTech Connect (OSTI)

    Du, Ying; Remmers, E.F.; Goldmuntz, E.A.


    This article reports on novel linkage maps of rat chromosomes 15, 16, 17, 19, and X. Such a map is needed to further the usefulness of the rat as a biological model in hereditary diseases. The linkage map results produced polymorphic markers which were associated with eight known genes and fourteen anonymous loci. This was accomplished using PCR analysis of somatic cell hybrids or previously listed loci locations. 15 refs., 1 fig., 1 tab.

  8. Direct imaging of crystal structure and defects in metastable Ge{sub 2}Sb{sub 2}Te{sub 5} by quantitative aberration-corrected scanning transmission electron microscopy

    SciTech Connect (OSTI)

    Ross, Ulrich; Lotnyk, Andriy Thelander, Erik; Rauschenbach, Bernd


    Knowledge about the atomic structure and vacancy distribution in phase change materials is of foremost importance in order to understand the underlying mechanism of fast reversible phase transformation. In this Letter, by combining state-of-the-art aberration-corrected scanning transmission electron microscopy with image simulations, we are able to map the local atomic structure and composition of a textured metastable Ge{sub 2}Sb{sub 2}Te{sub 5} thin film deposited by pulsed laser deposition with excellent spatial resolution. The atomic-resolution scanning transmission electron microscopy investigations display the heterogeneous defect structure of the Ge{sub 2}Sb{sub 2}Te{sub 5} phase. The obtained results are discussed. Highly oriented Ge{sub 2}Sb{sub 2}Te{sub 5} thin films appear to be a promising approach for further atomic-resolution investigations of the phase change behavior of this material class.

  9. SU-E-CAMPUS-J-05: Quantitative Investigation of Random and Systematic Uncertainties From Hardware and Software Components in the Frameless 6DBrainLAB ExacTrac System

    SciTech Connect (OSTI)

    Keeling, V; Jin, H; Hossain, S; Ahmad, S; Ali, I


    Purpose: To evaluate setup accuracy and quantify individual systematic and random errors for the various hardware and software components of the frameless 6D-BrainLAB ExacTrac system. Methods: 35 patients with cranial lesions, some with multiple isocenters (50 total lesions treated in 1, 3, 5 fractions), were investigated. All patients were simulated with a rigid head-and-neck mask and the BrainLAB localizer. CT images were transferred to the IPLAN treatment planning system where optimized plans were generated using stereotactic reference frame based on the localizer. The patients were setup initially with infrared (IR) positioning ExacTrac system. Stereoscopic X-ray images (XC: X-ray Correction) were registered to their corresponding digitally-reconstructed-radiographs, based on bony anatomy matching, to calculate 6D-translational and rotational (Lateral, Longitudinal, Vertical, Pitch, Roll, Yaw) shifts. XC combines systematic errors of the mask, localizer, image registration, frame, and IR. If shifts were below tolerance (0.7 mm translational and 1 degree rotational), treatment was initiated; otherwise corrections were applied and additional X-rays were acquired to verify patient position (XV: X-ray Verification). Statistical analysis was used to extract systematic and random errors of the different components of the 6D-ExacTrac system and evaluate the cumulative setup accuracy. Results: Mask systematic errors (translational; rotational) were the largest and varied from one patient to another in the range (−15 to 4mm; −2.5 to 2.5degree) obtained from mean of XC for each patient. Setup uncertainty in IR positioning (0.97,2.47,1.62mm;0.65,0.84,0.96degree) was extracted from standard-deviation of XC. Combined systematic errors of the frame and localizer (0.32,−0.42,−1.21mm; −0.27,0.34,0.26degree) was extracted from mean of means of XC distributions. Final patient setup uncertainty was obtained from the standard deviations of XV (0.57,0.77,0.67mm,0.39,0.35,0.30degree). Conclusion: Statistical analysis was used to calculate cumulative and individual systematic errors from the different hardware and software components of the 6D-ExacTrac-system. Patients were treated with cumulative errors (<1mm,<1degree) with XV image guidance.


    SciTech Connect (OSTI)

    Kim, D.-C.; Evans, A. S.; Privon, G. C. E-mail:; and others


    A Hubble Space Telescope/Advanced Camera for Surveys study of the structural properties of 85 luminous and ultraluminous (L{sub IR} > 10{sup 11.4} L{sub Sun }) infrared galaxies (LIRGs and ULIRGs) in the Great Observatories All-sky LIRG Survey (GOALS) sample is presented. Two-dimensional GALFIT analysis has been performed on F814W ''I-band'' images to decompose each galaxy, as appropriate, into bulge, disk, central point-spread function (PSF) and stellar bar components. The fraction of bulge-less disk systems is observed to be higher in LIRGs (35%) than in ULIRGs (20%), with the disk+bulge systems making up the dominant fraction of both LIRGs (55%) and ULIRGs (45%). Further, bulge+disk systems are the dominant late-stage merger galaxy type and are the dominant type for LIRGs and ULIRGs at almost every stage of galaxy-galaxy nuclear separation. The mean I-band host absolute magnitude of the GOALS galaxies is -22.64 {+-} 0.62 mag (1.8{sup +1.4}{sub -0.4} L{sup *}{sub I}), and the mean bulge absolute magnitude in GOALS galaxies is about 1.1 mag fainter than the mean host magnitude. Almost all ULIRGs have bulge magnitudes at the high end (-20.6 to -23.5 mag) of the GOALS bulge magnitude range. Mass ratios in the GOALS binary systems are consistent with most of the galaxies being the result of major mergers, and an examination of the residual-to-host intensity ratios in GOALS binary systems suggests that smaller companions suffer more tidal distortion than the larger companions. We find approximately twice as many bars in GOALS disk+bulge systems (32.8%) than in pure-disk mergers (15.9%) but most of the disk+bulge systems that contain bars are disk-dominated with small bulges. The bar-to-host intensity ratio, bar half-light radius, and bar ellipticity in GOALS galaxies are similar to those found in nearby spiral galaxies. The fraction of stellar bars decreases toward later merger stages and smaller nuclear separations, indicating that bars are destroyed as the merger advances. In contrast, the fraction of nuclear PSFs increases toward later merger stages and is highest in late-stage systems with a single nucleus. Thus, light from an active galactic nucleus or compact nuclear star cluster is more visible at I band as ULIRGs enter their latter stages of evolution. Finally, both GOALS elliptical hosts and nearby Sloan Digital Sky Survey (SDSS) ellipticals occupy the same part of the surface brightness versus half-light radius plot (i.e., the {sup K}ormendy Relation{sup )} and have similar slopes, consistent with the possibility that the GOALS galaxies belong to the same parent population as the SDSS ellipticals.

  11. Sci—Thur PM: Imaging — 04: An iterative triple energy window (TEW) approach to cross talk correction in quantitative small animal Tc99m and In111 SPECT

    SciTech Connect (OSTI)

    Prior, P; Timmins, R; Wells, R G


    Dual isotope SPECT allows simultaneous measurement of two different tracers in vivo. With In111 (emission energies of 171keV and 245keV) and Tc99m (140keV), quantification of Tc99m is degraded by cross talk from the In111 photons that scatter and are detected at an energy corresponding to Tc99m. TEW uses counts recorded in two narrow windows surrounding the Tc99m primary window to estimate scatter. Iterative TEW corrects for the bias introduced into the TEW estimate resulting from un-scattered counts detected in the scatter windows. The contamination in the scatter windows is iteratively estimated and subtracted as a fraction of the scatter-corrected primary window counts. The iterative TEW approach was validated with a small-animal SPECT/CT camera using a 2.5mL plastic container holding thoroughly mixed Tc99m/In111 activity fractions of 0.15, 0.28, 0.52, 0.99, 2.47 and 6.90. Dose calibrator measurements were the gold standard. Uncorrected for scatter, the Tc99m activity was over-estimated by as much as 80%. Unmodified TEW underestimated the Tc99m activity by 13%. With iterative TEW corrections applied in projection space, the Tc99m activity was estimated within 5% of truth across all activity fractions above 0.15. This is an improvement over the non-iterative TEW, which could not sufficiently correct for scatter in the 0.15 and 0.28 phantoms.

  12. Method and apparatus for transport, introduction, atomization and excitation of emission spectrum for quantitative analysis of high temperature gas sample streams containing vapor and particulates without degradation of sample stream temperature

    DOE Patents [OSTI]

    Eckels, David E.; Hass, William J.


    A sample transport, sample introduction, and flame excitation system for spectrometric analysis of high temperature gas streams which eliminates degradation of the sample stream by condensation losses.

  13. Oak Ridge National Laboratory Technology Marketing Summaries...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Find More Like This Spatially Resolved Quantitative ... for quantitative mapping of polymeric materials. This technique probes thermomechanical properties and phase ...

  14. Superconducting Topological Insulators

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and to strongly resist scattering from defects, naturally achieving some of the most desirable traits for computing components and next-generation "spintronics" technologies. ...

  15. SREL Reprint #3104

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    strategies by combining flood and shade-tolerance ratings with plant colonization traits, specifically seed size and dispersal mode, and asked if they predict field...

  16. A Holistic Framework for Environmental Flows Determination in...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... hydrologic classification and fish traits applied to 8-digit hydrologic unit codes (top). ... of ecological geospatial data sets. (A) Fish sampling point locations provided by two ...

  17. Genes and Genomics for Improving Energy Crops (Keynote Address - 2010 JGI User Meeting)

    ScienceCinema (OSTI)

    Pennell, Roger


    Roger Pennell, Vice President of Trait Development at Ceres, Inc., delivers a keynote address at the 5th Annual DOE JGI User Meeting on March 25, 2010

  18. The pathogen transmission avoidance theory of sexual selection

    SciTech Connect (OSTI)

    Loehle, C.


    The current theory that sexual selection results from female preference for males with good genes suffers from several problems. An alternative explanation, the pathogen transmission avoidance hypothesis, argues that the primary function of showy traits is to provide a reliable signal of current disease status, so that sick individuals can be avoided during mating. This study shows that a significant risk of pathogen transmission occurs during mating and that showy traits are reliable indicators of current disease status. The origin of female choosiness is argued to lie in a general tendency to avoid sick individuals, even in the absence of showy traits, which originate as exaggerations of normal traits that are indicative of good health (bright feathers, vigorous movement, large size). Thus, in this new model the origins of both showy traits and female choosiness are not problematic and there is no threshold effect. This model predicts that when the possession of male showy traits does not help to reduce disease in the female, showy traits are unlikely to occur. This case corresponds to thorough exposure of every animal to all group pathogens, on average, in large groups. Such species are shown with a large data set on birds to be less likely to exhibit showy traits. The good-genes model does not make this prediction. The pathogen transmission avoidance model can also lead to the evolution of showy traits even when selection is not effective against a given pathogen (e.g., when there is no heritable variation for resistance), but can result in selection for resistance if such genes are present. Monogamy is argued to reduce selection pressures for showy traits; data show monogamous species to be both less parasitized and less showy. In the context of reduction of pathogen transmission rates in showy populations, selection pressure becomes inversely frequency-dependent, which makes showy traits likely to be self-limiting rather than runaway.

  19. Evidence for the existence of a fourth dominantly inherited spinocerebellar ataxia locus

    SciTech Connect (OSTI)

    Lopes-Cendes, I. Montreal Neurological Institute and Hospital, Quebec McGill Univ., Quebec ); Andermann, E. McGill Univ., Quebec ); Rouleau, G.A. Montreal Neurological Institute and Hospital, Quebec )


    The autosomal dominantly inherited spinocerebellar ataxias (SCAs) are a heterogeneous group of disorders. To date, three loci have been identified: The SCA1 locus (on chr 6p), the SCA2 locus (on chr 12q), and more recently a Machado-Joseph disease (MJD) locus (on chr 14q). The authors have studied one large French-Canadian kindred with four generations of living affected individuals segregating an autosomal dominant form of SCA. Linkage analysis using anonymous DNA markers that flank the three previously described loci significantly exclude the French-Canadian kindred from the SCA1, SCA2, and MJD loci. Therefore, a fourth, still unmapped SCA locus remains to be identified. In addition, the unique clinical phenotype present in all affected individuals of the French-Canadian kindred might be characteristic of this still unmapped SCA locus. 34 refs., 2 figs., 2 tabs.

  20. Locus heterogeneity in autosomal dominant spinocerebellar ataxia: Evidence for the existence of a fifth locus

    SciTech Connect (OSTI)

    Sarrazin, J.; Rouleau, G.A.; Andermann, E.


    The autosomal dominantly inherited spinocerebellar ataxias (SCAs) are a heterogeneous group of neurodegenerative disorders. To date, four loci have been identified: the SCA-1 locus (on chromosome (chr) 6p), the SCA-2 locus (on chr 12q), the SCA-3/MJD locus (on chr 14q), and more recently an SCA-4 locus was described (chr 16q) in a Utah kindred. We have studied one large French Canadian kindred with four generations of living affected individuals segregating an autosomal dominant form of SCA. Linkage analysis using anonymous DNA markers which flank the four previously described loci significantly excludes the French Canadian kindred from the SCA-1, SCA-2, SCA-3/MJD and SCA-4 loci. Therefore a fifth, still unmapped, SCA locus remains to be identified.

  1. Slide 1

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    metrics provide quantitative basis for trading off between different operational modes ... metrics provide quantitative basis for trading off between different operational modes ...

  2. Office Of Nuclear Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    metrics provide quantitative basis for trading off between different operational modes ... metrics provide quantitative basis for trading off between different operational modes ...

  3. Recommendations for the Supplement Analysis Process

    Energy Savers [EERE]

    that are sometimes used to streamline quantitative estimates in EAs and Analytical Approaches to Streamline Quantitative Analysis * Scaling * Impact indicators * Numerical...

  4. BPA-2014-00440-FOIA Response

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    J. Munro Freedom of InformationPrivacy Act Officer e rLOCI y .. . u ... T5VWC e7.5 ffA< . . .. .dr7 74 cyi 4A iQ,i t?21 ,sS.Jgoi,&'9-, L.JM .thxayi 4 . i.. iIy 7 ...

  5. A note on Hardy-Weinberg equilibrium of VNTR data by using the Federal Bureau of Investigation's fixed-bin method

    SciTech Connect (OSTI)

    Devlin, B.; Risch, N. )


    To fully utilize the information of VNTR data for forensic inference, the probability of observing the matching suspect and evidentiary profile in a reference population is estimated, usually by assuming independence of alleles within and between loci. This assumption has been challenged on the basis of the observation that there is frequently an excess of single-band phenotypes (SBP) in forensic data bases, which could indicate lack of independence. Nevertheless, another explanation is that the excess SBP are artifacts of laboratory methods. In this report the authors examine the excess of SBP for three VNTR loci studied by the FBI (D17S79 and D2S44, for blacks, and D14S13, for Caucasians). The FBI claims that the excess is due to the effect of null alleles; the null alleles are suspected to be small to be detected. The authors estimate the frequency of null alleles for two loci (D17S79 and D14A13) by comparing, for these loci, the data from the FBI data base and the data from the Lifecodes data base. These comparisons yield information on small fragments because Lifecodes uses the restriction enzyme PstI, which yields larger fragments than does HaeIII, which the FBI uses. For D17S19 in blacks, the authors estimate a null allele frequency of 4.4%, and, for D14S13 in Caucasians, they estimate a frequency of 3.0%. The null-allele frequency for D2S44 in blacks is derived similarly, again being based on analysis of DNA cut with HaeIII and PstI; the estimate of the null-allele frequency for this locus is 1.5%. Using these null-allele frequency estimates and a goodness-of-fit test, the authors show that there is no evidence for deviations from Hardy-Weinberg expectations of genotype probabilities at these loci. 20 refs., 1 fig.

  6. index |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and nanoengineering techniques such as nanostructuring, thin film deposition, and nanoparticle infiltration. Methodologies for quantitative structuralchemical...

  7. Prepared in response to formal guidance and a request by Sam...

    Energy Savers [EERE]

    ... member) Burrill & Company - Partner Ceres - VP, Trait Development DuPont Genencor - Head of BioChemistry DuPont - Director, DuPont Central R & D (early member) General Motors - GM ...

  8. Genomic Analysis of Natural Variation for Seed and Plant Size in Maize ( JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)

    SciTech Connect (OSTI)

    Kaeppler, Shawn [University of Wisconsin, Madison] [University of Wisconsin, Madison


    Shawn Kaeppler from the University of Wisconsin-Madison on "Genomic Analysis of Biofuel Traits in Maize and Switchgrass" at the 7th Annual Genomics of Energy & Environment Meeting on March 21, 2012 in Walnut Creek, Calif

  9. Novel System for Recalcitrance Screening Will Reduce Biofuels Production Costs; The Spectrum of Clean Energy Innovation (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available


    Fact sheet describes a high-throughput screening process, developed at NREL, that enables researchers to screen a large variety of biomass feedstocks for traits that indicate they would easily convert to fermentable sugars.

  10. Genomic Analysis of Natural Variation for Seed and Plant Size in Maize ( JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)

    ScienceCinema (OSTI)

    Kaeppler, Shawn [University of Wisconsin, Madison


    Shawn Kaeppler from the University of Wisconsin-Madison on "Genomic Analysis of Biofuel Traits in Maize and Switchgrass" at the 7th Annual Genomics of Energy & Environment Meeting on March 21, 2012 in Walnut Creek, Calif

  11. Location of the spinal cerebellar ataxia 2 locus to a 1 cM interval on chromsome 12q23-24.1

    SciTech Connect (OSTI)

    Allotey, R.; Twells, R.; Orozco, G.


    Spinocerebellar ataxia 2 (SCA2) is a dominantly inherited neurodegenerative disorder characterised by progressive ataxia, dysarthria, dysmetria and dysdiadochokinesia. We have previously assigned the disease locus to chromosome 12q23-24.1 in a population from the Holguin province, Cuba, within a 31 cM interval flanked by the anonymous marker D12S53 and the phospholipase A2 gene (PLA2). Clinical as much as genealogical and geographical evidence indicate that the Cuban pedigrees are homogeneous and descend from a common ancestor. We now report fine genetic mapping of the disease locus with fourteen microsatellite loci known to span this region, which positions SCA2 in a 1 cM interval defined by the loci D12S84-AFM291xe9. Observation of a common haplotype segregating with the disease supports the existence of a founder effect in the Holguin pedigrees.

  12. High-resolution genetic mapping of allelic variants associated with cell

    Office of Scientific and Technical Information (OSTI)

    wall chemistry in Populus (Journal Article) | DOE PAGES Accepted Manuscript: High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus « Prev Next » Title: High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus We report the identification of six genetic loci and the allelic-variants associated with Populus cell wall phenotypes determined independently using pyrolysis Molecular Beam Mass Spectrometry

  13. Genetic barcodes

    DOE Patents [OSTI]

    Weier, Heinz -Ulrich G


    Herein are described multicolor FISH probe sets termed "genetic barcodes" targeting several cancer or disease-related loci to assess gene rearrangements and copy number changes in tumor cells. Two, three or more different fluorophores are used to detect the genetic barcode sections thus permitting unique labeling and multilocus analysis in individual cell nuclei. Gene specific barcodes can be generated and combined to provide both numerical and structural genetic information for these and other pertinent disease associated genes.

  14. Quadractic Model of Thermodynamic States in SDF Explosions

    SciTech Connect (OSTI)

    Kuhl, A L; Khasainov, B


    We study the thermodynamic states encountered during Shock-Dispersed-Fuel (SDF) explosions. Such explosions contain up to six components: three fuels (PETN, TNT and Aluminum) and their products corresponding to stoichiometric combustion with air. We establish the loci in thermodynamic state space that correctly describes the behavior of the components. Results are fit with quadratic functions that serve as fast equations of state suitable for 3D numerical simulations of SDF explosions.

  15. Genetic variation among agamid lizards of the trapelus agiliscomplex in the caspian-aral basin

    SciTech Connect (OSTI)

    Macey, J. Robert; Ananjeva, Natalia B.


    Allozyme variation is examined in eight populations of Trapelus from the Caspian-Aral Basin of the former USSR. Thirty-one loci (15 variable) exhibit remarkably low levels of genetic variation with only a Nei's genetic distance of 0.117 across 2500 km. An isolated population on the European side of the Caspian Sea is found to phenetically cluster inside the Asian populations examined, suggesting that it should not be considered taxonomically distinct.

  16. SREL Reprint #3127

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Development and characterization of twelve polymorphic microsatellite loci in the threatened Red Hills salamander, Phaeognathus hubrichti Stacey L. Lance1,2, Cris Hagen2, Travis C. Glenn1, Joseph J. Apodaca3, and Leslie J. Rissler3 1Department of Environmental Health Science, University of Georgia, Athens, GA 30602, USA 2Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29802, USA 3Department of Biological Sciences, University of Alabama, Tuscaloosa, AL 35487, USA

  17. SREL Reprint #3330

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0 Development and characterization of microsatellite loci for the endangered scrub lupine, Lupinus aridorum (Fabaceae) Angela Ricono1, Glen Bupp2, Cheryl Peterson2, Schyler O. Nunziata3, Stacey L. Lance3, and Christin L. Pruett1 1Department of Biological Sciences, Florida Institute of Technology, Melbourne, Florida 32901 USA 2Rare Plant Conservation Program, Bok Tower Gardens, Lake Wales, Florida 33853 USA 3Savannah River Ecology Laboratory, University of Georgia, Aiken, South Carolina 29802 USA

  18. Capillary zone electrophoresis-mass spectrometer interface

    DOE Patents [OSTI]

    D`Silva, A.


    A device for providing equal electrical potential between two loci unconnected by solid or liquid electrical conductors is provided. The device comprises a first electrical conducting terminal, a second electrical conducting terminal connected to the first terminal by a rigid dielectric structure, and an electrically conducting gas contacting the first and second terminals. This device is particularly suitable for application in the electrospray ionization interface between a capillary zone electrophoresis apparatus and a mass spectrometer. 1 fig.

  19. Capillary zone electrophoresis-mass spectrometer interface

    DOE Patents [OSTI]

    D'Silva, Arthur


    A device for providing equal electrical potential between two loci unconnected by solid or liquid electrical conducts is provided. The device comprises a first electrical conducting terminal, a second electrical conducting terminal connected to the first terminal by a rigid dielectric structure, and an electrically conducting gas contacting the first and second terminals. This device is particularly suitable for application in the electrospray ionization interface between a capillary zone electrophoresis apparatus and a mass spectrometer.

  20. Thermodynamic States in Explosion Fields

    SciTech Connect (OSTI)

    Kuhl, A L


    We investigate the thermodynamic states occurring in explosion fields from condensed explosive charges. These states are often modeled with a Jones-Wilkins-Lee (JWL) function. However, the JWL function is not a Fundamental Equation of Thermodynamics, and therefore cannot give a complete specification of such states. We use the Cheetah code of Fried to study the loci of states of the expanded detonation products gases from C-4 charges, and their combustion products air. In the Le Chatelier Plane of specific-internal-energy versus temperature, these loci are fit with a Quadratic Model function u(T), which has been shown to be valid for T < 3,000 K and p < 1k-bar. This model is used to derive a Fundamental Equation u(v,s) for C-4. Given u(v,s), one can use Maxwell's Relations to derive all other thermodynamic functions, such as temperature: T(v,s), pressure: p(v,s), enthalpy: h(v,s), Gibbs free energy: g(v,s) and Helmholz free energy: f(v,s); these loci are displayed in figures for C-4. Such complete equations of state are needed for numerical simulations of blast waves from explosive charges, and their reflections from surfaces.

  1. Violations of the ceiling principle: Exact conditions and statistical evidence

    SciTech Connect (OSTI)

    Slimowitz, J.R. ); Cohen, J.E. )


    The National Research Council recommended the use of the ceiling principle in forensic applications of DNA testing on the grounds that the ceiling principle was believed to be [open quotes]conservative,[close quotes] giving estimates greater than or equal to the actual genotype frequencies in the appropriate reference population. The authors show here that the ceiling principle can fail to be conservative in a population with two subpopulations and two loci, each with two alleles at Hardy-Weinberg equilibrium, if there is some linkage disequilibrium between loci. They also show that the ceiling principle can fail in a population with two subpopulations and a single locus with two alleles if Hardy-Weinberg equilibrium does not hold. They given explicit analytical formulas to describe when the ceiling principle fails. By showing that the ceiling principle is not always mathematically reliable, this analysis gives users of the ceiling principle the responsibility of demonstrating that it is conservative for the particular data with which it is used. Reanalysis of VNTR data bases of the FBI provides compelling evidence of two-locus associations within three major ethnic groups (Caucasian, black, and Hispanic) in the United States, even though the loci tested are located on different chromosomes. Before the ceiling principle is implemented, more research should be done to determine whether it may be violated in practice. 19 refs., 5 tabs.

  2. Identification of genetic factors that modify motor performance and body weight using Collaborative Cross mice

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Mao, Jian -Hua; Langley, Sasha A.; Huang, Yurong; Hang, Michael; Bouchard, Kristofer E.; Celniker, Susan E.; Brown, James B.; Jansson, Janet K.; Karpen, Gary H.; Snijders, Antoine M.


    Evidence has emerged that suggests a link between motor deficits, obesity and many neurological disorders. However, the contributing genetic risk factors are poorly understood. Here we used the Collaborative Cross (CC), a large panel of newly inbred mice that captures 90% of the known variation among laboratory mice, to identify the genetic loci controlling rotarod performance and its relationship with body weight in a cohort of 365 mice across 16 CC strains. Body weight and rotarod performance varied widely across CC strains and were significantly negatively correlated. Genetic linkage analysis identified 14 loci that were associated with body weight. However,more » 45 loci affected rotarod performance, seven of which were also associated with body weight, suggesting a strong link at the genetic level. As a result, we show that genes identified in this study overlap significantly with those related to neurological disorders and obesity found in human GWA studies. In conclusion, our results provide a genetic framework for studies of the connection between body weight, the central nervous system and behavior.« less

  3. Identification of genetic factors that modify motor performance and body weight using Collaborative Cross mice

    SciTech Connect (OSTI)

    Mao, Jian -Hua; Langley, Sasha A.; Huang, Yurong; Hang, Michael; Bouchard, Kristofer E.; Celniker, Susan E.; Brown, James B.; Jansson, Janet K.; Karpen, Gary H.; Snijders, Antoine M.


    Evidence has emerged that suggests a link between motor deficits, obesity and many neurological disorders. However, the contributing genetic risk factors are poorly understood. Here we used the Collaborative Cross (CC), a large panel of newly inbred mice that captures 90% of the known variation among laboratory mice, to identify the genetic loci controlling rotarod performance and its relationship with body weight in a cohort of 365 mice across 16 CC strains. Body weight and rotarod performance varied widely across CC strains and were significantly negatively correlated. Genetic linkage analysis identified 14 loci that were associated with body weight. However, 45 loci affected rotarod performance, seven of which were also associated with body weight, suggesting a strong link at the genetic level. As a result, we show that genes identified in this study overlap significantly with those related to neurological disorders and obesity found in human GWA studies. In conclusion, our results provide a genetic framework for studies of the connection between body weight, the central nervous system and behavior.

  4. Electricity Distribution System Workshop

    Broader source: (indexed) [DOE]

    ... For example, a quantitative metric such as time dependency may be valuable but there are ... For example, a quantitative metric such as time dependency may be valuable but there are ...

  5. Better Buildings Residential Data & Evaluation Peer Exchange...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... * Lead "swim lanes" Quantitative Diagnosis: * Lost leads * Poor contractor follow ... leads completed assessment) 23 Problem, Diagnosis, Solution: Contractor Close Rates ...

  6. Addressing Common Subsurface Challenges

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    geophysical and geochemical technologies quantitatively inferring subsurface evolution under current and future engineered conditions finding viable, low-risk resources...

  7. Local Soot Loading Distribution in Cordierite Diesel Particulate Filters by Dynamic Neutron Radiography

    Broader source: [DOE]

    Quantitative analysis of the soot loading and soot distribution for Cordierite type DPFs are studied under controlled conditions.

  8. A technique for measuring compressive properties of single microballoo...

    Office of Scientific and Technical Information (OSTI)

    quantitative microscopy in an effort to correlate morphology to mechanical properties. ... PROPERTIES; RESOLUTION; POLYMERS; SENSITIVITY; MEASURING INSTRUMENTS; MORPHOLOGY

  9. GBTL Opening Presentation_Tech Barriers

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    scale facilities Cross Cutting Sustainability Promote the positive economic, ... decisions by establishing quantitative metrics, tracking progress toward goals, and ...

  10. GBTL Workshop GHG Emissions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    scale facilities Cross Cutting Sustainability Promote the positive economic, ... decisions by establishing quantitative metrics, tracking progress toward goals, and ...

  11. Advances in Radiation Mutagenesis through Studies on Drosophila

    DOE R&D Accomplishments [OSTI]

    Muller, H. J.


    The approximately linear relation between radiation dose and induced lethals known for Drosophila spermatozoa, is now extended to spermatids. Data are included regarding oogonia. The linearity principle has been confined for minute structural changes in sperm as multi-hit events, on about the 1.5 power of the dose, long known for spermatozoa, is now extended to spermatids and late oocytes, for relatively short exposures. are found to allow union of broken chromosomes. Therefore, the frequencies are lower for more dispersed exposures of varies with lethals induced in late oocytes follow the same frequency pattern and there fore are multi-hit events. Yet han spermatozoan irradiation that two broken ends derived from nonreciprocal. The following is the order of decreasing radiation mutability of different stages found by ourselves and others: spermatids, spermatozoa in females, spermatozoa 0 to 1 day before ejaculation, earlier spermatozoa, late oocytes, gonia of either sex. Lethal frequencies for these stages range over approximately an order of magnitude, gross structural changes far more widely. Of potential usefulness is our extension of genesis by anoxia, known for spermatozoa in adult males, to those in pupal males and in females, to sperion is especially marked but the increase caused by substituting oxygen for air is less marked, perhaps because of enzymatic differences. In contrast, the induction of gross structural changes in oocytes, but not in spermatids, is markedly reduced by oxygen post-treatment; it is increased by dehydration. The efficacy of induction of structural changes by treatment of spermatozoa, whether with radiation or chemical mutagen, is correlated with the conditions of sperm utilization and egg production. Improving our perspective on radiation effects, some 800,000 offspring have been scored for spontaneous visible mutations of 13 specific loci. The average point-mutation rate was 0.5 to 1.0 per locus among 10/sup 5/ germ cells. Most mutation occurred in peri- fertilization stages. All loci studied mutated from one to nine times. Loci mutating oftener spontaneously also gave more radiation mutation, in other studies, Spectra of individual loci prove similar for spontaneous and induced mutation. Studies on back-mutation also showed similarity of spontaneous and radiation mutations. The doubling dose for back-mutations of forked induced in spermatozoa was several hundred roentgens, gonia at diverse loci. Recent analyses of human mutational load lead to mutation-rate estimated like those earlier based on extrapolations from Drosophila, thus supporting the significance for man of the present studies. (auth)

  12. Genetic Improvement of Switchgrass and Other Herbaceous Plants for Use as Biomass Fuel Feedstock

    SciTech Connect (OSTI)

    Vogel, K.P.


    It should be highly feasible to genetically modify the feedstock quality of switchgrass and other herbaceous plants using both conventional and molecular breeding techniques. Effectiveness of breeding to modify herbages of switchgrass and other perennial and annual herbaceous species has already been demonstrated. The use of molecular markers and transformation technology will greatly enhance the capability of breeders to modify the plant structure and cell walls of herbaceous plants. It will be necessary to monitor gene flow to remnant wild populations of plants and have strategies available to curtail gene flow if it becomes a potential problem. It also will be necessary to monitor plant survival and long-term productivity as affected by genetic changes that improve forage quality. Information on the conversion processes that will be used and the biomass characteristics that affect conversion efficiency and rate is absolutely essential as well as information on the relative economic value of specific traits. Because most forage or biomass quality characteristics are highly affected by plant maturity, it is suggested that plant material of specific maturity stages be used in research to determining desirable feedstock quality characteristics. Plant material could be collected at various stages of development from an array of environments and storage conditions that could be used in conversion research. The same plant material could be used to develop NIRS calibrations that could be used by breeders in their selection programs and also to develop criteria for a feedstock quality assessment program. Breeding for improved feedstock quality will likely affect the rate of improvement of biomass production per acre. If the same level of resources are used, multi-trait breeding simply reduces the selection pressure and hence the breeding progress that can be made for a single trait unless all the traits are highly correlated. Since desirable feedstock traits are likely to be similar to IVDMD, it is likely that they will not be highly positively correlated with yield. Hence to achieve target yields and improve specific quality traits, it will likely be necessary to increase the resources available to plant breeders. Marker assisted selection will be extremely useful in breeding for quality traits, particularly for traits that can be affected by modifying a few genes. Genetic markers are going to be needed for monitoring gene flow to wild populations. Transformation will be a very useful tool for determining the affects of specific genes on biomass feedstock quality.

  13. Methods for simultaneous control of lignin content and composition, and cellulose content in plants

    DOE Patents [OSTI]

    Chiang, Vincent Lee C.; Li, Laigeng


    The present invention relates to a method of concurrently introducing multiple genes into plants and trees is provided. The method includes simultaneous transformation of plants with multiple genes from the phenylpropanoid pathways including 4CL, CAld5H, AldOMT, SAD and CAD genes and combinations thereof to produce various lines of transgenic plants displaying altered agronomic traits. The agronomic traits of the plants are regulated by the orientation of the specific genes and the selected gene combinations, which are incorporated into the plant genome.

  14. Detecting Temporal Precursor Words and Phrases Using a Learning Algorithm and Wavelet Analysis

    Energy Innovation Portal (Marketing Summaries) [EERE]


    Most research on mammography focuses on image data, not textual reports. However, the reports associated with patient visits offer a valuable set of observations. To take advantage of these sequential writings, a robust ORNL learning algorithm assembles, searches, and analyzes cue phrases in radiology reports to determine if they define normal or abnormal traits in mammograms over time....

  15. Genetic analysis of inflorescence and plant height components in sorghum (Panicoidae) and comparative genetics with rice (Oryzoidae)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Dong; Kong, Wenqian; Robertson, Jon; Goff, Valorie H.; Epps, Ethan; Kerr, Alexandra; Mills, Gabriel; Cromwell, Jay; Lugin, Yelena; Phillips, Christine; et al


    Domestication has played an important role in shaping characteristics of the inflorescence and plant height in cultivated cereals. Taking advantage of meta-analysis of QTLs, phylogenetic analyses in 502 diverse sorghum accessions, GWAS in a sorghum association panel (n = 354) and comparative data, we provide insight into the genetic basis of the domestication traits in sorghum and rice. We performed genome-wide association studies (GWAS) on 6 traits related to inflorescence morphology and 6 traits related to plant height in sorghum, comparing the genomic regions implicated in these traits by GWAS and QTL mapping, respectively. In a search for signatures ofmoreselection, we identify genomic regions that may contribute to sorghum domestication regarding plant height, flowering time and pericarp color. Comparative studies across taxa show functionally conserved hotspots in sorghum and rice for awn presence and pericarp color that do not appear to reflect corresponding single genes but may indicate co-regulated clusters of genes. We also reveal homoeologous regions retaining similar functions for plant height and flowering time since genome duplication an estimated 70 million years ago or more in a common ancestor of cereals. In most such homoeologous QTL pairs, only one QTL interval exhibits strong selection signals in modern sorghum. Intersections among QTL, GWAS and comparative data advance knowledge of genetic determinants of inflorescence and plant height components in sorghum, and add new dimensions to comparisons between sorghum and rice.less

  16. Sciences and society

    ScienceCinema (OSTI)



    J.Luns des Pays-Bas, ancien sécétaire général de NATO (OTAN=Organisation du traité de l'Atlantique Nord) parle du passé, présent et future de la défense européenne et des relations est et ouest

  17. Genetic analysis of inflorescence and plant height components in sorghum (Panicoidae) and comparative genetics with rice (Oryzoidae)

    SciTech Connect (OSTI)

    Zhang, Dong; Kong, Wenqian; Robertson, Jon; Goff, Valorie H; Epps, Ethan; Kerr, Alexandra; Mills, Gabriel; Cromwell, Jay; Lugin, Yelena; Phillips, Christine; Paterson, Andrew H


    Domestication has played an important role in shaping characteristics of the inflorescence and plant height in cultivated cereals. Taking advantage of meta-analysis of QTLs, phylogenetic analyses in 502 diverse sorghum accessions, GWAS in a sorghum association panel (n = 354) and comparative data, we provide insight into the genetic basis of the domestication traits in sorghum and rice. We performed genome-wide association studies (GWAS) on 6 traits related to inflorescence morphology and 6 traits related to plant height in sorghum, comparing the genomic regions implicated in these traits by GWAS and QTL mapping, respectively. In a search for signatures of selection, we identify genomic regions that may contribute to sorghum domestication regarding plant height, flowering time and pericarp color. Comparative studies across taxa show functionally conserved ‘hotspots’ in sorghum and rice for awn presence and pericarp color that do not appear to reflect corresponding single genes but may indicate co-regulated clusters of genes. We also reveal homoeologous regions retaining similar functions for plant height and flowering time since genome duplication an estimated 70 million years ago or more in a common ancestor of cereals. In most such homoeologous QTL pairs, only one QTL interval exhibits strong selection signals in modern sorghum. Intersections among QTL, GWAS and comparative data advance knowledge of genetic determinants of inflorescence and plant height components in sorghum, and add new dimensions to comparisons between sorghum and rice.

  18. Genetic analysis of inflorescence and plant height components in sorghum (Panicoidae) and comparative genetics with rice (Oryzoidae)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Dong; Kong, Wenqian; Robertson, Jon; Goff, Valorie H; Epps, Ethan; Kerr, Alexandra; Mills, Gabriel; Cromwell, Jay; Lugin, Yelena; Phillips, Christine; et al


    Domestication has played an important role in shaping characteristics of the inflorescence and plant height in cultivated cereals. Taking advantage of meta-analysis of QTLs, phylogenetic analyses in 502 diverse sorghum accessions, GWAS in a sorghum association panel (n = 354) and comparative data, we provide insight into the genetic basis of the domestication traits in sorghum and rice. We performed genome-wide association studies (GWAS) on 6 traits related to inflorescence morphology and 6 traits related to plant height in sorghum, comparing the genomic regions implicated in these traits by GWAS and QTL mapping, respectively. In a search for signatures ofmore » selection, we identify genomic regions that may contribute to sorghum domestication regarding plant height, flowering time and pericarp color. Comparative studies across taxa show functionally conserved ‘hotspots’ in sorghum and rice for awn presence and pericarp color that do not appear to reflect corresponding single genes but may indicate co-regulated clusters of genes. We also reveal homoeologous regions retaining similar functions for plant height and flowering time since genome duplication an estimated 70 million years ago or more in a common ancestor of cereals. In most such homoeologous QTL pairs, only one QTL interval exhibits strong selection signals in modern sorghum. Intersections among QTL, GWAS and comparative data advance knowledge of genetic determinants of inflorescence and plant height components in sorghum, and add new dimensions to comparisons between sorghum and rice.« less

  19. Effects of Diet on Resource Utilization by a Model Human Gut Microbiota Containing Bacteroides cellulosilyticus WH2, a Symbiont with an Extensive Glycobiome

    SciTech Connect (OSTI)

    McNulty, Nathan; Wu, Meng; Erickson, Alison L; Pan, Chongle; Erickson, Brian K; Martens, Eric C; Pudlo, Nicholas A; Muegge, Brian; Henrissat, Bernard; Hettich, Robert {Bob} L; Gordon, Jeffrey


    The human gut microbiota is an important metabolic organ, yet little is known about how its individual species interact, establish dominant positions, and respond to changes in environmental factors such as diet. In this study, gnotobiotic mice were colonized with an artificial microbiota comprising 12 sequenced human gut bacterial species and fed oscillating diets of disparate composition. Rapid, reproducible, and reversible changes in the structure of this assemblage were observed. Time-series microbial RNA-Seq analyses revealed staggered functional responses to diet shifts throughout the assemblage that were heavily focused on carbohydrate and amino acid metabolism. High-resolution shotgun metaproteomics confirmed many of these responses at a protein level. One member, Bacteroides cellulosilyticus WH2, proved exceptionally fit regardless of diet. Its genome encoded more carbohydrate active enzymes than any previously sequenced member of the Bacteroidetes. Transcriptional profiling indicated that B. cellulosilyticus WH2 is an adaptive forager that tailors its versatile carbohydrate utilization strategy to available dietary polysaccharides, with a strong emphasis on plant-derived xylans abundant in dietary staples like cereal grains. Two highly expressed, diet-specific polysaccharide utilization loci (PULs) in B. cellulosilyticus WH2 were identified, one with characteristics of xylan utilization systems. Introduction of a B. cellulosilyticus WH2 library comprising .90,000 isogenic transposon mutants into gnotobiotic mice, along with the other artificial community members, confirmed that these loci represent critical diet-specific fitness determinants. Carbohydrates that trigger dramatic increases in expression of these two loci and many of the organism s 111 other predicted PULs were identified by RNA-Seq during in vitro growth on 31 distinct carbohydrate substrates, allowing us to better interpret in vivo RNA-Seq and proteomics data. These results offer insight into how gut microbes adapt to dietary perturbations at both a community level and from the perspective of a well-adapted symbiont with exceptional saccharolytic capabilities, and illustrate the value of artificial communities.

  20. Map refinement of locus RP13 to human chromosome 17p13.3 in a second family with autosomal dominant retinitis pigmentosa

    SciTech Connect (OSTI)

    Kojis, T.L.; Heinzmann, C.; Ngo, J.T.


    In order to elucidate the genetic basis of autosomal dominant retinitis pigmentosa (adRP) in a large eight-generation family (UCLA-RP09) of British descent, we assessed linkage between the UCLA-RP09 adRP gene and numerous genetic loci, including eight adRP candidate genes, five anonymous adRP-linked DNA loci, and 20 phenotypic markers. Linkage to the UCLA-RP09 disease gene was excluded for all eight candidate genes analyzed, including rhodopsin (RP4) and peripherin/RDS (RP7), for the four adRP loci RP1, RP9, RP10 and RP11, as well as for 17 phenotypic markers. The anonymous DNA marker locus D17S938, linked to adRP locus RP13 on chromosome 17p13.1, yielded a suggestive but not statistically significant positive lod score. Linkage was confirmed between the UCLA-RP09 adRP gene and markers distal to D17S938 in the chromosomal region 17p13.3. A reanalysis of the original RP13 data from a South African adRP family of British descent, in conjunction with our UCLA-RP09 data, suggests that only one adRP locus exists on 17p but that it maps to a more telomeric position, at band 17p13.3, than previously reported. Confirmation of the involvement of RP13 in two presumably unrelated adRP families, both of British descent, suggests that this locus is a distinct adRP gene in a proportion of British, and possibly other, adRP families. 39 refs., 4 figs., 3 tabs.

  1. Microsatellite instability is rare in sporadic ovarian cancer

    SciTech Connect (OSTI)

    Chen, S.S.; Han, H.; Schwartz, P.E.


    Microsatellite instability was first demonstrated to be a common underlying mechanism in hereditary nonpolyposis colorectal cancer (HNPCC) and has recently been implicated in the development of several other human cancers. Although numerous genetic changes have been documented in ovarian cancer, their molecular bases are poorly understood. In investigating the molecular genetics of ovarian cancer, we analyzed twelve short tandem repeats that were amplified by PCR from DNA of 48 tumors and their corresponding lymphocyte samples. All of the 48 cases studied have no noticeable family history and, of them, 42 are epithelial (benign/borderline, 5; grade I, 4; GII, 4; GIII, 29) and 6 are nonepithelial. A microsatellite instability has been shown to be inversely correlated with the occurrence of allelic losses, half of those cases chosen have a fractional allele loss of {le}15 (median = .18 of 50 tumors tested for 86 loci from every chromosomal arm). The loci examined included eight dinucleotide repeats (D2S123, D9S104, D10S197, D11S904, D16S408, D16S421, D17S250, and D17S579), two trinucleotide repeats (DM and AR) and two tetranucleotide repeats (DXS981 and VWF). Despite the fact that HNPCC phenotype includes ovarian cancer and that microsatellite instability has been shown in one ovarian cancer from an HNPCC family, the allele sizes of 12 loci were found to be identical in all paired tumor and normal samples we studied except for one tumor at a single locus. The band shift displayed on polyacrylamide gel representing an additional allele of VWF was only observed in one grade III tumor. Our results are thus a strong indication that the alteration of microsatellite repeats may not play a major role in the development of sporadic ovarian cancer.

  2. Taking off the training wheels: the properties of a dynamic vegetation model without climate envelopes

    SciTech Connect (OSTI)

    Fisher, R. A.; Muszala, S.; Verteinstein, M.; Lawrence, P.; Xu, C.; McDowell, N. G.; Knox, R. G.; Koven, C.; Holm, J.; Rogers, B. M.; Lawrence, D.; Bonan, G.


    We describe an implementation of the Ecosystem Demography (ED) concept in the Community Land Model. The structure of CLM(ED) and the physiological and structural modifications applied to the CLM are presented. A major motivation of this development is to allow the prediction of biome boundaries directly from plant physiological traits via their competitive interactions. Here we investigate the performance of the model for an example biome boundary in Eastern North America. We explore the sensitivity of the predicted biome boundaries and ecosystem properties to the variation of leaf properties determined by the parameter space defined by the GLOPNET global leaf trait database. Further, we investigate the impact of four sequential alterations to the structural assumptions in the model governing the relative carbon economy of deciduous and evergreen plants. The default assumption is that the costs and benefits of deciduous vs. evergreen leaf strategies, in terms of carbon assimilation and expenditure, can reproduce the geographical structure of biome boundaries and ecosystem functioning. We find some support for this assumption, but only under particular combinations of model traits and structural assumptions. Many questions remain regarding the preferred methods for deployment of plant trait information in land surface models. In some cases, plant traits might best be closely linked with each other, but we also find support for direct linkages to environmental conditions. We advocate for intensified study of the costs and benefits of plant life history strategies in different environments, and for the increased use of parametric and structural ensembles in the development and analysis of complex vegetation models.

  3. Down-regulation of gibberellic acid in poplar has negligible effects on host-plant suitability and insect pest response

    SciTech Connect (OSTI)

    Buhl, Christine; Strauss, Steven H.; Lindroth, Richard L.


    Abstract Endogenous levels and signaling of gibberellin plant hormones such as gibberellic acid (GA) have been genetically down-regulated to create semi-dwarf varieties of poplar. The potential benefits of semi-dwarf stature include reduced risk of wind damage, improved stress tolerance, and improved wood quality. Despite these benefits, modification of growth traits may have consequences for non-target traits that confer defense against insect herbivores. According to the growth-differentiation balance hypothesis, reductions in growth may shift allocation of carbon from growth to chemical resistance traits, thereby altering plant defense. To date, host-plant suitability and pest response have not been comprehensively evaluated in GA down-regulated plants. We quantified chemical resistance and nitrogen (an index of protein) in GA down-regulated and wild-type poplar (Populus alba × P. tremula) genotypes. We also evaluated performance of both generalist (Lymantria dispar) and specialist (Chrysomela scripta) insect pests reared on these genotypes. Our evaluation of resistance traits in four GA down-regulated genotypes revealed increased phenolic glycosides in one modified genotype and reduced lignin in two modified genotypes relative to the non-transgenic wild type. Nitrogen levels did not vary significantly among the experimental genotypes. Generalists reared on the four GA down-regulated genotypes exhibited reduced performance on only one modified genotype relative to the wild type. Specialists, however, performed similarly across all genotypes. Results from this study indicate that although some non-target traits varied among GA down-regulated genotypes, the differences in poplar pest susceptibility were modest and highly genotype-specific.

  4. Taking off the training wheels: the properties of a dynamic vegetation model without climate envelopes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Fisher, R. A.; Muszala, S.; Verteinstein, M.; Lawrence, P.; Xu, C.; McDowell, N. G.; Knox, R. G.; Koven, C.; Holm, J.; Rogers, B. M.; et al


    We describe an implementation of the Ecosystem Demography (ED) concept in the Community Land Model. The structure of CLM(ED) and the physiological and structural modifications applied to the CLM are presented. A major motivation of this development is to allow the prediction of biome boundaries directly from plant physiological traits via their competitive interactions. Here we investigate the performance of the model for an example biome boundary in Eastern North America. We explore the sensitivity of the predicted biome boundaries and ecosystem properties to the variation of leaf properties determined by the parameter space defined by the GLOPNET global leafmore » trait database. Further, we investigate the impact of four sequential alterations to the structural assumptions in the model governing the relative carbon economy of deciduous and evergreen plants. The default assumption is that the costs and benefits of deciduous vs. evergreen leaf strategies, in terms of carbon assimilation and expenditure, can reproduce the geographical structure of biome boundaries and ecosystem functioning. We find some support for this assumption, but only under particular combinations of model traits and structural assumptions. Many questions remain regarding the preferred methods for deployment of plant trait information in land surface models. In some cases, plant traits might best be closely linked with each other, but we also find support for direct linkages to environmental conditions. We advocate for intensified study of the costs and benefits of plant life history strategies in different environments, and for the increased use of parametric and structural ensembles in the development and analysis of complex vegetation models.« less

  5. Down-regulation of gibberellic acid in poplar has negligible effects on host-plant suitability and insect pest response

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Buhl, Christine; Strauss, Steven H.; Lindroth, Richard L.


    Abstract Endogenous levels and signaling of gibberellin plant hormones such as gibberellic acid (GA) have been genetically down-regulated to create semi-dwarf varieties of poplar. The potential benefits of semi-dwarf stature include reduced risk of wind damage, improved stress tolerance, and improved wood quality. Despite these benefits, modification of growth traits may have consequences for non-target traits that confer defense against insect herbivores. According to the growth-differentiation balance hypothesis, reductions in growth may shift allocation of carbon from growth to chemical resistance traits, thereby altering plant defense. To date, host-plant suitability and pest response have not been comprehensively evaluated in GAmore » down-regulated plants. We quantified chemical resistance and nitrogen (an index of protein) in GA down-regulated and wild-type poplar (Populus alba × P. tremula) genotypes. We also evaluated performance of both generalist (Lymantria dispar) and specialist (Chrysomela scripta) insect pests reared on these genotypes. Our evaluation of resistance traits in four GA down-regulated genotypes revealed increased phenolic glycosides in one modified genotype and reduced lignin in two modified genotypes relative to the non-transgenic wild type. Nitrogen levels did not vary significantly among the experimental genotypes. Generalists reared on the four GA down-regulated genotypes exhibited reduced performance on only one modified genotype relative to the wild type. Specialists, however, performed similarly across all genotypes. Results from this study indicate that although some non-target traits varied among GA down-regulated genotypes, the differences in poplar pest susceptibility were modest and highly genotype-specific.« less

  6. SREL Reprint #3074

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4 Development and characterization of microsatellite loci in the eastern chipmunk (Tamias striatus) MAUREEN B. PETERS1, JULIE L. GLENN1, PAM SVETE1, CRIS HAGEN1, OLGA V. TSYUSKO1, PATRICIA DECOURSEY2, MÉLISSA LIEUTENANT-GOSSELIN3, DANY GARANT3, and TRAVIS C. GLENN1,2 1Savannah River Ecology Laboratory, Institute of Ecology, The University of Georgia, PO Drawer E, Aiken, SC 29802, USA 2Department of Biological Sciences, University of South Carolina, Columbia, SC 29802, USA 3Département de

  7. SREL Reprint #3116

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 Development and characterization of microsatellite loci in the American white pelican (Pelecanus erythrorhynchos) Caleb R. Hickman1, Maureen B. Peters1, Nicholas G. Crawford1, Cris Hagen1, Travis C. Glenn1,2, and Christopher M. Somers3 1Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29802, USA 2Department of Environmental Health Science, University of Georgia, Athens, GA 30602, USA 3Department of Biology, University of Regina, Regina, SK, Canada S4S 0A2 Abstract:

  8. SREL Reprint #3139

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 Five hundred microsatellite loci for Peromyscus Jesse N. Weber1, Maureen B. Peters2, Olga V. Tsyusko2,3, Catherine R. Linnen1, Cris Hagen2, Nancy A. Schable2, Tracey D. Tuberville2, Anna M. McKee2, Stacey L. Lance2,4, Kenneth L. Jones4, Heidi S. Fisher1, Michael J. Dewey5, Hopi E. Hoekstra1, and Travis C. Glenn2,4 1Department of Organismic and Evolutionary Biology and The Museum of Comparative Zoology, Harvard University, Cambridge, MA 02138, USA 2Savannah River Ecology Laboratory, Drawer E,

  9. SREL Reprint #3272

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Development of microsatellite loci for the Honduran white-bat (Ectophylla alba) by using Illumina paired-end sequences Alberto Morales-Leyva1, Rodrigo A. Medellín2, Stacey L. Lance3, Bernal Rodríguez-Herrera4, Melina Del Real-Monroy1, and Jorge Ortega1 1Laboratorio de Bioconservación y Manejo, Posgrado en Ciencias Quimicobiológicas, Departamento de Zoología, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Prolongación de Carpio y Plan de Ayala s/n, Col. Sto.

  10. SREL Reprint #3319

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 Development and characterization of 29 microsatellite markers for the sergeant major damselfish (Abudefduf saxatilis) using paired-end Illumina shotgun sequencing Victor J. Piñeros1, Carla Gutiérrez-Rodríguez1, and Stacey L. Lance2 1Departamento de Biología Evolutiva, Instituto de Ecología A.C., 91070 Xalapa, Veracruz, Mexico 2Savannah River Ecology Laboratory, University of Georgia, Aiken, SC 29802, USA Abstract: We isolated and characterized microsatellite loci for the coral reef fish

  11. Mapping genes according to their amplification status in tumor cells: Contribution to the map of 11q13

    SciTech Connect (OSTI)

    Szeptowski, P.; Perucca-Lostanlen, D.; Gaudray, P. )


    DNA amplification events that occur at 11q13 in human carcinomas are complex, and amplicons were shown to exhibit numerous discontinuities that could be used as tools for mapping this genomic area. A statistical nearest-neighbor analysis of the amplification patterns of several 11q13 loci in a panel of amplified DNAs was performed in the region of 11q13 centromeric from BCL1. It was strongly correlated with the physical linkages that were established between the same markers. Taken together, the results led to a map of 14 genes and four anonymous probes located in this area. 33 refs., 4 figs., 2 tabs.

  12. Academic Year 2009-2010 Intern Project - Kayla Nguyen | Center for Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Efficient Materials Kayla Nguyen QUANTITATIVE ELECTROSTATIC FORCE MICROSCOPY FOR SOLAR CELL CHARACTERIZATION Kayla Nguyen Physics UC Santa Barbara Mentor: Thuc-Quyen Nguyen Faculty Advisor: Thuc-Quyen Nguyen Department: Chemistry and Biochemistry My project goal is to modify a commercial Electrostatic Force Microscopy (EFM) instrument to obtain quantitative data that is useful for organic solar cell materials. To obtain quantitative EFM results, we will separate the signal using two lock-in

  13. SPR - Energy Innovation Portal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    intensity loss is analyzed and can be used to quantitatively determine the molecular adsorption on the surface of the SPR active material. Most SPR experiments are performed using...

  14. Nanoscale Chemical Imaging of a Working Catalyst

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    catalysts for maximum selectivity and efficiency in a wide range of chemical processes. ... The measurements generated chemical contour maps for the species present. Quantitative ...

  15. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... (NE) (United States) USDOE Office of Policy and International Affairs (PO) (United ... Using polycrystalline GaP as an example, we apply a quantitative pattern matching approach ...

  16. Multi-keV x-ray sources from metal-lined cylindrical hohlraums...

    Office of Scientific and Technical Information (OSTI)

    These comparisons provide an attractive way to explain the discrepancies between experimental and calculated quantitative results. Authors: Jacquet, L. ; Girard, F. ; Primout, M. ; ...

  17. Intrinsic carrier multiplication efficiency in bulk Si crystals...

    Office of Scientific and Technical Information (OSTI)

    We estimated the carrier multiplication efficiency in the most common solar-cell material, ... of carriers quantitatively, which are crucial for the design of the solar cells. ...

  18. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to gain qualitative and quantitative understanding of photoconversion processes in semiconductor nanomaterials. I will outline the strengths and weaknesses of these methods,...

  19. NREL: Energy Analysis - Mackay Miller

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and multilateral initiatives including the US-China Renewable Energy Partnership and 21st Century Power Partnership Quantitative social network analysis of innovation pathways...

  20. 2012 National Electricity Forum

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Do you think that the 2009 study came to the appropriate conclusions regarding congestion ... What evidence -- quantitative or qualitative -- supports your conclusions regarding ...

  1. A new analytic-adaptive model for EGS assessment, development...

    Open Energy Info (EERE)

    ability to quantitative test hypotheses for new EGS designs and technologies, as well as reservoir sustainability modeling. Funding Source American Recovery and Reinvestment Act...

  2. index |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in the Predictive Geosciences competency develop and calibrate efficient tools and quantitative relationships for the science-based prediction of the behavior of...

  3. A Low-Velocity Zone in the Basement Beneath the Valles Caldera...

    Open Energy Info (EERE)

    Zone in the Basement Beneath the Valles Caldera, New Mexico Abstract We present quantitative results of forward modeling applied to a suite of travel time delays observed...

  4. Microsoft Word - DOE-ID-13-050 Northwestern EC B3-6.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    mechanical testing, in situ TEM under heavy ion irradiation and helium implantation, and quantitative in situ TEM or irradiated samples during nanoindentation. SECTION C....

  5. NUG_TownHall_Oct2009.ppt

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (memory, IO, CPU hours) * How easy is it for you to translate your science and research objectives into quantitative computational requirements? - Which is the hardest...

  6. Major Lectures & Conference Papers - Combustion Energy Frontier...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New Horizons Forum and Aerospace Exposition, Orlando, FL (2011). "Applications of Quantitative Laser Sensors to Kinetics, Propulsion and Practical Energy Systems," by Ronald K....

  7. Improvements to Laser Ablation-Inductively Coupled Plasma-Mass...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Improvements to Laser Ablation-Inductively Coupled Plasma-Mass Spectrometry for Quantitative Analysis using Short Pulse UV Laser FWPProject Description: Laser ablation inductively ...

  8. 2009_1112 HPC requirements workshop.pptx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    simulation of laser wakefield particle acceleration - M558 C.G.R. Geddes (M558 lead) ... project + collaborators: High gradient laser - plasma accelerators Quantitative ...

  9. Resonant Soft X-Ray Scattering of Tri-Block Copolymers

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    vast number of nanostructures. While quantitatively understanding the details of the morphology and the manner in which the different blocks interact with surfaces and interfaces...

  10. Mixture Formation in a Light-Duty Diesel Engine

    Broader source: [DOE]

    Presents quantitative measurements of evolution of in-cylinder equivalence ratio distributions in a light-duty engine where wall interactions and strong swirl are significant

  11. Search for: All records | DOE PAGES

    Office of Scientific and Technical Information (OSTI)

    ... of twin variants, resolving which, although critical for design of new materials and devices, has been difficult to achieve quantitatively with current characterization methods. ...

  12. Search for: All records | DOE PAGES

    Office of Scientific and Technical Information (OSTI)

    of twin variants, resolving which, although critical for design of new materials and devices, has been difficult to achieve quantitatively with current characterization methods. ...

  13. Band structure engineering and thermoelectric properties ofcharge...

    Office of Scientific and Technical Information (OSTI)

    Dopant Ga in the cage-structured skutterudite Co4Sb12 substitutes Sb sites while occupying the void sites. Combining quantitative scanning transmission electron microscopy and ...

  14. oreopoulos-98.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    figure, please see http:www.arm.govdocsdocumentstechnicalconf9803oreopoulos-98.pdf.) While we are not ready to provide at present quantitative estimates of the influence...


    Office of Scientific and Technical Information (OSTI)

    Quantitative hiRX Measurements Havrilla George J Los Alamos National Laboratory Instrumentation Related to Nuclear Science Technology Analytical Chemistry Analytical Chemistry...

  16. Chemically homogeneous and thermally reversible oxidation of...

    Office of Scientific and Technical Information (OSTI)

    Atomic-resolution characterization with scanning tunnelling microscopy is quantitatively ... as low as 260 8C using scanning tunnelling microscopy and spectroscopic techniques. ...

  17. Linkages from DOE's Wind Energy Program to Commercial Renewable...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The study examines linkages between three decades of DOE research and development (R&D) ... quantitative, objectively derived data and in qualitative data based on expert opinion. ...

  18. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... in this way, provide a quantitative approximation of the ... consistent with the qualitative picture presented in the ... This study aims to evaluate the global application of a ...

  19. The Smart Grid: An Estimation of the Energy and Carbon Dioxide...

    Open Energy Info (EERE)

    by which the smart grid can reduce energy use and carbon impacts associated with electricity generation and delivery in the United States. The quantitative estimates of...

  20. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... USDOE Office of Energy Efficiency and Renewable Energy ... (1) solar energy solar cell (1) therapy (1) thin films ... and quantitatively measure the spectral absorption ...