Powered by Deep Web Technologies
Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Oslo, Norway: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Oslo, Norway: Energy Resources Oslo, Norway: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 3143244 Coordinates 59.91325°, 10.73892° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91325,"lon":10.73892,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

2

Spontaneous dissipation of elastic energy by self-localizing thermal runaway Faculty of Engineering, Oslo University College, P.O. Box 4, St. Olavs Plass, N-0130 Oslo, Norway  

E-Print Network [OSTI]

Spontaneous dissipation of elastic energy by self-localizing thermal runaway S. Braeck* Faculty of Engineering, Oslo University College, P.O. Box 4, St. Olavs Plass, N-0130 Oslo, Norway Y. Y. Podladchikov-0316 Oslo, Norway Received 16 April 2009; published 8 October 2009 Thermal runaway instability induced

Podladchikov, Yuri

3

Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b  

E-Print Network [OSTI]

Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a that pollution by these metals peaked between 1940 and 1970. Dating results indicate that Hg discharges peaked such as heavy metals and organic pollu- tants are typically scavenged by suspended, fine-grained, mineral

Alve, Elisabeth

4

Economicenvironmental analysis of handling biogas from sewage sludge digesters in \\{WWTPs\\} (wastewater treatment plants) for energy recovery: Case study of Bekkelaget WWTP in Oslo (Norway)  

Science Journals Connector (OSTI)

Abstract This paper outlines a methodology for a systematic economicenvironmental analysis of realistic and realisable options for recovering and utilising energy from biogas produced in sewage sludge digesters in \\{WWTPs\\} (wastewater treatment plants). Heat, electricity and transport fuel can be produced from biogas, consumed in-plant or even sold to external end-users. The paper initially considers global warming as the environmental impact of concern, but later also stresses on the necessity of avoiding problem shifting by factoring in other environmental impact categories as well. The methodology is subsequently applied to the Bekkelaget WWTP in Oslo (Norway). Five different options for handling biogas are considered, in addition to the status quo the business-as-usual in year-2012, and a baseline case, where it is assumed that all biogas generated is flared completely and not utilised for energy recovery of any kind. Seven different cost scenarios for electricity, natural gas, wood pellets, bio-methane and diesel are constructed. This gives a total of 49 combinations, for each of which the net costs and net environmental impacts (global warming, eutrophication and acidification) are determined for the 10-year period 20122021. The changes (in percentages) with respect to the corresponding values for the baseline case, are recorded; suitable weighting factors are considered after interaction with experts and personnel associated with the plant, and the options are evaluated using this double-bottom-line approach (economic and environmental).

G. Venkatesh; Rashid Abdi Elmi

2013-01-01T23:59:59.000Z

5

Seasonal mass-balance gradients in Norway L.A. RASMUSSEN,1  

E-Print Network [OSTI]

Seasonal mass-balance gradients in Norway L.A. RASMUSSEN,1 L.M. ANDREASSEN2,3 1 Department of Earth@ess.washington.edu 2 Norwegian Water Resources and Energy Directorate (NVE), PO Box 5091, Majorstua, NO-0301 Oslo, Norway 3 Department of Geosciences, University of Oslo, Blindern, NO-0316 Oslo, Norway ABSTRACT

Rasmussen, L.A.

6

A knowledge portal for Norway  

E-Print Network [OSTI]

A knowledge portal for Norway 2012 Highlights from the University of Oslo's annual report #12 examinations 14 The Governor of the Bank of Norway's Annual Address: 15 A student ombudsman is introduced 15 The Administrative Streamlining Programme 33 Ongoing efforts 34 Key figures 16 Life sciences 17 UiO:Energy 17 Four

Johansen, Tom Henning

7

E-Print Network 3.0 - area western norway Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Geosciences 67 Slow exhumation of UHP terranes: Titanite and rutile ages of the Western Gneiss Region, Norway Summary: on the subduction-...

8

Seasonal mass balance gradients in Norway L. A. Rasmussen1  

E-Print Network [OSTI]

Norwegian Water Resources and Energy Directorate (NVE) P. O. Box 5091 Majorstua, N-0301 Oslo, Norway16 Aug 05 Seasonal mass balance gradients in Norway L. A. Rasmussen1 and L. M. Andreassen2 1 in Norway exists in their profiles of both seasonal balances, winter bw(z) and summer bs(z). Unlike many

Rasmussen, L.A.

9

On the dynamics of subaqueous clay rich gravity mass flows--the giant Storegga slide, Norway  

E-Print Network [OSTI]

Ulleva°l Stadion, 0806 Oslo, Norway c Norsk Hydro ASA, 0246 Oslo, Norway Received 10 November 2003 the path, extremely small yield strength must be attributed to the material. This finding is incompatible., 2004b). There are several reasons for this. Small events are easier to survey completely

10

Complex pockmarks with carbonate-ridges off mid-Norway: Products of sediment degassing  

E-Print Network [OSTI]

Geotechnical Institute, P.O. Box 3930 Ullevaal Stadion, 0806 Oslo, Norway d Institute of Energy, IFE, P.O. BoxComplex pockmarks with carbonate-ridges off mid-Norway: Products of sediment degassing Martin Fossa°f , Rene´ Jonssong , Ha°kon Ruesla°ttene a Statoil, N-4035, Stavanger, Norway b Physics

Svensen, Henrik

11

30 ENGINEERING & SCIENCE WI NTE R 2012 Whether processing radar signals in Norway or assessing rock properties in Nigeria, Calte  

E-Print Network [OSTI]

deeply into basic physics to solve problems. Oslo, Norway, José Navarro, PhD '94, Astronomy José Navarro, Navarro integrates radar into systems for maritime traffic services. Since radar installations are usually

12

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

13

ASSESSMENT OF GLACIOLOGICAL PARAMETERS USING LANDSAT SAT-ELLITE DATA IN SVARTISEN, NORTHERN NORWAY  

E-Print Network [OSTI]

.heiskanen@utu.fi 2. Norwegian Water Resources and Energy Directorate, Oslo, Norway 3. Department of Geography of the state of glaciers is important, for such purposes as hydropower production and natural hazard (Meyer et al. 1993). The dynamic range of most optical sensors is not optimised for high reflectance

Oldenburg, Carl von Ossietzky Universität

14

Haraldrud Municipal Solid Waste Combustion Plant in Oslo.  

E-Print Network [OSTI]

??This thesis has studied Haraldrud MSW combustion process. Haraldrud is a realcombustion plant burning waste for citizens of Oslo. A thoroughly description ofthe combustion process (more)

Gudim, Simen Johan

2011-01-01T23:59:59.000Z

15

Prospectus 2012 2013 Welcome to the University of Oslo  

E-Print Network [OSTI]

and is surrounded by sea, forests and hills. You can reach many of the 40 islands in the Oslo Fjord by boat from in total. 3. Oslomarka Vast forested hills surrounding Oslo. Ideal for outdoor actitivity after a short by forest and parks, and there are hundreds of lakes within the boundaries of the city. With public

Løw, Erik

16

Norway's next energy boom  

E-Print Network [OSTI]

"With Norway's petroleum era beginning to wind down, attention is being turned to the potential of thorium as the next power adventure for the country." (1 page)

2006-01-01T23:59:59.000Z

17

Analysis of possible systematic errors in the Oslo method  

SciTech Connect (OSTI)

In this work, we have reviewed the Oslo method, which enables the simultaneous extraction of the level density and {gamma}-ray transmission coefficient from a set of particle-{gamma} coincidence data. Possible errors and uncertainties have been investigated. Typical data sets from various mass regions as well as simulated data have been tested against the assumptions behind the data analysis.

Larsen, A. C.; Guttormsen, M.; Buerger, A.; Goergen, A.; Nyhus, H. T.; Rekstad, J.; Siem, S.; Toft, H. K.; Tveten, G. M.; Wikan, K. [Department of Physics, University of Oslo, N-0316 Oslo (Norway); Krticka, M. [Institute of Particle and Nuclear Physics, Charles University, Prague (Czech Republic); Betak, E. [Institute of Physics SAS, 84511 Bratislava (Slovakia); Faculty of Philosophy and Science, Silesian University, 74601 Opava (Czech Republic); Schiller, A.; Voinov, A. V. [Department of Physics and Astronomy, Ohio University, Athens, Ohio 45701 (United States)

2011-03-15T23:59:59.000Z

18

Rom i Tiggerstaden : En etnografisk studie av tilreisende rom i Oslo.  

E-Print Network [OSTI]

??Tema for avhandlingen er tilreisende roms hverdagsliv i Oslo. Avhandlingen baserer seg p kvalitative intervjuer med elleve rumenske rom, samt deltagende observasjon p gata og (more)

Nordb, Thov Midtsund

2013-01-01T23:59:59.000Z

19

A cross-cultural analysis of household energy use behaviour in Japan and Norway  

Science Journals Connector (OSTI)

In this paper we compare and contrast the results of ethnographic investigations of energy use behaviour in Fukuoka, Japan and Oslo, Norway. These studies show significant differences in end use patterns for space heating, lighting and hot water use. We discuss how these patterns are related to cultural and economic factors. Our findings show that while energy intensive space heating and lighting habits have become an integral part of the presentation of the Norwegian home, Japanese space heat and light habits are more disciplined and less culturally significant. In Japan, the bathing routine is extremely important to the Japanese lifestyle and at the same time very energy intensive. Other energy intensive patterns are identified which do not have the same cultural significance, such as lax temperature setback in Norway and dish washing practices in Japan. The policy implications of these findings are discussed.

Harold Wilhite; Hidetoshi Nakagami; Takashi Masuda; Yukiko Yamaga; Hiroshi Haneda

1996-01-01T23:59:59.000Z

20

International Advances in the Ecology, Zoogeography and Systematics of Mayflies and Stoneflies  

E-Print Network [OSTI]

and Energy Directorate, Oslo, Norway. In Norwegian. Schtz,NO-0318 Oslo, Norway Norwegian Water Resources and Energy

Hauer, Frederick Richard; Stanford, Jack Arthur; Newell, Robert Lee

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Natural gas ferries in Norway.  

E-Print Network [OSTI]

??This paper studies the emergence of natural gas powered ferries in Norway and their diffusion as a means to reaching the goals of reducing NOx (more)

Myklebust, Benjamin

2006-01-01T23:59:59.000Z

22

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

23

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

24

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

25

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

26

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

27

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

28

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

29

Building on Norways Energy Goldmine: Policies for Expertise, Export, and Market Efficiencies  

Science Journals Connector (OSTI)

This chapter deals with the governance of renewable energy in Norway. The Norwegian case is a ... one of Europes largest producers of renewable energy make a transition toward more renewable policy ... Norways ...

Tomas Moe Skjlsvold; Marianne Ryghaug; Jon Dugstad

2013-01-01T23:59:59.000Z

30

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

31

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

32

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

33

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

34

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

35

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

36

Developing Safe Control Systems using Patterns for Assurance Andre Alexandersen Hauge  

E-Print Network [OSTI]

for energy technology, Halden, Norway University of Oslo, Norway andre.hauge@hrp.no Ketil Stølen SINTEF ICT, Oslo, Norway University of Oslo, Norway ketil.stolen@sintef.no Abstract--The Safe Control Systems (Sa

Stølen, Ketil

37

An Analytic Evaluation of the SaCS Pattern Language Including Explanations of Major Design  

E-Print Network [OSTI]

Choices Andr´e Alexandersen Hauge Institute for energy technology, Halden, Norway University of Oslo, Norway andre.hauge@hrp.no Ketil Stølen SINTEF ICT, Oslo, Norway University of Oslo, Norway ketil

Stølen, Ketil

38

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

39

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

40

Arabidopsis WD REPEAT DOMAIN55 Interacts with DNA DAMAGED BINDING PROTEIN1 and Is Required for Apical Patterning in the Embryo  

Science Journals Connector (OSTI)

...University of Oslo, N-0316 Oslo, Norway b Institut de Biologie Moleculaire des...we performed fluorescence resonance energy transfer (FRET) assays (Levitt et al...University of Oslo, N-0316 Oslo, Norway. | Journal Article Research Support...

Katrine N. Bjerkan; Sabrina Jung-Roméo; Gerd Jürgens; Pascal Genschik; Paul E. Grini

2012-03-23T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

42

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

43

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

44

Z .Marine Geology 162 2000 303316 www.elsevier.nlrlocatermargeo  

E-Print Network [OSTI]

Resources and Energy Directorate, PB 5091 Majorstua, 0301 Oslo, Norway b Institute of Geology, Uni�ersity of Oslo, PB 1047, Blindern, N-0316 Oslo, Norway c Institute of Geology, Uni�ersity of Oslo, PB 1047, Blindern, N-0316 Oslo, Norway d J.S.I. Oil and Gas Consultants AS, PB 218, 1301 Sand�ika, Norway e

45

Tourism in Norway, and Study at Harstad University College.  

E-Print Network [OSTI]

Tourism in Norway, and Study at Harstad University College. UNBC November 2009 May Kristin College Tourism in Norway #12;Harstad University College Northern Norway Harstad; aprox. 25, Norway Advanced Marketing or Travel and Tourism with e-commerce #12;Avanced Marketing 1st semester 2nd

Northern British Columbia, University of

46

Norway-Indonesia-Forest Management Agreement | Open Energy Information  

Open Energy Info (EERE)

Norway-Indonesia-Forest Management Agreement Norway-Indonesia-Forest Management Agreement Jump to: navigation, search Name Norway-Indonesia-Forest Management Agreement Agency/Company /Organization Government of Norway, Government of Indonesia Sector Energy, Land Focus Area Forestry Topics Policies/deployment programs, Background analysis Website http://www.norway.or.id/Norway Country Norway, Indonesia UN Region South-Eastern Asia, Northern Europe References Norway-Indonesia REDD+ Partnership - Frequently asked questions[1] Letter of Intent[2] Background Letter of Intent FAQ's [Fact Sheet] Photo World Resources Institute: Susan Minnemeyer References ↑ "Norway-Indonesia REDD+ Partnership - Frequently asked questions" ↑ "Letter of Intent" Retrieved from "http://en.openei.org/w/index.php?title=Norway-Indonesia-Forest_Management_Agreement&oldid=374779"

47

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

48

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

49

Fluctuating dipolar chains and roughening of brownian worms. Renaud Toussaint,1  

E-Print Network [OSTI]

-0316 Oslo, Norway 3 Institute for Energy Technology, NO-2027 Kjeller, Norway (Dated: 19th June 2006

Toussaint, Renaud

50

everythingHighlights from the University of Oslo's annual report 2013  

E-Print Network [OSTI]

to technology for global health 09 User-driven innovation 16 Interdisciplinary programmes 17 UiO:Energy 17 collaboration with industry 21 Cooperation Norway-Brazil 22 Open Access 22 A conversation with Bill Gates 22 complexes are old, and there is a large need for rehabilitation and renewal. Contact with the authorities Ui

Løw, Erik

51

Norway: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Norway: Energy Resources Norway: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":62,"lon":10,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

52

SOME SOLAR ENERGY PROJECTS IN NORWAY (SCANDINAVIA)  

Science Journals Connector (OSTI)

ABSTRACT. Presentation of several solar architecture projects in Norway: Two housing schemes where passive means are introduced, combined with earth sheltering and low temperature solar heat from glass-covered winter gardens?. Solar energy is stored in the building fabric. One sports center using solar energy from a building integrated air solar collector for heating shower water. Autonomy.

Harald N. Rstvik

1985-01-01T23:59:59.000Z

53

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

54

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

55

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

56

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

57

PUBLISHED ONLINE: 6 DECEMBER 2009 | DOI: 10.1038/NGEO708 Towards absolute plate motions constrained by  

E-Print Network [OSTI]

of Geological Processes, University of Oslo, NO-0316 Oslo, Norway, 5Chevron Energy Technology Company, 250 St for Geodynamics, Geological Survey of Norway (NGU), Leiv Eirikssons vei 39, NO-7491 Trondheim, Norway, 4Physics

Torsvik, Trond Helge

58

Fracturing controlled primary migration of hydrocarbon fluids during1 heating of organic-rich shales2  

E-Print Network [OSTI]

, USA10 5 Institute for Energy Technology, Kjeller, Norway11 12 #12;2 Abstract13 Time-resolved three of Geological Processes, University of Oslo, Norway7 2 Statoil ASA, Oslo, Norway8 3 Institut des Sciences de la

59

High-Linear Energy Transfer Irradiation Targeted to Skeletal Metastases by the ?-Emitter 223Ra: Adjuvant or Alternative to Conventional Modalities?  

Science Journals Connector (OSTI)

...Cancer High-Linear Energy Transfer Irradiation...Hospital, N-0310 Oslo, Norway. Phone: 47-22934000...Algeta ASA (Oslo, Norway), 5 5 http://www...Laboratory at Institute for Energy Technology (Kjeller, Norway), where the sterile...

yvind S. Bruland; Sten Nilsson; Darrell R. Fisher; and Roy H. Larsen

2006-10-15T23:59:59.000Z

60

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

E-Print Network 3.0 - anticoagulant-susceptible norway rats Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Gary Greenberg Summary: rats will acquire the traditional pattern of behavior. Food Preference and Poison Avoidance by Norway... - tions of Norway rats (Rattus...

62

E-Print Network 3.0 - atomenergi norway 21st Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the staff is assigned to the OECD Halden experiment in Norway. 1.3. Reactor Physics... , Norway, Studsvik Energy Tech- nology, Sweden, and Ris National Laboratory. The project...

63

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

64

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

65

Spectral imaging of proton aurora and twilight at Troms, Norway  

E-Print Network [OSTI]

Spectral imaging of proton aurora and twilight at Tromsø, Norway M. Galand,1 J. Baumgardner,1 D was deployed from November 2001 until April 2003 in Tromsø, Norway. For moderately disturbed magnetic protons are frequently the dominant particle energy source in this region. For this experiment, four

Lummerzheim, Dirk

66

The Norway rat4 Bennett G. Galef6  

E-Print Network [OSTI]

1 1 2 3 The Norway rat4 5 Bennett G. Galef6 7 8 9 Department of Psychology, development, domestication, food choice,31 learning, olfaction, reproduction, social learning, taste of smell.48 49 Synopsis50 #12;3 Norway rats served for many decades as the main subject species

Galef Jr., Bennett G.

67

Norway Goes With the Flow To Light Up Its Nights  

Science Journals Connector (OSTI)

...punishing kinetic energy of waves into electricity...and the colossal energy of waves has remained...have been spent on offshore wave power, and...fin. This kinetic energy is used to work...between mainland Norway and Kvaloy Island...he says. Renewable energy. Norway...

Richard Stone

2003-01-17T23:59:59.000Z

68

Minimum Energy for the four-product Kaibel-column Ivar J. Halvorsen, SINTEF, Norway and Sigurd Skogestad, NTNU, Norway  

E-Print Network [OSTI]

Minimum Energy for the four-product Kaibel-column Ivar J. Halvorsen, SINTEF, Norway and Sigurd Skogestad, NTNU, Norway AIChE Annual meeting 2006, paper 216d 1. Introduction For a four-component feed that an analytic minimal energy expression for the Kaibel-arrangement is straightforward to deduce based

Skogestad, Sigurd

69

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

70

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

71

Geographies of security and statehood in Norways Battle of the North  

Science Journals Connector (OSTI)

In this paper, we explore how peak oil anxieties are woven into the spaces and practices of the state in Norway and the consequences of this for environmental justice and the public sphere more widely. We focus in particular on an ongoing struggle over access to hydrocarbon deposits in the Norwegian Arctic, the so-called Battle of the North. We use this dispute to highlight three wider theoretical points regarding (i) the continuing relevance of the state in the governing of nature-society relations, (ii) the increasingly fragmented and fluid nature of state space, and (iii) the significance of security as a term around which social, economic and environmental tensions pivot. The paper concludes by reflecting on current efforts to prevent new oil activities in the north of Norway.

Berit Kristoffersen; Stephen Young

2010-01-01T23:59:59.000Z

72

A Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and Politics  

E-Print Network [OSTI]

these questions, we must first understand the production and consumption of energy in Norway, along in Norway involving climate change mitigation policies. 1 Source CNN & Reuters. #12;2 NORWAY'S ENERGY SECTOR in Norway3 In addition to energy purposes, domestic oil is used as feedstock for the petrochemical industry

73

PUBLISHED ONLINE: 26 FEBRUARY 2012 | DOI: 10.1038/NGEO1401 Intra-Panthalassa Ocean subduction zones  

E-Print Network [OSTI]

78, NO-0271 Oslo, Norway, 7Chevron Energy Technology Company, 1500 Louisiana St, Houston, Texas 77002 Processes, University of Oslo, NO-0316 Oslo, Norway, 4Center for Geodynamics, Geological Survey of Norway, NO-7494 Trondheim, Norway, 5School of Geosciences, University of the Witwatersrand, WITS 2050

Torsvik, Trond Helge

74

On Magnetical Observations in Germany, Norway, and Russia  

Science Journals Connector (OSTI)

1837-1843 research-article On Magnetical Observations in Germany, Norway, and Russia Major Sabine The Royal Society is collaborating with JSTOR to digitize, preserve, and extend access to Abstracts of the Papers...

1837-01-01T23:59:59.000Z

75

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

76

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

77

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

78

DNA strand breaks measured within 100 milliseconds of irradiation of Escherichia coli by 4 MeV electrons  

Science Journals Connector (OSTI)

...Oslo, Blindern, Oslo, Norway; t Department of Biophysics, Norsk Hydros Institute for Cancer Research, Montebello, Oslo 3...data analysis. Technical assistance from the Linac crew at the Norsk Hydro's Institute for Cancer Research is gratefully acknowledged...

I Johansen; T Brustad; W D Rupp

1975-01-01T23:59:59.000Z

79

U.S. LNG Imports from Norway  

Gasoline and Diesel Fuel Update (EIA)

Noyes, MN Warroad, MN Babb, MT Port of Del Bonita, MT Port of Morgan, MT Sweetgrass, MT Whitlash, MT Portal, ND Sherwood, ND Pittsburg, NH Champlain, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Highgate Springs, VT U.S. Pipeline Total from Mexico Ogilby, CA Otay Mesa, CA Galvan Ranch, TX LNG Imports from Algeria LNG Imports from Australia LNG Imports from Brunei LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Elba Island, GA Freeport, TX Gulf LNG, MS LNG Imports from Equatorial Guinea LNG Imports from Indonesia LNG Imports from Malaysia LNG Imports from Nigeria Cove Point, MD LNG Imports from Norway Cove Point, MD Freeport, TX Sabine Pass, LA LNG Imports from Oman LNG Imports from Peru Cameron, LA Freeport, TX LNG Imports from Qatar Elba Island, GA Golden Pass, TX Sabine Pass, LA LNG Imports from Trinidad/Tobago Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake Charles, LA Sabine Pass, LA LNG Imports from United Arab Emirates LNG Imports from Yemen Everett, MA Freeport, TX Sabine Pass, LA LNG Imports from Other Countries Period: Monthly Annual

80

The Bamble Sector, South Norway: A review  

Science Journals Connector (OSTI)

Abstract The Proterozoic Bamble Sector, South Norway, is one of the world's classic amphibolite- to granulite-facies transition zones. It is characterized by a well-developed isograd sequence, with isolated granulite-facies islands in the amphibolite-facies portion of the transition zone. The area is notable for the discovery of CO2-dominated fluid inclusions in the granulite-facies rocks by Jacques Touret in the late 1960's, which triggered discussion of the role of carbonic fluids during granulite genesis. The aim of this review is to provide an overview of the current state of knowledge of the Bamble Sector, with an emphasis on the Arendal-Froland-Nelaug-Tvedestrand area and off shore islands (most prominantly Tromy and Hisy) where the transition zone is best developed. After a brief overview of the history of geological research and mining in the area, aspects of sedimentary, metamorphic and magmatic petrology of the Bamble Sector are discussed, including the role of fluids. Issues relevant to current geotectonic models for SW Scandinavia, directly related to the Bamble Sector, are discussed at the end of the review.

Timo G. Nijland; Daniel E. Harlov; Tom Andersen

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

City of Norway, Michigan (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Norway, Michigan (Utility Company) Norway, Michigan (Utility Company) Jump to: navigation, search Name City of Norway Place Michigan Utility Id 13826 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL (Over 40 kW Demand) - CITY Commercial COMMERCIAL (over 40 kW Demand) - TOWNSHIP Commercial COMMERCIAL - CITY Commercial COMMERCIAL - TOWNSHIP Commercial INDUSTRIAL - CITY Industrial INDUSTRIAL - TOWNSHIP Industrial

82

A review of the tidal current energy resource in Norway  

Science Journals Connector (OSTI)

As interest in renewable energy sources is steadily on the rise, tidal current energy is receiving more and more attention from politicans, industrialists, and academics. In this article, the conditions for and potential of tidal currents as an energy resource in Norway are reviewed. There having been a relatively small amount of academic work published in this particular field, closely related topics such as the energy situation in Norway in general, the oceanography of the Norwegian coastline, and numerical models of tidal currents in Norwegian waters are also examined. Two published tidal energy resource assessments are reviewed and compared to a desktop study made specifically for this review based on available data in pilot books. The argument is made that tidal current energy ought to be an important option for Norway in terms of renewable energy.

Mrten Grabbe; Emilia Lalander; Staffan Lundin; Mats Leijon

2009-01-01T23:59:59.000Z

83

Explaining social learning of food preferences without aversions: an evolutionary simulation model of Norway rats  

Science Journals Connector (OSTI)

...evolutionary simulation model of Norway rats Jason Noble * Peter M. Todd Elio Tucif...Lentzeallee 94, 14195, Berlin, Germany Norway rats (Rattus norvegicus) transmit preferences...smelling each other's breath. However, rats fail to learn aversions, acquiring a preference...

2001-01-01T23:59:59.000Z

84

A delayed effect of ozone fumigation on photosynthesis of Norway spruce  

E-Print Network [OSTI]

A delayed effect of ozone fumigation on photosynthesis of Norway spruce D. Eamus1 A.W. Davis J into the long-lastincl effects of ozone fumiga- tion upon photosynthesis of Norway spruce. Measurements were

Paris-Sud XI, Université de

85

Effect of the Synthesis Method on the Distribution of C, B, and N Elements in Multiwall Nanotubes: A Spatially Resolved Electron Energy Loss Spectroscopy Study  

Science Journals Connector (OSTI)

Box 1033, 0315 Oslo, Norway, and DMSC, ONERA, Chemin de la Huniere, 91761 Palaiseau Cedex, France ... DMSC, ONERA. ...

Shama Enouz-Vdrenne; Odile Stphan; Marianne Glerup; Jean-Lou Cochon; Christian Colliex; Annick Loiseau

2008-09-30T23:59:59.000Z

86

Increasing absolute mortality disparities by education in Finland, Norway and Sweden, 1971e2000  

E-Print Network [OSTI]

Increasing absolute mortality disparities by education in Finland, Norway and Sweden, 1971e2000 differences by education in Finland, Norway and Sweden over the period 1971 to 2000. Methods The age and the AIDs have increased since the 1970s in Norway and Sweden, and since the 1980s in Finland

87

BRAHMS Collaboration Jens Ivar Jrdre, University of Bergen, Norway Eps2003 Strangeness production in  

E-Print Network [OSTI]

BRAHMS Collaboration Jens Ivar Jørdre, University of Bergen, Norway Eps2003 Strangeness production Collaboration Jens Ivar Jørdre, University of Bergen, Norway Eps2003 Brief outline Motivations Experimental, Norway Eps2003 Au Au space time Chemical freeze out Expansion Mixed QGP Thermalization Pre equilibrium K

88

Abstract P2-01-04: High-density lipoprotein cholesterol is associated with mammographic density in premenopausal women  

Science Journals Connector (OSTI)

...Registry of Norway, Oslo, Norway; Faculty of Health Sciences, University of Tromso, Tromso, Norway; Harvard University, Cambridge...University of Life Sciences, Aas, Norway Background: High-Density...years, participating in the Energy Balance and Breast cancer Aspects...

VG Flote; H Frydenberg; G Ursin; T Wilsgaard; A Iversen; PT Ellison; EA Wist; T Egeland; I Thune; and A-S Furberg

2013-12-15T23:59:59.000Z

89

AMP-activated protein kinase protects against antiepidermal growth factor receptor-Pseudomonas exotoxin A immunotoxin-induced MA11 breast cancer cell death  

Science Journals Connector (OSTI)

...Hospital, 0310 Oslo, Norway. Phone: 47-22935421...Radium Hospital, Oslo, Norway Grant support: Norwegian...imbalance in the cellular energy status with an increase...is also known that the energy status of the cell plays...Cancer Research, Oslo, Norway; ref. 11). The AMPK...

Yvonne Andersson; Hang Le; Siri Juell; and ystein Fodstad

2006-04-01T23:59:59.000Z

90

Experimental validation of finite element codes for welding deformations  

E-Print Network [OSTI]

Institute for Energy Technology, N-2027 Kjeller, Norway. Abstract A single pass Metal Inert Gas welding. Hamidec , H. G. Fjærd , A. Moa , M. Belletc a SINTEF Materials Technology, N-0314 Oslo, Norway. b University of Oslo, N-0316 Oslo, Norway. c CEMEF Ecole des Mines de Paris, Sophia Antipolis, France. d

Boyer, Edmond

91

2, 299339, 2008 Landsat-derived  

E-Print Network [OSTI]

Water Resources and Energy Directorate (NVE), Oslo, Norway 2 Department of Geosciences, University of The Cryosphere The new Landsat-derived glacier inventory for Jotunheimen, Norway, and deduced glacier changes of Oslo, Oslo, Norway 3 Department of Geography, University of Zurich, 8057 Zurich, Switzerland Received

Boyer, Edmond

92

1. INTRODUCTION At Falconbridge Nikkelverk in Kristiansand, Norway,  

E-Print Network [OSTI]

, even if they are quite frequent in chemical process industry (e.g. purification processes and waste-water in an electrolyte purification plant, where impurities like lead and manganese are removed by chemical precipitation of the electrolyte purification plant at Falconbridge Nikkelverk in Kristiansand, Norway. The process including

Foss, Bjarne A.

93

Weaning in the Norway Rat: Relation Between Sucklinqc and-  

E-Print Network [OSTI]

of milk to exclusive ingestion of solid food in weaning-age rat pups (Babicky, Ostadalova, ParizekWeaning in the Norway Rat: Relation Between Sucklinqc and- Milk, and Suckling and Independent examined in rat pups the relation between the decline of suckling and the emergence of independent

94

Studies of Social Learning in Norway Rats: A Brief Review  

E-Print Network [OSTI]

in the transmission of karncd food preferences from adult rats to their young. The 2nd examines the possibility that the habit of diving in shallow watcr for food is socially transmitted from I rat to iJnother. In the decadesStudies of Social Learning in Norway Rats: A Brief Review BENNETT G. GALEF, JR. DC/Jartment 0/ P

Galef Jr., Bennett G.

95

ACTA ORIENTALIA, founded in 1922, published annually under the auspices of the Oriental Societies of Denmark, Finland, Norway and Sweden,  

E-Print Network [OSTI]

of Denmark, Finland, Norway and Sweden, with support from the Nordic Publications Board for Periodicals

Løw, Erik

96

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

97

E-Print Network 3.0 - atlantic troms norway Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Ecology ; Geosciences 45 & CONSUMPTION US HYDROPOWER PRODUCTION Summary: the NAO. ENERGY CONSUMPTION AND PRODUCTION IN NORWAY AND THE NAO The demand for heating oil in...

98

Norway as Europe's green battery : analysing functions in technological innovation systems for renewable energy technologies.  

E-Print Network [OSTI]

??In order to prevent global warming, the world is in need of a reduction in CO2 emissions. This thesis seeks to analyse the possibilities Norway (more)

Simensen, Erlend Osland

2012-01-01T23:59:59.000Z

99

Specification of Distributed Systems with a Combination of Graphical and Formal Languages  

E-Print Network [OSTI]

for Energy Technology N-1751 Halden, Norway wenhuiz@hrp.no Olaf Owe Department of Informatics University of Oslo, Norway olaf@ifi.uio.no Demissie B. Aredo Institute for Energy Technology N-1751 Halden, Norway. Johnsen Department of Informatics University of Oslo, Norway einarj@ifi.uio.no Wenhui Zhang Institute

Johnsen, Einar Broch

100

Specification of Distributed Systems with a Combination of Graphical and Formal Languages #  

E-Print Network [OSTI]

for Energy Technology N­1751 Halden, Norway wenhuiz@hrp.no Olaf Owe Department of Informatics University of Oslo, Norway olaf@ifi.uio.no Demissie B. Aredo Institute for Energy Technology N­1751 Halden, Norway. Johnsen Department of Informatics University of Oslo, Norway einarj@ifi.uio.no Wenhui Zhang Institute

Johnsen, Einar Broch

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

INTERNATIONAL JOURNAL FOR NUMERICAL METHODS IN FLUIDS Int. J. Numer. Meth. Fluids 2008; 58:639658  

E-Print Network [OSTI]

. Langtangen3,4 1Scandpower Petroleum Technology, P.O. Box 113, 2027 Kjeller, Norway 2Institute for Energy Technology, P.O. Box 40, 2027 Kjeller, Norway 3Simula Research Laboratory, P.O. Box 134, 1325 Lysaker, Norway 4Department of Informatics, University of Oslo, P.O. Box 1080 Blindern, N-0316 Oslo, Norway SUMMARY

Clamond, Didier

102

A regional energy paradoxthe case of Central Norway  

Science Journals Connector (OSTI)

Central Norway is expected to have a gap of 8TWh in 2010 because of heavy investments in energy-intensive industries. The region has two landing sites for natural gas and a considerable potential for wind power to cover the gap. Small-scale hydropower and upgrading of existing hydropower plants also constitute a regional energy potential. Paradoxically, the most realistic investment prospect seems to be extensive investments in new transmission lines to cover the supply deficit. The aim of this paper is to present a problem of regional supply security and public intervention to illustrate and discuss the challenges of arriving at long-term capacity adequacy in deregulated electricity markets.

Maria Sandsmark

2009-01-01T23:59:59.000Z

103

Langfjordjkelen, a rapidly shrinking glacier in northern Norway Liss M. ANDREASSEN,1  

E-Print Network [OSTI]

of mainland Norway, the Norwegian Water Resources and Energy Directorate (NVE) began investigations in 1989Langfjordjøkelen, a rapidly shrinking glacier in northern Norway Liss M. ANDREASSEN,1 Bjarne KJ?LLMOEN,1 Al RASMUSSEN,2 Kjetil MELVOLD,1 ?yvind NORDLI3 1 Norwegian Water Resources and Energy

Rasmussen, L.A.

104

Ice sheet limits in Norway and on the Norwegian continental shelf Jan Mangerud  

E-Print Network [OSTI]

Ice sheet limits in Norway and on the Norwegian continental shelf Jan Mangerud University of Bergen, Department of Geology, Allégt. 41, N-5007 Bergen, Norway Jan.Mangerud@geol.uib.no Introduction Ice sheets and other glaciers have had a spectacular erosional impact on the Norwegian landscape, producing deep fjords

Ingólfsson, ?lafur

105

Assessing the effects of Norway rats on auklet breeding success and survival at Sirius Point, Kiska  

E-Print Network [OSTI]

Assessing the effects of Norway rats on auklet breeding success and survival at Sirius Point, Kiska-8141 FAX: (709) 737-2410 e-mail: carie@mun.ca #12;Eggleston and Jones Kiska auklet-rat monitoring in 2006 2 Introduction The presence of introduced Norway rats (Rattus norvegicus) has been implicated as a possible

Jones, Ian L.

106

IMPACTS OF INTRODUCED NORWAY RATS (RATTUS NORVEGICUS) ON LEAST AUKLETS (AETHIA PUSILLA) BREEDING AT KISKA ISLAND,  

E-Print Network [OSTI]

IMPACTS OF INTRODUCED NORWAY RATS (RATTUS NORVEGICUS) ON LEAST AUKLETS (AETHIA PUSILLA) BREEDING 2004 #12;ii ABSTRACT I quantified impacts of non-indigenous Norway rats on Least Auklets breeding at Kiska Island. Little direct evidence of rat predation was found in my productivity crevices

Jones, Ian L.

107

Ultrasonic vocalizations and social learning of food preferences by female Norway rats  

E-Print Network [OSTI]

Ultrasonic vocalizations and social learning of food preferences by female Norway rats BENNETT G the pair members were separated. However, the influence of demonstrator rats on food choices social learning of food preferences in Norway rats. ? 2004 The Association for the Study of Animal

Galef Jr., Bennett G.

108

Slow exhumation of UHP terranes: Titanite and rutile ages of the Western Gneiss Region, Norway  

E-Print Network [OSTI]

Slow exhumation of UHP terranes: Titanite and rutile ages of the Western Gneiss Region, Norway A: titanite rutile geochronology ultrahigh-pressure Norway U­Pb ages of titanite and rutile were obtained from of the Western Gneiss UHP terrane. Approximately half of the titanite ages are concordant, the majority of which

Hacker, Bradley R.

109

Mogens Blanke Adjunct Professor at Centre for Ships and Ocean Structures, NTNU, Norway  

E-Print Network [OSTI]

Mogens Blanke Adjunct Professor at Centre for Ships and Ocean Structures, NTNU, Norway Professor;DTU, Denmark & CeSOS, NTNU, Norway Position Mooring ­ essential in offshore Mooring lines provide energy-free positioning They are anchored to the bottom (200-1500 m) Buoys are attached along mooring

Nørvåg, Kjetil

110

Decomposition and nitrogen dynamics of fine roots of Norway spruce (Picea abies (L.) Karst) at different sites  

Science Journals Connector (OSTI)

Long-term decomposition and nitrogen dynamics of Norway spruce finest (energy content and nitrogen concentration was determined. After...

Krista Lhmus; Mari Ivask

1995-01-01T23:59:59.000Z

111

Decomposition and nitrogen dynamics of fine roots of Norway spruce (Picea abies (L.) Karst.) at different sites  

Science Journals Connector (OSTI)

Long-term decomposition and nitrogen dynamics of Norway spruce finest (energy content and nitrogen concentration was determined. After...

Krista Lhmus; Mari Ivask

112

ECOLOGY OF NORWAY RATS (RATTUS NORVEGICUS) IN RELATION TO CONSERVATION AND MANAGEMENT OF SEABIRDS ON KISKA ISLAND,  

E-Print Network [OSTI]

ECOLOGY OF NORWAY RATS (RATTUS NORVEGICUS) IN RELATION TO CONSERVATION AND MANAGEMENT OF SEABIRDS to predation by introduced Norway rats (Rattus norvegicus). In 2001 and 2002 the auklet colony experienced the lowest reproductive success ever recorded for auklets. Norway rats have been suggested as the cause

Jones, Ian L.

113

Abstract 1277: The association between seasonality, vitamin D and calcium intake and mammographic density in Norwegian postmenopausal women  

Science Journals Connector (OSTI)

...Health Economic and Drug Unit, Oslo, Norway, Norway. Background: Mammographic density (MD...obtained, as well as vitamin D intake, energy and calcium intake in a population of women from Norway, a country with limited sunlight exposure...

Merete Ellingjord-Dale; Isabel dos Santos Silva; Tom Grotmol; Amrit Kaur Sakhi; Samera Qureshi; Solveig Hofvind; Marianne Skov Markussen; Elisabeth Couto; Lene Frost Andersen; Giske Ursin; and Giske Ursin

2014-10-01T23:59:59.000Z

114

First Clinical Experience with ?-Emitting Radium-223 in the Treatment of Skeletal Metastases  

Science Journals Connector (OSTI)

...of Tromso, Tromso, Norway; and 5 Malarsjukhuset...conducted with low-linear energy transfer (LET) beta-emitters...Algeta ASA, Oslo, Norway. The product concentrate...Laboratory at Institute for Energy Technology, Kjeller, Norway, where the sterile...

Sten Nilsson; Roy H. Larsen; Sophie D. Foss; Lise Balteskard; Kari W. Borch; Jan-Erik Westlin; Gro Salberg; and yvind S. Bruland

2005-06-15T23:59:59.000Z

115

The political feasibility of Norway as the green battery of Europe  

Science Journals Connector (OSTI)

Norway has great potential for producing pumped-storage hydropower, and the European Union (EU) hope Norway can contribute to Europe's transition to a renewable energy system by serving as a green battery. This is certainly technically feasible. However, this paper asks whether the green battery idea is politically feasible. The paper analyses four scenarios, three of which Norway serves as a green battery and one domestic. It focuses on decision-makers' and interest groups' positions on new interconnectors from Norway to continental Europe and the United Kingdom (UK), pumped-storage hydropower, and new renewable energy production in Norway. The paper argues that the present policy is characterised by incremental changedecisions about new interconnectors are made on an individual basis. Moreover the paper argues there is little reason to believe that this status quo policy will change based on any of the green battery scenarios in the near term. Still, decision-makers and interest groups are positive, in principle, towards new interconnectors and pumped-storage hydropower. Hence, Norway might become a green battery in the longer term. In the short term, however, a politically feasible contribution from Norway is balancing power through already existing hydropower capacity.

Anne Therese Gullberg

2013-01-01T23:59:59.000Z

116

Spin-orbit coupling constants in a multiconfiguration linear response approach  

E-Print Network [OSTI]

: Denmark Trygve Helgaker Department ofChemistry, University ofOslo, Box 1033, BUndem, N-0315 Oslo 3, Norway to electrons and A to nuclei. rij is the position ofparticle irelative to particlejand Iii = rIi XPi

Helgaker, Trygve

117

Norsk Hydro ASA | Open Energy Information  

Open Energy Info (EERE)

ASA ASA Jump to: navigation, search Name Norsk Hydro ASA Place Oslo, Norway Zip NO-0283 Sector Hydro, Renewable Energy, Solar Product Oslo-based energy and aluminium supplier operating in more than 40 countries, with renewable activities particularly focused on solar and hydroelectric power. Coordinates 59.91228°, 10.74998° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91228,"lon":10.74998,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

118

Norwegian Silicon Refining AS | Open Energy Information  

Open Energy Info (EERE)

Refining AS Refining AS Jump to: navigation, search Name Norwegian Silicon Refining AS Place Oslo, Norway Zip 214 Product Oslo-based company with an upgraded metallurgical silicon (UMG) production process called the Stubergh method. Coordinates 59.91228°, 10.74998° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91228,"lon":10.74998,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

119

Decisions with Multiple Environmental Objectives. The Siting of Oil Drilling Wells in Norway  

Science Journals Connector (OSTI)

This multiattribute analysis shows how the seven steps of decision analysis is applied to the siting of oil drilling wells in Northern Norway. The study includes ... an assessment of the frequency of accidents ...

Knut L. Seip

1991-01-01T23:59:59.000Z

120

Influence of oil prices on stock market indexes in Russia and Norway  

Science Journals Connector (OSTI)

The effects of oil price dynamics on share quotations are discussed in ... paper for the 20002012 period for two oil exporting countriesRussia and Norway. It has ... , that, in spite of intuitive expectations,

I. A. Kopytin

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Porosity development in selected Jurassic sandstones from the Norwegian and North Seas, Norway an overview  

Science Journals Connector (OSTI)

Petrographic analyses of selected Jurassic sandstone core specimens from wells in the Norwegian and North Seas, Norway, indicate that porosity development has been influenced significantly by provenance and se...

Richard E. Larese; Norman L. Haskell

1984-01-01T23:59:59.000Z

122

Carriage of Clostridium difficile by Wild Urban Norway Rats (Rattus norvegicus) and Black Rats (Rattus rattus)  

Science Journals Connector (OSTI)

...Carriage of Clostridium difficile by Wild Urban Norway Rats (Rattus norvegicus) and Black Rats (Rattus rattus) Chelsea G. Himsworth a b David...objective of this study was to determine whether urban rats (Rattus spp.) from Vancouver, Canada, carry...

Chelsea G. Himsworth; David M. Patrick; Sunny Mak; Claire M. Jardine; Patrick Tang; J. Scott Weese

2013-12-06T23:59:59.000Z

123

Evaluating permeability anisotropy in the early Jurassic Tilje formation, offshore mid-Norway  

E-Print Network [OSTI]

EVALUATING PERMEABILITY ANISOTROPY IN THE EARLY JURASSIC TILJE FORMATION, OFFSHORE MID-NORWAY A Thesis by KANAN R. ALIYEV Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE August 2004 Major Subject: Petroleum Engineering EVALUATING PERMEABILITY ANISOTROPY IN THE EARLY JURASSIC TILJE FORMATION, OFFSHORE MID-NORWAY A Thesis by KANAN R. ALIYEV...

Aliyev, Kanan

2005-11-01T23:59:59.000Z

124

A Pattern-Based Method for Safe Control Systems Exemplified within Nuclear Power  

E-Print Network [OSTI]

´e Alexandersen Hauge1,3 and Ketil Stølen2,3 1 Department of Software Engineering, Institute for Energy Technology, Halden, Norway andre.hauge@hrp.no 2 Department of Networked Systems and Services, SINTEF ICT, Oslo, Norway ketil.stolen@sintef.no 3 Department of Informatics, University of Oslo, Norway Abstract

Stølen, Ketil

125

Combining Graphical and Formal Development of Open Distributed Systems #  

E-Print Network [OSTI]

, {einarj,olaf}@ifi.uio.no 2 Institute for Energy Technology, Halden, Norway 3 BISS, FB3, University,3 , Wenhui Zhang 2 , Olaf Owe 1 , Demissie B. Aredo 2,4 1 Dept. of Informatics, University of Oslo, Norway of Bremen, Germany, einar@tzi.de 4 Norwegian Computing Center, Oslo, Norway, aredo@nr.no Abstract

Johnsen, Einar Broch

126

Hydrol. Earth Syst. Sci., 10, 369381, 2006 www.hydrol-earth-syst-sci.net/10/369/2006/  

E-Print Network [OSTI]

. Rue2, and L. Gottschalk3 1SINTEF Energy Research, Sem S�lands vei 11, 7465 Trondheim, Norway 2Department of Mathematical Sciences, NTNU, 7491 Trondheim, Norway 3Department of Geosciences, University of Oslo. P.O. Box 1047 Blindern, 0316 Oslo, Norway Received: 24 June 2005 � Published in Hydrol. Earth

Boyer, Edmond

127

Combining Graphical and Formal Development of Open Distributed Systems  

E-Print Network [OSTI]

,olaf}@ifi.uio.no 2 Institute for Energy Technology, Halden, Norway 3 BISS, FB3, University of Bremen, Germany, einar Zhang2 , Olaf Owe1 , Demissie B. Aredo2,4 1 Dept. of Informatics, University of Oslo, Norway, {einarj@tzi.de 4 Norwegian Computing Center, Oslo, Norway, aredo@nr.no Abstract A specification of a software

Johnsen, Einar Broch

128

Genetic Interactions of DNA Repair Pathways in the Pathogen Neisseria meningitidis  

Science Journals Connector (OSTI)

...from The Research Council of Norway to T.T. We thank the late...meningitidis isolated from patients in Norway during the first six months...H. H. Winterwerp, N. de Wind, and T. K. Sixma. 2000...University of Oslo, Oslo, Norway. | Comparative Study Journal...

Tonje Davidsen; Hanne K. Tuven; Magnar Bjrs; Einar A. Rdland; Tone Tnjum

2007-05-18T23:59:59.000Z

129

Comparison Between the Continuous Commissioning Process and Methods Used for Energy Efficiency in Norway - Results from a Case Study  

E-Print Network [OSTI]

THE CONTINUOUS COMMISSIONING SM PROCESS AND METHODS USED FOR ENERGY EFFICIENCY IN NORWAY RESULTS FROM A CASE STUDY Vojislav Novakovic, Professor*; Jacob Stang, PhD**; Elin Skjerven, MSc*; Johnny N. Holst, PhD candidate* *Norwegian University... of Science and Technology (NTNU), Department of Energy and Process Technology, NO-7491 Trondheim, Norway **SINTEF Energy Research, Department of Energy Processes, NO-7465 Trondheim, Norway Summary For a long period of time Norwegian energy authorities...

Novakovic, V.; Stang, J.; Skjerven, E.; Holst, J.

2004-01-01T23:59:59.000Z

130

A geochemical assessment of petroleum from underground oil storage caverns in relation to petroleum from natural reservoirs offshore Norway.  

E-Print Network [OSTI]

??The aim of this study is to compare oils from known biodegraded fields offshore Norway to waxes and oils from an artificial cavern storage facility, (more)

stensen, Marie

2005-01-01T23:59:59.000Z

131

Residential energy use: an international perspective on long-term trends in Denmark, Norway and Sweden  

Science Journals Connector (OSTI)

This paper examines residential energy use in the Scandinavian countries: Denmark, Norway and Sweden, over the period 19731999. The paper uses a decomposition approach to investigate differences in residential energy demand structure and end-use intensities and discusses both differences in absolute levels of energy use and differences over time. Comparisons are also made to other countries that have been analysed in the IEA energy efficiency indicator project. The analysis shows that, in contrast to Denmark and Sweden, Norway saw a growth in total residential energy use between 1973 and 1999. This can be partially explained by the fact that Norway started from a lower per capita income level in the early 1970s but has since then enjoyed a rapid income growth that drove up house area and consequently put a pressure on energy use. But the analysis also shows that Denmark and Sweden achieved significant reductions of residential energy intensities between 1973 and 1990, while the reductions in Norway were negligible. After 1990, the picture changed; there was a strong decline in residential energy intensities in Norway and a high rate of energy savings compared to most other countries analysed by the IEA, while energy savings in Denmark and Sweden more or less came to a halt.

Fridtjof Unander; Ingunn Ettestl; Mike Ting; Lee Schipper

2004-01-01T23:59:59.000Z

132

Wave Refraction Analyses at the Coast of Norway for Offshore Applications  

Science Journals Connector (OSTI)

Abstract The wave load on potential offshore wind farms off Norway is studied by the use of a numerical wave refraction model. The model estimates trajectories of wave energy (rays) for waves propagating in water with varying surface velocity. The calculations indicate that for southerly and southwesterly winds the majority of shoreward propagating waves will converge in the coastal area off southwestern Norway. For offshore wave propagation directions equal to 180o and 210o, respectively 88% and 72% of the shoreward propagating rays approaches land south of lesund on the western part of Norway. For westerly and northerly winds the distributions are approximately uniform. It is further found that in the case of southerly or southwesterly winds, waves approach- ing the southern part of Norway are frequently misaligned with the wind. This will result in an increased bending moment of the masts. For offshore wave propagation direction between 180o and 240o the calculations indicate that approximately 24% of the rays reaching the coast of Norway along its southwestern part deviates by more than 45o of offshore propagation direction.

Ole Henrik Segtnan

2014-01-01T23:59:59.000Z

133

Options for CO2-lean hydrogen export from Norway to Germany  

Science Journals Connector (OSTI)

Norway is a nation with an abundant supply of energy, both from fossil and renewable resources. Due to limited domestic demand, Norway is today exporting large amounts of petroleum products. For the future, various options for export of CO2-lean energy exist, both from Northern and Southern Norway, and both from fossil sources (including carbon capture and storage), and renewable energies (particularly wind power). Transport vectors are hydrogen pipelines, liquid hydrogen ships and HVDC cables, and a plausible customer is central Europe due to its proximity, high population density and lack of domestic energy resources. Within the framework of the NorWays project, various options to deliver energy for hydrogen-based transportation from Norway to Germany were studied. Eight CO2-lean well-to-wheel energy export chains were evaluated with respect to efficiency, GHG emissions and other environmental impacts, costs and utilisation of Norwegian R&D experience. In the chosen scenarios, energy export via hydrogen pipelines and ships appeared energetically and economically interesting against existing approaches as NG and electricity export. Furthermore, increased utilisation of Norwegian R&D experience and higher value creation is anticipated by the export of a higher refined product.

Christoph Stiller; Ann Mari Svensson; Steffen Mller-Holst; Ulrich Bnger; Kari Aamodt Espegren; ystein Bindesbll Holm; Asgeir Tomasgrd

2008-01-01T23:59:59.000Z

134

NREL: Wind Research - News Release Archives  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

4 November 6, 2014 NREL Analyzes Floating Offshore Wind Technology for Statoil NREL engineers traveled to Oslo, Norway, to meet with Statoil representatives regarding NREL's...

135

E-Print Network 3.0 - aivo vares veiko Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Medicine ; Environmental Sciences and Ecology 70 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Summary:...

136

E-Print Network 3.0 - ahto buldas aivo Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Computer Technologies and Information Sciences 65 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Summary:...

137

stad, and Thor A. Klevjer. Beyond the average: Diverse individual ...  

Science Journals Connector (OSTI)

a Department of Biology, University of Oslo, Norway. bKing Abdullah ..... Given also that energy expenditure depends on size, one may expect a variation in...

2011-09-16T23:59:59.000Z

138

Thermostat Interface and Usability: A Survey  

E-Print Network [OSTI]

of household energy use behaviour in Japan and Norway.Japan (Wilhite, Nakagami, Masuda, Yamaga, & Haneda, 1996) reveals that less than 50% of Oslo's households

Meier, Alan

2011-01-01T23:59:59.000Z

139

NREL: Wind Research - NREL Analyzes Floating Offshore Wind Technology...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NREL Analyzes Floating Offshore Wind Technology for Statoil November 6, 2014 NREL engineers traveled to Oslo, Norway, to meet with Statoil representatives regarding NREL's analysis...

140

NREL: Technology Transfer - NREL Analyzes Floating Offshore Wind...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NREL Analyzes Floating Offshore Wind Technology for Statoil November 6, 2014 NREL engineers traveled to Oslo, Norway, to meet with Statoil representatives regarding NREL's analysis...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

142

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

143

DOE Study Monitors Carbon Dioxide Storage in Norway's Offshore Sleipner Gas  

Broader source: Energy.gov (indexed) [DOE]

DOE Study Monitors Carbon Dioxide Storage in Norway's Offshore DOE Study Monitors Carbon Dioxide Storage in Norway's Offshore Sleipner Gas Field DOE Study Monitors Carbon Dioxide Storage in Norway's Offshore Sleipner Gas Field May 21, 2009 - 1:00pm Addthis Washington, D.C. -- In a newly awarded project, researchers funded by the U.S. Department of Energy (DOE) are partnering with European scientists to track injected carbon dioxide (CO2) in the world's first and longest running carbon storage operation located at the Sleipner gas field in the North Sea. The researchers--from the Scripps Institution of Oceanography at the University of California, San Diego, and the Lamont-Doherty Earth Observatory (LDEO) in New York--will conduct surveys on the seafloor to monitor injected CO2 in the 1 kilometer-deep reservoir, where more than

144

Effects of environmental stability and demonstrator age on social learning of food preferences by young Norway rats  

E-Print Network [OSTI]

online 25 August 2004; MS. number: A9636) We used socially learned food preferences of Norway rats. However, food choices of rats that were moved daily from one cage to another and fed at unpredictable learning of food preferences by Norway rats, Rattus norvegicus, a species that has served for several

Galef Jr., Bennett G.

145

Differences Between Golden Hamsters (Mesocricetus auratus) and Norway Rats (Rattus norvegicus) in Preference for the Sole Diet That  

E-Print Network [OSTI]

- ferred the food with the unfamiliar flavor. In contrast, Norway rats (Rattus norvegicus) examined under found that, in a variety of circumstances, rats exhibited robust reductions in preference for the foodDifferences Between Golden Hamsters (Mesocricetus auratus) and Norway Rats (Rattus norvegicus

Galef Jr., Bennett G.

146

Building new power plants in a CO2 constrained world: A Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and  

E-Print Network [OSTI]

including technologies for carbon sequestration. Norway's primary energy production is dominated by oilBuilding new power plants in a CO2 constrained world: A Case Study from Norway on Gas-Fired Power director. Most of the material used in this work are either courtesy of the persons I talked to in Norway

147

Genetic Bases of Estrogen-Induced Tumorigenesis in the Rat: Mapping of Loci Controlling Susceptibility to Mammary Cancer in a Brown Norway ACI Intercross  

Science Journals Connector (OSTI)

...E2-induced pyometritis in the Brown Norway rat, to RNO5. Mamm Genome...McComb RD, Shull JD. Dietary energy restriction inhibits estrogen-induced...to mammary cancer in a Brown Norway x ACI intercross. | Exposure...strain and the unrelated Brown Norway (BN) rat strain. Whereas...

Beverly S. Schaffer; Cynthia M. Lachel; Karen L. Pennington; Clare R. Murrin; Tracy E. Strecker; Martin Tochacek; Karen A. Gould; Jane L. Meza; Rodney D. McComb; and James D. Shull

2006-08-01T23:59:59.000Z

148

Social costs of public service obligation routes--calculating subsidies of regional flights in Norway  

Science Journals Connector (OSTI)

In this note we describe an iterative procedure of how to estimate unit costs per leg of a public service obligation (PSO) route network if certain data is publicly available. The aim of this approach is to make judgments in benchmarking and in regulation ... Keywords: Airline, Networks, Norway, Operating costs, Origin-destination matrix, Public service obligation, Subsidies

Branko Bubalo

2012-07-01T23:59:59.000Z

149

Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 19952007 (the  

E-Print Network [OSTI]

1 Cancer survival in Australia, Canada, Denmark, Norway, Sweden, and the UK, 1995­2007 (the International Cancer Benchmarking Partnership): an analysis of population-based cancer registry data M P Coleman Background Cancer survival is a key measure of the effectiveness of health-care systems. Persistent regional

Maizels, Rick

150

An overview of the biomass resource potential of Norway for bioenergy use  

Science Journals Connector (OSTI)

This paper provides an overview of the Norwegian biomass resources for bioenergy use, bioenergy market and frame conditions through a comparison with Denmark, Finland and Sweden, which have a leading role in bioenergy production in the European Union. Although the contribution of renewable energy in Norway is among the highest in Europe (58%), mainly due to hydroelectricity, bioenergy has a low contribution to Norwegian energy supply (6%). As the experience from the other EU Member States showed, long-term, stable policies and relatively strong incentives are needed to initiate and build up a bioenergy market. In Norway, there is still a significant available potential for increasing the bioenergy contribution to the energy supply. The abundance and relatively low prices of energy (i.e. fossil fuels and electricity), in connection with the need of high investment costs, did not favour so far bioenergy production. Additional forest biomass may be mobilized in Norway by more intensive management of currently exploited forests. However, there are several limitations related to topography, accessibility and economics. The biomass resources and the full range of technologies available for heat or electricity generation both at small and large scale that can provide good opportunities for increased bioenergy production. The experience gained in Denmark, Finland and Sweden may be relevant for Norway, as well as for other EU Member States, where there is a deficit of mobilization of biomass resources and insufficient industrial integration of bioenergy with other forest-based sectors.

Nicolae Scarlat; Jean-Francois Dallemand; Odd Jarle Skjelhaugen; Dan Asplund; Lars Nesheim

2011-01-01T23:59:59.000Z

151

Marine Ornithology 41: 4148 (2013) Bond et al.: Crested Auklet survival with Norway Rats 41  

E-Print Network [OSTI]

Marine Ornithology 41: 41­48 (2013) Bond et al.: Crested Auklet survival with Norway Rats 41 (Jones et al. 2008, Towns et al. 2011). Introduced rats (Rattus spp.) cause reduced breeding success al. 2008, Lavers et al. 2010). However, deciphering and quantifying the effect of rats on seabird

Jones, Ian L.

152

Available online at www.sciencedirect.com `Conformity' in Norway rats?  

E-Print Network [OSTI]

with `demonstrator' rats that have eaten that food. Such observer rats will eat as much unpalatable or presumably toxic food after interacting with demonstrator rats that have eaten them as they would if they hadAvailable online at www.sciencedirect.com `Conformity' in Norway rats? BENNETT G. GALEF & ELAIN E

Galef Jr., Bennett G.

153

Fuel Poverty as an Outcome Measure: A Comparative Study of Energy Policies in Norway and the United Kingdom  

Science Journals Connector (OSTI)

ABSTRACT Whether low income families have difficulty in being warm at home or not can be considered as an outcome measure of the effectiveness of policies for housing, energy, and income maintenance. This study aims to compare such policies in Norway and the United Kingdom. As background, evidence of fuel poverty in a wider international context is presented. To conclude, policies from Norway which might help to relieve fuel poverty in Britain are set out.

S. Hutton; T. Braend; L. Warren

1988-01-01T23:59:59.000Z

154

A qualitative examination of performance and energy yield of photovoltaic modules in southern Norway  

Science Journals Connector (OSTI)

Three different, commercially available photovoltaic modules have been monitored outdoors in the town of Grimstad, Norway. The present paper describes the experimental setup that was implemented, in particular details of the low-cost electronic loads. Results compare measured performance with manufacturer's data, and temperature measurements enable a comparison with performance at standard test condition temperature. Overall, the monocrystalline module performed best both regarding maximum efficiency and overall energy production, whereas the module based on triple junction amorphous silicon technology had the worst performance considering these criteria. The gross numbers of energy yield corresponding to measurements over a whole year show that photovoltaic technology could become a viable alternative also in a Northern country like Norway.

Ole-Morten Midtgard; Tor Oskar Stre; Georgi Yordanov; Anne Gerd Imenes; Chee Lim Nge

2010-01-01T23:59:59.000Z

155

A Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and Politics  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Case Study from Norway on Case Study from Norway on Gas-Fired Power Plants, Carbon Sequestration, and Politics Guillaume Quiviger and Howard Herzog (hjherzog@mit.edu; +1-617-253-0688) Massachusetts Institute of Technology (MIT) Room E40-471 1 Amherst Street Cambridge, MA 02139 INTRODUCTION On Thursday March 9, 2000, Norwegian Prime Minister Kjell Magne Bondevik's minority government resigned over a disagreement with the opposition about a controversial proposal to build two gas-fired power plants. The government had been rejecting the building of the proposed plants for months. Bondevik and his coalition government wanted to hold off construction until new technology, such as carbon sequestration, allowed building more environmentally friendly plants. They argued that their position was supported by European

156

Toward policy integration: Assessing carbon capture and storage policies in Japan and Norway  

Science Journals Connector (OSTI)

The objective of this paper is to develop independent and systematic criteria for assessing CCS policy in terms of its level of policy integration. We believe that we should assess CCS policy in terms of the distance to an ideal integrated CCS policy in order to keep track of its trajectory toward sustainable development. After reviewing the existing literature of environmental policy integration, an assessment framework for integrated CCS policy is developed based on Arild Underdal's notion of integrated policy then, its usefulness is demonstrated by applying it to CCS policies in Japan and Norway. In the final part, we summarize the findings of the cases and conclude with some observations regarding explanatory factors of the difference in terms of the achieved level of policy integration between Japan and Norway's CCS policies, and some policy implications derived from the analysis based on the framework.

Atsushi Ishii; Oluf Langhelle

2011-01-01T23:59:59.000Z

157

Forecasting future oil production in Norway and the UK: a general improved methodology  

E-Print Network [OSTI]

We present a new Monte-Carlo methodology to forecast the crude oil production of Norway and the U.K. based on a two-step process, (i) the nonlinear extrapolation of the current/past performances of individual oil fields and (ii) a stochastic model of the frequency of future oil field discoveries. Compared with the standard methodology that tends to underestimate remaining oil reserves, our method gives a better description of future oil production, as validated by our back-tests starting in 2008. Specifically, we predict remaining reserves extractable until 2030 to be 188 +/- 10 million barrels for Norway and 98 +/- 10 million barrels for the UK, which are respectively 45% and 66% above the predictions using the standard methodology.

Fievet, Lucas; Cauwels, Peter; Sornette, Didier

2014-01-01T23:59:59.000Z

158

Reproductive Factors and Risk of Cancer of the Uterine Corpus: A Prospective Study  

Science Journals Connector (OSTI)

...In: Drug Consump tion in Norway, pp. 108-109. Oslo: Norsk Medisinaldepot, 1984. 12. Bergsje, P. Comments on the use...In: Drug Con sumption in Norway, pp. 114-115. Oslo: Norsk Medisinaldepot, 1984. 13. Baron, J. A. Smoking and estrogen-related...

Gunnar Kvle; Ivar Heuch; Giske Ursin

1988-11-01T23:59:59.000Z

159

31P Nuclear Magnetic Resonance Spectroscopy Studies of Tumor Energy Metabolism and Its Relationship to Intracapillary Oxyhemoglobin Saturation Status and Tumor Hypoxia  

Science Journals Connector (OSTI)

...Spectroscopy Studies of Tumor Energy Metabolism and Its Relationship...Montebello, 0310 Oslo 3, Norway. Relationships between...MLS, OWI). Tumor energy metabolism was studied...lipid metabolism, high energy Received 2/4/88...Montebello, 0310 Oslo 3, Norway. }The abbreviations...

Einar K. Rofstad; Paul DeMuth; Bruce M. Fenton; and Robert M. Sutherland

1988-10-01T23:59:59.000Z

160

Scaling behaviour of clay-rich submarine debris flows D. Isslera,b,*, F.V. De Blasioa,b  

E-Print Network [OSTI]

3930 Ulleva°l Stadion, N-0806 Oslo, Norway c Norsk Hydro ASA, N-0246 Oslo, Norway Received 27 February described as a power-law function of the volume. For small to moderate volumes, visco-plastic models mixing of the shear layer with ambient water or hydro-planing must be invoked in order to explain

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Meridian-scanning photometer, coherent HF radar, and magnetometer observations of the cusp: a case study  

E-Print Network [OSTI]

the transport of mass, energy, and momentum from the solar wind into the near-Earth environment, is facilitated-9170 Longyearbyen, Norway 3 Department of Physics, University of Oslo, P O Box 1048 Blindern, N-0316 Oslo, Norway 4 Queen Mary and West®eld College, University of London, London E1 4NS, UK Received: 29

Paris-Sud XI, Université de

162

Estimating expected energy capture at potential wind turbine sites in Norway  

Science Journals Connector (OSTI)

To estimate the expected energy capture at potential wind turbine sites in Norway, a combination of low-cost wind monitoring, correlation and models are used. The wind monitoring, the correlation and the uncertainty of the method are described. Results from two cases are compared with predictions made with the model WASP. The results indicate that measurements are needed near potential wind turbine sites, until a high quality reference data set has been established, and models for complex terrain effects are validated.

T.A. Nygaard

1992-01-01T23:59:59.000Z

163

Forest sector impacts of the increased use of wood in energy production in Norway  

Science Journals Connector (OSTI)

The main objective of this study was to analyse the impacts of increased energy prices on the traditional forest sector (forestry and forest industries) in Norway The study applied a regionalized partial equilibrium model covering forestry, forest industries and the bioenergy sector. In the model, an increase in the energy price from NOK 0.50/kWh (0.06Euro/kWh) to NOK 0.70/kWh by the year 2015 reduces production by 12% for particleboard and by 4% for pulp (mainly sulphate), whereas the production of fibreboard was unaffected. The pulp and paper industries in Norway are mainly relying on spruce pulpwood, which is only partly affected by increased bioenergy prices. In the sawmill industries, the negative impact of higher energy prices (input of electricity) is compensated by higher prices received for chips, sawdust and bark. The production of pine sawnwood (accounting for about 31% of the sawnwood production in Norway) increased by 3% by 2015 when the energy price increased from NOK 0.50 to 0.70NOK per kWh, whereas the production of spruce sawnwood (accounting for 69% of the sawnwood production) decreased by 0.4%. Future, improvements of the model should include even more detailed descriptions of bioenergy technologies, the supply of wood residues and the energy market, including consumer behaviour and investment decisions.

Erik Trmborg; Birger Solberg

2010-01-01T23:59:59.000Z

164

Water and energy exchange above a mixed European Beech Norway Spruce forest canopy: a comparison of eddy covariance against soil water depletion measurement  

Science Journals Connector (OSTI)

Evapotranspiration of a mixed European beech Norway spruce forest was measured by means of ... the results by (1) the degree of energy balance closure (EBC), (2) footprint...

H. Schume; H. Hager; G. Jost

2005-06-01T23:59:59.000Z

165

Quality of Supply in Energy Regulation Measurement,Assessment and Experience from Norway  

E-Print Network [OSTI]

www.eprg.group.cam.ac.uk E P R G W O R K IN G P A P E R N O N -T E C H N IC A L S U M M A R Y Quality of Supply in Energy Regulation Measurement, Assessment and Experience from Norway EPRG Working Paper EPRG 0920 Cambridge... in the perforrnace of the Norwegian electricity distribution utilities. Contact c.growitsch@wik.org Publication July 2009 Financial Support www.eprg.group.cam.ac.uk Quality of Supply in Energy Regulation Measurement, Assessment...

Growitsch, Christian; Jamasb, Tooraj; Mueller, C; Wissner, M

166

,"Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars per Thousand Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Norway (Dollars per Thousand Cubic Feet)" Norway (Dollars per Thousand Cubic Feet)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Price of U.S. Liquefied Natural Gas Imports From Norway (Dollars per Thousand Cubic Feet)",1,"Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ngm_epg0_nus-nno_pml_dmcfm.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/ngm_epg0_nus-nno_pml_dmcfm.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov"

167

Modelling the effects of climate change on the energy systemA case study of Norway  

Science Journals Connector (OSTI)

The overall objective of this work is to identify the effects of climate change on the Norwegian energy system towards 2050. Changes in the future wind- and hydro-power resource potential, and changes in the heating and cooling demand are analysed to map the effects of climate change. The impact of climate change is evaluated with an energy system model, the MARKAL Norway model, to analyse the future cost optimal energy system. Ten climate experiments, based on five different global models and six emission scenarios, are used to cover the range of possible future climate scenarios and of these three experiments are used for detailed analyses. This study indicate that in Norway, climate change will reduce the heating demand, increase the cooling demand, have a limited impact on the wind power potential, and increase the hydro-power potential. The reduction of heating demand will be significantly higher than the increase of cooling demand, and thus the possible total direct consequence of climate change will be reduced energy system costs and lower electricity production costs. The investments in offshore wind and tidal power will be reduced and electric based vehicles will be profitable earlier.

Pernille Seljom; Eva Rosenberg; Audun Fidje; Jan Erik Haugen; Michaela Meir; John Rekstad; Thore Jarlset

2011-01-01T23:59:59.000Z

168

Hydropower'10 6th International Hydropower Conference, 13 February 2010, Troms, NORWAY Understanding Future Climate Impacts on Scotland's  

E-Print Network [OSTI]

Hydropower'10 ­ 6th International Hydropower Conference, 13 February 2010, Tromsø, NORWAY Understanding Future Climate Impacts on Scotland's Hydropower Resource Niall Duncan*, Gareth. P. Harrison and A energy by 2020. As hydropower currently makes up over 10% (1383 MW) of Scotland's installed generation

Harrison, Gareth

169

Failure to find aversive marking of toxic foods by Norway rats BENNETT G. GALEF, JR, SHANNON PRETTY & ELAINE E. WHISKIN  

E-Print Network [OSTI]

Failure to find aversive marking of toxic foods by Norway rats BENNETT G. GALEF, JR, SHANNON PRETTY in an area soiled by demonstrators that had not learned to avoid the food, the naive rats ate an equal amount rats to learn socially to avoid foods in areas that conspecifics soil after becoming ill. ? 2006

Galef Jr., Bennett G.

170

Norsun AS | Open Energy Information  

Open Energy Info (EERE)

Norsun AS Norsun AS Jump to: navigation, search Name Norsun AS Place Oslo, Norway Zip NO-0151 Product Norwegian manufacturer of monocrystalline ingots and PV wafers. Coordinates 59.91228°, 10.74998° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91228,"lon":10.74998,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

171

MultiPower ASA Formerly Jumpit ASA | Open Energy Information  

Open Energy Info (EERE)

MultiPower ASA Formerly Jumpit ASA MultiPower ASA Formerly Jumpit ASA Jump to: navigation, search Name MultiPower ASA (Formerly Jumpit ASA) Place Oslo, Norway Zip N-0117 Product Norwegian firm focused on the development of batteries, both rechargeable and disposable. Coordinates 59.91228°, 10.74998° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91228,"lon":10.74998,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

172

Elkem Solar | Open Energy Information  

Open Energy Info (EERE)

Elkem Solar Elkem Solar Jump to: navigation, search Name Elkem Solar Place Oslo, Norway Zip 303 Sector Solar Product Norwegian manufacturer of solar grade silicon that uses metallurgical process. Coordinates 59.91228°, 10.74998° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91228,"lon":10.74998,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

173

Towards a flexible energy system A case study for Inland Norway  

Science Journals Connector (OSTI)

Abstract This paper analyze the benefits of the use of bioenergy, solar thermal and wind energy in a flexible energy system to increase the share of renewable sources (RES) in primary energy supply, reduce primary energy consumption (PEC) and ensure power supply security in Inland Norway, and Norway at large. Firstly, the Inland reference energy system was built and validated using the EnergyPLAN system analysis tool based on the year 2009. Two alternative systems (scenarios), mainly of bio-heat and heat pumps in individual and district heating systems were then constructed and compared with the reference system using EnergyPLAN. The quality of a given energy system can be best described by its PEC, RES, emission levels and socio-economic costs. The result shows that it is plausible to improve the quality of the Inland energy system by optimal resource assortment in the energy mix. Integrated use of bio-heat and heat pumps in individual and district heating systems, as a replacement for direct electric heaters would reduce PEC and socio-economic costs considerably more than intensive bio-heating deployment alone, thereby increasing total domestic green electricity generation. The ability to integrate wind power and its value in the Inland energy system is more reflected by reducing imports of electricity during peak demand periods in winter, as wind power availability in the region is significant as opposed to the low precipitation during these periods. In addition, increasing wind energy penetration helps to limit biomass consumption in a district heating system built on heat pumps and bio-heat boilers.

Dejene Assefa Hagos; Alemayehu Gebremedhin; Bjrn Zethraeus

2014-01-01T23:59:59.000Z

174

Model-based Risk Assessment to Improve Enterprise Security Jan yvind Aagedal  

E-Print Network [OSTI]

11 0QX, UK # Institute for Energy Technology, P.O. Box 173, N-1751 Halden, Norway INTRACOM, 19.5 Km and Informatics, P.O.Box 124, Blindern, N-0314 Oslo, Norway § CLRC Rutherford Appleton Laboratory, Oxfordshire, OX: Intracom (Greece), Solinet (Germany) and Telenor (Norway); seven research institutes: CTI and FORTH (Greece

Stølen, Ketil

175

([SHULHQFHV IURP 8VLQJ 06& 80/ DQG 6'/ LQ WKH 'HYHORSPHQW RI WKH )$0( &RPPXQLFDWLRQ 0DQDJHU  

E-Print Network [OSTI]

was carried out in full at the Institute for Energy Technology (IFE) in Halden, Norway. The FCM development reports was carried out in full at the Institute for Energy Technology (IFE) in Halden, Norway. The first Stølen SINTEF Telecom and Informatics, Oslo, Norway Peter Mohn Deimos AG, Zurich, Switzerland DEVWUDFW

Stølen, Ketil

176

The CORAS Framework for a Model-Based Risk Management Process  

E-Print Network [OSTI]

for Energy Technology, Halden, Norway {Rune.Fredriksen,Monica Kristiansen,Bjorn-Axel Gran}@hrp.no http://www.ife.no 2 Sintef Telecom and Informatics, Oslo, Norway Ketil.Stolen@informatics.sintef.no http://www.sintef.no 3 Telenor Communications AS R&D, Fornebu, Norway Tom-Arthur.Opperud@telenor.com http

Stølen, Ketil

177

Adult Height, Insulin, and 17?-Estradiol in Young Women  

Science Journals Connector (OSTI)

...in the Norwegian Energy Balance and Breast...locally in Northern Norway during 2000 to...daily intake of energy and nutrients was...University of Oslo, Norway (15). Height...World War II in Norway (18) support that energy restriction, as...

Sissi Espetvedt Finstad; Aina Emaus; Steinar Tretli; Grazyna Jasienska; Peter T. Ellison; Anne-Sofie Furberg; Erik A. Wist; and Inger Thune

2009-05-01T23:59:59.000Z

178

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

179

Publicprivate partnership for improved hydrocarbon recovery Lessons from Norway's major development programs  

Science Journals Connector (OSTI)

Abstract Oil and gas field extraction strategies built on winwin publicprivate partnerships facilitate adaptation to new opportunities created by developments in science, technology and social structures. Such partnerships produce far more effective and efficient solutions than what may be achieved through neutral or confrontational partnerships. We define partnership broadly; to include both fiscal and regulatory interactions, development of hard and soft infrastructure as well as formal partnerships between public and private entities engaged in technology and field development. The partnerships are shaped to respect the obligations that each party has to their constituencies. The analysis uses Norway to illustrate how both government and industry can adapt to the geologic, technical, and commercial realities to enable more effective oil and gas recovery projects and thus increase the total economic value captured. The collaboration process we describe is comprehensive and long-lasting. It depends critically on integrative dynamic capabilities of both the public and the private side. We show that effective publicprivate partnerships greatly reduce the risks to each partner by shaping conditions that minimize uncertainty in the behavior of all partners. Strategy can then focus on getting the job done.

Knut m; Sigurd Heiberg

2014-01-01T23:59:59.000Z

180

Analysis of a Low-level Coastal Jet off the Western Coast of Norway  

Science Journals Connector (OSTI)

Abstract Offshore wind installations depend strongly on an improved knowledge of the atmospheric and ocean conditions affecting the marine atmospheric boundary layer (MABL). In particular the better understanding of atmospheric phenomena that are related to extreme atmospheric and sea state conditions e.g. high levels of wind speed, wind shear, waves and turbulence, is crucially important for offshore applications. This study investigates a low level coastal jet off the Western coast of Norway on 20 March 2011, using both in situ data and model results. The analysis is focused on parameters that are relevant to wind energy such as wind speed, turbulence intensity and wind shear. The jet is characterized by high wind speeds, moderate turbulence intensity and significant high wind shear. Furthermore, the structure and the dynamical characteristics of the low level coastal flow are investigated from the model results. The results show a maximum wind speed, greater than 30 m/s, between 500 to 800 m height above the sea level and at 15-20km distance from the coast.

Konstantinos Christakos; George Varlas; Joachim Reuder; Petros Katsafados; Anastasios Papadopoulos

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

The impact of future energy demand on renewable energy production Case of Norway  

Science Journals Connector (OSTI)

Abstract Projections of energy demand are an important part of analyses of policies to promote conservation, efficiency, technology implementation and renewable energy production. The development of energy demand is a key driver of the future energy system. This paper presents long-term projections of the Norwegian energy demand as a two-step methodology of first using activities and intensities to calculate a demand of energy services, and secondly use this as input to the energy system model TIMES-Norway to optimize the Norwegian energy system. Long-term energy demand projections are uncertain and the purpose of this paper is to illustrate the impact of different projections on the energy system. The results of the analyses show that decreased energy demand results in a higher renewable fraction compared to an increased demand, and the renewable energy production increases with increased energy demand. The most profitable solution to cover increased demand is to increase the use of bio energy and to implement energy efficiency measures. To increase the wind power production, an increased renewable target or higher electricity export prices have to be fulfilled, in combination with more electricity export.

Eva Rosenberg; Arne Lind; Kari Aamodt Espegren

2013-01-01T23:59:59.000Z

182

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

183

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

184

The Open Inorganic Chemistry Journal, 2008, 2, 11-17 11 1874-0987/08 2008 Bentham Science Publishers Ltd.  

E-Print Network [OSTI]

in memory applications [8] and metal gate electrodes [6,9] because of its low resistivity and high thermal Rohm and Haas Electronic Materials, 60 Willow Street, North Andover, MA 01845, USA 2 Centre for Materials Science and Nanotechnology, University of Oslo, PO Box 1033, Oslo N-0315, Norway 3 IBM

185

Low-field vortex matter in YBa2Cu3O7 : An atomic beam magnetic-resonance study Harald Hauglin  

E-Print Network [OSTI]

the rate that rf magnetic-resonance hyperfine tran- sitions are excited in atoms as they pass over Department of Physics, University of Oslo, N-0316 Oslo, Norway Nathan G. Woodard, Samuel Dapore-Schwartz, and Gregory P. Lafyatis Department of Physics, The Ohio State University, Columbus, Ohio 43210-1106 Received

Johansen, Tom Henning

186

Asymptotic Behaviour of Random Vandermonde Matrices with Entries on the Unit Circle  

E-Print Network [OSTI]

types of matrices, such as Vandermonde matrices with and without uniform phase distributions, as well with important tools in the field such as the FFT [1] or Hadamard [2] transforms, to name a few. Vandermonde, Uni- versity of Oslo, P.O. Box 1053 Blindern, NO-0316 Oslo, NORWAY, oyvin- dry@ifi.uio.no M

Paris-Sud XI, Université de

187

Reports and other Publications  

Science Journals Connector (OSTI)

... 10-75 dollars. (Baltimore, Md.: Williams and Wilkins Company 1963.) [184Norsk Polarinstitutt. (Det Kongelige Department for Industri og Hand-verk). Skrifter Nr. 114: ... Norway. By Adolf Hoel and Johannes Norvik. Pp. 242. 30 Kr. (Oslo: Norsk Polarinstitutt, 1962. Distributed by Oslo University Press.) [184

1963-05-11T23:59:59.000Z

188

Reports and other Publications  

Science Journals Connector (OSTI)

... 85. 7 florins. ('S-Gravenhage: Staatsdrukkerij- en Uitgeverijbedrijf, 1957.) [131 Norsk Polarinstitutt, Oslo. Skrifter. Nr. 109: The Quaternary Geology of Brageneset, Nordaustlandet, ... Dammed Lakes in Norway. By Olav Liestel. Pp. 29. 2 Kr. (Oslo: Norsk Polarinstitutt, 1956 and 1957.) [131 Yearbook of Forest Products Statistics, 1957. Pp ...

1958-04-12T23:59:59.000Z

189

Theoretical Determination of the Dissociation Energy of Molecular Hydrogen  

E-Print Network [OSTI]

Theoretical Determination of the Dissociation Energy of Molecular Hydrogen Konrad Piszczatowski and Computational Chemistry, University of Oslo, P.O. Box 1033 Blindern, N-0315 Oslo, Norway, Department Physics, University of Warsaw, Hoza 69, 00-681 Warsaw, Poland Abstract The dissociation energy

Pachucki, Krzysztof

190

26 March 1999 Z .Chemical Physics Letters 302 1999 437446  

E-Print Network [OSTI]

26 March 1999 Z .Chemical Physics Letters 302 1999 437­446 Basis-set convergence of the energy of Chemistry, Uni?ersity of Oslo, P.O. Box 1033 Blindern, N-0315 Oslo, Norway Received 18 December 1998­Fock total energy and binding energy is investigated for the correlation-consistent cc-pVXZ basis sets

Helgaker, Trygve

191

Models of Environment and T1 Relaxation in Josephson Charge Qubits Lara Faoro,1  

E-Print Network [OSTI]

08540, USA 4 Department of Physics, University of Oslo, P.O. Box 1048 Blindern, 0316 Oslo, Norway 5 A. F with Josephson energy EJ pierced by an external magnetic field. Provided that Ec EJ T (where Ec, EJ, and T are correspondingly the charging energy, Josephson energy, and temperature, kB @ 1), only two charge states j0i

Johansen, Tom Henning

192

Resting and daily energy expenditures of free-living field voles are positively correlated but reflect  

E-Print Network [OSTI]

, University of Oslo, P.O. Box 1050 Blindern, 0316 Oslo, Norway; Aberdeen Centre for Energy RegulationResting and daily energy expenditures of free-living field voles are positively correlated and Obesity, Division of Energy Balance and Obesity, Rowett Research Institute, Bucksburn, Aberdeen AB24 9SB

Lambin, Xavier

193

THE ASTROPHYSICAL JOURNAL, 564:508524, 2002 January 1 ( 2002. The American Astronomical Society. All rights reserved. Printed in U.S.A.  

E-Print Network [OSTI]

mechanical energy in the overlying chromo- spheric and coronal plasmas. The question remains unanswered Astrophysics, University of Oslo, Box 1029, N-0315 Blindern, Oslo, Norway. 2 HAO/NCAR, Box 3000, Boulder, in the network and internetwork photosphere, in the deep solar interior, and in the distant solar wind. We detect

Stein, Robert

194

Annales Geophysicae (2004) 22: 28912905 SRef-ID: 1432-0576/ag/2004-22-2891  

E-Print Network [OSTI]

, University of New Hampshire, NH, USA 2Department of Physics, University of Oslo, Oslo, Norway 3Department of the bifurcation line (geomagnetic Bx>0) when a solar wind dynamic pressure release shifted the spacecraft footprint of the region of Cluster flow bursts, FAST observed an ion energy- latitude disperison

Paris-Sud XI, Université de

195

Nonlin. Processes Geophys., 17, 3747, 2010 www.nonlin-processes-geophys.net/17/37/2010/  

E-Print Network [OSTI]

. Mesoscale anticyclones appear as "islands" of increased penetration of wind energy into the ocean interior correlated with the degree of stratification. The wind energy injected at the surface is transferred at depth. Ceballos2, and A. Bracco2 1Institute of Geosciences, University of Oslo, 1022 Blinden, 0315 Oslo, Norway 2

Koszalka, Inga Monika

196

Simulations of crescent water wave patterns on finite depth . Kristiansen, D. Fructus, D. Clamond, and J. Grue  

E-Print Network [OSTI]

, and J. Grue Department of Mathematics, University of Oslo, P.O. Box 1053 Blindern, NO-0316 Oslo, Norway waves," Phys. Fluids 27, 2595 1984 . Also, a recurrent five-wave instability can boost the energy. For this purpose, small nonconservative effects resembling weak wind and weak breaking were added to the otherwise

Clamond, Didier

197

Astronomy & Astrophysics manuscript no. 3259 July 9, 2003 (DOI: will be inserted by hand later)  

E-Print Network [OSTI]

of Theoretical Astrophysics, University of Oslo, PB 1029 Blindern, 05315 Oslo, Norway 9 Astrophysikalisches of #11;2 = 2:11 #6; 0:07. The UV-optical spectral energy distribution (SED) around 14 hours after into an external environment that has a constant mean density rather than a wind-fed density structure. We estimate

Fynbo, Johan

198

arXiv:1205.5114v1[astro-ph.SR]23May2012 370 Years of Astronomy at Utrecht  

E-Print Network [OSTI]

Astrophysics, University of Oslo, P.O. Box 1029, Blindern, N­0315 Oslo, Norway Abstract. Type-II solar spicules appear as long, thin, highly dynamic strands of field-tied matter that feed significant mass and energy to the corona and solar wind. A recent result is that they exhibit torsional Alfv´en waves in addition

Rutten, Rob

199

Multimodel estimates of intercontinental source-receptor relationships for ozone pollution  

E-Print Network [OSTI]

. Pyle,11 S. Schroeder,4 M. G. Vivanco,30 P. Wind,24 G. Wojcik,31 S. Wu,23,32 and A. Zuber33 Received 21., Omakau, New Zealand. 13 Atmospheric Earth and Energy Division, Lawrence Livermore National Laboratory Department of Geosciences, University of Oslo, Oslo, Norway. 20 Air Quality Research Division, Science

200

Ann. Geophys., 25, 191205, 2007 www.ann-geophys.net/25/191/2007/  

E-Print Network [OSTI]

Annales Geophysicae The magnetosphere under weak solar wind forcing C. J. Farrugia1, A. Grocott2, P. E of Oslo, Oslo, Norway 4Solar-Terrestrial Environment Laboratory, Nagoya University, Japan 5Air Force flux, the convection is generally weak and patchy, which we ascribe to the lack of solar wind driver

Boyer, Edmond

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Annales Geophysicae (2003) 21: 693708 c European Geosciences Union 2003 Geophysicae  

E-Print Network [OSTI]

, MD 20771, USA 2University of Leicester, Leicester, LE1 7RH, UK 3University of Oslo, Oslo, Norway), has proven to explain success- fully many aspects of the transport of mass, momentum and energy from the solar wind into the near-Earth magneto- spheric region. The principal controller of dayside reconnec

Paris-Sud XI, Université de

202

THE UNFOLDING AND RENATURATION OF A SPECIFIC UNIVALENT ANTIBODY FRAGMENT  

Science Journals Connector (OSTI)

...Its conjugate to polystyrene was prepared by the method of Gyner and Sehon,12 using polyaminopolystyrene purchased from Norsk Hydrelectrik Co. (Oslo, Norway). Guanidine hydrochloride was prepared from Eastman guanidine carbonate by the method of...

C. E. Buckley III; Philip L. Whitney; Charles Tanford

1963-01-01T23:59:59.000Z

203

NATIONAL ACADEMY OF SCIENCES: July 1, 1954  

Science Journals Connector (OSTI)

...Fysikalisk-Kemiska Institutionen, Uppsala University, Uppsala, Sweden Sverdrup, Harald Ulrik, (1945)* 1952 (13), Norsk Polarinstitutt, Observatoriegt 1, Oslo, Norway Taylor, Sir Geoffrey I., 1945 (1), Trinity College, Cambridge, England...

1954-01-01T23:59:59.000Z

204

NATIONAL ACADEMY OF SCIENCES: July 1, 1955  

Science Journals Connector (OSTI)

...Fysikalisk-Kemiska Institutionen, Uppsala University, Uppsala, Sweden Sverdrup, Harald Ulrik, (1945)* 1952 (13), Norsk Polarinstitutt, Observatoriegt 1, Oslo, Norway Taylor, Sir Geoffrey Ingram, 1945 (1), Trinity College, Cambridge...

1955-01-01T23:59:59.000Z

205

N.A.S. Organization: July 1, 1957  

Science Journals Connector (OSTI)

...Fysikalisk-Kemiska Institutionen, Uppsala University, Uppsala, Sweden Sverdrup, Harald Ulrik, (1945)* 1952 (13), Norsk Polarinstitutt, Observatoriegt 1, Oslo, Norway Taylor, Sir Geoffrey Ingram, 1945 (1), Trinity College, Cambridge...

1957-01-01T23:59:59.000Z

206

NATIONAL ACADEMY OF SCIENCES: July 1, 1956  

Science Journals Connector (OSTI)

...Fysikalisk-Kemiska Institutionen, Uppsala University, Uppsala, Sweden Sverdrup, Harald Ulrik, (1945)* 1952 (13), Norsk Polarinstitutt, Observatoriegt 1, Oslo, Norway Taylor, Sir Geoffrey Ingram, 1945 (1), Trinity College, Cambridge...

1956-01-01T23:59:59.000Z

207

The specific induction of myc protooncogene expression in normal human B cells is not a sufficient event for acquisition of competence to proliferate  

Science Journals Connector (OSTI)

...PFEIFER-OHLSSON?, AND ROLF OHLSSON? tLaboratory of Immunology, Department of Pathology and the Norwegian Cancer Society, Norsk Hydro's Institute for Cancer Research, The Norwegian Radiumhospital, Montebello, Oslo 3, Norway; tDepartment of Microbiology...

E Smeland; T Godal; E Ruud; K Beiske; S Funderud; E A Clark; S Pfeifer-Ohlsson; R Ohlsson

1985-01-01T23:59:59.000Z

208

UPb and geochemical evidence for a Cryogenian magmatic arc in central Novaya Zemlya, Arctic Russia  

E-Print Network [OSTI]

U­Pb and geochemical evidence for a Cryogenian magmatic arc in central Novaya Zemlya, Arctic Russia-0349 Oslo, Norway Introduction The High Arctic of Scandinavia and Russia consists of a collage

Svensen, Henrik

209

Production of Large Quantities of Heavy Water  

Science Journals Connector (OSTI)

... concentrates of the new water are now produced on a large scale in Norway by Norsk Hydro-Elektrisk Kvlstofaktieselskab, Oslo. Large quantities of 1: 300-water can be ...

LEIF TRONSTAD

1934-06-09T23:59:59.000Z

210

E-Print Network 3.0 - aivo lepland atko Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

aivo lepland atko Page: << < 1 2 3 4 5 > >> 1 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Summary:...

211

E-Print Network 3.0 - aivo lepland tiit Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

aivo lepland tiit Page: << < 1 2 3 4 5 > >> 1 Sedimentation and chronology of heavy metal pollution in Oslo harbor, Norway Aivo Lepland a,*, Thorbjrn J. Andersen b Summary:...

212

Abstract 4876: Characterization of malignant melanoma growth triggered by the brain microenvironment in experimental metastasis models  

Science Journals Connector (OSTI)

...malignant melanoma growth triggered by the brain microenvironment in experimental metastasis...University Hospital, Oslo, Norway. The brain offers a unique microenvironment to which...molecular determinants that promote melanoma brain metastases however, remain largely unknown...

Vigdis Nygaard; Lina Prasmickaite; Kotryna Vasiliauskaite; Trevor Clancy; Eivind Hovig

2014-10-01T23:59:59.000Z

213

Urinary Excretion of Flavonoids Reflects Even Small Changes in the Dietary Intake of Fruits and Vegetables  

Science Journals Connector (OSTI)

...Medical faculty, University of Oslo, Norway. Inclusion criteria were a BMI 30 kg...Composition All subjects had diets with energy levels related to their energy needs. The relative content of energy from protein, fat, and carbohydrates...

Asgeir Brevik; Salka Elbl Rasmussen; Christian A. Drevon; and Lene Frost Andersen

2004-05-01T23:59:59.000Z

214

ARABIDOPSIS CRINKLY4 Function, Internalization, and Turnover Are Dependent on the Extracellular Crinkly Repeat Domain  

Science Journals Connector (OSTI)

...interaction between KAPP and SERK (revealed by fluorescence resonance energy transfer) occurs in internalized vesicles rather than at the...Probes) and Protein-A coupled Dynabeads (Dynal, Oslo, Norway) following the manufacturers instructions with room temperature...

Miriam L. Gifford; Fiona C. Robertson; Dinesh C. Soares; Gwyneth C. Ingram

2005-03-16T23:59:59.000Z

215

Abstract. The convergence properties of Gaussian orbitals are studied by considering a very simple system,  

E-Print Network [OSTI]

. We have studied the convergence of the total energy, the kinetic energy, the extent of the atom the atomic orbitals are represented numerically on a spatial grid. Detailed studies of the energy convergence Oslo, Norway Received: 1 April 2003 / Accept

Helgaker, Trygve

216

Harmful routines? Uncertainty in science and conflicting views on routine petroleum operations in Norway  

Science Journals Connector (OSTI)

Abstract Offshore petroleum activities are the focus of highly politicised debates globally. Typically, public debate is sparked by catastrophic events, such as the 2010 oil spill in the Gulf of Mexico, and decision-making processes fuelled by the assessment of worst-case scenarios. However, everyday routine petroleum operations also impact the marine ecosystems and adjoining socio-economic sectors, but the extent and severity of the impacts are uncertain. This paper takes as its point of departure routine operations and their surrounding uncertainties. Particularly, it focuses on the debates of whether to extend routine petroleum operations in vulnerable and valuable parts of Norway, such as the Lofoten area and the Sula Ridge. These conflicts draw on important and for some, epistemological uncertainties that surround the impacts of routine operations. The paper argues that it is necessary to first highlight these uncertainties, rather than marginalise them, and second, recognise that uncertainties are not simply a scientific challenge, but can be a powerful political tool. This paper unpacks and explores uncertainties associated with three phases of routine operations, that are used to steer political actions: (i) the impacts of seismic surveys on fish and marine mammals; (ii) the impacts of drilling mud and drill cuttings on benthic communities such as deep-sea coral reefs; and (iii) the impacts of produced water on the marine environment. The paper discusses the importance of transparency in addressing these uncertainties, and emphasises the need to implement the precautionary principle in a more participatory way. It thus proposes participatory exercises in order to allow the recognition of the epistemological nature of uncertainties.

Anne Blanchard; Kjellrun Hiis Hauge; Gisle Andersen; Jan Helge Foss; Bjrn Einar Grsvik; Nils Olav Handegard; Matthias Kaiser; Sonnich Meier; Erik Olsen; Frode Vikeb

2014-01-01T23:59:59.000Z

217

Heavy metals in blue mussels (mytilus edulis) in the Bergen Harbor area, Western Norway  

SciTech Connect (OSTI)

Heavy metal discharges to the marine environment are of great concern all over the world. Both essential (e.g., Fe, Zn, Cu) and non essential (e.g., Hg, Cd, Pb) metals are toxic to living organism when subjected to high concentration. Many heavy metals accumulate in organisms and some also accumulate in the food chain. The anthropogenic heavy metal outlets can in this way both reduce marine species diversity and ecosystem. Further, by consuming seafood, humans will be exposed to the metals with a potential danger to human health. Goldberg proposed to use marine mussels to monitor contamination levels of coastal waters. Since then marine mussels, especially the blue mussel (Mytilus edulis), has been used widely as a surveillance organism. The blue mussel is regarded a suitable species for this purpose because it accumulates metals, it sessile, has a relatively long life span, is large enough for individual analysis, can tolerate a relatively wide range of temperature and salinity regimes, and can also synthesize the metal-binding protein, metallothionein, for metal detoxification. Furthermore, the blue mussel is a popular and tasteful food source and is suitable for culturing. The world-wide annual yield of mussels during the period 1988 to 1992 was about 1.3 million tons, of which about 0.5 million tons was Mytilus edulis. In Norway, the annual production was 77 tons in 1990. The interest of culturing mussels has increased in recent years, but the consumption of mussels has been hampered both by toxic algae and high levels of heavy metals. The latter is of special concern to those close to urban or industrial areas. This study investigated whether blue mussels in the Bergen Harbor area were contaminated with the heavy metals zinc, copper, lead, cadmium, and mercury, evaluating whether humans could eat them. 21 refs., 6 figs.

Andersen, V.; Johannessen, P.J. [Univ. of Bergen (Norway)] [Univ. of Bergen (Norway); Maage, A. [Directorate of Fisheries, Bergen (Norway)] [Directorate of Fisheries, Bergen (Norway)

1996-12-31T23:59:59.000Z

218

Ozone induces glucose intolerance and systemic metabolic effects in young and aged brown Norway rats  

SciTech Connect (OSTI)

Air pollutants have been associated with increased diabetes in humans. We hypothesized that ozone would impair glucose homeostasis by altering insulin signaling and/or endoplasmic reticular (ER) stress in young and aged rats. One, 4, 12, and 24 month old Brown Norway (BN) rats were exposed to air or ozone, 0.25 or 1.0 ppm, 6 h/day for 2 days (acute) or 2 d/week for 13 weeks (subchronic). Additionally, 4 month old rats were exposed to air or 1.0 ppm ozone, 6 h/day for 1 or 2 days (time-course). Glucose tolerance tests (GTT) were performed immediately after exposure. Serum and tissue biomarkers were analyzed 18 h after final ozone for acute and subchronic studies, and immediately after each day of exposure in the time-course study. Age-related glucose intolerance and increases in metabolic biomarkers were apparent at baseline. Acute ozone caused hyperglycemia and glucose intolerance in rats of all ages. Ozone-induced glucose intolerance was reduced in rats exposed for 13 weeks. Acute, but not subchronic ozone increased ?{sub 2}-macroglobulin, adiponectin and osteopontin. Time-course analysis indicated glucose intolerance at days 1 and 2 (2 > 1), and a recovery 18 h post ozone. Leptin increased day 1 and epinephrine at all times after ozone. Ozone tended to decrease phosphorylated insulin receptor substrate-1 in liver and adipose tissues. ER stress appeared to be the consequence of ozone induced acute metabolic impairment since transcriptional markers of ER stress increased only after 2 days of ozone. In conclusion, acute ozone exposure induces marked systemic metabolic impairments in BN rats of all ages, likely through sympathetic stimulation. - Highlights: Air pollutants have been associated with increased diabetes in humans. Acute ozone exposure produces profound metabolic alterations in rats. Age influences metabolic risk factors in aging BN rats. Acute metabolic effects are reversible and repeated exposure reduces these effects. Ozone metabolic effects are only slightly exacerbated in geriatric rats.

Bass, V. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gordon, C.J.; Jarema, K.A.; MacPhail, R.C. [Toxicity Assessment Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Cascio, W.E. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Phillips, P.M. [Toxicity Assessment Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Ledbetter, A.D.; Schladweiler, M.C. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Andrews, D. [Research Cores Unit, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Miller, D. [Curriculum in Toxicology, University of North Carolina, Chapel Hill, NC (United States); Doerfler, D.L. [Research Cores Unit, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Kodavanti, U.P., E-mail: kodavanti.urmila@epa.gov [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

2013-12-15T23:59:59.000Z

219

A complete record of Holocene glacier variability at Austre Okstindbreen, northern Norway: an integrated approach  

Science Journals Connector (OSTI)

Arctic glaciers are currently undergoing major changes, but accurate knowledge about how they varied during the entire Holocene is still scarce. Here we present a new complete glacier record from Austre Okstindbreen in Nordland, northern Norway. This reconstruction is based on a number of short and long cores retrieved from several downstream basins, which have been analyzed by a suite of methods including geochemical elements (XRF), rock magnetic properties, dry bulk density (DBD) and Loss-on-ignition (LOI). Lake sediment distribution was surveyed and mapped prior to coring by the use of ground penetrating radar (GPR). Independently lichen-dated marginal moraines and historical information about the glacier frontal positions from old photographs and maps have made it possible to link the moraine sequence to the 210Pb dated lake sediment chronology. This integrated approach reveals that Austre Okstindbreen is the first known glacier in Scandinavia to possibly have survived the Holocene Thermal Optimum. It also brackets the four largest glacier advances to c 74007000, 14001200, 900700 and 300150 years before AD 2000 (b2k). In contrast to most reconstructed glaciers in Scandinavia, the largest glacier advance was not associated with the Little Ice Age, but rather to an earlier period centred at 1300 b2k. Both the moraine chronology and the lacustrine records document this Neoglacial advance. Compared to other glacier reconstructions from the Northern Hemisphere, we identify near-synchronous glacier advances occurring roughly at 4000 b2k; 2700 b2k; 1300 b2k and during the Little Ice Age. These correlative advances across the Northern Hemisphere suggest that these observed centennial-scale events are a shared feature regardless of the large geographical distances separating them. Some minor discrepancies between different geographical areas may be caused by lack of precise dating, but local climatic conditions may play a role as well.

Jostein Bakke; Svein Olaf Dahl; yvind Paasche; Joachim Riis Simonsen; Bjrn Kvisvik; Kristina Bakke; Atle Nesje

2010-01-01T23:59:59.000Z

220

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

von Clarmann, T. , and Stiller, G. P. : Short- and medium-B. , Lopez-Puertas, M. , Stiller, G. P. , von Clarmann,

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

sion estimates over South America from 2006 to 2010, J. Geo-biomass burn- ing in South America in 2005 observed duringand overesti- mated in South America, but these biases are

2012-01-01T23:59:59.000Z

222

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

Fig. 1. Climatology of lightning flashes in observations andwith scaling to match lightning flash rates observed by theis the grid-averaged lightning flash rate at the horizontal

2012-01-01T23:59:59.000Z

223

UNIVERSITY OF OSLO Department of Informatics  

E-Print Network [OSTI]

Nicolas Peltier Viorica Sofronie- Stokkermans ISBN 82-7368-347-8 ISSN 0806-3036 June 23, 2009 #12, July 2009 Proceedings Nicolas Peltier and Viorica Sofronie-Stokkermans (eds.) #12;#12;Preface to the FTP workshop series. Nicolas Peltier and Viorica Sofronie-Stokkermans iii #12;Programme committee

224

The chemical transport model Oslo CTM3  

E-Print Network [OSTI]

the-pole flow at the two pie-shaped grid boxes at each polesmall area of these polar-pie boxes, the Lifshitz limitertime step. Thus, each polar-pie box and its adjacent lower-

2012-01-01T23:59:59.000Z

225

Langlee Wave Power AS | Open Energy Information  

Open Energy Info (EERE)

Power AS Address: Smedsvingen 4 Entrance B 1st floor Place: Hvalstad Zip: 1395 Region: Norway Sector: Marine and Hydrokinetic Phone Number: +47 90044104 Website: http:...

226

Ing Arvid Nesheim | Open Energy Information  

Open Energy Info (EERE)

search Name: Ing Arvid Nesheim Address: Hoymyrmarka 123A Place: Vollen Zip: 1391 Region: Norway Sector: Marine and Hydrokinetic Phone Number: 47 951 08 439 Website: http:...

227

Long-term changes in acidification and recovery at nine calibrated catchments in Norway, Sweden and Finland Hydrology and Earth System Sciences, 5(3), 339349 (2001) EGS  

E-Print Network [OSTI]

and Finland 339 Hydrology and Earth System Sciences, 5(3), 339­349 (2001) © EGS Long-term changes in acidification and recovery at nine calibrated catchments in Norway, Sweden and Finland F. Moldan1 , R.F. Wright2, Finland 5 Finnish Meteorological Institute, Box 503, FIN-00101 Helsinki, Finland Email for corresponding

Paris-Sud XI, Université de

228

Recovery from acidification of lakes in Finland, Norway and Sweden 19901999 Hydrology and Earth System Sciences, 5(3), 327337 (2001) EGS  

E-Print Network [OSTI]

Recovery from acidification of lakes in Finland, Norway and Sweden 1990­1999 327 Hydrology and Earth System Sciences, 5(3), 327­337 (2001) © EGS Recovery from acidification of lakes in Finland, FIN-00251, Helsinki, Finland 3 University of Agricultural Sciences, PB 7050, S-75007 Uppsala, Sweden

Boyer, Edmond

229

Effects of Forest Management on Total Biomass Production and CO2 Emissions from use of Energy Biomass of Norway Spruce and Scots Pine  

Science Journals Connector (OSTI)

The aim of this study was to analyze the effects of forest management on the total biomass production (t ha-1a-1) and CO2 emissions (kg CO2 MWh-1) from use of energy biomass of Norway spruce and Scots pine grown ...

Johanna Routa; Seppo Kellomki; Harri Strandman

2012-09-01T23:59:59.000Z

230

ATTRACTIVENESS OF CARBON DISULFIDE TO WILD NORWAY RATS J. RUSSELL MASON, U.S. Deparunent of Agriculture, Animal and Plant Health Inspection Service, Denver Wildlife  

E-Print Network [OSTI]

Heiber 1976). When faced with a choice among several novel foods, naive (observer) rats choose novelATTRACTIVENESS OF CARBON DISULFIDE TO WILD NORWAY RATS J. RUSSELL MASON, U.S. Deparunent) increases the attractiveness of feeding stations to rats and mice. Bait consumption is also increased

Galef Jr., Bennett G.

231

Reports and other Publications  

Science Journals Connector (OSTI)

... Hos Andr. Fr. H0st and Son, 1967.) 9.75 D.kr. [59Norsk Polarinstitutt. Skrifter Nr. 141: Storbreen Glacier in Jotun-heimen, Norway. By Olav ... Storbreen Glacier in Jotun-heimen, Norway. By Olav Liestel. Pp. 63. (Oslo: Norsk Polarinstitutt, 1967.) [59

1967-11-25T23:59:59.000Z

232

Reports and Publications  

Science Journals Connector (OSTI)

... Book. Pp. 230. (Rome: International Council of Scientific Unions, 1970.) [226Norsk Polarinstitutt. Skrifter Nr. 151: Glaciological Investigations of Store Supphellebre, West-Norway. By ... Investigations of Store Supphellebre, West-Norway. By Olav Orheim. Pp. 48. (Oslo: Norsk Polarinstitutt, 1970.) [226

1970-08-01T23:59:59.000Z

233

A Denotational Model for Component-Based Risk Analysis  

E-Print Network [OSTI]

matches the value of the assets to be protected. A certain level of risk may be acceptable if the riskA Denotational Model for Component-Based Risk Analysis Gyrd Brændeland1,2, , Atle Refsdal2 , and Ketil Stølen1,2 1 Department of Informatics, University of Oslo, Norway 2 SINTEF, Norway Abstract. Risk

Stølen, Ketil

234

Annales Geophysicae (2005) 23: 123134 SRef-ID: 1432-0576/ag/2005-23-123  

E-Print Network [OSTI]

and subsequent magnetotail reconnection transfer solar wind plasma and energy to the magnetospheric of Physics, University of Oslo, Norway 3University Centre on Svalbard, Longyearbyen, Norway 4Rutherford merging between the interplanetary and terrestrial magnetic fields couples the solar wind electric field

Paris-Sud XI, Université de

235

Ann. Geophys., 25, 661673, 2007 www.ann-geophys.net/25/661/2007/  

E-Print Network [OSTI]

). High energy protons, originating from the magnetosphere and the solar wind, precipitate along, France 2Plasma and Space Physics Group, Department of Physics, University of Oslo, Norway 3Department of Arctic Geophysics, University Centre in Svalbard (UNIS), Longyearbyen, Norway 4Solar

Paris-Sud XI, Université de

236

Comparing 13 magnetotail reconnection events observed by A. L. Borg1  

E-Print Network [OSTI]

before reconnection onset and the average solar wind energy input to the magnetosphere reaches a maximum of Oslo, Norway 2 Space Sciences Laboratory, University of California, Berkeley, California, USA 3 Department of Physics, University of Bergen, Norway 4 Space and Atmospheric Physics, Imperial College, London

?stgaard, Nikolai

237

Tellus (2008), 60B, 300317 C 2008 The Authors Journal compilation C 2008 Blackwell Munksgaard  

E-Print Network [OSTI]

-Technical University of Denmark, Department of Wind Energy, Frederiksborgvej 399, P.O. 49, DK-4000 Roskilde, Denmark and Global Pollution Issues, P.O. Box 100, NO-2027 Kjeller, Norway; 9 Stockholm University, Department of Geosciences, P.O. Box 1022 Blindern, NO-0315 Oslo, Norway; 18 Norwegian Meteorological Institute, P.O. Box 43

Pryor, Sara C.

238

Use of post-Chernobyl data from Norway to validate the long-term exposure pathway models in the accident consequence code MACCS  

SciTech Connect (OSTI)

This paper describes a task performed for the US Nuclear Regulatory Commission (NRC), consisting of using post-Chernobyl data from Norway to verify or find areas for possible improvement in the chronic exposure pathway models utilized in the NRC's program for probabilistic risk analysis, level 3, of the MELCOR accident consequence code system (MACCS), developed at Sandia National Laboratories, Albuquerque, New Mexico. Because of unfortunate combinations of weather conditions, the levels of Chernobyl fallout in parts of Norway were quite high, with large areas contaminated to more than 100 kBq/m[sup 2] of radioactive cesium. Approximately 6% of the total amount of radioactive cesium released from Chernobyl is deposited on Norwegian territory, according to a countrywide survey performed by the Norwegian National Institute for Radiation Hygiene. Accordingly, a very large monitoring effort was carried out in Norway, and some of the results of this effort have provided important new insights into the ways in which radioactive cesium behaves in the environment. In addition to collection and evaluation of post-Chernobyl monitoring results, some experiments were also performed as part of the task. Some experiments performed pre-Chernobyl were also relevant, and some conclusions could be drawn from these. In most connections, the data available show the models and data in MACCS to be appropriate. A few areas where the data indicate that the MACCS approach is inadequate are, however, also pointed out in the paper.

Tveten, U. (Inst. for Energiteknikk, Kjeller (Norway))

1994-03-01T23:59:59.000Z

239

Reforming Brazil?s offshore oil and gas safety regulatory framework: Lessons from Norway, the United Kingdom and the United States  

Science Journals Connector (OSTI)

Abstract We propose reforming the Brazilian regulatory safety framework (BRSF) for offshore oil and gas production and drilling operations. Brazil has emerged as a leading offshore producer with extensive proven reserves yet to be exploited. However, the BRSF has not been updated since 2007, and there are now major concerns about the industry?s safety, particularly after the BP Deepwater Horizon accident, along with the technical challenges due to extreme conditions under which Brazil?s resources are located. Drawing on experiences from three leading offshore oil and gas producers (Norway, the UK, and the US), we recommend the adoption of three best practices: the UK?s safety case approach (where operators are expected to provide convincing and valid arguments that a system is sufficiently safe for a given application in a specific environment), Norway?s barrier management (evidence that there are at least two tested and independent barriers to avoid accidents) and greater investment in safety research and development, as suggested by the US?s National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling. We discuss implications for policy reform and how best practices can be applied within the Brazilian context.

Pietro A.S. Mendes; Jeremy Hall; Stelvia Matos; Bruno Silvestre

2014-01-01T23:59:59.000Z

240

Effects of wood chip ash fertilization on soil chemistry in a Norway spruce plantation on a nutrient-poor soil  

Science Journals Connector (OSTI)

Abstract Harvest of forest biomass for energy production may lead to export of nutrients from the forest. Recirculation of nutrients from wood chip combustion by ash spreading in forests has been proposed as a means for counteracting the nutrient export. This study was carried out to examine the effect of wood chip ash application on soil chemistry in a 44-year-old Norway spruce (Picea abies) plantation on a nutrient-poor soil in Denmark and to investigate the effect of applying different ash types and doses. Soil samples were collected and analyzed 2.5years (3 growing seasons) after ash application. This study shows that, regardless of ash formulation, preparation or dose, application of wood ash to forest soil has a liming effect in the O-horizon manifested as an increase in CECe, BS and pH. This effect was not seen in the mineral soil within the time frame of this study. At the same time, an increase in Cd was found in the O-horizon, corresponding to the amount added in the ashes. Generally, no other increase in soil contents of the heavy metals was seen. Hardening of the wood ash did not decrease the chemical impact on the soil chemistry as compared to non-treated ash whereas an increase in ash application dose increases the liming effect.

Morten Ingerslev; Mette Hansen; Lars Bo Pedersen; Simon Skov

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Remediation of Contaminated Marine Sediment Using Thin-Layer Capping with Activated CarbonA Field Experiment in Trondheim Harbor, Norway  

Science Journals Connector (OSTI)

Remediation of Contaminated Marine Sediment Using Thin-Layer Capping with Activated CarbonA Field Experiment in Trondheim Harbor, Norway ... Innovative chemical and biological monitoring methods were deployed to test capping effectiveness. ... (1) Two earlier pilot studies on AC amendment in the field have been established: one at Hunters Point, in San Francisco Bay, CA,(2, 3) and the other at Grasse River, NY.(1) The first field test aimed at remediating polychlorinated biphenyl (PCB)-contaminated mud flats in the San Francisco Bay, and the second field study was carried out on a permanently inundated freshwater river bed also contaminated with PCBs. ...

Gerard Cornelissen; Marie Elmquist Krus; Gijs D. Breedveld; Espen Eek; Amy M.P. Oen; Hans Peter H. Arp; Caroline Raymond; Gran Samuelsson; Jenny E. Hedman; ystein Stokland; Jonas S. Gunnarsson

2011-06-14T23:59:59.000Z

242

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

243

Toluene effects on oxidative stress in brain regions of young-adult, middle-age, and senescent Brown Norway rats  

Science Journals Connector (OSTI)

The influence of aging on susceptibility to environmental contaminants is not well understood. To extend knowledge in this area, we examined effects in rat brain of the volatile organic compound, toluene. The objective was to test whether oxidative stress (OS) plays a role in the adverse effects caused by toluene exposure, and if so, if effects are age-dependent. OS parameters were selected to measure the production of reactive oxygen species (NADPH Quinone oxidoreductase 1 (NQO1), NADH Ubiquinone reductase (UBIQ-RD)), antioxidant homeostasis (total antioxidant substances (TAS), superoxide dismutase (SOD), ?-glutamylcysteine synthetase (?-GCS), glutathione transferase (GST), glutathione peroxidase (GPX), glutathione reductase (GRD)), and oxidative damage (total aconitase and protein carbonyls). In this study, Brown Norway rats (4, 12, and 24months) were dosed orally with toluene (0, 0.65 or 1g/kg) in corn oil. Four hours later, frontal cortex, cerebellum, striatum, and hippocampus were dissected, quick frozen on dry ice, and stored at ?80C until analysis. Some parameters of OS were found to increase with age in select brain regions. Toluene exposure also resulted in increased OS in select brain regions. For example, an increase in NQO1 activity was seen in frontal cortex and cerebellum of 4 and 12month old rats following toluene exposure, but only in the hippocampus of 24month old rats. Similarly, age and toluene effects on glutathione enzymes were varied and brain-region specific. Markers of oxidative damage reflected changes in oxidative stress. Total aconitase activity was increased by toluene in frontal cortex and cerebellum at 12 and 24months, respectively. Protein carbonyls in both brain regions and in all age groups were increased by toluene, but step-down analyses indicated toluene effects were statistically significant only in 12month old rats. These results indicate changes in OS parameters with age and toluene exposure resulted in oxidative damage in frontal cortex and cerebellum of 12month old rats. Although increases in oxidative damage are associated with increases in horizontal motor activity in older rats, further research is warranted to determine if these changes in OS parameters are related to neurobehavioral and neurophysiological effects of toluene in animal models of aging.

Prasada Rao S. Kodavanti; Joyce E. Royland; Judy E. Richards; Jonathan Besas; Robert C. MacPhail

2011-01-01T23:59:59.000Z

244

Dynamics of the xanthophyll cycle and non-radiative dissipation of absorbed light energy during exposure of Norway spruce to high irradiance  

Science Journals Connector (OSTI)

Summary The response of Norway spruce saplings (Picea abies [L.] Karst.) was monitored continuously during short-term exposure (10 days) to high irradiance (HI; 1000?molm?2s?1). Compared with plants acclimated to low irradiance (100?molm?2s?1), plants after HI exposure were characterized by a significantly reduced CO2 assimilation rate throughout the light response curve. Pigment contents varied only slightly during HI exposure, but a rapid and strong response was observed in xanthophyll cycle activity, particularly within the first 3 days of the HI treatment. Both violaxanthin convertibility under HI and the amount of zeaxanthin pool sustained in darkness increased markedly under HI conditions. These changes were accompanied by an enhanced non-radiative dissipation of absorbed light energy (NRD) and the acceleration of induction of both NRD and de-epoxidation of the xanthophyll cycle pigments. We found a strong negative linear correlation between the amount of sustained de-epoxidized xanthophylls and the photosystem II (PSII) photochemical efficiency (FV/FM), indicating photoprotective down-regulation of the PSII function. Recovery of FV/FM at the end of the HI treatment revealed that Norway spruce was able to cope with a 10-fold elevated irradiance due particularly to an efficient NRD within the PSII antenna that was associated with enhanced violaxanthin convertibility and a light-induced accumulation of zeaxanthin that persisted in darkness.

Michal troch; Kristina Kuldov; Ji? Kalina; Vladimr punda

2008-01-01T23:59:59.000Z

245

L.J. van Vliet and P.W. Verbeek, Curvature and bending energy in digitized 2D and 3D images, in: SCIA'93, Proc. Scandinavian Conference on Image Analysis, Tromso, Norway, 1993, 1403-1410.  

E-Print Network [OSTI]

L.J. van Vliet and P.W. Verbeek, Curvature and bending energy in digitized 2D and 3D images, in: SCIA'93, Proc. 8th Scandinavian Conference on Image Analysis, Tromso, Norway, 1993, 1403-1410. Curvature and Bending Energy in Digitized 2D and 3D Images Lucas J. van Vliet and Piet W. Verbeek Pattern

van Vliet, Lucas J.

246

L.J. van Vliet and P.W. Verbeek, Curvature and bending energy in digitized 2D and 3D images, in: SCIA'93, Proc. 8 th Scandinavian Conference on Image Analysis, Tromso, Norway, 1993, 14031410.  

E-Print Network [OSTI]

L.J. van Vliet and P.W. Verbeek, Curvature and bending energy in digitized 2D and 3D images, in: SCIA'93, Proc. 8 th Scandinavian Conference on Image Analysis, Tromso, Norway, 1993, 1403­1410. Curvature and Bending Energy in Digitized 2D and 3D Images Lucas J. van Vliet and Piet W. Verbeek Pattern

van Vliet, Lucas J.

247

The laboratory rat strains most commonly used in research are believed to be domesticated albino strains of the Norway rat rattus nirvegicus. Rats like mice, belong to the order Rodentia  

E-Print Network [OSTI]

Rats History The laboratory rat strains most commonly used in research are believed to be domesticated albino strains of the Norway rat rattus nirvegicus. Rats like mice, belong to the order Rodentia and the family Muridae. Adult rats generally weigh between 200 and 400 g, with males significantly larger than

Shihadeh, Alan

248

Statkraft is Europe's largest generator of renewable energy and is the leading power company in Norway. The company owns, produces and develops hydropower, wind power, gas-fired power and  

E-Print Network [OSTI]

in Norway. The company owns, produces and develops hydropower, wind power, gas-fired power and districtStatkraft is Europe's largest generator of renewable energy and is the leading power company countries. For our office in Düsseldorf we are currently looking to hire a System Manager Renewable Energy

Morik, Katharina

249

Norsk Solkraft AS | Open Energy Information  

Open Energy Info (EERE)

Solkraft AS Solkraft AS Jump to: navigation, search Name Norsk Solkraft AS Place Oslo, Norway Zip 184 Product Has an arm, Solkraft Energy AS, developing PV projects in Italy, and a division called Solkraft Innovation AS which is making aluminium mounting systems incorporating passive cooling, which it claims will increase PV power output by 10-15 in hot climates. Coordinates 59.91228°, 10.74998° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.91228,"lon":10.74998,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

250

DEPARTMENT OF MEDIA AND COMMUNICATION UNIVERSITETET OF OSLO  

E-Print Network [OSTI]

and Cyberway Pte Ltd.) ADSL Asymmetric Digital Subscriber Line AFI The ASEAN Forum on the Internet ASEAN

Løw, Erik

251

E CO Energi | Open Energy Information  

Open Energy Info (EERE)

to: navigation, search Name: E CO Energi Address: PO Box 255 Sentrum Zip: 103 Region: Norway Sector: Marine and Hydrokinetic Phone Number: + 47 24 11 69 00 Website: http:http:...

252

Wave Energy AS | Open Energy Information  

Open Energy Info (EERE)

Wave Energy AS Address: Opstadveien 11C Place: Aalgaard Zip: 4330 Region: Norway Sector: Marine and Hydrokinetic Phone Number: (+47) 51 6109 30 Website: http:www.waveenergy.no...

253

Pelagic Power AS | Open Energy Information  

Open Energy Info (EERE)

Pelagic Power AS Address: LIV bygget Place: Vanvikan Zip: N-7125 Region: Norway Sector: Marine and Hydrokinetic Website: http:www.pelagicpower.com This company is listed in the...

254

Ocean temperature forcing by aerosols across the Atlantic tropical cyclone development region  

E-Print Network [OSTI]

; Accepted 12 February 2008; Published 29 May 2008. Evan, A. T., A. K. Heidinger, R. Bennartz, V. Bennington T. Evan Cooperative Institute for Meteorological Satellite Studies, University of Wisconsin Research, N-0318 Oslo, Norway James P. Kossin Cooperative Institute for Meteorological Satellite Studies

Kossin, James P.

255

5, 10751099, 2014 Uncertainty in crop  

E-Print Network [OSTI]

Resources and Energy Directorate, Oslo, Norway 16 International Institute for Applied System Analysis, New York, USA 24 Institute for Sustainable Economic Development, Vienna, Austria 25 Max Planck of Bonn, Bonn, Germany 28 Santa Fe Institute, Santa Fe, New Mexico, USA Received: 28 July 2014 ­ Accepted

Levermann, Anders

256

S.J. Langan and D. Hirst Hydrology and Earth System Sciences, 8(3), 422435 (2004) EGU  

E-Print Network [OSTI]

S.J. Langan and D. Hirst 422 Hydrology and Earth System Sciences, 8(3), 422435 (2004) © EGU (Galloway, S.W. Scotland) under contrasting land management S.J. Langan1 and D. Hirst2 1 Macaulay Land Use 114, Blindern, N-0414 Oslo, Norway Email for corresponding author: s.langan@macaulay.ac.uk Abstract

Boyer, Edmond

257

Reports and other Publications  

Science Journals Connector (OSTI)

... C. Poynton. Pp. 1334. (Pietermaritzburg: The Natal Museum, 1964.)\t[33Norsk Polarinstitutt. Skrifter Nr. 133: On the Tides at Norway Station and Adjacent Coastal ... and Adjacent Coastal Areas of Antarctica. By V. Hisdal. Pp. 21. (Oslo Norsk Polarinstitutt, 1965.) 4 kr.\t[33

1965-05-15T23:59:59.000Z

258

Missouri University of Science and Technology 1 Petroleum Engineering  

E-Print Network [OSTI]

development, and carbon sequestration. Shari Dunn Norman, Associate Professor PHD Heriot-Watt University Well, Assistant Professor PHD University of Oslo-Norway Drilling, geomechanics, carbon sequestration. Mingzhen Wei include reservoir enhancement, hydraulic fracturing, CO2 sequestration, gel treatments, drilling, well

Missouri-Rolla, University of

259

Reactivity of Anti-CD15 Monoclonal Antibody PM-81 with Breast Cancer and Elimination of Breast Cancer Cells from Human Bone Marrow by PM-81 and Immunomagnetic Beads  

Science Journals Connector (OSTI)

...immunomagnetic beads, Dynabeads R (Dynal, Oslo, Norway), are 4.5-mm polystyrene beads with 20% iron in the form 7-Fe2O3 and have a magnetic susceptibility of approximately 10~2cgs units (19). Dynabeads covalently coated with sheep-anti-mouse...

James J. Vredenburgh; Wendy Simpson; Vincent A. Memoli; Edward D. Ball

1991-05-01T23:59:59.000Z

260

_ OF THE CONFIGURATION-INTERACIIO~ ENERGY --_-r ) Jack SIMONS  

E-Print Network [OSTI]

_ OF THE CONFIGURATION-INTERACIIO~ ENERGY - - _- r ) -_ _. Jack SIMONS Deparrment of Chemrstty. Bhndern, Oslo 3, Norway Received 26 October 1983 We derive expressions for the first through fourth denvatives of the configuration-Interaction (CI) electromc energy with respect to molecular deformation

Helgaker, Trygve

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

ACCUMULATION OF PHOTOSYSTEM ONE1, a Member of a Novel Gene Family, Is Required for Accumulation of [4Fe-4S] Cluster??Containing Chloroplast Complexes and Antenna Proteins  

Science Journals Connector (OSTI)

...of chlorophyll and that absorbed light energy cannot be used efficiently, which is...fluorescence is quenched by the use of light energy (photochemical quenching [qP]) measured...manufacturers instructions (Dynal, Oslo, Norway) and used for RACE experiments. Total...

Katrin Amann; Lina Lezhneva; Gerd Wanner; Reinhold G. Herrmann; Jörg Meurer

2004-10-19T23:59:59.000Z

262

The Arabidopsis HUELLENLOS Gene, Which Is Essential for Normal Ovule Development, Encodes a Mitochondrial Ribosomal Protein  

Science Journals Connector (OSTI)

...pathways, in addition to their role in energy production. These processes are essential...Landschutze et al., 1995), indicating a high energy requirement in carpels and ovules. This...using the mRNA Direct kit (Dynal, Oslo, Norway) according to the manufacturers instructions...

Debra J. Skinner; Shawn C. Baker; Robert J. Meister; Jean Broadhvest; Kay Schneitz; Charles S. Gasser

263

Revised Version DESY 06230 arXiv:0705.2018v2  

E-Print Network [OSTI]

-230 Neutrino Dark Energy { Revisiting the Stability Issue Ole Eggers Bj#26;lde 1 , Anthony W. Brook#12;eld 2 Oslo, Norway 6 Deutsches Elektron-Synchroton DESY, Hamburg, Notkestr. 85, 22607 Hamburg, Germany 7 and the present energy density and equation of state of dark energy. However, it has been pointed out

264

The Arabidopsis Plastidic Glucose 6-Phosphate/Phosphate Translocator GPT1 Is Essential for Pollen Maturation and Embryo Sac Development  

Science Journals Connector (OSTI)

...accumulate intracellular lipid bodies, which act as reserves of energy and biomolecules for pollen germination. The pollen grain-the...purified twice with the Dynabeads mRNA Direct kit (Dynal, Oslo, Norway) to minimize DNA contamination. Quantitative real-time RT-PCR...

Patrycja Niewiadomski; Silke Knappe; Stefan Geimer; Karsten Fischer; Burkhard Schulz; Ulrike S. Unte; Mario G. Rosso; Peter Ache; Ulf-Ingo Flügge; Anja Schneider

2005-02-18T23:59:59.000Z

265

EPJ manuscript No. (will be inserted by the editor)  

E-Print Network [OSTI]

, France 4 Physics of Geological Processes, University of Oslo, Norway 5 Institut de Physique du Globe de that promotes them, owing to the gain in the total elastic energy: the intrinsic elastic energy plus the work free energy is increased and local gradients of free-energy can induce mass transfer from the most

266

A Chromodomain Protein Encoded by the Arabidopsis CAO Gene Is a Plant-Specific Component of the Chloroplast Signal Recognition Particle Pathway That Is Involved in LHCP Targeting  

Science Journals Connector (OSTI)

...Emerson effect (E) value in state 2, indicating that light energy absorption was well balanced between the two photosystems...performed with a Dynabeads mRNA purification kit (Dynal, Oslo, Norway), using 100 mug of total RNA for each sample. RNA gel blot...

Victor I. Klimyuk; Fabienne Persello-Cartieaux; Michel Havaux; Pascale Contard-David; Danja Schuenemann; Karin Meiherhoff; Patrice Gouet; Jonathan D. G. Jones; Neil E. Hoffman; Laurent Nussaume

267

Assessment of Tumor Energy and Oxygenation Status by Bioluminescence, Nuclear Magnetic Resonance Spectroscopy, and Cryospectrophotometry  

Science Journals Connector (OSTI)

...research-article Assessment of Tumor Energy and Oxygenation Status by Bioluminescence...Montebello, 0310 Oslo 3, Norway [E. K. R.]; Experimental...Federal Republic of Germany. The energy and oxygenation status of tumors...independent techniques. Tumor energy metabolism was investigated...

W. Mueller-Klieser; C. Schaefer; S. Walenta; E. K. Rofstad; B. M. Fenton; and R. M. Sutherland

1990-03-15T23:59:59.000Z

268

The Arabidopsis Basic/Helix-Loop-Helix Transcription Factor Family  

Science Journals Connector (OSTI)

...paramagnetic protein A beads (Dynabeads Protein A Dynal, Oslo, Norway) and GAD antibody (Santa Cruz Biotechnology, Santa Cruz...National Institutes of Health Grant GM47475, Department of Energy Grant DE-FG03-87ER13742, U.S. Department of Agriculture-Agricultural...

Gabriela Toledo-Ortiz; Enamul Huq; Peter H. Quail

2003-07-14T23:59:59.000Z

269

U.S. GOVERNMENT PRINTING OFFICE WASHINGTON  

E-Print Network [OSTI]

EMISSIONS ROUNDTABLE BEFORE THE COMMITTEE ON ENERGY AND NATURAL RESOURCES UNITED STATES SENATE ONE HUNDRED for the use of the Committee on Energy and Natural Resources #12;(II) COMMITTEE ON ENERGY AND NATURAL .............................................................................................. 14 Wold, Per-Otto, Founding Partner and CEO, Point Carbon, Oslo, Norway ....... 10 APPENDIX Responses

270

Risk Analysis of Changing and Evolving Systems Using CORAS  

E-Print Network [OSTI]

to determine whether the risk and its magnitude are acceptable or tolerable. ­ Risk treatment is the processRisk Analysis of Changing and Evolving Systems Using CORAS Mass Soldal Lund1 , Bjørnar Solhaug1, University of Oslo, Norway {mass.s.lund,bjornar.solhaug,ketil.stolen}@sintef.no Abstract. Risk analysis

Stølen, Ketil

271

Progress in Nuclear Energy 53 (2011) 618 625 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

Progress in Nuclear Energy 53 (2011) 618 625 Contents lists available at ScienceDirect Progress in Nuclear Energy journal homepage: www.elsevier.com/locate/pnucene Comparison of thorium-based fuels Fhager a , Christophe Demazière b a Thor Energy, Sommerrogaten 13 15, NO-0255 Oslo, Norway b Chalmers

Demazière, Christophe

272

http://jab.sagepub.com The Journal of Applied Behavioral Science  

E-Print Network [OSTI]

: Case Study From Mozambique An Institutional Perspective on Health Sector Reforms and the Process. / CASE STUDY FROM MOZAMBIQUE An Institutional Perspective on Health Sector Reforms and the Process Sahay University of Oslo, Norway Health sector reform, including structural and process changes

Sahay, Sundeep

273

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark  

E-Print Network [OSTI]

Comparative Microbial Genomics group CenterforBiologicalSequenceanalysisDepartmentofSystemsBiology,TechnicalUniversityofDenmark E. coli pangenomics - or - How to compare hundreds of E. coli genomes Fuzzy Dave Ussery Ullevål Universitetssykehus Oslo, Norway Wednesday, 10 December, 2008 #12;Comparative Microbial Genomics group Centerfor

Ussery, David W.

274

Journal of Hazardous Materials 161 (2009) 13471354 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

.MONTES-HERNANDEZ@obs.ujf-grenoble.fr, german montes@hotmail.com (G. Montes-Hernandez). free energy sources (nuclear, solar, wind, geothermal of Geological Processes, University of Oslo,Norway a r t i c l e i n f o Article history: Received 27 November. The main actions include: (I) the increase of the efficiency of energy conver- sion, (II) the reduction

275

Introduction to Atmosphere-Ocean J. H. LaCasce  

E-Print Network [OSTI]

Blindern 0315 Oslo, Norway j.h.lacasce@geo.uio.no #12;2 #12;Contents 1 Equations 9 1.1 Derivatives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44 2.5.2 Mass . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 2.5.3 Energy wind . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 3.3 Hydrostatic balance

LaCasce, Joseph H.

276

Annales Geophysicae (2001) 19: 14831489 c European Geophysical Society 2001 Geophysicae  

E-Print Network [OSTI]

.-A. Lindqvist5, B. Lybekk1, A. Masson3, F. Mozer6, and A. Vaivads4 1University of Oslo, Norway 2LPCE field and low energy particle measurements. The conductivity required for this purpose is of the order and the electric reference point (star point). This is sufficient for most magnetospheric and solar wind envi

California at Berkeley, University of

277

Nonlinear Processes in Geophysics (2002) 9: 443451 Nonlinear Processes  

E-Print Network [OSTI]

University of Oslo, Norway 10Kyushu University, Japan 11Technical University, Braunschweig, Germany Received June 1998. Interball-1 data in the summer TBL are compared with that of Geotail in solar wind (SW., 1986). Here the energy density of the ultra low-frequency (ULF) magnetic fluctuations is comparable

Paris-Sud XI, Université de

278

Does aquaculture add resilience to the global food system?  

Science Journals Connector (OSTI)

...Blindern, NO-0317 Oslo, Norway;bStockholm Resilience Centre...those sheltered from wind and wave exposure...forcing aquaculture further offshore. In Africa, where the...related to changes in the energy and financial sectors...variation and volatility in energy prices, they are not...

Max Troell; Rosamond L. Naylor; Marc Metian; Malcolm Beveridge; Peter H. Tyedmers; Carl Folke; Kenneth J. Arrow; Scott Barrett; Anne-Sophie Crpin; Paul R. Ehrlich; sa Gren; Nils Kautsky; Simon A. Levin; Karine Nyborg; Henrik sterblom; Stephen Polasky; Marten Scheffer; Brian H. Walker; Tasos Xepapadeas; Aart de Zeeuw

2014-01-01T23:59:59.000Z

279

Estimating broad-brush rebound effects for household energy consumption in the EU 28 countries and Norway: some policy implications of Odyssee data  

Science Journals Connector (OSTI)

Abstract Currently there is a strong policy commitment in European Union (EU) and Organisation for Economic Co-operation and Development (OECD) countries to increase the energy efficiency of residential buildings, and it is widely assumed that this will naturally and automatically reduce domestic energy consumption. However, other factors such as fuel prices, wages, attitudes and lifestyles also influence energy consumption. This paper calculates broad-brush rebound effects based on changes in energy efficiency and energy consumption in each of the 28EU countries plus Norway, for the years 20002011. In doing so, it tests how well the assumption of energy efficiency leading to energy reduction stands up to scrutiny in these lands. It uses the EUs Odyssee database for efficiency and consumption figures and a commonly employed econometric definition of the rebound effect as an energy-efficiency elasticity. Most older EU lands show rebound effects in the expected range of 050%. However, the range for newer EU countries is 100550%, suggesting that energy efficiency increases are not a good predictor of energy consumption. A more in-depth look at one country, Germany, suggests these results underestimate the rebound effect significantly. This also identifies research needs for specific energy consumption determinants in each country, to find more precisely what is driving consumption levels.

Ray Galvin

2014-01-01T23:59:59.000Z

280

The wind/hydrogen demonstration system at Utsira in Norway: Evaluation of system performance using operational data and updated hydrogen energy system modeling tools  

Science Journals Connector (OSTI)

An autonomous wind/hydrogen energy demonstration system located at the island of Utsira in Norway was officially launched by Norsk Hydro (now StatoilHydro) and Enercon in July 2004. The main components in the system installed are a wind turbine (600kW), water electrolyzer (10Nm3/h), hydrogen gas storage (2400Nm3, 200bar), hydrogen engine (55kW), and a PEM fuel cell (10kW). The system gives 23 days of full energy autonomy for 10 households on the island, and is the first of its kind in the world. A significant amount of operational experience and data has been collected over the past 4 years. The main objective with this study was to evaluate the operation of the Utsira plant using a set of updated hydrogen energy system modeling tools (HYDROGEMS). Operational data (10-min data) was used to calibrate the model parameters and fine-tune the set-up of a system simulation. The hourly operation of the plant was simulated for a representative month (March 2007), using only measured wind speed (m/s) and average power demand (kW) as the input variables, and the results compared well to measured data. The operation for a specific year (2005) was also simulated, and the performance of several alternative system designs was evaluated. A thorough discussion on issues related to the design and operation of wind/hydrogen energy systems is also provided, including specific recommendations for improvements to the Utsira plant. This paper shows how important it is to improve the hydrogen system efficiency in order to achieve a fully (100%) autonomous wind/hydrogen power system.

ystein Ulleberg; Torgeir Nakken; Arnaud Et

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Suppression of Culture in Norway  

Science Journals Connector (OSTI)

... Science and Letters of Gteborg have already for a considerable time been deprived of their liberty. They are known to us as eminent scientists and scholars and are citizens beyond ... Excellency to do everything in your power in order to set our fellow-members at liberty and enable them to resume their studies and research.It is to be feared ...

1942-04-11T23:59:59.000Z

282

Handbook for Travellers in Norway  

Science Journals Connector (OSTI)

... of tourist invasion is curiously displayed by reference to the various editions of Murray's Handbooks. We have before us the tattered remnants of our old travelling companion and oracle- ... us the tattered remnants of our old travelling companion and oracle-Part 1 of the "Handbook for Northern Europe,"including Denmark, N orway, and Sweden (1849). We are ...

W. M. W.

1892-08-25T23:59:59.000Z

283

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

284

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

285

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

286

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

287

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

288

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

289

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

290

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

291

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

292

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

293

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

294

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

295

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

296

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

297

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

298

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

299

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

300

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

302

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

303

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

304

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

305

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

306

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

307

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

308

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

309

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

310

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

311

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

312

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

313

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

314

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

315

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

316

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

317

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

318

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

319

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

320

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

322

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

323

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

324

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

325

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

326

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

327

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

328

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

329

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

330

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

331

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

332

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

333

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

334

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

335

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

336

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

337

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

338

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

339

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

340

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

342

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

343

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

344

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

345

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

346

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

347

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

348

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

349

Literature Review of Displacement Ventilation  

E-Print Network [OSTI]

) and Nielsen et al. (1988) showed the impact of supply diffusers whereby increasing the entrainment of room air can decrease the temperature gradient in the occupied zone. #0;? Two important parameters to evaluate the performance of displacement ventilation... of Ventilated Rooms, Oslo, Norway. Nielsen, P.V., Hoff, L., Pedersen, L.G. 1988. Displacement Ventilation by Different Types of Diffusers. Proceedings of the 9 th AIVC Conference, Warwick. Niu, J. 1994. Modeling of Cooled-Ceiling Air-Conditioning Systems Ph...

Cho, S.; Im, P.; Haberl, J. S.

350

New palaeomagnetic results from the Oslo Graben, a Permian Superchron lava province  

Science Journals Connector (OSTI)

......magnetite component, as can be seen from the thermal decay curves (Fig.-5). At the highest...growth of new magnetic minerals during thermal demagnetization. Fig.-6 shows examples...palaeomagnetic data from North Africa (Sudan, N = 1; Morocco, N = 2) and Adria......

M.M. Haldan; M.J.M. Meijers; C.G. Langereis; B.T. Larsen; H. Heyer

2014-01-01T23:59:59.000Z

351

U.S. LNG Imports from Norway  

Gasoline and Diesel Fuel Update (EIA)

Charles, LA LNG Imports from Canada Highgate Springs, VT Champlain, NY LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake...

352

Lignin studies of transgenic Norway spruce.  

E-Print Network [OSTI]

??An attractive objective in tree breeding is to reduce the content of lignin, or increase its extractability, to favor delignification during pulping. This study investigates (more)

Wadenbck, Johan

2006-01-01T23:59:59.000Z

353

U.S. LNG Imports from Norway  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

Brunei Lake Charles, LA LNG Imports from Canada Highgate Springs, VT LNG Imports from Egypt Cameron, LA Cove Point, MD Elba Island, GA Everett, MA Freeport, TX Gulf LNG, MS Lake...

354

Natural Airborne Radioactivity at Kjeller, Norway  

Science Journals Connector (OSTI)

... During the last four months of 1957, radon concentrations have varied between about 30 and 1,100 X 10~18 c./cm. ... inversion and low temperature. In order to explain this effect, we suggest that considerable radon exhalation may be trapped in the cooled air which tends to follow the natural water ...

S. H. SMALL; A. LILLEGRAVEN; P. B. STOREB

1958-04-26T23:59:59.000Z

355

Norwegian Agency for Development Cooperation (Norad) | Open Energy  

Open Energy Info (EERE)

Norwegian Agency for Development Cooperation (Norad) Norwegian Agency for Development Cooperation (Norad) Jump to: navigation, search Logo: Norwegian Agency for Development Cooperation (Norad) Name Norwegian Agency for Development Cooperation (Norad) Address Ruseløkkveien 26, 0251 Oslo Place Oslo, Norway Phone number +4722242030 Website http://www.norad.no/en/ Coordinates 59.9126774°, 10.7258011° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.9126774,"lon":10.7258011,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

356

storvold-98.pdf  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 3 Boundary-Layer Structure Obtained with a Tethered Balloon System and Large-Scale Observations of the Arctic Basin Obtained with a Satellite Data Acquisition System at the SHEBA Ice Camp R. Storvold, H. A. Eide, P. Utley, K. Stamnes, and G. Adalsgeirsdottir University of Alaska Fairbanks Fairbanks, Alaska D. Lubin Scripps Institution of Oceanography University of California, San Diego LaJolla, California B. D. Zak Sandia National Laboratories Albuquerque, New Mexico P. Lawson SPEC, Inc. Stratton Park Engineering Company, Inc. Boulder, Colorado T. Svendby University of Oslo Oslo, Norway R. Moritz University of Washington Seattle, Washington J. A. Moore National Center for Atmospheric Research Boulder, Colorado Abstract Temperature, wind, and water vapor profiles through the

357

LOCAL ACTORS BUILD BROADBAND INFRASTRUCTURE Ingjerd Skogseid, Western Norway Research Institute, Postboks 163, 6851 Sogndal, Norway,  

E-Print Network [OSTI]

of market liberalisation of the telecom sector, the Norwegian government chose a demand driven strategy- liberalisation in 1998 very few organisations had access to high-speed communication; the cost was too high

Hanseth, Ole

358

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

359

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

360

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

362

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

363

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

364

Dear Madam/Sir, European Movement Croatia in cooperation with University of Oslo are inviting you to participate at the  

E-Print Network [OSTI]

contemporary problems, both the global ones such as the environmental degradation, and the local ones. M.S. in oceanography/environmental systems modeling, University of Zagreb, 1979. B.S. in electrical possibilities that may now be available to us. The dialog will then proceed through four stages called Awareness

Karabeg, Dino

365

Strategic Environmental Assessment in Norway's Offshore Oil and Gas.  

E-Print Network [OSTI]

??Strategic environmental assessment (SEA) is used as a policy tool in the management of offshore oil and gas. As offshore oil and gas exploration continues (more)

Ohman, Tyra

2014-01-01T23:59:59.000Z

366

Success factors of energy efficiency measures in buildings in Norway  

Science Journals Connector (OSTI)

Abstract The aim of the study was to identify factors and parameters, which could contribute to the successful implementation of energy efficiency measures in buildings, and to find which parameters introduce uncertainties in achieving the planned energy savings. A database of 41 buildings was developed for the analysis. The database contained information related to buildings, energy efficiency measures, and energy use over several years. A presentation method for the persistence of the energy efficiency measures was introduced. Through the energy performance contract, energy savings of 30% of the total energy use were suggested on average. The results showed that the success factors of the energy efficiency measures were: previous energy use, project cost, consultant experience and engagement, and implementation of a good operation plan. The persistence of the energy efficiency measures was influenced by the achieved savings in the first year, the guaranty period, and the implementation of the operation measures. Uncertainties in the presented results were induced by the following factors: temperature correction method, difference in reported building area, correctness of the information regarding the implemented measures, and calculation method. The uncertainty due to lack of information or not delivering the operation measures was about 20% of the total energy use.

Natasa Nord; Stine Fjrli Sjthun

2014-01-01T23:59:59.000Z

367

,"U.S. Liquefied Natural Gas Imports From Norway (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Web Page:","http:tonto.eia.govdnavnghistngmepg0nus-nnoimlmmcfm.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202)...

368

Catastrophes of Redemption: Modernism and Fascism in Norway  

E-Print Network [OSTI]

Psykologisk Literatur. Paa Turn: Tre Foredrag ompost-war years called Paa gjengrodde stier (On Overgrowninteresting analysis of Paa gjengrodde stier in Troubling

Krouk, Dean N.

2011-01-01T23:59:59.000Z

369

Microsoft Word - CX-Coos-CurryNorwaySubstation_WEB.doc  

Broader source: Energy.gov (indexed) [DOE]

1 REPLY TO ATTN OF: KEP-4 SUBJECT: Environmental Clearance Memorandum Shari Sundeen Public Utilities Specialist - TPC-TPP-4 Proposed Action: Line and load interconnection of...

370

Balancing of Offshore Wind Power in Mid-Norway.  

E-Print Network [OSTI]

?? In order to comply with governmentally announced greenhouse gas emission reductions goals and to consolidate an independent and stable electric power and energy supply, (more)

Gleditsch, Morten

2009-01-01T23:59:59.000Z

371

Reports and other Publications  

Science Journals Connector (OSTI)

... (Rome: International Council of Scientific Unions, 1965.) 1.50 dollars., [193Norsk Polarinstitutt. Arbok 1963. Pp.267. (Oslo: ... Polarinstitutt. Arbok 1963. Pp.267. (Oslo: Norsk Polarinstitutt. Obtainable from Universitetsforlaget, Postboks 307, Blindern, Oslo.) 35 kr. [193 ...

1965-05-29T23:59:59.000Z

372

Reports and other Publications  

Science Journals Connector (OSTI)

... America Latina en colaboracion con la Organizacion de los Estados Americanos, 1966.) [231Norsk Polarinstitutt. Arbok 1965. Pp.186. (Oslo: ... Polarinstitutt. Arbok 1965. Pp.186. (Oslo: Norsk Polarinstitutt, 1966. Obtainable from Universitetsforlaget, Postboks 307, Blindern, Oslo 3.) 22 ...

1967-04-08T23:59:59.000Z

373

Reports and other Publications  

Science Journals Connector (OSTI)

... viii + 87. 50 cents. (Ottawa: Queen's Printer, 1962.), [255Norsk Polarinstitutt. Arbok 1960. Pp. 132+9 plates. (Oslo: ... Polarinstitutt. Arbok 1960. Pp. 132+9 plates. (Oslo: Norsk Polarinstitutt, 1962. Distributed by Oslo University Press.) ...

1962-07-21T23:59:59.000Z

374

Tax and Fiscal Policies for Promotion of Industrial Energy Efficiency: A Survey of International Experience  

E-Print Network [OSTI]

and Macfarane, 2003). Norways Industrial Energy Efficiencyto Norways draft budget for 2004, the current energymanagement or energy monitoring. Like Thailand, Norway also

Price, Lynn; Galitsky, Christina; Sinton, Jonathan; Worrell, Ernst; Graus, Wina

2005-01-01T23:59:59.000Z

375

Reports and Publications  

Science Journals Connector (OSTI)

... the United Nations; London: HMSO, 1971.) $2.50; 1. [282Norsk Polarinstitutt. Arbok 1970. Pp. 302. (Oslo: ... Polarinstitutt. Arbok 1970. Pp. 302. (Oslo: Norsk Polarinstitutt, 1972.) [282

1972-05-19T23:59:59.000Z

376

Reports and Publications  

Science Journals Connector (OSTI)

... Quality.) (Ottawa: National Research Council Canada, 1975.) $1.25. [193Norsk Polarinstitutt. Arbok 1974. Pp. 269. (Oslo: ... Polarinstitutt. Arbok 1974. Pp. 269. (Oslo: Norsk Polarinstitutt, 1976.) [223

1976-07-15T23:59:59.000Z

377

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

378

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

379

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

380

Posters Sensitivity of Cirrus Cloud Radiative  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 7 Posters Sensitivity of Cirrus Cloud Radiative Properties to Ice Crystal Size and Shape in General Circulation Model Simulations D. L. Mitchell Desert Research Institute Reno, Nevada J. E. Kristjánsson Department of Geophysics University of Oslo, Norway M. J. Newman Los Alamos National Laboratory Los Alamos, New Mexico Introduction Recent research (e.g., Mitchell and Arnott 1994) has shown that the radiative properties of cirrus clouds (i.e., optical depth, albedo, emissivity) depend on the shapes and sizes of ice crystals. For instance, the cloud albedo may vary by a factor of two, depending on whether hexagonal columns or bullet rosette ice crystals are assumed for a given ice water path (IWP). This variance occurs primarily because, at sizes characteristic of cirrus

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Bellona | Open Energy Information  

Open Energy Info (EERE)

Bellona Bellona Jump to: navigation, search Logo: Bellona Name Bellona Address Boks 2141 Grünerløkka 0505 Place Oslo, Norway Number of employees 51-200 Year founded 1986 Phone number +47 23 23 46 00 Website http://www.bellona.org/ Coordinates 59.9138204°, 10.7387413° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":59.9138204,"lon":10.7387413,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

382

The Gulf Investment Framework, 20102025: Opportunities, Limitations, and Risks  

E-Print Network [OSTI]

research programme based at the University of Oslo Regardless of discoveries of "new" energy suppliers

Løw, Erik

383

Forum for teologiske og religionsfaglige bibliotek Forum for Theological and Religious Libraries  

E-Print Network [OSTI]

Universitetsbiblioteket i Oslo Boks 1023 Blindern, 0315 Oslo tlf: 2285 7170 epost: astrid.anderson@ub.uio.no web: http, 9037 Tromsø tlf: 7764 6815 epost: per.pippin.aspaas@ubt.no web: http Universitetsbiblioteket i Oslo Boks 1023 Blindern, 0315 Oslo tlf: 2285 0353/2284 4203 epost: s.h.birkeflet@ub.uio.no web

Løw, Erik

384

Innotech Solar AS formerly known as Solar Cell Repower | Open Energy  

Open Energy Info (EERE)

Innotech Solar AS formerly known as Solar Cell Repower Innotech Solar AS formerly known as Solar Cell Repower Jump to: navigation, search Name Innotech Solar AS (formerly known as Solar Cell Repower) Place Narvik, Norway Zip 8512 Sector Solar Product Norway-based developer of repowering technologies for solar cells. Coordinates 68.439515°, 17.43015° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":68.439515,"lon":17.43015,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

385

A Guidebook for Low-Carbon Development at the Local Level  

E-Print Network [OSTI]

Institute for Energy Efficiency, Norway) and CRES (Center1998. Kjeller, Norway: Institute for Energy Technology.the 1990s, Norways Industrial Energy Efficiency Network (

Zhou, Nan

2012-01-01T23:59:59.000Z

386

International Experience with Key Program Elements of Industrial Energy Efficiency or Greenhouse Gas Emissions Reduction Target-Setting Programs  

E-Print Network [OSTI]

Institute for Energy Efficiency, Norway) and CRES (CenterInstitute for Energy Efficiency, Norway) and CRES (Centermembers, 48 Norways Industrial Energy Efficiency Network

Price, Lynn; Galitsky, Christina; Kramer, Klaas Jan

2008-01-01T23:59:59.000Z

387

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

388

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

389

"No God and no Norway": collective resource loss among members of Tamil NGO's in Norway during and after the last phase of the civil war in Sri Lanka  

Science Journals Connector (OSTI)

Studies on the mental health of refugees have tended to focus upon the impact of traumatic experiences in the country of origin, and acculturation processes in exile. The effects of crises in the country of or...

Eugene Guribye

2011-08-01T23:59:59.000Z

390

Journal of Computer and System Sciences 78 (2012) 16061622 Contents lists available at SciVerse ScienceDirect  

E-Print Network [OSTI]

a Department of Informatics, University of Bergen, Bergen, Norway b SINTEF Energy Research, Trondheim, Norway c

Dimitrios, Thilikos

391

Certainty in Timing of Death: A New Analysis of Shifting Mortality and Life Span Disparity  

E-Print Network [OSTI]

Continued on next page Country Netherlands Norway Swedenon next page Total Italy Total Netherlands Total Norway

Zureick, Sarah Marie

2010-01-01T23:59:59.000Z

392

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

393

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

394

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

395

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

396

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

397

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

398

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

399

Variation in xylem structure from tropics to tundra: Evidence from vestured pits  

Science Journals Connector (OSTI)

...The Netherlands). 38. Lid, J. & Lid, D. T. (1994) Norsk Flora (Samlaget, Oslo). 39. De Lesse, H. (1952) Flore...Copenhagen). 46. Ronning, O. I. (1964) Svalbards Flora (Norsk Polarinstitutt, Oslo). Variation in xylem structure from...

Steven Jansen; Pieter Baas; Peter Gasson; Frederic Lens; Erik Smets

2004-01-01T23:59:59.000Z

400

Reports and other Publications  

Science Journals Connector (OSTI)

... Institute of International Studies, University of California, 1965.) 2.95 dollars. [43Norsk Polarinstitutt. Arbok 1964. Pp.242. (Oslo: ... Polarinstitutt. Arbok 1964. Pp.242. (Oslo: Norsk Polarinstitutt, 1966.) 30 kr. [43 ...

1966-05-07T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Reports and other Publications  

Science Journals Connector (OSTI)

... Publication 4525.) (Washington, D.C.: Government Printing Office, 1964.) [122Norsk Polarinstitutt. Arbok 1962. Pp. 193. (Oslo : ... Polarinstitutt. Arbok 1962. Pp. 193. (Oslo : Norsk Polarinstitutt, 1963. Distributed by Universitetsforlaget, 1963.) [122

1964-04-11T23:59:59.000Z

402

Reports and Publications  

Science Journals Connector (OSTI)

... By Jan Lundqvist. Pp. 32. (Stockholm: Sveriges Geologiska Undersokning, 1969.) [252Norsk Polarinstitutt. Arbok 1968. Pp. 138. (Oslo: ... Polarinstitutt. Arbok 1968. Pp. 138. (Oslo: Norsk Polar-institutt, 1970.) [252

1970-05-23T23:59:59.000Z

403

A Comparative Analysis of School Finance Management in Norway and Ukraine.  

E-Print Network [OSTI]

??This paper explores school finance management in the context of two different organizational models, rather decentralized Norwegian school management and highly centralized school management in (more)

Yevdokymova, Yulya

2012-01-01T23:59:59.000Z

404

CO2 Changes from the Increasing Percentage of Diesel Passenger Cars in Norway  

Science Journals Connector (OSTI)

The changes in CO2 emissions are calculated for different percentages of Diesel penetration in the Norwich market. ... The majority of the EU and Norwich markets corresponds to four classes:? economic, small car, lower medium, and upper medium. ...

Efthimios Zervas; Georgios Bikas

2005-07-15T23:59:59.000Z

405

U.S.-Norway Conference Focuses on Advancing Carbon Capture and...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

There are carbon capture and storage (CCS) projects all over the world. The multinational Carbon Sequestration Leadership Forum (CSLF) recognizes more than 40 active and completed...

406

Forerunners for change: Work and motherhood among second-generation immigrants in Norway  

E-Print Network [OSTI]

specifically, the factors that shape the work choices of second-generation women. However, in studying and the meaning attached to these practices are shaped by the individual's context of opportunities. The empirical practices and `meaning-making' concerning work and care in the family, the study employs theoretical

Johansen, Tom Henning

407

Lignin biosynthesis in Norway spruce: from a model system to the tree.  

E-Print Network [OSTI]

??Lignin is a hydrophobic polymer that is synthesised in the secondary cell walls of all vascular plants. It enables water conduction through the stem, supports (more)

Koutaniemi, Sanna

2007-01-01T23:59:59.000Z

408

Russia and Norway in the High North. : Petroleum, Security and the Room of Manoeuvre.  

E-Print Network [OSTI]

??The High North has the potential to become a new and promising oil and gas region. Though large areas of the High North remain unexplored, (more)

Alagic, Ajla

2009-01-01T23:59:59.000Z

409

Demand for Electric Power in Norway : Estimating price and substitution elasticities.  

E-Print Network [OSTI]

??The main goal of this master thesis is to estimate how the prices of electricity and heating oil affect the aggregate demand for electric power (more)

yan, Ola Hagen

2010-01-01T23:59:59.000Z

410

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

incentives given by transmission pricing form the foundationhas focussed on transmission pricing, monopoly regulation,

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris

1999-01-01T23:59:59.000Z

411

Energy intake and utilisation by nursing bearded seal (Erignathus barbatus) pups from Svalbard, Norway  

Science Journals Connector (OSTI)

In this study we measure energy intake via milk in nursing bearded seal (Erignathus barbatus) pups and determine how this energy is allocated into metabolism and storage of new tissues. This was accomplished usin...

C. Lydersen; K. M. Kovacs; M. O. Hammill; I. Gjertz

1996-11-01T23:59:59.000Z

412

Costs and Benefits of Climate Policies: An Integrated Economy-Energy-Environment Model Approach for Norway  

Science Journals Connector (OSTI)

Proposals for environmental policies are often preceded by a cost-benefit assessment. Thus, after many years of environmental regulation there exists much information on economic costs and benefits associated ...

Morten Aaserud

1996-01-01T23:59:59.000Z

413

Quantifying fatigue generated in high strain rate cyclic loading of Norway spruce  

Science Journals Connector (OSTI)

Papermaking especially mechanical pulping consumes much energy. To reduce this energy consumption one has to understand and exploit the phenomena present during the pulping. An important phenomenon to understand is wood fatigue. We quantitatively measure the fatigue generated during high strain rate cyclic loading of spruce wood performed under conditions resembling those present during mechanical pulping. We impacted the samples with 5% strain pulses at 500 Hz. The radial direction stiffness drop in the samples was quantified by 500 kHz ultrasonic through-transmission postimpacting. The depth profile of the generated fatigue was also determined. A dependency of the amount of fatigue generated during cyclic straining on the moisture content was detected. A hypothesis about the temporal and spatial evolution of the fatigue during the process is presented. The results supporting the hypothesis provide insight into wood behavior under mechanical pulping conditions.

Ari Salmi; Lauri Salminen; Edward Hggstrm

2009-01-01T23:59:59.000Z

414

Climate change perception in the energy sector : A comparative study of Norway and Germany.  

E-Print Network [OSTI]

??The thesis investigates perceptions of climate change (CC) among stakeholders within Norwegian and German energy sector, and the implications of climate perception for personal behaviour. (more)

Lindberg, Marie Byskov

2008-01-01T23:59:59.000Z

415

Making Maps Matter: : GIS and the Cognitive Challenges of Climate Change Adaptation in Fredrikstad, Norway.  

E-Print Network [OSTI]

??Denne oppgaven utforsker de kognitive utfordringene assosiert med klimatilpasning, og potensialet for geografiske informasjonssystemer (GIS) til inkorporere disse slik at vellykket bevisstgjring og beslutningstakning (more)

Skivenes, Ida

2009-01-01T23:59:59.000Z

416

Environmental Microbiology team capability relevant to Arctic climate change studies - Dogliani Norway visit  

SciTech Connect (OSTI)

The goal is for ecosystem measurements combined with modeled changes in landscape dynamics, to estimate impacts of warming, subsequent ecosystem responses and feedbacks on atmospheric carbon.

Kuske, Cheryl R. [Los Alamos National Laboratory

2012-08-31T23:59:59.000Z

417

Combined life cycle and economic assessment of wood based bio fuels in Norway.  

E-Print Network [OSTI]

?? The increasing global demand for energy coupled with decreasing oil-supplies, and increasing risk of adverse climate change due to anthropogenic carbon emissions has created (more)

Gryczon, Michal

2008-01-01T23:59:59.000Z

418

Norway and Emissions Trading: From Global Front-Runner to EU Follower  

Science Journals Connector (OSTI)

A striking convergence has taken place in the design of the Norwegian and EU greenhouse gas emissions trading systems from 1998 to 2004. This article ... the EU trading system and resulted in EU emissions trading

Ingvild Andreassen Sverud; Jrgen Wettestad

2006-03-01T23:59:59.000Z

419

Copyright 1998 Psychonomic Society, Inc. 76 Colonies of Norway rats (Rattus norvegicus) in large  

E-Print Network [OSTI]

so may allow rats to find food efficiently. Other fac- tors that could have favored path following these traits al- lowed rats to orient in the environment and to economi- cally gather food from spatially separated food patches. Empirical support for the hypothesis that rats can use paths to economically forage

Timberlake, William D.

420

Anim. Behav., 1996, 51, 765771 Use of foraging trails by Norway rats  

E-Print Network [OSTI]

was affected by the number of times it had been traversed by a rat on its way to and from food, but not by the amount of food a rat ate before depositing a trail. There was no evidence that trails contained information that would allow a rat to move directly towards food rather than directly away from it. Possible

Galef Jr., Bennett G.

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Anim. Behav., 1997, 54, 705714 Socially acquired information reduces Norway rats' latencies to find food  

E-Print Network [OSTI]

rats, Rattus norvegicus, look for food and what foods they eat. The present studies were undertaken to determine whether rats could also use information acquired from conspecifics to determine when food had forager. Furthermore, naive rats that had been trained to eat a food, but not naive rats trained to avoid

Galef Jr., Bennett G.

422

Occurrence of a Broad Range of Legacy and Emerging Flame Retardants in Indoor Environments in Norway  

Science Journals Connector (OSTI)

The objectives of this study were (1) to undertake a comprehensive monitoring of a wide range of BFRs, PFRs, and dechloranes in indoor air and dust in Norwegian households and schools, (2) to explore the sources of exposure to these FRs in the households, and (3) to assess the total intake of FRs from indoor environments for the mothers and their children living in the household. ... Nevertheless, the PFR concentrations were much lower than the levels detected in residential dwellings in Japan(28) (TCIPP 89.2, TNBP 27.1, and TCEP 15.5 ng/m3) (SI Figure S2). ...

Enrique Cequier; Alin C. Ionas; Adrian Covaci; Rosa Maria Marc; Georg Becher; Cathrine Thomsen

2014-05-20T23:59:59.000Z

423

Stephen N. Ehrenberg $ StatoilHydro, N-9481, Harstad, Norway; present address  

E-Print Network [OSTI]

; tas@statoilhydro.com Tore received his Candidatus Scientiarium de- gree in geology at the University of marine geology and geophysics in the Rosenstiel School of Marine and Atmospheric Sciences. His versions of this article. Uranium depletion across the Permian­Triassic boundary in Middle East carbonates

Miami, University of

424

Norway and the USA: The Norwegian Media's Coverage of September 11, 2001.  

E-Print Network [OSTI]

??The terrorist attack in the USA on September 11, 2001, is perhaps the most significant event in recent American history. This thesis is a study (more)

degrd, Per Refseth

2005-01-01T23:59:59.000Z

425

E-Print Network 3.0 - aamli southern norway Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ostseeforschung Warnemnde, Universitt Rostock Collection: Geosciences 2 Mass and Wind Atmospheric Angular Momentum variations at intraseasonal and diurnal periodicities...

426

Internal energy, the work of the wind, and the thermal stability in Lake Tyrifjord, southeastern Norway  

Science Journals Connector (OSTI)

Lake Tyrifjord consists of Holsfjord and Steinsfjord, two lakes of highly contrasting morphology, was used as the basis for a comparison of internal energy, the work of the wind, and thermal stability in two l...

Johannes Kjensmo

1994-06-01T23:59:59.000Z

427

Public attitudes towards renewable energy technologies in Norway. The role of party preferences  

Science Journals Connector (OSTI)

Abstract Transition to a sustainable society requires large-scale conversion of the energy system to new, renewable, non-fossil sources of energy. This presupposes public support for new technologies, which means the public must deal with challenges in terms of placement, area requirements, ecological degradation and price developments. This paper discusses how citizens view renewable energy technologies. It analyses responses to representative surveys of the Norwegian population on the desirability of various energy technologies such as hydroelectric dams, onshore and offshore wind energy, bioenergy plants and, for contrast, gas plants with and without carbon capture and storage. Our main focus is on the influence of party political preference on views of renewable energy. We find that the sometimes lukewarm enthusiasm for renewable energy technologies cannot be fully explained by existing theories and that political party preference has a larger impact on energy technology attitudes than previously believed.

Henrik Karlstrm; Marianne Ryghaug

2014-01-01T23:59:59.000Z

428

E-Print Network 3.0 - ab initio g-tensor Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

i Oslo Collection: Physics ; Chemistry 8 imageslogoetsf Introduction Electron Energy Loss Spectroscopy Applications: Nanotubes and Graphene Perspectives Summary:...

429

Polar Year Book  

Science Journals Connector (OSTI)

... in Spitsbergen in relation to the export of coal. The book is published by Gyldendal Norsk Forlag at Oslo. ...

1936-01-25T23:59:59.000Z

430

Reports and other Publications  

Science Journals Connector (OSTI)

... Pp. 1993-2002. (Tokyo: Tokyo Astronomical Observatory, 1961 and 1962.) [249Norsk Polarinstitutt, Oslo. Skrifter Nr. 125: Studies in the Tertiary Flora of Spitsbergen, ... Iceland-a Palynological Investigation. By Svein Manum. Pp. 128+21 plates. (Oslo: Norsk Polarinstitutt, 1962. Distributed bv Oslo University Press.) 26 Kr. [249

1962-11-17T23:59:59.000Z

431

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

432

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

433

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

434

Residential Prosumers: Drivers and Policy Options (Re-Prosumers)  

E-Print Network [OSTI]

Halden, Norway: Norwegian Centre of Expertise Smart Energyenergy market (IMPROSUME Publication Series #2). Narvik, NorwayNorway: Narvik University College and Norwegian Center of Expertise for Smart Energy

Couture, Toby

2014-01-01T23:59:59.000Z

435

Novus Energy Partners | Open Energy Information  

Open Energy Info (EERE)

Novus Energy Partners Novus Energy Partners Place Alexandria, Virginia Zip 22314 Product Virginia and Norway-based investment fund focused on emerging companies in the new energy industry. Coordinates 31.19224°, 29.88987° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.19224,"lon":29.88987,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

436

Metallkraft AS | Open Energy Information  

Open Energy Info (EERE)

Metallkraft AS Metallkraft AS Jump to: navigation, search Name Metallkraft AS Place Kristiansand, Norway Zip 4617 Sector Solar Product Norwegian company providing SiC and glycol recovery for reuse in wafer manufacturing and recovering solar-grade silicon. Coordinates 58.143805°, 7.994845° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":58.143805,"lon":7.994845,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

437

Hydra Tidal Energy Technology AS | Open Energy Information  

Open Energy Info (EERE)

Tidal Energy Technology AS Tidal Energy Technology AS Jump to: navigation, search Name Hydra Tidal Energy Technology AS Address PO Box 399 Place Harstad Zip 9484 Sector Marine and Hydrokinetic Year founded 2001 Phone number (+47) 77 06 08 08 Website http://http://www.hydratidal.i Region Norway LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: MORILD Demonstration Plant Morild 2 This company is involved in the following MHK Technologies: MORILD 2 Floating Tidal Power System Morild Power Plant This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Hydra_Tidal_Energy_Technology_AS&oldid=678333

438

Tidal Sails AS | Open Energy Information  

Open Energy Info (EERE)

Sails AS Sails AS Jump to: navigation, search Name Tidal Sails AS Address Standgaten 130 Place Haugesund Zip 5531 Sector Marine and Hydrokinetic Phone number +32 474 98 06 16 Website http://www.tidalsails.com Region Norway LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Technologies: Tidal Sails This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Tidal_Sails_AS&oldid=678479" Categories: Clean Energy Organizations Companies Organizations Stubs MHK Companies What links here Related changes Special pages Printable version Permanent link Browse properties

439

Thermal barrier coatings application in diesel engines  

SciTech Connect (OSTI)

Commercial use of thermal barrier coatings in diesel engines began in the mid 70`s by Dr. Ingard Kvernes at the Central Institute for Industrial Research in Oslo, Norway. Dr. Kvernes attributed attack on diesel engine valves and piston crowns encountered in marine diesel engines in Norwegian ships as hot-corrosion attributed to a reduced quality of residual fuel. His solution was to coat these components to reduce metal temperature below the threshold of aggressive hot-corrosion and also to provide protection. The Department of Energy has supported thermal barrier coating development for diesel engine applications. In the Clean Diesel - 50 Percent Efficient (CD-50) engine for the year 2000, thermal barrier coatings will be used on piston crowns and possibly other components. The primary purpose of the thermal barrier coatings will be to reduce thermal fatigue as the engine peak cylinder pressure will nearly be doubled. As the coatings result in higher available energy in the exhaust gas, efficiency gains are achieved through use of this energy by turbochargers, turbocompounding or thermoelectric generators.

Fairbanks, J.W.

1995-03-01T23:59:59.000Z

440

Natural Gas Discovery and Development Impacts on Rio Vista and Its Community  

E-Print Network [OSTI]

Energy Resource Communities, Institute of Industrial Economics, Bergen, Norway,Norway in August 1981 sponsored an international conference on energy

Gbedema, Tometi Koku

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Worldwide Status of Energy Standards for Buildings - Appendices  

E-Print Network [OSTI]

about energy efficiency for buildings in: Norway 1. TheC - 83 NORWAY 16. Entities involved in IMPLEMENTING energy

Janda, K.B.

2008-01-01T23:59:59.000Z

442

Asianettverkets nyhetsbrev -Uke 44, 2011 Weekly Newsletter from the Network for Asian Studies -Week 44, 2011  

E-Print Network [OSTI]

Norway-Japan Seminar med tittelen "Renewables and Energy Security in Japan, East Asia and Norway". Tid og

Løw, Erik

443

Thermostat Interface and Usability: A Survey  

E-Print Network [OSTI]

household energy use behaviour in Japan and Norway. Energycultural study of energy behavior in Norway and Japan (

Meier, Alan

2011-01-01T23:59:59.000Z

444

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

445

Boron isotopes in tourmaline as a tracer of metasomatic processes in the Bamble sector of Southern Norway  

Science Journals Connector (OSTI)

For the B isotope determinations in tourmaline by secondary ion mass spectrometry...2009a) was used. The O? primary ion beam was accelerated to 14.5keV at a beam current of 1 nA. The diameter of the spot used fo...

R. Bast; E. E. Scherer; K. Mezger

2014-10-01T23:59:59.000Z

446

Health consequences of Chernobyl disaster in Europe in general and in Norway in particular. Literature review and ecological study.  

E-Print Network [OSTI]

??Health costs of Chernobyl disaster are still not clear.Main goal of this paper therefore is to investigate health consequences of Chernobyl disaster in Europe (outside (more)

Fedorov, Roman

2012-01-01T23:59:59.000Z

447

Published at the fourth meeting of the European Concerted Action on Process Tomography (ECAPT). Bergen, Norway, April 1995.  

E-Print Network [OSTI]

to emphasize the controller properties. KEYWORDS: Closed­loop Control, Image Processing, Minimization, Combustion. 1 INTRODUCTION Combustion is a turbulent reactive fluid dynamic process. The interaction of chemical reactions, heat transfer and fluid dynamics makes it impossible to model these multiphase flows

448

Differential utilization of primary health care services among older immigrants and Norwegians: a register-based comparative study in Norway  

Science Journals Connector (OSTI)

Aging in an unfamiliar landscape can pose health challenges for the growing numbers of immigrants and their health care providers. Therefore, better understanding of how different immigrant groups use Primary ...

Esperanza Diaz; Bernadette N Kumar

2014-11-01T23:59:59.000Z

449

Observations of pP in the Short-Period Phases of NTS Explosions Recorded at Norway  

Science Journals Connector (OSTI)

......Massachusetts P waves from 11 Nevada Test Site explosions, recorded digitally...3)* Summary P waves from 11 Nevada Test Site explosions, recorded digitally...results of applying this method to Nevada Test Site (NTS) explosions recorded digitally......

C. W. Frasier

1972-12-01T23:59:59.000Z

450

ATP content and adenylate energy charge of the mussel Mytilus edulis during the annual reproductive cycle in Lindspollene, Western Norway  

Science Journals Connector (OSTI)

Adenine nucleotide levels and the adenylate energy charge (EC) ratio of Mytilus edulis L. were determined at monthly intervals over a one-year cycle. The ATP concentration ranged from 2.7 to 4.7 mg g-1 dry weig...

H. R. Skjoldal; S. Barkati

451

Spruce Forests (Norway and Sitka Spruce, Including Douglas Fir): Carbon and Water Fluxes and Balances, Ecological and Ecophysiological Determinants  

Science Journals Connector (OSTI)

Natural forests with a high percentage of spruce will be found in Europe only in subalpine and alpine regions or in the boreal forests of Scandinavia and Russia. Nevertheless, spruce belongs to the most import...

C. Bernhofer; M. Aubinet; R. Clement

2003-01-01T23:59:59.000Z

452

ANALYSIS AND CONTROL OF DISTILLATION COLUMNS Sigurd Skogestad, Chem. Eng., Norwegian Inst. of Tech. (NTH), N7034 Trondheim, Norway  

E-Print Network [OSTI]

­frequencies. The other extreme is to match the high­frequency gains (Rademaker et al., 1975, p. 137). (7) provides a link

Skogestad, Sigurd

453

ANALYSIS AND CONTROL OF DISTILLATION COLUMNS Sigurd Skogestad, Chem. Eng., Norwegian Inst. of Tech. (NTH), N-7034 Trondheim, Norway  

E-Print Network [OSTI]

extreme is to match the high-frequency gains (Rademaker et al., 1975, p. 137). (7) provides a link between

Skogestad, Sigurd

454

Masting and trophic cascades: interplay between rowan trees, apple fruit moth, and their parasitoid in southern Norway  

E-Print Network [OSTI]

Masting and trophic cascades: interplay between rowan trees, apple fruit moth, and their parasitoid. 2004. Masting and trophic cascades: interplay between rowan trees, apple fruit moth of the dominant seed predator and its parasitoid. The apple fruit moth, Argyresthia conjugella Zeller, is a pre

455

Anim. Behav., 1991,41,295-301 Information centres of Norway rats: sites for information exchange and  

E-Print Network [OSTI]

interacting, both members of a pair of rats, each of which had just eaten a different, novel food exhibited to impart about available foods) and 'observer' rats (i.e. naive animals that were given the opportunity, observer rats exhibit enhanced preferences for the foods eaten by their respective demonstrators (Galef

Galef Jr., Bennett G.

456

BULLETIN OF THE UNITED STATES FISH COMBIISSICln'. 75 of salmon. Experiments made in Norway and elsewhere ]lare shown  

E-Print Network [OSTI]

hunclred yards from shore, and in a few hours aere as sure of catching a few hundred pounds #12;76 BULLETIN

457

How do firms promote stability in an evolving technological system? : The case of second generation biofuels in Norway.  

E-Print Network [OSTI]

??This thesis aims to increase the understanding of the formative phase of an evolving technological innovation system (TIS) related to second generation (2G) biofuels in (more)

Blomberg, Line Elisabeth

2008-01-01T23:59:59.000Z

458

E-Print Network 3.0 - atlas construction site Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

institutt, Universitetet i Oslo Collection: Biology and Medicine 14 WIND ATLAS FOR EGYPT: MEASUREMENTS, MICRO-AND MESOSCALE MODELLING Summary: WIND ATLAS FOR EGYPT:...

459

E-Print Network 3.0 - atlantoaxial rotatory fixation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Physics ; Chemistry 12 GUIDe SACCADE DETECTION AND SMOOTHING ALGORITHM Stanford University, HCI Group Summary: fixation. Before returning a...

460

E-Print Network 3.0 - atlanto-axial rotatory fixation Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Physics ; Chemistry 7 GUIDe SACCADE DETECTION AND SMOOTHING ALGORITHM Stanford University, HCI Group Summary: fixation. Before returning a...

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

ADVANCED ELECTRON BEAM TECHNIQUES FOR METALLIC AND CERAMIC PROTECTIVE COATING SYSTEMS  

E-Print Network [OSTI]

cobalt and chromium. Ceramic or thermal barrier coatings canin fuel usage. Also, ceramic or thermal barrier coatings~n Oslo developed ceramic or thermal barrier coatings that

Boone, Donald H.

2013-01-01T23:59:59.000Z

462

How do toxins penetrate cells?  

Science Journals Connector (OSTI)

... may facilitate direct transfer, for example by exposure of hydrophobic segments. S. Olsnes (Norsk-Hydro's Institute for Cancer Research, Oslo) and R. C. Hughes (National ... similar.

R. C. Hughes

1979-10-18T23:59:59.000Z

463

The Norwegian Polar Institute  

Science Journals Connector (OSTI)

... ON March 1, the Norwegian Polar Institute (Norsk Polarinstitutt) was established in Oslo in order to continue and expand the activity of ...

1948-06-19T23:59:59.000Z

464

E-Print Network 3.0 - av pasienter med Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oslo Collection: Computer Technologies and Information Sciences 15 The Foundation for The Gator Nation An Equal Opportunity Institution Summary: insurers, AvMed, had data stolen...

465

E-Print Network 3.0 - adaptive petrov-galerkin formulation Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- Matematisk institutt, Universitetet i Oslo Collection: Mathematics 66 COHERENT VORTEX SIMULATION (CVS) OF A FLOW PAST A NACA AIRFOIL 23012 AT RE 1000 Summary: . In...

466

E-Print Network 3.0 - age ten-year retrospective Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oslo Collection: Computer Technologies and Information Sciences 25 Endangered Species Act Section 7(a)(2) Consultation Biological Opinion and Magnuson-Stevens Fishery Summary: for...

467

Med nedsltt blikk : vanskeligstiltes opplevelse av byens offentlige rom.  

E-Print Network [OSTI]

??Denne oppgaven handler om byens offentlige rom, nrmere bestemt hvordan tiggere i Oslo sentrum opplever Karl Johans gate. Teorier om konstruksjon og produksjon av rom (more)

Kvifte, Harald Magnus

2007-01-01T23:59:59.000Z

468

Solar Heating in Norwegian Passive Houses : A Case Study of two Passive Houses Heated by Solar Collector and Heat Pump.  

E-Print Network [OSTI]

??To like, nybygde passivhus i Oslo ble underskt for se hvor energieffektive de var. Det ene ble varmet opp med solenergi, det andre med (more)

Murtnes, Espen

2013-01-01T23:59:59.000Z

469

E-Print Network 3.0 - aa redusere sannsynligheten Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Mathematics 40 Passivhus Norden 2008 1st Nordic passive house conference Summary: elevforsk br derfor ikke reduseres i forhold til...

470

E-Print Network 3.0 - amphibolites Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universitetet i Oslo Collection: Geosciences 38 Phase-equilibrium constraints on titanite and rutile activities in mafic epidote amphibolites and geobarometry using...

471

Wind Energy Resource Atlas of Armenia (CD-ROM)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Resource Atlas of Armenia (CD-ROM) http:www.nrel.govdocsfy03osti33877CD.zip (ZIP 31.9 MB) NRELCD-500-33877 July 2003 Instructions: The URL above links to a zipped archive...

472

Thermal barrier coatings application in diesel engines  

SciTech Connect (OSTI)

Commercial use of thermal barrier coatings in diesel engines began in the mid 70`s by Dr. Ingard Kvernes at the Central Institute for Industrial Research in Oslo, Norway. Dr. Kvernes attributed attack on diesel engine valves and piston crowns encountered in marine diesel engines in Norwegian ships as hot-corrosion attributed to a reduced quality of residual fuel. His solution was to coat these components to reduce metal temperature below the threshold of aggressive hot-corrosion and also provide protection. Roy Kamo introduced thermal barrier coatings in his `Adiabatic Diesel Engine` in the late 70`s. Kamo`s concept was to eliminate the engine block water cooling system and reduce heat losses. Roy reported significant performance improvements in his thermally insulated engine at the SAE Congress in 1982. Kamo`s work stimulates major programs with insulated engines, particularly in Europe. Most of the major diesel engine manufacturers conducted some level of test with insulated combustion chamber components. They initially ran into increased fuel consumption. The German engine consortium had Prof. Woschni of the Technical Institute in Munich. Woschni conducted testing with pistons with air gaps to provide the insulation effects. Woschni indicated the hot walls of the insulated engine created a major increase in heat transfer he refers to as `convection vive.` Woschni`s work was a major factor in the abrupt curtailment of insulated diesel engine work in continental Europe. Ricardo in the UK suggested that combustion should be reoptimized for the hot-wall effects of the insulated combustion chamber and showed under a narrow range of conditions fuel economy could be improved. The Department of Energy has supported thermal barrier coating development for diesel engine applications. In the Clean Diesel - 50 Percent Efficient (CD-50) engine for the year 2000, thermal barrier coatings will be used on piston crowns and possibly other components.

Fairbanks, J.W.

1995-10-01T23:59:59.000Z

473

The influence of different electricity-to-emissions conversion factors on the choice of insulation materials  

Science Journals Connector (OSTI)

Abstract The current practice of building energy upgrade typically uses thick layers of insulation in order to comply with the energy codes. Similarly, the Norwegian national energy codes for residential buildings are moving towards very low U-values for the building envelope. New and more advanced materials, such as vacuum insulation panels (VIPs) and aerogel, have been presented as alternative solutions to commonly used insulation materials. Both aerogel and \\{VIPs\\} offer very high thermal resistance, which is a favourable characteristic in energy upgrading as the same insulation level can be achieved with thinner insulation layers. This paper presents the results of energy use and lifecycle emissions calculations for three different insulation materials (mineral wool, aerogel, and vacuum insulation panels) used to achieve three different insulation levels (0.18W/m2K, 0.15W/m2K, and 0.10W/m2K) in the energy retrofitting of an apartment building with heat pump in Oslo, Norway. As advanced insulation materials (such as VIP and aerogel) have reported higher embodied emissions per unit of mass than those of mineral wool, a comparison of performances had to be based on equivalent wall U-values rather than same insulation thicknesses. Three different electricity-to-emissions conversion factors (European average value, a model developed at the Research Centre on Zero Emission Buildings ZEB, and the Norwegian inland production of electricity) are used to evaluate the influence of the lifecycle embodied emissions of each insulation alternative. If the goal is greenhouse gas abatement, the appraisal of buildings based solely on their energy use does not provide a comprehensive picture of the performance of different retrofitting solutions. Results show that the use of the conversion factor for Norwegian inland production of electricity has a strong influence on the choice of which of the three insulation alternatives gives the lowest lifecycle emissions.

Nicola Lolli; Anne Grete Hestnes

2014-01-01T23:59:59.000Z

474

Gas exploration and oceanography beyond the shelf break  

E-Print Network [OSTI]

for Computational Science, University of Bergen, Norway 3 Norsk Hydro, Oil & Energy, Research Center, Bergen, Norway , G. Furnes3 1 Department of Mathematics, University of Bergen, Norway 2 UNIFOB, Bergen Center Introduction The second largest gas field in Norway, Ormen Lange, is located approximately 120 km off mid-Norway

Thiem, ?yvind

475

Ris-R-1243(EN) Radiological Assessment of Past,  

E-Print Network [OSTI]

Protection Authority, Norway 4) G. Christensen, Institute of Energy Technology, Norway 5) B. Salbu Radiation Protection Authority (NRPA), Agricultural University of Norway (AUN) and Institute of Energy, Agricultural University of Norway, Norway Risø National Laboratory, Roskilde December 2000 #12;Abstract

476

DNA Single-Strand Breaks and Sister Chromatid Exchanges Induced by Treatment with Hematoporphyrin and Light or by X-Rays in Human NHIK 3025 Cells  

Science Journals Connector (OSTI)

...Biophysics [J. M., T. C.] and Genetics [H. W.], Norsk Hydro's Institute for Cancer Research, Montebello, Oslo...of Biophysics (J. M., T. C.Jand Genetics (H. W.j, Norsk Hydro s Institute for Cancer Research, Montebello, Oslo 3...

Johan Moan; Helga Waksvik; Terje Christensen

1980-08-01T23:59:59.000Z

477

Oncogenic Transformation and Cell Lysis in C3H/10T Cells and Increased Sister Chromatid Exchange in Human Lymphocytes by Nickel Subsulfide  

Science Journals Connector (OSTI)

...Rikshosptalet, The National Hospital, Oslo 1 [H. J. K. S.], and Norsk Hydro's Institute for Cancer Research, The Norwegian Radium...Rikshosptalet, The National Hospital, Oslo 1 [H. J. K. S. ,and Norsk Hydro's Institute for Cancer Research, The Norwegian Radium...

Harald J. K. Saxholm; Albrecht Reith; Anton Brgger

1981-10-01T23:59:59.000Z

478

Reports and other Publications  

Science Journals Connector (OSTI)

... Stationery Office, 1962.) 47.25 NF.; 69s.; 13.50 dollars. [15Norsk Polarinstitutt. Skrifter Nr. 123: On the Snow Accumulation in Dronning Maud Land. By ... 60. Scientific Results, No. 1). Pp. iii4-48+4 plates. (Oslo: Norsk Polarinsfcitutt, 1961. Distributed by Oslo University Press, 1961.) 9kr. [15

1962-07-07T23:59:59.000Z

479

Reports and other Publications  

Science Journals Connector (OSTI)

... Royal Society of New Zealand, c/o Victoria University of Wellington, 1961.) [23Norsk Polarinstitutt. Skrifter Nr. 122 : The Geology of Certain Parts of Eastern Spitsbergen. ... Spitsbergen. By Michael Frank and William Holland. Pp. 43+1 plate. (Oslo : Norsk Polarinstitutt, 1961. Distributed by Oslo University Press, 1961.) [23

1962-05-26T23:59:59.000Z

480

Reports and other Publications  

Science Journals Connector (OSTI)

... 13. (Geneva : Universita di Geneva, Istituto Geofisico e Geodetico, 1960.) [202Norsk Polarinstituut. Meddelelser. Nr. 83 : Reinen pa Svalbard. Av Odd L0n0. Pp. ... Anders Rapp. Pp. vii+96+20 plates. Kr. 25.00. (Oslo : Norsk Polarinstituut, 1960. Distributed by the Oslo University Press.) [202

1961-05-13T23:59:59.000Z

Note: This page contains sample records for the topic "oslo norway zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Strategies for Local Low-Carbon Development  

E-Print Network [OSTI]

22-23 May 2000. Norway: Institute for Energy Technology.energy auditing ? Lack of funding Dairy companies in NorwayCompanies in Norway. Source: Finden, 2000. Policy 1.3 Energy

Zhou, Nan

2014-01-01T23:59:59.000Z

482

Building Energy-Efficiency Best Practice Policies and Policy Packages  

E-Print Network [OSTI]

In Norway and Belgium (Flanders), energy performanceand Norway. Most labels also indicate the specific energyNorway, Switzerland, and countries in Southeast Europe that are part of the Energy

Levine, Mark

2014-01-01T23:59:59.000Z

483

Alcohol Consumption and the Risk for Prostate Cancer in the European Prospective Investigation into Cancer and Nutrition  

Science Journals Connector (OSTI)

...Bilthoven, Utrecht), Norway, Spain (Asturias...of France, Naples, Norway, and Utrecht included...the ratio of reported energy intake to energy requirement...under investigation. Energy intake was estimated...Italy, the Netherlands, Norway, Spain, Sweden, and...

Sabine Rohrmann; Jakob Linseisen; Timothy J. Key; Majken K. Jensen; Kim Overvad; Nina Fns Johnsen; Anne Tjnneland; Rudolf Kaaks; Manuela M. Bergmann; Cornelia Weikert; Androniki Naska; Antonia Trichopoulou; Dimitrios Trichopoulos; Valeria Pala; Carlotta Sacerdote; Domenico Palli; Rosario Tumino; H. Bas Bueno-de-Mesquita; Alina Vrieling; Carlos A. Gonzlez; Nerea Larraaga; Carmen Navarro; Aurelio Barricarte; J. Ramon Quiros; Carmen Martnez-Garca; Gran Hallmans; Pr Stattin; Jonas Manjer; Elisabet Wirflt; Sheila Bingham; Key-Tee Khaw; Lars Egevad; Pietro Ferrari; Mazda Jenab; and Elio Riboli

2008-05-01T23:59:59.000Z

484

Mercantilist Development in Russia: The Legitimacy of State Power, State Identity, and the Energy Charter Regime (1990 - 2010)  

E-Print Network [OSTI]

of the national energy policy, Norway argued that: In theECH policy of Norway (also an energy exporter to Europe),added) Thus, Norway was arguing that energy policy was a

Barkanov, Boris

2011-01-01T23:59:59.000Z

485

AN EXPONENTIAL TIME-DIFFERENCING METHOD FOR MONOTONIC RELAXATION SYSTEMS  

E-Print Network [OSTI]

S), NO-4036 Stavanger, Norway. CSINTEF Energy Research, P.O. Box 4761 Sluppen, NO-7465 Trondheim, Norway and Technology (NTNU), NO-7491 Trond- heim, Norway. BDept. of Petroleum Engineering, University of Stavanger (Ui

486

17?-estradiol in relation to birthweight and adult waist circumference  

Science Journals Connector (OSTI)

...Infection control, University Hospital North Norway, Tromso, Norway, Haukeland University Hospital, Bergen, Norway, Department of Anthropology, Harvard...that birthweight, in combination with energy status later in life, may influence premenopausal...

Sissi espetvedt; Aina emaus; Nancy Potischman; Emily Barrett; Anne-Sofie Furberg; Lars Akslen; Peter Ellison; Grazyna Jasienska; and Inger Thune

2008-05-01T23:59:59.000Z

487

Essays on International Finance and Trade  

E-Print Network [OSTI]

LHS) Domestic real oil price Mexico Figure-2. Domestic Realcountries, Norway and Mexico, the oil-price exchange rateboth pure oil- exporting countries, Norway and Mexico, are

Zeng, Li

2009-01-01T23:59:59.000Z

488

Eltek Valere | Open Energy Information  

Open Energy Info (EERE)

Valere Jump to: navigation, search Name: Eltek Valere Place: Norway Sector: Renewable Energy Product: A Norway-based member of the Eltek Group, this company manufactures power...

489

China's Energy and Carbon Emissions Outlook to 2050  

E-Print Network [OSTI]

Canada Energy per capita (kgoe/person) USA Singapore NorwayCanada Energy per capita (kgoe/person) USA Singapore Norway

Zhou, Nan

2011-01-01T23:59:59.000Z

490

Work and Life in the Balance: Ways of Working and Living Among Elite French, Norwegian, and American Professionals  

E-Print Network [OSTI]

energy company, a company with offices in many countries outside Norway,energy company, describes the constraining effects of the barnehager's limited opening hours: In Norway

Schulz, Jeremy Markham

2010-01-01T23:59:59.000Z

491

Industry  

E-Print Network [OSTI]

land, Canada, Norway and Nigeria that monetized non-energyNetherlands, Norway and the USA. As part of its energy and

Bernstein, Lenny

2008-01-01T23:59:59.000Z

492

Key Elements of and Materials Performance Targets for Highly Insulating Window Frames  

E-Print Network [OSTI]

Norway Abstract The thermal performance of windows is important for energyNorway Norwegian University of Science and Technology Howdy Goudey Lawrence Berkeley National Laboratory Environmental Energy

Gustavsen, Arild

2012-01-01T23:59:59.000Z

493

Impact on Wind Turbine Systems from Transient Fluctuations in Offshore Utility Grids.  

E-Print Network [OSTI]

?? Gas turbines in offshore power systems contribute to about 23% of Norways total emissions of CO2. One method for reducing these emissions could be (more)

Einervoll, Torger

2009-01-01T23:59:59.000Z

494

E-Print Network 3.0 - als3p protects mice Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to mice and rats. In Utah, house mice (Mus musculus) and Norway rats (Rattus... of house mice and Norway rats. House mice are ... Source: Berryman Institute, Department of...

495

E-Print Network 3.0 - acyltransferase-2 protects mice Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Utah, house mice (Mus musculus) and Norway rats (Rattus... of house mice and Norway rats. House mice are ... Source: Berryman Institute, Department of Fisheries and Wildlife, Utah...

496

E-Print Network 3.0 - alface lactuca sativa Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

63 Molecular Ecology (2001) 10, 947964 2001 Blackwell Science Ltd Summary: , 1994 3 (potato) Norway Slagen, Tonsberg, 1994 2 Norway S. minor Lactuca sativa Palumbo farm, 1998...

497

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

498

Existing Commercial Reference Buildings Constructed Before 1980 - Archive  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed Before 1980 - Existing Commercial Reference Buildings Constructed Before 1980 - Archive Existing Commercial Reference Buildings Constructed Before 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed before 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB) Full service restaurant

499

Existing Commercial Reference Buildings Constructed In or After 1980 -  

Broader source: Energy.gov (indexed) [DOE]

Existing Commercial Reference Buildings Constructed In or After Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Existing Commercial Reference Buildings Constructed In or After 1980 - Archive Here you will find past versions of the commercial reference building models for existing buildings constructed in or after 1980, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. Archived Reference Buildings Building Type Version 1.2_4.0 updated 3/12/10 Large office (ZIP 2.3 MB) Medium office (ZIP 2.2 MB) Small office (ZIP 1.4 MB) Warehouse (ZIP 980 KB) Stand-alone retail (ZIP 2 MB) Strip mall (ZIP 2.3 MB) Primary school (ZIP 2.7 MB) Secondary school (ZIP 3.9 MB) Supermarket (ZIP 2.2 MB) Quick service restaurant (ZIP 1.1 MB)

500

Yngve Kristoffersen, University of Bergen, Allegaten 41, Bergen, 5007 Norway, yngve.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany  

E-Print Network [OSTI]

.kristoffersen@geo.uib.no Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Lomonosov Canada Basin Coen Hofstede, AWI, Bremerhaven, Germany Olaf Eisen, AWI, Bremerhaven, Germany Richard Blenkner, Dept

Kristoffersen, Yngve