Powered by Deep Web Technologies
Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Oslo, Norway: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty,Orleans County, Vermont: EnergyThis articleOslo, Norway: Energy

2

Flux turbulence in NdBa2Cu3O6 x and underdoped YBa2Cu3O6 x single crystals Department of Physics, University of Oslo, Blindern, N-0316 Oslo, Norway  

E-Print Network [OSTI]

of Physics, University of Oslo, Blindern, N-0316 Oslo, Norway and Condensed Matter Physics and Chemistry of Physics, University of Oslo, Blindern, N-0316 Oslo, Norway N. H. Andersen Condensed Matter Physics of Physics, University of Oslo, Blindern, N-0316 Oslo, Norway Received 3 November 1998 Magnetic flux

Johansen, Tom Henning

3

Yuri M. GALPERIN Address: Department of Physics, University of Oslo, P. O. Box 1048 Blindern, 0316 Oslo, Norway  

E-Print Network [OSTI]

Oslo, Norway Phone: Direct: +47 22 85 64 95, Fax: +47 22 85 64 22, Cell.: +47 90 51 72 38 E, Israel; University of Trondheim, Norway; Chalmers University of Technology, Sweden; Nordic visiting at International Schools in Trondheim (Norway), Brasilia (Brazil), Trieste and Erice (Italy); St. Petersburg

Johansen, Tom Henning

4

Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b  

E-Print Network [OSTI]

Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,d , Anders Rindby e a Geological Survey of Norway, Leiv Eirikssons vei 39, 7491 Trondheim, Norway b Norwegian Geotechnical Institute, P.O. Box 3930 UllevĂĽl Stadion, 0806 Oslo, Norway d Department

Alve, Elisabeth

5

Last date modified 7/12/13 Location and Institution NORWAY -OSLO  

E-Print Network [OSTI]

Last date modified 7/12/13 Location and Institution NORWAY - OSLO HECUA In Norway, students live in a student village near campus and have a 4-day Requirements You will need a student visa to enter and study in Norway. You must

Galles, David

6

Last date modified 1/16/13 Location and Institution NORWAY -OSLO  

E-Print Network [OSTI]

Last date modified 1/16/13 Location and Institution NORWAY - OSLO HECUA://hecua.org/programs/scholarshipshttp://hecua.org/programs/scholarships Accommodation In Norway, students live in a student village near campus and have a 4 in Norway. You must apply as soon as possible once accepted. Documents must

Galles, David

7

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

Oslo (CICERO), Oslo, Norway of Earth System Science,oil and gas scenar- ios for Norway and Northwest Russia, J.1022 Blindern, 0315 Oslo, Norway, ISSN 1501–7710, No. 304,

2012-01-01T23:59:59.000Z

8

Dr. Sven Wedemeyer-Bhm Institute of Theoretical Astrophysics, University of Oslo, Norway RESEARCH PROFILE OF DR. SVEN WEDEMEYER-BHM  

E-Print Network [OSTI]

Dr. Sven Wedemeyer-BÜhm ¡ Institute of Theoretical Astrophysics, University of Oslo, Norway tornadoes on the Sun and cool stars" Funded by the Research Council of Norway in the highly competetive://www.mn.uio.no/astro/english/research/projects/vortex ¡ "Magnetic Activity of the Atmospheres of M-type Dwarf Stars " Funded by the Research Council of Norway

Wedemeyer-BĂśhm, Sven

9

Norway: Ban on Advertising and Promotion  

E-Print Network [OSTI]

use in the 20th century Norway). Thesis. Oslo: Departementof Tobacco Products etc. (Norway) Oslo: National Council onin its advertising over the Norway: Ban on Advertising and

Bjartveit, Kjell; World Health Organization

2003-01-01T23:59:59.000Z

10

The Within-Job Motherhood Wage Penalty in Norway, 1979–1996  

E-Print Network [OSTI]

arbeid, velferdsstat. Oslo, Norway: Universitetsforlaget.NOS C 6. Oslo-Kongsvinger, Norway: Statistisk Sentralbyrĺ.Job Motherhood Wage Penalty in Norway 28 Datta Gupta, N. , &

Petersen, Trond; Penner, Andrew M.; Hřgnsnes, Geir

2010-01-01T23:59:59.000Z

11

Reconstruction of mass balance of glaciers in southern Norway back to 1948  

E-Print Network [OSTI]

Reconstruction of mass balance of glaciers in southern Norway back to 1948 L.A. RASMUSSEN,1 L), PO Box 5091, Majorstua, NO-0301 Oslo, Norway 3 Department of Geosciences, University of Oslo, PO Box 1047 Blindern, NO-0316 Oslo, Norway ABSTRACT. A model using upper-air meteorological variables

Rasmussen, L.A.

12

A knowledge portal for Norway  

E-Print Network [OSTI]

A knowledge portal for Norway 2012 Highlights from the University of Oslo's annual report #12 examinations 14 The Governor of the Bank of Norway's Annual Address: 15 A student ombudsman is introduced 15 for Norway, and in addition to its achievements in the form of education and new research, it has a large

Johansen, Tom Henning

13

Modeling thermal convection in supradetachment basins: example from western Norway  

E-Print Network [OSTI]

Modeling thermal convection in supradetachment basins: example from western Norway A. SOUCHE*, M. DABROWSKI AND T. B. ANDERSEN Physics of Geological Processes (PGP), University of Oslo, Oslo, Norway basins of western Norway are examples of supradetachment basins that formed in the hanging wall

Andersen, Torgeir Bjørge

14

Seasonal mass-balance gradients in Norway L.A. RASMUSSEN,1  

E-Print Network [OSTI]

Seasonal mass-balance gradients in Norway L.A. RASMUSSEN,1 L.M. ANDREASSEN2,3 1 Department of Earth, Norway 3 Department of Geosciences, University of Oslo, Blindern, NO-0316 Oslo, Norway ABSTRACT. Previously discovered regularity in vertical profiles of net balance, bnĂ°zĂ?, on ten glaciers in Norway also

Rasmussen, L.A.

15

Architecture of the Middle Devonian Kvamshesten Group, western Norway: sedimentary response to deformation above a ramp-flat  

E-Print Network [OSTI]

Architecture of the Middle Devonian Kvamshesten Group, western Norway: sedimentary response. ANDERSEN 1 1Department of Geology, University of Oslo, Pb 1047 Blindern, 0316 Oslo, Norway 2present address." Geological Survey of Norway, 7491 Trondheim, Norway Abstract: The Mid-Devonian Kvamshesten basin in western

Andersen, Torgeir Bjørge

16

Complex pockmarks with carbonate-ridges off mid-Norway: Products of sediment degassing  

E-Print Network [OSTI]

Complex pockmarks with carbonate-ridges off mid-Norway: Products of sediment degassing Martin Fossa°f , Rene´ Jonssong , Ha°kon Ruesla°ttene a Statoil, N-4035, Stavanger, Norway b Physics of Geological Processes (PGP), University of Oslo, P.O. Box 1048 Blindern, 0316 Oslo, Norway c Norwegian

Svensen, Henrik

17

PERI-GONDWANAN ELEMENTS IN THE CALEDONIAN NAPPES OF FINNMARK, NORTHERN NORWAY: IMPLICATIONS FOR THE  

E-Print Network [OSTI]

PERI-GONDWANAN ELEMENTS IN THE CALEDONIAN NAPPES OF FINNMARK, NORTHERN NORWAY: IMPLICATIONS Complex in northern Norway. In the standard interpretation, the Kalak Nappe Complex was viewed as a stack of Geosciences, University of Oslo, Postbox 1047 Blindern, N-0316 Oslo, Norway; fernando

Torsvik, Trond Helge

18

Langfjordjkelen, a rapidly shrinking glacier in northern Norway Liss M. ANDREASSEN,1  

E-Print Network [OSTI]

Langfjordjøkelen, a rapidly shrinking glacier in northern Norway Liss M. ANDREASSEN,1 Bjarne Directorate (NVE), Oslo, Norway E-mail: lma@nve.no 2 University of Washington, Seattle, WA, USA 3 The Norwegian Meteorological Institute, Oslo, Norway ABSTRACT. In this paper we document changes

Rasmussen, L.A.

19

LOCAL ACTORS BUILD BROADBAND INFRASTRUCTURE Ingjerd Skogseid, Western Norway Research Institute, Postboks 163, 6851 Sogndal, Norway,  

E-Print Network [OSTI]

LOCAL ACTORS BUILD BROADBAND INFRASTRUCTURE Ingjerd Skogseid, Western Norway Research Institute, Postboks 163, 6851 Sogndal, Norway, Ingjerd.Skogseid@vestforsk.no Ole Hanseth, Department of informatics, University of Oslo, Norway, Ole.Hanseth@ifi.uio.no Abstract This paper explores how local actors can play

Hanseth, Ole

20

E-Print Network 3.0 - area western norway Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Geosciences 67 Slow exhumation of UHP terranes: Titanite and rutile ages of the Western Gneiss Region, Norway Summary: on the subduction-...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Fluids and halogens at the diagenetic-metamorphic boundary: evidence from veins in continental basins, western Norway  

E-Print Network [OSTI]

basins, western Norway H. SVENSEN1 , B. JAMTVEIT1 , D. A. BANKS2 AND D. KARLSEN1 1 Department of Geology, University of Oslo, Blindern, Oslo, Norway; 2 School of Earth Sciences, University of Leeds, Leeds, UK, Kvamshesten and Solund basins) in western Norway. These include calcite-, quartz- and epidote-dominated veins

Banks, David

22

Seasonal mass balance gradients in Norway L. A. Rasmussen1  

E-Print Network [OSTI]

16 Aug 05 Seasonal mass balance gradients in Norway L. A. Rasmussen1 and L. M. Andreassen2 1 Norwegian Water Resources and Energy Directorate (NVE) P. O. Box 5091 Majorstua, N-0301 Oslo, Norway in Norway exists in their profiles of both seasonal balances, winter bw(z) and summer bs(z). Unlike many

Rasmussen, L.A.

23

On the dynamics of subaqueous clay rich gravity mass flows--the giant Storegga slide, Norway  

E-Print Network [OSTI]

Ulleva°l Stadion, 0806 Oslo, Norway c Norsk Hydro ASA, 0246 Oslo, Norway Received 10 November 2003 the path, extremely small yield strength must be attributed to the material. This finding is incompatible., 2004b). There are several reasons for this. Small events are easier to survey completely

24

ACTA ORIENTALIA, founded in 1922, published annually under the auspices of the Oriental Societies of Denmark, Finland, Norway and Sweden,  

E-Print Network [OSTI]

of Denmark, Finland, Norway and Sweden, with support from the Nordic Publications Board for Periodicals orders may be placed with: Hermes Academic Publishing P.O.Box 2709 Solli, N-0204 Oslo, Norway Fax + 47 22

Løw, Erik

25

ACTA ORIENTALIA, founded in 1922, published annually under the auspices of the Oriental Societies of Denmark, Finland, Norway and Sweden,  

E-Print Network [OSTI]

of Denmark, Finland, Norway and Sweden, with support from the Nordic Publications Board for Periodicals: Hermes Academic Publishing P.O.Box 2709 Solli, N-0204 Oslo, Norway Fax + 47 22 43 69 95; telephone + 47

Løw, Erik

26

30 ENGINEERING & SCIENCE WI NTE R 2012 Whether processing radar signals in Norway or assessing rock properties in Nigeria, Calte  

E-Print Network [OSTI]

30 ENGINEERING & SCIENCE WI NTE R 2012 Whether processing radar signals in Norway or assessing rock deeply into basic physics to solve problems. Oslo, Norway, JosĂŠ Navarro, PhD '94, Astronomy JosĂŠ Navarro

27

Absolute dating of brittle fault movements: Late Permian and late Jurassic extensional fault breccias in western Norway  

E-Print Network [OSTI]

breccias in western Norway Elizabeth A. Eide1 *, Trond H. Torsvik1,2 and Torgeir B. Andersen3 1 Geological Survey of Norway, PO Box 3006 Lade, N-7002 Trondheim, Norway, 2 Department of Solid Earth Physics, University of Bergen, N-5002 Bergen, Norway, 3 Department of Geology, University of Oslo, PO Box 1047

Andersen, Torgeir Bjørge

28

Trends in life expectancy by education in Norway 19612009 O lof Anna Steingrimsdottir yvind Nss  

E-Print Network [OSTI]

MORTALITY Trends in life expectancy by education in Norway 1961­2009 O´ lo¨f Anna Steingri in life expectancy by education in Norway in the period 1961­2009, and to determine whether the patterns, 0403 Oslo, Norway e-mail: Olof.Anna.Steingrimsdottir@fhi.no �. NÌss Á J. O. Moe Department of Health

29

Come to Norway Experience the World JuNE 20-July 31  

E-Print Network [OSTI]

Come to Norway ­ Experience the World 2015 JuNE 20-July 31 #12;An Academic Experience The ISS of Bergen and the fjords of Western Norway. Studying and living with fellow students from all over the world School PO Box 1082 Blindern NO 0317 Oslo Norway uio.no/summerschool Tel: +47 22 85 63 85 iss

Johansen, Tom Henning

30

Nitrogen dynamics in runoff from two small heathland catchments in Norway Hydrology and Earth System Sciences, 6(3), 351362 (2002) EGS  

E-Print Network [OSTI]

Nitrogen dynamics in runoff from two small heathland catchments in Norway 351 Hydrology and Earth catchments representing opposite extremes with respect to climate and N deposition in Norway Ă?yvind Kaste1 Grimstad, Norway 2 Norwegian Institute for Water Research, P.O. Box 173 KjelsĂĽs, N-0411 Oslo, Norway Email

Paris-Sud XI, UniversitĂŠ de

31

Future recovery of acidified lakes in southern Norway predicted by the MAGIC model Hydrology and Earth System Sciences, 7(4), 467483 (2003) EGU  

E-Print Network [OSTI]

Future recovery of acidified lakes in southern Norway predicted by the MAGIC model 467 Hydrology and Earth System Sciences, 7(4), 467483 (2003) Š EGU Future recovery of acidified lakes in southern Norway.O. Box 173 Kjelsüs, N-0411 Oslo, Norway 2 Department of Environmental Sciences, University of Virginia

Paris-Sud XI, UniversitĂŠ de

32

Recovery from acidification of lakes in Finland, Norway and Sweden 19901999 Hydrology and Earth System Sciences, 5(3), 327337 (2001) EGS  

E-Print Network [OSTI]

Recovery from acidification of lakes in Finland, Norway and Sweden 1990­1999 327 Hydrology, Norway and Sweden 1990­1999 B.L. Skjelkvüle1 , J. Mannio2 , A. Wilander3 and T. Andersen1 1 Norwegian Institute for Water Research, PB 173 Kjelsüs, N-0411 Oslo, Norway 2 Finnish Environment Institute, PB.140

Boyer, Edmond

33

Long-term changes in acidification and recovery at nine calibrated catchments in Norway, Sweden and Finland Hydrology and Earth System Sciences, 5(3), 339349 (2001) EGS  

E-Print Network [OSTI]

Long-term changes in acidification and recovery at nine calibrated catchments in Norway, Sweden in acidification and recovery at nine calibrated catchments in Norway, Sweden and Finland F. Moldan1 , R.F. Wright2 KjelsĂĽs, N-0411 Oslo, Norway 3 Insitute for Environmental Assessment, Swedish University of Agricultural

Paris-Sud XI, UniversitĂŠ de

34

Journal of the Geological Society, London, Vol. 154, 1997, pp. 961973, 10 figs, 2 tables. Printed in Great Britain The age and tectonic significance of dolerite dykes in western Norway  

E-Print Network [OSTI]

in Great Britain The age and tectonic significance of dolerite dykes in western Norway TROND H. TORSVIK1,3 , TORGEIR B. ANDERSEN2 , ELIZABETH A. EIDE1 & HARALD J. WALDERHAUG3 1 Geological Survey of Norway, PB 3006 Lade, N-7002 Trondheim, Norway 2 Department of Geology, University of Oslo, PO Box 1047, 0316 Blindern

Andersen, Torgeir Bjørge

35

ASSESSMENT OF GLACIOLOGICAL PARAMETERS USING LANDSAT SAT-ELLITE DATA IN SVARTISEN, NORTHERN NORWAY  

E-Print Network [OSTI]

.heiskanen@utu.fi 2. Norwegian Water Resources and Energy Directorate, Oslo, Norway 3. Department of Geography of the state of glaciers is important, for such purposes as hydropower production and natural hazard (Meyer et al. 1993). The dynamic range of most optical sensors is not optimised for high reflectance

Oldenburg, Carl von Ossietzky Universität

36

Prospectus 2012 2013 Welcome to the University of Oslo  

E-Print Network [OSTI]

and is surrounded by sea, forests and hills. You can reach many of the 40 islands in the Oslo Fjord by boat from in total. 3. Oslomarka Vast forested hills surrounding Oslo. Ideal for outdoor actitivity after a short by forest and parks, and there are hundreds of lakes within the boundaries of the city. With public

Løw, Erik

37

Attribution of the Arctic ozone column deficit in March 2011  

E-Print Network [OSTI]

Air Research, Kjeller, Norway. Department of Earth Systemof Oslo, N-0315 Oslo, Norway. (ivar.isaksen@geo.uio.no) ŠUniversity of Oslo, Oslo, Norway. Center for International

2012-01-01T23:59:59.000Z

38

Session 6B3 International Conference on Engineering Education August 6 10, 2001 Oslo, Norway  

E-Print Network [OSTI]

, and the sciences [8] - [15]. The use of writing in introductory physics classes for non-majors may help students questions involved the assessment of student learning in physics as well as in college writing. The primary, could this enhanced motivation be linked to increased student understanding in physics? In this paper

Larkin, Teresa L.

39

Analysis of possible systematic errors in the Oslo method  

SciTech Connect (OSTI)

In this work, we have reviewed the Oslo method, which enables the simultaneous extraction of the level density and {gamma}-ray transmission coefficient from a set of particle-{gamma} coincidence data. Possible errors and uncertainties have been investigated. Typical data sets from various mass regions as well as simulated data have been tested against the assumptions behind the data analysis.

Larsen, A. C.; Guttormsen, M.; Buerger, A.; Goergen, A.; Nyhus, H. T.; Rekstad, J.; Siem, S.; Toft, H. K.; Tveten, G. M.; Wikan, K. [Department of Physics, University of Oslo, N-0316 Oslo (Norway); Krticka, M. [Institute of Particle and Nuclear Physics, Charles University, Prague (Czech Republic); Betak, E. [Institute of Physics SAS, 84511 Bratislava (Slovakia); Faculty of Philosophy and Science, Silesian University, 74601 Opava (Czech Republic); Schiller, A.; Voinov, A. V. [Department of Physics and Astronomy, Ohio University, Athens, Ohio 45701 (United States)

2011-03-15T23:59:59.000Z

40

Analysis of possible systematic errors in the Oslo method  

E-Print Network [OSTI]

In this work, we have reviewed the Oslo method, which enables the simultaneous extraction of level density and gamma-ray transmission coefficient from a set of particle-gamma coincidence data. Possible errors and uncertainties have been investigated. Typical data sets from various mass regions as well as simulated data have been tested against the assumptions behind the data analysis.

A. C. Larsen; M. Guttormsen; M. Krticka; E. Betak; A. Bürger; A. Görgen; H. T. Nyhus; J. Rekstad; A. Schiller; S. Siem; H. K. Toft; G. M. Tveten; A. V. Voinov; K. Wikan

2012-11-27T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Trondheim, Norway Concurrent Design Approach  

E-Print Network [OSTI]

22.11.2012 1 1 Trondheim, Norway Concurrent Design Approach to the Design of Customized Corporate E and Technology 20.11.2012 Trondheim, Norway 2 Trondheim, Norway Outline ¡ Introduction ¡ Research Context;22.11.2012 2 3 Trondheim, Norway Introduction ¡ I have followed the PhD-program at the Department of Computer

Langseth, Helge

42

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

43

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

44

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

45

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

46

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

47

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

48

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

49

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

50

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

51

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

52

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

53

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

54

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

55

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

56

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

57

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

58

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

59

Natural gas ferries in Norway.  

E-Print Network [OSTI]

??This paper studies the emergence of natural gas powered ferries in Norway and their diffusion as a means to reaching the goals of reducing NOx… (more)

Myklebust, Benjamin

2006-01-01T23:59:59.000Z

60

doi:10.1182/blood-2013-09-527978 Prepublished online November 15, 2013;  

E-Print Network [OSTI]

, Norwegian Institute of Public Health, Oslo, Norway; 4 School of Pharmacy, University of Oslo, Oslo, Norway Biology, University of Tromso, Tromso, Norway; and 9 University Hospital of North Norway, Tromso, Norway

Gleeson, Joseph G.

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

PROCEEDINGS D. LEVIATAN  

E-Print Network [OSTI]

, 0316 Oslo, Norway K. Mørken Dept. of Informatics, University of Oslo, P.O. Box 1080 Blindern, 0316 Oslo, Norway E. Quak SINTEF Applied Mathematics, P.O. Box 124 Blindern, 0314 Oslo, Norway A. Cohen Laboratoire

62

Seminar COST 356 EST "Towards the definition of a measurable environmentally sustainable transport", 20 February 2008, Oslo, Norway  

E-Print Network [OSTI]

. For instance the global warming potential evaluates the global temperature increase and not really the final on the causes of the impact, because the impact cannot be linked by a one-to-one relationship with the accidents, hazards, among others cause death and injuries. The account of death and injuries due to the accident

Paris-Sud XI, UniversitĂŠ de

63

Water Retrieval by Norway Rats: Behavior as Deduction  

E-Print Network [OSTI]

1948). Burrows and feeding of the Norway a radial Mammalogy,Object retrieval preferences of Norway rats: An evolutionaryinedible objects by Norway rats: Motivational interactions

Wallace, R J

1998-01-01T23:59:59.000Z

64

Catastrophes of Redemption: Modernism and Fascism in Norway  

E-Print Network [OSTI]

and Henning Wćrp. Hamarřy, Norway: Hamsun-Selskapet, 2007.litterćre modernisme. Bergen, Norway: Fagbokforlaget, 2005.and Henning Wćrp. Hamarřy, Norway: Hamsun-Selskapet, 2003.

Krouk, Dean N.

2011-01-01T23:59:59.000Z

65

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

66

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

67

Dear Madam/Sir, European Movement Croatia in cooperation with University of Oslo are inviting you to participate at the  

E-Print Network [OSTI]

Dear Madam/Sir, European Movement Croatia in cooperation with University of Oslo are inviting you will subsequently spread and grow in Croatia and worldwide through Internet and other media. The question remains.bacic@europe.hr Renata Bacic and Dino Karabeg European Movement Croatia and University of Oslo #12;

Karabeg, Dino

68

Quality system for the educational activities at the University of Oslo (last update 6 July 2010) QUALITY ASSURANCE SYSTEM FOR THE EDUCATIONAL  

E-Print Network [OSTI]

Quality system for the educational activities at the University of Oslo (last update 6 July 2010) 1 QUALITY ASSURANCE SYSTEM FOR THE EDUCATIONAL ACTIVITIES AT THE UNIVERSITY OF OSLO (last update 6 July 2010............................................................................25 #12;Quality system for the educational activities at the University of Oslo (last update 6 July

Johansen, Tom Henning

69

NORWAY-SOUTH AFRICA RESEARCH PROJECT TPCP/CTHB STUDENTS VISIT NORWAY  

E-Print Network [OSTI]

NORWAY-SOUTH AFRICA RESEARCH PROJECT TPCP/CTHB STUDENTS VISIT NORWAY Recently two masters' students of visiting Norway to work with the Norwegian Forestry Research Institute (Skogforsk) in Ă?s. This opportunity arose from a bilateral agreement between the Governments of Norway and South Africa. For Gilbert

70

Original article Stem cracks in Norway spruce  

E-Print Network [OSTI]

Original article Stem cracks in Norway spruce in southern Scandinavia: causes and consequences Garpenberg, Sweden (Received 1st September 1992; accepted 17 June 1993) Summary — Stem cracks in Norway;INTRODUCTION Background During this century, the widespread crack- ing of Norway spruce (Picea abies L Karst

Boyer, Edmond

71

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

72

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

73

1. INTRODUCTION At Falconbridge Nikkelverk in Kristiansand, Norway,  

E-Print Network [OSTI]

1. INTRODUCTION At Falconbridge Nikkelverk in Kristiansand, Norway, nickel is produced Cybernetics, The Norwegian University of Science and Technology, N-7034 Trondheim, Norway Abstract: This paper of the electrolyte purification plant at Falconbridge Nikkelverk in Kristiansand, Norway. The process including

Foss, Bjarne A.

74

Animal rights organisations in Norway and their work against  

E-Print Network [OSTI]

Animal rights organisations in Norway and their work against animal experiments DyreforsøkslÌre ZO............................................................................................................................ 4 2. Organisations against animal experiments in Norway ........................................................................................ 7 2.4 Animal Liberation Front In Norway

Bech, Claus

75

Thomas J. Impelluso Professor, Bergen University College, Norway  

E-Print Network [OSTI]

Thomas J. Impelluso Professor, Bergen University College, Norway Math, Motion, and Visualization and in Norway. Center for Research in Mathematics and Science Education #12;

Gallo, Linda C.

76

Wind Power in Norway -Innovation strategy -  

E-Print Network [OSTI]

Wind Power in Norway - Innovation strategy - Liana MĂźller #12;2 Introduction The existing energy and, at the same time, not to irreversibly damage the life on Earth. The use of waterpower, wind power, the growth of the wind power industry in Norway. In the sequel, a brief history of wind power energy

MĂźller, Ralf R.

77

Tourism in Norway, and Study at Harstad University College.  

E-Print Network [OSTI]

Tourism in Norway, and Study at Harstad University College. UNBC November 2009 May Kristin College Tourism in Norway #12;Harstad University College Northern Norway Harstad; aprox. 25, Norway Advanced Marketing or Travel and Tourism with e-commerce #12;Avanced Marketing 1st semester 2nd

Northern British Columbia, University of

78

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

79

Use of the Internet among dermatologists in the United Kingdom, Sweden and Norway  

E-Print Network [OSTI]

Denmark, Iceland, and Norway, 2000. [In Swedish]. 9.United Kingdom, Sweden and Norway Petter Jensen Gjersvik 1Kingdom, Sweden, and Norway. Six hundred fifty-three (51%)

Gjersvik, Petter Jensen; Nylenna, Magne; Aasland, Olaf Gjerlřw

2002-01-01T23:59:59.000Z

80

Genome sequence of the Brown Norway rat yields insights into  

E-Print Network [OSTI]

Genome sequence of the Brown Norway rat yields insights into mammalian evolution Rat Genome Norway (BN) rat strain. The sequence represents a high-quality `draft' covering over 90% of the genome

Pachter, Lior

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Ris-R-1513(EN) The "Red" Decline of Norway  

E-Print Network [OSTI]

Risø-R-1513(EN) The "Red" Decline of Norway Spruce or "Røde Rødgraner" ­ Is it Ammonium Overload. Engvild Title: The "Red" Decline of Norway Spruce or "Røde Rødgraner" ­ Is it Ammonium Overload or Top" decline of Norway spruce (Picea abies) became a serious problem in plantations in Jutland on poor, sandy

82

Geirangerfjord, Norway 404 British Isles & Norwegian Fjords V1  

E-Print Network [OSTI]

¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ #12;V1 Geirangerfjord, Norway 404 British Isles & Norwegian Fjords V1 PRSRTSTD U and a gateway to the Highlands, the other the capital of the Shetland Islands. Sail to Norway and visit �lesund in the world." Discover Norway's oldest Viking port, Hellesylt, and Belfast, Northern Ireland, a city brimming

Raina, Ramesh

83

Seminar in Trondheim, Norway, Friday 25th of January 2013  

E-Print Network [OSTI]

Seminar in Trondheim, Norway, Friday 25th of January 2013 Research on occupational accidents for occupational accidents and injuries for Norway, and eventually in collaboration with other Nordic countries on occupational accidents and injuries in Norway? Inggard Lereim, Norwegian University of Science and Technology

Malinnikova, Eugenia

84

Geophysical phenomena during an ionospheric modication experiment at Troms, Norway  

E-Print Network [OSTI]

Geophysical phenomena during an ionospheric modiÂŽcation experiment at TromsĂš, Norway N. F-9037, TromsĂš, and The University Courses of Svalbard, Svalbard, Norway 3 EISCAT, N-9027 RamfjĂšrdbotn, Norway Received: 13 October 1997 / Revised: 11 May 1998 / Accepted: 26 May 1998 Abstract. We present

Paris-Sud XI, UniversitĂŠ de

85

"Charter and Code" Gap Analysis ANALYSIS FOR NORWAY  

E-Print Network [OSTI]

"Charter and Code" ­ Gap Analysis ANALYSIS FOR NORWAY The European Charter for Researchers: Acceptable. The principle of research freedom is well-established in Norway. The committee refers for Research Ethics in Norway. #12;In recent years, issues of research ethics have received increasing

Johansen, Tom Henning

86

The scientific case for eInfrastructure in Norway  

E-Print Network [OSTI]

The scientific case for eInfrastructure in Norway The eInfrastructure Scientific Opportunities Panel #12;2 3 The scientific case for eInfrastructure in Norway The eInfrastructure Scientific Opportunities Panel Appointed by the Research Council of Norway Galen Gisler (chair) Physics of Geological

Helgaker, Trygve

87

Gerhard Fischer 1 IRIS'24, Norway Communities of Interest  

E-Print Network [OSTI]

Gerhard Fischer 1 IRIS'24, Norway Communities of Interest: Learning through the Interaction for social creativity among CoIs. #12;Gerhard Fischer 2 IRIS'24, Norway 1 Introduction Design projects the interaction of these diverse communities. #12;Gerhard Fischer 3 IRIS'24, Norway 2 Design Communities Design

Fischer, Gerhard

88

The Fisheries of Norway UNITED STATES DEPARTMENT OF THE INTERIOR  

E-Print Network [OSTI]

The Fisheries of Norway UNITED STATES DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE SERVICE BUREAU 11 12 15 16 16 16 17 17 17 18 19 19 #12;The Fisheries of Norway By SID 'EY SHAPIRO Foreign Fisheries about 1.3 million tons annually between 1960 and 1964. Thes e landings make Norway the foremost fishing

89

India-Norway Workshop on Web Concepts and Technologies, Trondheim, Norway, October 3rd, 2011 A Survey of Domain Adaptation in Machine Translation  

E-Print Network [OSTI]

India-Norway Workshop on Web Concepts and Technologies, Trondheim, Norway, October 3rd, 2011 Trondheim, Norway Abstract--Domain adaptation is a recurring problem in Artificial Intelligence in general

Gambäck, BjÜrn

90

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

91

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

92

The European tobacco control report 2007  

E-Print Network [OSTI]

bars and restaurants in Norway. Oslo, National Institute fornational report 2004. Norway Data for 2001 Definition: dailyInterview survey, Statistics Norway, 2001. Data for 2004

World Health Organization

2007-01-01T23:59:59.000Z

93

From Motherhood Penalties to Husband Premia: The New Challenge for Gender Equality and Family Policy, Lessons from Norway  

E-Print Network [OSTI]

2001. “Cohabitation in Norway: An Accepted and GraduallyWage Gap, The Case of Norway. ” European Sociological ReviewA Comparison of Finland, Norway and Swe- den. ” European

Petersen, Trond; Penner, Andrew; Hřgnes, Geir

2012-01-01T23:59:59.000Z

94

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

Energy Researh (SEfAS) Norway Ms. Grřnli has been workingPower Research Institute), Norway, since 1995. She holds aGRID ACCESS AND PRICING IN NORWAY, SPAIN AND CALIFORNIA – A

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris

1999-01-01T23:59:59.000Z

95

Social Influences on Food Choices of Norway Rats and Mate Choices of Japanese Quail  

E-Print Network [OSTI]

ecology and sociology of the Norway rat . Bethesda: U.S. De-food stealing by young Norway rats. Journal of Comparativesufficient diet by Norway rats. Journal of Comparative

Galef, Jr., Bennett G.

2001-01-01T23:59:59.000Z

96

Demography of auklets Aethia spp. in relation to introduced Norway rats Rattus norvegicus at Kiska  

E-Print Network [OSTI]

Demography of auklets Aethia spp. in relation to introduced Norway rats Rattus norvegicus at Kiska................................................................................................4 Norway Rat Abundance and Distribution .........................................................5................................................................................................6 Norway Rat Abundance and Distribution.........................................................7

Jones, Ian L.

97

ORIGINAL RESEARCH Introgression of Brown Norway Chromosome 1 onto the Fawn  

E-Print Network [OSTI]

ORIGINAL RESEARCH Introgression of Brown Norway Chromosome 1 onto the Fawn Hooded Hypertensive (FHH) and Brown Norway (BN) parent strains with a Brown Norway chromosome 1 substitution on the FHH

Helmstetter, Fred J.

98

angiosperms nuphar advena: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences and Ecology Websites Summary: , University of Oslo, NO-0318 Oslo, Norway Genomic comparisons provide evidence for ancient genome lineages. We found evidence...

99

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

100

Discrete ultrahigh-pressure domains in the Western Gneiss Region, Norway: implications for formation and exhumation  

E-Print Network [OSTI]

Discrete ultrahigh-pressure domains in the Western Gneiss Region, Norway: implications of Norway, Leiv Erikssons vei 39, 7491 Trondheim, Norway 4 Division of Geological and Planetary Sciences Ar ages within the Western Gneiss Region of Norway define three discrete ultrahigh-pressure (UHP

Hacker, Bradley R.

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

A post-Caledonian dolerite dyke from Magery, North Norway: age and geochemistry  

E-Print Network [OSTI]

A post-Caledonian dolerite dyke from Magerøy, North Norway: age and geochemistry DAVID ROBERTS-Caledonian dolerite dyke from Magerøy, North Norway: age and geochemistry. Norsk Geologisk Tidsskrift, Vol. 71, pp, Geological Survey of Norway, Post Box 3006-Lade, N-7(}()2 Trondheim, Norway; John G. Mitchell, Department

Andersen, Torgeir Bjørge

102

Mesozoic sediments and structures onshore Norway and in the coastal zone  

E-Print Network [OSTI]

15 Mesozoic sediments and structures onshore Norway and in the coastal zone Reidulv Bøe1 , Hükon Fossen2 , Morten Smelror1 1 Geological Survey of Norway (NGU), P.O. Box 6315 Sluppen, 7491 Trondheim, Norway. 2 University of Bergen, Department of Earth Science, P.O. Box 7800, 5020 Bergen, Norway. reidulv

Fossen, Haakon

103

Mesozoic and Cenozoic tectonics of the Mre Trndelag Fault Complex, central Norway: constraints from new apatite  

E-Print Network [OSTI]

Mesozoic and Cenozoic tectonics of the Møre Trøndelag Fault Complex, central Norway: constraints.H. Gabrielsen c,2 a Geological Survey of Norway, Leiv Erikssons vei 39, N-7491 Trondheim, Norway b Faculty Geological Institute, University of Bergen, Allegt. 41, N-5007, Bergen, Norway Available online 17 April 2004

Torsvik, Trond Helge

104

Regional scale effects of base cation fertilization on Norway spruce and European beech stands situated on acid brown soils: soil and foliar chemistry  

E-Print Network [OSTI]

net N transformations in Norway spruce (Picea abies (L. )Vascular tissue anatomy of Norway spruce needles and twigsnutrient imbalances in Norway spruce, Ecol. Bull. 44 (

Misson, Laurent

2001-01-01T23:59:59.000Z

105

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

106

Frequency responses of radial growth series after different thinning intensities in Norway spruce (Picea abies (L.) Karst.) stand  

E-Print Network [OSTI]

characteristics of Norway spruce canopy. 1. LightVitality of immission-damaged Norway spruce as a function ofB. , 1995. Crown damage in Norway spruce and Silver Žr:

Misson, Laurent

2003-01-01T23:59:59.000Z

107

Testing the Cultural Boundaries of a Model of Trust: Subordinate-Manager Relationships in China, Norway and the United States  

E-Print Network [OSTI]

Key Variables for China, Norway, and United States Variablein-Supervisor—China, Norway and US Independent VariableCommunication N China B p R Norway B p R United States B p

Whitener, Ellen M.; Maznevski, Martha L.; Hua, Wei; Saebo, Snorre R.; Ekelund, Bjorn Z.

2000-01-01T23:59:59.000Z

108

Modeling the evolution of polar ice sheets: Ice sheet system model workshop; Bergen, Norway, 2-4 June 2014  

E-Print Network [OSTI]

Model Workshop; Bergen, Norway, 2?4 June 2014 The Ice SheetUniversity of Bergen in Norway, in June 2014. This is the

Larour, E; Schlegel, N; Morlighem, M

2014-01-01T23:59:59.000Z

109

A delayed effect of ozone fumigation on photosynthesis of Norway spruce  

E-Print Network [OSTI]

A delayed effect of ozone fumigation on photosynthesis of Norway spruce D. Eamus1 A.W. Davis J into the long-lastincl effects of ozone fumiga- tion upon photosynthesis of Norway spruce. Measurements were

Paris-Sud XI, Université de

110

N I C O K E I L M A N Using Deterministic and  

E-Print Network [OSTI]

of such a forecast, which was recently computed by Statistics Norway (Statistics Norway 2006). Norway's population. Professor Nico Keilman Department of Economics, University of Oslo, Norway E-mail: n w keilman@econ uio no CAS Group Leader 2006/2007 Professor Nico Keilman Department of Economics, University of Oslo, Norway

Løw, Erik

111

Forerunners for change: Work and motherhood among second-generation immigrants in Norway  

E-Print Network [OSTI]

Forerunners for change: Work and motherhood among second- generation immigrants in Norway Marjan by studying how second-generation women of Pakistani descent in Norway organise paid work and childcare, how in the context of their everyday lives in Norway. Qualitative interviews with second-generation families

Johansen, Tom Henning

112

Assessing the effects of Norway rats on auklet breeding success and survival at Sirius Point, Kiska  

E-Print Network [OSTI]

Assessing the effects of Norway rats on auklet breeding success and survival at Sirius Point, Kiska Introduction The presence of introduced Norway rats (Rattus norvegicus) has been implicated as a possible sightings of Norway rats at Sirius Point Colony during the late 1980s and early 1990s. Furthermore

Jones, Ian L.

113

Marine Ornithology 41: 4148 (2013) Bond et al.: Crested Auklet survival with Norway Rats 41  

E-Print Network [OSTI]

Marine Ornithology 41: 41­48 (2013) Bond et al.: Crested Auklet survival with Norway Rats 41 in the Aleutians (Bailey 1993, Ebbert & Byrd 2002). Another introduced predator, the Norway rat Rattus norvegicus AND REPRODUCTIVE SUCCESS OF CRESTED AUKLETS AETHIA CRISTATELLA IN THE PRESENCE OF INTRODUCED NORWAY RATS RATTUS

Jones, Ian L.

114

GENERAL TECHNICAL REPORT PSW-GTR-240 Breeding for Resistance in Norway Spruce to the  

E-Print Network [OSTI]

GENERAL TECHNICAL REPORT PSW-GTR-240 162 Breeding for Resistance in Norway Spruce to the Root Results from previous studies of resistance in Norway spruce (Picea abies (L.) Karst.) to the pathogens Heterobasidion spp. show significant genotypic variation in fungal growth and spore susceptibility among Norway

Standiford, Richard B.

115

ForPeerReview Influence of woody elements of a Norway spruce canopy on nadir reflectance  

E-Print Network [OSTI]

ForPeerReview Only Influence of woody elements of a Norway spruce canopy on nadir reflectance) for a simulated Norway spruce canopy was performed at a very high spatial resolution (modelling resolution 0.2 m the Norway spruce canopy as being composed of i) leaves, ii) leaves, trunks and first order branches

Paris-Sud XI, UniversitĂŠ de

116

Increasing absolute mortality disparities by education in Finland, Norway and Sweden, 1971e2000  

E-Print Network [OSTI]

Increasing absolute mortality disparities by education in Finland, Norway and Sweden, 1971e2000 differences by education in Finland, Norway and Sweden over the period 1971 to 2000. Methods The age and the AIDs have increased since the 1970s in Norway and Sweden, and since the 1980s in Finland

117

BRAHMS Collaboration Jens Ivar Jrdre, University of Bergen, Norway Eps2003 Strangeness production in  

E-Print Network [OSTI]

BRAHMS Collaboration Jens Ivar Jørdre, University of Bergen, Norway Eps2003 Strangeness production in Au+Au collisions at RHIC sNN=200GeV Jens Ivar Jørdre University of Bergen, Norway #12;BRAHMS Collaboration Jens Ivar Jørdre, University of Bergen, Norway Eps2003 Brief outline Motivations Experimental

118

Variations in the diet of introduced Norway rats (Rattus norvegicus) inferred using stable isotope analysis  

E-Print Network [OSTI]

Variations in the diet of introduced Norway rats (Rattus norvegicus) inferred using stable isotope predators; island ecosystem conservation; stable isotope analysis; Norway rats; diet. Correspondence Heather of introduced Norway rats Rattus norvegicus has raised concerns for the fate of the large least auklet Aethia

Jones, Ian L.

119

Stimulus Control of Maternal Responsiveness to Norway Rat (Rattus norvegicus) Pup Ultrasonic Vocalizations  

E-Print Network [OSTI]

Stimulus Control of Maternal Responsiveness to Norway Rat (Rattus norvegicus) Pup Ultrasonic be considered a specialization of Norway rats and other small rodents. When removed from the nest and placed in a cool environment, infant Norway rats emit USVs. These vocalizations range from 30 to 50 k

120

ORIGINAL ARTICLE Fungal Diversity of Norway Spruce Litter: Effects of Site  

E-Print Network [OSTI]

ORIGINAL ARTICLE Fungal Diversity of Norway Spruce Litter: Effects of Site Conditions and Premature duplicatus). The study was conducted in 37-year-old Norway spruce [Picea abies (L.) Karst.] stands as endophytes of Norway spruce in prior studies. During spring of 2005, we found less than half the number

Minnesota, University of

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Norway, Canada, the United States, and the Tar Sands James Hansen  

E-Print Network [OSTI]

Norway, Canada, the United States, and the Tar Sands 9 May 2013 James Hansen Today 36 Norwegian development, given the fact that Norway saves much of its oil earnings for future generations and given the fact that Norway is not likely among the nations that will suffer most from climate change. I wonder

Hansen, James E.

122

APPARATUS AND METHODS EMPLOYED AT THE MARINE FISH HATCHERY AT FLODEVIG, NORWAY  

E-Print Network [OSTI]

APPARATUS AND METHODS EMPLOYED AT THE MARINE FISH HATCHERY AT FLODEVIG, NORWAY By G. M. Dannevig AND METHODS EMPLOYED AT THE MARINE FISH HATCHERY AT FLODEVIG, NORWAY. ~ By G. M. DANNEVIG, Director Fliidevig is situated on the seacoast near Arendal, Norway. The principal parts are a main building, having on the lower

123

Centre for Research-based Innovation Established by the Research Council of Norway improving the best  

E-Print Network [OSTI]

1 SIMLab Centre for Research-based Innovation Established by the Research Council of Norway improving the best In Trondheim, Norway, a truly international group of researchers are busily working of Structural Engineering, NTNU, Richard Birkelands vei 1a, 7491 Trondheim, Norway Toril M. Wahlberg, Centre

Tufto, Jarle

124

Individualization of textural and reactional microdomains in eclogites from the Bergen Arcs (Norway): Consequences for  

E-Print Network [OSTI]

Individualization of textural and reactional microdomains in eclogites from the Bergen Arcs (Norway in Caledonian eclogites from the Linda°s Nappe, Bergen Arcs, Norway, in order to investigate processes in eclogites from the Bergen Arcs (Norway): Consequences for Rb/Sr and Ar/Ar radiochronometer behavior during

Demouchy, Sylvie

125

Grandparents Climate Campaign Leader Halfdan Wiik, vre Kyvik 94, 5414 Stord, Norway  

E-Print Network [OSTI]

Stord, Norway Stord, April 17th 2012 Open letter to the Board of Statoil ASA, by chair Svein Campaign Leader Halfdan Wiik, Ă?vre Kyvik 94, 5414 Stord, Norway 3. Extraction that Statoil's continued exploitation of tar sands is contradictory to the long-term interest of Norway

Hansen, James E.

126

Discussion Papers No. 386, August 2004 Statistics Norway, Social and Demographic Research  

E-Print Network [OSTI]

Discussion Papers No. 386, August 2004 Statistics Norway, Social and Demographic Research Nico Commission. Address: Nico Keilman, Statistics Norway, Social and Demographic Research. E-mail: Nico.Keilman@ssb.no Dinh Quang Pham, Statistics Norway, Statistical Methods and Standards. E-mail: dinh.quang.pham @ssb

Løw, Erik

127

Ice sheet limits in Norway and on the Norwegian continental shelf Jan Mangerud  

E-Print Network [OSTI]

Ice sheet limits in Norway and on the Norwegian continental shelf Jan Mangerud University of Bergen, Department of Geology, AllĂŠgt. 41, N-5007 Bergen, Norway Jan.Mangerud@geol.uib.no Introduction Ice sheets the author will briefly review present knowledge of the glacial history of Norway. The recon- struction

IngĂłlfsson, Ă?lafur

128

-Establishment of Norway spruce seedlings -681 Journal of Vegetation Science 7: 681-684, 1996  

E-Print Network [OSTI]

- Establishment of Norway spruce seedlings - 681 Journal of Vegetation Science 7: 681-684, 1996 abandoned for half a century and are sur- rounded by Picea abies (Norway spruce) forests. The causes of inhibition of establishment of Norway spruce seedlings in the meadows were tested experimentally

Leps, Jan "Suspa"

129

Interactions of ozone and pathogens on the surface structure of Norway spruce needles  

E-Print Network [OSTI]

Interactions of ozone and pathogens on the surface structure of Norway spruce needles K. Ojanperä S and pathogens. It also acts as a barrier to air pollutants (Jeffree, 1986). The epicuticular wax of Norway and then a plate-like wax structure (Sauter and Voss, 1986). The life span of healthy needles of Norway spruce

Paris-Sud XI, UniversitĂŠ de

130

Pathogenicity of Ceratocystis resinifera to Norway spruce By Paal Krokene1,3  

E-Print Network [OSTI]

Pathogenicity of Ceratocystis resinifera to Norway spruce By Paal Krokene1,3 , Jolanda Roux2-1432 A° s, Norway; 2 Forestry and Agricultural Biotechnology Institute, University of Pretoria Norwegian C. resinifera isolates were inoculated on to Norway spruce (Picea abies) using two different

131

A Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and Politics  

E-Print Network [OSTI]

1 A Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and Politics Guillaume contended the gas-fired plants would slow Norway's dependence on imported electricity from Denmark, which 81-71 in favor of building Norway's first natural gas-fired power plant.1 As a result Bondevik

132

Impacts of the Norway Rat on the auklet breeding colony at Sirius Point, Kiska  

E-Print Network [OSTI]

Impacts of the Norway Rat on the auklet breeding colony at Sirius Point, Kiska Island, Alaska-3239 FAX: (709) 737-3018 e-mail: x19hlm@mun.ca #12;Major and Jones Impacts of the Norway Rat... 2 Fresh rat during World War II (Atkinson, 1985). It is believed that the Norway Rat (Rattus norvegicus

Jones, Ian L.

133

TREE RINGS OF NORWAY SPRUCE (PICEA ABIES (L.) KARSTEN) IN LITHUANIA AS DROUGHT INDICATORS  

E-Print Network [OSTI]

TREE RINGS OF NORWAY SPRUCE (PICEA ABIES (L.) KARSTEN) IN LITHUANIA AS DROUGHT INDICATORS A. Vitas growth of Norway spruce in Lithuania during 20th century has been conducted. Hypothesis of the study century are attributed. Keywords: air temperature, drought, Norway spruce, pointer year, precipitation

134

Mogens Blanke Adjunct Professor at Centre for Ships and Ocean Structures, NTNU, Norway  

E-Print Network [OSTI]

Mogens Blanke Adjunct Professor at Centre for Ships and Ocean Structures, NTNU, Norway Professor;DTU, Denmark & CeSOS, NTNU, Norway Position Mooring ­ essential in offshore Mooring lines provide deflection max 4-6 % of depth Abortion is extremely critical #12;DTU, Denmark & CeSOS, NTNU, Norway Diagnosis

Nørvüg, Kjetil

135

Least and Crested Auklet productivity and survival in relation to introduced Norway  

E-Print Network [OSTI]

Least and Crested Auklet productivity and survival in relation to introduced Norway Rats at Sirius and rats - Kiska 2004 2 Norway rats (Rattus norvegicus) were introduced to Kiska Island, western Aleutian was near normal (c. 50%) at Sirius Point in 2003 (Major and Jones 2003, Major 2004). Introduced Norway rats

Jones, Ian L.

136

The Caledonide Orogen in the Nordic countries is exposed in Norway, western Sweden, westernmost Fin-  

E-Print Network [OSTI]

The Caledonide Orogen in the Nordic countries is exposed in Norway, western Sweden, westernmost Fin-age basement. In northernmost Norway, the NE-trending Caledonian thrust front trun- cates the NW and north- eastern Greenland; it continues northwards from northern Norway, across the Barents Shelf

Fossen, Haakon

137

aamli southern norway: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

aamli southern norway First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Seep mounds on the Southern Vring...

138

Spectral imaging of proton aurora and twilight at Troms, Norway  

E-Print Network [OSTI]

Spectral imaging of proton aurora and twilight at Tromsř, Norway M. Galand,1 J. Baumgardner,1 D, which offers a unique opportunity to investigate the Ha to Hb Balmer decrement in proton aurora locations (Tromsř, Poker Flat, Svalbard) in proton aurora is presented. Lummerzheim and Galand [2001] find

Lummerzheim, Dirk

139

The Challenges of Migration as a Long-term Preservation Strategy: The Findings of TEAM Norway and LongRec*  

E-Print Network [OSTI]

The Challenges of Migration as a Long-term Preservation Strategy: The Findings of TEAM Norway and LongRec* Feng Luan; Norwegian University of Science and Technology; Trondheim, Norway Mads NygĂĽrd; Norwegian University of Science and Technology; Trondheim, Norway Lars Gaustad; National Library of Norway

Nørvüg, Kjetil

140

Late Mesozoic to Early Cenozoic components of vertical separation across the MbreTrbndelag Fault Complex, Norway  

E-Print Network [OSTI]

Complex, Norway T.F. Redfielda,*, A. Braathenb , R.H. Gabrielsenb,1 , P.T. Osmundsena , T.H. Torsvika,c , P.A.M. Andriessend,2 a Center for Geodynamics, Geological Survey of Norway, N-7491 Trondheim, Norway-5007, Bergen c Institute for Petroleum Technology and Applied Geophysics, NTNU, N-7491, NTNU (Norway

Torsvik, Trond Helge

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Hydrol. Earth Syst. Sci., 11, 10351045, 2007 www.hydrol-earth-syst-sci.net/11/1035/2007/  

E-Print Network [OSTI]

Water Resources and Energy Directorate, Oslo, Norway 3Department of Civil and Environmental Engineering. Skaugen1,2, and D. P. Lettenmaier3 1Department of Geosciences, University of Oslo, Oslo, Norway 2Norwegian of producing goods and services. The expansion of croplands has resulted in a 20 percent reduction in forest

Paris-Sud XI, UniversitĂŠ de

142

Taking sameness for granted through the Nordic worker-carer model  

E-Print Network [OSTI]

NIKK magasin 3?2006 pp  Statistics Norway (2010): Women and men in Norway: What the figures say.  Oslo, Norway.    The Norwegian Gender Equality Act.  

Boyle, Kaitlin

2011-01-01T23:59:59.000Z

143

The Scientific Basis of Tobacco Product Regulation  

E-Print Network [OSTI]

of Public Health, Oslo, Norway Dr N. Gray, Scientist,the mouth or chewed Sweden, Norway, USA Moist, finely groundthan 20% of young men in Norway, which is not a member of

World Health Organization

2008-01-01T23:59:59.000Z

144

Request received (from Norway, regarding e-mail titled "Grandparents Oppose Tar Sands"): Thanks. I have seen them in the news here in Norway as well about the Tar Sands.  

E-Print Network [OSTI]

Request received (from Norway, regarding e-mail titled "Grandparents Oppose Tar Sands"): Thanks. I have seen them in the news here in Norway as well about the Tar Sands. Question: When you send us by Anne Dalberg, chair of the Sami Church Council. Norway's First Nation - the Sami - showing solidarity

Hansen, James E.

145

Slow exhumation of UHP terranes: Titanite and rutile ages of the Western Gneiss Region, Norway  

E-Print Network [OSTI]

Slow exhumation of UHP terranes: Titanite and rutile ages of the Western Gneiss Region, Norway A: titanite rutile geochronology ultrahigh-pressure Norway U­Pb ages of titanite and rutile were obtained from of the Western Gneiss UHP terrane. Approximately half of the titanite ages are concordant, the majority of which

Hacker, Bradley R.

146

Masting and trophic cascades: interplay between rowan trees, apple fruit moth, and their parasitoid in southern Norway  

E-Print Network [OSTI]

in southern Norway Akiko Satake, Ottar N. Bjørnstad and Sverre Kobro Satake, A., Bjørnstad, O. N. and Kobro, S, and their parasitoid in southern Norway. Á/ Oikos 104: 540Á/550. We analyzed berry production in rowan, Sorbus aucuparia L., in southern Norway and examined the ramifying effects of rowan masting on the dynamics

147

Impacts of the Norway Rat on the auklet breeding colony at Sirius Point, Kiska Island, Alaska in 2003  

E-Print Network [OSTI]

Impacts of the Norway Rat on the auklet breeding colony at Sirius Point, Kiska Island, Alaska of the Norway rat (Rattus norvegicus) onto Kiska Island, Aleutian Islands, Alaska, in the 1940s (Murie 1959 and to investigate the biology and demography of the Norway rat population. Moors and Atkinson (1984) suggested

Jones, Ian L.

148

Labor Market Institutions and the Industry Wage Distribution: Evidence from Austria, Norway, and the U.S.  

E-Print Network [OSTI]

2 Occl Occ2 Occ3 Occ4 Occ6 NORWAY coeff. std.dev. US UNIONof log Wages Austria Norway U.S. union U.S. non-unionin the U.S. is high and low in Norway. Within the U.S. ,pay

Barth, Erling; Zweimuller, Josef

1992-01-01T23:59:59.000Z

149

UiT The Arctic University of Norway Fakultet for biovitenskap, fiskeri og konomi -Inst. for arktisk og marin biologi  

E-Print Network [OSTI]

UiT The Arctic University of Norway Fakultet for biovitenskap, fiskeri og økonomi - Inst/616 The Faculty of Biosciences, Fishery and Economics, UiT The Arctic University of Norway has a PhD position and participate in field work in Norway and Russia. The candidate must have a god command of written and spoken

Uppsala Universitet

150

Auklet Demography and the Influence of Norway rats at Kiska Island report on results of monitoring to 2009  

E-Print Network [OSTI]

Auklet Demography and the Influence of Norway rats at Kiska Island ­ report on results METHODS 4 AUKLET PRODUCTIVITY 4 TIMING OF BREEDING 5 AUKLET SURVIVAL 6 NORWAY RAT ABUNDANCE 10 NORWAY RAT ABUNDANCE AND DISTRIBUTION 10 VEGETATION CHANGES 11 DISCUSSION 11 LEAST AUKLET

Jones, Ian L.

151

Maternal Responsiveness to Infant Norway Rat (Rattus norvegicus) Ultrasonic Vocalizations During the Maternal Behavior Cycle and After  

E-Print Network [OSTI]

Maternal Responsiveness to Infant Norway Rat (Rattus norvegicus) Ultrasonic Vocalizations During environment, Norway rat (Rattus norvegicus) pups emit ultrasonic vocalizations that can elicit maternal search is particularly important in altricial species such as the Norway rat in which infants rely on the mother

152

ECOLOGY OF NORWAY RATS (RATTUS NORVEGICUS) IN RELATION TO CONSERVATION AND MANAGEMENT OF SEABIRDS ON KISKA ISLAND,  

E-Print Network [OSTI]

ECOLOGY OF NORWAY RATS (RATTUS NORVEGICUS) IN RELATION TO CONSERVATION AND MANAGEMENT OF SEABIRDS to predation by introduced Norway rats (Rattus norvegicus). In 2001 and 2002 the auklet colony experienced the lowest reproductive success ever recorded for auklets. Norway rats have been suggested as the cause

Jones, Ian L.

153

PUBLISHED ONLINE: 6 DECEMBER 2009 | DOI: 10.1038/NGEO708 Towards absolute plate motions constrained by  

E-Print Network [OSTI]

Georges Terrace, Perth, Western Australia 6000, Australia, 6School of Geosciences, University of Geological Processes, University of Oslo, NO-0316 Oslo, Norway, 5Chevron Energy Technology Company, 250 St

Torsvik, Trond Helge

154

Evaluating permeability anisotropy in the early Jurassic Tilje formation, offshore mid-Norway  

E-Print Network [OSTI]

The problem of evaluating permeability anisotropy in the Tilje Formation, Heidrum field, offshore mid-Norway, has been investigated by the Statoil Research Centre by a detailed combination of the geological and petrophysical data. The large...

Aliyev, Kanan

2005-11-01T23:59:59.000Z

155

Wars of position : language policy, counter-hegemonies and cultural cleavages in Italy and Norway   

E-Print Network [OSTI]

This thesis investigates the development of the present-day linguistic hegemonies within Italy and Norway as products of ongoing linguistic ‘wars of position’. Language activist movements have been key actors in these ...

Puzey, Guy Edward Michael

2011-11-22T23:59:59.000Z

156

agricultural runoff contaminants: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

P.O Box 173, Kjelsaas, N-0411 Oslo, Norway 3 National Environmental-00251 Helsinki, Finland 8 Lithuania University of Agriculture, Water Management Department, 4324 Kaunas. The...

157

E-Print Network 3.0 - aivo vares veiko Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Medicine ; Environmental Sciences and Ecology 70 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Summary:...

158

E-Print Network 3.0 - ahto buldas aivo Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Computer Technologies and Information Sciences 65 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Summary:...

159

aivo lepland atko: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Topic Index 1 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Geosciences Websites Summary: backscatter and...

160

aivo lepland tiit: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Topic Index 1 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Geosciences Websites Summary: backscatter and...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

A geochemical assessment of petroleum from underground oil storage caverns in relation to petroleum from natural reservoirs offshore Norway.  

E-Print Network [OSTI]

??The aim of this study is to compare oils from known biodegraded fields offshore Norway to waxes and oils from an artificial cavern storage facility,… (more)

Řstensen, Marie

2005-01-01T23:59:59.000Z

162

The second-language vocabulary trajectories of Turkish immigrant children in Norway from ages five to ten: The role of preschool talk exposure,maternal education, and co-ethnic concentration in the neighborhood  

E-Print Network [OSTI]

in Denmark, Finland, Iceland, Norway, and Sweden. Greenwich,Living conditions among immigrants in Norway 2005/2006.Statistics Norway, Report 2009/2. Available on-line at :

Ryland, Veslemoy; Grover, Vibeke; Lawrence, Joshua Fahey

2013-01-01T23:59:59.000Z

163

During the week of July 3--8, 1997 an international conference on Math ematical Methods for Curves and Surfaces was held at Lillehammer, Norway.  

E-Print Network [OSTI]

for Curves and Surfaces was held at Lillehammer, Norway. The conference was attended by 144 mathematicians was specifically marked by some author. We would like to thank SINTEF, The Research Council of Norway

Schumaker, Larry

164

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi@mat.ucm.es  

E-Print Network [OSTI]

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism AND RESEARCHERS IN UNIVERSIDAD COMPLUTENSE DE MADRID (MADRID, SPAIN) AND IN RESEARCH INSTITUTIONS IN NORWAY in the frame of the "Improving student, researchers and artists mobility and cooperation between Spain, Norway

Tradacete, Pedro

165

An alternative model for ultra-high pressure in the Svartberget Fe-Ti garnet-peridotite, Western Gneiss Region, Norway  

E-Print Network [OSTI]

Gneiss Region, Norway JOHANNES C. VRIJMOED1,*, YURI Y. PODLADCHIKOV1 , TORGEIR B. ANDERSEN1 and EBBE H, Norway *Corresponding author, e-mail: j.c.vrijmoed@fys.uio.no 2 Aker Exploration AS, PO Box 580, Sentrum, 4003 Stavanger, Norway Abstract: The previously reported ``Fe-Ti type'' garnet-peridotite is located

Andersen, Torgeir Bjørge

166

Real-Time Visualizations of Ocean Data Collected By The NORUS Glider in Svalbard, Norway Daniel Medina, Mark Moline, Christopher Clark, and Zo J. Wood  

E-Print Network [OSTI]

Real-Time Visualizations of Ocean Data Collected By The NORUS Glider in Svalbard, Norway Daniel, the North America-Norway educational program, has a scientific focus on how climate-induced changes impact, but chemical, biological, and even geological parameters (Bellingham and Godin, 2008). NORUS, the North America-Norway

Wood, ZoĂŤ J.

167

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi@mat.ucm.es  

E-Print Network [OSTI]

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism APPLICATION FORM #12;Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial;Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary

Tradacete, Pedro

168

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi@mat.ucm.es  

E-Print Network [OSTI]

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism;Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi

Tradacete, Pedro

169

The Minnesota Wri.ng Project's Collabora.on with Teacher Educators in Norway Na.onal Center for Wri.ng Educa.on and Research (Skrivesenteret)  

E-Print Network [OSTI]

The Minnesota Wri.ng Project's Collabora.on with Teacher Educators in Norway (HiST) ¡ Located in Trondheim, Norway It funcIons as a naIonal resource center their work with teachers throughout all of Norway. In order to obtain more first

Amin, S. Massoud

170

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi@mat.ucm.es  

E-Print Network [OSTI]

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism IN UNIVERSIDAD COMPLUTENSE DE MADRID (MADRID, SPAIN) AND IN RESEARCH INSTITUTIONS IN NORWAY, ICELAND of the "Improving student, researchers and artists mobility and cooperation between Spain, Norway, Iceland

Tradacete, Pedro

171

anticoagulant-susceptible norway rats: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

anticoagulant-susceptible norway rats First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Assessing the...

172

Assessing the catastrophic break up of Briksdalsbreen, Norway,1 associated with rapid climate change.2  

E-Print Network [OSTI]

about the potential influence of rapid climate change13 on the stability of major ice sheets retreat of Greenland's tidewater glaciers.32 33 Introduction34 The response of glaciers to climate change1 Assessing the catastrophic break up of Briksdalsbreen, Norway,1 associated with rapid climate

Southampton, University of

173

Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 19952007 (the  

E-Print Network [OSTI]

1 Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 1995­2007 (the International Cancer Benchmarking Partnership): an analysis of population-based cancer registry data M P Coleman Background Cancer survival is a key measure of the effectiveness of health-care systems. Persistent regional

Maizels, Rick

174

[The Journal of Geology, 1999, volume 107, p. 353374] 1999 by The University of Chicago. All rights reserved. 0022-1376/99/10703-0007$01.00 Early Carboniferous Unroofing in Western Norway: A Tale of Alkali  

E-Print Network [OSTI]

rights reserved. 0022-1376/99/10703-0007$01.00 353 Early Carboniferous Unroofing in Western Norway Geological Survey of Norway, N-7491 Trondheim, Norway (e-mail: Elizabeth.Eide@ngu.no) A B S T R A C T 40 Ar/39 Ar thermochronologic data from an extensional detachment zone in western Norway document

Andersen, Torgeir Bjørge

175

Stein Beldring , Kolbjrn Engeland , Lars A. Roald , Nils Roar Slthun and AstridVoks Hydrology and Earth System Sciences, 7(3), 304316 (2003) EGU  

E-Print Network [OSTI]

independent catchments. Finally, a river routing procedure using a kinematic wave approximation to open SÌlthun 2 and Astrid Voksø 1 1 Norwegian Water Resources and Energy Directorate, P.O. Box 5091 Majorstua, 0301 Oslo, Norway 2 Norwegian Institute for Water Research, P.O. Box 173 Kjelsüs, 0411 Oslo, Norway

Paris-Sud XI, UniversitĂŠ de

176

Scaling behaviour of clay-rich submarine debris flows D. Isslera,b,*, F.V. De Blasioa,b  

E-Print Network [OSTI]

3930 Ulleva°l Stadion, N-0806 Oslo, Norway c Norsk Hydro ASA, N-0246 Oslo, Norway Received 27 February described as a power-law function of the volume. For small to moderate volumes, visco-plastic models mixing of the shear layer with ambient water or hydro-planing must be invoked in order to explain

177

Forecasting future oil production in Norway and the UK: a general improved methodology  

E-Print Network [OSTI]

We present a new Monte-Carlo methodology to forecast the crude oil production of Norway and the U.K. based on a two-step process, (i) the nonlinear extrapolation of the current/past performances of individual oil fields and (ii) a stochastic model of the frequency of future oil field discoveries. Compared with the standard methodology that tends to underestimate remaining oil reserves, our method gives a better description of future oil production, as validated by our back-tests starting in 2008. Specifically, we predict remaining reserves extractable until 2030 to be 188 +/- 10 million barrels for Norway and 98 +/- 10 million barrels for the UK, which are respectively 45% and 66% above the predictions using the standard methodology.

Fievet, Lucas; Cauwels, Peter; Sornette, Didier

2014-01-01T23:59:59.000Z

178

?>*)3>OOOlt>A -j^t I Ris-R-628(EN)  

E-Print Network [OSTI]

, Sweden Risto Nieminen, Espoo, Finland Olav Steinsvoll, Oslo, Norway Local Organizing Committee: J, Norway L. Johansson, Linkoping, Sweden I. Lindau, Lund, Sweden N. Mirtensson, Uppsala, Sweden 1, Norway K. Fossheim, Trondheim, Norway K.V. Rao, Stockholm, Sweden G. Wendin, Goteborg, Sweden \\ Symposium

179

Freeport, TX Liquefied Natural Gas Imports from Norway (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 1 0 0 0ThousandFeet) South KoreaNorway

180

,"U.S. Liquefied Natural Gas Imports From Norway (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale ProvedTexas"Brunei (Dollars perReserves (BillionCanadaNorway (MMcf)"

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

FLGESKJEMA FOR SKERE TIL PPU TEACH FIRST NORWAY Dersom du har utdanning som ikke er tatt ved UiO, m du skrive ut dette skjemaet og  

E-Print Network [OSTI]

F�LGESKJEMA FOR S�KERE TIL PPU TEACH FIRST NORWAY Dersom du har utdanning som ikke er tatt ved Ui søke PPU Teach First Norway i Søknadsweb. Ditt navn: Fødselsnr: Jeg har søkt om fagdidaktikk i

Løw, Erik

183

Modelling the effects of acid deposition and climate change on soil and run-off chemistry at Risdalsheia, Norway Hydrology and Earth System Sciences, 5(3), 487498 (2001) EGS  

E-Print Network [OSTI]

at Risdalsheia, Norway 487 Hydrology and Earth System Sciences, 5(3), 487­498 (2001) Š EGS Modelling effects of acid deposition and climate change on soil and run-off chemistry at Risdalsheia, Norway J.P. Mol Norway. These unique experiments at the ecosystem scale provide information on the short-term effects

Paris-Sud XI, UniversitĂŠ de

184

Norway Expedition  

E-Print Network [OSTI]

Journal:  Wader Study Group Bulletin Attachment Size p00008-p00008.pdf 117.21 KB Issue:  16 Year:  1975 Pages:  8

185

EVS24 International Battery, Hybrid and Fuel Cell Electric Vehicle Symposium 1 Stavanger, Norway, May 13-16, 2009  

E-Print Network [OSTI]

EVS24 International Battery, Hybrid and Fuel Cell Electric Vehicle Symposium 1 EVS24 Stavanger and Fuel Cell Electric Vehicle Symposium & Exhibition, Stavanger : Norway (2009)" #12;EVS24 International Battery, Hybrid and Fuel Cell Electric Vehicle Symposium 2 that Discrete MDCM (Multi Criteria Decision

Boyer, Edmond

186

Hydropower'10 6th International Hydropower Conference, 13 February 2010, Troms, NORWAY Understanding Future Climate Impacts on Scotland's  

E-Print Network [OSTI]

Hydropower'10 ­ 6th International Hydropower Conference, 13 February 2010, Tromsø, NORWAY Understanding Future Climate Impacts on Scotland's Hydropower Resource Niall Duncan*, Gareth. P. Harrison and A energy by 2020. As hydropower currently makes up over 10% (1383 MW) of Scotland's installed generation

Harrison, Gareth

187

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

SciTech Connect (OSTI)

The openness of the transmission grid and the incentives given by transmission pricing form the foundation for retail and wholesale competition in the electricity market. The deregulated markets of Norway, Spain, and California all have introduced retail access and wholesale competition, although with different approaches to pricing of transmission grid services. This paper will briefly describe the three different solutions, and discuss some of their implications. Of the three electricity systems, Norway was the first to open the grid to competition in electricity trade. The Norwegian Energy Law of 1990 introduced open competition to wholesale and retail trade starting January 1991. In Spain, the Electricity Law of 1997 came into force early in 1998. Wholesale and retail markets in California were opened for competition on April 1, 1998, following the passage of Assembly Bill 1890, in August 1996. Introducing competition in electricity markets also implies introducing Third Party Access to the transmission grid. All potential competitors have to be given access to the grid in order to compete, no matter who owns the actual wires. This principle raises several challenges, notably, how to price transmission services. Who is to pay for which transmission services? The Norwegian grid is divided into three levels depending on its function. The transmission grid includes all parts of the national grid having a transmission function, meaning that some lower voltage levels also are included. In Spain, the definition of the transmission grid is similar, including the 400 kV and 220 kV national grid as well as lower voltage installations that could affect transmission operation or generation dispatch. For historic reasons, wholesale electricity transactions in the US are regulated by the federal government through the FERC. However, operations of utility systems within one state fall primarily under state jurisdiction. Because the utility systems in California generally are large and exchanges between them limited, the role of FERC was small prior to restructuring, although the state is a large importer of power.

Gronli, H.; Gomez San Ramon, T.; Marnay, C.

1999-09-01T23:59:59.000Z

188

Planning the Linguistic Landscape: A Comparative Survey of the Use of Minority Languages in the Road Signage of Norway, Scotland and Italy   

E-Print Network [OSTI]

This dissertation explores the controversial nature of current policies on the use of minority language place-names on official signage in Norway, Scotland and in Italy. Following a survey of recent developments in the ...

Puzey, Guy

2008-06-26T23:59:59.000Z

189

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

190

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

191

Submitted to J. Geophys. Res. May 19, 2004, Revised October 20, 2004, In Press October 27, 2004. Model simulations of dust sources and transport in the global  

E-Print Network [OSTI]

Department of Geosciences, University of Oslo, P.O. Box 1022 Blindern, 0315 Oslo, Norway 2 Department [Lohmann, 2002], stratospheric water vapor [Sherwood, 2002] and nu- trient transport to oceans and forests or crusting ¡ High particle availability ¡ Low binding energies of the suspended particles in the soil matrix

Zender, Charles

192

Investigating Evolvable Hardware Classification for the BioSleeve Electromyographic Interface  

E-Print Network [OSTI]

Glette Department of Informatics University of Oslo Oslo, Norway Email: kyrrehg@ifi.uio.no Paul Kaufmann for datasets with 17 and 11 gestures and compare to results of Support Vector Machines (SVM) and Random Forest for high- performance computing devices, embedded systems steadily become lighter, more energy efficient

Glette, Kyrre

193

Self-Organization in Models Sandpiles, Earthquakes, and Flashing Fireflies.  

E-Print Network [OSTI]

: Department of Physics University of Oslo P.O.Box 1048, Blindern N - 0316 Oslo 3 Norway Bitnet address . . . . . . . . . . . . . . . 18 2.3 Mean-field theory of the forest-fire model . . . . . . . . . . . . . . . 19 2.4 Summary . . . . . . . . . . . . . . . . . . . . . 41 4.3.1 The energy-frequency relation of earthquake occurrence . . . 41 4.3.2 Spatiotemporal

Christensen, Kim

194

The Open Inorganic Chemistry Journal, 2008, 2, 11-17 11 1874-0987/08 2008 Bentham Science Publishers Ltd.  

E-Print Network [OSTI]

in memory applications [8] and metal gate electrodes [6,9] because of its low resistivity and high thermal Rohm and Haas Electronic Materials, 60 Willow Street, North Andover, MA 01845, USA 2 Centre for Materials Science and Nanotechnology, University of Oslo, PO Box 1033, Oslo N-0315, Norway 3 IBM

195

Asymptotic Behaviour of Random Vandermonde Matrices with Entries on the Unit Circle  

E-Print Network [OSTI]

types of matrices, such as Vandermonde matrices with and without uniform phase distributions, as well with important tools in the field such as the FFT [1] or Hadamard [2] transforms, to name a few. Vandermonde, Uni- versity of Oslo, P.O. Box 1053 Blindern, NO-0316 Oslo, NORWAY, oyvin- dry@ifi.uio.no M

Paris-Sud XI, UniversitĂŠ de

196

adult rodent brains: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Moldestad, J.F. Storm, T.B. Leergaard and J.G. Bjaalie CMBN & IMB, University of Oslo, Norway INTRODUCTION Conventional atlases contain for 3-D reconstruction of series of such...

197

UPb and geochemical evidence for a Cryogenian magmatic arc in central Novaya Zemlya, Arctic Russia  

E-Print Network [OSTI]

U­Pb and geochemical evidence for a Cryogenian magmatic arc in central Novaya Zemlya, Arctic Russia-0349 Oslo, Norway Introduction The High Arctic of Scandinavia and Russia consists of a collage

Svensen, Henrik

198

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

Ozone and Ultraviolet Radiation Data Centre (WOUDC), andOzone and Ultraviolet Radiation Data Centre (WOUDC). Also

2012-01-01T23:59:59.000Z

199

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

von Clarmann, T. , and Stiller, G. P. : Short- and medium-B. , L´opez-Puertas, M. , Stiller, G. P. , von Clarmann,

2012-01-01T23:59:59.000Z

200

UNIVERSITY OF OSLO Department of Informatics  

E-Print Network [OSTI]

Nicolas Peltier Viorica Sofronie- Stokkermans ISBN 82-7368-347-8 ISSN 0806-3036 June 23, 2009 #12, July 2009 Proceedings Nicolas Peltier and Viorica Sofronie-Stokkermans (eds.) #12;#12;Preface to the FTP workshop series. Nicolas Peltier and Viorica Sofronie-Stokkermans iii #12;Programme committee

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Geothermal Energy at Oslo Airport Gardermoen.  

E-Print Network [OSTI]

?? Rock Energy is a Norwegian company with a patented solution for drilling deep geothermal wells, for exploitation of deep geothermal energy from Hot Dry… (more)

Huuse, Karine Valle

2012-01-01T23:59:59.000Z

202

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

sion estimates over South America from 2006 to 2010, J. Geo-biomass burn- ing in South America in 2005 observed duringand overesti- mated in South America, but these biases are

2012-01-01T23:59:59.000Z

203

Ozone induces glucose intolerance and systemic metabolic effects in young and aged brown Norway rats  

SciTech Connect (OSTI)

Air pollutants have been associated with increased diabetes in humans. We hypothesized that ozone would impair glucose homeostasis by altering insulin signaling and/or endoplasmic reticular (ER) stress in young and aged rats. One, 4, 12, and 24 month old Brown Norway (BN) rats were exposed to air or ozone, 0.25 or 1.0 ppm, 6 h/day for 2 days (acute) or 2 d/week for 13 weeks (subchronic). Additionally, 4 month old rats were exposed to air or 1.0 ppm ozone, 6 h/day for 1 or 2 days (time-course). Glucose tolerance tests (GTT) were performed immediately after exposure. Serum and tissue biomarkers were analyzed 18 h after final ozone for acute and subchronic studies, and immediately after each day of exposure in the time-course study. Age-related glucose intolerance and increases in metabolic biomarkers were apparent at baseline. Acute ozone caused hyperglycemia and glucose intolerance in rats of all ages. Ozone-induced glucose intolerance was reduced in rats exposed for 13 weeks. Acute, but not subchronic ozone increased ?{sub 2}-macroglobulin, adiponectin and osteopontin. Time-course analysis indicated glucose intolerance at days 1 and 2 (2 > 1), and a recovery 18 h post ozone. Leptin increased day 1 and epinephrine at all times after ozone. Ozone tended to decrease phosphorylated insulin receptor substrate-1 in liver and adipose tissues. ER stress appeared to be the consequence of ozone induced acute metabolic impairment since transcriptional markers of ER stress increased only after 2 days of ozone. In conclusion, acute ozone exposure induces marked systemic metabolic impairments in BN rats of all ages, likely through sympathetic stimulation. - Highlights: • Air pollutants have been associated with increased diabetes in humans. • Acute ozone exposure produces profound metabolic alterations in rats. • Age influences metabolic risk factors in aging BN rats. • Acute metabolic effects are reversible and repeated exposure reduces these effects. • Ozone metabolic effects are only slightly exacerbated in geriatric rats.

Bass, V. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gordon, C.J.; Jarema, K.A.; MacPhail, R.C. [Toxicity Assessment Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Cascio, W.E. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Phillips, P.M. [Toxicity Assessment Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Ledbetter, A.D.; Schladweiler, M.C. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Andrews, D. [Research Cores Unit, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Miller, D. [Curriculum in Toxicology, University of North Carolina, Chapel Hill, NC (United States); Doerfler, D.L. [Research Cores Unit, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Kodavanti, U.P., E-mail: kodavanti.urmila@epa.gov [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

2013-12-15T23:59:59.000Z

204

,"Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars per Thousand Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale ProvedTexas"Brunei (Dollars per Thousand Cubic Feet)"Nigeria (Dollars perNorway

205

Proceedings of EARSeL-SIG-Workshop Land Ice and Snow, Dresden/FRG, June 16 17, 2000 EARSeL eProceedings No. 1 328  

E-Print Network [OSTI]

Norwegian Computing Center, Oslo, Norway ABSTRACT A snow-covered forest mapping method for optical remote of South Norway. The reflectance modelling shows best results for pine forest and mixed pine and birchProceedings No. 1 328 A METHOD FOR SNOW-COVER MAPPING OF FORESTS BY OPTICAL REMOTE SENSING Dagrun Vikhamar1

Oldenburg, Carl von Ossietzky Universität

206

OSLO Workstation Assessment --page 1August 2013 OSLO Workstation Assessment --a general guide  

E-Print Network [OSTI]

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . > If symptoms are persisting, please complete an Incident Notification Form at https://policies.anu.edu.au/ppl

Botea, Adi

207

Use of post-Chernobyl data from Norway to validate the long-term exposure pathway models in the accident consequence code MACCS  

SciTech Connect (OSTI)

This paper describes a task performed for the US Nuclear Regulatory Commission (NRC), consisting of using post-Chernobyl data from Norway to verify or find areas for possible improvement in the chronic exposure pathway models utilized in the NRC's program for probabilistic risk analysis, level 3, of the MELCOR accident consequence code system (MACCS), developed at Sandia National Laboratories, Albuquerque, New Mexico. Because of unfortunate combinations of weather conditions, the levels of Chernobyl fallout in parts of Norway were quite high, with large areas contaminated to more than 100 kBq/m[sup 2] of radioactive cesium. Approximately 6% of the total amount of radioactive cesium released from Chernobyl is deposited on Norwegian territory, according to a countrywide survey performed by the Norwegian National Institute for Radiation Hygiene. Accordingly, a very large monitoring effort was carried out in Norway, and some of the results of this effort have provided important new insights into the ways in which radioactive cesium behaves in the environment. In addition to collection and evaluation of post-Chernobyl monitoring results, some experiments were also performed as part of the task. Some experiments performed pre-Chernobyl were also relevant, and some conclusions could be drawn from these. In most connections, the data available show the models and data in MACCS to be appropriate. A few areas where the data indicate that the MACCS approach is inadequate are, however, also pointed out in the paper.

Tveten, U. (Inst. for Energiteknikk, Kjeller (Norway))

1994-03-01T23:59:59.000Z

208

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

209

DEPARTMENT OF MEDIA AND COMMUNICATION UNIVERSITETET OF OSLO  

E-Print Network [OSTI]

and Cyberway Pte Ltd.) ADSL Asymmetric Digital Subscriber Line AFI The ASEAN Forum on the Internet ASEAN

Løw, Erik

210

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet  

E-Print Network [OSTI]

+ 7y antar p°a D? Fmax = 132 Fmax = 140 Fmax = 136 6) Funksjonen f(x) = cax, der c og a er reelle tall

Løw, Erik

211

Atmos. Chem. Phys., 12, 69997014, 2012 www.atmos-chem-phys.net/12/6999/2012/  

E-Print Network [OSTI]

- tation of vertical BC load is important because the climate effects of the aerosols depend (BC) aerosols have received increasing atten- tion as a contributor to climate warming. BC can. Berntsen1,2 1CICERO ­ Center for International Climate and Environmental Research, Oslo, Norway 2Department

Meskhidze, Nicholas

212

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark E. coli pangenomics - or - How to compare hundreds of E. coli genomes Fuzzy Dave Ussery UllevĂĽl Universitetssykehus Oslo, Norway Wednesday, 10 December, 2008 #12;Comparative Microbial Genomics group Centerfor

Ussery, David W.

213

The use of genome wide association methods to investigate pathogenicity, population structure and serovar in Haemophilus parasuis  

E-Print Network [OSTI]

, Hinxton, Cambridge CB10 1SA, UK 5 Norwegian Veterinary Institute, N-0106 Oslo, Norway 6 Centre de Recerca en Sanitat Animal (CReSA), UAB-IRTA, Campus de la Universitat Autňnoma de Barcelona, 08193, Bellaterra, and Institut de Recerca i Tecnologia...

Howell, Kate J; Weinert, Lucy A; Chaudhuri, Roy R; Luan, Shi-Lu; Peters, Sarah E; Corander, Jukka; Harris, David; Angen, Řystein; Virginia, Aragon; Bensaid, Albert; Williamson, Susanna M.; Parkhill, Julian; Langford, Paul R; Rycroft, Andrew N; Wren, Brendan W.; Holden, Matthew T.; Tucker, Alexander W.; Maskell, Duncan J.

2014-12-24T23:59:59.000Z

214

TREE vol. 15, no. 10 October 2000 0169-5347/00/$ see front matter 2000 Elsevier Science Ltd. All rights reserved. PII: S0169-5347(00)01956-X 393 NEWS & COMMENT  

E-Print Network [OSTI]

of energy and multiple chemical elements [e.g. carbon (C), ni- trogen (N) and phosphorus (P)] in ecologi (University of Oslo, Norway) and soil ecologist Jan Bengtsson (Swedish Uni- versity of Agricultural Sciences, insect biology, forest ecology and soil biology. A mix of empirical and theoretical findings

Elser, Jim

215

HYDROLOGICAL PROCESSES Hydrol. Process. 23, 4261 (2009)  

E-Print Network [OSTI]

. Fountain,4 K. Stahl,5 K. Holm6 and M. Jakob6 1 Department of Geography and Department of Forest Resources University, USA 5 Department of Geosciences, University of Oslo, Norway 6 BGC Engineering, Vancouver, Canada autumn. Glaciers represent a substantial source of renewable energy, contribute to the sustain- ability

Fountain, Andrew G.

216

ESTABLISHING THE LINK BETWEEN AMMONIA EMISSION CONTROL AND MEASUREMENTS OF REDUCED NITROGEN  

E-Print Network [OSTI]

, Slovakia; 10 Swiss Agency for the Environment, Forest and Landscape (SAEFL), Air Pollution Control Division Norwegian Meteorological Institute (DNMI), Blindern, Oslo, Norway; 13 Swiss Federal Research Station of Agroecology and Agriculture (FAL), Bern-Liebefeld, Switzerland; 14 Energie Centrum Nederland (ECN), Petten

Aneja, Viney P.

217

Boundary-Layer Meteorol DOI 10.1007/s10546-014-9914-6  

E-Print Network [OSTI]

dispersion model that includes time variations of the turbulent kinetic energy dissipation rate is proposed is consistent with field measurements inside a pine forest and with published dissipation rate measurements Institute for Air Research (NILU), Oslo, Norway 123 #12;T. Duman et al. 1 Introduction High Reynolds

Katul, Gabriel

218

ORIGINAL RESEARCH ARTICLE published: 19 July 2012  

E-Print Network [OSTI]

, Seattle, WA, USA 2 Graduate School of Oceanography and Center for Dark Energy Biosphere Investigations, University of Rhode Island, Narragansett, RI, USA 3 Norwegian Institute for Water Research, Oslo, Norway 4 in marine sediments (Thamdrup and Dalsgaard, 2002) and the water column (Dalsgaard et al., 2003; Kuypers et

Murray, James W.

219

Progress in Nuclear Energy 53 (2011) 618 625 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

Progress in Nuclear Energy 53 (2011) 618 625 Contents lists available at ScienceDirect Progress in Nuclear Energy journal homepage: www.elsevier.com/locate/pnucene Comparison of thorium-based fuels Fhager a , Christophe Demazière b a Thor Energy, Sommerrogaten 13 15, NO-0255 Oslo, Norway b Chalmers

Demazière, Christophe

220

http://jab.sagepub.com The Journal of Applied Behavioral Science  

E-Print Network [OSTI]

: Case Study From Mozambique An Institutional Perspective on Health Sector Reforms and the Process. / CASE STUDY FROM MOZAMBIQUE An Institutional Perspective on Health Sector Reforms and the Process Sahay University of Oslo, Norway Health sector reform, including structural and process changes

Sahay, Sundeep

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

The Astrophysical Journal, 743:14 (19pp), 2011 December 10 doi:10.1088/0004-637X/743/1/14 C 2011. The American Astronomical Society. All rights reserved. Printed in the U.S.A.  

E-Print Network [OSTI]

atmosphere and can be important with respect to the transfer of mass and energy dumping. Solar-DIMENSIONAL SOLAR ATMOSPHERE TO WAVE-DRIVEN JETS E. Scullion1,2 , R. Erd´elyi2 , V. Fedun2 , and J. G. Doyle3 1 Institute of Theoretical Astrophysics, University of Oslo, Norway; eamonms@astro.uio.no 2 Solar Physics

222

5, 10751099, 2014 Uncertainty in crop  

E-Print Network [OSTI]

Resources and Energy Directorate, Oslo, Norway 16 International Institute for Applied System Analysis, New York, USA 24 Institute for Sustainable Economic Development, Vienna, Austria 25 Max Planck of Bonn, Bonn, Germany 28 Santa Fe Institute, Santa Fe, New Mexico, USA Received: 28 July 2014 ­ Accepted

Levermann, Anders

223

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

224

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

225

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

226

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

227

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

228

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

229

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

230

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

231

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

232

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

233

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

234

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

235

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

236

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

237

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

238

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

239

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

240

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

242

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

243

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

244

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

245

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

246

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

247

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

248

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

249

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

250

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

251

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

252

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

253

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

254

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

255

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

256

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

257

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

258

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

259

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

260

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

262

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

263

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

264

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

265

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

266

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

267

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

268

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

269

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

270

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

271

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

272

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

273

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

274

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

275

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

276

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

277

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

278

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

279

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

280

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

282

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

283

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

284

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

285

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

286

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

287

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

288

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

289

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

290

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

291

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

292

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

293

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

294

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

295

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

296

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

297

Osseo, Minnesota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty,Orleans County, Vermont: EnergyThis articleOslo, Norway:

298

Ossining, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty,Orleans County, Vermont: EnergyThis articleOslo, Norway:Ossian,

299

everythingHighlights from the University of Oslo's annual report 2013  

E-Print Network [OSTI]

O should develop into one of Europe's best uni- versities and act as an academic powerhouse, a strategic

Løw, Erik

300

U.S. LNG Imports from Norway  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelinesProved ReservesFeet)per Thousand28 198 18 Q 10OriginSep-14InternationalNoyes,

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

U.S. LNG Imports from Norway  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelinesProved ReservesFeet)per Thousand28 198 18 Q 10OriginSep-14InternationalNoyes,Noyes, MN

302

Lignin studies of transgenic Norway spruce.  

E-Print Network [OSTI]

??An attractive objective in tree breeding is to reduce the content of lignin, or increase its extractability, to favor delignification during pulping. This study investigates… (more)

Wadenbäck, Johan

2006-01-01T23:59:59.000Z

303

Norway: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwest Basin and RangeNorvento USA LLC Jump

304

Ossian, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty,Orleans County, Vermont: EnergyThis articleOslo, Norway:Ossian, New

305

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

306

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

307

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

308

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

309

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

310

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

311

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

312

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

313

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

314

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

315

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

316

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

317

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

318

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

319

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

320

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

322

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

323

FACULTY OF HUMANITIES DEAN: PROFESSOR T KUPE BA Hons MA (Zimbabwe) PhD (University of Oslo)  

E-Print Network [OSTI]

) Doctor of Philosophy CHETTY-MAKKAN, Candice Maylene Psychology Thesis: Fetal alcohol spectrum disorder, motivation and behavioural skills (IMB) model for targeting HIV risk behaviour among adolescent learners Philosophy Dissertation: On the antinomy of suicide with special consideration of the Schopenhauerian

Wagner, Stephan

324

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

325

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

326

atlantic troms norway: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

hydropower resource is not a new subject of study however with growing concern over both energy in this area. Lehner et al. (2005) conducted European scale hydrological modelling...

327

atomenergi norway 21st: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CENTURY Engineering Websites Summary: reinforcement. This problem is more serious in cold climate countries, where de-icing salts accelerate of these materials for the 21st...

328

Poster Session Roster: Page 1 of 3 From Norway  

E-Print Network [OSTI]

in Supercapacitors Rice James Tour zhiwei.peng@rice.edu #12;Poster Session Roster: Page 3 of 3 From Texas Last Name

329

Microsoft Word - CX-Coos-CurryNorwaySubstation_WEB.doc  

Broader source: Energy.gov (indexed) [DOE]

1 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Shari Sundeen Public Utilities Specialist - TPC-TPP-4 Proposed Action: Line and load interconnection of...

330

Norway-Indonesia-Forest Management Agreement | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN) |Agny JumpNational Marine

331

0RGHOEDVHG ULVN DVVHVVPHQW WKH &25$6 DSSURDFK .HWLO 6WOHQ1  

E-Print Network [OSTI]

commercial companies: Intracom (Greece), Solinet (Germany) and Telenor (Norway); seven research institutes: CTI (Greece), FORTH (Greece), IFE (Norway), NCT (Norway), NR (Norway), RAL (UK) and Sintef (Norway

Stølen, Ketil

332

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

333

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

334

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

335

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

336

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

337

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

338

The Gulf Investment Framework, 20102025: Opportunities, Limitations, and Risks  

E-Print Network [OSTI]

research programme based at the University of Oslo Regardless of discoveries of "new" energy suppliers

Løw, Erik

339

E-Print Network 3.0 - analysis nukleaere virksomheter Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Mathematics 49 Passivhus Norden 2008 1st Nordic passive house conference Summary: ......

340

Certainty in Timing of Death: A New Analysis of Shifting Mortality and Life Span Disparity  

E-Print Network [OSTI]

Continued on next page Country Netherlands Norway Swedenon next page Total Italy Total Netherlands Total Norway

Zureick, Sarah Marie

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

342

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

343

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

344

The Consortium The CORAS consortium consists  

E-Print Network [OSTI]

), - Solinet (Germany) and - Telenor (Norway); seven research institutes: - CLRC/RAL (UK), - CTI (Greece), - FORTH (Greece), - IFE (Norway), - NST (Norway), - NR (Norway) and - SINTEF (Norway); as well as one

Stølen, Ketil

345

The Taming of Two Alley CATs D. Recoskie  

E-Print Network [OSTI]

Canada, Norway, and Switzerland), Canada - 2 wins (beat Norway and Switzerland, Switzerland - 1 win (beat Norway), Norway - 0 wins. The increasing sequence corresponding to this outcome is 0123 (Norway

Sawada, Joe

346

E-Print Network 3.0 - ab initio g-tensor Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

i Oslo Collection: Physics ; Chemistry 8 imageslogoetsf Introduction Electron Energy Loss Spectroscopy Applications: Nanotubes and Graphene Perspectives Summary:...

347

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

348

Periodic Activity report month 25-36 Version 1 April 2008  

E-Print Network [OSTI]

monoxide (CO), all models, but OSLO CTM2 using POET emissions, significantly underestimate the values stratosphere (Fig. 2.3.1). In contrast, OSLO CTM2 (POET) agrees well in the upper troposphere and seasonally varying biases. During summer, all models (except OSLO CTM2 (POET)) underestimate observed CO

Haak, Hein

349

Russia and Norway in the High North. : Petroleum, Security and the Room of Manoeuvre.  

E-Print Network [OSTI]

??The High North has the potential to become a new and promising oil and gas region. Though large areas of the High North remain unexplored,… (more)

Alagic, Ajla

2009-01-01T23:59:59.000Z

350

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

incentives given by transmission pricing form the foundationhas focussed on transmission pricing, monopoly regulation,

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris

1999-01-01T23:59:59.000Z

351

The Welfare Implications of Oil Privatisation: A Cost-Benefit Analysis of Norway's Statoil  

E-Print Network [OSTI]

of corporate performance and efficiency, and to consider the welfare of all relevant stakeholders including consumers, government and employees. To do so, SCBA contrasts t he factual scenario (what happened?) with a plausible counterfactual (what would have... in 2001, and to investigate the distribution of costs and benefits among government, producers and consumers. Statoil is a suitable case study within the oil and gas industry – its corporate performance improvement during privatisation was below...

Wolf, C; Pollitt, Michael G.

352

ENROLLED WSU UNDERGRADUATE INTERNATIONAL STUDENTS 1 Argentina 1 35 Norway 1  

E-Print Network [OSTI]

and Tobago 1 17 Isle of Man 1 51 United Arab Emirates 3 18 Italy 1 52 United Kingdom 12 19 Japan 85 53

Collins, Gary S.

353

Public private equity : an evaluation of public early stage risk capital initiatives in Norway  

E-Print Network [OSTI]

Access to finance limits the ability to grow for many early stage ventures. To mitigate this limitation, the Norwegian State has initiated seed funds partly financed by public funds. The funds carried out many investments ...

Oeby, Simen Berger

2014-01-01T23:59:59.000Z

354

Quality of Supply in Energy Regulation Measurement,Assessment and Experience from Norway  

E-Print Network [OSTI]

  added,  i.e.  a  linear  correlation  is  seen  between  the  electricity  consumption of these sectors and economic output. This ratio therefore forms an  upper bound for the energy not supplied.    A  similar approach  for  the calculation of  the... in the perforrnace of the Norwegian electricity distribution utilities. Contact c.growitsch@wik.org Publication July 2009 Financial Support www.eprg.group.cam.ac.uk Quality of Supply in Energy Regulation Measurement, Assessment...

Growitsch, Christian; Jamasb, Tooraj; Mueller, C; Wissner, M

355

DOE Study Monitors Carbon Dioxide Storage in Norway's Offshore Sleipner Gas  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomentheATLANTA, GA - U.S. Department ofThe U.S.D.C. - Energy Secretary Samuel W.Field

356

Price of Cove Point, MD Natural Gas LNG Imports from Norway (Dollars per  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per(NominalThousandThousand

357

Price of Cove Point, MD Natural Gas LNG Imports from Norway (Dollars per  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per(NominalThousandThousandThousand

358

U.S. Liquefied Natural Gas Imports From Norway (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteamYearTexas--StateWinter 2013-14 Wells (ThousandYear JanDecade Year-0

359

U.S. Liquefied Natural Gas Imports From Norway (Million Cubic Feet)  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteamYearTexas--StateWinter 2013-14 Wells (ThousandYear JanDecade Year-0Year

360

Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars per  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in NonproducingAdditions to Capacity on theThousand Cubic Feet)Thousand Cubic

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Lignin biosynthesis in Norway spruce: from a model system to the tree.  

E-Print Network [OSTI]

??Lignin is a hydrophobic polymer that is synthesised in the secondary cell walls of all vascular plants. It enables water conduction through the stem, supports… (more)

Koutaniemi, Sanna

2007-01-01T23:59:59.000Z

362

Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars per  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998throughThousand Cubic Feet)ThousandThousand CubicThousand Cubic

363

Sabine Pass, LA Liquefied Natural Gas Imports From Norway (Million Cubic  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet)Chile (Million

364

Sabine Pass, LA Natural Gas LNG Imports (Price) From Norway (Dollars per  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet)Chile (MillionFeet)

365

Sabine Pass, LA Natural Gas LNG Imports (Price) From Norway (Dollars per  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet)Chile

366

Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Norway  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 633 622 56623 4623 42Year Jan Feb Mar Apr May(Million

367

Freeport, TX LNG Imports (Price) from Norway (Dollars per Thousand Cubic  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 1 0 0 0Thousand Cubic

368

Freeport, TX LNG Imports (Price) from Norway (Dollars per Thousand Cubic  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 1 0 0 0Thousand CubicFeet) Year Jan Feb

369

Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars per  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30 2013 Macroeconomicper8,170Thousand CubicThousand Cubic Feet)Thousand

370

U.S.-Norway Conference Focuses on Advancing Carbon Capture and Storage |  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomenthe House Committee on EnergyEnergyTheUnited States and Israel participate

371

U.S. Liquefied Natural Gas Imports From Norway (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007York"Hawaii" "Sector", (Million CubicAdjustments7-2015Decade Year-0 Year-1

372

Stephen N. Ehrenberg $ StatoilHydro, N-9481, Harstad, Norway; present address  

E-Print Network [OSTI]

; tas@statoilhydro.com Tore received his Candidatus Scientiarium de- gree in geology at the University of marine geology and geophysics in the Rosenstiel School of Marine and Atmospheric Sciences. His versions of this article. Uranium depletion across the Permian­Triassic boundary in Middle East carbonates

Miami, University of

373

WHO Report on the Global Tobacco Epidemic 2011: Warning about the dangers of tobacco  

E-Print Network [OSTI]

Kuwait, Madagascar, Montenegro, Myanmar, Niger, Norway,Luxembourg Malta Monaco Montenegro Netherlands Norway PolandLuxembourg Malta Monaco 7 Montenegro Netherlands Norway

WHO

2011-01-01T23:59:59.000Z

374

Soviet Children's Flags  

E-Print Network [OSTI]

Nation in Con- temporary Norway”, Childhood 4 #1 (1997), pp.and blue flags (France and Norway). Older children typicallystudying nationalism in Norway observed that “the assumption

Platoff, Anne M.

2010-01-01T23:59:59.000Z

375

Quarrying and Mining (Stone)  

E-Print Network [OSTI]

Geological Survey of Norway Special Publication 12.Geological Survey of Norway. American Geological InstituteGeological Survey of Norway. (INCO-CT-2005- 015416-Project

Bloxam, Elizabeth

2010-01-01T23:59:59.000Z

376

Ornamental Stones  

E-Print Network [OSTI]

Geological Survey of Norway, Special Publication 12, ed.Geological Survey of Norway, Special Publication 12, ed.Geological Survey of Norway, Special Publication 12, ed.

Harrell, James A.

2013-01-01T23:59:59.000Z

377

Utilitarian Stones  

E-Print Network [OSTI]

Geological Survey of Norway, Special Publication 12, ed.Geological Survey of Norway, Special Publication 12, ed.Geological Survey of Norway, Special Publication 12, ed.

Harrell, James A.

2012-01-01T23:59:59.000Z

378

Cross-National Differences in Attitudes towards Homosexuality  

E-Print Network [OSTI]

Japan, the Netherlands, Norway, Portugal, and Sweden). Noapproval in all years and Norway was second in 1998 andwith Denmark second, Norway third, Sweden seventh, and

Smith, Tom W.

2011-01-01T23:59:59.000Z

379

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

380

A r c t i c Barents Sea  

E-Print Network [OSTI]

Ri Vychegda R U S S I AC A N A D A U.K.IRE. ICELAND NORWAY SWEDEN FINLAND LATVIA LITH. BELARUS UKRAINE POLAND DENMARK GERMANY EST. KAZ. JAPAN (DENMARK) Greenland (NORWAY) Svalbard (NORWAY) (NORWAY) CHINA UNITED

Martin, Jeff

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Technical Report TR_003 Technical report produced for  

E-Print Network [OSTI]

........................................................................................................12 3.2.5 Norway pout .......................................................................................................17 3.2.15 Norway lobster (Nephrops norvegicus).....................................................17

382

Building Stones  

E-Print Network [OSTI]

Geological Survey of Norway, Special Publication 12, ed.Geological Survey of Norway, Special Publication 12, ed.

2012-01-01T23:59:59.000Z

383

Divide and Conquer Towards a Notion of Risk Model Encapsulation  

E-Print Network [OSTI]

, Bjřrnar Solhaug1 , and Ketil Střlen1,3 1 SINTEF ICT, Norway 2 Oilfield Technology Group, Norway 3 Dep

Střlen, Ketil

384

E-Print Network 3.0 - av straalsaekerhetsmyndighetens regler...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ingen regler. Du m ikke gjre... , for eksempel langt mer avansert utnyttelse av solenergi. Her er jeg ... Source: Lw, Erik - Matematisk institutt, Universitetet i Oslo...

385

Bibliography (in the on-line pdf version the html links are live only where  

E-Print Network [OSTI]

Kurdistan. Universitetes Etnologiske Museum Bulletin 7, Oslo. ------. 1954. Father's brother's daughter in Kurdistan. Southwestern Journal of Anthropology 10: 164-171. ------. 1960. Ethnic Groups and Boundaries

White, Douglas R.

386

Bibliography (the html links are live in the on-line pdf version)  

E-Print Network [OSTI]

. Principles of Social Organization in Southern Kurdistan. Universitetes Etnologiske Museum Bulletin 7, Oslo. ------ 1954. Father's Brother's Daughter in Kurdistan. Southwestern Journal of Anthropology 10:164-171. #12

White, Douglas R.

387

E-Print Network 3.0 - abstract stochastic equation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

< 1 2 3 4 5 > >> 1 Swansea University Wales Institute for Mathematical Department of Mathematics and Computational Sciences Summary: ksendal (Oslo) Backward stochastic...

388

The Value of Small-Scale Projects in Biodiversity Conservation and Sustainable Rural Development in the Ecuadorian Chocó  

E-Print Network [OSTI]

Ecotourism and Sustainable Development: Who Owns Paradise?Biodiversity for Sustainable Development. Oslo: ScandinavianConservation and Sustainable Development. Washington D.C. :

Fernández, Sarah Haidée

2013-01-01T23:59:59.000Z

389

ADVANCED ELECTRON BEAM TECHNIQUES FOR METALLIC AND CERAMIC PROTECTIVE COATING SYSTEMS  

E-Print Network [OSTI]

cobalt and chromium. Ceramic or thermal barrier coatings canin fuel usage. Also, ceramic or thermal barrier coatings~n Oslo developed ceramic or thermal barrier coatings that

Boone, Donald H.

2013-01-01T23:59:59.000Z

390

E-Print Network 3.0 - age ten-year retrospective Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oslo Collection: Computer Technologies and Information Sciences 25 Endangered Species Act Section 7(a)(2) Consultation Biological Opinion and Magnuson-Stevens Fishery Summary: for...

391

E-Print Network 3.0 - assurance implementation plan Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection: Computer Technologies and Information Sciences 14 Quality system for the educational activities at the University of Oslo (last update 6 July 2010) QUALITY ASSURANCE...

392

E-Print Network 3.0 - astrid haljas romi Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Erik - Matematisk institutt, Universitetet i Oslo Collection: Mathematics 7 School of Architecture, civil And environmentAl engineering Summary: Ies5 (last) StAUFER Astrid --...

393

E-Print Network 3.0 - application od aster Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Oslo P.O. Box... and internal structure of such slope instabilities. Application schemes that combine and exemplify Source: Kb, Andreas - Department of Geosciences,...

394

E-Print Network 3.0 - atlas construction site Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

institutt, Universitetet i Oslo Collection: Biology and Medicine 14 WIND ATLAS FOR EGYPT: MEASUREMENTS, MICRO-AND MESOSCALE MODELLING Summary: WIND ATLAS FOR EGYPT:...

395

Solar Heating in Norwegian Passive Houses : A Case Study of two Passive Houses Heated by Solar Collector and Heat Pump.  

E-Print Network [OSTI]

??To like, nybygde passivhus i Oslo ble undersřkt for ĺ se hvor energieffektive de var. Det ene ble varmet opp med solenergi, det andre med… (more)

Murtnes, Espen

2013-01-01T23:59:59.000Z

396

E-Print Network 3.0 - aa redusere sannsynligheten Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Mathematics 40 Passivhus Norden 2008 1st Nordic passive house conference Summary: elevforsk br derfor ikke reduseres i forhold til...

397

E-Print Network 3.0 - amphibolites Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Geosciences 38 Phase-equilibrium constraints on titanite and rutile activities in mafic epidote amphibolites and geobarometry using...

398

Comparison Between the Continuous Commissioning Process and Methods Used for Energy Efficiency in Norway - Results from a Case Study  

E-Print Network [OSTI]

Energy audit The energy audit process is described in /1/: 1. Collect all relevant information about building and facilities 2. Obtain information about current energy use, and cost for energy 3. Identify obvious profitable projects 4. Detailed... in several ways but a typical process can include the following steps: 1. Collect all relevant information about the energy supply system, existing energy consumption, building and facilities 2. Subdivide the building according to different use...

Novakovic, V.; Stang, J.; Skjerven, E.; Holst, J.

2004-01-01T23:59:59.000Z

399

How do firms promote stability in an evolving technological system? : The case of second generation biofuels in Norway.  

E-Print Network [OSTI]

??This thesis aims to increase the understanding of the formative phase of an evolving technological innovation system (TIS) related to second generation (2G) biofuels in… (more)

Blomberg, Line Elisabeth

2008-01-01T23:59:59.000Z

400

BULLETIN OF THE UNITED STATES FISH COMBIISSICln'. 75 of salmon. Experiments made in Norway and elsewhere ]lare shown  

E-Print Network [OSTI]

hunclred yards from shore, and in a few hours aere as sure of catching a few hundred pounds #12;76 BULLETIN

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

6th International Conference on CFD in Oil & Gas, Metallurgical and Process Industries SINTEF/NTNU, Trondheim NORWAY  

E-Print Network [OSTI]

INTRODUCTION The efficiency of gas-liquid rectors like bubble columns, air-lift or agitated stirred reactors. Especially in case of fast reactions the effi- ciency of chemical reactors significantly depends on the mass6th International Conference on CFD in Oil & Gas, Metallurgical and Process Industries SINTEF

Bothe, Dieter

402

Health consequences of Chernobyl disaster in Europe in general and in Norway in particular. Literature review and ecological study.  

E-Print Network [OSTI]

??Health costs of Chernobyl disaster are still not clear.Main goal of this paper therefore is to investigate health consequences of Chernobyl disaster in Europe (outside… (more)

Fedorov, Roman

2012-01-01T23:59:59.000Z

403

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

404

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

405

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

406

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

407

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database  https://github.com/solarpermit/solarpermit/archive/devel.zip 

408

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

409

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

410

Ris-R-1243(EN) Radiological Assessment of Past,  

E-Print Network [OSTI]

Protection Authority, Norway 4) G. Christensen, Institute of Energy Technology, Norway 5) B. Salbu, Agricultural University of Norway, Norway Risø National Laboratory, Roskilde December 2000 #12;Abstract Radiation Protection Authority (NRPA), Agricultural University of Norway (AUN) and Institute of Energy

411

Snow Avalanches in a Nutshell: A Brief Phenomenology for Non-Specialists  

E-Print Network [OSTI]

, western Norway, 2005-06-21 Photo K. Kristensen, NGI #12;Tystigen, western Norway, 2005-06-21 Photo K. Kristensen, NGI #12;Tystigen, western Norway, 2005-06-21 Photo K. Kristensen, NGI #12; Sliding wet

Tradacete, Pedro

412

Essays on International Finance and Trade  

E-Print Network [OSTI]

Turkey UK Canada Mexico Norway Obs. Mean Std. Dev. Min MaxForecast horizon Canada Norway Mexico Turkey MSE MAE DIR MSEForecast horizon Canada Norway Mexico Turkey MSE MAE DIR MSE

Zeng, Li

2009-01-01T23:59:59.000Z

413

Inducing Information Structures for Data-driven Text Analysis Andrew Salway  

E-Print Network [OSTI]

N-5008 Bergen Norway andrew.salway@uni.no Samia Touileb University of Bergen N-5020 Bergen Norway samia.touileb@gmail.com Endre Tvinnereim Uni Research Rokkansenteret N-5015 Bergen Norway endre

Salway, Andrew

414

Postscript - Optimization Online  

E-Print Network [OSTI]

norway-DBM. 831. 2754. 84836.5925. 333307.2. 383890. norway-UUE. 804. 2652. 162715.395. 412130.1817. 452680. norway-UUM. 753. 2652. 162715.395

Christian Raack,,,

415

Memento Mundi: Are Virtual Worlds History?  

E-Print Network [OSTI]

Spaight, T. 2003. “Who Killed Miss Norway? ” Salon (14 Aprilkill ed_miss_norway/index.htmlretrieved, Feb. 2009.Legend MUD. A former Miss Norway, she was killed in a car

Lowood, Henry

2009-01-01T23:59:59.000Z

416

av norges fiskerihgskole: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

i Norge. Open Access Theses and Dissertations Summary: ??Establishment of PETCT in Norway Background: The first dedicated PETCT-scanner in Norway was installed at...

417

arrangert av norges: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

i Norge. Open Access Theses and Dissertations Summary: ??Establishment of PETCT in Norway Background: The first dedicated PETCT-scanner in Norway was installed at...

418

AFTER A Framework for electrical power sysTems vulnerability...  

Open Energy Info (EERE)

Norway) Jump to: navigation, search Project Name AFTER A Framework for electrical power sysTems vulnerability identification, dEfense and Restoration Country Norway Coordinates...

419

E-Print Network 3.0 - adult rats effects Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in Norway rats and von Frisch's (1967) extraordinary demonstrations of social effects on food selection... observed that Norway rats born to a colony whose adults had learned to...

420

Essays on International Finance and Trade  

E-Print Network [OSTI]

LHS) Domestic real oil price Mexico Figure-2. Domestic Realcountries, Norway and Mexico, the oil-price exchange rateboth pure oil- exporting countries, Norway and Mexico, are

Zeng, Li

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Laboratory measurements on core-scale sediment/hydrate samples to predice reservoir behavior  

E-Print Network [OSTI]

International Conference on Gas Hydrates, Trondheim, Norway,coring of near-surface gas hydrate sediments on HydrateInternational Conference on Gas Hydrates, Trondheim, Norway,

Kneafsey, Timothy J.; Seol, Yongkoo; Moridis, George J.; Tomutsa, Liviu; Freifeld, Barry M.

2008-01-01T23:59:59.000Z

422

E-Print Network 3.0 - als3p protects mice Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to mice and rats. In Utah, house mice (Mus musculus) and Norway rats (Rattus... of house mice and Norway rats. House mice are ... Source: Berryman Institute, Department of...

423

E-Print Network 3.0 - acyltransferase-2 protects mice Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Utah, house mice (Mus musculus) and Norway rats (Rattus... of house mice and Norway rats. House mice are ... Source: Berryman Institute, Department of Fisheries and Wildlife, Utah...

424

An explanation of infrared catastrophe of 1/f power spectra Simula Research Laboratory, P. O. Box. 134, 1325 Lysaker, Norway (wenc@simula.no)  

E-Print Network [OSTI]

physical energy) attenuation (1) and the frequency power law (2), #12;which lie on the solid underpinningAn explanation of infrared catastrophe of 1/f power spectra W. Chen Simula Research Laboratory, P between the 1/f power spectra and the acoustic frequency power law dissipation and, accordingly, presents

425

Yngve Kristoffersen, University of Bergen, Allegaten 41, Bergen, 5007 Norway, yngve.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany  

E-Print Network [OSTI]

.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Lomonosov Canada Basin Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Richard Blenkner, Dept

Kristoffersen, Yngve

426

Building new power plants in a CO2 constrained world: A Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and  

E-Print Network [OSTI]

consumption per capita in the world, with demand on the rise at about 2% per year. Consequently electricity of Development in the government led by Mr. Bondevik, Member of the Norwegian Parliament; Ă?yvind SlĂĽke, political Minister Kjell Magne Bondevik's minority government resigned over a disagreement with the opposition about

427

Evaluation of the Nordland Group overburden as an effective seal for the Sleipner CO2 storage site (offshore Norway) using analytical and stochastic modelling techniques   

E-Print Network [OSTI]

Saline aquifers and depleted hydrocarbon fields situated beneath the North Sea are currently being proposed as storage repositories for anthropogenic CO2 captured from point source emitters in the UK and mainland Europe. ...

Nicoll, Grant Douglas

2012-11-29T23:59:59.000Z

428

China Energy Databook -- User Guide and Documentation, Version 7.0  

E-Print Network [OSTI]

Mexico Mongolia Morocco Mozambique Nepal Netherlands New Zealand Nicaragua Nigeria Norway Oman Pakistan Panama Coal &

Fridley, Ed., David

2008-01-01T23:59:59.000Z

429

A 4D synchrotron X-ray tomography study of the formation of hydrocarbon migration pathways in heated organic-rich shale  

E-Print Network [OSTI]

. Institute for Energy Technology, Kjeller, Norway Abstract Recovery of oil from oil shales and the natural

Boyer, Edmond

430

Computer Science at Kent Second European Workshop on Model  

E-Print Network [OSTI]

Griffin, IBM, UK Sune Jakobsson, Telenor, Norway Belaunde Mariano, France Telecom, France Ian Oliver

Kent, University of

431

E-Print Network 3.0 - automatisk hjernestammeaudiometri og Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Matematisk institutt, Universitetet i Oslo Collection: Mathematics 5 RisNyt NO2 2005 1313 Demand response er som at kbe benzin Summary: , som kan handle p elbrsen. Et...

432

Hypercholesterolemia and dietary compliance  

E-Print Network [OSTI]

cholesterol response include the Oslo Heart Study, the Leiden Intervent. ion Trial, the North Karelia, Finland Study, and more (16, 25). Certainly, dietary fat and cholesterol are not the only nutrients involved in the manifestation of CHD. Re- search has...

Person, Judith Fredricka

1988-01-01T23:59:59.000Z

433

Reuse the muse : the museum as a transcultural negotiator of national identity  

E-Print Network [OSTI]

The project proposes a museum that acts as public infrastructure, situated across the boundary between east and west Oslo. The architecture of the museum is a continuous linear element that acts as a bridge through the ...

Dykxhoorn, Lee (Lee Marinus)

2011-01-01T23:59:59.000Z

434

Kaon and Pion Production in Central Au+Au Collisions at sNN = 62.4 GeV$  

E-Print Network [OSTI]

Universit´e de Strasbourg, Strasbourg, France cInstitute of Space Science,Bucharest-Magurele, Romania dUniversity of Bucharest, Romania jUniversity of Kansas, Lawrence, Kansas, USA kUniversity of Oslo, Department of Physics

435

Production of ATLAS silicon detector modules Report from the Scandinavian Cluster  

E-Print Network [OSTI]

This document describes the assembly and quality assurance of Semi Conductor Tracker (SCT) barrel modules performed by the Scandinavian Cluster. The project has been carried out as a joint effort between University of Bergen, University of Oslo and Uppsala University.

Johansen, L G; Solberg, A O; Stugu, B; Oye, O K; Dorholt, O; Huse, T; Stapnes, S; Bingefors, N; Brenner, R; Ehn, S; Ekelöf, T J C; Eklund, L; Lindquist, L E

2006-01-01T23:59:59.000Z

436

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada ...

437

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

438

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

439

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

440

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

442

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

443

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

444

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

445

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

446

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

447

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

448

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

449

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

450

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

451

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

452

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

453

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

454

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

455

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

456

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

457

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

458

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

459

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

460

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

463

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

464

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

465

affect foreign bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

466

allied irish bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

467

affects higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...

468

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

469

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

470

Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

471

Wind: wind power density maps at 50 m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

472

Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

473

Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

474

Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

475

Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

476

Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

477

STUDENT / PARENT INFORMATION MAIL DELIVERY ON CAMPUS The information below provides the basic information you need to send and receive United States  

E-Print Network [OSTI]

West Street Address (if applicable) 522 Thurstin Ave. Bowling Green State University Bowling Green State University City, State and Zip Code Bowling Green, OH 43403-4603 Please note that BGSU has its own zip code, 43403, which is unique from the city of Bowling Green (43402). Please ensure to include

Moore, Paul A.

478

Reference Buildings by Building Type: Secondary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

479

Reference Buildings by Building Type: Primary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

480

Sandia Group Medicare Advantage Plan Enrollment Form Senior Advantage Health Plan Choices (Choose One)  

E-Print Network [OSTI]

Home Phone: Cell: E-Mail Address: Permanent Residence Address: City: State: Zip Code: County: Mailing Address (only if different from your Permanent Residence Address): City: State: Zip Code: County drug coverage, including other private insurance, TRI- CARE, Federal employee health benefits coverage

Fuerschbach, Phillip

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

2011 ODU Game Development Summer Camp Registration Form Child's Name Date of Birth Sex  

E-Print Network [OSTI]

Contacts Primary Emergency Contact Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work or Cell Phone Home Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information's/Guardian's Name Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work Phone Home Phone Work Phone Address Address

482

Finance Division Employee Status Form Finance Division  

E-Print Network [OSTI]

's Date: Employee Name: Home Address: City/State: Zip/Postal Code: Work Phone Home Phone: Cell Phone Phone: Work Phone: Cell Phone: Relationship: Name (2): Address: State/Province: Zip/Postal Code: Home Phone: Work Phone: Cell Phone: Relationship: Special Notes: Department New Employee Resignation Change

Crews, Stephen

483

University of Washington Transplant Services Rev. 5/23/02  

E-Print Network [OSTI]

.: City: State: Country: Zip Code: - Home Phone: Work Phone: Ext.: Cell Phone: Home Phone: Cell phone: Work Phone: DEMOGRAPHIC INFORMATION LIVING KIDNEY DONOR FORM #12;University to you: Street Address: Apt No: City, State, Zip: Home Phone: Cell phone: Work Phone: EMPLOYER Name

Borenstein, Elhanan

484

UCR 09/2014 Washington Academic Internship Program  

E-Print Network [OSTI]

: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if different from above: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 09/2014 Do you currently receive): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship: Address: City: State

485

#~i;:~~.:(' . AQUATIC PLANT CONTROL  

E-Print Network [OSTI]

-4 EFFECTS OF WATER CHEMISTRY ON SUBMERSED AQUATIC PLANTS: A SYNTHESIS by R. Michael Smart Environmental. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City. State, and ZIP Code) 3909 Halls Ferry Road IDENTIFICATION NUMBER ORGANIZATION (If applicable) US Army Corps of Engineers Be. ADDRESS (City, Stitte

US Army Corps of Engineers

486

LES VOYAGEURS College of Agriculture Ambassadors  

E-Print Network [OSTI]

. - Uphold the policies outlined by the LSU Code of Student Conduct. - Make a commitment of time and energy area of study, questions regarding the transition into college life, campus activities, and other address City State Zip Local phone number Home phone number Home address City State Zip Country E

487

Note: The State Clearinghouse will assign identification numbers for all new projects. If a SCH number already exists for a project (e.g. Notice of Preparation or previous draft document) please fill in.  

E-Print Network [OSTI]

: City: Zip: County: Project Location: County: City/Nearest Community: Cross Streets: Zip Code: Longitude Waste Land Use Drainage/Absorption Population/Housing Balance Toxic/Hazardous Cumulative Effects For LCNG Fueling Facility California Energy Commission Donald Coe 1516 Ninth Street (916) 654

488

Reference Buildings by Building Type: Outpatient health care  

Broader source: Energy.gov [DOE]

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

489

Reference Buildings by Building Type: Hospital  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

490

Reference Buildings by Building Type: Full service restaurant  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

491

Reference Buildings by Building Type: Large office  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

492

Introduction to SAS Programming Registration Form  

E-Print Network [OSTI]

* Date of Birth Employer Job Title Work Address * Home Address City / State / Zip * City / State / Zip a certificate, you must complete at least 80% of the online quizzes and programming activities with scores of 70% or higher. Certificates of completion may take up to two weeks to process once your program has concluded

493

UPS, the UPS brandmark and the color brown are trademarks that are used with permission by the owner, United Parcel Service of America, Inc. All rights reserved. You may type directly into this form  

E-Print Network [OSTI]

UPS, the UPS brandmark and the color brown are trademarks that are used with permission VALUE Post / Zip Post / Zip UPS NEXT DAY AIRŽ Most deliveries made by 10:30 a.m. UPS GROUND Delivery in 1­5 business days (in-state deliveries usually arrive next day) UPS WORLDWIDE SAVERSM Int'l Service

Jones, Michelle

494

A Second-Site Noncomplementation Screen for Modifiers of Rho1 Signaling during Imaginal Disc Morpogenesis in Drosophila  

E-Print Network [OSTI]

+/+ RhoGEF2 11-3b 21 31 (239) 25 75 (61) Rho1 E3.10 +/+ RhoGEF2 11-3b 21 20 (143) 25 20 (30) Rho1 k02107b +/+ RhoGEF2 11-3b 21 80 (5) 25 100 (9) Rho1 J3.8 +/+ RhoGEF2 11-3b 21 55 (62) 25 91 (22) Rho1 E(br)246 +/+ zip E(br) 21 50 (82) 25 66 (44) Rho1 E...(br)233 +/+ zip E(br) 21 20 (102) 25 66 (29) Rho1 E3.10 +/+ zip E(br) 21 ND 25 33 (12) Rho1 k02107b +/+ zip E(br) 21 ND 25 ND Rho1 J3.8 +/+ zip E(br) 21 95 (20) 25 97 (30) a Balanced, Rho heterozygous mutant virgin females were crossed to either w 1118...

Patch, Kistie; Stewart, Shannon; Welch, Aaron; Ward, Robert

2009-10-23T23:59:59.000Z

495

E-Print Network 3.0 - area central fennoscandian Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

near the coastline, while the central and eastern portions of southern Norway... of the FIS ARTICLE IN PRESS Fig. 1. Map of southern and central Norway showing areas studied....

496

Nordisk kernesikkerhedsforskning Norrnar kjarnryggisrannsknir  

E-Print Network [OSTI]

and Safety Department Institute of Energy Technology, Norway March 2010 #12;Abstract Within the current Environmental Monitoring Section, Health and Safety Department. Institute of Energy Technology. Norway i #12

497

Report: An Updated Annual Energy Outlook 2009 Reference Case...  

U.S. Energy Information Administration (EIA) Indexed Site

and Development - Austria, Belgium, Czech Republic, Denmark, Finland, France, Germany, Greece, Hungary," "Iceland, Ireland, Italy, Luxembourg, the Netherlands, Norway,...

498

Process Systems Engineering, 5. Process Dynamics, Control, Monitoring,  

E-Print Network [OSTI]

of Chemical Engineering, Trondheim, Norway STEFAN KRA¨ MER, INEOS, Ko¨ln, Germany ANDREAS WEIß, INEOS, Ko

Skogestad, Sigurd

499

Preparing Guyana's REDD+ Participation: Developing Capacities...  

Open Energy Info (EERE)

AgencyCompany Organization Guyana Forestry Commission, The Government of Norway Sector Land Focus Area Forestry Topics Implementation, Policiesdeployment programs,...

500

FLUID FLOW AND PARTICLE DEPOSITION SIMULATIONS IN THE HUMAN NOSE  

E-Print Network [OSTI]

. Melaaen Telemark University College (HiT-TF) and Telemark R&D Centre (Tel-Tek) Porsgrunn Norway Martin

Reimers, Martin